WO2005058950A2 - Procedes pour generer une immunite a un antigene - Google Patents

Procedes pour generer une immunite a un antigene Download PDF

Info

Publication number
WO2005058950A2
WO2005058950A2 PCT/US2004/041690 US2004041690W WO2005058950A2 WO 2005058950 A2 WO2005058950 A2 WO 2005058950A2 US 2004041690 W US2004041690 W US 2004041690W WO 2005058950 A2 WO2005058950 A2 WO 2005058950A2
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
vector
ligand
protein
fusion protein
Prior art date
Application number
PCT/US2004/041690
Other languages
English (en)
Other versions
WO2005058950A3 (fr
Inventor
Albert Deisseroth
Yucheng Tang
Wei-Wei Zhang
Xiang-Ming Fang
Original Assignee
Sidney Kimmel Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sidney Kimmel Cancer Center filed Critical Sidney Kimmel Cancer Center
Priority to JP2006544078A priority Critical patent/JP2008504219A/ja
Priority to EP04813939A priority patent/EP1720905A2/fr
Priority to CA002548347A priority patent/CA2548347A1/fr
Publication of WO2005058950A2 publication Critical patent/WO2005058950A2/fr
Publication of WO2005058950A3 publication Critical patent/WO2005058950A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575—NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation

Definitions

  • the present invention relates to methods of developing immunity against an antigen using an expression vector that expresses a secretable fusion protein comprising an antigen fused to CD40 ligand.
  • the methods also relate to an immunization scheme of priming with the expression vector and boosting with a protein antigen.
  • the invention also relates to an approach for producing the vector and the protein antigen simultaneously in a production cell system.
  • APCs antigen presenting cells
  • DCs dendritic cells
  • LNs regional lymph nodes
  • APCs express insufficient amounts of surface activation molecules which are required for optimal activation and expansion of T cell clones competent to recognize tumor antigens. See Shortman, et al., Stem Cells 15:409- 419, 1997.
  • CD40L CD40-CD40 ligand
  • the antigen is a tumor antigen; the tumor antigen is the E6 or E7 protein of human papilloma virus; the tumor antigen is a mucin antigen, which maybe selected from the group consisting of MUC1, MUC2, MUC3A, MUC3B, MUC4, MUC5AC, MUC5B, MUC6, MUC7, MUC8, MUC9, MUC12, MUC13, MUC15, and MUC16; the mucin antigen is from MUCl; the human epidermal growth factor (EGF) like receptor (e.g., HER1, HER2, HER3 and HER4), the antigen is an infectious agent antigen; the infectious agent antigen is a viral antigen; the infectious agent viral antigen is from human papilloma virus; the viral antigen is the E6 or E7 protein of human papilloma virus.
  • the infectious agent antigen is a viral antigen
  • infectious agent viral antigen is from human papilloma virus
  • the invention provides methods of treating an individual with cancer that expresses a tumor antigen.
  • the method includes administering the expression vector which includes a transcription unit encoding a secretable fusion protein that contains the tumor antigen and CD40 ligand.
  • the fusion protein is also administered before, concurrently or after administration of the vector.
  • the fusion protein is administered after the vector.
  • the invention provides a method of generating immunity in a subject to an infectious agent.
  • the method includes administering the expression vector which includes a transcription unit encoding a secretable fusion protein that contains the infectious agent antigen and CD40 ligand.
  • the fusion protein is also administered before, concunently or after administration of the vector.
  • the fusion protein is administered after the vector.
  • the invention relates to an approach for producing the vector and the fusion protein together in the same host production cell system.
  • the fusion protein is expressed from the same vector used to generate immunity by vaccination. In this way, both the vector and the fusion protein can be produced simultaneously through a single production system.
  • the expression vector may be a viral expression vector or a non- viral expression vector; the expression vector may be an adenoviral vector; the vector may be advantageously administered subcutaneously; the vector may be administered on a subsequent occasion(s) to increase the immune response; a signal sequence may be placed upstream of the fusion protein for secretion of the fusion protein; immunity against the antigen may be long lasting and involve generation of cytotoxic CD8 + T cells against antigen expressing cells and the production of antibody to the antigen; the transcription unit may include sequence that encodes a linker between the antigen and the CD40 ligand; suitable linkers may vary in length and composition; the expression vector may include a human cytomegalovirus promoter/enhancer for controlling transcription of the transcription unit; and the CD40 ligand may be a human CD40 ligand.
  • Abbreviations used herein include “Ad” (adenoviral); “sig” (signal sequence); and “ecd” (extracellular domain).
  • FIG. 2 shows the amino acid sequence of human MUC1 (SEQ JD NO:2).
  • FIG. 3 shows the level of interferon gamma produced in an ELISA spot assay using spleen cells from MUC-1 transgenic animals (hMUC-l.Tg ) primed with adenoviral expression vector Ad-K7ecdhMUCl- ⁇ Ct ⁇ TmCD40L and boosted subcutaneously with either expression vector or the mature fusion protein ecdhMUCl- ⁇ Ct ⁇ TmCD40L.
  • the various treatment groups include protein boost seven days after two weekly vector injections (TI), two weeks after two weekly vector injections (T2), one week after one vector injection (T3), and two weeks after one vector injection (T4). In T5, two subcutaneous protein injections (administered two weeks apart) were given starting 7 days after a single vector injection. In TI, two vector injections were given without protein.
  • FIG. 5 shows the level of antibody against fusion protein ecdhMUCl- ⁇ Ct ⁇ TmCD40L in serum of MUC-1 transgenic animals (hMUC-1.Tg ) primed with adenoviral expression vector Ad-K/ecdhMUCl- ⁇ Ct ⁇ TmCD40L and boosted subcutaneously with either expression vector or the mature fusion protein ecdhMUCl- ⁇ Ct ⁇ TmCD40L.
  • the various treatment groups are as described in FIG. 3.
  • Antibodies were detected in an ELISA. Microwell plates coated with the fusion protein ecdhMUCl- ⁇ Ct ⁇ TmCD40L were reacted with serum, washed and bound mouse antibody detected using rat anti-mouse antibody conjugated to horseradish peroxidase.
  • FIG. 6 shows the level growth of MUC1 expressing tumor cells (LL2/LL2hMUC- 1) in MUC-1 transgenic animals (hMUC-l.Tg ) administered adenoviral expression vector Ad-K/ecdhMUCl- ⁇ Ct ⁇ TmCD40L versus one or two subsequent administrations of fusion protein ecdhMUCl- ⁇ Ct ⁇ TmCD40L.
  • FIG. 7 demonstrates tumor prevention in animals immunized with Ad-sig- ecdhMUC-l/ ⁇ Ct ⁇ TmCD40L vector and ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L protein.
  • VVV three Ad-sig-ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L vector subcutaneous injections administered on days 1, 7 and 21;
  • PPP three ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L protein subcutaneous injections administered on days 1, 7 and 21; or
  • VPP a single Ad-sig-ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L vector subcutaneous injection followed at days 7 and 21 by ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L protein subcutaneous injections.
  • FIG. 8 demonstrates the levels of hMUC-1 specific antibodies in vaccinated test mice at 63 days following the start of the vaccination.
  • VVV three Ad-sig-ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L vector subcutaneous injections administered on days 1, 7 and 21;
  • PPP three ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L protein subcutaneous injections administered on days 1, 7 and 21; or
  • VPP a single Ad-sig-ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L vector subcutaneous injection followed at days 7 and 21 by ecdhMUC-1/ ⁇ Ct ⁇ Tm CD40L protein subcutaneous injections.
  • Subcutaneous tumor (500,000 of the LL2/LL1 hMUC-1) was administered on day 1 and vaccinations were carried out at day 5. Tumor was administered i.v. on day 40 and tumor development (subcutaneous and lung) evaluated at day 54.
  • FIG. 10 demonstrates lung metastatic tumor nodule therapy (post establishment) in the animals treated as described in FIG. 9.
  • Left panel The results were similar to the subcutaneous tumor prevention with schedule VVV and VPP most effective.
  • Right panel the combination of one vector injection followed by two protein injections (VPP) completely suppressed the growth of established lung nodules of the hMUC-1 positive cancer cells.
  • the individual is first administered the vector on one or more occasions to generate a primary immune response.
  • the fusion protein is also administered in an effective amount after administration of vector to boost the immune response to the antigen above that obtained with vector administration alone.
  • the use of the fusion protein to boost the immune response avoids having to repetitively administer the expression vector which might generate hypersensitivitiy to multiple injections.
  • the antigen portion of the fusion protein is preferably the fusion protein which is encoded by the transcription unit of the expression vector used in the initial administration.
  • the antigen portion of the fusion protein may differ from the encoded antigen provided that there is at least one shared antigenic determinant or epitope common to the antigen of the expression vector and that of the fusion protein used for boosting.
  • the fusion protein may be prepared in a mammalian cell line system, which is complementary to the vector.
  • the cell line system can be 293 cells that contain the Early Region 1 (El) gene and can support the propagation of the El -substituted recombinant adenoviruses.
  • El Early Region 1
  • the viral vectors will propagate themselves following the viral replication cycles.
  • the gene of interest that is carried by the viral vector in the expression cassette will express during the viral propagation process.
  • This can be utilized for preparation of the fusion protein encoded by the vector in the same system for production of the vector.
  • the production of both the vector and the fusion protein will take place simultaneously in the production system.
  • the vector and protein thus produced can be further isolated and purified via different processes.
  • the fusion protein may be administered parenterally, such as intravascularly, intravenously, intraarterially, intramuscularly, subcutaneously, or the like. Administration can also be orally, nasally, rectally, transdermally or inhalationally via an aerosol.
  • the protein boost may be administered as a bolus, or slowly infused.
  • the protein boost is preferably administered subcutaneously.
  • the fusion protein boost may be formulated with an adjuvant to enhance the resulting immune response.
  • adjuvant means a chemical that, when administered with the vaccine, enhances the immune response to the vaccine.
  • An adjuvant is distinguished from a carrier protein in that the adjuvant is not chemically coupled to the immunogen or the antigen.
  • Adjuvants are well known in the art and include, for example, mineral oil emulsions (U.S. Pat. No. 4,608,251, supra) such as Freund's complete or Freund's incomplete adjuvant (Freund, Adv. Tuberc. Res. 7:130 (1956); Calbiochem, San Diego Calif), aluminum salts, especially aluminum hydroxide or ALLOHYDROGEL (approved for use in humans by the U.S. Food and Drug Administration), muramyl dipeptide (MDP) and its analogs such as [Thr 1 J-MDP (Byers and Allison, Vaccine 5:223 (1987)), monophosphoryl lipid A (Johnson et al., Rev. Infect. Dis. 9:S512 (1987)), and the like.
  • mineral oil emulsions such as Freund's complete or Freund's incomplete adjuvant (Freund, Adv. Tuberc. Res. 7:130 (1956); Calbiochem, San Diego Calif)
  • aluminum salts especially aluminum hydroxide or ALLOH
  • the fusion protein can be administered in a microencapsulated or a macroencapsulated form using methods well known in the art.
  • Fusion protein can be encapsulated, for example, into liposomes (see, for example, Garcon and Six, J. Immunol. 146:3697 (1991)), into the inner capsid protein of bovine rotavirus (Redmond et al., Mol. Immunol. 28:269 (1991)) into immune stimulating molecules (ISCOMS) composed of saponins such as Quil A (Morein et al., Nature 308:457 (1984)); Morein et al., in nmunological Adjuvants and Vaccines (G. Gregoriadis al.
  • the fusion protein also can be adsorbed to the surface of lipid microspheres containing squalene or squalane emulsions prepared with a PLURONIC block-copolymer such as L-121 and stabilized with a detergent such as TWEEN 80 (see Allison and Byers, Vaccines: New Approaches to hnmunological Problems (R. Ellis ed.) pp. 431-449, Butterworth-Hinemann, Stoneman N.Y. (1992)).
  • a microencapsulated or a macroencapsulated fusion protein can also include an adjuvant.
  • the fusion protein also may be conjugated to a carrier or foreign molecule such as a carrier protein that is foreign to the individual to be administered the protein boost.
  • Foreign proteins that activate the immune response and can be conjugated to a fusion protein as described herein include proteins or other molecules with molecular weights of at least about 20,000 Daltons, preferably at least about 40,000 Daltons and more preferably at least about 60,000 Daltons.
  • Carrier proteins useful in the present invention include, for example, GST, hemocyanins such as from the keyhole limpet, serum albumin or cationized serum albumin, thyroglobulin, ovalbumin, various toxoid proteins such a tetanus toxoid or diptheria toxoid, immunoglobulins, heat shock proteins, and the like.
  • Methods to chemically couple one protein to another (carrier) protein are well known in the art and include, for example, conjugation by a water soluble carbodiimide such as l-ethyl-3-(3dimethylaminopropyl)carbodiimide hydrochloride, conjugation by a homobifunctional cross-linker having, for example, NHS ester groups or sulfo-NHS ester analogs, conjugation by a heterobifunctional cross-linker having, for example, and NHS ester and a maleimide group such as sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1- carboxylate and, conjugation with gluteraldehyde (see, for example, Hermanson, Bioconjugate Techniques, Academic Press, San Diego, Calif. (1996)); see, also, U.S. Pat. Nos. 4,608,251 and 4,161,519).
  • a water soluble carbodiimide such as
  • vector which contains a transcription unit (aka. "expression vector”) as used herein refers to viral and non- viral expression vectors that when administered in vivo can enter target cells and express an encoded protein.
  • Viral vectors suitable for delivery in vivo and expression of an exogenous protein are well known and include adenoviral vectors, adeno-associated viral vectors, retroviral vectors, herpes simplex viral vectors, and the like. Viral vectors are preferably made replication defective in normal cells. See U.S. Patent no. 6,669,942; 6,566,128; 6,794,188; 6,110, 744; 6,133,029.
  • adenoviral expression vector refers to any vector from an adenovirus that includes exogenous DNA inserted into its genome which encodes a polypeptide.
  • the vector must be capable of replicating and being packaged when any deficient essential genes are provided in trans.
  • An adenoviral vector desirably contains at least a portion of each terminal repeat required to support the replication of the viral DNA, preferably at least about 90% of the full ITR sequence, and the DNA required to encapsidate the genome into a viral capsid.
  • Many suitable adenoviral vectors have been described in the art. See U.S. Patent nos. 6,440,944 and 6,040,174 (replication defective El deleted vectors and specialized packaging cell lines).
  • a preferred adenoviral expression vector is one that is replication defective in normal cells.
  • Adeno-associated viruses represent a class of small, single-stranded DNA viruses that can insert their genetic material at a specific site on chromosome 19. The preparation and use of adeno-associated viral vectors for gene delivery is described in U.S. Patent no. 5,658,785.
  • transcription unit as it is used herein in connection with an expression vector means a stretch of DNA that is transcribed as a single, continuous mRNA strand by RNA polymerase, and includes the signals for initiation and termination of transcription.
  • a transcription unit of the invention includes nucleic acid that encodes from 5' to 3,' a secretory signal sequence, an antigen and CD40 ligand.
  • the transcription unit is in operable linkage with transcriptional and/or translational expression control elements such as a promoter and optionally any upstream or downstream enhancer element(s).
  • a useful promoter/enhancer is the cytomegalovirus (CMV) immediate-early promoter/enhancer. See U.S. Patents no. 5,849,522 and 6,218,140.
  • secretory signal sequence refers to a short peptide sequence, generally hydrophobic in charter, including about 20 to 30 amino acids which is synthesized at the N-terminus of a polypeptide and directs the polypeptide to the endoplasmic reticulum.
  • the secretory signal sequence is generally cleaved upon translocation of the polypeptide into the endoplasmic reticulum.
  • Eukaryotic secretory signal sequences are prefened for directing secretion of the exogenous gene product of the expression vector.
  • suitable such sequences are well known in the art and include the secretory signal sequence of human growth hormone, immunoglobulin kappa chain, and the like.
  • the endogenous tumor antigen signal sequence also may be used to direct secretion.
  • antigen refers broadly to any antigen to which an individual can generate an immune response.
  • Antigen refers broadly to molecule that contains at least one antigenic determinant to which the immune response may be directed.
  • the immune response may be cell mediated or humoral or both.
  • an antigen may be protein in nature, carbohydrate in nature, lipid in nature, or nucleic acid in nature, or combinations of these biomolecules.
  • An antigen may include non-natural molecules such as polymers and the like.
  • Antigens include self antigens and foreign antigens such as antigens produced by another animal or antigens from an infectious agent. Infectious agent antigens may be bacterial, viral, fungal, protozoan, and the like.
  • tumor associated antigen refers to a protein which is present on tumor cells, and on normal cells during fetal life (onco-fetal antigen), after birth in selected organs, or on many normal cells, but at much lower concentration than on tumor cells.
  • TAA tumor associated antigen
  • An exemplary TAA is a mucin such as MUC1, described in further detail below or the HER2 (neu) antigen also described below.
  • TSA tumor specific antigen
  • TSAs usually appear when an infecting virus has caused the cell to become immortal and to express a viral antigen(s).
  • An exemplary viral TSA is the E6 or E7 proteins of HPV type 16.
  • HPV can cause a variety of epithelial lesions of the skin and genital tract.
  • HPV related diseases of the genital tract constitute the second leading cause of cancer death among women in the world. These include genital warts, cervical intraepithelial neoplasia (CTN) and cancer of the cervix.
  • CTN cervical intraepithelial neoplasia
  • the HPV type most commonly associated with high grade CIN and cervical cancer is HPV type 16. The majority of cervical cancers express the non-structural HPV16-derived gene products E6 and E7 oncoproteins.
  • TSAs not induced by viruses can be idiotypes of the immunoglobulin on B cell lymphomas or the T cell receptor (TCR) on T cell lymphomas.
  • TAA Tumor-associated antigens
  • mocin refers to any of a class of high molecular weight glycoproteins with a high content of clustered oligosaccharides O-glycosidically linked to tandem repeating peptide sequences which are rich in threonine, serine and proline. Mucin plays a role in cellular protection and, with many sugars exposed on the extended structure, effects multiple interactions with various cell types including leukocytes and infectious agents.
  • Mucin antigens also include those identified as CD227, Tumor-associated epithelial membrane antigen (EMA), Polymorphic epithelial mucin (PEM), Peanut- reactive urinary mucin (PUM), episialin, Breast carcinoma-associated antigen DF3, H23 antigen, mucin 1, Episialin, Tumor-associated mucin, Carcinoma-associated mucin. Also included are CA15-3 antigen, M344 antigen, Sialosyl Lewis Antigen (SLA), CA19-9, CA195 and other mucin antigen previously identified by monoclonal antibodies (e.g., see U.S. Patent no. 5,849,876).
  • mucin does not include proteoglycans which are glycoproteins characterized by glycosaminoglycan chains covalently attached to the protein backbone.
  • MUC1 NCBI NM002456, Swiss Prot P15941
  • MUC2 NCBI NM002457, Swiss Prot Q02817)
  • MUC3A NCBI AFl 13616, Swiss Prot Q02505
  • MUC3B NCBI AJ291390, Swiss Prot Q9H195
  • MUC4 NCBI NM 138299, Swiss Prot Q99102
  • MUC5AC NCBI AF043909, Swiss Prot Q8WWQ5
  • MUC5B Swiss Prot Q9HC84
  • MUC6 NCBI U97698, Swiss Prot Q8N8I1
  • MUC7 NCBI L42983, Swiss Prot Q8TAX7
  • MUC8 NCBI U14383, Swiss Prot Q12964
  • MUC9 NCBI U09550, Swiss Prot Q12889)
  • MUC12 Swiss Prot Q9TJKN1
  • MUC13 NCBI NM017648
  • mucins secreted gel- forming mucins (MUC2, MUC5AC, MUC5B, and MUC6) and transmembrane mucins (MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC 17).
  • secreted gel- forming mucins MUC2, MUC5AC, MUC5B, and MUC6
  • transmembrane mucins MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC 17.
  • MUC7, MUC8, MUC9, MUC13, MUC15, MUC 16 secreted gel- forming mucins
  • mucins as TAA in particular cancers is supported by alterations in expression and structure in association with pre-neoplastic and neoplastic lesions (Filipe MI: Invest Cell Pathol 1979, 2:195-216; Filipe MI, Acta Med Port 1979, 1 :351-365).
  • normal mucosa of the stomach is characterized by the expression of MUC 1, MUC5A/C, MUC6 mRNA and the encoded immunoreactive protein.
  • high levels of MUC2, MUC3 mucin mRNA and encoded immunoreactive protein are associated with intestinal metaplasia.
  • Gastric cancer exhibits markedly altered secretory mucin mRNA levels compared with adjacent normal mucosa, with decreased levels of MUC5 and MUC6 mRNA and increased levels of MUC3 and MUC4 mRNA.
  • High levels of MUC2 and MUC3 mRNA and protein are detectable in the small intestine, and MUC2 is the most abundant colonic mucin.
  • Mucins represent diagnostic markers for early detection of pancreatic cancer and other cell types. Studies have shown, that ductal adenocarcinomas (DACs) and tumor cell lines commonly overexpress MUCl mucin . See Andrianifahanana et al, Clin Cancer Res 2001, 7:4033-4040). This mucin was detected only at low levels in the most chronic pancreatitis and normal pancreas tissues but is overexpressed in all stages of pancreatic cancers. The de novo expression of MUC4 in pancreatic adenocarcinoma and cell lines has been reported (Hollingsworth et al., t J Cancer 1994, 57:198-203 ).
  • MUC4 mRNA expression has been observed in the majority of pancreatic adenocarcinoma and established pancreatic cancer cell lines but not in normal pancreas or chronic pancreatitis tissues. MUC 4 expression also has been associated with lung cancer (see Nguyen et al. 1996 Tumor Biol. 17:176-192). MUC5 is associated with metastases in non-small cell lung cancer (see Yu et al., 1996 h t. J. Cancer 69:457-465). MUC6 is overexpressed and MUC5AC is de novo expressed in gastric and invasive DACs (Kim et al., Gastroenterology 2002, 123:1052-1060). MUC7 has been reported as a marker for invasive bladder cancer (see Retz et al. 1998 Cancer Res. 58:5662-5666)
  • MUC2 secreted gel-forming mucin is generally decreased in colorectal adenocarcinoma, but preserved in mucinous carcinomas, a distinct subtype of colon cancer associated with microsatellite instability. MUC2 is increased in laryngeal cancer (Jeannon et al. 2001 Otolaryngol Head Neck Surg. 124:199-202).
  • Another secreted gel- forming mucin, MUC5AC, a product of normal gastric mucosa is absent from normal colon, but frequently present in colorectal adenomas and colon cancers.
  • MUCl also known as episialm, polymorphic epithelial mucin (PEM), mucin like cancer associated antigen (MCA), CA27.29, peanut-reactive urinary mucin (PUM), tumor- associated epithelial mucin, epithelial membrane antigen (EMA), human milk fat globule (HMFG) antigen, MUCl/REP, MUCI/SEC, MUCl/Y, CD227, is the most well known of the mucins.
  • the gene encoding MUCl maps to Iq21-q24.
  • the MUCl gene contains seven exons and produces several different alternatively spliced variants.
  • the tandem repeat domain is highly O-glycosylated and alterations in glycosylation have been shown in epithelial cancer cells.
  • MUCl/REP is cleaved into two products that form a tightly associated heterodimer complex composed of a large extracellular domain, linked noncovalently to a much smaller protein including the cytoplasmic and transmembrane domains.
  • the extracellular domain can be shed from the cell.
  • the extracellular domain (ecm) of MUCl isoform 1 represents amino acids 24 to 1158
  • the transmembrane domain represents 1159-1181
  • the cytoplasmic domain represents 1182-1255.
  • the SEA domain represents is 1034-1151 and represents a C-terminal portion of what is referced to as the extracellular domain.
  • the SEA domain of a mucin is generally a target for proteolytic cleavage, yielding two subunits, the smaller of which is associated with the cell membrane.
  • MUCl isoform 5 (alca MUCI/SEC) is a form of MUCl that is secreted by cells. It has an extracellular domain that is identical to that of isoform 1 (MUCl/REP), but lacks a transmembrane domain for anchoring the protein to a cell membrane.
  • MUCl isoform 7 (aka MUCl/Y) contains the cytoplasmic and transmembrane domains observed in isoforms 1 (MUCl/REP) and 5 (MUCI/SEC), but has an extracellular domain that is smaller than MUCl, lacking the repeat motif and its flanking region (see Baruch A. et al., 1999 Cancer Res. 59, 1552-1561).
  • Isoform 7 behaves as a receptor and binds the secreted isofonn 5. Binding induces phosphorylation of isoform 7 and alters cellular morphology and initiates cell signaling through second messenger proteins such as GRB2, (see Zrihan-Licht S. et al., 1995 FEBS Lett. 356, 130-136). It has been shown that ⁇ -catenin interacts with the cytoplasmic domain of MUCl (Yamamoto M. et al., 1997 J. Biol. Chem. 272, 12492-12494).
  • MUCl is expressed focally at low levels on normal epithelial cell surfaces. See 15. Greenlee, et al., Cancer Statistics CA Cancer J. 50, 7-33 (2000); Ren, et al., J. Biol. Chem. 277, 17616-17622 (2002); Kontani, et al., Br. J. Cancer 84, 1258-1264 (2001); Rowse, et al., Cancer Res. 58, 315 (1998). MUCl is overexpressed in carcinomas of the breast, ovary, pancreas as well as other carcinomas (see also Gendler S.J. et al, 1990 J. Biol. Chem. 265, 15286-15293).
  • MUCl mucin as detected immunologically, is increased in expression in colon cancers, which conelates with a worse prognosis and in ovarian cancers.
  • MUC-l.Tg Human MUCl transgenic mice
  • MUC 1 protein and mRNA have been found in the ER-positive MCF-7 and BT-474 cells as well as in the ER-negative MDA-MB-231 and SK-BR-3 BCC cells.
  • the mRNA Transcript level was higher in ER+ than in ER- cell lines.
  • MUCl reacts with intracellular adhesion molecule-1 (ICAM-1).
  • IAM-1 intracellular adhesion molecule-1
  • At least six tandem repeats of MUCl are needed (Regimbald et al., 1996 Cancer Res. 56,4244-4249).
  • the tandem repeat peptide of MUCl from T-47D BCC was found to be highly O-glycosylated with 4.8 glycosylated sites per repeat, which compares to 2.6 sites per repeat for the mucin from milk.
  • muc antigen refers to the full length mucin or a portion of a mucin that contains an epitope characterized in being able to elicit cellular immunity using a MUC-CD40L expression vector administered in vivo as described herein.
  • a “mucin antigen” includes one or more epitopes from the extracellular domain of a mucin such as one or more of the tandem repeat motifs associated with the VNTR, or the SEA region.
  • a mucin antigen may contain the entire extracellular domain. Also included within the meaning of "mucin antigen” are variations in the sequence including conservative amino acid changes and the like which do not alter the ability of the antigen to elicit an immune response that crossreacts with a native mucin sequence.
  • the VNTR consists of variable numbers of a tandemly repeated peptide sequences which differ in length (and composition) according to a genetic polymorphism and the nature of the mucin.
  • the VNTR may also include 5' and 3' regions which contain degenerate tandem repeats.
  • MUCl the number of repeats varies from 21 to 125 in the northern European population, the U.S. the most infrequent alleles contains 41 and 85 repeats, while more common alleles have 60-84 repeats.
  • the MUCl repeat has the general repeating peptide sequence PDTRPAPGSTAPPAHGVTSA (SEQ JD NO: 3).
  • a mucin antigen as this term is used herein also may encompass tandem repeats from different types of mucins.
  • an expression vector may encode tandem repeats from two different mucins, e.g., MUCl and MUC2.
  • Such a vector also may encode multiple forms of the SEA domain as well or a combination of tandem repeats and one or more SEA domains.
  • a secretable form of an antigen is one that lacks all or substantially all of its transmembrane domain, if present in the mature protein.
  • the transmembrane domain if present, is generally about 24 amino acids in length and functions to anchor the mucin or a fragment of the mucin in the cell membrane.
  • a secretable form of MUCl in which all of the transmembrane domain has been deleted is MUCl missing residues 1159-1181.
  • a mucin that lacks substantially all of the transmembrane domain rendering the mucin secretable is one that contains no more than six residues of sequence on one end of the domain.
  • the extracellular domain of a human mucin such as MUCl is denoted herein as "ecdhMUCl.”
  • a source of DNA encoding the various mucins, and mucin antigens may be obtained from mucin expressing cell lines using a commercial cDNA synthesis kit and amplification using a suitable pair of PCR primers that can be designed from the published mucin DNA sequences.
  • MUCl or MUC2 encoding nucleic acid may be obtained from CRL-1500 cells, available from the American Type Culture Collection.
  • Mucin encoding DNA also may be obtained by amplification from RNA or cDNA obtained or prepared from human or other animal tissues. For DNA segments that are not that large, the DNA may be synthesized using an automated oligonucleotide synthesizer.
  • linker refers to one or more amino acid residues between the carboxy terminal end of the antigen and the amino terminal end of CD40 ligand.
  • the composition and length of the linker may be determined in accordance with methods well known in the art and may be tested for efficacy. See e.g. Arai et al., design of the linkers which effectively separate domains of a bifunctional fusion protein. Protein Engineering, Vol. 14, No. 8, 529-532, August 2001.
  • the linker is generally from about 3 to about 15 amino acids long, more preferably about 5 to about 10 amino acids long, however, longer or shorter linkers may be used or the linker may be dispensed with entirely. Longer linkers may be up to about 50 amino acids, or up to about 100 amino acids. A short linker of less than 10 residues is preferred when the mucin antigen is N-terminal to the CD40 ligand.
  • CD40L full length CD40L is designated herein as "CD40L,” “wtCD40L” or “wtTmCD40L.”
  • the form of CD40L in which the cytoplasmic domain has been deleted is designated herein as “ ⁇ CtCD40L.”
  • the form of CD40L where the transmembrane domain has been deleted is designated herein as “ ⁇ TmCD4OL.”
  • the form of CD40L where both the cytoplasmic and transmembrane domains have been deleted is designated herein as " ⁇ Ct ⁇ TmCD40L.”
  • the nucleotide and amino acid sequence of CD40L from mouse and human is well known in the art and can be found, for example, in U.S. Patent No. 5,962,406 (Armitage et al).
  • Also included within the meaning of CD40 ligand are variations in the sequence including conservative amino acid changes arid the like which do not alter the ability of the ligand to elicit an immune response to a mucin in conjunction the fusion
  • Human CD40L (hCD40L) is 261 amino acids in length.
  • the cytoplasmic domain of hCD40L extends approximately from position 1-22, the transmembrane domain extends approximately from position 23-46, while the extracellular domain extends approximately from position 47-261.
  • CD40 ligand is missing all or substantially all of the transmembrane domain rendering CD40 ligand secretable
  • the transmembrane domain of CD40L which contains about 24 amino acids in length, functions to anchor CD40 ligand in the cell membrane.
  • CD40L from which all of the transmembrane domain has been deleted is CD40 ligand lacking residues 23-46.
  • CD40 ligand missing substantially all of the transmembrane is one that retains 6 residues or less of sequence at one end of the transmembrane domain, more preferably less than about 4 residues of sequence at one end of the transmembrane domain, even more preferably less than about 2 residues of sequence on one end of the transmembrane domain, and most preferably 1 residue or less on one end of the transmembrane domain.
  • a CD40L that lacks substantially all of the transmembrane domain rendering the CD40L secretable is one that retains no more than six residues of sequence on one end of the domain.
  • CD40L would contain, in addition to the extracellular domain and optionally the cytoplasmic domain, and no more than amino acids 41-46 or 23-28 located in the transmembrane domain of CD40L.
  • the vaccine vector transcription unit encodes a secretable form of CD40 containing less than 10% of the transmembrane domain. More preferably, CD40L contains no transmembrane domain.
  • a CD40L which lacks a functional transmembrane domain may still include all or a portion of the cytoplasmic domain.
  • a CD40L which lacks a functional transmembrane domain may include all or a substantial portion of the extracellular domain.
  • Suitable diluents are normal isotonic saline solution, standard 5% dextrose in water, or buffered sodium or ammonium acetate solution.
  • Such formulations are especially suitable for parenteral administration, but may also be used for oral administration or contained in a metered dose inhaler or nebulizer for insufflation. It may be desirable to add excipients such as polyvinylpyrrolidone, gelatin, hydroxy cellulose, acacia, polyethylene glycol, mannitol, sodium chloride, sodium citrate, and the like.
  • the amount of solid carrier varies but, preferably, will be between about 20 mg to about 1 g per dosage unit.
  • the preparation maybe in the form of a syrup, elixir, emulsion, or an aqueous or non-aqueous suspension.
  • an effective amount refers to a dose sufficient to provide concentrations high enough to generate (or contribute to the generation of) an immune response in the recipient thereof.
  • the specific effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated, the severity of the disorder, the activity of the specific compound, the route of administration, the rate of clearance of the viral vectors, the duration of treatment, the drugs used in combination or coincident with the viral vectors, the age, body weight, sex, diet, and general health of the subject, and like factors well known in the medical arts and sciences.
  • the range of particles per administration typically if from about 1 X 10 7 to 1 X 10 11 , more preferably 1 X 10 8 to 5 X 10 10 , and even more preferably 5 X 10 8 to 2 X 10 10 .
  • ecdhMUCl - ⁇ Ct ⁇ TmCD40L produced from an adenoviral vector dramatically enhanced the potency of the cellular immune response to MUCl expressing tumor cells.
  • subcutaneous injection of the Ad-K-ecdhMUCl- ⁇ Ct ⁇ TmCD40L vector elicited strong MUCl specific CD8 + T cell-mediated immunity, which prevents the engraftment of cancer cells which express the MUCl tumor associated antigen.
  • the immunity generated against the antigens using the invention methods is long lasting.
  • the term long lasting means that immunity elicited by the antigen encoded by the vector can be demonstrated for up to 6 months from the last administration, more preferably for up to 8 months, more preferably for up to one year, more preferably up to 1.5 years, and more preferably for at least two years.
  • immunity to a mucin TAA can be generated by producing a fusion protein that comprises the extracellular domain of MUCl fused the amino-terminal end of the CD40 ligand from which the transmembrane and cytoplasmic domains were deleted. Construction of such vector is disclosed in the Examples. As was observed herein, subcutaneous administration of this adenoviral vector mucin vaccine induced a very robust and long lasting CD8 + cytotoxic T cell lymphocyte dependent systemic immune response against cancer cells which carry the MUCl antigen. The mucin vaccine induced the production of memory cells, which underlie the long lasting immunity.
  • mice with the adenoviral vector Ad-sig- ecdhMUCl/ecdmCD40L induced an immune response which suppressed the growth of human MUCl (hMUCl) antigen positive tumor cells in 100% of mice transgenic for hMUCl (i.e. these mice are anergic to the hMUCl antigen prior to the vector injection.
  • hMUCl human MUCl
  • the immune response to the Ad- sig- ecdhMUCl/ecdmCD40L vector lasted up to a year and was shown to be antigen specific.
  • the cells infected in the vicinity of the site of subcutaneous injection of the vector release the tumor antigen/CD40 ligand secretory which is taken up by antigen presenting cells (e.g. DCs) in the vicinity of the infected cells.
  • the internalized tumor antigen would be digested in the proteosome with the resultant tumor antigen peptides trafficking to the endoplasmic reticulum where they would bind to Class I MHC molecules.
  • the DCs would present the tumor antigen on the surface in the Class I MHC molecule.
  • tumor antigen-loaded antigen presenting cells would migrate to lymphocyte bearing secondary organs such as the regional lymph nodes or the spleen.
  • CD8 cytotoxic T cell lymphocytes competent to recognize and kill cells, which carried the tumor associated antigens, would be expanded in the lymph nodes and spleen by the presence of the activated and antigen loaded dendritic cells.
  • the continuous nature of the stimulation and the expansion of the tumor antigen specific cytotoxic T cells by the continuous release from the vector infected cells is believed to generate an immune response which would be greater in magnitude than is possible using a vector which carried a tumor antigen/CD40 ligand which is non-secretory.
  • the methods of the present invention can be used to generate immunity to an antigen which is a self-antigen in an individual.
  • a vector that encodes a mucin antigen from MUCl can be used to generate CD8 + immunity in a human where the MUCl mucin antigen is a self antigen.
  • the invention methods also can be used to overcome a state of immunological anergy to an antigen which is a self-antigen.
  • adenoviral expression vectors [0089]
  • the transcription unit, sig-ecdhMUC 1 - ⁇ Ct ⁇ TmCD40L of the adenoviral vector encodes a signal sequence (from an Ig kappa chain) followed by the extracellular domain of human MUCl which is connected via a linker to a fragment of the CD40 ligand (human or mouse) which contains the extracellular domain without the transmembrane or cytoplasmic domains.
  • the fusion protein was engineered to be secreted from vector infected cells by the addition of the kappa chain signal sequence to the amino-terminal end of the fusion protein.
  • the amino acid sequence of human MUC-1 and the encoding nucleotide sequence are shown in FIGs. 2 and 1, respectively.
  • the encoded MUCl protein represents 1255 amino acids encoded by nucleotides 74 to 3,841 of SEQ JD NO: 1.
  • the first 23 amino acids represent the MUCl signal sequence which is removed from the mature mucin.
  • the extracellular domain represents about 1135 amino acids from positions 24 to 1158 (encoded by nucleotides 143 to 3547).
  • the tandem repeat region represents approximately 900 amino acids.
  • Amino acids 74 to 126 (encoded by 229 to 451 of SEQ JD NO:l) represents a 5' degenerate tandem repeat region
  • amino acids 127 to 945 represents the tandem repeat region (encoded by 452 to 2,908 of SEQ JD NO: 1) while amino acids 946 to 962 represent a 3' degenerate tandem repeat region (encoded by 2809 to 2959 of SEQ JD NO:l).
  • the SEA domain represents amino acids 1034 to 1151
  • the transmembrane domain represents 1159 to 1181
  • the cytoplasmic domain represents 1182 to 1255 (see SEQ JD NO:2).
  • the transcription unit was introduced into the El gene region of the adenoviral vector backbone. After the adenoviral vector particles were generated in HEK 293 cells, the vector DNA was purified by cesium chloride gradient centrifugation. The presence of the signal peptide in the adenoviral vector was confirmed by restriction enzyme analysis and by DNA sequencing.
  • a transcription unit that included DNA encoding the signal sequence of the mouse IgG kappa chain gene upstream of DNA encoding human MUC-1 (“sig-ecdhMUC-1”) was generated by PCR using plasmid pcDNA3-hMUC-l (gift of Finn O.J., University of Pittsburgh School of Medicine) and the following primers: DNA encoding the mouse IgG kappa chain METDTLLLWVLLLWVPGSTGD (single letter amino acid code) (SEQ JD NO: 11) was prepared by PCR amplification (SEQ JD NOs: 12 ,13 and 14) to generate the full 21 amino acid mouse IgG kappa chain signal sequence (the start codon "ATG" is shown bolded in SEQ JD NO: 12).
  • the sig-ecdhMUC-1 encoding DNA was cloned into the pcDNATM 3.1 TOPO vector (Invitrogen, San Diego, CA) forming pcDNA-sig-ecdl MUC-1.
  • pShuttle - ⁇ Ct ⁇ TmCD40L (no signal sequence and murine CD40L) was prepared as follows: Plasmid pDC406-mCD40L was purchased from the American Type Culture
  • a pair of PCR primers (SEQ JD NOs: 17 and 18) was designed to amplify the mouse CD40 ligand from position 52 to 260 (i.e., without the cytoplasmic and transmembrane domains) and include sequence encoding a linker (indicated as "+ spacer ”) at the 5' end of the amplicon.
  • Mouse ⁇ Ct ⁇ TmCD40L+ spacer forward primer (MCD40LSPF) (CD40L sequence italicized; cloning site underlined and bolded): 5'- CCGCTCGAGAACGACGCACAAGCACCAAAATCAAAGGTCGAAG
  • the forward primer MCD40LSPF encodes a 10 residue spacer (LENDAQAPKS; single letter code; SEQ ID NO: 19) to be located between the mucin and the CD40 ligand (mCD40L) of the transcription unit.
  • PCR performed using the forward and reverse primers (SEQ JD NOs 17 and 18) and plasmid pDC406-mCD40L as the template resulted in PCR fragment "space4- ⁇ Ct ⁇ TMCD40L", which was inserted into the plasmid pcDNA-sig- ecdhMUCl after restriction endonuclease digestion with Xbal (TCTAGA) and Xho I (CTCGAG).
  • This vector is designated pcDNA-sig- ecdhMUCl / ⁇ Ct ⁇ TmCD40L.
  • a vector was produced that was otherwise the same except that it encoded full length CD40L rather than the truncated form. This vector was made using a CD40 forward primer that annealed to the starting codons of murine CD40L. This vector is designated pShuttleCD40L (no signal sequence).
  • the transcription unit sig- ecdhMUCl- ⁇ Ct ⁇ TmCD40L encodes the mouse IgG kappa chain secretory signal followed by the extracellular domain of human MUCl followed by a 10 amino acid linker with (NDAQAPK; SEQ JD NO: 19) followed by murine CD40 ligand residues 52-260.
  • the mouse HSF1 trimer domain was added between the ecdhMUCl encoding DNA and ⁇ Ct ⁇ Tm CD40L by PCR using plasmid pcDNA-sig- ecdhMUCl/ ⁇ Ct ⁇ TmCD40L and the following primers:
  • HSF1 / ⁇ Ct ⁇ Tm CD40L with the trimer domain sequence was generated by four rounds of PCR amplification (1 st round: primers SEQ TD NOs 23 and 18; 2 nd round: primer
  • MUCl and mCD40L is as follows:
  • a His tag encoding sequence was added to the end of the ⁇ Ct ⁇ Tm CD40L and was generated by PCR using Plasmid pDC406-mCD40L (purchased from the American Type Culture Collection) and the following primers:
  • GAG -3' (SEQ ID NO: 29) (poly His region encoded by nucleotides in the box)
  • Vector / ⁇ Ct ⁇ Tm CD40L/His with the His tag sequence was generated by 2 rounds of PCR amplification (1 st round: primers 1 +2; 2 nd round: primer 1+3).
  • the / ⁇ Ct ⁇ TmCD40L/His encoding DNA was cloned into pcDNA-sig-ecdhMUC-1 restriction sites Xbal (TCTAGA) and Xho I (CTCGAG).
  • the recombinant adenoviral vectors were generated using the AdEasy vector system (Stratagene, San Diego, CA). Briefly the resulting plasmid pShuttle-sig- ecdhMUCl- ⁇ Ct ⁇ TmCD40L, and other control adenoviral vectors were linearized with Pme I and co- transformed into E. coli strain B J5183 together with p AdEasy- 1 , the viral DNA plasmid. Recombinants were selected with kanamycin and screened by restriction enzyme analysis.
  • the recombinant adenoviral construct was then cleaved with Pac I to expose its Inverted Terminal Repeats (ITR) and transfected into 293A cells to produce viral particles.
  • ITR Inverted Terminal Repeats
  • the titer of recombinant adenovirus was determined by the Tissue culture Infectious Dose (TCTD 50 ) method.
  • HCD40LSPF Human ⁇ Ct ⁇ TmCD40L+ spacer forward primer
  • HCD40LR Human CD40L reverse primer
  • These primers will amplify a ⁇ Ct ⁇ TmCD40L+spacer which encodes 47-261 of human CD40L.
  • the forward primer HCD40LSPF encodes a 10 residue spacer (LENDAQAPKS; single letter code; SEQ JD NO: 19) to be located between the tumor antigen and the CD40 ligand (hCD40L) of the transcription unit.
  • Modification of pShuttle sig-ecdhMUCl/ ⁇ Ct ⁇ TmCD40L(human) to include the ecdhMUCl upstream of the human CD40 ligand sequence was accomplished essentially as described above for the murine CD40 ligand encoding vectors.
  • the transcription unit sig- ecdhMUCl- ⁇ Ct ⁇ TmCD40L(human) encodes the kappa secretory signal followed by the extracellular domain of human MUCl followed by a 10 amino acid linker (NDAQAPK; SEQ ID NO: 19) followed by human CD40 ligand residues 47-261.
  • DNA encoding the human growth hormone signal sequence MATGSRTSLLLAFGLLCLPWLQEGSA (single letter amino acid code) (SEQ JD NO: 32) could be used in place of the kappa chain signal sequence.
  • Bone marrow derived DCs was harvested from hMUC-.Tg transgenic mice at 48 hours after exposure to the adenoviral vectors. The cells were exposed to vector at MOI 100, and plated in 24-well plates at 2 x 10 5 cells/ml. After incubation for 24 hours at 37°C, supernatant fluid (1ml) was harvested and centrifuged to remove debris. The level of murine IL-12 or IFN- gamma released into the culture medium was assessed by enzyme-linked immunoadsorbent assay (ELISA) using the mouse IL-12 p70 or IFN-gamma R & D Systems kits.
  • ELISA enzyme-linked immunoadsorbent assay
  • Bone marrow derived DCs contacted with the Ad-sig-ecdmMUCl- ⁇ Ct ⁇ TCD40L (murine) vector showed significantly increased the levels of interferon gamma and IL-12 cytokines from DCs harvested from the hMUC-.Tg transgenic mice at 48 hours after exposure to the vector.
  • virtually no cytokines were detected from restimulated DCs from animals immunized with an adenoviral vector that encoded the extracellular domain of hMUCl but without fusion to a secretable form of CD40L.
  • hMUC- 1.Tg mice inj ected subcutaneously with the Ad-sig-ecdhMUC 1 - ⁇ Ct ⁇ TmCD40L (murine) vector were resistant to engraftment by the hMUCl positive LL2/LLlhMUCl mouse cancer cells. Control animals not injected with vector were not resistant to the growth of the same cells. Also, hMUC-1.Tg mice injected with the Ad-sig- ecdhMUC l/ecdCD40L (murine) vector were not resistant to engraftment by parental cell line (LL2/LL1), which does not express MUCl.
  • hMUC-l.Tg mice injected intravenously with ecdhMUCl- ⁇ Ct ⁇ TmCD40L (murine) protein were not resistant to engraftment by the hMUCl positive LL2/LLlhMUCl mouse cancer cells.
  • Furthennore, hMUC-1.Tg mice injected with Ad-sig-ecdhMUC 1- ⁇ Ct ⁇ TmCD40L (murine) vector lived longer than did control vector injected mice subsequently administered the LL2/LLlhMUCl cell line.
  • a population of splenic CD8 T lymphocytes was obtained seven days following Ad-sig-ecdl MUCl- ⁇ Ct ⁇ TmCD40L (murine) vector administration was obtained by depleting CD4 + T lymphocytes using CD4 + antibody coated magnetic beads. The isolated CD8 + T lymphocytes released over 2,000 times the level of interferon gamma as did CD8 + T cells from MUC-1. Tg mice administered a control vector (without MUCl). b) Cytotoxicity Assay
  • Splenic T cells collected from hMUC-1.Tg mice 7 days following administration of Ad-sig-ecdhMUC l- ⁇ Ct ⁇ TmCD40L (murine) vector were cultured with hMUCl antigen positive LL2/LLlhMUCl cancer cells in vitro for 7 days.
  • the stimulated splenic T cells were mixed in varying ratios with either the hMUCl positive LL2/LLlhMUCl cells or the hMUCl negative LL2/LL1 cancer cells.
  • the results showed that T cells from Ad-sig- ecdhMUC l- ⁇ Ct ⁇ TmCD40L (murine) vector vaccinated mice were cytotoxic only for the cane er cells expressing hMUC 1.
  • Splenic CD8 + T cells obtained from hMUC-l.Tg transgenic mice 7 days following no vector injection or subcutaneous injection with the Ad- sig-ecdhMUCl- ⁇ Ct ⁇ TmCD40L (murine) vector, were mixed in a 1/1 ratio with the Ad- sig-ecdhMUCl/ecdCD40L (murine) vector-infected DCs.
  • the ERK1/EK2 proteins were phosphorylated in the CD8+ T cells isolated from Ad- sig-ecdhMUCl- ⁇ Ct ⁇ TmCD40L vector injected hMUC-l.Tg transgenic mice following 45 minutes of in vitro exposure to Ad- sig-ecdhMUCl- ⁇ Ct ⁇ TmCD40L (murine) vector infected DCs.
  • Ad- sig-ecdhMUCl- ⁇ Ct ⁇ TmCD40L (murine) vector infected DCs In contrast no increase in phosphorylation of ERK1 and ERK2 proteins was seen in CD8 positive T cells from unvaccinated hMUC-l.Tg mice.
  • the tumor antigen fusion protein was produced directly from an adenoviral vector that carries the expression cassette of the fusion gene encoding the fusion protein.
  • the production cells e.g. 293 cell line
  • the infected cells were further cultured for 48-72 hours, when the viral vectors propagated in the cells and the tumor antigen fusion proteins were expressed in the cells and secreted into culture media.
  • the infected cells were collected when 70-90% of them showed cytopathic effect (CPE).
  • CPE cytopathic effect
  • the cell culture media was collected separately.
  • Cell lysates were prepared through 3-time freeze-and-thaw cycles.
  • the viral particles were isolated via the standard procedure (19).
  • the tumor antigen fusion proteins were purified through affinity chromatograph from the collected cell media
  • hMUC- 1 Tg animals were primed by subcutaneous administration of Ad- K/ecdhMUCl- ⁇ Ct ⁇ TmCD40L vector as described.
  • the protein boost constituted 10 micrograrns of ecdhMUC-l/ecdCD40L fusion protein injected subcutaneously.
  • the time of protein boosting and comparison with vector was evaluated in various treatment groups shown in table 2.
  • Spleen cells from the different groups were isolated and evaluated by the ELISPOT assay for interferon gamma positivity. As seen in FIG 3. two subcutaneous protein injections at a 14 day interval beginning one week after the initial vector injection showed the greatest elevation of the frequency of positive T cells as compared to no treatment or compared with one or two vector injections without protein boost. The next highest elevation of the frequency of interferon gamma positive T cells was with the T3 group (one protein injection 7 days following the initial vector injection).
  • Cytotoxic T cells development in the various immunization groups was also evaluated (FIG. 4). Spleen cells from the various treatment groups were stimulated in vitro for 5 days with a hMUC-1 positive cell line (LLl/LL2hMUC-l ). CD8 T cells were isolated and mixed with the target cells (LLl/LL2hMUC-l) in a 50/1 ratio. Cytotoxic activity generally followed the ELISPOT assay results, with the T5 group showing the greatest increase levels of LLl/LL2hMUC-l specific cytotoxic T cell activity. The level of cytotoxicity seen with T cells from the T5 group was nine fold that seen with the negative control group.
  • FIG. 5 shows a dramatic increase in the level of antibodies to the ecdhMUCl - ⁇ Ct ⁇ TmCD40L fusion protein generated by the treatment with one vector injection and two protein injections spaced at a 14 day interval.
  • the increase in the anti-ecdhMUCl- ⁇ Ct ⁇ TmCD40L antibodies following the T5 treatment was 2 fold greater than with any of the other treatment group.
  • Antibodies in serum from vaccinated hMUC-1.Tg mice were evaluated for binding to cancer biopsy tissue specimens. Tissue microarrays containing normal breast and breast cancer tissue sections were obtained commercially. Tissue was contacted with serum from transgenic mice immunized with Ad-K/ecdhMUC-1 // ⁇ Ct ⁇ Tm CD40L vector and boosted later with ecdhMUC-l// ⁇ Ct ⁇ Tm CD40L protein. The arrays were washed and then exposed to a horseradish peroxidase (HRP) secondary antibody which recognizes mouse IgG antibody. As a control, the serum was exposed first to a hMUC-1 peptide from the antigenic repeat of the hMUC-1 domain (same as used for the protein boost).
  • HRP horseradish peroxidase
  • mice Serum from the vaccinated mice bound to the breast epithelial cells from biopsy specimens of cancerous epithelial cells. No binding to the intervening fibroblast or stromal cells were observed. Serum from normal mice showed no reaction.
  • hMUC-1.Tg animals were primed by subcutaneous administration of Ad-K/ecdhMUCl- ⁇ Ct ⁇ TmCD40L vector as described or were immunized with one or two administrations of the ecdhMUCl - ⁇ Ct ⁇ TmCD40L fusion protein. Animals were then challenged with LL2/LLlhMUC-l tumor cells.
  • FIG. 6 shows that mice vaccinated with the Ad-K/ecdhMUC 1 - ⁇ Ct ⁇ TmCD40L vector survived longer than 120 days (solid bold line), whereas all mice not vaccinated with the Ad-sig-ecdhMUC- l/ecdCD40L vector died by 50 days (broken line).
  • the specificity of tumor growth suppression for the hMUC-1 antigen was evaluated by comparing rejection of the LL2/LLlhMUC-l cell line (which is positive for the hMUC-1 antigen) with the LL2/LL1 cell line, which is otherwise identical except for the absence of the hMUC-1 antigen.
  • the results showed subcutaneous injection of the adenoviral vector completely suppressed the growth of the LL2/LL1 hMUC-1 cell line but did not the same cells which do not express MUC-1.
  • Tumor growth suppression was evaluated using combinations of vector and protein administration. Three combinations of Ad-sig-ecdhMUC-l/ecdCD40L vector and ecdhMUC-l/ecdCD40L protein were administered to hMUC-l.Tg mice before challenge with LL2/LLlhMUC-l tumor cells.
  • mice were challenged one week later with a subcutaneous injection of five hundred thousand LL2/LL1 hMUC-1 lung cancer cells, and two weeks later with an intravenous injection of 500,000 LL2/LLlhMUC-l tumor cells.
  • the size of the subcutaneous tumor nodules at day were measured by caliper at multiple time points to determine the effect of the various vaccine schedules on the growth of the LL2/LLlhMUC-l cells as subcutaneous nodules.
  • the metasteses were measured by total lung weight following sacrifice.
  • FIG. 7 shows that three injections of the fusion protein (PPP) without a preceding Ad-sig-ecdhMUC- l/ecdCD40L vector injection failed to induce complete resistance to the development of the subcutaneous LL2/LLlhMUC-l tumor.
  • the schedule of three successive vector injections (VW) or one vector injection followed by two protein injections (VPP) completely suppressed the appearance of the subcutaneous LL2/LLlhMUC-l tumor.
  • a tumor treatment (post establishment) protocol was also evaluated, hi this schedule, subcutaneous tumor (500,000 of the LL2/LLlhMUC-l) was administered on day 1.
  • the three schedules (PPP, VPP and VVV) were accomplished on days 5, 12 and 26. Tumor was administered i.v. on day 35 and tumor development (subcutaneous and lung) evaluated at day 49. Further details are found in the legend to FIG. 9.
  • VPP protein injections
  • FIG. 10 The growth of metastatic lung nodules in the pretreatment and post-treatment (pre- establisl ment) cancer models is shown in FIG. 10.
  • the pretreatment results in FIG. 10, left hand panel show that three successive fusion protein injections (PPP) did not appear to suppress lung nodule growth.
  • schedule VVV and schedule VPP appeared to completely suppress the engraftment of the lung cancer in the lungs of the vaccinated animals.
  • VPP schedule involving a single injection of Ad-sig-ecdhMUC- l/ecdCD40L vector followed in one week by two successive subcutaneous injections, spaced two weeks apart, of the ecdhMUC-l/ecdCD40L protein.
  • This protocol is characterized by induction of antibody (humoral immunity) and T cell immunity (cellular immunity) to the mucin antigen.
  • mice were boosted with a bacterial extract containing ecdMUC-1 /ecdCD40 (from a bacterial host strain infected with Ad-sig-ecdMUC- l/ecdCD40L vector); ecdMUC-1 linked to the keyhole limpet hemocyaninin (KLH), with or without incomplete Freund's adjuvant; PBS; and control bacterial extract (from a bacterial host strain not infected with Ad-sig-ecdMUC-l/ecdCD40L vector).
  • KLH keyhole limpet hemocyaninin
  • PBS incomplete Freund's adjuvant
  • control bacterial extract from a bacterial host strain not infected with Ad-sig-ecdMUC-l/ecdCD40L vector.
  • the tumor cells were given 7 days following the completion of the 2nd protein boost.
  • the results shown in FIG. 12 indicate that boosting with ecdMUC-1 /ecdCD40L soluble protein was superior to all other
  • the transcription unit included DNA encoding the signal peptide from the HGH gene upstream of DNA encoding the full length HPV type 16 E7 protein upstream of ⁇ Ct ⁇ TmCD40L.
  • DNA encoding the human growth hormone signal sequence MATGSRTSLLLAFGLLCLPWLQEGSA (single letter amino acid code) (SEQ ID NO: 32) was prepared by annealing phosphorylated oligonucleotides (SEQ JD NOs:33 and 34) to generate the full 26 amino acid HGH sequence with Bgl II and Notl overhangs.
  • Synthetic HGH signal sequence was prepared by annealing the above upper and lower strand oligos.
  • the oligos were dissolved in 50 ⁇ l H 2 O (about 3 mg/ml). 1 ⁇ l from each oligo (upper and lower strand) was added to 48 ⁇ l annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM Mg-acetate) incubated at 4 minutes at 95°C,
  • T4 PNK polynucleotide kinase
  • HGH signal sequence with Bgl II and Not I overhangs was inserted via Bgl II and Not I into pShuttle-E7- ⁇ Ct ⁇ TmCD40L(no signal sequence) to yield ⁇ shuttle-HGH/E7- ⁇ Ct ⁇ TmCD40L.
  • pShuttle-E7- ⁇ Ct ⁇ TmCD40L (no signal sequence) was prepared by inserting HPV-16 E7 upstream of the CD40 ligand sequence as follows: Sequence encoding the full HPV-16 E7 protein was obtained by PCR amplifying from the HPV viral genome using the following primers:
  • HPV 16 E 7 forward primer SEQ JD NO: 35
  • HPV E7 reverse primer SEQ JD NO: 36
  • the resulting amplicon was HPV 16 E 7 encoding DNA with 5' end Not I and 3' end Xho 1 restriction sites.
  • the E7 DNA was inserted into the pShuttle ⁇ Ct ⁇ TmCD40L between the
  • the plasmid is designated pShuttle-E7-
  • the transcription unit HGH/E7- ⁇ Ct ⁇ TmCD40L encodes the HGH secretory signal followed by the full length HPV type 16 E7 followed by a 10 amino acid linker with (FENDAQAPKS; SEQ JD NO: 37) followed by murine CD40 ligand residues 52-260.
  • a transcription unit that included DNA encoding the signal sequence of the mouse IgG kappa chain gene upstream of DNA encoding the full length HPV type 16 E7 protein (“K/E7”) was generated by PCR using HPV16 plasmid and the following primers:
  • K/E7 with the upstream kappa signal sequence was generated by four rounds of PCR amplification (1 st round: primers 4 +5; 2 nd round: add primer 3; 3 rd round: add primer 2; 4 th round: add primer 1).
  • the K/E7 encoding DNA was cloned into the pcDNATM 3.1 TOPO vector (Invitrogen, San Diego, CA) forming pcDNA-K/E7.
  • a DNA fragment that contained the mouse CD40 ligand from which the transmembrane and cytoplasmic domain had been deleted was generated from a mouse CD40 ligand cDNA Plasmid (pDC406-mCD40L; ATCC) using the following PCR primers:
  • JD NO: 44 high fidelity PCR kit, Roche.
  • Fragment ⁇ Ct ⁇ TmCD40L was digested with Xba I and Xhol restriction endonucleases and then ligated into pcDNA-E7.
  • K/E7- ⁇ Ct ⁇ TmCD40L fragment was cut from the pcDNA vector and inserted into the pShuttle plasmid using Hind III and Xba I sites (pShuttle K E7-
  • the K/E7- ⁇ Ct ⁇ TmCD40L fragment includes the kappa chain secretory signal followed by the full length HPV type 16 E7 followed by a 10 amino acid linker (LQNDAQAPKS; SEQ ID NO: 31) followed by murine CD40 ligand residues 52-260.
  • LQNDAQAPKS 10 amino acid linker
  • a vector encoding E7 fused to human CD40 ligand lacking a transmembrane domain is prepared by inserting "space+ ⁇ Ct ⁇ TmCD40L(human)" (prepared as described above) into the plasmid pShuttle-CMV (13) after restriction endonuclease digestion with Hind ⁇ i (AAGCTT) and Xho I (CTCGAG).
  • This vector is designated pShuttle ⁇ Ct ⁇ TmCD40L(human).
  • Modification of pShuttle ⁇ Ct ⁇ TmCD40L(human) to include the HPV-16 E7 upstream of the human CD40 ligand sequence was accomplished essentially as described above for the murine CD40 ligand encoding vectors.
  • the resulting plasmid is designated pShuttle-E7- ⁇ Ct ⁇ TmCD40L(human)(no signal sequence) and is used for insertion of the HGH signal sequence upstream of E7 to generate HGH/E7- ⁇ Ct ⁇ TmCD40L(human).
  • the transcription unit HGH/E7- ⁇ Ct ⁇ TmCD40L(human) encodes the HGH secretory signal followed by the full length HPV type 16 E7 followed by a 10 amino acid linker (FENDAQAPKS; SEQ JD NO: 19) followed by human CD40 ligand residues 47-261.
  • H2N Her-2-Neu
  • the mouse is made transgenic for a normal unactivated rat Her-2-Neu gene under the control of a mammary specific transcriptional promoter such as the MMTV promoter.
  • the MMTV promoter produces overexpression of a non-mutant rat Her-2-Neu receptor, which is analogous to what occurs in human breast cancer.
  • This model produces palpable tumor nodules in the primary tissue (the breast) at 24 weeks as well as pulmonary metastases at 32 weeks.
  • the development of breast cancer occurs spontaneously.
  • the cancer begins focally as a clonal event in the breast epithelial tissue through a step-wise process (Id.).
  • Dysplasia can be detected by 12 weeks of birth.
  • Palpable tumors in the mammary glands can be detected at 25 weeks, and metastatic breast cancer in the lung can be demonstrated in 70% of mice by 32 weeks (Id.).
  • Ad-sig-rH2N/ecdCD40L vector was subcutaneously administered to transgenic animals one or two times at 7 day intervals to test if an immune response could be induced against the rat Her-2-Neu antigen.
  • Two subcutaneous injections of the Ad-sig- rH2N/ecdCD40L vector induced complete resistance to the growth of the N202 (rH2N positive) mouse breast cancer cell line, whereas one subcutaneous injection of the same vector did not induce sufficient immune response to completely suppress the growth of the rH2N positive N202 cell line.
  • ELISPOT assays showed that the administration of two subcutaneous injections of the Ad-sig-rH2N/ecdCD40L vector 7 days apart induced levels of rH2N specific T cells in the spleens of vaccinated mice which were 10 times higher than the levels of rH2N specific T cells induced in mice following one injection of the Ad-sig- rH2N/ecdCD40L vector. Finally, the immune resistance induced against the NT2 cells by the Ad-sig-rH2N/ecdCD40L vector prime vaccination was better than the response obtained in transgenic animals vaccinated with irradiated cytokine positive tumor cells (mitomycin treated NTW cells which had been transfected with a GMCSF transcription unit).
  • the rH2N specific antibody levels were also measured in mice vaccinated with one or two subcutaneous injections of the Ad-sig-rH2N/ecdCD40L vector. As shown below in Figure 11, the levels of the rH2N specific antibody levels were higher following two subcutaneous injections than following a single subcutaneous injection of the Ad-sig- rH2N/ecdCD40L vector.
  • An adenoviral vector encoding sig ecdhuHER2/CD40L was prepared as follows.
  • the mouse IgG kappa chain METDTLLLWVLLLWVPGSTGD (single letter amino acid code) (SEQ JD NO: 11) was prepared by PCR amplification (SEQ JD NOs: 12, 13 and 45) to generate the full 21 amino acid mouse IgG kappa chain signal sequence (the start codon "ATG" is shown bolded in SEQ JD NO:12).
  • sig-ecdhHER2 with the upstream kappa signal sequence is generated by four rounds of PCR amplification (1 st round: primers SEQ JD NOs 46 and 47; 2 nd round: primer SEQ JD NOs 45 and 47; 3 rd round: primer SEQ JD NOs 13 and 47; 4 th round: primer SEQ JD NOs 12 and 47).
  • the sig-ecdhHER2 encoding DNA can be cloned into the pcDNATM 3.1 TOPO vector (hivitrogen, San Diego, CA) forming pcDNA-sig-ecdhHER2.
  • the additional cloning steps described for the MUC-1/CD40 Ligand expression vector are also applicable for the HER2/CD40 ligand expression vector.
  • This region HER2 extracellular domain to be fused to CD40 ligand contains two CTL epitopes; One is an HLA-A2 peptide, K I F G S L A F L (SEQ ID NO:48) representing amino acids 369-377. This peptide elicited short-lived peptide-specific immunity in HER2 expressing cancer patients. See Knutson et al., Immunization of cancer patients with a HER-2/neu, HLA-A2 peptide, Clin Cancer Res. 2002 May;8(5):1014-8p369- 377.
  • the second epitope is E L T Y L P T N A S (SEQ JD NO: 49) (HER2 residues 63- 71) also was useful in generating immunity to HER2 expressing tumor cells. See Wang et al. Essential roles of tumor-derived helper T cell epitopes for an effective peptide-based tumor vaccine, Cancer Immuii. 2003 Nov 21;3:16.
  • the region of the HER2 ecd also includes a B cell epitope P L H N Q E V T A E D G T Q R C E K C S K P C (SEQ JD NO: 50) (HER2 positions 316-339).
  • SEQ JD NO: 50 HER2 positions 316-339.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des procédés pour générer une réponse immunitaire à un antigène. Ces procédés consistent à mettre en condition un individu en administrant un vecteur d'expression qui code l'antigène. Ce vecteur comprend une unité de transcription qui code une protéine de fusion pouvant être sécrétée, qui contient un antigène et un ligand CD40. L'administration d'une protéine de fusion contenant l'antigène et un ligand CD40 est utilisée pour améliorer la réponse immunitaire au-delà de celle obtenue par l'administration du vecteur seul. Les procédés selon cette invention peuvent être utilisés pour générer une réponse immunitaire contre un cancer exprimant un antigène tumoral, tel qu'un antigène tumoral de mucine ou de papillomavirus humain, et pour générer une réponse immunitaire contre un agent infectieux. La présente invention concerne également un procédé pour produire simultanément le vecteur d'expression et la protéine de fusion.
PCT/US2004/041690 2003-12-11 2004-12-10 Procedes pour generer une immunite a un antigene WO2005058950A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2006544078A JP2008504219A (ja) 2003-12-11 2004-12-10 抗原に対する免疫を生じさせる方法
EP04813939A EP1720905A2 (fr) 2003-12-11 2004-12-10 Procedes pour generer une immunite a un antigene
CA002548347A CA2548347A1 (fr) 2003-12-11 2004-12-10 Procedes pour generer une immunite a un antigene

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US59201603P 2003-12-11 2003-12-11
US60/592,016 2004-07-29

Publications (2)

Publication Number Publication Date
WO2005058950A2 true WO2005058950A2 (fr) 2005-06-30
WO2005058950A3 WO2005058950A3 (fr) 2006-03-02

Family

ID=34700248

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/041690 WO2005058950A2 (fr) 2003-12-11 2004-12-10 Procedes pour generer une immunite a un antigene

Country Status (3)

Country Link
EP (1) EP1720905A2 (fr)
CA (1) CA2548347A1 (fr)
WO (1) WO2005058950A2 (fr)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006061414A1 (fr) * 2004-12-09 2006-06-15 Ingenium Pharmaceuticals Ag Procedes et agents utilises dans le traitement d'etats caracterises par l'hyperproduction/ hypersecretion de mucus
US8604178B2 (en) 2006-09-18 2013-12-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
CN104345152A (zh) * 2013-08-08 2015-02-11 中国人民解放军第二军医大学东方肝胆外科医院 MUC15与p-AKT在制备肝癌预后评估试剂盒中的应用
US8956849B2 (en) 2007-11-01 2015-02-17 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US8956618B2 (en) 2010-01-21 2015-02-17 The Texas A&M University System Vaccine vectors and methods of enhancing immune responses
US8961990B2 (en) 2010-06-09 2015-02-24 The Board Of Trustees Of The University Of Arkansas Vaccine and methods to reduce campylobacter infection
US9125854B2 (en) 2007-10-30 2015-09-08 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to flagellated bacterium
WO2016112195A1 (fr) * 2015-01-09 2016-07-14 Etubics Corporation Méthodes et compositions d'immunothérapie combinée
US9533036B2 (en) 2005-11-07 2017-01-03 Microvax, Llc Methods for generating immune responses to influenza antigens with a secretable CD40L fusion protein
US9603915B2 (en) 2013-02-14 2017-03-28 The Board of Trustees of the University of Akansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
EP3253876A4 (fr) * 2015-02-06 2018-09-19 Heat Biologics, Inc. Vecteur co-exprimant un vaccin et des molécules co-stimulantes
US10174100B1 (en) * 2006-11-06 2019-01-08 Microvax, Llc Multivalent DNA composition for Yersinia pestis
US10376571B2 (en) 2013-03-15 2019-08-13 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to enteric pathogens
US10563224B2 (en) 2012-08-24 2020-02-18 Etubics Corporation Replication defective adenovirus vector in vaccination
US10682398B2 (en) 2016-05-03 2020-06-16 The Texas A&M University System Yeast vaccine vector including immunostimulatory and antigenic polypeptides and methods of using the same
US10695417B2 (en) 2015-01-09 2020-06-30 Etubics Corporation Human adenovirus serotype 5 vectors containing E1 and E2B deletions encoding the ebola virus glycoprotein
US11149087B2 (en) 2015-04-20 2021-10-19 Etubics Corporation Methods and compositions for combination immunotherapy
US11344613B2 (en) 2007-07-02 2022-05-31 Etubics Corporation Sequential administration of a replication defective adenovirus vector in vaccination protocols
US11548930B2 (en) 2017-04-04 2023-01-10 Heat Biologics, Inc. Intratumoral vaccination
US11666649B2 (en) 2016-10-11 2023-06-06 University Of Miami Vectors and vaccine cells for immunity against Zika virus

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1255560B1 (fr) * 2000-02-02 2008-10-29 UNITED STATES GOVERNMENT as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES, CENTERS FOR DISEASE Adjuvant du ligand cd40 destine au virus respiratoire syncytial

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
DHODAPKAR ET AL., J CLIN INVEST, vol. 104, 1999, pages 173 - 180
FONG ET AL., J IMMUNOL., vol. 166, 2001, pages 4254 - 4259
GUNZER ET AL., SEMIN IMMUNOL, vol. 13, 2001, pages 291 - 302
HSU ET AL., NAT MED., vol. 2, 1996, pages 52 - 58
KUSUHARA ET AL., EUR J IMMUNOL, vol. 32, 2002, pages 1035 - 1043
LUFT ET AL., INT IMMUNOL, vol. 14, 2002, pages 367 - 380
MARKOWICZ ET AL., J CLIN INVEST, vol. 85, 1990, pages 955 - 961
MURPHY ET AL., PROSTATE, vol. 38, 1999, pages 73 - 78
NESTLE ET AL., NAT MED, vol. 4, 1998, pages 328 - 332
PAGLIA ET AL., J EXP MED, vol. 183, 1996, pages 317 - 322
ROWSE ET AL., CANCER RES, vol. 58, 1998, pages 315
SKOV ET AL., J IMMUNOL., vol. 164, 2000, pages 3500 - 35Q5
ZITVOGEL ET AL., J EXP MED., vol. 183, 1996, pages 87 - 97

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006061414A1 (fr) * 2004-12-09 2006-06-15 Ingenium Pharmaceuticals Ag Procedes et agents utilises dans le traitement d'etats caracterises par l'hyperproduction/ hypersecretion de mucus
US9533036B2 (en) 2005-11-07 2017-01-03 Microvax, Llc Methods for generating immune responses to influenza antigens with a secretable CD40L fusion protein
US9226957B2 (en) 2006-09-18 2016-01-05 The Texas A&M University System Compositions and methods of enhancing immune responses
US8604178B2 (en) 2006-09-18 2013-12-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
US10004798B2 (en) 2006-09-18 2018-06-26 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
US10174100B1 (en) * 2006-11-06 2019-01-08 Microvax, Llc Multivalent DNA composition for Yersinia pestis
US11376316B2 (en) 2007-07-02 2022-07-05 Etubics Corporation Breast cancer vaccines and methods of use thereof
US11504423B2 (en) 2007-07-02 2022-11-22 Etubics Corporation Methods and compositions for producing an adenovirus vector for use with multiple vaccinations
US11389521B2 (en) 2007-07-02 2022-07-19 Etubics Corporation Methods and compositions for producing an adenovirus vector for use with multiple vaccinations
US11369673B2 (en) 2007-07-02 2022-06-28 Etubics Corporation HPV vaccines and methods of use thereof
US11529408B2 (en) 2007-07-02 2022-12-20 Etubics Corporation Methods and compositions for producing an adenovirus vector for use with multiple vaccinations
US11826417B2 (en) 2007-07-02 2023-11-28 Etubics Corporation Methods and compositions for producing an adenovirus vector for use with multiple vaccinations
US11344613B2 (en) 2007-07-02 2022-05-31 Etubics Corporation Sequential administration of a replication defective adenovirus vector in vaccination protocols
US9125854B2 (en) 2007-10-30 2015-09-08 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to flagellated bacterium
US10016493B2 (en) 2007-11-01 2018-07-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US10842858B2 (en) 2007-11-01 2020-11-24 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US8956849B2 (en) 2007-11-01 2015-02-17 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US9913893B2 (en) 2010-01-21 2018-03-13 The Board Of Trustees Of The University Of Arkansas Vaccine vectors and methods of enhancing immune responses
US8956618B2 (en) 2010-01-21 2015-02-17 The Texas A&M University System Vaccine vectors and methods of enhancing immune responses
US10960068B2 (en) 2010-06-09 2021-03-30 The Board Of Trustees Of The University Of Arkansas Vaccine and methods to reduce campylobacter infection
US8961990B2 (en) 2010-06-09 2015-02-24 The Board Of Trustees Of The University Of Arkansas Vaccine and methods to reduce campylobacter infection
US10563224B2 (en) 2012-08-24 2020-02-18 Etubics Corporation Replication defective adenovirus vector in vaccination
US10328137B2 (en) 2013-02-14 2019-06-25 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
US11904005B2 (en) 2013-02-14 2024-02-20 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
US10792351B2 (en) 2013-02-14 2020-10-06 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
US9603915B2 (en) 2013-02-14 2017-03-28 The Board of Trustees of the University of Akansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
US9884099B2 (en) 2013-02-14 2018-02-06 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
US11364290B2 (en) 2013-02-14 2022-06-21 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to eimeria or limiting eimeria infection
US10376571B2 (en) 2013-03-15 2019-08-13 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to enteric pathogens
US10716840B2 (en) 2013-03-15 2020-07-21 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to enteric pathogens
US11013792B2 (en) 2013-03-15 2021-05-25 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to enteric pathogens
CN104345152B (zh) * 2013-08-08 2016-09-21 中国人民解放军第二军医大学东方肝胆外科医院 MUC15与p-AKT在制备肝癌预后评估试剂盒中的应用
CN104345152A (zh) * 2013-08-08 2015-02-11 中国人民解放军第二军医大学东方肝胆外科医院 MUC15与p-AKT在制备肝癌预后评估试剂盒中的应用
US10695417B2 (en) 2015-01-09 2020-06-30 Etubics Corporation Human adenovirus serotype 5 vectors containing E1 and E2B deletions encoding the ebola virus glycoprotein
CN107406857A (zh) * 2015-01-09 2017-11-28 埃图比克斯公司 用于联合免疫治疗的方法和组合物
WO2016112195A1 (fr) * 2015-01-09 2016-07-14 Etubics Corporation Méthodes et compositions d'immunothérapie combinée
US11352642B2 (en) 2015-01-09 2022-06-07 Etubics Corporation Methods and compositions for combination immunotherapy
CN107406857B (zh) * 2015-01-09 2021-06-29 埃图比克斯公司 用于联合免疫治疗的方法和组合物
EP3253876A4 (fr) * 2015-02-06 2018-09-19 Heat Biologics, Inc. Vecteur co-exprimant un vaccin et des molécules co-stimulantes
US10758611B2 (en) 2015-02-06 2020-09-01 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
RU2714157C2 (ru) * 2015-02-06 2020-02-12 Хит Байолоджикс, Инк. Вектор, коэкспрессирующий молекулы для вакцинации и костимулирующие молекулы
US10780161B2 (en) 2015-02-06 2020-09-22 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
AU2016215175B2 (en) * 2015-02-06 2021-09-16 Heat Biologics, Inc. Vector co-expressing vaccine and costimulatory molecules
US11149087B2 (en) 2015-04-20 2021-10-19 Etubics Corporation Methods and compositions for combination immunotherapy
US11382962B2 (en) 2016-05-03 2022-07-12 The Board Of Trustees Of The University Of Arkansas Yeast vaccine vector including immunostimulatory and antigenic polypeptides and methods of using the same
US10682398B2 (en) 2016-05-03 2020-06-16 The Texas A&M University System Yeast vaccine vector including immunostimulatory and antigenic polypeptides and methods of using the same
US11666649B2 (en) 2016-10-11 2023-06-06 University Of Miami Vectors and vaccine cells for immunity against Zika virus
US11548930B2 (en) 2017-04-04 2023-01-10 Heat Biologics, Inc. Intratumoral vaccination

Also Published As

Publication number Publication date
CA2548347A1 (fr) 2005-06-30
EP1720905A2 (fr) 2006-11-15
WO2005058950A3 (fr) 2006-03-02

Similar Documents

Publication Publication Date Title
US9353167B2 (en) Methods for generating immunity to antigen
US9757438B2 (en) Mucin antigen vaccine
US20060286074A1 (en) Methods for immunotherapy of cancer
EP1720905A2 (fr) Procedes pour generer une immunite a un antigene
JP4662708B2 (ja) エクソゾームにタンパク質を標的化する方法および組成物
US7662586B2 (en) Synthetic gene encoding human epidermal growth factor 2/neu antigen and uses thereof
US8119117B2 (en) Adenoviral expression vector comprising a CD40L fusion protein adapted to elicit cellular immunity
US20040241686A1 (en) Her2/neu target antigen and use of same to stimulate an immune response
WO2019101062A1 (fr) Vaccin recombiné et son application
WO2008012237A1 (fr) Construction de multiples antigènes et leur utilisation
JP2008504219A (ja) 抗原に対する免疫を生じさせる方法
US20060286114A1 (en) Synthetic gene encoding rhesus monkey carcinoembryonic antigen and uses thereof
JP2005526511A (ja) ワクチン

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2548347

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004813939

Country of ref document: EP

Ref document number: 2006544078

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2004813939

Country of ref document: EP