WO2005056573A1 - Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante - Google Patents

Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante Download PDF

Info

Publication number
WO2005056573A1
WO2005056573A1 PCT/CA2004/002124 CA2004002124W WO2005056573A1 WO 2005056573 A1 WO2005056573 A1 WO 2005056573A1 CA 2004002124 W CA2004002124 W CA 2004002124W WO 2005056573 A1 WO2005056573 A1 WO 2005056573A1
Authority
WO
WIPO (PCT)
Prior art keywords
disease
mutations
mtdna
disorder
biological sample
Prior art date
Application number
PCT/CA2004/002124
Other languages
English (en)
Inventor
Mark Birch-Machin
Gabriel D. Dakubo
Robert Thayer
Ryan Parr
Alioune Ngom
John Th'ng
Original Assignee
1304854 Ontario Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/CA2002/000848 external-priority patent/WO2002101086A2/fr
Priority claimed from US10/732,374 external-priority patent/US20050026167A1/en
Application filed by 1304854 Ontario Ltd. filed Critical 1304854 Ontario Ltd.
Priority to CA002550135A priority Critical patent/CA2550135A1/fr
Priority to EP04802299A priority patent/EP1694695A4/fr
Publication of WO2005056573A1 publication Critical patent/WO2005056573A1/fr
Priority to US11/339,751 priority patent/US20070190534A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/40—Population genetics; Linkage disequilibrium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • This invention is related to the field of mitochondrial genomics.
  • it is related to mutations in the mitochondrial genome and their utility as an indicator of the genesis of disease, for example detecting the presence of pre-neoplasia, neoplasia and progression towards potential malignancy even before common clinical symptoms are evident.
  • Mitochondrial Genome The mitochondrial genome is a compact yet critical sequence of nucleic acid.
  • the mitochondrial genome codes for enzyme subunits necessary for cellular respiration.
  • Mitochondrial DNA, or "mtDNA” is a minuscule genome of nucleic acid at 16,569 base pairs (bp) Anderson et al., 1981; Andrews et al, 1999) in contrast to the immense nuclear genome of 3.3 billion bp. Its genetic complement is astronomically smaller than that of its nuclear cell mate (0.0005%). However, individual cells carry anywhere from 10 3 to 10 4 mitochondria depending on specific cellular function (Singh and Modica-Napolitano 2002).
  • mtDNA mitochondrial DNA genomes in a given individual are identical given the clonal expansion of mitochondria within the ovum, once fertilization has occurred.
  • the essential role of mtDNA is the generation of the cellular fuel, adenosine triphosphate (ATP), which fires cellular metabolism.
  • ATP adenosine triphosphate
  • the mitochondrial genome is dependent on seventy nuclear encoded proteins to accomplish the oxidation and reduction reactions necessary to this vital function, in addition to the thirteen polypeptides supplied by the mitochondrial genome (Leonard and Shapira, 1997). Different tissues and organs depend on oxidative phosphorylation to a varied extent.
  • Oxidative phosphorylation (OXPHOS)
  • Oxidative phosphorylation (OXPHOS)
  • mtDNA mutations Borne, 1992
  • organ specific energetic thresholds are exceeded which give rise to a variety of clinical phenotypes.
  • mutations in the mitochondrial genome are associated with a variety of chronic, degenerative diseases (Gattermann et al. 1995). It is well known that aging and specific types of pathology can alter, or mutate mtDNA compromising the energy production capacity of the cell.
  • MtDNA sequence dynamics are important diagnostic tools. Mutations in mtDNA are often preliminary indicators of developing disease, often associated with nuclear mutations, and act as biomarkers specifically related to disease, such as but not limited to: tissue damage and cancer from smoking and exposure to second hand tobacco smoke (Lee et al., 1998; Wei, 1998); longevity, based on accumulation of mitochondrial genome mutations beginning around 20 years of age and increasing thereafter (von Wurmb, 1998); metastatic disease caused by mutation or exposure to carcinogens, mutagens, ultraviolet radiation (Birch-Machin, 2000); osteoarthritis; cardiovascular, Alzheimer, Parkinson disease (Shoffner et al, 1993; Sherratt et al., 1997;Zhang et al, 1998); age associated hearing loss (Seidman et al., 1997); optic nerve degeneration and cardiac dysrhythmia (Brown et al, 1997; Wallace et al., 1988); chronic progressive external exophthalmoplegia (Taniike e
  • alterations include point mutations (transitions, transversions), deletions (one base to thousands of bases), inversions, duplications, (one base to thousands of bases), recombinations and insertions (one base to thousands of bases), h addition, specific base pair alterations, deletions, or combinations of are associated with early onset of prostate, skin, and lung cancer, as well as aging (e.g. Polyak et al., 1998), premature aging, exposure to carcinogens (Lee et al., 1998), etc.
  • mtDNA is passed to offspring exclusively through the ovum, it is imperative to understand mitochondrial sequences through this means of inheritance.
  • the sequence of mtDNA varies widely between maternal lineages (Ward et al., 1991), hence mutations associated with disease must be clearly understood in comparison to this variation.
  • a specific T to C transition noted in the sequence of several individuals, associated with a specific cancer could in reality be natural variation in a maternal lineage widespread in a given particular geographical area or associated with ethnicity.
  • Native North Americans express an unusually high frequency of adult onset diabetes.
  • Lineage A is distinguished by a simple point mutation resulting in a Hae III site at bp 663 in the mitochondrial genome, yet there is no causative relationship between this mutation and the adult onset of diabetes.
  • sequence variation even within lineage clusters there is sequence variation.
  • a substantial mtDNA sequence database is a clear prerequisite to accurate forecasting of potential disease as a natural process, or through exposure to causative agents.
  • the entire molecule must be sequenced for its full information content.
  • the entire suite of point mutations (transitions, transversions), deletions (one base to thousands of bases), inversions, duplications, (one base to thousands of bases), recombinations and insertions (one base to thousands of bases) must be characterized as a whole over the entire mitochondrial genome. This ensures that all possible information available in the mitochondrial genome is captured.
  • the genome of cytoplasmic mitochondria (16,569bp) has been sequenced at an individual level, like its nuclear counterpart, the mitochondrial genome has not been sequenced at a population level for use as a diagnostic tool.
  • UV radiation is important in the development and pathogenesis of non-melanoma skin cancer ( ⁇ MSC) (Weinstock 1998; Rees, 1998) and UN induces mtD ⁇ A damage in human skin (Birch-Machin, 2000a).
  • mitochondrial sequence loses integrity.
  • the 4977bp deletion increases in frequency with age (Fahn et al., 1996). Beginning at age 20, this deletion begins to occur in small numbers of mitochondria. By age 80, a substantial number of molecules have been deleted. This deletion characterizes the normal aging process, and as such serves as a biomarker for this process. Quantification of this aging process may allow medical or other interventions to slow the process.
  • This application of mitochondrial genomics to medicine has been overlooked because mtD ⁇ A has been used primarily as a tool in population genetics and more recently in forensics; however, it is becoming increasingly evident that the information content of mtDNA has substantial application in the field of medical diagnostics.
  • sequencing the entire complement of mtDNA was a laborious task before the recent advent of high capacity, high-throughput robotic DNA sequencing systems.
  • population geneticists were able to gather significant data from two highly variable areas in the control region; however, these small regions represent a small portion of the overall genome, less than 10%, meaning that 90% of the discriminating power of the data is left unused!
  • many disease associated alterations are outside of the control region.
  • the character of the entire genome should be considered to include all sequence information for accurate and highly discriminating diagnostics.
  • Non-Melanoma Skin Cancer Human non-melanoma skin cancer (NMSC) is the commonest cancer in many Caucasian populations (Weinstock, 1998; Rees, 1998). The majority of these tumours are basal cell carcinoma (BCC) and squamous cell carcinoma (SCC). BCCs are locally invasive and can cause significant morbidity but rarely metastasis. SCCs show significant metastatic potential and the occurrence of multiple NMSCs in patients with immunosuppression causes significant management problems (Rees, 1998).
  • BCC basal cell carcinoma
  • AKs actinic keratoses
  • Bowen's disease in situ carcinoma
  • SCCs show loss of heterozygosity affecting several chromosomes which suggests the involvement of several tumour suppressor genes in their development.
  • AKs an equal or greater degree of genetic loss is observed in these precursor lesions compared to SCCs (Rehman et al. 1994; Rehman et al. 1996). This is important for the proposed invention because it suggests that other mechanisms, in addition to inactivation of tumour suppressor genes, are likely to be involved in the development of SCCs.
  • tumour cells were found to have an impaired respiratory system and high glycolytic activity
  • MtD ⁇ A as a molecular marker was used to study the relation between chronological aging and photo aging in human skin.
  • a 3 -primer quantitative PCR method was used to study the changes in the ratio of the 4977 bp-deleted to wild type mtD ⁇ A in relation to sun exposure and chronological age of human skin.
  • Prostate Cancer is a frequently diagnosed solid tumour that most likely originates in the prostate epithelium (Huang et al. 1999). In 1997, nearly 10 million American men were screened for prostate specific antigen (PSA), the presence of which suggests prostate cancer (Woodwell, 1999). Indeed, this indicates an even higher number of men screened by an initial digital rectal exam (DRE). In the same year, 31 million men had a DRE (Woodwell, 1999). Moreover, the annual number of newly diagnosed cases of prostate cancer in the United States is estimated at 179,000 (Landis et al., 1999). It is the second most commonly diagnosed cancer and second leading cause of cancer mortality in Canadian men.
  • PSA prostate specific antigen
  • DRE digital rectal exam
  • Prostate cancer exhibits a wide variety of histological behaviour involving both erogenous and exogenous factors, i.e. socio-economic situations, diet, geography, hormonal imbalance, family history and genetic constitution (Konishi et al. 1997; Hayward et al. 1998).
  • Familial cancers refer to the incidences within a family, but are not inherited. This form accounts for up to 25% of prostate cancers (Walsh & Partin, 1997).
  • Hereditary refers to a subtype of prostate cancer with a Mendelian inheritance of a predisposing gene(s) and accounts for approximately 9% of reported cases. A positive family history of prostate cancer for this disease suggests that these predisposing gene(s) play an important role in prostate cancer development and progression.
  • Prostate cancer prognosis mainly depends on the tumour stage and grade at diagnosis. Only localized prostate cancer can be cured by radical treatment. Standard detection still relies on digital rectal examination, PSA testing and histopathologic examination of prostatic biopsied tissues. Biopsy of a mass is used to confirm malignancy, it is not an early detection technique. Unfortunately, some early tumours are impossible to identify during rectal exams.
  • PSA tests have a specificity of 60 to 70% and a sensitivity of 70 to 80% (personal communication, Dr. Sunil Gulavita, Northwestern Ontario Cancer Centre).
  • a newer technique which refines diagnosis for tumours of common histologic grade is ploidy-DNA analysis employing flow cytometry (Shankey et al. 1995); however, this technique measures chromosomal changes that are only apparent in later stages of cancer development and is not sufficiently sensitive for the detection of minor alterations in DNA structure or chromosomal inversions, or reciprocal trans-locations in early cancers.
  • the invention focuses on early detection since prognosis is heavily dependent on the stage of disease at diagnosis.
  • mitochondria have been implicated in the carcinogenic process because of their role in apoptosis and other aspects of tumour biology (Green & Reed 1998).
  • somatic mutations of mtDNA have been observed in a number of human tumours (Polyale et al. 1998, Tamura et al. 1999, Fliss et al. 2000).
  • previous studies have been exclusively cross-sectional as they have not considered the clonal nature of mtDNA in maternal lines. These limited cross-sectional studies merely show the mutation at one time point. This may or may not give an accurate link between a mutation and the corresponding disease state.
  • Cross-sectional studies employing a maternal line have the advantage of tracking a mutation in mtDNA over time and thus mimic the strength of a longitudinal design. Mutations which are common population variants, as opposed to mutations associated with disease, can both be identified.
  • Aging consists of an accumulation of changes with time both at the molecular and cellular levels; however, the specific molecular mechanisms underlying the aging process remain to be elucidated.
  • mitochondrial genomes in older subjects are compared to the genomes of younger subjects from trie same matemal lineage.
  • One deletion associated with aging is known as the common deletion, or 4977-bp deletion. Aging research has been limited to this common deletion and polymorphisms in the control region. For a clear understanding of these mutations, the entire genome must be analyzed. Other deletions are seen in Table 1 adapted from Wei, 1992.
  • Oxygen free radicals are a probable cause of this deletion, which increases in frequency with age.
  • Existing literature demonstrates a strong association between mtDNA (mtDNA) mutations, chronological age, and the overall aging process in postmitotic tissues such as muscle and brain; however, comparative maternal line studies are needed to discriminate between aging associated mutational events and those mutations without an aging association.
  • mtDNA mtDNA
  • a variety of chronic degenerative diseases have been shown to result from mutations in mtDNA (Gatterman et al. 1995). Diseases related to defective OXPHOS appear to be closely linked to mtDNA mutations (Byrne, 1992).
  • An object of the present invention is to provide a simple, straightforward system for monitoring the mitochondrial genome for early transitions associated with cancer, aging, and other human diseases with a DNA component.
  • a small biological sample which includes tissue or fluid samples such as urine, prostate fluid, skin cells, or saliva is taken from an individual. These samples are examined, using any suitable method including histological examination, to identify cells demonstrating disease morphology. Using any suitable method, including without limitation; laser capture, identified cells demonstrating disease mo ⁇ hology are recovered from the sample and the mtDNA therefrom is sequenced, followed by comparison to a database of known mitochondrial sequences associated with both health and disease. hi a preferred embodiment, the entire mitochondrial genome is sequenced at a population level to determine the variation of mtDNA sequences associated with disease.
  • the presence of mutation progression may signal the beginning and continuing development of disease.
  • Mutation load may also indicate progression or disease state.
  • mtDNA sequences from prostate massage fluid are compared to a mtDNA sequence database of normal, transitory, and metastatic mtDNA sequences clearly associated with prostate cancer.
  • This comparative data set is based on studies of maternal lines, and other normal maternal line variation present in the population stored in a maternal line database affording a lucid picture of mtDNA mutations clearly associated with disease, as opposed to variation present in mitochondrial lineages existing in the general population. There may be specific matemal lineages which indicate a predisposition to disease.
  • mtDNA sequences from suspected non-melanoma skin cancers are compared to a mtDNA sequence database of normal and mtDNA sequences clearly associated with non-melanoma skin cancer.
  • a method of detecting in a subject containing mtDNA the genesis or progression of disease comprising obtaining a biological sample from the subject, extracting DNA from the biological sample, and detecting the presence of mutations in the mtDNA.
  • the step of detecting the presence of mutations is chosen from sequencing the mtDNA, amplifying the mtDNA by PCR, South- Western blotting, denaturing HPLC, hybridization to microarrays, gene chips or biochips, molecular marker analysis or combinations thereof.
  • the mtDNA of the biological sample is compared to a database, the database containing data of mutations associated with the mtDNA sequences of non-disease and disease associated mitochondrial genomes.
  • a method of detecting in a human subject the presence of a disease comprising obtaining a biological sample from the human subject, extracting DNA from the biological sample, detecting mutations in the mitochondrial DNA of the biological sample, and comparing the mitochondrial DNA sequence of the biological sample to a database, the database containing data of mutations associated with the mitochondrial DNA sequences of non- disease and disease associated mitochondrial genomes Mutation rates of mitochondria DNA associated with a specific disease may be an important indicator of disease development and prognosis. This may allow specific identification of disease stage, improving disease definition resulting in better disease intervention and specific therapy application.
  • the invention may be used to monitor the progression of disease by watching important sites targeted by metastasis.
  • a method of determining a predisposition to a disease or disorder indicated by mutations in a mitochondrial DNA sequence comprising: obtaining a biological sample from the human subject, extracting DNA from the biological sample, detecting mutations in the mitochondrial DNA of the biological sample, and comparing the mitochondrial DNA sequence of the biological sample to a database, the database containing data of mutations associated with the mitochondrial DNA sequences of individuals who are predisposed to the disease or disorder, and individuals who are not predisposed to the disease or disorder.
  • a DNA microarray is used in determining the sequence of the mitochondrial DNA. Other technologies can also be used.
  • a method for assessing the status of the aging process of a human subject comprising obtaining a biological sample from the human subject, extracting DNA from the biological sample, detecting mutations in the mitochondrial DNA of the biological sample, and comparing the mitochondrial DNA sequence of the biological sample to a database, the database containing data of mutations of TDNA associated with aging.
  • the step of detecting the presence of mutations in the mtDNA can be selected from: sequencing the mtDNA, amplifying mtDNA by PCR, Southern, Northern, Western, Southwestern blot hybridizations, denaturing HPLC, hybridization to microarrays, biochips or gene chips, molecular marker analysis, biosensors, melting temperature profiling or a combination of any of the above.
  • a database containing a plurality of human mitochondrial DNA sequences, the mitochondrial DNA sequences selected from the group of normal control sequences associated with non- disease states, sequences associated with the presence of disease or sequences indicative of the predisposition to disease.
  • a kit for diagnosis of a disease comprising a disposable chip, microarray, means for holding the disposable chip, means for extraction of mitochondrial DNA and means for access to a database of mitochondrial DNA sequences.
  • a method of diagnosing a disease in a patient comprising hybridizing a nucleic acid sample obtained from mitochondrial DNA to an array comprising a solid substrate and a plurality of nucleic acid members, wherein each member is indicative of the presence of a disease, wherein each nucleic acid member has a unique position and is stably associated with the solid substrate, and wherein hybridization of said nucleic acid sample to one or more nucleic acid members comprising said array is indicative of the presence of prostate cancer.
  • kits for determining predisposition to a disease comprising a disposable chip, microarray, means for holding the disposable chip, means for extraction of DNA and means for access to a database of mitochondrial DNA sequences.
  • a method of determining a predisposition to or developing symptoms of a disease or disorder indicated by mutations in a mitochondrial DNA sequence comprising obtaining a biological sample from the human subject, extracting mitochondrial DNA from the biological sample, sequencing the mitochondrial DNA of the biological sample, and comparing the mitochondrial DNA sequence of the biological sample to a database, the database containing population-level data of mutations associated with the mtDNA sequences of non-disease and disease associated mitochondrial genomes.
  • a method of diagnosing non-melanoma skin cancer in a patient comprising: hybridizing a nucleic acid sample obtained from mitochondrial DNA to an array comprising a solid substrate and a plurality of nucleic acid members, wherein each member is indicative of non-melanoma cancer, wherein each nucleic acid member has a unique position and is stably associated with the solid substrate, and wherein hybridization of said nucleic acid sample to one or more nucleic acid members comprising said array is indicative of the presence of non- melanoma skin cancer.
  • non-specific mutations may reach a threshold effect beyond which cancer develops.
  • prostate cancer can also be diagnosed.
  • a method of detecting heteroplasmy in a subject containing mtDNA comprising obtaining a biological sample from the subject; extracting DNA from the biological sample; and performing denaturing HPLC on the sample.
  • a method of detecting mutations associated with disease in a subject containing mtDNA comprising: obtaining a biological sample from the subject, extracting DNA from the biological sample, detecting the presence of mutations in the mtDNA, and comparing the mtDNA of the biological sample to a database, the database containing data of common population variants in non-disease and disease associated mitochondrial genomes.
  • Another aspect of the invention is to provide a use of any one or any combination of the mutations, substitutions, deletions or insertions listed on Table 4 or SEQ ID NOs: 102 to 138 to detect a predisposition to a disease or disorder, early detection of a disease or a disorder, genesis of a disease or a disorder, presence of a disease or a disorder, progression of a disease or a disorder, or aging in a subject having mtDNA.
  • Another aspect of the invention is to provide a method of detecting mutations associated with a disease, a disorder or aging in a subject having mtDNA, comprising: providing a biological sample from the subject, wherein the biological sample is chosen from non-involved tissue, distant benign tissue, adjacent benign tissue, atypical tissue, histologically abnormal tissue, and diseased tissue; extracting DNA from the biological sample; detecting the presence of mutations in the mtDNA; and determining whether the mutations are associated with normal mterpopulation or intrapopulation variations, or whether the mutations are associated with the disease, the disorder or aging.
  • the method further comprises at least one of determining total mutation load in the mtDNA of the biological sample; and determining the identity of the mutation in the mtDNA of the biological sample.
  • the step of determining whether the mutations are associated with normal mterpopulation or intrapopulation variations, or whether the mutations are associated with the disease, the disorder or aging may comprise at least one of: comparing the mtDNA of the biological sample to a database, the database containing data of mterpopulation and intrapopulation variations, and mutations associated with the disease, the disorder or aging; and determining total mutation load of the biological sample.
  • the diagnosis may be chosen from predisposition to a disease or a disorder, early detection of a disease or a disorder, genesis of a disease or a disorder, presence of a disease or a disorder, and progression of a disease or a disorder.
  • the step of detecting the presence of mutations may be chosen from: sequencing the mtDNA; amplifying mtDNA by PCR; Southern, Northern, Western and South- Western blot hybridizations; denaturing HPLC; hybridization to microarrays, gene chips or biochips; molecular marker analysis; and a combination of any of the above.
  • the disease may be non-melanoma skin cancer or prostate cancer.
  • the database contains at least a statistically significant number of mitochondrial DNA sequences, the mitochondrial DNA sequences having been obtained from a maternal line, a non-maternal line, or both.
  • Another aspect of the invention is to provide an array comprising a plurality of nucleic acid members, and a solid substrate, wherein the nucleic acid members are associated with the mutations listed on Table 4 or SEQ ID Nos: 102 to 138 and are indicative of the presence or predisposition of a disease, a disorder or aging, or used to determine a prohibiting index by quantifying the proportion of base pair deletions and mutations associated with a disease, a disorder or aging, and is chosen from mitochondrial DNA, RNA transcribed from mitochondrial DNA, and cDNA, wherein each nucleic acid member has a unique position on said array and is stably associated with the solid substrate.
  • the members may be associated with prostate cancer or any other disease or disorder.
  • Another aspect of the invention is to provide a kit for diagnosing, determining a predisposition, or early detection of a disease comprising a disposable chip, the array described above, means for holding the disposable chip, means for extraction of mitochondrial DNA and means for access to a database of mitochondrial DNA sequences.
  • the member may be associated with prostate cancer.
  • Another aspect of the invention is to provide a database containing a plurality of human mitochondrial DNA sequences, the mitochondrial DNA sequences are chosen from normal control sequences associated with non-disease states, sequences associated with mterpopulation variations, sequences associated with intrapopulation variations, and sequences associated with the mutations on Table 4 or SEQ ID Nos: 102 to 138.
  • Another aspect of the invention is a method of monitoring a person for the presence of pre-neoplasia, neoplasia or progression of neoplasia toward potential malignancy, in a biological sample, comprising (a) providing a biological sample from the subject, (b) extracting DNA from the biological sample, (c) detecting the presence of mutations in the mtDNA, (d) determining whether the mutations are associated with normal mterpopulation or intrapopulation variations, or whether the mutations are associated with pre-neoplasia, neoplasia or progression of neoplasia toward potential malignancy, and (e) repeating steps (a) through (d).
  • the step of determining whether the mutations are associated with pre-neoplasia, neoplasia or progression of neoplasia may be done by comparing the mutations with DNA from non-involved tissue or bodily fluid from the subject, or by comparing the mutations with mitochondrial DNA from a matemal relative.
  • the progression of neoplasia may comprise monitoring the person at successive time periods for an increase in mutations or an increase in mutated mitochondrial genomes.
  • Another aspect of the invention is a method of determining whether pre-neoplasia, neoplasia, or malignancy is latent or aggressive in its growth pattern, in a biological sample, comprising (a) providing a biological sample from the subject, (b) extracting DNA from the biological sample, (c) detecting the presence of mutations in the mtDNA, (d) determining whether the mutations are associated with normal mterpopulation or intrapopulation variations, or whether the mutations are associated with pre-neoplasia, neoplasia or progression of neoplasia toward potential malignancy, and (e) repeating steps (a) through (d). ).
  • the step of determining whether the mutations are associated with pre- neoplasia, neoplasia or progression of neoplasia may be done by comparing the mutations with DNA from non-involved tissue or bodily fluid from the subject, or by comparing the mutations with mitochondrial DNA from a maternal relative.
  • the determination of whether the malignancy is latent or aggressive may comprise monitoring the person at successive time periods for an increase in mutations or an increase in mutated mitochondrial genomes.
  • specific mutation sites may indicate a disease state, a disorder or aging, the total mutation load is also important in deteimining the genesis, presence and progression of a disease, a disorder or aging.
  • mutation load can be used to diagnose a disease, a disorder or aging.
  • the biological sample for the methods of the present invention may be taken from a tissue that is chosen from benign tissue, normal tissue, atypical tissue and histologically/pathologically abnormal tissue. Other clinical methods can also identify abnormal tissue.
  • the sample may be taken from any bodily fluid, for example, blood, urine, prostate massage fluid, etc.
  • the step of detem ining whether the mutations are associated with normal mterpopulation or intrapopulation variations, or whether the mutations are associated with pre-neoplasia, neoplasia, progression of neoplasia toward potential malignancy, or malignancy comprises comparing the mtDNA of the biological sample to a database of sequences associated with pre-neoplasia, neoplasia, progression of neoplasia toward potential malignancy, malignancy, inter and intra population variations and normal sequences.
  • the step of determining whether the mutations are associated with pre- neoplasia, neoplasia or progression of neoplasia may be done by comparing the mutations mitochondrial DNA from non-involved tissue or bodily fluid from the subject, or by comparing the mutations with mitochondrial DNA from a maternal relative.
  • the entire mitochondrial genome, or a subset of the genome, can be monitored for mutations which are then compared to the database to aid in the detection of pre-neoplasia ,and/or neoplasia, progression towards malignancy and malignancy.
  • Another aspect of the invention is to provide oligonucleotide primers chosen from SEQ ID NO. 19 to 101.
  • an oligonucleotide primer is provided which comprises a sequence of 10, 12, 14, 16, 18, 20, 22, 24, 26, or 30 contiguous nucleotides comprised of sequences from human mtDNA.
  • the methods, arrays and kits may comprise the mutations listed in Table 4 or SEQ ID Nos: 102 to 138.
  • Another aspect of the invention is provide a use of a primer to amplify a nucleic acid molecule comprising at least one mutation listed in Table 4 or SEQ ID Nos: 102 to 138.
  • the primer maybe selected from SEQ ID Nos: 19 to 101.
  • Another aspect of the invention is to provide a method of detecting at least one mutation listed in Table 4 or SEQ ID Ns: 102 to 138 in a nucleic acid molecule, comprising: amplifying the nucleic acid molecule with a primer associated with the mutation; and detecting the mutation.
  • the primer maybe selected from SEQ ID Nos: 19 to 101.
  • Figure 1 is a histogram showing the number of mutations at nucleotide position in mitochondrial DNA from patients with prostate cancer.
  • Table 1 is a summary of mutations associated with aging.
  • Table la is a principal component analysis of mutations in mtDNA of seven protein coding regions in control, distant benign, adjacent benign and malignant tissue.
  • Table lb is a neural network analysis of mutations in mtDNA of seven protein coding regions in control, distant benign, adjacent benign and malignant tissue.
  • Table 2 is a summary of the mean number of deletions is epidermal tumours and adjacent normal tissues.
  • Table 3 is summary of the standard method of DHPLC.
  • Table 4 is a summary of mitochondrial mutations (including D-loop) from prostate needle biopsies and complete genome mutations from malignant, adjacent and distant benign prostate glands from patients with prostate cancer.
  • Table 5 is a list of primers used for complete mitochondrial genome amplification for formalin fixed and normal tissues from blood.
  • the method of the present invention can be used to diagnose diseases linked to mtDNA.
  • the method of the present invention provides for analysis of the mitochondrial genome of an individual from a biological sample, for example by amplification of the mitochondrial genome, sequencing a portion of the mitochondrial genome, preferably the entire mitochondrial genome of the individual using any known means. Denaturing high performance liquid chromatography (DHPLC) may also be used to rapidly screen many samples. DHPLC can focus on hotspots of mutations. DHPLC is more sensitive than automated sequencing in terms of detecting mutations, and can even detect 2% heteroplasmy, compared with 20-25% for ordinary sequencing. Methods for detecting lower levels of heteroplasmy ( ⁇ 2%) may also be developed.
  • DHPLC Denaturing high performance liquid chromatography
  • the "presence" of a mutation in mtDNA includes heteroplasmic mutations and, therefore, it is contemplated that there may be additionally the presence of some normal mtDNA in a sample in which the mutated DNA is present.
  • actinic kerotoses means proposed precursor epidermal lesion of a squamous cell carcinoma.
  • aging refers to an accumulation of changes with time, both at the molecular and cellular levels.
  • attaching or “spotting” refers to a process of depositing a nucleic acid onto a solid substrate to form a nucleic acid array such that the nucleic acid is irreversibly bound to the solid substrate via covalent bonds, hydrogen bonds or ionic interactions.
  • atypical or abnormal means cellular appearance which is not normal, but also does not appear to be malignant.
  • basic cell carcinoma means a type of cancer of skin cells.
  • Boen's disease means in situ epidermal carcinoma.
  • diagnosis means using the presence or absence of a mutation or combination of mutations as a factor in disease diagnosis or management.
  • the detection of the mutation(s) can be a step in the disease state diagnosis.
  • diagnosis includes a disorder or other abnormal physical state.
  • disease associated mitochondiral genomes means genomes containing mutations indicative or otherwise associated with a particular disease.
  • database means an electronic storage system (computer based using standard industry software) which will have the capacity to store and provide retrievable information that will enable researchers to rapidly determine the structure of the nucleotide sequences.
  • the database will also store descriptive information about those individuals who provide the biological samples. This descriptive information will include health status and other pertinent indices which may be correlated to the biological sample.
  • deletion means removal of a region of DNA from a contiguous sequence of nucleic acids, where once a deletion has occurred, the gap is repaired by rejoining of the ends. Deletions can range in size from one base to thousands of bases or larger.
  • duplications means when a specific sequence of DNA is copied and inserted behind or forward of the original copy one or more times or elsewhere in the genome.
  • heteroplasmy is defined by the ratio of mutant: to wild type mtDNA molecules, where 100% mutant mtDNA is termed “homoplasmic”.
  • Heteroplasmic mutations are those mutations which occur in some, but not all of the copies of the mitochondrial genome.
  • homoplasmy means all mitochondrial sequences are identical.
  • hyper-mutation means accelerated mutation rate which cannot be explained by normal cellular processes or standard evolutionary principles.
  • inversions refers to when a length of DNA is excised and reinserted in reverse orientation.
  • mitochondria which are inherited through the cytoplasm of the ovum.
  • mitochondrial DNA refers to the clonal sequence of mitochondrial DNA as passed down through successive generations from the mother.
  • mitochondria means a eukaryotic cytoplasmic organelle that generates ATP for cellular processes.
  • mutation encompasses any change in a DNA sequence from the wild type sequence, including without limitation point mutations, transitions, insertions, transversions, translocations, deletions, inversions, duplications, recombinations or combinations thereof.
  • mutant load refers to an increase in mutations in mtDNA which eventually leads to compromised function of the involved gene or the entire genome.
  • neoplasia means a pathological process which may result in transformation to malignant status.
  • non-involved tissue means tissue from a part of the body which is not associated with the disease in question.
  • normal tissue means tissue with no visible manifestations of disease as determined by histology.
  • nucleic acid array refers to a plurality of unique nucleic acids attached to one surface of a solid support at a density exceeding 20 different nucleic acids/cm 2 wherein each of the nucleic acids is attached to the surface of the solid support in a non-identical preselected region.
  • the nucleic acid attached to the surface of the solid support is DNA.
  • the nucleic acid attached to the surface of the solid support is cDNA.
  • the nucleic acid attached to the surface of the solid support is cDNA synthesized by polymerase chain reaction (PCR).
  • a nucleic acid array comprises nucleic acids of at least 150 nucleotides in length.
  • a nucleic acid array comprises nucleic acids of less than 6,000 nucleotides in length. More preferably, a nucleic acid array comprises nucleic acids of less than 500 nucleotides in length.
  • the array comprises at least 500 different nucleic acids attached to one surface of the solid support.
  • the array comprises at least 10 different nucleic acids attached to one surface of the solid support, i yet another embodiment, the array comprises at least 10,000 different nucleic acids attached to one surface of the solid support.
  • the te ⁇ n "nucleic acid”, as used herein, is interchangeable with the term "polynucleotide”.
  • nucleic acid target or “a target nucleic acid” is defined as a nucleic acid capable of binding to a nucleic acid member of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation.
  • a nucleic acid target may include natural (i. e., A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.).
  • the bases in nucleic acid probe may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization.
  • nucleic acid targets may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages.
  • the nucleic acid targets are derived from human tissue or fluid extracts. More preferably, the nucleic acid targets are single- or double-stranded DNA, RNA, or DNA-RNA hybrids synthesized from human tissue of fluid extracts.
  • nucleus means the most conspicuous organelle in the eucaryotic cell, contains all of the chromasomal DNA.
  • PSA Test means prostate-specific antigen test; an antigen found in blood that may be indicative of cancer of the prostate.
  • point mutation means the change of a single nucleotide in DNA.
  • polymorphism means sequence variation in a population of alleles or mtDNA genomes.
  • precursor lesions means a DNA mutation, or combinations thereof, indicating potential disease association.
  • predisposed to a disease or a “predisposition to a disease” means that individuals are at higher risk for developing the disease or disorder or are at higher risk for early onset of the disease or disorder than the average individual, due to the presence or absence of mutations which are associated with the disease or disorder.
  • pre-neoplasia means indications at the cellular or DNA level that a cell may be on the threshold of becoming neoplastic.
  • preselected region refers to a localized area on a substrate which is, was, or is intended to be used for the deposit of a nucleic acid and is otherwise referred to herein in the alternative as a "selected region” or simply a "region.”
  • the preselected region may have any convenient shape, e.g., circular, rectangular, elliptical, wedge-shaped, etc.
  • a preselected region is smaller than about 1 cm 2 , more preferably less than 1 mm 2 , still more preferably less than 0.5 mm , and in some embodiments about 0.125 to 0.5 mm .
  • “somatic mutation” means a change in DNA sequence after fertilization.
  • solid substrate or “solid support” refers to a material having a rigid or semi-rigid surface.
  • substrate and “support” are used interchangeable herein with the terms “solid substrate” and “solid support”.
  • the solid support may be biological, non-biological, organic, inorganic, or a combination of any of these, existing as particles, strands, precipitates, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates, slides, etc.
  • the substrate is a silicon or glass surface, (poly)tetrafluoroethylene, (poly)vinylidendifluoride, polystyrene, polycarbonate, a charged membrane, such as nylon 66 or nitrocellulose, or combinations thereof.
  • the solid support is glass.
  • at least one surface of the substrate will be substantially flat.
  • the surface of the solid support will contain reactive groups, including, but not limited to, carboxyl, amino, hydroxyl, thiol, or the like.
  • the surface is optically transparent.
  • squamous cell carcinoma means a type of cancer of skin cells.
  • stably associated refers to a nucleic acid that is irreversibly bound to a solid substrate to form an array via covalent bonds, hydrogen bonds or ionic interactions such that the nucleic acid retains its unique preselected position relative to all other nucleic acids that are stably associated with an array, or to all other preselected regions on the solid substrate under conditions wherein an array is analyzed (i.e., hybridization and scanning).
  • a "statistically significant" number of mitochondrial DNA sequences is determined by or through the use of standard chi-square statistical algorithms using or determining observed versus expected scores.
  • “subtle mutation” means low level of mutation at the threshold of detection.
  • “transitions” means substitution of like nitrogenous bases, pyrimidine to pyrimidine, purine to purine. A mutation in which one pyrimidine is substituted by the other, or in which one purine is substituted by the other.
  • transversions means substitution of unlike nitrogenous bases, purine to pyrimidine, pyrimidine to purine. A mutation in which a purine is substituted or replaced by a pyrimidine or vice versa.
  • MtDNA and diagnosis of specific diseases are provided for monitoring aging and diagnosing specific diseases such as prostate cancer and non-melanoma skin cancer through comparisons of mtDNA sequences.
  • Diagnosing diseases such as prostate cancer with mtDNA, rather than nuclear DNA has several advantages. Firstly, mtDNA, a less complex genome, is easily understood at an individual and population level, hence a large mtDNA database with normal and disease associated genomes renders individual diagnosis extremely accurate. Accordingly, variation, in relationship to disease, is understood. Secondly, mtDNA has a 10-fold higher mutation rate than nuclear DNA (Wallace 1992). Nuclear rearrangements, suggestive of preliminary disease, are rapidly communicated to mitochondria, where they appear as somatic mutations.
  • mtDNA has a maternal inheritance pattern, and is essentially clonal in that all mitochondria begin with the same mtDNA sequence, hence variation from this clonal condition is easily detected. Additionally, mtDNA does not show convincing evidence of recombination, thus any alterations in sequence are a somatic event. Any one mitochondrion harboring a mutation(s) is in a sense 'recessive' as a consequence of there being many mitochondrial genomes (2-10 copies) per mitochondrion, and many mitochondria per cell (500-2,000). Moreover, mitochondrial genomes can tolerate very high levels (up to 90%) of mitochondria with damaged genomes. This happens through complementation by the remaining wild type mtDNA (Chomyn et al. 1992).
  • mutated genomes have a replicative advantage over wild type genomes because they are usually smaller (Hayashi et al. 1991), hence there is clonal expansion of mutated mtDNA (Brierley et al. 1998), suggesting that unlike nuclear genes, there is little or no selection against cells harboring mtDNA mutations. Because of this elevated mutation rate, mutations and/or deletions that appear in mtDNA are maintained through the life span of the cell and may serve as a record of exposures to various mutagens. The integrity of mtDNA is maintained by nuclear repair mechanisms, and a defect at these loci has been suggested to result in an autosomal dominant disorder associated with multiple mitochondrial deletions (Zeviani et al. 1990). Consequently, mtDNA may function as an early warning sentinel of early nuclear events related to a variety of cancers or other diseases. Finally, the mitochondrial genome can be sequenced and monitored for mutations on an individual basis.
  • heteroplasmic mutations may be key to the detection of the early genesis of disease, disorder or aging.
  • specific mutation sites may indicate a particular disease state, disorder or aging process, the total mutation load is also important in determining the genesis, presence and progression of a disease, a disorder or aging.
  • the present invention allows for the ability to examine benign or normal tissue or bodily fluids to determine the genesis of disease, disorder or aging.
  • the present invention allows for the ability to examine benign tissue or bodily fluids for the presence of pre-neoplasia, neoplasia, progression toward malignancy and malignancy.
  • the mitochondrial mutations detected by the methods of the invention are compared to inter and intrapopulation variations in mitochondrial DNA, and may include comparison with mitochondrial DNA from non-involved tissue from the subject, or with mitochondrial DNA from a maternal relative. It is not necessary to analyze the entire mitochondrial genome. For example, it is not necessary to sequence the entire mitochondrial genome, only a select portion of it. Accordingly, a sample of mitochondrial DNA can provide a diagnosis.
  • a system for early diagnosis of mtDNA changes in non-melanoma skin cancer (NMSC) and their precursor lesions indicative of solid tumour development is provided.
  • the particular changes, such as the common deletion and associated mutations, and the incidence of as yet uncharacterised deletions in mtDNA serve as reliable bio-markers of potential skin cancer.
  • the mutation fingerprint of the entire mtDNA genome in human NMSC and its precursor lesions is determined.
  • mtDNA changes are established as an early bio-marker of human skin cancer and its precursor lesions.
  • Denaturing HPLC can then be used to assess low levels of heteroplasmy at the sequences of interest. This approach can also provide an insight into the development of early changes in other human tumours.
  • a system for diagnosis of prostate cancer is provided.
  • Age related accumulation of mtDNA defects might predispose an individual to the appearance of certain clinical disorders such as prostate cancer which is prevalent in middle age and older men.
  • routine prostate cancer screening takes place through mitochondrial genome sequencing from prostate massage fluid.
  • the presence of epithelial cells transformed into cancer cells can be determined through amplification of mtDNA from prostate massage fluid, eclipsing current diagnostic techniques such as digital rectal examination and PSA.
  • the system and method of the present invention may be used to detect cancer, and in particular prostate cancer, at an early stage, and before any histological abnormalities.
  • the system and method of the present invention may be used to detect pre- neoplasia in prostate tissue.
  • the system can be used to detect the genesis and progression of prostate cancer. Mutations, including both subtle and hyper-mutation (Chen et al. 2002; Chen et al. 2003) in mitochondrial DNA from human prostate tissue, or fluid associated with the prostate (for example prostate massage fluid or urine), can be tested for the presence of neoplasia, and retested at intervals to follow cancer transformation, diagnose malignancy, or confirm continued benign status.
  • mutations are determined by comparison to mitochondria extracted from non-involved tissue such as, but not limited to: blood, urine, hair and buccal swabs. This direct comparison eliminates polymorphisms, matemal background or normal haplotype variation unassociated with disease.
  • the mutations can also be compared to mitochondrial sequences associated with inter and intrapopulation variations. One or more mutations from fluid or tissue of the organ or body system in question, indicates possible disease genesis. The person is then monitored, at successive intervals, for an increase in mutations at other sites, and/or an increase in the number of mutated mitochondrial genomes, indicating disease progression.
  • Benign tissue from the prostate cannot always be considered non-involved, i fact, as can be seen in Example 9, below, what appears to be benign tissue may contain mitochondrial mutations associated with pre-neoplasia, neoplasia, progression toward malignancy or malignancy.
  • mutation load rather than specific mutations may be instrumental in determining disease and progression of disease.
  • the system and method of the present invention detects heteroplasmic as well as homoplasmic mutations.
  • the prostate gland is monitored for mutations in the mitochondrial genome through prostate massage fluid (PMF) taken during an initial digital rectal examination (DRE) of the prostate. Cells within the PMF are concentrated, smeared on a slide and stained with PSA immunoperoxidase for identification of prostate epithelial cells.
  • PMF prostate massage fluid
  • DRE digital rectal examination
  • the mitochondrial DNA from these cells is analyzed and compared to mitochondrial DNA from non-involved tissue, and to sequences of inter and intrapopulation variations.
  • the DNA analysis can comprise sequencing of the mtDNA.
  • Total DNA is extracted from these cells and mitochondrial specific primers, designed for use with biopsy material treated with formalin (Table 5), are used to amplify the entire mtDNA genome with overlapping amplicons.
  • These PCR products are then sequenced by methods well known to those in the art, including DNA resequencing arrays. Sequencing results are screened for heteroplasmies and mutations and compared to a database of known mtDNA mutations associated with malignant and benign prostate tissues.
  • a designation is returned as to the condition of the prostate in regards to, but not limited to: benign (no mutations); pre-neoplasia or neoplasia (low level of mutations); or malignancy (high level of mutations).
  • benign, pre-neoplasia and neoplasia the prostate can be monitored for progression through regular PMF screenings as described.
  • biopsy material which has been diagnosed as benign, atypical, abnormal can undergo similar testing by either laser capture micro-dissection of the biopsy, or the tissue can be scrapped off the slides, followed by DNA extraction, amplification, sequencing and database comparison.
  • micro-array technology could be used to identify a specific pattern of mutations, or mutation load based on any number, or combination of the mutations listed in Table 4, through the construction of oligonucleotides, or a specific set of oligonucleotides.
  • Disease progression can be monitored by comparing mtDNA mutations at successive intervals to a database of mutations in mitochondrial genomes associated with pre-neoplasia, neoplasia and prostate cancer, including calculation of total mutation load.
  • Prostate biopsy tissue can be tested for pre-neoplasia, neoplasia and/or malignant progression in cells described clinically as benign, normal, atypical or abnormal by common histological pathological, or other clinical methods.
  • the system and method of the present invention may be used to assess aging, based on the increasing frequency of mutations such as the "common deletion" of 4977-bp and other mutations of the mitochondrial genome (Liu et al. 1997).
  • This information in conjunction with health survey data, allows crucial statistical discrimination between separate causes resulting in the same mutation/deletion.
  • mtDNA is inherited exclusively through the ovum and is essentially clonal in nature (Van De Graaff & Fox, 1995). This permits carefully controlled studies of mutations/deletions within maternal lines through several generations to determine a reliable age related deletion frequency. This information may be used to develop treatment methods which slow the aging process.
  • Biological samples can be collected by any known means, whether for the purpose of constructing a mtDNA sequence database, or performing a diagnostic test on an individual.
  • Samples destined for database generation include, but are not limited to: tumour banks, maternal lineage studies involving affected and unaffected individuals from the same matemal lineage, as well as maternal lineage studies from groups or populations with high frequencies of specific disease such as, but not limited to: skin and prostate cancer, assessment of health status and aging.
  • FT A ® Gene Cards ® may be used to collect and archive biological samples.
  • Suitable samples include any tissue or body fluid derived from mesothelium, epithelium, or endothelium.
  • Such tissues and fluids include, but are not limited to blood, sputum, buccal cells, saliva, prostate massage fluid, sweat, bone, hair, lymph tissue, cervical smears, breast aspirate, fecal matter, ejaculate, menstrual flow and biopsy tissue.
  • skin cells or tissue, (from normal, NMSC and precursor lesions) is taken from skin biopsy or a routine suction blistering technique.
  • primary care physicians, oncologists or other practitioners may extract both no ⁇ nal and suspected disease tissue from the patient.
  • HE hematoxylin and eosin
  • MG methyl green
  • HE stains are graded by a pathologist for no ⁇ nal, precursor, and applicable grades of tumour progression.
  • Replicate MG slides are used for laser capture, according to manufacturers recommendations (Arcturus) of graded cells.
  • Extraction of mtDNA Extraction of DNA may take place using any method known in the art, followed by sequencing of the mitochondrial genome, as described in Current Protocols in Molecular Biology.
  • the step of detecting the presence of mutations in the mtDNA can be selected from any technique as is known to those skilled in the art.
  • analyzing mtDNA can comprise sequencing the mtDNA, amplifying mtDNA by PCR, Southern, Northern, Western South-Westem blot hybridizations, denaturing HPLC, hybridization to microarrays, biochips or gene chips, molecular marker analysis, biosensors, melting temperature profiling or a combination of any of the above.
  • statistical techniques such as Inductive Rule Extraction, Neural Networking and Wave Analysis can be used.
  • PCR Polynucleotide sequences of the invention can be amplified by the polymerase chain reaction (PCR).
  • PCR methods are well-known to those skilled in the art. PCR requires the presence of a nucleic acid to be amplified, two single stranded oligonucleotide primers flanking the sequence to be amplified, a DNA polymerase, deoxyribonucleoside triphosphates, a buffer and salts.
  • the method of PCR is well known in the art. PCR is performed as described in Mullis and Faloona, 1987, Methods Enzymol., 155: 335, herein incorporated by reference. In general, PCR is performed using template DNA (at least lfg; more usefully, 1-
  • a typical reaction mixture includes: 2 ⁇ l of DNA, 25 pmol of oligonucleotide primer, 2.5 ⁇ of 10X PCR buffer 1 (Perkin-Elmer, Foster City, CA), 0.4 ⁇ l of 1.25 ⁇ M dNTP, 0.15 ⁇ l (or 2.5 units) of Taq DNA polymerase (Perkin Elmer, Foster City, CA) and deionized water to a total volume of 25 ⁇ l.
  • Mineral oil is overlaid and the PCR is performed using a programmable thermal cycler.
  • the length and temperature of each step of a PCR cycle, as well as the number of cycles, are adjusted according to the stringency requirements in effect.
  • Annealing temperature and timing are determined both by the efficiency with which a primer is expected to anneal to a template and the degree of mismatch that is to be tolerated.
  • the ability to optimize the stringency of primer annealing conditions is well within the knowledge of one of moderate skill in the art.
  • An annealing temperature of between 30°C and 72°C is used.
  • initial denaturation of the template molecules normally occurs at between 92°C and 99°C for 4 minutes, followed by 20-40 cycles consisting of denaturation (94-99°C for 15 seconds to 1 minute), annealing (temperature determined as discussed above; 1-2 minutes), and extension (72°C for 1 minute).
  • the final extension step is generally carried out for 4 minutes at 72°C, and may be followed by an indefinite (0-24 hour) step at 4°C.
  • DNA Sequencing Any known means to sequence the mitochondrial genome may be used.
  • mtDNA is amplified by PCR prior to sequencing.
  • PCR products can be sequenced directly or cloned into a vector which is then placed into a bacterial host. Examples of DNA sequencing methods are found in Brumley, R. L. Jr. and Smith, L.M., 1991, Rapid DNA sequencing by horizontal ultrathin gel electrophoresis, Nucleic Acids Res. 19:4121-4126 and Luckey, J.A., et al, 1993, High speed DNA sequencing by capillary gel electrophoresis, Methods Enzymol. 218: 154-172.
  • LX-PCR long extension PCR
  • Expand Long Template PCR system Boehringer Mannheim
  • a semi-quantitative PCR method can be used to estimate the proportion of the mtDNA 4977 deletion in the total mtDNA.
  • Southern Blot and probing technology labeled with isotopes or any other technique as is standard in the art may be used for deletion detection as well.
  • Sequencing of PCR products Any known means may be used to sequence the PCR products. Preferably, the entire DNA sequence is characterized by di-deoxy sequencing using ABI Big Dye TerminatorTM technology and a series of 72 overlapping primers each for heavy and light strands. Sequencing occurs on one, several, or a combination of ABI platforms such as the 310, 3100, or 3700. Sequencing reactions are performed according to manufacturer's recommendation.
  • DHPLC denaturing high performance liquid chromatography
  • Rapid screening for heteroplasmic mtDNA mutations is determined using the relatively new technique of denaturing high performance liquid chromatography (DHPLC) (Oefner & Underhill, 1998). This technique has recently been used to rapidly screen and identify whole mtDNA genomes for heteroplasmic point mutations down to levels ⁇ 5% (Van den Bosch et al. 2000).
  • the DHPLC may be performed on the WANETM D ⁇ A Fragment Analysis System (Transgenomic, Omaha, USA) which provides a fully automated screening procedure.
  • the same technology can be used to screen for mfD ⁇ A heteroplasmic mutations.
  • the entire mtD ⁇ A genome is amplified by PCR in 13 overlapping fragments using two different PCR conditions as described by van den Bosch et al.
  • the 1-2 kb PCR products are digested into fragments of 90-600bp and resolved at their optimal melting temperature. Mutations are represented as two peaks and mutations with low percentages, such as ⁇ 2% heteroplasmy as a 'shoulder' in the peak.
  • D ⁇ A sequencing can also take place using a microarray, as is known in the art (Chee et al. 1996).
  • a multidimensional evaluation research database of clinical and biological data is used, which provides the bio-informatics infrastructure necessary for the collection, processing and dissemination of information amassed by the laboratories involved in this venture.
  • the database is a centralized electronic system which links networks resulting in a dynamic and powerful resource.
  • the database may be accessed through any known means, and preferably through a secure Internet pathway.
  • the database is developed using an e-commerce algorithm, built on a server and deployed using an application server which supports a high volume of concurrent users through optimized performance and scalability features.
  • a separate "web” server can provide the foundation of the web-site architecture since it can serve as the central point through which all content, applications, and transactions must flow before reaching users.
  • Data mining algorithms known in the art are used to discover patterns, clusters and models from data (SAS 2000). Moreover, intelligent algorithms and methods will be developed for: occurrence of mutation and mutation rates, patterns of mutations for disease detection, information retrieval, and other complex sequence analysis software.
  • the invention provides for nucleic acid members and probes that bind specifically to a target nucleic acid sequence.
  • the target nucleic acid sequence is a nucleic acid or a region of a nucleic acid that is to be detected, as indicative of disease such as prostate cancer, non-melanoma skin cancer and the like.
  • the target nucleic acid sequences to be analyzed using a microarray of the invention are preferably derived from human tissue or fluid samples.
  • the invention provides for target nucleic acid sequences comprising RNA or nucleic acid co ⁇ esponding to RNA, (i.e., cDNA), or DNA.
  • Nucleic acid members are stably associated with a solid support to comprise an a ⁇ ay according to the invention.
  • the nucleic acid members may be single or double stranded, and may be a PCR fragment amplified from cDNA.
  • the invention also provides for polynucleotide sequences comprising a probe.
  • probe refers to an oligonucleotide which forms a duplex structure with a sequence in the target nucleic acid, due to complementarity of at least one sequence in the probe with a sequence in the target region.
  • the probe may be labeled, according to methods known in the art.
  • a probe according to the invention may be single or double stranded. Diagnostic devices
  • the invention includes diagnostic devices such as biochips, gene chips or microarrays used to diagnose specific diseases or identify specific mutations.
  • All sequenced mitochondrial genomes are assessed to create a conseiius structure of the base pair arrangement and are assigned a prohibiting index for proportion of base pair deletions and mutations associated with a particular disease or disorder.
  • the diagnostic arrangement is then used to create biochips, gene chips, or microarrays.
  • hybridization of mtDNA to an array of oligonucleotides can be used to identify particular mutations. Any known method of hybridization may be used.
  • an array is used, which has oligonucleotide probes matching the wild type or mutated region, and a control probe.
  • Commercially available arrays such as microarrays or gene chips are suitable. These arrays contain thousands of matched and control pairs of probes on a slide or microchip, and are capable of sequencing the entire genome very quickly. Review articles describing the use of microarrays in genome and DNA sequence analysis is available at www.gene-chips.com.
  • Microarray Polynucleotide arrays provide a high throughput technique that can assay a large number of polynucleotides in a sample comprising one or more target nucleic acid sequences.
  • the arrays of the invention are useful for gene expression analysis, diagnosis of disease and prognosis of disease (e.g., monitoring a patient's response to therapy, drug screening, and the like).
  • the target nucleic acid samples to be analyzed using a microarray are derived from any human tissue or fluid which contains adequate amounts of mtDNA, as previously described, preferably prostate massage fluid, solid tumours, blood, or urine.
  • the target nucleic acid samples are contacted with polynucleotide members under hybridization conditions sufficient to produce a hybridization pattern of complementary nucleic acid members/target complexes.
  • the microarray comprises a plurality of unique polynucleotides attached to one surface of a solid support, wherein each of the polynucleotides is attached to the surface of the solid support in a non-identical preselected region.
  • Each associated sample on the array comprises a polynucleotide composition, of known identity, usually of known sequence, as described in greater detail below. Any conceivable substrate may be employed in the invention.
  • the array is constructed using any known means.
  • the nucleic acid members may be produced using established techniques such as polymerase chain reaction (PCR) and reverse transcription (RT). These methods are similar to those currently known in the art (see e.g. PCR Strategies, Michael A. Innis (Editor), et al. (1995) and PCR: Introduction to Biotechniques Series, C. R. Newton, A. Graham (1997)).
  • Amplified polynucleotides are purified by methods well known in the art (e.g., column purification). A polynucleotide is considered pure when it has been isolated so as to be substantially free of primers and incomplete products produced during the synthesis of the desired polynucleotide.
  • a purified polynucleotide will also be substantially free of contaminants which may hinder or otherwise mask the binding activity of the molecule.
  • the polynucleotide compositions are stably associated with the surface of a solid support, wherein the support may be a flexible or rigid solid support.
  • any solid support to which a nucleic acid member may be attached may be used in the invention.
  • suitable solid support materials include, but are not limited to, silicates such as glass and silica gel, cellulose and nitrocellulose papers, nylon, polystyrene, polymethacrylate, latex, rubber, and fluorocarbon resins such as TEFLONTM.
  • the solid support material may be used in a wide variety of shapes including, but not limited to slides and beads. Slides provide several functional advantages and thus are a preferred form of solid support. Due to their flat surface, probe and hybridization reagents are minimized using glass slides.
  • Slides also enable the targeted application of reagents, are easy to keep at a constant temperature, are easy to wash and facilitate the direct visualization of RNA and/or DNA immobilized on the solid support. Removal of RNA and/or DNA immobilized on the solid support is also facilitated using slides.
  • the particular material selected as the solid support is not essential to the invention, as long as it provides the described function. Normally, those who make or use the invention will select the best commercially available material based upon the economics of cost and availability, the expected application requirements of the final product, and the demands of the overall manufacturing process. Numerous methods are used for attachment of the nucleic acid members of the invention to the substrate (a process refe ⁇ ed as spotting). For example, polynucleotides are attached using the techniques of, for example U.S. Pat. No. 5,807,522, which is incorporated herein by reference for teaching methods of polymer attachment. Alternatively, spotting is carried out using contact printing technology.
  • each composition will be sufficient to provide for adequate hybridization and detection of target polynucleotide sequences during the assay in which the a ⁇ ay is employed.
  • the amount of each nucleic acid member stably associated with the solid support of the array is at least about 0.1 ng, preferably at least about 0.5 ng and more preferably at least about 1 ng, where the amount may be as high as 1000 ng or higher, but will usually not exceed about 20 ng.
  • the diameter of the "spot” will generally range from about 10 to 5,000 ⁇ m, usually from about 20 to 2,000 ⁇ m and more usually from about 50 to 1000 ⁇ m.
  • Control polynucleotides may be spotted on the a ⁇ ay and used as target expression control polynucleotides and mismatch control nucleotides to monitor non-specific binding or cross-hybridization to a polynucleotide in the sample other than the target to which the probe is directed.
  • Mismatch probes thus indicate whether a hybridization is specific or not. For example, if the target is present the perfectly matched probes should be consistently brighter than the mismatched probes, hi addition, if all central mismatches are present, the mismatch probes are used to detect a mutation.
  • Target preparation The targets for the microa ⁇ ays, are derived from human fluid or tissue samples. It may be desirable to amplify the target nucleic acid sample prior to hybridization.
  • amplification method is used, if a quantitative result is desired, care must be taken to use a method that maintains or controls for the relative frequencies of the amplified polynucleotides.
  • Methods of "quantitative" amplification are well known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction.
  • the high density a ⁇ ay may then include probes specific to the internal standard for quantification of the amplified polynucleotide.
  • PCR Protocols A Guide to Methods and Applications, Innis et al., Academic Press, Inc. N.Y., (1990).
  • Other suitable amplification methods include, but are not limited to polymerase chain reaction (PCR) (Innis, et al., PCR Protocols. A guide to Methods and Application. Academic Press, Inc.
  • LCR ligase chain reaction
  • the invention provides for labeled target or labeled probe.
  • Any analytically detectable marker that is attached to or incorporated into a molecule may be used in the invention.
  • An analytically detectable marker refers to any molecule, moiety or atom which is analytically detected and quantified.
  • Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DynabeadsTM), fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, and the like), radiolabels (e.g., 3 H, 125 I, 35S, 14 C, or 32 P), enzymes (e.g., horseradish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
  • Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
  • radiolabels may be detected using photographic film or scintillation counters
  • fluorescent markers may be detected using a photodetector to detect emitted light
  • Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visualizing the colored label.
  • the labels may be incorporated by any of a number of means well known to those of skill in the art. However, in a prefe ⁇ ed embodiment, the label is simultaneously incorporated during the amplification step in the preparation of the sample polynucleotides.
  • PCR polymerase chain reaction
  • a labeled nucleotide e.g. fluorescein- labeled UTP and/or CTP
  • a label may be added directly to the original polynucleotide sample (e.g., mRNA, polyA mRNA, cDNA, etc.) or to the amplification product after the amplification is completed.
  • Means of attaching labels to polynucleotides are well known to those of skill in the art and include, for example nick translation or end-labeling (e.g. with a labeled RNA) by kinasing of the polynucleotide and subsequent attachment (ligation) of a polynucleotide linker joining the sample polynucleotide to a label (e.g., a fluorophore).
  • the target will include one or more control molecules which hybridize to control probes on the microarray to normalize signals generated from the microa ⁇ ay.
  • Labeled normalization targets are polynucleotide sequences that are perfectly complementary to control oligonucleotides that are spotted onto the microa ⁇ ay as described above.
  • the signals obtained from the normalization controls after hybridization provide a control for variations in hybridization conditions, label intensity, "reading" efficiency and other factors that may cause the signal of a perfect hybridization to vary between arrays.
  • Polynucleotide hybridization involves providing a denatured probe or target nucleic acid member and target polynucleotide under conditions where the probe or target nucleic acid member and its complementary target can form stable hybrid duplexes through complementary base pairing. The polynucleotides that do not form hybrid duplexes are then washed away leaving the hybridized polynucleotides to be detected, typically through detection of an attached detectable label. It is generally recognized that polynucleotides are denatured by increasing the temperature or decreasing the salt concentration of the buffer containing the polynucleotides.
  • hybrid duplexes e.g., DNA:DNA, RNA:RNA, RNA:DNA, cDNA:RNA and cDNA:DNA
  • hybrid duplexes e.g., DNA:DNA, RNA:RNA, RNA:DNA, cDNA:RNA and cDNA:DNA
  • specificity of hybridization is reduced at lower stringency.
  • higher stringency e.g., higher temperature or lower salt
  • Methods of optimizing hybridization conditions are well known to those of skill in the art (see, e.g., Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 24: Hybridization With Polynucleotide Probes, P. Tijssen, ed. Elsevier, N.Y., (1993)).
  • non-hybridized labeled or unlabeled polynucleotide is removed from the support surface, conveniently by washing, thereby generating a pattern of hybridized target polynucleotide on the substrate surface.
  • wash solutions are known to those of skill in the art and may be used.
  • the resultant hybridization patterns of labeled, hybridized oligonucleotides and/or polynucleotides may be visualized or detected in a variety of ways, with the particular manner of detection being chosen based on the particular label of the test polynucleotide, where representative detection means include scintillation counting, autoradiography, fluorescence measurement, calorimetric measurement, light emission measurement and the like.
  • the resultant hybridization pattern is detected, hi detecting or visualizing the hybridization pattern, the intensity or signal value of the label will be not only be detected but quantified, by which is meant that the signal from each spot of the hybridization will be measured and compared to a unit value co ⁇ esponding to the signal emitted by a known number of end labeled target polynucleotides to obtain a count or absolute value of the copy number of each end-labeled target that is hybridized to a particular spot on the a ⁇ ay in the hybridization pattern.
  • data analysis can include the steps of determining fluorescent intensity as a function of substrate position from the data collected, removing outliers, i.e., data deviating from a predetermined statistical distribution, and calculating the relative binding affinity of the test polynucleotides from the remaining data.
  • the resulting data is displayed as an image with the intensity in each region varying according to the binding affinity between associated oligonucleotides and/or polynucleotides and the test polynucleotides.
  • the hybridization pattern is used to determine quantitative information about the genetic profile of the labeled target polynucleotide sample that was contacted with the a ⁇ ay to generate the hybridization pattern, as well as the physiological source from which the labeled target polynucleotide sample was derived.
  • genetic profile is meant information regarding the types of polynucleotides present in the sample, e.g. in terms of the types of genes to which they are complementary, as well as the copy number of each particular polynucleotide in the sample.
  • the invention provides for diagnostic tests for detecting diseases.
  • the invention also provides for prognostic tests for monitoring a patient's response to therapy.
  • the presence of disease or the patient's response to therapy is detected by obtaining a fluid or tissue sample from a patient.
  • a sample comprising nucleic acid is prepared from the fluid or tissue sample.
  • the nucleic acid extracted from the sample is hybridized to an a ⁇ ay comprising a solid substrate and a plurality of nucleic acid members, wherein each member is indicative of the presence of disease or a predisposition to a disease or disorder.
  • hybridization of the sample comprising nucleic acid to one or more nucleic acid members on the a ⁇ ay is indicative of disease, a predisposition to a disease or disorder, or in the case of a prognostic test, indicative of a patient's response to therapy.
  • Kits containing reagents and instructions to carry out the methods of the present invention are provided.
  • the kit may comprise reagents and instructions for detecting mitochondrial mutations, heteroplasmies, homoplasmies in tissue specific samples and tissue associated fluids.
  • the kits may also comprise one or more primers which hybridize to the mitochondrial genome for making a primer extension product.
  • Kits may also include a disposable chip, means for holding the disposable chip, means for extraction of mtDNA and means for access to a database of mtDNA sequences.
  • Example 1 Prostate Tumours Following acquisition of prostate fluid or surgery to remove prostate tumours, biopsy slides are prepared to identify transforming or cancerous cells. Laser Capture Microdissection (LCM) microscopy is used to isolate cells that are either normal, benign, or malignant from the tissue section. Procurement of diseased cells of interest, such as precancerous cells or invading groups of cancer cells is possible from among the su ⁇ ounding heterogeneous cells. Total DNA extraction from each of these cells was purified according to a modification of the protocol outlined by Arcturus Engineering Inc.
  • LCM Laser Capture Microdissection
  • PK proteinase K
  • prostate tissues which could and are amplified includes: prostatic intraepithelial neoplasia (PIN), benign prostatic hyperplasia (BPH), hype ⁇ lasia of various types, stroma, and cells with undetermined changes.
  • PIN prostatic intraepithelial neoplasia
  • BPH benign prostatic hyperplasia
  • hype ⁇ lasia of various types stroma
  • cells with undetermined changes This work was done on prostate tissues from 31 individuals electing to have a prostatectomy because of a prostate cancer diagnosis. Three tissue types were captured: malignant, adjacent benign and distant benign from each individual. Blood from each patient was used as a positive, non-diseased tissue control. Amplification and sequencing of these samples resulted in the novel mutations seen in Table 4.
  • SEQ LO No: 102 which lists the substitutions
  • SEQ ID NOs: 103 to 109 which lists the deletions
  • SEQ ID No: 110 to 138 which lists the insertions.
  • Polymorphisms and mutation positions were determined by comparison to the Revised Cambridge Reference Sequence (2001), however the historical numbering has been maintained such that the deletion at position 3106 is denoted as a gap and the rare polymo ⁇ hism 750A has been retained.
  • a subset of this data (7 protein coding regions) was then subjected to principal component analysis, as is standard in the art, with the following results as shown in Table la:
  • Example 2 Duplications in the non-coding region of mtDNA from sun-exposed skin DNA was extracted from tissue samples as described in Example 1, with the use of
  • NCR non-coding region
  • Primers pairs C/D and E/F are 'back to back' at the site of two separate sets of direct repeats in the non-coding region. As a result they only generate a product if a duplication is present at these points. Products generated are 260 bp and/or less common 200bp variant.
  • Modified PCR conditions are: lOOng total cellular DNA, 200 ⁇ M dNTPs, 2.5 U HotStarTaq polymerase and PCR buffer (Qiagen, Uk), 25 pmoles of primers: one cycle of 94°C for 4 minutes, 36 cycles of 94 °C x 1 minute, 55°C x 1 minute, 72°C x 1 minute and one cycle of 72°C x 7 minutes.
  • Example 3 Mutation fingerprint of mtDNA in human NMSC and its precursor lesions DNA was extracted from human skin tissue samples as described in Example 1, with the use of DNeasyTM by Qiagen Using specific primers, mtDNA is amplified by PCR and following DNA sample preparation (Qiagen), mutations are identified by automated sequencing (PE Applied Biosystems) using BigDyeTM Terminator Cycle sequencing. This methodology is described in Healy et al. 2000; Harding et al. 2000. The entire 16,569bp human mitochondrial genome is sequenced using established PCR primer pairs, which are known not to amplify pseudogenes, or other nuclear loci.
  • DHPLC is performed on the WAVETM DNA Fragment Analysis System (Transgenomic, Omaha, USA) which provides a fully automated screening procedure. The same technology is used to screen for heteroplasmic mutations in the skin tumour mtDNA. Using the back to back primer methodology described in Example 2, the pattern of
  • DNA length mutations i.e. tandem duplications
  • NCR non- coding region
  • Example 4 deletion spectrum of the entire mitochondrial genome in human NMSC and its precursor lesions MtDNA damage in squamous cell carcinomas (SCCS), Basal cell carcinomas (BCCS) and putative precursor lesions such as Bowen's disease and actinic keratoses (As) was compared to adjacent perilesional skin taken from different sun-exposed body sites.
  • a long-extension PCR technique (LX-PCR) (Ray et al. 1998) was used to amplify the entire mitochondrial genome in order to determine the whole deletion spectrum of mtDNA.
  • LX-PCR Long-extension PCR technique
  • DNA is extracted by use of a commercial kit (Qiangen) according to the manufacturer's recommendations.
  • the entire mitochondrial genome is amplified in two separate reactions using the Expand TM Long Template PCR SystemTM (Boehringer Manheim, Switzerland).
  • the PCR primers used are those described by Kleinle et al. (1997) covering the following regions of the Cambridge sequence (Andrews et al. 1999): DIA(nucleotides (nt) 336-363), DIB (nt 282-255), OLA (nt 5756-5781), and OLB (nt 5745- 5781). These large products eliminate amplification of nuclear pseudogenes.
  • the sequences of the primers are as follows:
  • DIAF (336-363) 5' AACACATCTCTGCCAAACCCCAAAAACA 3' SEQ ID NO: 5
  • OLBR (5745-5721) 5' CCGGCGGCGGGAGAAGTAGATTGAA 3' SEQ ID NO: 6
  • OLAF (5756-5781) 5' GGGAGAAGCCCCGGCAGGTTTGAAGC 3' SEQ ID NO: 7
  • DD3R (282-255) 5' ATGATGTCTGTGTGTGGAAAGTGGCTGTGC 3* SEQ ID NO: 8
  • Amplifications are performed in 50 microlitre reactions containing 16 pmol of each primer, 500 ⁇ mol dNTPs, 10 x PCR buffer with 22.5mM MgCl 2 and detergents(kit), 0.75 ⁇ l of enzyme (3.5 x 10 3 units/ml) and 50-200ng of total DNA.
  • One reaction generates 1 l,095bp segments of the genome, while another results in 5,409bp lengths (e.g. Kleinle et al, 1997).
  • the PCR amplification conditions consists of a denaturing stage at 93°C for 1 min 30s, followed by 10 cycles of 93°C for 30s, 60°C for 30s and 68°C for 12 min, followed by a further 20 cycles of the same profile with an additional 5s added to the elongation time every cycle. There is a final cycle of 93°C for 30s, 60°C for 30s and an elongation time of 68°C for 26 minutes.
  • a known amount of DNA is separated on a 1% agarose gel and only samples which have at least the same amount of DNA are included in the analysis.
  • Example 5 Aging and MtD ⁇ A Using temporal maternal line comparisons (i.e. great-grandchild through great- grand parents), the entire sequence of mtD ⁇ A extracted from a given tissue is rapidly, and accurately sequenced, in order to definitively state the a ⁇ angement of nucleotide base pairs for that specific molecule and possible changes through time. These characterizations are compared to health status, aging indicators and between specific maternal lines, within larger populations.
  • the next step measures only mtD ⁇ A in leukocytes. MtD ⁇ A deletions/mutations are then determined as previously described.
  • Amplifications were performed in 50 microlitre reactions containing 2.0 ⁇ mol of each primer, 250 ⁇ mol dNTPs, 10 x PCR buffer(Thermopol Reaction Buffer), bovine serum albumin, 0.5units Deep vent polymerase and 50-200ng of total DNA.
  • the PCR amplification conditions consists of a denaturing stage at 95 °C for 5 min (hot start), followed by 30 cycles of 94°C for 30s, 60°C for 60s and 72°C for 30s with a final extension at 72°C for 10 min.
  • Gel electrophoresis was performed on a 2% agarose gel at 125 volts for 60 min, stained with ethidium bromide, and visualized under UN light. To ensure reproducibility, a known amount of D ⁇ A was separated on a 2% agarose gel and only samples which have the same amount of D ⁇ A were included in the analysis.
  • Example 6 Quantitative detection of the 4977bp common mtD ⁇ A deletion by 3-primer PCR Where appropriate the incidence of the common deletion is determined in a quantitative manner by a 3-primer PCR method which detects levels greater than 1-5% or a dilution PCR method which detects levels less than 1 % down to 10 "4 %.
  • Samples are obtained and D ⁇ A extracted as described in Example 1.
  • a 3-primer PCR procedure is used (as described in Birch-Machin et al 1998).
  • Primers A, and C co ⁇ espond to heavy strand positions 13720-13705 and 9028-9008 respectively (Anderson et al., 1981); primer B co ⁇ esponds to light strand positions 8273- 8289.
  • Primer C maps to a mtD ⁇ A region within the common deletion, whereas primers A and B flank the deleted region. Therefore primers B and C only amplify wt-mtD ⁇ As and primers A and B only amplify deleted mtD ⁇ As (the distance between the two primers in the absence of the deletion, approximately 5.5kb, is too long to be amplified under our PCR conditions as described below).
  • the PCR reaction mixture (25 ⁇ l total volume) contained lOOng total cellular DNA, 200 ⁇ M dNTPs, lOmM Tris-HCl (pH 8.8), 50mM KCl, 1.5mM Mg Cl 2 , 0.1% Triton X-100, 2.5U Taq DNA polymerase (BioTaq, BiolineUK Limited, London), 25 pmoles of primers A and B, 6.25 pmoles of primer C and 3 ⁇ Ci of [ ⁇ - 32 P]-dATP.
  • the PCR conditions were 25 cycles of 94°C at 1 minute, 55°C at 1 minute, 72°C at 2 minutes including a final extension of 15 minutes at 72°C.
  • These PCR products were then electrophoresed through a 6% nondenaturing polyacrylamide gel and the radioactive PCR fragments were quantified by phophorimage analysis using the ImageQuantTM software (Molecular Dynamics, Chesham UK).
  • Example 7 Serial Dilution PCR method to quantitatively detect low levels ( ⁇ 1%) of the common mtDNA deletion
  • a semi-quantitative PCR method (Co ⁇ al-Debrinski et al 1991) is used to estimate the proportion of the common deletion in the total mtDNA extracted from the tissue/cell samples.
  • Biological samples are obtained and DNA extracted as described in Example 1.
  • the DNA sample is initially linearised using the restriction enzyme Bam HI (l ⁇ l enzyme and l ⁇ l of commercially supplied buffer) at 37°C for 90 minutes.
  • Serial dilutions are performed in two-fold steps (for total mtDNA there was an initial 10-fold dilution) and PCR performed for each dilution (l ⁇ l) using the following primers:
  • PCR reactions are carried out in the following mixture (50 ⁇ l): Sample DNA l ⁇ l, 0.6 ⁇ M forward primer, 0.6 ⁇ M reverse primer, 0.2mM dNTP's, 5 ⁇ l GeneAmp® lOx PCR Buffer, (Perkin Elmer), 0.2 ⁇ l Amplitaq® DNA polymerase (Perkin Elmer), 35.75 ⁇ l sterile autoclaved double distilled water.
  • the PCR productes are visualised on a UN transilluminator (TMW-20, Flowgen Ltd., Lichfield, UK) and a digital image of the gel obtained using image acquisition apparatus (Alpha hnager 2000, Alpha hmotech Co ⁇ oration, supplied by Flowgen Ltd., Lichfield, UK).
  • image acquisition apparatus Alpha hnager 2000, Alpha hmotech Co ⁇ oration, supplied by Flowgen Ltd., Lichfield, UK.
  • the associated image analysis software (Alpha Ease v3.3, Alpha hmotech Co ⁇ .) allows the calculation of the integrated optical density (IOD) for each PCR product in a dilution series.
  • Example 8 Denaturing high performance liquid chromatography (DHPLC ) Samples are obtained and D ⁇ A extracted as in Example 1. PCR in 13 overlapping fragments using two different PCR conditions as described by van den Bosch et al. (2000). The following three mtD ⁇ A specific primer pairs for PCR: i. Oligo Sequence Mt3118F CCCTGTACGAAAGGACAAGAG SEQ ID NO: 13 Mt3334R TGAGGAGTAGGAGGTTGG SEQ ID NO: 14
  • DHPLC is performed with a mobile phase consisting of two eluents (pH 7.0).
  • Buffer A contains triethylammonium acetate (TEAA), which interacts with both the negatively charged phosphate groups on the DNA as well as the surface of the column.
  • Buffer B contains TEAA with 25% of the denaturing agent acetonitrile. Fragments were eluted with a linear acetonitrile gradient at a constant flow rate. Increasing the concentration of acetonitrile will denature the fragments.
  • Table 3 is an example of a standard method for DHPLC of a PCR reaction generated using the WANEMAKER software (Transgenomics) according to manufacturer's instructions.
  • the numbering of the bases is based on the revised Cambridge Reference Sequence having a total of 16569 base positions.
  • a histogram showing the number of mutations per location of the mitochondrial genome is shown in Figure 1. As can be seen in Figure 1, the mutations were found throughout the mtDNA genome and in all diseased prostates. However, certain "hot spots" were also apparent, for example in the D-loop region and the 16s region. These data sets imply that the designation of malignant or benign tissue, as made by a qualified pathologist using routine histological methods and grading standards, does not identify early disease progression. This strongly suggests that malignant transformation begins at the cellular level before the mo ⁇ hological characteristics of a cell are altered.
  • the mutation patterns are completely inconsistent for matched prostate tissue from an individual patient, or in comparison to another patient, perhaps indicating possible tissue sites where clonal expansion of malignant cells may occur.
  • separate needle biopsies with the same Gleason score, from the same individual almost always demonstrate alternative mtDNA mutation patterns. This indicates that total mutation load rather than specific mutation sites may be more representative of the disease and progression of the disease. Since this data was gathered from individuals with known prostate cancer, and in the prostatectomy group with known advanced staging, it is likely that histologically benign tissue has undergone some intracellular transformation(s) associated with neoplasia and possible progression towards malignancy.
  • Benign tissue harboring mtDNA mutations serve as a "biosensor" which can be monitored for increasing mutations indicative of the rate of disease progression. This rate may also indicate tumor aggression. Moreover, the effectiveness of a specific therapy could also be monitored based on the change in this mutational pattern.
  • This technique may be used as a confirmatory test for benign needle biopsies. Cu ⁇ ently when a patient has a needle biopsy performed on the prostate and the tissue looks histologically benign he is sent home and is usually scheduled for follow-up needle biopsies in six months.
  • Birch-Machin MA et al., Methods in Toxicology, Volume 2, 51-69,1993
  • Birch-Machin MA et al., J.Invest.Dermatol., 110:149-152 1998
  • Birch-Machin MA Online Conference Report (Sunburnt DNA), International Congress of Biochemistry and Molecular Biology, New Scientist, 2000(a)
  • MITOMAP A human mt genome database (www, gen. emory. edu/mitomap .html)
  • Weinstock MA In: JJ Stem RS, MacKie RM and Weinstock MA, Grab (eds) Epidemiology, Blackwell (UK). p ⁇ l21-128, 1998
  • Woodwell DA National Ambulatory Medical Care Survey: 1997 Summary. Advance data from vital and health statistics; no. 305. Hyattsville, Maryland: National Center for Health Statistics. 1999

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Evolutionary Biology (AREA)
  • Theoretical Computer Science (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Physiology (AREA)
  • Ecology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'examen de mutations dans le génome mitochondrial est utilisé comme un système de diagnostic pour des maladies, telles que le cancer de la prostate et le cancer de la peau non-mélanome. Des mutations et des réarrangements caractéristiques, notamment des mutations ponctuelles (transitions, transversions), des effacements, des inversions, des duplications, des recombinaisons, des insertions ou des combinaisons de ceux-ci dans le génome mitochondrial, sont utilisés comme indicateurs précoces du cancer de la prostate et du cancer de la peau non-mélanome. De plus, le bp 4977 ou 'l'effacement commun', ainsi que d'autres mutations et/ou effacements associés sont utilisés comme mesure du vieillissement.
PCT/CA2004/002124 2001-06-11 2004-12-13 Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante WO2005056573A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CA002550135A CA2550135A1 (fr) 2003-12-11 2004-12-13 Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante
EP04802299A EP1694695A4 (fr) 2003-12-11 2004-12-13 Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante
US11/339,751 US20070190534A1 (en) 2001-06-11 2006-01-26 Mitochondrial sites and genes associated with prostate cancer

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
PCT/CA2002/000848 WO2002101086A2 (fr) 2001-06-11 2002-06-10 Sequences completes du genome mitochondrial servant d'outil diagnostique dans les sciences de la sante
US10/732,374 2003-12-11
US10/732,374 US20050026167A1 (en) 2001-06-11 2003-12-11 Complete mitochondrial genome sequences as a diagnostic tool for the health sciences

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/732,374 Continuation-In-Part US20050026167A1 (en) 2001-06-11 2003-12-11 Complete mitochondrial genome sequences as a diagnostic tool for the health sciences

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/339,751 Continuation-In-Part US20070190534A1 (en) 2001-06-11 2006-01-26 Mitochondrial sites and genes associated with prostate cancer

Publications (1)

Publication Number Publication Date
WO2005056573A1 true WO2005056573A1 (fr) 2005-06-23

Family

ID=36693286

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2004/002124 WO2005056573A1 (fr) 2001-06-11 2004-12-13 Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante

Country Status (3)

Country Link
EP (1) EP1694695A4 (fr)
CA (1) CA2550135A1 (fr)
WO (1) WO2005056573A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1897958A2 (fr) * 2006-09-07 2008-03-12 Genocheck Co., Ltd. Procédé, sonde polynucléotide, puce ADN et kit pour l'identification d'une mutation d'ADN mitochondrial humain
WO2009059414A1 (fr) * 2007-11-09 2009-05-14 Genesis Genomics Inc. Suppression de mutations d'adn mitochondrial entre les résidus 12317-16254 pour une utilisation dans la détection d'un cancer
WO2019241273A1 (fr) * 2018-06-11 2019-12-19 The Broad Institute, Inc. Suivi de lignée à l'aide de mutations du génome mitochondrial et de la génomique cellulaire unique
CN114350778A (zh) * 2021-12-14 2022-04-15 迈基诺（重庆）基因科技有限责任公司 用于检测线粒体环基因突变的引物对、试剂盒及检测方法

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998023632A1 (fr) * 1996-11-27 1998-06-04 Mitokor Procede optimise servant a isoler des alleles mitochondriaux mutants
JPH11113597A (ja) * 1997-10-13 1999-04-27 Masatsugu Tanaka ヒトミトコンドリアｄｎａを用いた遺伝子診断方法
WO2000063441A2 (fr) * 1999-04-20 2000-10-26 Mitokor Polymorphismes de nucleotides simples dans des genes mitochondriaux qui segregent avec la maladie d'alzheimer
US6344322B1 (en) * 1998-08-20 2002-02-05 The Johns Hopkins University Subtle mitochondrial mutations as tumor markers
WO2002022873A1 (fr) * 2000-09-15 2002-03-21 Ulf Gyllensten Procede et trousse permettant de determiner l'origine geographique ou demographique d'un etre humain
EP1266970A2 (fr) * 2001-06-11 2002-12-18 Ortho-Clinical Diagnostics, Inc. Détécter des séquences d'acides nucléiques délétés
WO2002101086A2 (fr) * 2001-06-11 2002-12-19 1304854 Ontario Ltd. Sequences completes du genome mitochondrial servant d'outil diagnostique dans les sciences de la sante

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE0200817D0 (sv) * 2002-03-15 2002-03-15 Ulf Gyllensten Method and kit for detection of mutations in mitochondrial DNA

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998023632A1 (fr) * 1996-11-27 1998-06-04 Mitokor Procede optimise servant a isoler des alleles mitochondriaux mutants
JPH11113597A (ja) * 1997-10-13 1999-04-27 Masatsugu Tanaka ヒトミトコンドリアｄｎａを用いた遺伝子診断方法
US6344322B1 (en) * 1998-08-20 2002-02-05 The Johns Hopkins University Subtle mitochondrial mutations as tumor markers
WO2000063441A2 (fr) * 1999-04-20 2000-10-26 Mitokor Polymorphismes de nucleotides simples dans des genes mitochondriaux qui segregent avec la maladie d'alzheimer
WO2002022873A1 (fr) * 2000-09-15 2002-03-21 Ulf Gyllensten Procede et trousse permettant de determiner l'origine geographique ou demographique d'un etre humain
EP1266970A2 (fr) * 2001-06-11 2002-12-18 Ortho-Clinical Diagnostics, Inc. Détécter des séquences d'acides nucléiques délétés
WO2002101086A2 (fr) * 2001-06-11 2002-12-19 1304854 Ontario Ltd. Sequences completes du genome mitochondrial servant d'outil diagnostique dans les sciences de la sante

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEN J.Z. ET AL.: "Extensive somatic mitochondrial mutations in primary prostate cancer using laser capture microdissection", CANCER RESEARCH, vol. 62, no. 22, 15 November 2002 (2002-11-15), pages 6470 - 6474, XP003019067 *
CHEN J.Z. ET AL.: "Simultaneous generation of multiple mitochondrial DNA mutations in human prostate tumors suggests mitochondrial hyper-mutagenesis", CARCINOGENESIS, vol. 24, no. 9, September 2003 (2003-09-01), pages 1481 - 1487, XP003019068 *
JERONIMO C. ET AL.: "Mitochondrial mutations in early stage prostate cancer and bodily fluids", ONCOGENE, vol. 20, 2001, pages 5195 - 5198, XP009012216 *
See also references of EP1694695A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1897958A2 (fr) * 2006-09-07 2008-03-12 Genocheck Co., Ltd. Procédé, sonde polynucléotide, puce ADN et kit pour l'identification d'une mutation d'ADN mitochondrial humain
EP1897958A3 (fr) * 2006-09-07 2008-04-30 Genocheck Co., Ltd. Procédé, sonde polynucléotide, puce ADN et kit pour l'identification d'une mutation d'ADN mitochondrial humain
WO2009059414A1 (fr) * 2007-11-09 2009-05-14 Genesis Genomics Inc. Suppression de mutations d'adn mitochondrial entre les résidus 12317-16254 pour une utilisation dans la détection d'un cancer
EP3409793A1 (fr) * 2007-11-09 2018-12-05 MDNA Life Sciences Inc. Suppression de mutations d'adn mitochondrial entre les résidus 12317-16254 pour une utilisation dans la détection d'un cancer
US10400290B2 (en) 2007-11-09 2019-09-03 Mdna Life Sciences, Inc. Mitochondrial DNA deletion between about residues 12317-16254 for use in the detection of cancer
WO2019241273A1 (fr) * 2018-06-11 2019-12-19 The Broad Institute, Inc. Suivi de lignée à l'aide de mutations du génome mitochondrial et de la génomique cellulaire unique
US12012633B2 (en) 2018-06-11 2024-06-18 The Broad Institute, Inc. Lineage tracing using mitochondrial genome mutations and single cell genomics
CN114350778A (zh) * 2021-12-14 2022-04-15 迈基诺（重庆）基因科技有限责任公司 用于检测线粒体环基因突变的引物对、试剂盒及检测方法
WO2023108865A1 (fr) * 2021-12-14 2023-06-22 迈基诺（重庆）基因科技有限责任公司 Paire d'amorces, kit et procédé de détection de la mutation du gène de la boucle mitochondriale

Also Published As

Publication number Publication date
EP1694695A1 (fr) 2006-08-30
CA2550135A1 (fr) 2005-06-23
EP1694695A4 (fr) 2007-10-31

Similar Documents

Publication Publication Date Title
US10907213B2 (en) Mitochondrial mutations and rearrangements as a diagnostic tool for the detection of sun exposure, prostate cancer and other cancers
US20070190534A1 (en) Mitochondrial sites and genes associated with prostate cancer
US20050026167A1 (en) Complete mitochondrial genome sequences as a diagnostic tool for the health sciences
JP2007504827A (ja) １３ｑ１４染色体変化の検出
JP2007502113A (ja) エピジェネティク・マーカーを使用して組織または細胞タイプを鑑別するための方法および組成物
EP1397508A2 (fr) Sequences completes du genome mitochondrial servant d'outil diagnostique dans les sciences de la sante
Yeung et al. Impact of copy neutral loss of heterozygosity and total genome aberrations on survival in myelodysplastic syndrome
WO2005056573A1 (fr) Sequences completes du genome mitochondrial utilisees comme outil de diagnostic pour des sciences de la sante
Huijsmans et al. Single nucleotide polymorphism profiling assay to confirm the identity of human tissues
AU2011242123B2 (en) Mitochondrial mutations and rearrangements as a diagnostic tool for the detection of sun exposure, prostate cancer and other cancers
AU2002312671A1 (en) Complete mitochondrial genome sequences as a diagnostic tool for the health sciences
Stankov et al. Cloning of the genes for non-medullary thyroid cancer: Methods and advances

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 11339751

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2550135

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004802299

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2004802299

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 11339751

Country of ref document: US