CN105461811A - Renaturation and crystallization method for O-type foot-and-mouth disease virus polypeptide and SLA-2 heavy chain as well as light chain beta2m - Google Patents
Renaturation and crystallization method for O-type foot-and-mouth disease virus polypeptide and SLA-2 heavy chain as well as light chain beta2m Download PDFInfo
- Publication number
- CN105461811A CN105461811A CN201510961939.9A CN201510961939A CN105461811A CN 105461811 A CN105461811 A CN 105461811A CN 201510961939 A CN201510961939 A CN 201510961939A CN 105461811 A CN105461811 A CN 105461811A
- Authority
- CN
- China
- Prior art keywords
- sla
- renaturation
- crystal
- concentrated
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32111—Aphthovirus, e.g. footandmouth disease virus
- C12N2770/32122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of biology, and in particular relates to a renaturation and crystallization method for O-type foot-and-mouth disease virus polypeptide and an SLA-2 heavy chain as well as a light chain beta2m. The method comprises the following steps: by taking a Hebao pig as an example, constructing an SLA-2 extracellular area prokaryotic expression vector, transferring into host bacteria to obtain expression protein and an inclusion body thereof, enabling SLA-2, Hu62 polypeptide and sbeta2m to be correctly combined and folded in vitro by a dilution renaturation method, and then separating and purifying renaturation protein by using a molecular sieve. A prokaryotic expression system is adopted to highly express the heavy chain extracellular area and the light chain of SLA I molecules of the Hebao pig, and the advantages such as quickness and direct perception are achieved; a result of SLA-2-HB-Hu62-sbeta2m obtains high-quality single crystals, and the crystal resolution is shown in the description; the SLA-2-HB-Hu62-sbeta2m is of an asymmetric dimolecular structure, showing that the SLA-2-HB-Hu62-sbeta2m may have two conformations.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of method of O type foot-and-mouth disease virus polypeptide and Hebao pig SLA-2 heavy chain, light chain β 2m renaturation, crystallization.
Background technology
Major histocompatibility complex (majorhistocompatibilitycomplex, MHC), being called for short MHC, is the genoid group relevant to immunne response that vertebrates has.MHC is divided into I, II and III class.Wherein, MHCI quasi-molecule is relevant with cellullar immunologic response, and this is determined by the space structure that MHCI quasi-molecule is special.From last century the eighties, people start the research to MHCI quasi-molecule crystalline structure gradually.
The MHC of people, also known as the human leucocyte antigen (humanleukocyteantigen, HLA) for people.1987, Bjorkman etc. (Nature, 1987,6139:506-512) resolved the three-dimensional crystalline structure of the HLA-A2 of people first, and MHCI is made up of heavy chain α and light chain β2-microglobulin.Heavy chain α comprises extracellular region, cross-film district and intracellular region, and wherein extracellular part is made up of 3 structural domains: α 1, α 2 and α 3, and each structural domain comprises nearly 90 amino acid; The structural domain in cross-film district is made up of, with the hydrophilic amino acid of a length of tape electricity about 25 hydrophobic amino acids; The part of grappling in born of the same parents is made up of 30 amino-acid residues.Wherein, α 1 has similar tertiary structure to α 2, and α 3 and β 2m have similar folding.β 2m is combined by non covalent bond with α chain, without cross-film district with 99 amino acid whose folding.α in MHCI quasi-molecule 3 and β 2m are near cytolemma, and α 3 is embedded in cytolemma by part in its hydrophobic transmembrane part and hydrophilic born of the same parents.α 1 and α 2 form the top of whole molecule, and helicoidal structure territory is pointed to outside born of the same parents, for being identified by TCR.
The MHC of pig is also known as swine leukocyte antigen (swineleukocyteantigen, SLA), and its genome area only has 1.1Mb, current known minimum Mammals mhc gene linkage group (Renard, etal., Genomic, 2006,88:96-100).SLA is positioned on No. 7 karyomit(e)s of pig, is divided into classI, classII and classIII tri-class regional gene.II class regional gene be positioned at long-armed on, I and III class regional gene is positioned on galianconism, respectively near telomere and kinetochore.
SLA-2 gene is the important locus of pig SLA-class Ⅰmolecule, forms 3 typical functional gene groups of class Ⅰmolecule together with SLA-1, SLA-3.
Wait (JVirol, 2011,22:11709-11724) of opening thought have resolved pig SLA-1*0401 crystalline structure recently.In this research, SLA-1*0401 and influenza polypeptide S-OIV-NA449-457 (NSDTVGWSW) and Ebola virus polypeptide Ebolavirus-vp35155-163 (ATAAATEAY) successfully obtains crystal.
But up to the present, the crystalline structure of pig SLA-2 have not been reported.Especially shortage foot-and-mouth disease virus polypeptide and SLAI quasi-molecule form the research of crystal.Seminar studies for a long period of time pig SLAI quasi-molecule, and is absorbed in design and the screening of foot and mouth disease virus epi-position.On the basis of early-stage Study, the Hebao pig SLA-2 heavy chain built with laboratory and β 2m light chain are for albumen, the O type foot-and-mouth disease virus polypeptide epi-position gone out with an optimal screening carries out renaturation in vitro, and obtain crystal, resolve SLA-2 crystalline structure, for from now on more Exact Design pig source viral polypeptide epi-position scientific basis is provided.
Summary of the invention
The object of the invention is: the complex body space structure that research pig SLA-2 and β 2m and polypeptide are formed, resolve SLA-2 space structure, for the antigen presentation function studying SLA-2 from now in great detail provides foundation.
Technical scheme of the present invention is: for Hebao pig, builds SLA-2 born of the same parents' outside area prokaryotic expression carrier, proceeds to Host Strains and obtains expressing protein and inclusion body (SLA-2-HB) thereof.Utilize netMHCpan2.8 to design the foot and mouth disease virus epidemic isolates polypeptide mated with SLA-2-HB, carry out common combination according to mol ratio 3:1:1 by dilution refolding method with heavy chain SLA-2-HB, light chain s β 2m mature peptide, detected by molecular sieve.Be separated recombinant protein matter mixture and concentrate, adjustment complex concentration is respectively the concentration of 7.5mg/mL and 10mg/mL, carries out the growth of crystal in crystal growth liquid.Result shows, and SLA-2-HB expressing protein size is about 33kDa, deposits in case at s β 2m, can renaturation successful with O type foot and mouth disease polypeptide Hu62.When crystal concentration is 10mg/mL time, occur high-quality crystal with the screening of HamptonResearch test kit, resolving power is
crystal is through resolving post analysis display, and SLA-2-HB-Hu62-s β 2m presents bimolecular configuration, and analyze further to disclose and cause mainly there are differences at second and the 4th the folding of amino acids of this conformational difference, concrete steps are as follows.
1, design of primers and synthesis
According to Hebao pig SLA-2 full genome encoding sequence, design upstream primer and the downstream primer of its extracellular region of amplification respectively:
2, the synthesis of polypeptide
By prediction website NetMHC2.8Server with the complete sequence of O type foot and mouth disease (Foot-and-mouthdisease, FMDV) virus stain HQ116229-FMDV-O-HuBHK99, devise Hu62 foot-and-mouth disease virus polypeptide, sequence is: ALLRTATYY.
3, the structure of SLA-2-HB extracellular region expression vector
With pHB21F/pHB-21R1 as primer pair, with Hebao pig SLA-2-HB01/pMD18-T full genome recombinant plasmid for template, amplification Hebao pig SLA-2 extracellular part, PCR primer 5 ' end band has NdeI restriction enzyme site CA/TATG, and 3 ' end band has XhoI restriction enzyme site CT/CGAG.Set up following PCR reaction system, cumulative volume is 50 μ L:
PCR reaction conditions is
PCR primer reclaims through cutting glue, and after NdeI and XhoI double digestion, connect with pET-21a (+) empty carrier cutting back to close process through same enzyme, transform BL21 competent cell, picking positive colony is cultivated, extract plasmid and carry out double digestion evaluation and screening positive colony, and check order.
4, abduction delivering, inclusion body extract and SDS-PAGE electrophoresis detection expressing protein
The SLA-2 heavy chain positive colony bacterium of checking order correct and light chain s β 2m express bacterium the flat lining out of solid LB of Amp resistance, dull and stereotyped 37 DEG C of cultivations 12 hours, picking list bacterium colony cultivates 10h to the test tube that 3mLLB+3 μ LAmp (100mg/mL) substratum is housed, cultured bacterium liquid 50 μ L access is equipped with in the Erlenmeyer flask of 50mLLB liquid nutrient medium, the Amp of 50 μ L is added, Erlenmeyer flask 37 DEG C of constant temperature oscillation incubated overnight in substratum.With the LB liquid nutrient medium of large triangular flask preparation 2L, 121 DEG C of 20min sterilizings.The ratio of the bacterium of incubated overnight in 1:100 in large triangular flask is inoculated, and adds the Amp of 2mL (100mg/mL).In large shaking table, 37 DEG C of isothermal vibrations are cultivated and about within 2 hours, are surveyed OD value, until the IPTG (1mol/L) adding 2mL when OD is 0.5 induces, receive bacterium after 37 DEG C of cultivation 5h.Proceed in the Centrifuge Cup of 500mL by the bacterium of cultivation, 4 DEG C, 6000rpm, 15min receive bacterium, outwell supernatant and only stay bacterial sediment.After receipts bacterium (subsequent step is carried out all at low temperatures), suspend (60 μ lDTT, 1 ‰) with about 60ml 1 × PBS, ultrasonic degradation (super 6S, interval 12S, 99+99 time, about 250W).Centre sees if there is precipitation, has, and stirs, ultrasonic afterwards.16000rpm, 15min, pull out bacterial debris with glass rod by 4 DEG C, and washingbuffer (100mL+100 μ LDTT altogether, 1 ‰) washes 3 times.At every turn ultrasonic: 4S, 10S, 25 times, about 250W, ultrasound condition can from Row sum-equal matrix.Each ultrasonic rear 16000rpm, 15min, washingbuffer washing, removes bacterial debris as far as possible.Weigh.16000rpm, 15min, resuspensionbuffer (60mL+60 μ LDTT, 1 ‰) suspend.16000rpm, 15min, dissolve by 30mg/ml dissolutionbuffer (adding DTT by 1%), 4 DEG C of stirring and dissolving (spending the night).16000rpm, 15min, pour out supernatant or be distributed into 1ml/ pipe, save backup in-20 DEG C or-80 DEG C.
5, the external combination of heavy chain SLA-2-HB, light chain s β 2m and foot and mouth disease virus epitope polypeptide thereof
Hebao pig heavy chain SLA-2-HB, light chain β 2m are combined in vitro with foot and mouth disease virus Hu62 epitope peptide:
(1) dilution method recombinant protein matter
1. 500mLrefoldingbuffer (100mmol/LTris is prepared, pH8.0,400mmol/LL-ArgHCl, 2mmol/LEDTA, 5mmol/LGSH, 0.5mmol/LGSSH (adding after renaturation solution precooling) 0.5mmol/LPMSF), 4 DEG C are slowly stirred to it and dissolve mixing completely.
2. with 5mL or 10mL syringe by dissolve after inclusion body (about 3-5ml, can divide 3 times to add, every minor tick 8-10 hours) add in syringe, make it dripping in refoldingbuffer drop by drop (if be that urea dissolves, inclusion body should be able to freeze, available injectionbuffer adds in syringe after dissolving again), slowly stir 8-10 hour (can proper extension time).(carrying out under 4 DEG C of conditions).First add β 2m, then add polypeptide, finally add heavy chain (heavy chain divides three times and adds), heavy chain: light chain: polypeptide=1:1:3 (mol ratio).
3. after renaturation, available concentrated cup concentrating sample changes liquid (be suitable for the damping fluid of this albumen, be generally molecular sieve buffer), then forwards in evaporating pipe concentrated, if renaturation system is little directly can change liquid with evaporating pipe is concentrated.If (after renaturation, renaturation solution becomes muddy, can remove the rear reconcentration of precipitation by low-temperature centrifugation.) (carrying out under 4 DEG C of conditions)
(2) protein compression
6000rpm, 4 DEG C of centrifugal 15min in centrifuge tube recombinant protein plastome being transferred to 500mL, go precipitation.At Cool Room 4 DEG C, supernatant is transferred in the stirring-type ultra-filtration equipment (StirredCells) of 350mL, installs albumen mwco membrane (10kDa, MilliporeCentricon) in advance bottom concentrated cup, utilize N
2carrying out pressurization to concentrate, adding the good molecular sieve buffer (20mmol/LTrispH8.0,50mmol/LNaCl) of prior precooling suction filtration when being concentrated into 30mL to volume 150mL.Continue concentrated repetition above-mentioned steps.Finally be concentrated into 30mL, solution be transferred in 30mL centrifuge tube, 16000rpm, 4 DEG C of centrifugal 15min, supernatant is forwarded in ultrafiltration and concentration pipe (MilliporeCentricon) and be concentrated into 4mL further.The albumen concentrated is changed to 13300rpm in EP pipe, 4 DEG C of centrifugal 10min, replace tubes goes precipitation; Repeat above-mentioned steps more once, checked whether precipitation, continue to repeat once if having, if do not precipitate, place on ice and use in order to loading.
(3) molecular sieve and SDS-PAGE identify that polypeptide combines
Molecular sieve buffer washs the loading pump of AKTA, uses molecular sieve buffer balanced gel post Superdex200pgHiLoad16/600 prepacked column afterwards again.By sample 12000rpm, 10min, 4 DEG C of centrifugal bubbles that degas are in order to loading.Run with the flow velocity of 1mL/min, collect by the standard of OD280, mAU>20, quantitatively often 1.8mL collected by pipe.The sample collecting peak value place is prepared protein sample, and then whether SDS-PAGE qualification combines.
Protein race glue being shown as renaturation is collected rear concentrated, is further purified recombinant protein matter after anion column ResourceQ.First use A (10mmol/LTrispH8.0,10mmol/LNaCl), B (10mmol/LTrispH8.0,1mol/LNaCl) liquid alternately rinse ResourceQ, to remove on original pillar hang foreign protein, rear A liquid balance pillar.Recombinant protein matter concentrated, centrifugal going is precipitated, the same molecular sieve of step.After loading 10mL, wash the albumen be combined on anion column with B liquid, within 40 minutes, evenly draw gradient to 25%B liquid.Collect the protein of OD280 at more than 20mAU, SDS-PAGE is accredited as the protein of renaturation again, collects concentrated rear some crystal of preparing against and uses.
6, SLA-2-HB-Hu62-s β 2m complex proteins matter crystallization
1. the recombinant protein matter mixture obtained by purifying changes liquid through molecular sieve buffer, and is concentrated into 100 μ about L with the ultrafiltration and concentration pipe of 10kDa, measures protein concn, be diluted to the concentration of 7.5mg/mL and 10mg/mL respectively by BSA method.
2. utilize Index1-48, Index49-96, PEG/Ion I, PEG/Ion test kit such as II, CrystalScreen I, CrystalScreen, II, PEGRx I, PEGRx II grade, utilize sessile drop method to carry out the crystal screening of albumen composition respectively in 4 DEG C and 18 DEG C.
3. drip in plate at the seat in 48 holes, every hole adds 120 μ L crystal reagent (pond liquid), adds 1 μ L albumen and 1 μ L pond liquid, make it mix, with adhesive tape by 48 pore plate by sealing, put into crystal growth cabinet in crystal pores.After one week, observe with low-power microscope and whether have crystal to grow, and carry out mark.
If 4. have crystal growth, preservation of being taken pictures by crystal, delivers on roentgen machine and carries out diffraction qualification.If crystal is albumin crystal and diffracting effect is better, directly can collect the data of crystal, if the poor effect of diffraction, then need again to screen crystal growth condition or optimization.
5. the condition optimized is the precipitation agent by changing in primary dcreening operation condition, and buffer pH, the method for ionic concn or additive obtains.After obtaining the good albumin crystal of quality, repeat above-mentioned steps 4..
Beneficial effect of the present invention, present invention employs prokaryotic expression system, the heavy chain extracellular regions of the SLAI molecule of high expression level Hebao pig and light chain, make SLA-2, polypeptide and the external correct combination of s β 2m folding by dilution refolding method, recycling molecular sieving purification renaturation protein, has the advantages such as quick, directly perceived.Through the further optimization of polypeptide design, alternatively polypeptide and Hebao pig SLA-2-HB and s β 2m carry out renaturation and crystallization to select Hu62, found that the pH of its preference is that 6.5, SLA-2-HB-Hu62-s β 2m result obtains high-quality monocrystalline, crystal resolving power reaches
further analysis display, SLA-2-HB-Hu62-s β 2m presents asymmetrical bimolecular structure, and disclosing SLA-2-HB-Hu62-s β 2m may have two kinds of conformations.
Accompanying drawing explanation
Fig. 1 is Hebao pig SLA-2 extracellular region pcr amplification product, wherein M:DL2000Marker; 1:SLA-2-HB extracellular region;
Fig. 2 is Hebao pig SLA-2-HB-pET-21a (+) recombinant plasmid figure, wherein M:DL2000Marker; 1:SLA-2-HB-pET-21a (+) plasmid;
Fig. 3 is the double digestion qualification of Hebao pig SLA-2-HB-pET-21a (+) recombinant plasmid, wherein M:DL2000Marker; 1:SLA-2-HB-pET-21a (+) enzyme cuts result;
Fig. 4 is that the SLA-2-HB-pET-21a (+) of Hebao pig takes temperature and reaches, wherein M: low molecular weight protein (LMWP) Marker; 1: contrast, SLA-2-HB-pET-21a (+)-BL21 recombinant bacterium not adding IPTG induction is expressed; 2:SLA-2-HB-pET-21a (+)-BL21 albumen is taken temperature and is reached;
Fig. 5 is that Hebao pig SLA-2 heavy chain inclusion body extracts SDS-PAGE figure, wherein M: low molecular weight protein (LMWP) Marker; 1:SLA-2-HB-pET-21a (+)-BL21 inclusion body protein;
Fig. 6 is that pig light chain s β 2m inclusion body extracts SDS-PAGE figure, wherein, and M: low molecular weight protein (LMWP) Marker; 1:s β 2m-pET-21a (+)-BL21 inclusion body protein;
Fig. 7 is SLA-2-HB-Hu62-s β 2m molecular sieve;
Fig. 8 is SLA-2-HB-Hu62-s β 2mResourceQ;
Fig. 9 is the crystal of Index71#SLA-2-HB-Hu62-s β 2m;
Figure 10 is the crystal of Index79#SLA-2-HB-Hu62-s β 2m;
Figure 11 is the crystallogram of SLA-2-HB-Hu62-s β 2m;
Figure 12 is the crystal of SLA-2-HB-Hu62-s β 2m;
Figure 13 is SLA-2-HB-Hu62-s β 2m antigenic peptide engagement groove;
Figure 14 is that SLA-2-HB-Hu62-s β 2m two kinds of chiral molecular polypeptide folding modes compare.
Embodiment
Now in conjunction with concrete implementation of class, the present invention will be described further.
Implementation of class 1
1, design of primers and synthesis
According to Hebao pig SLA-2 full genome encoding sequence, design upstream primer and the downstream primer of its extracellular region of amplification respectively:
2, the synthesis of polypeptide
By prediction website NetMHC2.8Server (http://genome.cbs.dtu.dk/services/NetMHC/) with O type foot and mouth disease (Foot-and-mouthdisease, FMDV) complete sequence of virus stain HQ116229-FMDV-O-HuBHK99, devise Hu62 foot-and-mouth disease virus polypeptide, sequence is ALLRTATYY, is synthesized by Shanghai Qiangyao Biotechnology Co., Ltd..
3, the structure of SLA-2-HB extracellular region expression vector
With pHB21F/pHB-21R1 as primer pair, with Hebao pig SLA-2-HB01/pMD18-T full genome recombinant plasmid, (sequence number is for AB602431, restructuring condition is shown in the MicrobiologyandImmunology that publishes an article, 2012,56:208-215) be template, amplification Hebao pig SLA-2 extracellular part, called after SLA-2-HB, size is about 820bp, product as shown in Figure 1, PCR primer 5 ' end band has NdeI restriction enzyme site CA/TATG, and 3 ' end band has XhoI restriction enzyme site CT/CGAG.
Set up following PCR reaction system, cumulative volume is 50 μ L:
PCR reaction conditions is
PCR primer reclaims through cutting glue, and after NdeI and XhoI double digestion, connect with through same pET-21a (+) empty carrier processed, transform BL21 competent cell, picking positive colony is cultivated, and extracts plasmid and carries out double digestion evaluation and screening positive colony.Positive colony send biotech firm to check order.
Hebao pig SLA-2-HB-pET-21a (+) plasmid extraction result, as shown in Figure 2, plasmid size is about 6260bp, conforms to expection size.
The result of Hebao pig SLA-2-HB-pET-21a (+) plasmid after Nde I and Xho I double digestion, as shown in Figure 3, pET-21a (+) empty carrier is 5443bp, and goal gene size is 820bp.
Recombinant plasmid SLA-2-HB-pET-21a (+) induces through IPTG cultivate 3h in BL21 after, and at 37 DEG C, 6h is cultivated in concussion, and cracking thalline extracts albumen and carries out SDS-PAGE, and protein expression band size is about 33kDa.As shown in Figure 4.
4, abduction delivering, inclusion body extract and SDS-PAGE electrophoresis detection expressing protein
The SLA-2 heavy chain positive colony bacterium of checking order correct and light chain s β 2m express bacterium the flat lining out of solid LB of Amp resistance, dull and stereotyped 37 DEG C of cultivations 12 hours, picking list bacterium colony cultivates 10h to the test tube that 3mLLB+3 μ LAmp (100mg/mL) substratum is housed, cultured bacterium liquid 50 μ L access is equipped with in the Erlenmeyer flask of 50mLLB liquid nutrient medium, the Amp of 50 μ L is added, Erlenmeyer flask 37 DEG C of constant temperature oscillation incubated overnight in substratum.With the LB liquid nutrient medium of large triangular flask preparation 2L, 121 DEG C of 20min sterilizings.The ratio of the bacterium of incubated overnight in 1:100 in large triangular flask is inoculated, and adds the Amp of 2mL (100mg/mL).In large shaking table, 37 DEG C of isothermal vibrations are cultivated and about within 2 hours, are surveyed OD value, until the IPTG (1mol/L) adding 2mL when OD is 0.5 induces, receive bacterium after 37 DEG C of cultivation 5h.Proceed in the Centrifuge Cup of 500mL by the bacterium of cultivation, 4 DEG C, 6000rpm, 15min receive bacterium, outwell supernatant and only stay bacterial sediment.After receipts bacterium (subsequent step is carried out all at low temperatures), suspend (60 μ lDTT, 1 ‰) with about 60ml 1 × PBS, ultrasonic degradation (super 6S, interval 12S, 99+99 time, about 250W).Centre sees if there is precipitation, has, and stirs, ultrasonic afterwards.16000rpm, 15min, pull out bacterial debris with glass rod by 4 DEG C, and washingbuffer (100mL+100 μ LDTT altogether, 1 ‰) washes 3 times.At every turn ultrasonic: 4S, 10S, 25 times, about 250W, ultrasound condition can from Row sum-equal matrix.Each ultrasonic rear 16000rpm, 15min, washingbuffer washing, removes bacterial debris as far as possible.Weigh.16000rpm, 15min, resuspensionbuffer (60mL+60 μ LDTT, 1 ‰) suspend.16000rpm, 15min, dissolve by 30mg/ml dissolutionbuffer (adding DTT by 1%), 4 DEG C of stirring and dissolving (spending the night).16000rpm, 15min, pour out supernatant or be distributed into 1ml/ pipe, save backup in-20 DEG C or-80 DEG C.
By 2L large bottle culture expression intestinal bacteria, extraction heavy chain and light chain inclusion body carry out SDS-PAGE qualification, and as shown in Figure 5 and Figure 6, heavy chain protein matter size is about 33kDa to result, and light chain protein matter size is about 12kDa.
5, the external combination of heavy chain SLA-2-HB, light chain s β 2m and foot and mouth disease virus epitope polypeptide thereof
Hebao pig heavy chain SLA-2-HB, light chain β 2m and foot and mouth disease virus Hu62 epitope peptide binding tests in vitro.
(1) dilution method recombinant protein matter
1. 500mLrefoldingbuffer (100mmol/LTris is prepared, pH8.0,400mmol/LL-ArgHCl, 2mmol/LEDTA, 5mmol/LGSH, 0.5mmol/LGSSH (adding after renaturation solution precooling) 0.5mmol/LPMSF), 4 DEG C are slowly stirred to it and dissolve mixing completely.
2. with 5mL or 10mL syringe by dissolve after inclusion body (about 3-5ml, can divide 3 times to add, every minor tick 8-10 hours) add in syringe, make it dripping in refoldingbuffer drop by drop (if be that urea dissolves, inclusion body should be able to freeze, available injectionbuffer adds in syringe after dissolving again), slowly stir 8-10 hour (can proper extension time).(carrying out under 4 DEG C of conditions).First add β 2m, then add polypeptide, finally add heavy chain (heavy chain divides three times and adds), heavy chain: light chain: polypeptide=1:1:3 (mol ratio).
3. after renaturation, available concentrated cup concentrating sample changes liquid (be suitable for the damping fluid of this albumen, be generally molecular sieve buffer), then forwards in evaporating pipe concentrated, if renaturation system is little directly can change liquid with evaporating pipe is concentrated.If (after renaturation, renaturation solution becomes muddy, can remove the rear reconcentration of precipitation by low-temperature centrifugation.) (carrying out under 4 DEG C of conditions).
The heavy chain SLA-2 of Hebao pig, foot and mouth disease virus epitope polypeptide and light chain s β 2m are carried out external dilution refolding, identify its whether renaturation by molecular sieve, ResourceQ and SDS-PAGE, obtain molecular sieve and SDS-PAGE, ion column and SDS-PAGE result as Figure 7-8.The swimming lane of SDS-PAGE mark is numbered the numbering that sample collected by molecular sieve.The present invention's molecular sieve gel post used is Hiload10/600Superdex200pg, SLA-2 heavy chain, foot and mouth disease virus epitope polypeptide Hu62 and light chain s β 2m is contained in the sample of protein renaturation, mixture size is about 45kDa, go out peak position between 75-90mL, different heavy chains all can cause the slightly different of peak position from the different mixture formed between polypeptide and different pillars.Recombinant protein matter situation only has one, and namely heavy chain and light chain mol ratio are 1:1 (in SDS-PAGE figure, heavy chain and light chain mass ratio are 3:1).And the protein situation of renaturation does not have three kinds: only have heavy chain to be polymerized; Heavy chain light chain molar ratio is not 1:1; Only has light chain.Found that SLA-2-HB and Hu62 and s β 2m success renaturation.
(2) protein compression
6000rpm, 4 DEG C of centrifugal 15min in centrifuge tube recombinant protein plastome being transferred to 500mL, go precipitation.At Cool Room 4 DEG C, supernatant is transferred in the stirring-type ultra-filtration equipment (StirredCells) of 350mL, albumen mwco membrane (10kDa is installed in advance bottom concentrated cup, MilliporeCentricon), utilize N2 to carry out pressurization to concentrate, the good molecular sieve buffer (20mmol/LTrispH8.0,50mmol/LNaCl) of prior precooling suction filtration is added to volume 150mL when being concentrated into 30mL.Continue concentrated repetition above-mentioned steps.Finally be concentrated into 30mL, solution be transferred in 30mL centrifuge tube, 16000rpm, 4 DEG C of centrifugal 15min, supernatant is forwarded in ultrafiltration and concentration pipe (MilliporeCentricon) and be concentrated into 4mL further.The albumen concentrated is changed to 13300rpm in EP pipe, 4 DEG C of centrifugal 10min, replace tubes goes precipitation; Repeat above-mentioned steps more once, checked whether precipitation, continue to repeat once if having, if do not precipitate, place on ice and use in order to loading.
(3) molecular sieve and SDS-PAGE identify that polypeptide combines
Molecular sieve buffer washs the loading pump of AKTA, uses molecular sieve buffer balanced gel post Superdex200pgHiLoad16/600 prepacked column (GE, AmershamBiosciences company) afterwards again.By sample 12000rpm, 10min, 4 DEG C of centrifugal bubbles that degas are in order to loading.Run with the flow velocity of 1mL/min, collect by the standard of OD280, mAU>20, quantitatively often 1.8mL collected by pipe.The sample collecting peak value place is prepared protein sample, and then whether SDS-PAGE qualification combines.
Protein race glue being shown as renaturation is collected rear concentrated, is further purified recombinant protein matter after anion column ResourceQ.First use A (10mmol/LTrispH8.0,10mmol/LNaCl), B (10mmol/LTrispH8.0,1mol/LNaCl) liquid alternately rinse ResourceQ, to remove on original pillar hang foreign protein, rear A liquid balance pillar.Recombinant protein matter concentrated, centrifugal going is precipitated, the same molecular sieve of step.After loading 10mL, wash the albumen be combined on anion column with B liquid, within 40 minutes, evenly draw gradient to 25%B liquid.Collect the protein of OD280 at more than 20mAU, SDS-PAGE is accredited as the protein of renaturation again, collects concentrated rear some crystal of preparing against and uses.
6, SLA-2-HB-Hu62-s β 2m complex proteins matter crystallization
1. the recombinant protein matter mixture obtained by purifying changes liquid through molecular sieve buffer, and is concentrated into 100 μ about L with the ultrafiltration and concentration pipe of 10kDa, measures protein concn, be diluted to the concentration of 7.5mg/mL and 10mg/mL respectively by BSA method.
2. the Index1-48 of HamptonResearch company is used, Index49-96, PEG/Ion I, PEG/Ion II, CrystalScreen I, CrystalScreen II, test kit such as PEGRx I, PEGRx II grade, utilizes sessile drop method to carry out the crystal screening of albumen composition respectively in 4 DEG C and 18 DEG C.
3. drip in plate at the seat in 48 holes, every hole adds 120 μ L crystal reagent (pond liquid), adds 1 μ L albumen and 1 μ L pond liquid, make it mix, with adhesive tape by 48 pore plate by sealing, put into crystal growth cabinet in crystal pores.After one week, observe with low-power microscope and whether have crystal to grow, and carry out mark.
If 4. have crystal growth, preservation of being taken pictures by crystal, delivers on roentgen machine and carries out diffraction qualification.If crystal is albumin crystal and diffracting effect is better, directly can collect the data of crystal, if the poor effect of diffraction, then need again to screen crystal growth condition or optimization.
5. the condition optimized is the precipitation agent by changing in primary dcreening operation condition, and buffer pH, the method for ionic concn or additive obtains.After obtaining the good albumin crystal of quality, repeat above-mentioned steps 4..
HB-SLA-2-Hu62-s β 2m, under 4 DEG C of conditions, obtains crystal in Index71 and No. 79 condition respectively.
The condition of crystal is Index71#10mg/mL4 DEG C, 0.2MSodiumchloride, 0.1MBIS-TRISpH6.5 and 25%w/vPolyethyleneglycol3,350, see Fig. 9.
The condition of crystal is Index79#10mg/mL4 DEG C, 0.2MAmmoniumacetate, 0.1MBIS-TRISpH6.5,25%w/vPolyethyleneglycol3,350, see Figure 10.
Through X-diffraction, the crystalline structure diffraction of HB-SLA-2-Hu62-s β 2m reaches
its crystallogram is shown in Figure 11.
By analysis, SLA-2-HB-Hu62-s β 2m is an asymmetrical bimolecular structure, as shown in figure 12.Resolve antigenic peptide engagement groove, the polypeptide Hu62 that display SLA-2-HB-Hu62-s β 2m bimolecular crystal combines presents two kinds of different folding modes, shows that SLA-2-HB-Hu62-s β 2m may have two kinds of conformations to exist, sees Figure 13.Further com-parison and analysis finds, causes mainly there are differences at second and the 4th the folding of amino acids of this conformational difference, sees Figure 14.
The present invention is on design pET-21a (+) vector expression Hebao pig SLA-2 Extracellular domain, the feature of this expression vector is that 5 ' end multiple clone site proximity is only containing a Tag label protein, and a NdeI restriction enzyme site is contained in Tag upstream, utilize this restriction enzyme site Tag can be removed; In addition, a His label protein is only had at 3 ' end of multiple clone site, in order to be conducive to the research of protein structure, His label is eliminated by the method artificially arranging terminator codon at insertion gene end, this avoid the work of the series of complex that cutting His label protein brings, be also conducive to albumen and at utmost can recover natural structure when renaturation.
The present invention adopts prokaryotic expression system, the heavy chain extracellular regions of the SLAI molecule of high expression level Hebao pig and light chain, makes SLA-2, polypeptide and the external correct combination of s β 2m folding by dilution refolding method, recycling molecular sieving purification renaturation protein.
Through the further optimization of polypeptide design, selection Hu62 alternatively polypeptide and Hebao pig SLA-2-HB and s β 2m carries out renaturation and crystallization, found that the pH of its preference is 6.5, close to slant acidity environment.SLA-2-HB-Hu62-s β 2m obtains high-quality monocrystalline, and crystal resolving power reaches
further analysis display, SLA-2-HB-Hu62-s β 2m presents asymmetrical bimolecular structure, and disclosing SLA-2-HB-Hu62-s β 2m may have two kinds of conformations.Analyze display further to SLA-2-HB-Hu62-s β 2m crystal polypeptides engagement groove, its polypeptide engagement groove Hu62 polypeptide has two kinds of combinations, and the difference of these two kinds of combinations is mainly reflected in second and the 4th amino acids residue there are differences.
<110> University Of Dalian
The method of <120> O type foot-and-mouth disease virus polypeptide and SLA-2 heavy chain, the crystallization of light chain β 2m renaturation
<160>2
<170>PatentInversion3.3
<210>1
<211>40
<212>DNA
<213> synthetic
<400>1
ggaattccatatgggcccgcattccctgagctattcttac40
<210>2
<211>40
<212>DNA
<213> synthetic
<400>2
agtctcgagttagtcccatctcagggtgaggggctcctgc40
Claims (1)
1. a method for O type foot-and-mouth disease virus polypeptide and Hebao pig SLA-2 heavy chain, light chain β 2m renaturation, crystallization, it is characterized in that, concrete steps are as follows:
(1), design of primers and synthesis
According to Hebao pig SLA-2 full genome encoding sequence, design upstream primer and the downstream primer of its extracellular region of amplification respectively:
(2), the synthesis of polypeptide
With the complete sequence of O type hoof-and-mouth disease poison strain HQ116229-FMDV-O-HuBHK99, devise Hu62 foot-and-mouth disease virus polypeptide, sequence is ALLRTATYY;
(3), the structure of SLA-2-HB extracellular region expression vector
With pHB21F/pHB-21R1 as primer pair, with Hebao pig SLA-2-HB01/pMD18-T full genome recombinant plasmid for template, amplification Hebao pig SLA-2 extracellular part, PCR primer 5 ' end band has NdeI restriction enzyme site CA/TATG, 3 ' end band has XhoI restriction enzyme site CT/CGAG, set up following PCR reaction system, cumulative volume is 50 μ L:
PCR reaction conditions is
PCR primer reclaims through cutting glue, and after NdeI and XhoI double digestion, connects with through same pET-21a (+) empty carrier processed, transform BL21 competent cell, picking positive colony is cultivated, and extracts plasmid and carries out double digestion evaluation and screening positive colony, and check order;
(4), abduction delivering, inclusion body extract and SDS-PAGE electrophoresis detection expressing protein
The SLA-2 heavy chain positive colony bacterium of checking order correct and light chain s β 2m express bacterium the flat lining out of solid LB of Amp resistance, dull and stereotyped 37 DEG C of cultivations 12 hours, picking list bacterium colony cultivates 10h to the test tube that 3mLLB+3 μ LAmp (100mg/mL) substratum is housed, cultured bacterium liquid 50 μ L access is equipped with in the Erlenmeyer flask of 50mLLB liquid nutrient medium, the Amp of 50 μ L is added in substratum, Erlenmeyer flask 37 DEG C of constant temperature oscillation incubated overnight, with the LB liquid nutrient medium of large triangular flask preparation 2L, 121 DEG C of 20min sterilizings, the ratio of the bacterium of incubated overnight in 1:100 in large triangular flask is inoculated, and add 2mL, the Amp of 100mg/mL, in large shaking table, 37 DEG C of isothermal vibrations are cultivated and about within 2 hours, are surveyed OD value, until add 2mL when OD is 0.5, the IPTG of 1mol/L induces, bacterium is received after 37 DEG C of cultivation 5h, the bacterium of cultivation is proceeded in the Centrifuge Cup of 500mL, 4 DEG C, 6000rpm, 15min receives bacterium, outwell supernatant and only stay bacterial sediment, after receiving bacterium, at low temperatures, to suspend 60 μ lDTT with about 60ml 1 × PBS, 1 ‰, ultrasonic degradation, super 6S, interval 12S, 99+99 time, 250W, centre sees if there is precipitation, have, stir, ultrasonic afterwards, 16000rpm, 15min, 4 DEG C, with glass rod, bacterial debris is pulled out, washingbuffer is 100mL+100 μ LDTT altogether, 1 ‰ wash 3 times, at every turn ultrasonic: 4S, 10S, 25 times, 250W, each ultrasonic rear 16000rpm, 15min, washingbuffer washs, remove bacterial debris, weigh, 16000rpm, 15min, resuspensionbuffer, 60mL+60 μ LDTT, 1 ‰ suspend, 16000rpm, 15min, add DTT by 30mg/ml dissolutionbuffer by 1% to dissolve, 4 DEG C of stirring and dissolving are spent the night, 16000rpm, 15min, pour out supernatant or be distributed into 1ml/ pipe, save backup in-20 DEG C or-80 DEG C,
(5), the external combination of Hebao pig heavy chain SLA-2-HB, light chain s β 2m and foot and mouth disease virus epitope polypeptide thereof
Hebao pig heavy chain SLA-2-HB, light chain β 2m are combined in vitro with foot and mouth disease virus Hu62 epitope peptide:
1) dilution method recombinant protein matter
1. 500mLrefoldingbuffer is prepared, formula 100mmol/LTris, pH8.0,400mmol/LL-ArgHCl, 2mmol/LEDTA, 5mmol/LGSH, 0.5mmol/LGSSH, add 0.5mmol/LPMSF after renaturation solution precooling, 4 DEG C are slowly stirred to it and dissolve mixing completely
2. with 5mL or 10mL syringe by the inclusion body 3-5ml after dissolving, point to add for 3 times, every minor tick 8-10 hour, add in syringe, make it dripping in refoldingbuffer drop by drop, slowly stir 8-10 hour, under 4 DEG C of conditions, first add light chain β 2m, add polypeptide again, finally add Hebao pig heavy chain SLA-2-HB, Hebao pig heavy chain SLA-2-HB divides three times and adds, Hebao pig heavy chain SLA-2-HB: light chain β 2m: polypeptide (mol ratio)=1:1:3
3., after renaturation, change liquid with concentrated cup concentrating sample, damping fluid is molecular sieve buffer, forward in evaporating pipe concentrated again, if renaturation system is little directly can change liquid with evaporating pipe is concentrated, if renaturation solution becomes muddy after renaturation, reconcentration after centrifugal segregation precipitation under 4 DEG C of conditions;
2) protein compression
6000rpm, 4 DEG C of centrifugal 15min in centrifuge tube recombinant protein plastome being transferred to 500mL, go precipitation, at Cool Room 4 DEG C, supernatant is transferred in the stirring-type ultra-filtration equipment of 350mL, install albumen mwco membrane 10kDa in advance bottom concentrated cup, MilliporeCentricon, utilizes N
2carry out pressurization to concentrate, add the good molecular sieve buffer of prior precooling suction filtration when being concentrated into 30mL to volume 150mL, molecular sieve buffer is 20mmol/LTrispH8.0,50mmol/LNaCl, continue concentrated repetition above-mentioned steps, be finally concentrated into 30mL, solution be transferred in 30mL centrifuge tube, 16000rpm, 4 DEG C of centrifugal 15min, forward to supernatant in ultrafiltration and concentration pipe and are concentrated into 4mL further, and the albumen concentrated is changed to 13300rpm in EP pipe, 4 DEG C of centrifugal 10min, replace tubes goes precipitation; Repeat above-mentioned steps more once, checked whether precipitation, continue to repeat once if having, if do not precipitate, place on ice in order to loading use,
3) molecular sieve and SDS-PAGE identify that polypeptide combines
Molecular sieve buffer washs the loading pump of AKTA, use molecular sieve buffer balanced gel post Superdex200pgHiLoad16/600 prepacked column afterwards again, by sample 12000rpm, 10min, 4 DEG C of centrifugal bubbles that degas are in order to loading, run with the flow velocity of 1mL/min, collect by the standard of OD280, mAU>20, quantitatively often 1.8mL collected by pipe, the sample collecting peak value place is prepared protein sample, and then whether SDS-PAGE qualification combines
Protein race glue being shown as renaturation is collected rear concentrated, recombinant protein matter is further purified after anion column ResourceQ, first A liquid is used, B liquid alternately rinses ResourceQ, to remove on original pillar hang foreign protein, afterwards with A liquid balance pillar, recombinant protein matter is concentrated, centrifugal going is precipitated, the same molecular sieve of step, after loading 10mL, the albumen be combined on anion column is washed with B liquid, within 40 minutes, evenly draw gradient to 25%B liquid, collect the protein of OD280 at more than 20mAU, SDS-PAGE is accredited as the protein of renaturation again, collect concentrated rear some crystal of preparing against to use, wherein, A liquid is 10mmol/LTrispH8.0, 10mmol/LNaCl, B liquid is 10mmol/LTrispH8.0, 1mol/LNaCl,
(6), SLA-2-HB-Hu62-s β 2m complex proteins matter crystallization
1. the recombinant protein matter mixture obtained by purifying changes liquid through molecular sieve buffer, and is concentrated into 100 μ about L with the ultrafiltration and concentration pipe of 10kDa, measures protein concn, be diluted to the concentration of 7.5mg/mL and 10mg/mL respectively by BSA method,
2. utilize Index1-48, Index49-96, PEG/Ion I, PEG/Ion II, CrystalScreen I, CrystalScreen, II, PEGRx I, PEGRx II test kit, utilize sessile drop method to carry out the crystal screening of albumen composition respectively in 4 DEG C and 18 DEG C,
3. drip in plate at the seat in 48 holes, every hole adds 120 μ L crystal reagent (pond liquid), 1 μ L albumen and 1 μ L pond liquid is added in crystal pores, make it mix, with adhesive tape by 48 pore plate by sealing, put into crystal growth cabinet, after one week, whether have crystal grow, and carry out mark if observing with low-power microscope
If 4. have crystal growth, preservation of being taken pictures by crystal, delivers on roentgen machine and carries out diffraction qualification, if crystal is albumin crystal and diffracting effect is good, directly can collect the data of crystal, if the poor effect of diffraction, then need again to screen crystal growth condition or optimization
5. the condition optimized is the precipitation agent by changing in primary dcreening operation condition, buffer pH, and the method for ionic concn or additive obtains, and after obtaining the measured albumin crystal of matter, repeats above-mentioned steps 4..
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510961939.9A CN105461811B (en) | 2015-12-18 | 2015-12-18 | A kind of method of O-shaped foot-and-mouth disease virus polypeptide and SLA-2 heavy chain, the crystallization of light chain β 2m renaturation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510961939.9A CN105461811B (en) | 2015-12-18 | 2015-12-18 | A kind of method of O-shaped foot-and-mouth disease virus polypeptide and SLA-2 heavy chain, the crystallization of light chain β 2m renaturation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105461811A true CN105461811A (en) | 2016-04-06 |
| CN105461811B CN105461811B (en) | 2018-12-18 |
Family
ID=55600011
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510961939.9A Active CN105461811B (en) | 2015-12-18 | 2015-12-18 | A kind of method of O-shaped foot-and-mouth disease virus polypeptide and SLA-2 heavy chain, the crystallization of light chain β 2m renaturation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105461811B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207444A (en) * | 2018-09-03 | 2019-01-15 | 浙江善测禾骑士生物科技有限公司 | A kind of preparation method and its crystal structure analysis method of LPOR-6803 albumen |
| CN110791517A (en) * | 2018-08-01 | 2020-02-14 | 中国农业大学 | Preparation, purification and crystallization of fibroblast growth factor 21 |
| CN114181895A (en) * | 2021-12-10 | 2022-03-15 | 大连大学 | Method for screening CTL epitope by self-constructed SLA-2-HB01-pCDH/sT2 cell line |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984058A (en) * | 2010-11-16 | 2011-03-09 | 大连大学 | Pouch pig SLA-2 genes and application thereof |
| CN103864905A (en) * | 2013-12-30 | 2014-06-18 | 大连大学 | CTL (Cytotoxic T Lymphocyte) epitope peptide of foot-and-mouth disease virus type O and screening method of CTL epitope peptide |
-
2015
- 2015-12-18 CN CN201510961939.9A patent/CN105461811B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984058A (en) * | 2010-11-16 | 2011-03-09 | 大连大学 | Pouch pig SLA-2 genes and application thereof |
| CN103864905A (en) * | 2013-12-30 | 2014-06-18 | 大连大学 | CTL (Cytotoxic T Lymphocyte) epitope peptide of foot-and-mouth disease virus type O and screening method of CTL epitope peptide |
Non-Patent Citations (7)
| Title |
|---|
| FENG-SHAN GAO等: "Reconstruction of a swine SLA-I protein complex and", 《VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY》 * |
| FULIANG CHU等: "Complex assembly, crystallization and preliminary X-ray crystallographic studies of rhesus macaque MHC Mamu-A*01 complexed with an immunodominant SIV-Gag nonapeptide", 《ACTA CRYSTALLOGRAPHICA SECTION F》 * |
| NIANZHI ZHANG等: "Crystal Structure of Swine Major Histocompatibility Complex Class I SLA-1*0401 and Identification of 2009 Pandemic Swine-Origin Influenza A H1N1 Virus Cytotoxic T Lymphocyte Epitope Peptides", 《JOURNAL OF VIROLOGY》 * |
| WEIHONG CHEN等: "Crystal structure of a bony fish beta2-microglobulin: insights into the evolutionary origin of immunoglobulin superfamily constant molecules", 《JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| 姜巍等: "烟台黑猪SLA-2-YTH原核表达载体的构建及表达", 《中国畜牧兽医》 * |
| 高凤山等: "巴马小型猪SLA-2和β2m复合体蛋白的构建及二级结构测定分析", 《畜牧兽医学报》 * |
| 高凤山等: "重构猪SLA-Ⅰ单链复合体及其口蹄疫病毒VP1蛋白限制性表位的筛选", 《自然科学进展》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110791517A (en) * | 2018-08-01 | 2020-02-14 | 中国农业大学 | Preparation, purification and crystallization of fibroblast growth factor 21 |
| CN109207444A (en) * | 2018-09-03 | 2019-01-15 | 浙江善测禾骑士生物科技有限公司 | A kind of preparation method and its crystal structure analysis method of LPOR-6803 albumen |
| CN114181895A (en) * | 2021-12-10 | 2022-03-15 | 大连大学 | Method for screening CTL epitope by self-constructed SLA-2-HB01-pCDH/sT2 cell line |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105461811B (en) | 2018-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10724006B2 (en) | Buffers for stabilization of lentiviral preparations | |
| CN102636641B (en) | Detection kit of helicobacter pylori emulsion method and preparation process thereof | |
| CA3108657A1 (en) | Processes for generating engineered cells and compositions thereof | |
| CN111499765A (en) | Coronavirus fusion protein and preparation method and application thereof | |
| CN105461811A (en) | Renaturation and crystallization method for O-type foot-and-mouth disease virus polypeptide and SLA-2 heavy chain as well as light chain beta2m | |
| CN103525773B (en) | A kind of method and application thereof improving PRRS virus target cell infection titre | |
| CN109053883A (en) | The binding protein of NS1 albumen | |
| CN104380106A (en) | Method for producing reagent for antibody detection and use thereof | |
| CN105504045A (en) | Method for refolding and crystallizing between Asian type-I foot and mouth disease virus polypeptide and heavy chain SLA-2 and light chain beta2m | |
| CN109081869A (en) | The binding protein of NS1 albumen | |
| CN109134647A (en) | The binding protein of NS1 albumen | |
| CN109022419A (en) | A kind of preparation method of fragmentation DNA | |
| CN106955361A (en) | A kind of pharmaceutical composition containing tuberculosis allergen CE | |
| Kohyama et al. | Efficient induction of cytotoxic T lymphocytes specific for severe acute respiratory syndrome (SARS)-associated coronavirus by immunization with surface-linked liposomal peptides derived from a non-structural polyprotein 1a | |
| CN104357474A (en) | Method for preparing in vitro expression and polyclonal antibody of porcine Sox6 protein | |
| CN104678097A (en) | Mycobacterium tuberculosis combined antigen for diagnosing pulmonary tuberculosis | |
| CN102796172B (en) | Hepatitis B virus (HBV) specific human leukocyte antigen-A33 (HLA-A33) restrictive epitope peptides and application thereof | |
| CN106344914A (en) | Simple and convenient method for preparing periodic brugia malayi M29 epitope gene protein vaccine | |
| CN102827292B (en) | Fusion protein TgMEP as well as preparation method and application thereof | |
| CN104892758A (en) | AQP7 extracellular domain antibody prepared by using GST expression system, and application thereof | |
| CN114807193B (en) | Carbonic anhydrase gene and application thereof | |
| KR101441950B1 (en) | Norovirus detection method, and the preparing method of recombinant vector and recombinant protein for the detection | |
| CN113444153B (en) | African swine fever virus CD2v truncated protein and application thereof in preparation of wild virus and natural attenuated virus detection kit | |
| CN101691585B (en) | Recombinant plasmid pSEB-Wnt5a and preparation method thereof | |
| Philipp et al. | Efficient virus detection utilizing chitin-immobilized nanobodies synthesized in Ustilago maydis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |