WO2005042748A1

WO2005042748A1 - Coloured fusion proteins

Info

Publication number: WO2005042748A1
Application number: PCT/GB2004/003543
Authority: WO
Inventors: Mark John Ingraham Paine
Original assignee: University Court Of The University Of Dundee
Priority date: 2003-10-11
Filing date: 2004-08-18
Publication date: 2005-05-12
Also published as: GB0323897D0

Abstract

The present invention relates to the generation of coloured fusion proteins and constructs capable of expressing such coloured fusion proteins. The invention also relates to a method of purifying a coloured fusion and tracking it quantitatively and qualitatively through the purification process.

Description

COLOURED FUSION PROTEINS

Field of the Invention

Background to the Invention

Fusion tags are commonly used as ligands for affinity purification such as hexahistidine [Franklin, 1994; Winter, 1997], Glutathione-S-Transferase (GST) [Parker, 1990; Ji, 1992; Maru, 1996] and maltose binding protein (MBP) [Di Guan, 1988; Maina, 1988] . These facilitate protein purification by reducing the number of steps required to obtain highly pure samples . Such tags can also be used to track proteins, using specific tag antibodies, or by measuring an enzyme activity such as GST. There are also tags that are routinely used to track or visualise proteins through fluorescence. The best known of these are the GFP tags (green fluorescent protein) [Chalfie, 1994; Crameri, 1996] that are used extensively for the localisation of proteins in cells. However, visualisation of GFP-tagged proteins requires excitation at specific wavelengths to emit fluorescence, which requires appropriate equipment and dark-room facilities . β-galactosidase has also been used to provide a system to visualise fusion proteins [Bainbridge, 1991] . However, this is an indirect method, which relies on the formation of blue deposits by the enzyme in the presence of chromogenic substrates such as X-gal . It is an object of the present invention to obviate and/or mitigate at least one of the aforementioned disadvantages . NADPH Cytochrome P450 reductase (CPR) is a diflavin enzyme that contains F N and FAD prosthetic groups that are involved in the one electron reduction of a variety of exogenous and endogenous substrates [Dignam, 1975] . It has been shown that human CPR can be dissected into discrete domains that retain both the structural and functional properties of the full-length protein [Smith, 1994] . A number of other diflavin. reductases have since been dissected into functional units including; rat CPR [Hodgson, 1996], BM3 [Sevrioukova , 1996; Munro, 1993], NR1 [Finn, 2003] and methionine synthase reductase [Wolthers, 2003] . The ability to separate CPR and other diflavin reductases into their component parts has greatly facilitated structural and functional studies of these enzymes [Barsukov, 1997; Zhao, 1999]. The FMN binding domain of CPR is a small 21kDa peptide that is highly soluble when, expressed in E. coli . Interestingly, it is blue-green or yellow in colour depending upon the redox state of the bound FMN cofactor. Summary of the Invention The present invention is based on observations by the present inventor that coloured fusion proteins can be generated by fusing the FMN binding domain of NADPH cytochrome P450 reductase (CPR) to a substantially non- coloured protein. Thus, in a first aspect there is provided an intrinsically coloured fusion protein, said fusion protein comprising an intrinsically coloured polypeptide or polypeptides fused to a non-coloured or substantially non-coloured polypeptide. It is to be understood that the term "intrinsically coloured" refers to the protein/polypeptide being naturally visibly coloured. That is, the protein/polypeptide absorbs light in the visible spectrum, about 360 - 650 nm, resulting in the fusion protein appearing coloured. The protein/polypeptide generally will be coloured by virtue of binding a coloured co-factor such as a flavin. This is in contrast to fluorescent/luminescent fusion proteins which require to be excited at a specific wavelength prior to emitting fluorescene/luminescence, or fusion proteins which may appear to be coloured due to enzyme action on a chromogenic substrate which results in the generation of a colour by action of said enzyme, e.g. the β- galactosidase/XGal system well known in the art. Desirably the fusion protein appears coloured to the naked eye. However, where small amounts of fusion protein are concerned, it may be necessary to employ, for example, a spectrophotometer to detect the fusion protein which absorbs light in the visible spectrum. In this respect it is worth noting that the spectroscopic detection may be used as an adjunct to the visualisation of the fusion protein, offering the means of quantifying the amount fusion protein, and also automating the tracking procedure . It is to be appreciated that the non-coloured or substantially non-coloured polypeptide therefore does not, or only to a limited extent, absorb light in the visible spectrum. The intrinsically coloured polypeptide may be any suitable polypeptide such as the FMN or FAD/NADPH binding domain of NADPH cytochrome P450 reductase (CPR) , cytochrome b₅, cytochrome c or cytochrome P450 (pink/red coloured), or copper containing proteins, such as azurin. A extensive list of coloured polypeptid.es which may be used are identified in the tables shown in Appendix I . Moreover, the intrinsically coloured polypeptide may be fused 5 ' or 3 ' of the non-coloured or substantially non- coloured polypeptide. The FMN and FAD/NADPH binding domains of CPR are intrinsically coloured because they bind the flavins, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) respectively. Flavins absorb light in the visible spectrum and appear yellow/green coloured and are visible to the naked eye when expressed at high levels. The FMN domain of CPR is part of the flavodoxin family of FMN, while the FAD domain of CPR belongs to the ferrodoxin reductase family. Both are widely distributed in nature and share common structural and physical properties within each family. Thus, the present invention is not limited to human CPR domains. For instance there are related bacterial flavodoxins (FMN- binding) such as FLDA (GenBank: M59426) and FLDB (GenBank: z48060) from Eschericia coli ; FLDA (GenBank: AE001536 and AE000622) from Helicobacter pylori , and FLDA (GenBank: AE008840) from Salmonlla typh±murium which may improve the solubility and/or expression of recombinant proteins when using bacterial expression systems such as an E. coli expression system. The attached tables also list other FMN-containing flavodoxins that have been identified in bacterian and other organisms. It may also be possible to use more than one type of intrinsically coloured polypeptide to alter the colour and/or intensity of colour. For instance a red/pink protein such as a member of the cytochrome P450 gene family e.g. CYP101 (GenBank: M12456) could be used to produce a red fusion protein. Likewise, there are several other naturally occurring red proteins that might be used including the heme domain of nitric oxide synthase, e.g. NOS2A (GenBank: L09210) ,- cytochrome b5, e.g. CYB5 (GenBank: X13617) ; cytochrome b2 , e.g. CYB2 (GenBank: X13617) , and cytochrome c, e.g. CCHO (GenBank: CCHO) . Without wishing to restrict the scope of the invention, the FMN domain peptide has several intrinsic properties that make it particularly desirable as a fusion tag including:

1) the FMN domain is small in size (21 kDa) and less likely to reduce yields of expressed recombinant protein; large recombinant proteins may be less stabile when expressed in for example E. coli , reducing yields;

2) it is highly soluble, which can improve the solubility of the protein to which it is fused, that are otherwise ^' intractable to expression;

3) there is a lack of requirement for growth supplements, unlike most other cofactor—binding polypeptides. Thus extremely high yields of FMNT domain may be achieved (e.g. 30-50 mg/litre E. coli culture) using a standard bacterial growth media such a_s Luria Broth; and

4) it is non-toxic. The FAD/NADPH binding domain also has intrinsic physical properties which may be exploited to both track and affinity purify fused proteins, as in addition to being coloured i.e. yellow, the domain binds NADP(H), a nucleotide co-factor. This property allows a fusion protein comprising an FAD/NADPH domain to be affinity purified using, for example, an ADP-sepharose column. The intrinsically coloured fusion protein may further comprise additional domains to facilitate for example purification and/or processing of the fusion protein. For example, the fusion protein may comprise a fusion tag, such as hexahistidine, glutathione-S- transferase, or maltose binding protein, as known in the art (see Terpe, 2003) , as ligands for affinity purification. Typically this fusion tag is bound 5' or 3' of the fusion protein amino acid sequence. Additionally/alternatively a suitable cleavage sequence (e.g. a thrombin cleavage site factor Xa [Wearne, 1990]; or enterokinase [Collins-Racie et al, 1995]) may be provided between the coloured polypeptide domain and the non-coloured/substantially non-coloured polypeptide domain, to allow the non-coloured/substantially non- coloured polypeptide to be separated from the coloured domain after purification of the coloured fusion protein. In order to generate a suitable fusion protein, a polynucleotide fragment which is capable of encoding the fusion protein comprises the respective polynucleotide sub-fragments, encoding the intrinsically coloured polypeptide and the non-coloured or substantially non- coloured polypeptide, located in frame. This may be generally achieved using commonly known molecular biology techniques employing restriction enzyme sites and ligation. There are also novel ways that fusion proteins can be constructed other than traditional restriction enzyme cleavage and ligation. For example, new Gateway™ cloning vectors (Gibco BRL Life Sciences) enable ligase free recombination cloning. Alternative protein-splicing strategies in which post-translational mechanisms are used for the production and manipulation of proteins and peptides can also be used in conjunction with coloured polypeptides. For example a method utilising intein- mediated ligation and cyclization of expressed proteins has been developed [Xu, M.-Q. and Evans, J.T.C. Intein- Mediated Ligation and Cyclization of Expressed Proteins. Methods, 24 : 257-277, 2001], which uses an the internal protein sequence, termed an intein, embedded in -the protein precursor to self-catalyze its excision and the ligation of the flanking protein regions, termed exteins . Alternative protein-splicing strategies in which post- translational mechanisms are used for the production and manipulation of proteins and peptides can also be used in conjunction with coloured polypeptides to generate a coloured fusion protein. Thus, in a second aspect there is provided a polynucleotide fragment capable of encoding a fusion protein according to the first aspect. In a third aspect, the present invention provides a polynucleotide construct comprising a polynucleotide fragment according to the second aspect . In a fourth aspect there is provided a nucleic acid expression vector for use in purifying proteins or polypeptides, the nucleic acid vector comprising: a first nucleic acid sequence capable of encoding an intrinsically coloured polypeptide and a cloning site adjacent to said nucleic acid sequence for introducing, in-frame, a second nucleic acid, such that upon expression of said first and second nucleic acid sequence a coloured fusion protein is generated comprising a coloured polypeptide encoded by said first nucleic acid and a polypeptide encoded by said second nucleic acid. The polynucleotide construct or expression -vector may further comprise regulatory sequences such as promoter, signal sequence,' 5^! and 3' untranslated sequences, enhancer and/or terminator sequences appropriate for the chosen host. These are routinely employed and their choice is used within the level of skill of the routine worker in the art. The resultant molecule, containing the individual elements linked, in a proper reading frame, may be introduced into the chosen cell using techniques well known to those in the art, such as calcium phosphate precipitation, electroporation, biolistic introduction, lipoplex introduction, polyamine introduction, virus introduction, etc. Suitable expression construct and vectors and methods for recombinant production of proteins are well known for host organisms such as E. coli (see Sambrook et al, 2001) . Preferably the expression construct is provided as a plasmid, phagemid, cosmid or viral vector. Naturally the nucleic acid fragment, vector and/or construct may comprise nucleic acid sequences capable of encoding the additional domains, previously mentioned, to facilitate purification and/or processing of the fusion protein. In a fifth aspect there is provided a method of producing a coloured fusion protein comprising the steps of: a) providing a nucleic acid expression vector according to the fourth aspect; b) introducing a nucleic acid sequence into said cloning site; and c) expressing said coloured fusion protein. Purification may be carried out solely on the basis of tracking the easily identified coloured fusion protein in a purification process. However, where, for example, a fusion tag has been utilised, purification is carried out by a combination of employing the properties of the fusion tag (e.g. first binding the coloured fusion protein to an affinity column) and the coloured property of the fusion protein, as the protein is easily visualised. It is understood that the coloured fusion protein may be produced in a cell or cell-free based system. In a sixth aspect there is provided a method of purifying a non-coloured protein comprising the steps of: a) producing a coloured fusion protein according to the fifth aspect; b) purifying said coloured fusion protein; and c) removing the coloured polypeptide domain from said fusion protein, so as to generate said non-coloured protein. Advantageoulsy, the present invention also allows for tracking of a protein during its purification. Moreover, the present invention may be used to monitor protein solubility, i.e. correct folding of a protein during purification. Visualisation of tagged protein is largely dependent on there being correctly bound coloured co-factor (e.g. flavin or heme) , which in turn is dependent on the correct folding of the protein. The colour can also be spectrophotometricaly measured to quantify the amount of coloured protein. Thus, the presence of colour is a very effective indicator of the quantity and solubility of the recombinant fusion protein being expressed. For example with the expression of a red heme binding b5 fusion construct, the presence of a dark red colour in solution is an effective visual indication of a high concentration fo soluble b5-fusion that is likely to be correctly folded so as to incorporate the heme cofactor. As lack of solubility is a major problem experienced when expressing recombinant proteins, a major advantage of the present invention is that it allows the identification of clones that express soluble recombinant protein, thus permitting extensive rapid screening and optimisation, for instance to encourage elevated levels of recombinant protein prior to chromatography. It is feasible also for coloured protein to become insoluble, in which case following centrifugation it may be visible as a coloured pellet. Thus the coloured tag can also be useful in tracking the partitioning of recombinant fusion proteins into soluble and insoluble phases . The present invention will now be further described by way of example and with reference to the Figures which show: Figure 1: Plasmid maps of the constructs used in this study.

Figure 2. 12% SDS-PAGE analysis of recombinant protein expression by E. coli cells transformed with pF N, pHis_s- GST and pFMN-GST. U, uninduced whole cells; I, IPTG induced whole cells; S, 10,000 g soluble fraction from IPTG induced cells. Molecular weight markers are shown on the left. The positions of recombinant FMN, GST and FMN-GST fusion proteins are indicated on the right. Lanes contain approximately 10 pg protein.

Figure 3. Visualization of the FMN-GST fusion protein during the purification procedure. A. Preliminary cell fractionation; the tubes contain 100,000 g supematants from E. coli lysates. In comparison to GST and untransformed cells, E. coli expressing FMN-GST produces a blue-grey lysate, indicating a high semi-quinone flavin content. B . Nickel affini ty column step; FMN-GST is visible as a blue-grey colour binding to the nickel affinity column. A similar quantity of bound GST is shown in comparison, along with an empty nickel column. C. Final elution step; 200 pi fractions containing FMN- GST are visible by their yellow colour in microtitre plate wells. A microtitre . late with wells containing similar concentrations of GST is shown below for comparison. Fraction numbers are indicated. The colour intensity corresponds with protein concentration (see Figure 4) . Figure 4 : Spectrophotometric and enzymatic analysis of purified fractions. Absorbance was monitored at 450nm (units shown on left side of graph) and GST activity (nmoles GSH conjugate produced/min/mg protein of fraction, units shown on right side of graph) was measured as outlined in Materials and Methods. The open and closed circles represent A₄₅₀ nm and GST activity of FMN-GST respectively; the open and closed squares represent A₄₅₀ nm and GST activity of His₆-GST respectively. Shown in the lower panels are 12% SDS-PAGE gels of the corresponding FMN-GST and His₆-GST elution fractions used in the analysis. Each lane contains an equivalent volume of eluate (2 pi) .

Figure 5: FMN-GST is cleaved by thrombin. 12% SDS-Page gel of uncleaved and thrombin cleaved FMN-GST. Because of their similar sizes, FMN and GST migrate as a single band at ~25 kDa in the cleaved lane.

Figure 6: Schematic of the red tag and GST- fusion. (a)

The red tag is the soluble heme binding region of mosquito b5. An, membrane anchor, FAD, FAD binding domain. (b) Red GST fusion constructs, GST was cloned downstream of the b5 tag. T7, T7 promoter; His., histidine tag; TCS, thrombin cleavage site; MCS, cloning site. Figure 7: Visualization of GST fusions during purification. (a) Comparison of cell pellets expressing b5 and FMN tagged GST. In each picture the tube at the top is the untagged GST control . (b) Comparison of sonicated whole cells (top) and supematants (bottom) expressing untagged (GST) , yelloe (FMN) and red (b5) tagged GST. (c) . Comparison of the binding of red (b5) , yellow (FMN) and histidine tagged GST purification on nickel NTA agarose following washes with binding buffer (BB) and BB plus 40 mM imidazole, and elution with 300 mM inidazole. (d) . Eluted fractions containing red b5-GST and yellow FMN-GST. Fraction numbers 1 to 11 are shown on the right. Biochemical analusis of fractions 4 is presented in Table 1.

MATERIALS AND METHODS:

1. Abbreviations: GST, Glutathione S-transferase; MBP, Maltose-binding protein; GFP, Green fluorescent protein; CPR, Cytochrome P450 reductase; FMN, Flavin mononucleotide; CDNB, l-Chloro-2, 4-dinitrobenzene; ALA, δ-aminolevulinic acid; FNR, flavodoxin NADP+ reductase,

FAD, flavin adenine dinucleotide Chemicals and reagents - All chemicals were purchased from Sigma (Poole, Dorset, United Kingdom (UK)) and all enzymes from Life Technologies Inc. (Paisley, UK) , except, where stated. Plasmid Construction - A two-step polymerase chain reaction (PCR) using Pfu polymerase (Stratagene) was used to generate a fragment encoding the FMN binding domain of human cytochrome P450 reductase (CPR) with an N-terminal hexahistidine tag and a C-terminal thrombin cleavage site (tcs) . The first PCR amplified a fragment of the vector pET15b (Novagen) whose C-terminus was fused to the first 21 nucleotides of exon 2 of the FMN binding domain of CPR, using the oligonucleotides 5'- CCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG - 3 ' and 5'- GCTCTCTCTGACAGAGGAGGTGCCGCTGCTGTGATGATGATG -3" as forward and reverse primers respectively. This fragment was purified and used as the forward primer, together with the oligonucloetide 5'-

CCTCGAGCATATGGCTGCCGCGCGGCACCAGGCTGGACTCCTCGCCAGT -3 ' as the reverse primer in a PCR to generate the full His₆-CPR FMN-tcs fragment. This 600bp fragment was subcloned into the unique Xbal/Xhol sites of pET15b to generate plasmid pFMN (Figure 1) . A 700bp fragment encoding GST was amplified by PCR using the oligonucleotides 5 ' -

GAGGAATTCCATATGTCCCCTATACTAGGTTAT-3 ' and 5 ' - CGGGGAATTCCGGGGATCCCAGGGGCCCCTAGAACAG-3' as forward and reverse primers respectively and pGEX 6P-1 (Pharmacia) as a DNA template. The resulting fragment was subcloned into the unique Ndel/Xhol sites of pET15b and pFMN to produce pGST and pGST-FMN, which produced "non-coloured" GST and "coloured" FMN-GST proteins (Figure 1) . Recombinant Protein Expression and Purification For E. coli expression of the various constructs, BLR (DE3/pLysS) strains containing the appropriate plasmid were grown at 37°C in LB broth containing ampicillin (50 pg/ml) and chloroamphenicol (34 pg/ml) to an optical density at 600 nm of 0.4-0.8. Isopropyl-1-thio-β-D- galactopyranoside was then added at a concentration ImM to initiate expression, cultures were transferred to 30°C and grown overnight. Cells were harvested at 5,000 X g for 20 min and resuspended in binding buffer (20 mM Sodium phosphate pH 8.0, 500 mM NaCl, 5 mM Imidazole and 10% glycerol (BDH) ) . Cell suspensions were lysed by incubating at 30°C for 15 min in the presence of 100 pg/ml lysozyme, followed by

30 min at 4°C in the presence of 0.1% Triton X-100. The lysates were sonicated (MSE probe, several short bursts at high power) and centrifuged at 40,000 X g for 30 min at 4°C. The supe atants were filtered through a 0.45 pm filter before being loaded on a Hi-trap nickel column (Amhersham-Pharmacia) . The column was washed with 5 column volumes of binding buffer to remove any unbound material; bound protein was then eluted with a 10 column volume linear gradient of 0 - 350 mM Imidazole, collecting 0.2 ml fractions. Analysis of Fractions - Fractions were analysed for absorbance at 450 nm, GST activity and by 12% SDS PAGE. GST activity was determined at 37°C by measuring the rate of increase of absorbance at 340 nm in 100 mM sodium phosphate buffer pH 6.5 / 2 mM Glutathione and using 1 mM l-Chloro-2, 4-dinitrobenzene (CDNB) as a substrate. Thrombin Cleavage - Purified fractions were pooled and buffer exchanged using a 10 ml PD10 column into thrombin cleavage buffer (20 mM Tris pH 8.4, 150 mM NaCl, 2.5 mM CaCl.) . Cleavage was performed at 4°C overnight in the presence of Thrombin at a concentration of 0.5 U/mg of protein.

Example 1: Plasmid construction To test the principle of producing a coloured fusion protein, the present inventor have fused the colourless enzyme, GST, to the FMN binding domain of CPR (residues 61-274) . As control, a 6x histidine tagged GST construct was made which provided a comparative control for background colour intensity and enzyme activity. Plasmid maps of the constructs used are shown in Figure 1. In order to broaden the application of CPR-FMN as a protein purification tool, the inventor have engineered a 6x histidine tag sequence at the amino terminus to enable metal chelating affinity chromatography. A thrombin cleavage sequence was also added to the C-terminal end of the FMN domain to enable the fusion tag to be removed.

Example 2 : Recombinant ^■protein expression High levels of soluble FMN-GST protein were produced at 37°C following IPTG induction for 4 hr, although a lower temperature expression at 30°C following overnight induction by IPTG was found to increase the levels of soluble recombinant protein appreciably (Figure 2). In the initial low spin (20K) cell recovery phase, a high level of FMN-GST expression is visibly apparent from the dark-grey colour of the cell pellet. This phenomenon has been observed previously and is due to the reduced state of the FMN co-factor [Smith, 1994; Munro, 2001]. Following cell lysis and ultra-centrifugation, the 100K soluble fraction containing FMN-GST appears blue-grey in colour compared to GST (Figure 3A) , changing to bright yellow over a few days upon storage at 4°C due to oxidation of the FMN co-factor, which forms an air stable semi-quinone [Munro, 2001] .

Example 3; Recombinant protein purification Clarified lysates containing FMN-GST or GST alone were loaded onto Ni²⁺ agarose columns for purification. The FMN-GST peptide was a clearly visible blue-grey colour on the column (Figure 3B) . The colour produced in the case of FMN-GST is a result of the column being saturated with the fusion peptide. At low expression levels the protein binds as a distinct tight yellow band at the top of the column (data not shown) . This ability to visualise the fusion protein binding to the column, even in cases of low expression/solubility, allows, for example, the researcher to determine at this early stage whether to continue with the purification or not, without the need to invest time or money in performing a western blot or activity assay. The column was washed with binding buffer and the bound protein eluted in 0.2 ml fractions with a 0 - 350 mM imidazole linear gradient. As shown in Figure 3C (i) , fractions containing FMN-GST were clearly visible as bright yellow in colour in comparison to His tagged GST control. At this stage the colour has changed to yellow from blue-grey due to the complete oxidation of the flavin. SDS-PAGE analysis showed that the intensity of the colour was relative to the amount of FMN-GST protein (Figure 4) . This data shows that FMN-GST is visible through the purification process, and that individual chromatographic fractions containing the recombinant protein can be pin-pointed by the naked eye. Thus greatly simplifying the chromatographic procedure. FMN absorbs at 450 nm, and the fractions were spectrophotometrically examined. As shown in Figure 4, fractions contain FMN-GST by SDS-PAGE absorbed strongly at 450 nm compared with the His tagged GST control. This increases the sensitivity of the system and offers a means of quantifying the concentration of FMN-fusion protein with reference to an FMN standard. Thus, at a low concentration in which the FMN-fusion is invisible, the protein can still be monitored spectrophotometrically. To determine if GST fused with the FMN domain was still functional, the catalytic activity of the fractions was measured. Yellow FMN-GST fractions were catalytically active, and maximum activity corresponded with the peak of colour intensity (Figure 4) .

Example 4 ; Fusion tag removal Following purification it is normally desirable to remove the fusion tag to produce a recombinant product that is as close to the native version as possible. In this system, thrombin cleavage was carried out on FMN-GST at 4°C overnight with thrombin at a concentration of 0.5 U/mg fusion peptide. As shown in Figure 5, GST was successfully cleaved from the FMN tag. It was also found that cleavage could be carried out directly on the Ni²⁺ agarose column. Thus, thrombin cleavage could be used to elute GST or other fused polypeptides rather than imidazole. Since high concentrations of imidazole can sometimes have a detrimental affect on enzyme activities and is usually removed by dialysis or other means, this offers the advantage of eluting the protein in a physiological buffer ready for immediate analysis.

The above examples have shown that CPR-FMN fused to GST produces a yellow hybrid polypeptide that is visible with the naked-eye. This is an extremely useful property that enables the fusion protein to be tracked from the first stage of expression in __.. coli through to the chromatographic separation by Ni-agarose affinity resin. This provides a new role for the FMN domain of CPR as a biotechnological tool to facilitate the process of recombinant protein production and purification. The FMN binding domain has a number of intrinsically useful features which recommend it as a good fusion molecule. It is small in size (21kDa) and therefore less likely to reduce recombinant proteins yields. It is also highly soluble when expressed in E. coli , which can sometimes improve the solubility of linked proteins [Davis, 1999] that are otherwise intractable to expression. There is a lack of requirement for growth supplements, thus extremely high yields of FMN domain are achieved (30-50 mg/litre E. coli culture) using a standard bacterial growth media such as Luria Broth. This contrasts with many other cofactor-binding polypeptides such as cytochromes P450, which require a heme precursor δ-aminolevulinic acid (ALA) to be added to the culture media [Pritchard et al, 1997] for correct folding and expression. Importantly, the human CPR-FMN domain structure has been determined by X-ray crystallography (Zhao et al, 1999] and NMR [Barsukov, 1997] , which greatly facilitates the rational design of future derivative molecules. In this respect, the concept of visible-tagged polypeptides can be extended to any nucleotide sequence that produces a coloured peptide and it should be feasible to construct a series of differently coloured fusion tags. For instance, the heme binding cytochromes P450, b_ and c produce red proteins that may also be amenable as red fusion tags. Moreover, there are endogenous prokaryotic flavoproteins such as FNR that may function even better as fusion tags in E. coli with further enhanced features of high yields, stability and solubility. In summary, the present inventor have described a novel system, for generating visible coloured recombinant proteins . The System increases the ease and speed at which recombinant proteins can be purified and tracked throughout the purification process. With the mass of genomic information now available, the major bottleneck to a comprehensive understanding of protein function is now the rate at which these genes can be expressed, characterised and structurally determined. The FMN fusion system may be particularly useful in the development of automated high throughput tools for the expression of recombinant proteins for functional analysis and structural determination. Although larger than the FMN domain, the 50 KDa FNR- like FAD/NADPH domain also has useful features as a fusion tag. Firstly, it is yellow so can also be used as a visible tag molecule in much the same way as the FMN- domain. Secondly, it contains an NADP(H) binding site located at the extreme carboxy-terminal end of the molecule [Wang, M., Roberts, D.L., Paschke, R. , Shea, T.M., Masters, B.S., and Kim, J.J. Three-dimensional structure of NADPH-cytochrome P450 reductase: prototype for FMN- and FAD-containing enzymes. Proc Natl Acad Sci U S A, 94 : 8411-8416, 1997] . NADP+ dependent dehydrogenases interact strongly with 2'5'ADP (Affinity Chromotography; Principles and Methods. Handbooks from Amersham Pharmacia Biotech Series, www. apbiotech. com) . Thus, the FAD/NADPH domain combines both visibility and affinity for nucleotide ligands, which greatly facilitates the purification of chimeric FAD/NADPH polypeptide fusions.

Example 5: .Red tag labelled cytochrome b5 Similarly, research with hemoproteins pointed to the small cytochrome b5 (b5) molecule (~17 kDa) , which expresses to levels of up to 1000 nmol/1 in E. coli culture [Voice et al, 1999], as being a potentially good red fusion tag. The inventor engineered a red tag (Figure 6) using the mosquito (Anopheles gambiae) b5 gene [Nikou et al, 2003] . The b5 molecule is a membrane protein containing a hydrophobic carboxy terminal sequence for anchorage to the endoplasmic reticulum membrane. This segment was removed to create a smaller (~13 kDa) more soluble heme-binding molecule for the expression of fusion constructs in E. coli . In contrast to the FMN domain, the heme precursor, δ-aminolevulinic acid, is required as a growth supplement to ensure effective yields of holo b5. The A . gambiae b5 cDNA was supplied by Dr. Hilary Ranson (Liverpool School of Tropical Medicine) . For the red fusion (Figure 6) , the nucleotides 2-300 of the Anopheles gambiae cDNA sequence [Nikou et al, 2003] were amplified using the forward and reverse primers 5 ' -

GATATACCATGGGCAGCAGCCATCATCATCATCATCATTCGGAAGTGAAAACGTACT CGC-3' and 5'-

CCTCGAGCATATGGCTGCCGCGCGGCACCAGCTGCTGGTCCATTTTCCAGTC- 3' respectively. Incorporated in the forward primer was a hexa histidine sequence for affinity purification, while the reverse primer contains a thrombin cleavage sequence immediately downstream of the b5 coding sequence. Following Ncol/Ndel digestion, the b5 fragment was gel purified. The pFMN-GST clone was digested with Ncol/Ndel to remove the FMN domain, which was replaced with the b5 fragment to create plasmid pb5-GST that expresses the red GST fusion.

Recombinant Protein Expression and Purification E. coli expression and purification was essentially done described above with some minor modifications. For b5 expression the growth media was Terrific Broth modified (Fluka) supplemented with 1 mM δ-aminolevulinic acid (Sigma) for efficient heme incoporation. The E. coli strain BL21 (DE3/pLysS) was used and the following induction of expression with 1 mM isopropyl-1-thio-β-D- galactopyranoside, cultures were transferred to 30 °C and grown overnight. Cells from 50 ml cultures were harvested at 5,000 X g for 20 min and resuspended in 5 ml of binding buffer (20 mM Tris pH 8.0 , 500 mM NaCl) . Cell suspensions were lysed by freeze-thawing and sonication (MSE probe, several short bursts at high power) and centrifuged at 16,000g for 10 min at 4°C in eppendorf tubes. The supematants were loaded onto ~2 ml nickel-

NTA agarose columns (Qiagen) previously equilibrated in binding buffer. Proteins were eluted by increasing the imidazole concentrion to 300 mM.

Analysis of Fractions - Extinction coefficients were calculated from the formula E=A/c, where A is absorbance of the solution in a cuvette with a 1cm light path, and c is concentration in μM, b5-GST absorbance was measured at 412nm. The concentration of the fusion was determined using an estimated molecular weight of 38 Kda. FMN GST absorbance was measured at 450nm, and concentration determined using an estimated molecular weight of 50 Kda. Total protein concentrations were determined using Bradford assays (Sigma) and bovine serum albumin standard. Electrophoresis was carried using precast NuPage™ 4-12% Bis-Tris gels. GST activity was determined at 37 °C by measuring the rate of increase of absorbance at 340 nm in 100 mM sodium phosphate buffer pH 6.5 / 2 mM Glutathione and using 1 mM l-Chloro-2, 4-dinitrobenzene (CDNB) as a substrate. Recombinant b5 protein expression is detectable at an early stage of purification from the colour of the harvested cell pellets, with b5 tagged GST's producing a red coloured pellet (see Figure 7) . The b5 tag retains its pink/red colour throughout the purification process. The colour of the supernatant is a very effective early indicator of the quantity and solubility of the recombinant fusion protein. This is useful for identifying clones that express recombinant protein in soluble form, and can be used to optimise growth conditions to encourage elevated levels of recombinant protein. Thus extensive screening and optimisation work can be carried out prior to chromatography. The absorbance spectra of the domain produces a wavelength maxima in the regions of -420 nm, which can be used to directly quantify the protein concentrations of the tagged molecules. Here, the inventor have calculated the extinction co-efficients of the b5 and FMN tagged GSTs to be 0.061 μM^"1 cm^"1 and 0.008 μM^"1 cm^"1 respectively. Thus a single absorbance unit (1 A.U.) is equivalent to protein concentrations of 16 μM and ~118 μM for the yellow and red tags respectively. The red tag is therefore significantly more sensitive (approximately 10 fold) then the yellow tag. The limit of eye-ball detection is ~0.1 A.U, which means the system is sensitive down to ~1.6 μM (0.1 mg b5-GST/ml) for the red tag and -12 μM (0.7 mg FMN-GST/ml) for the yellow tag. The characteristic absorbance signatures of the colour tagged proteins means they can be tracked spectrophotometricaly, thus increasing sensitivity of detection and allowing selective monitoring of colour tagged proteins using automated protein purification procedures, such as fast protein liquid chromatography (FPLC) . The inventor have also measured the catalytic activity of the yellow and red tagged GSTs and found little difference with the his-tagged GST control (data not shown) , indicating the enzyme activity is not compromised by the presence of the visual tag molecules. If desired, the coloured fusion tags can be removed by thrombin cleavage . While the data above demonstrates the FMN domain and b5 molecules to be extremely effective visualisation tags for recombinant protein expression, this system can include any gene producing a visible peptide. Also, while the inventor have used E. coli for expression, the visible tag system could be used in conjunction with other commonly used protein expression systems such as baculovirus, yeast or cell-free transcription systems.

REFERENCES Franklin A., Jetton T., Shelton K. and Magnuson M. BZP, a novel serum-responsive zinc finger protein that inhibits gene transcription. Mol. Cell. Biol. 14: 6773- 6788, 1994. Winter Maw M. Stimulation of CFTR activity by its phosphorylated R domain. Nature 389: 294 - 296, 1997. Parker M. , Lo Bello M. and Federici G. Crystallization of glutathione S-transferase from human placenta. J. Mol. Biol. 213: 221 - 222, 1990. Ji X., Zhang P., Armstrong R. and Gilliland G. The three-dimensional structure of a glutathione S- transferase from the Mu gene class. Structural analysis of the binary complex of isoenzyme 3-3 and glutathione at 2.2A resolution. Biochemistry 31: 10169 - 10184, 1992. Maru Y., Afar D., Witte O. and Shibuya M. The dimerization property of Glutathione S-transferase partially reactivates Bcr-Abl lacking the oligomerization domain. J. Biol. Chem. 271: 15353 - 15357, 1996. Di Guan C, Li P., Riggs P. and Inouye H. Vectors that facilitate the expression and purification of foreign peptides in Escherichia coli by fusion to maltose-binding protein. Gene 67: 21 - 30, 1988. Maina C. , Riggs P., Grandea A., Slatko B., Moran L. , Tagliamonte J. , McReynolds L. and Guan C. An Escherichia coli vector to express and purify foreign proteins by fusions to and separation from maltose-binding protein. Gene 74: 365 - 373, 1988. Chalfie M., Tu Y., Euskirchen G. , Ward W. and Prasher D. Green fluorescent protein as a marker for gene expression. Science, 263: 802 - 805, 1994. Crameri A., Whitehorn E., Tate E. and Stemmer W. Improved Green fluorescent protein by molecular evolution using DNA shuffling. Nature Biotech. 14: 315 - 319, 1996. Bainbridge B.W., Mathias N. , Price R.G., et al . Improved methods for the detection of beta-galactosidase activity in colonies of Escherichia coli using a new chromogenic substrate: VBzTM-gal (2- (2- (4- (beta-D- galactopyranosyloxy) -3-methoxyphenyl) -vinyl) -3- methylbenzothiazolium toluene-4-sulphonate) . FEMS Microbial Lett 64: 319 - 23, 1991. Dignam JaS H. Preparation of homogenous NADPH- cytochrome P-450 reductase from rat liver. Biochim. Biophys. Res. Commun. 63: 845 - 852, 1975. Smith G., Tew D. and Wolf CR. Dissection of NADPH- cytochrome P450 oxidoreductase into distinct functional domains. Proc. Natl. Acad. Sci. USA 91: 8710 - 8714, 1994. Hodgson A.V. , Strobel H.W. Characterization of the FAD binding domain of cytochrome P450 reductase. Arch Biochem Biophys 325: 99 - 106, 1996. Sevriokova I., Peterson J.A. Domain-domain interaction in cytochrome P450BM-3. Biochimie 78: 744 - 51, 1996. Munro A.W. Purification schemes for the constituent domains of cytochrome P450 BM3 in E. coli. Biochem Soc Trans 21: 316S., 1994. Finn R.D., Basran J. , Roitel O., et al . Determination of the redox potentials and electron transfer properties of the FAD- and FMN-binding domains of the human oxidoreductase NR1. Eur J Biochem 270: 1164 - 75, 2003. Wolthers K.R., Basran J. , Munro A.W., Scrutton N.S. Molecular dissection of human methionine synthase reductase: determination of the flavin redox potentials in full-length enzyme and isolated flavin-binding domains. Biochemistry 42: 3911 - 20, 2003. Xu M.-Q. and Evans J.T.C. Intein-Mediated Ligation and Cyclization of Expressed Proteins. Methods, 24 : 257- 277, 2001. Terpe K. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Applied Microbiology and Biotechnology, 60 : 523-533, 2003. Wearne S.J. Factor Xa cleavage of fusion proteins. Elimination of non-specific cleavage by reversible acylation. FEBS Lett, 263 : 23-26, 1990. Collins-Racie L.A. , McColgan J.M. Grant K.L., DiBlasio-Smith E.A., McCoy J.M. , and LaVallie E.R. Production of recombinant bovin enterokinasecatalytic subunit in Escherichia coli using the novel secretory fusion partner DsbA. Biotechnology, 13 : 982-987, 1995. Sambrook J. , Russell D.W. , and Sambrook J. 2001, Molecular cloning: a lab manual, 3rd Ed. Cold Spring Harbour Laboratory Press (New York) . Pritchard M.P., Ossetian R. , Li D.N., Henderson C.J., Burchell B., Wolf C.R., and Friedberg T. A general strategy for the expression of recombinant human cytochrome P450s in Escherichia coli using bacterial signal peptides: expression of CYP3A4 , CYP2A6, and CYP2E1. Arch Biochem Biophys, 345, 342-354, 1997. Zhao Q., Modi S., Smith G. , Paine M. , McDonagh P.D., Wolf C.R., Tew D., Lian L.Y. , Roberts G.C., and Driessen H.P. Crystal structure of the FMN-binding domain of human cytochrome P450 reductase at 1.93 A resolution. Protein Sci, 8 : 298-306, 1999. Barsukov I., Modi S., Lian L.Y., Sze K.H. , Paine M.J., Wolf C.R., and Roberts G.C. IH, 15N and 13C NMR resonance assignment, secondary structure and global fold of the FMN-binding domain of human cytochrome P450 reductase. J Biomol NMR, 10 : 63-75, 1997. Wang M. , Roberts D.L., Paschke R. , Shea T.M., Masters B.S., and Kim J.J. Three-dimensional structure of NADPH-cytochrome P450 reductase: prototype for FMN- and FAD-containing enzymes. Proc Natl Acad Sci USA, 94 : 8411-8416, 1997. Voice, M.W., Zhang, Y. , Wolf, CR. , Burchell, B. & Friedberg, T. Effects of human cytochrome b5 on CYP3A4 activity and stability in vivo. Arch . Biochem. Biophys . 366, 116-124. (1999) . Nikou, D. , Ranson, H. & Hemingway, J. An adult- specific CYP6 P450 gene is overexpressed in a pyrethroid- resistant strain of the malaria vector, Anopheles gambiae. Gene 318, 91-102 (2003) .

APPENDIX I

Dual flavin (FMN and FAD/NADPH containing) yellow proteins (I). NADPH cytochrome P450 reductases and related enzymes.

' Much of the information was derived from the following web site www.icgeb.trieste,it/~p450srv/new/'. 2005/042748 34

Dual flavin (FMN and FAD/NADPH containing) yellow proteins (II). NADPH sulfite reductase flavoproteins

FMN containing yellow proteins. Flavodoxins

FAD containing yellow proteins. Ferredoxin: NADP+ reductases (FNRs).

Heme containing red proteins. Cytochrome b5 enzymes.

Heme containing red/pink proteins. Cytochrome b5 domain containing proteins.

Heme and dual flavin containing red/yellow/green proteins, Nitric oxide synthases

Heme containing red/pink proteins. Cytochrome P450s

005/042748 49

Saccharomyces

CYP61 KRG5 YEAST U34636 Z49211 [cerevisiae

CYP62 lEmericella nidulans BTCB EMENI 34740

CYP64 Asperεillus flavus PRDA ASPFL U81806 U81807 Aspergillus

CYP64 IORDA ASPPA parasiticus AF017151 AF169016 Fusarium

CYP65A1 pTRl l FUSSP AF011355 sporotrichioides

CYP67 Uromyces fabae ICP67 UROFA IU81793

CYP71A1 iPersea americana [CP71 PERAE 1M32885

CYP71A12 [Arabidopsis thaliana 1C71C ARATH AC002340

CYP71A13 Arabidopsis thaliana IC71D ARATH AC002340

CYP71A14 Arabidopsis thaliana IC71E ARATH AF069716

CYP71A15 Arabidopsis thaliana 71F ARATH AF069716

CYP71A16 [Arabidopsis thaliana IC71G ARATH AB022210

CYP71A18 Arabidopsis thaliana C71I ARATH AC007296

CYP71A19 Arabidopsis thaliana LC71J ARATH IAL049608 AL161536

(CYP71A2 Solanum melongena C712 SOLME P 14990 X71654

CYP71A20 [Arabidopsis thaliana C71K ARATH IAL049608 AL161536

CYP71A21 Arabidopsis thaliana C71L ARATH AL049659

CYP71A22 [Arabidopsis thaliana 71M ARATH AL049659

CYP71A23 [Arabidopsis thaliana IC71N ARATH AL049659

CYP71A24 Arabidopsis thaliana C71O ARATH 1AL049659

CYP71A25 [Arabidopsis thaliana C71P ARATH AL049659

CYP71A26 [Arabidopsis thaliana [C71Q ARATH L049659

CYP71A27 Arabidopsis thaliana C71R ARATH AL022224 AL161552

CYP71A28 [Arabidopsis thaliana C71S ARATH AL022224 AL161552

CYP71A3 Solanum melonεena IC713 SOLME 1X70982

CYP71A4 Solanum melonεena C714 SOLME 1X70981

CYP71A6 Nepeta racemosa C716 NEPRA Y09424

CYP71A8 Mentha piperita 1C718 MENPI E33875

CYP71A9 [Glycine max IC719 SOYBN IY10489

CYP71B1 [Thlaspi arvense [C7B1 THLAR IL24438

CYP71B10 Arabidopsis thaliana C72A ARATH 1AB019233

CYP71B11 Arabidopsis thaliana C72B ARATH AC005964

CYP71B12 Arabidopsis thaliana C72C ARATH AC006259 AC005964

CYP71B13 Arabidopsis thaliana IC72D ARATH IAC005964

CYP71B14 Arabidopsis thaliana IC72E ARATH AC006259

CYP71B15 Arabidopsis thaliana 1C72F ARATH A 16889

CYP71B16 Arabidopsis thaliana IC72G ARATH AB024038

CYP71B17 Arabidopsi s thaliana IC72H ARATH IAB024038

CYP71B19 Arabidopsis thaliana C72J ARATH AB024038

CYP71B2 Arabidopsis thaliana C722 ARATH ID78605 AC007357

68

69

005/042748 70

005/042748 71

48

005/042748 75

Mixed heme and dual flavin (FMN and FAD/NADPH containing) red/yellow/green proteins. P450-CPR fusions

005/042748 76

Mixed heme and dual flavin (FMN and FAD/NADPH containing) red/yellow/green proteins. Nitrix oxide synthases.

77

78

Representative examples of genes encoding coloured proteins.

Claims

CLAIMS 1. An intrinsically coloured fusion protein, said fusion protein comprising an intrinsically coloured polypeptide or polypeptides fused to a non-coloured or substantially non-coloured polypeptide.

2. The intrinsically coloured ^• fusion protein, according to claim 1 wherein the fusion protein is coloured to the naked eye.

3. The intrinsically coloured fusion protein, according to either of claims 1 or 2 wherein the intrinsically coloured polypeptide is selected from the FMN or FAD/NADPH binding domain of NADPH cytochrome P450 reductase (CPR) , cytochrome b₅, cytochrome c, cytochrome P 50 heme containing proteins, heme/dual flavin containing proteins, or copper containing proteins such as azurin

4. The intrinsically coloured fusion protein according to any preceding claim wherein the intrinsically coloured polypeptide is fused 5 ' or 3 ' of the non-coloured or substantially non-coloured polypeptide .

5. The intrinsically coloured fusion protein according to any preceding claim wherein the fusion protein comprises more than one type of intrinsically coloured polypeptide.

6. The intrinsically coloured fusion protein according to any preceding claim wherein the intrinsically coloured polypeptide comprises an FMN and/or FAD/NADPH binding domain.

7. The intrinsically coloured fusion protein according to any preceding claim further comprising additional domains to facilitate purification and/or processing of the fusion protein.

8. The intrinsically coloured fusion protein according to any claim 7 wherein the additional domain is hexahistidine, glutathione-S-transferase, or maltose binding protein.

9. The intrinsically coloured fusion protein according to any preceding claim further comprising a cleavage sequence between the coloured polypeptide domain and the non-coloured/substantially non-coloured polypeptide domain.

10. A polynucleotide fragment capable of encoding a fusion protein according to any preceding claim.

11. A polynucleotide construct comprising a polynucleotide fragment according to claim 10.

12. A nucleic ac±d expression vector for use in purifying proteins or polypeptides, the nucleic acid vector comprising: a first nucleic acid sequence capable of encoding an intrinsically coloured polypeptide and a cloning site adjacent to said nucleic acid sequence for introducing, in-frame, a second nucleic acid, such that upon expression of said first and second nucleic acid sequence a coloured fusion protein is generated comprising a coloured polypeptide encoded by said first nucleic acid and a polypeptide encoded by said second nucleic acid.

13. A method of producing a coloured fusion protein comprising the steps of: a) providing a nucleic acid expression vector according to claim 12; b) introducing a nucleic acid sequence into said cloning site; and c) expressing said coloured fusion protein.

14. A method of purifying a non-coloured protein comprising the steps of: a) producing a coloured fusion protein according to claim 13 ; b) purifying said coloured fusion protein; and c) removing the coloured polypeptide domain from said fusion protein, so as to generate said non-coloured protein. l . 'rne raetnod according to claim 14 wherein the protein is purified by tracking the coloured fusion protein during purification.

16. The method according to either of claims 14 or 15, wherein the method is optimised to ensure expression of soluble coloured fusion protein prior to and/or during purification of said coloured fusion protein.