WO2005040363A1 - Glucosyltransferases - Google Patents
Glucosyltransferases Download PDFInfo
- Publication number
- WO2005040363A1 WO2005040363A1 PCT/GB2004/004330 GB2004004330W WO2005040363A1 WO 2005040363 A1 WO2005040363 A1 WO 2005040363A1 GB 2004004330 W GB2004004330 W GB 2004004330W WO 2005040363 A1 WO2005040363 A1 WO 2005040363A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- acid molecule
- cell
- cell according
- acid sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8255—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis
Definitions
- the invention relates to transgenic cells which have been transformed with nucleic acid molecules which encode glucosyltransferases (GTase) which glycosylate monolignols which are internediates in lignin biosynthesis.
- GTase glucosyltransferases
- GTases are enzymes which post-translationally transfer glucosyl residues from an activated nucleotide sugar to monomeric and polymeric acceptor molecules such as other sugars, proteins, lipids and other organic substrates. These glucosylated molecules take part in diverse metabolic pathways and processes. The transfer of a glucosyl moiety can alter the acceptor's bioactivity, solubility and transport properties within the cell and throughout the plant.
- One family of GTases in higher plants is defined by the presence of a C-terminal consensus sequence.
- the GTases of this family function in the cytosol of plant cells and catalyse the transfer of glucose to small molecular weight substrates, such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones.
- Wood used in the paper industry is initially particulated, typically by chipping, before conversion to a pulp which can be utilised to produce paper.
- the pulping process involves the removal of lignin.
- Lignin is a major non-carbohydrate component of wood and comprises approximately one quarter of the raw material in wood pulp.
- the removal of lignin is desirable since the quality of the paper produced from the pulp is largely determined by the lignin content.
- Many methods have been developed to efficiently and cost effectively remove lignin from wood pulp. These methods can be chemical, mechanical or biological. For example, chemical methods to pulp wood are disclosed in WO9811294, EP0957198 and WO0047812.
- lignin content and the level of cross-linking of polysaccharide polymers within plant cell walls also play an important role in determining texture and quality of raw materials through altering the cell walls and tissue mechanical properties. For example, there is considerable interest in reducing cell separation in edible tissues since this would prevent over-softening and loss of juiciness.
- Phenolics, such as ferulic acid play an important role in cell adhesion since they can be esterified to cell wall polysaccharides during synthesis and oxidatively cross-linked in the wall, thereby increasing rigidity. Most non-lignified tissues contain these phenolic components and their levels can be modified by altering flux through the same metabolic pathways as those culminating in lignin.
- GTase nucleic acid in sense and/or antisense configurations can be used to affect levels of ferulic acid and related phenylpropanoid derivatives that function in oxidative cross-linking. These changes in content have utility in the control of raw material quality of edible plant tissues.
- Lignin and oxidative cross-linking in plant cell walls also play important roles in stress and defence responses of most plant species. For example, when non-woody tissues are challenged by pests or pathogen attack, or suffer abiotic stress such as through mechanical damage or UN radiation, the plant responds by localised and systemic alteration in cell wall and cytosolic properties, including changes in lignin content and composition and changes in cross-linking of other wall components. Therefore, it can also be anticipated that cell- or tissue-specific changes in these responses brought about by changed levels of the relevant GTase activities will have utility in protecting the plant to biotic attack and biotic/abiotic stresses.
- GTases also have utility with respect to the modification of antioxidants.
- Reactive oxygen species are produced in all aerobic organisms during respiration and normally exist in a cell in balance with biochemical anti-oxidants.
- Environmental challenges such as by pollutants, oxidants, toxicants, heavy metals and so on, can lead to excess reactive oxygen species which perturb the cellular redox balance, potentially leading to wide-ranging pathological conditions.
- cardiovascular diseases, cancers, inflammatory and degenerative disorders are linked to events arising from oxidative damage.
- Anti-oxidant micronutrients obtained from vegetables and fruits, teas, herbs and medicinal plants are thought to provide significant protection against health problems arising from oxidative stress.
- Well known anti-oxidants from plant tissues include for example: quercetin, luteolin, and the catechin, epicatechin and cyanidin groups of compounds.
- Certain plant species, organs and tissues are known to have relatively high levels of one or more compounds with anti-oxidant activity. Greater accumulation of these compounds in those species, their wider distribution in crop plants and plant parts already used for food and drink production, and the increased bioavailability of anti- oxidants (absorption, metabolic conversions and excretion rate) are three features considered to be highly desirable.
- 72E2 and 72E3 led to the ability, via regulating gene expression, to be able to modulate the extent of lignification within a plant, thereby altering the mechanical properties, responsiveness to wounding and pathogen stress and xenobiotic de-toxification ability of the plant.
- a transgenic cell wherein the genome of said cell comprises a nucleic acid molecule wherein said nucleic acid molecule is selected from the group consisting of; i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1 ; ii) a nucleic acid molecule comprising a nucleic acid sequence which hybridises to the sequence in (i) above and which glucosylates at least one monolignol; iii) a nucleic acid molecule comprising a nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
- said aldehyde of a monolignol is selected from the group consisting of; ?-coumaryl aldehyde, coniferyl aldehyde and sinapyl aldehyde.
- said monolignol is coniferyl alcohol.
- hybridisation is stringent hybridisation.
- Stringent hybridisation/washing conditions are well known in the art.
- nucleic acid hybrids that are stable after washing in O.lxSSC, 0.1% SDS at 60°C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known.
- hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation.
- said nucleic acid is cDNA.
- said nucleic acid is genomic DNA.
- said nucleic acid molecule comprises a nucleic acid sequence as shown in Figure 1.
- said nucleic acid molecule consists of a nucleic acid sequence as shown in Figure 1.
- nucleic acid molecule is over expressed.
- said over-expression is at least 2-fold higher when compared to a non-transformed reference cell of the same species.
- said over-expression is: at least 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or at least 10- fold when compared to a non-transformed reference cell of the same species.
- said cell over-expresses a nucleic acid molecule selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1 and Figure 3 and/or Figure 5; ii) a nucleic acid molecule comprising a nucleic acid sequence which hybridises to the sequence in (i) above and which glucosylates at least one monolignol; iii) a nucleic acid molecule comprising a nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
- said cell over-expresses a nucleic acid molecule as represented by the nucleic acid sequence shown in Figure 3 and Figure 5, or a nucleic acid molecule which hybridises to a nucleic acid molecule as represented by the nucleic acid sequence in Figure 3 and Figure 5.
- nucleic acid sequence may be operably linked to a heterologous promoter.
- a vector comprising the nucleic acid molecule operably linked to a heterologous promoter would be used to transfect/transform a selected cell.
- Vector includes, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissable or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication ie an episomal vector).
- Suitable vectors can constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
- appropriate regulatory sequences including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
- shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
- a vector including nucleic acid according to the invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the gene.
- the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell.
- a host cell such as a microbial, (e.g. bacterial), or plant cell.
- the vector may be a bi-functional expression vector which functions in multiple hosts. In the case of GTase genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
- promoter is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription.
- Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design.
- Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.
- Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171) ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like, Other constitutive promoters include those in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.
- Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
- the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
- Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- la promoter, which is activated by salicylic acid.
- promoters of interest include steroid- responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and US Patent Nos. 5,814,618 and 5,789,156, herein incorporated by reference.
- tissue-specific promoters can be utilised.
- Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331- 1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol.
- operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
- DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
- the promoter is an inducible promoter or a developmentally regulated promoter.
- nucleic acid constructs which operate as plant vectors.
- Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148.
- Suitable vectors may include plant viral- derived vectors (see e.g. EP-A-194809).
- selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e.g. kanamycin, hygromycm, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
- said promoter is the cinnamate-4-hydroxylase (CH4) promoter, wherein C4H is an enzyme in the phenylpropanoid pathway.
- said promoter is the constitutive promoter, CaMN 35S promoter.
- the expression of said nucleic acid molecule is down-regulated to reduce glucosyltransferase activity in said cell.
- said expression is reduced by at least 10%.
- said activity is reduced by between 10%-99%.
- said activity is reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or at least 90% when compared to a non-transgenic reference cell.
- said down-regulation is as a result of said cell being null for a nucleic acid molecule selected from the group consisting of; i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1; ii) a nucleic acid molecule comprising a nucleic acid sequence which hybridises to the sequence in (i) above; iii) a nucleic acid molecule comprising a nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
- a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields R ⁇ A which is complementary to normal mR ⁇ A transcribed from the "sense" strand of the target gene.
- R ⁇ A is complementary to normal mR ⁇ A transcribed from the "sense" strand of the target gene.
- Antisense technology is also reviewed in Bourque (1995), Plant Science 105, 125- 149, and Flavell (1994) PNAS USA 91, 3490-3496.
- said down-regulation is as a result of said cell being null for a nucleic acid molecule selected from the group consisting of; i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1 and Figure 3 and/or Figure 5; ii) a nucleic acid molecule comprising a nucleic acid sequence which hybridises to the sequence in (i) above; iii) a nucleic acid molecule comprising a nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
- said down-regulation is the result of said cell being null for a nucleic acid molecule comprising a nucleic acid sequence as shown in Figure 3 and Figure 5 or a nucleic acid molecule which hybridises to a nucleic acid molecule comprising a nucleic acid sequence as shown in Figure 3 and Figure 5.
- said cell is transformed with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1; ii) a nucleic acid molecule comprising a nucleic acid sequence which hybridises to the sequence in (i) above and which glucosylates at least one monolignol; iii) a nucleic acid molecule comprising a nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above, wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.
- said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.
- said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.
- first and second parts are linked by at least one nucleotide base.
- first and second parts are linked by 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide bases.
- linker is at least 10 nucleotide bases.
- the length of the RNA molecule or antisense RNA is between 10 nucleotide bases (nb) and lOOOnb.
- RNA molecule or antisense RNA is lOOnb; 200nb; 300nb; 400nb; 500nb; 600nb; 700nb; 800nb; 900nb; or lOOOnb in length. More preferably still said RNA molecule or antisense RNA is at least lOOOnb in length.
- the length of the RNA molecule or antisense RNA is at least lOnb; 20nb; 30nb; 40nb; 50nb; 60nb; 70nb; 80nb; or 90nb in length.
- said RNA molecule is 21nb in length.
- said cell is transformed with a nucleic acid molecule comprising an expression cassette(s) which cassette(s) comprises a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1 and Figure 3 and/or Figure 5; iii) a nucleic acid molecule comprising a nucleic acid sequence which hybridises to the sequence in (i) above and which glucosylates at least one monolignol; iii) a nucleic acid molecule comprising a nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above, wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.
- cassette(s) comprises a nucleic acid sequence selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure 1 and
- said cassette(s) comprises a nucleic molecule comprising a nucleic acid sequence as shown in Figure 3 and Figure 5 or a nucleic acid molecule which hybridises to a nucleic acid molecule comprising a nucleic acid sequence as shown in Figure 3 and Figure 5.
- said expression cassette is part of a vector.
- said transgenic cell is a eukaryotic cell.
- said eukaryotic cell is a plant cell.
- said eukaryotic cell is a yeast cell.
- said transgenic cell is a prokaryotic cell.
- said prokaryotic cell is a bacterial cell.
- a transgenic plant comprising a transgenic cell of the invention.
- said plant is a woody plant selected from: poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak; spruce.
- said woody plant is a plant used typically in the paper industry, for example poplar.
- said plant is a non-woody plant selected from the group consisting of: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (helianthus annuas), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Iopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.)
- plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea, and other root, tuber or seed crops.
- Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum.
- Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, and carnations and geraniums.
- the present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, chrysanthemum.
- Grain plants that provide seeds of interest include oil-seed plants and leguminous plants.
- Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc.
- Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc.
- Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.
- a further aspect of the invention there is provided for modulating the lignin content of a plant comprising the steps of; i) providing a cell according to the invention, ii) providing conditions conducive to growth of said cell into a plantlet and optionally iii) determining the lignin content of said plant.
- a method of manufacture of paper or board from a transgenic plant exhibiting an altered lignin content comprising the steps of; i) pulping the transgenic wood material derived from the transgenic plant according to the invention; and ii) producing paper from said pulped transgenic wood material.
- Figure 1 is the nucleic acid sequence of glucosyltransferase 72E1;
- Figure 2 is the amino acid sequence of glucosyltransferase 72E1;
- Figure 3 is the nucleic acid sequence of glucosyltransferase 72E2;
- Figure 4 is the amino acid sequence of glucosyltransferase 72E2;
- Figure 5 is the nucleic acid sequence of glucosyltransferase 72E3
- Figure 6 is the amino acid sequence of glucosyltransferase 72E3;
- Figure 7 illustrates examples of monolignols and their modfication by the glucosyltransferase 72E1 and 72E2;
- Figure 8a A 248 bp UTG72E1 cDNA fragment was amplified using oligos 72E1- 5(XhoI/XmaI) (CTCGAGCCCGGGATGAAGATTACAAAAC) and 72El-3(5-E3) (ATCTTGTCACCACAAAGGCTGATGGGTCG);
- Figure 8b A 234 bp UTG72E3 cDNA fragment was amplified using oligos 72E3-5(3-El) (CGACCCATCAGCCTTTGTGGTGACCAAGAT) and 72E3-3(5-E2) (GGTATAGCGAGTGGGTTTCGTTGCACTGTG);
- Figure 8c A 247 bp UTG72E2 cDNA fragment was amplified using oligos 72E2-5(3-E3) (CACAGTGCAACGAAACCCACTCGCTATACC) and 72E2-3(XbaI/SwaI) (ATTTAAATTCTAGAGATGATTGTATCGGTCTG) nucleic
- Recombinant UGT72E1 was expressed and purified from E. coli as described previously (Lim et al., 2001, J. Biol. Chem. 276, 4344-4349). The enzyme (2 ⁇ g) was incubated with 1 mM phenolic substrates, 5 mM UDP-glucose, 100 mM Tris-HCl, pH 7.0 in a total volume 200 ⁇ l. The reaction mix was incubated at 30 °C for 1 h and was analysed using HPLC subsequently.
- Coniferyl alcohol 10-25% acetonitrile (0.1 % TFA), 306 nm Sinapyl alcohol: 10-25% acetonitrile (0.1% TFA), 285 nm p-coumaryl alcohol: 10-25% acetonitrile (0.1 % TFA), 311 nm conifery aldehyde: 10-47% acetonitrile (0.1% TFA), 311 nm sinapylaldehyde: 10-47% acetonitrile (0.1% TFA), 280 nm p-coumaryl aldehyde: 10-47% acetonitrile (0.1% TFA), 315 nm
- Table 1 illustrates the activity of 72E1 with respect to monolignol substrates.
- the UGT72E1 and UGT72E3 fragments were linked by standard procedure taking advantage of the overlapping sequences of oligos 72El-3(5-E3) and 72E3-5(3-El) and further PCR amplification using oligos 72El-5(XhoI/XmaI) and 72E3-3(5-E2). Then the UGT72E1E3 fragment were linked to the UGT72E2 fragment by, again, taking advantage of the overlapping sequence of oligos 72E3-3(5-E2) and 72E2-5(3- E3) and further PCR amplification with oligos 72El-5(XhoI/XmaI) and 72E2- 3(XbaI/SwaI).
- the UGT72E1E3E2 fragment was then cloned into the pGEM-T vector (Promega). From that vector the fragment was excised by Xbal/Xmal double digestion and cloned into pFGC5941 (http://www.chromdb.org/plasmids/pFGC5941.html) open with the same restriction enzymes. Then the fragment UGT72E1E3E2 was excised from the pGEM-T construct with a Xhol/Swal double digestion and cloned into Xhol/Swal- digested pFGC5941 vector (carrying the previously cloned Xbal/Xmal UGT72E1E3E2 fragment) .
- the resulting 72E132 inverted repeat construct was used to transform A. thaliana (Columbia ecotype) plants using standard floral-dipping methods.
- Kanamycin resistant plants were selected in media containing the antibiotic. Some (10 out of 40) of the Tl primary transformants showed more elongated petioles and a smaller plant size compared to non-transformed plants. We are currently selecting for T3 homozygous plants. These plants will be assessed for RNA levels of the targeted UGT mRNAs and then a more deep analysis of secondary metabolite population will be conducted.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Paper (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/575,349 US20070049744A1 (en) | 2003-10-13 | 2004-10-12 | Glucosyltransferases |
EP04768861A EP1675945A1 (en) | 2003-10-13 | 2004-10-12 | Glucosyltransferases |
NZ546404A NZ546404A (en) | 2003-10-13 | 2004-10-12 | Transgenic cells expressing nucleic acids encoding glucosyltransferase polypeptides |
BRPI0415317-0A BRPI0415317A (en) | 2003-10-13 | 2004-10-12 | transgenic cell, transgenic plant, and methods for modulating the lignin content of a plant and for making paper or cardboard from a transgenic plant demonstrating an altered lignin content |
AU2004284283A AU2004284283B2 (en) | 2003-10-13 | 2004-10-12 | Glucosyltransferases |
US12/638,069 US20100181035A1 (en) | 2003-10-13 | 2009-12-15 | Glucosyltransferases |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0323813.6 | 2003-10-13 | ||
GBGB0323813.6A GB0323813D0 (en) | 2003-10-13 | 2003-10-13 | Glucosyltransferases |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/638,069 Continuation US20100181035A1 (en) | 2003-10-13 | 2009-12-15 | Glucosyltransferases |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2005040363A1 true WO2005040363A1 (en) | 2005-05-06 |
Family
ID=29433710
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB2004/004330 WO2005040363A1 (en) | 2003-10-13 | 2004-10-12 | Glucosyltransferases |
Country Status (8)
Country | Link |
---|---|
US (2) | US20070049744A1 (en) |
EP (1) | EP1675945A1 (en) |
AU (1) | AU2004284283B2 (en) |
BR (1) | BRPI0415317A (en) |
GB (1) | GB0323813D0 (en) |
NZ (1) | NZ546404A (en) |
WO (1) | WO2005040363A1 (en) |
ZA (1) | ZA200602887B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB201820109D0 (en) | 2018-12-11 | 2019-01-23 | Vib Vzw | Plants with a lignin trait and udp-glycosyltransferase mutation |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001059140A1 (en) * | 2000-02-09 | 2001-08-16 | The University Of York | Transgenic cells expressing glucosyltransferase nucleic acids |
WO2002000894A2 (en) * | 2000-06-30 | 2002-01-03 | Cropdesign N.V. | Gene silencing vector |
WO2002006320A2 (en) * | 2000-07-14 | 2002-01-24 | Institut Für Pflanzenbiochemie | Method for influencing the content of sinapine in transgenic plant cells and plants |
WO2002016655A2 (en) * | 2000-08-24 | 2002-02-28 | The Scripps Research Institute | Stress-regulated genes of plants, transgenic plants containing same, and methods of use |
WO2003078629A1 (en) * | 2002-03-20 | 2003-09-25 | Basf Plant Science Gmbh | Constructs and methods for the regulation of gene expression |
WO2004113540A1 (en) * | 2003-06-18 | 2004-12-29 | The University Of York | Expression of heterologous protein |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997008331A1 (en) * | 1995-08-30 | 1997-03-06 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Stimulation of homologous recombination in eukaryotic organisms or cells by recombination promoting enzymes |
-
2003
- 2003-10-13 GB GBGB0323813.6A patent/GB0323813D0/en not_active Ceased
-
2004
- 2004-10-12 EP EP04768861A patent/EP1675945A1/en not_active Withdrawn
- 2004-10-12 WO PCT/GB2004/004330 patent/WO2005040363A1/en active Application Filing
- 2004-10-12 US US10/575,349 patent/US20070049744A1/en not_active Abandoned
- 2004-10-12 BR BRPI0415317-0A patent/BRPI0415317A/en not_active IP Right Cessation
- 2004-10-12 AU AU2004284283A patent/AU2004284283B2/en not_active Ceased
- 2004-10-12 NZ NZ546404A patent/NZ546404A/en unknown
-
2006
- 2006-04-07 ZA ZA200602887A patent/ZA200602887B/en unknown
-
2009
- 2009-12-15 US US12/638,069 patent/US20100181035A1/en not_active Abandoned
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001059140A1 (en) * | 2000-02-09 | 2001-08-16 | The University Of York | Transgenic cells expressing glucosyltransferase nucleic acids |
WO2002000894A2 (en) * | 2000-06-30 | 2002-01-03 | Cropdesign N.V. | Gene silencing vector |
WO2002006320A2 (en) * | 2000-07-14 | 2002-01-24 | Institut Für Pflanzenbiochemie | Method for influencing the content of sinapine in transgenic plant cells and plants |
WO2002016655A2 (en) * | 2000-08-24 | 2002-02-28 | The Scripps Research Institute | Stress-regulated genes of plants, transgenic plants containing same, and methods of use |
WO2003078629A1 (en) * | 2002-03-20 | 2003-09-25 | Basf Plant Science Gmbh | Constructs and methods for the regulation of gene expression |
WO2004113540A1 (en) * | 2003-06-18 | 2004-12-29 | The University Of York | Expression of heterologous protein |
Non-Patent Citations (6)
Title |
---|
DATABASE EMBL [online] 13 May 1999 (1999-05-13), "Arabidopsis thaliana DNA chromosome 3, BAC clone F18B3", XP002318944, retrieved from EBI accession no. EM_PRO:ATF18B3 Database accession no. ATF18B3 * |
DATABASE EMBL [online] 15 June 2000 (2000-06-15), "Arabidopsis thaliana cDNA clone:APZ04c01R, 5' end.", XP002318945, retrieved from EBI accession no. EM_PRO:AV526055 Database accession no. AV526055 * |
LI YI ET AL: "Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 6, 9 February 2001 (2001-02-09), pages 4338 - 4343, XP002318942, ISSN: 0021-9258 * |
LIM E-K ET AL: "The activity of Arabidopsis glycosyltransferases toward salicylic acid, 4-hydroxybenzoic acid, and other benzoates", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 277, no. 1, 4 January 2002 (2002-01-04), pages 586 - 592, XP002237707, ISSN: 0021-9258 * |
LIM ENG-KIAT ET AL: "Identification of glucosyltransferase genes involved in sinapate metabolism and lignin synthesis in Arabidopsis", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 276, no. 6, 9 February 2001 (2001-02-09), pages 4344 - 4349, XP002172233, ISSN: 0021-9258 * |
ROSS J ET AL: "Higher plant glycosyltransferases", GENOMEBIOLOGY 2001 UNITED KINGDOM, vol. 2, no. 2, 2001, pages 3004.1 - 3004.6, XP002318943, ISSN: 1465-6906 * |
Also Published As
Publication number | Publication date |
---|---|
BRPI0415317A (en) | 2006-12-05 |
AU2004284283A1 (en) | 2005-05-06 |
US20100181035A1 (en) | 2010-07-22 |
US20070049744A1 (en) | 2007-03-01 |
NZ546404A (en) | 2010-04-30 |
AU2004284283B2 (en) | 2009-10-01 |
EP1675945A1 (en) | 2006-07-05 |
ZA200602887B (en) | 2007-09-26 |
GB0323813D0 (en) | 2003-11-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20080209597A1 (en) | Transgenic Cells Expressing Glucosyltransferase Nucleic Acids | |
Thompson et al. | Ectopic expression of a tomato 9‐cis‐epoxycarotenoid dioxygenase gene causes over‐production of abscisic acid | |
Wuddineh et al. | Identification and overexpression of gibberellin 2‐oxidase (GA 2ox) in switchgrass (P anicum virgatum L.) for improved plant architecture and reduced biomass recalcitrance | |
Jin et al. | Overexpression of Populus trichocarpa CYP 85A3 promotes growth and biomass production in transgenic trees | |
Jeon et al. | Developing xylem‐preferential expression of PdGA20ox1, a gibberellin 20‐oxidase 1 from Pinus densiflora, improves woody biomass production in a hybrid poplar | |
Li et al. | The growth reduction associated with repressed lignin biosynthesis in Arabidopsis thaliana is independent of flavonoids | |
Qin et al. | Overexpression of a 9-cis-epoxycarotenoid dioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances drought tolerance | |
von Dahl et al. | Tuning the herbivore‐induced ethylene burst: the role of transcript accumulation and ethylene perception in Nicotiana attenuata | |
Li et al. | LeERF1 positively modulated ethylene triple response on etiolated seedling, plant development and fruit ripening and softening in tomato | |
Rommens et al. | Engineered native pathways for high kaempferol and caffeoylquinate production in potato | |
Espley et al. | Red to brown: an elevated anthocyanic response in apple drives ethylene to advance maturity and fruit flesh browning | |
Davuluri et al. | Manipulation of DET1 expression in tomato results in photomorphogenic phenotypes caused by post‐transcriptional gene silencing | |
Senior | Uses of plant gene silencing | |
US20210115462A1 (en) | NOVEL MUTANT PLANT CINNAMOYL-CoA REDUCTASE PROTEINS | |
Beyene et al. | Cassava shrunken-2 homolog MeAPL3 determines storage root starch and dry matter content and modulates storage root postharvest physiological deterioration | |
Andrade et al. | Biomass accumulation and cell wall structure of rice plants overexpressing a dirigent-jacalin of sugarcane (ShDJ) under varying conditions of water availability | |
US7071376B2 (en) | Genes encoding p-coumarate 3-hydroxylase (C3H) and methods of use | |
WO2013190322A1 (en) | Regulation of seed dormancy | |
AU2004284283B2 (en) | Glucosyltransferases | |
WO2006021558A2 (en) | A plant with reduced lignin by modulating dahps gene expression | |
US20100281567A1 (en) | Transgenic plants having altered levels of aromatic amino acids and metabolites derived therefrom | |
WO2009095641A2 (en) | Enhanced plant growth | |
US20240164267A1 (en) | Genetic mechanism to enhance healthy sterols and hard endosperm in seeds | |
WO2003023035A2 (en) | Glucosyltransferases which glucosylate abscisic acid | |
WO2004003208A2 (en) | Stress tolerant plant |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2004284283 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004768861 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 546404 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006/02887 Country of ref document: ZA Ref document number: 200602887 Country of ref document: ZA |
|
ENP | Entry into the national phase |
Ref document number: 2004284283 Country of ref document: AU Date of ref document: 20041012 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 546615 Country of ref document: NZ |
|
WWP | Wipo information: published in national office |
Ref document number: 2004284283 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 2004768861 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007049744 Country of ref document: US Ref document number: 10575349 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: PI0415317 Country of ref document: BR |
|
WWP | Wipo information: published in national office |
Ref document number: 10575349 Country of ref document: US |