WO2004065606A2

WO2004065606A2 - Glycerol kinase inhibition in transgenic plant cells

Info

Publication number: WO2004065606A2
Application number: PCT/GB2004/000007
Authority: WO
Inventors: Peter Eastmond
Original assignee: The University Of York
Priority date: 2003-01-22
Filing date: 2004-01-05
Publication date: 2004-08-05
Also published as: GB0301415D0; WO2004065606A3

Abstract

We describe a transgenic plant cell which is genetically modified to provide a regulatable copy of a gene encoding a glycerol kinase, said plant shows increased resistance to abiotic stress and elevated cellular glycerol content.

Description

Glycerol Kinase Expression in Transgenic Plant Cells

The invention relates to a transgenic plant cell, which is genetically modified to provide a regulatable copy of a gene encoding a glycerol kinase.

Glycerol is an important compound used in many industrial applications. For example, it is used in cosmetics, soaps, food, pharmaceuticals, lubricants, paints and anti-freeze solutions. Derivatives of glycerol such as glycerol esters are used in the fat and oil industry. Typically, glycerol is extracted from oil or produced either synthetically from propylene or by hydrogenolysis of carbohydrates. Certain species of yeast and algae also produce glycerol, for example Saccharomyces spp [1], Dunaliella spp and Astromonas spp [2]. Glycerol is produced as an osmolyte/ osmoprotectant to ameliorate various abiotic stresses. Glycerol plays a role in maintaining intracellular water balance, stabilizes proteins, protein complexes, membranes and protects against oxidative damage by scavenging reactive oxygen intermediates [1,3]. Two enzymes are required for glycerol synthesis from the glycolytic intermediate dihydroxyacetone phosphate. Glycerol-3-phosphate dehydrogenase (GPD) has been cloned and characterized from numerous organisms [e.g. 4]. To date glycerol-3 -phosphate phosphatase (GPP) has only been cloned and characterized from S. cerevisiae [3].

The primary seed storage reserve of many higher plants is triacylglycerol (TAG). During germination TAG reserves are broken down and the carbon skeletons used to support post-germinative growth [5]. The initial step in the process is catalysed by TAG lipase, which hydrolyses TAG to yield free fatty acids and glycerol in a 3:1 molar ratio. The subsequent conversion of fatty acids to sucrose has been intensively studied in plants and many of the genes concerned have been cloned and characterised [6,7]. contrast, relatively little is known about the pathway of glycerol metabolism in plants, the enzymes responsible have yet to be defined at the molecular level and its physiological importance has not been tested. Experiments using radiolabel have established that glycerol is also converted to sucrose in germinating seeds [8]. Two alternative pathways have been described for such a conversion to occur (Fig. 11). In the first pathway glycerol is phosphorylated to glycerol-3-phosphate by glycerol kinase (EC: 2.7.1.30) and then converted to dihydroxyacetone phosphate by a glycerol-3 -phosphate dehydrogenase (or oxidase) [9,10]. Glycerol-3-phosphate dehydrogenase commonly exists as a cytosolic NAD⁺- dependent form or as a FAD⁺-dependent form, which is mitochondrial in mammals and yeast [9,10]. Alternatively, in some bacteria that lack cytochrome a glycerol-3- phosphate oxidase is used [11]. hi the second pathway glycerol is converted to dihydroxyacetone by NAD⁺-glycerol dehydrogenase and then phosphorylated to dihydroxyacetone phosphate by dihydroxyacetone kinase [9,10]. hi either pathway the dihydroxyacetone phosphate generated is available to be converted to sucrose by gluconeogenesis (or serve as a respiratory substrate).

In a biochemical study by Huang [12], using castor bean (Ricinus communis) and peanut (Archis hypogaea), glycerol dehydrogenase activity was not detected in the germinating seed. In contrast glycerol kinase and FAD⁺-dependent glycerol-3- phosphate dehydrogenase activity were present [12]. These data suggest that glycerol is likely to be metabolised to dihydroxyacetone phosphate by the sequential action of glycerol kinase and FAD⁺-dependent glycerol-3-phosphate dehydrogenase [12] (Fig. 11).

Glycerol is known to be toxic to plants [13]. This toxicity might be a result of glycerol phosphorylation leading to a depletion of free phosphate in the cell of glycerol-3-phosphate inhibiting cellular metabolism. In order to identify genes involved in glycerol catabolism we have used a genetic screen to isolate glycerol resistant (glr) mutant seedlings.

Three separate mutant loci were identified (girl, glr2 and glr3). Glycerol rescued the post-germinative growth of icl-2 mutant seedlings that are unable to convert storage oil to sugars [14], demonstrating that glycerol is taken up and metabolised. However, glycerol was unable to rescue growth of a girl icl-2 double mutant showing that girl is unable to metabolise glycerol. The survival of germinating girl seeds was only significantly impaired in poor light conditions. Enzyme assays revealed that girl lacks glycerol kinase activity, girl alleles contained mutations in a putative glycerol kinase gene. A cDNA encoding AtGLRl was cloned an its function confirmed by complementation of an E. coli glpK detetion strain [15]. Quantitative RT-PCR analysis showed that AtGLRl is expressed constitutively in many tissues but is transiently up regulated during early post-germinative growth and senescence.

The girl mutant has a number of interesting phenotypes. The girl mutant plants accumulate high levels of glycerol during germination and early post-germinative growth without detrimental effects and show dramatically enhanced tolerance to various abiotic stresses, for example, salt, osmotic stress, freezing and desiccation. Stress is a major factor that limits the productivity of crops. Furthermore if glycerol is produced in sufficient amounts in plants it can be produced as a viable crop and extracted for industrial use.

According to an aspect of the invention there is provided a transgenic plant cell wherein the genome of said cell is modified such that the activity of glycerol kinase is reduced when compared to a non-transgenic reference cell of the same species.

In a preferred embodiment of the invention said activity is reduced by at least 10%. Preferably said activity is reduced by between about 10%-90%. Preferably said activity is reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or at least 90% when compared to a non-transgenic reference cell of the same species.

In a preferred embodiment of the invention said cell is transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter, said sequence selected from the group consisting of: i) a sequence, or part thereof, comprising an antisense sequence of the sequence presented in Figure 8; ii) antisense sequences, which hybridise to the sense sequence presented in Figure 8 and which inhibit the activity of glycerol kinase.

In an alternative preferred embodiment of the invention said cell is transformed with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of glycerol kinase wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.

hi a preferred embodiment of the invention said nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of: i) a nucleic acid sequence, or part thereof, represented by the sequence in Figure

8; ii) a nucleic acid sequence, or part thereof, which hybridises to the sequence in Figure 8 and encodes at least part of a glycerol kinase polypeptide; and iii) a nucleic acid sequence which is degenerate as a result of the genetic code to the sequences in (i) and (ii).

In a further preferred embodiment of the invention said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.

hi a further preferred embodiment of the invention said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.

In a preferred embodiment of the invention said first and second parts are linked by at least one nucleotide base, hi a further preferred embodiment of the invention said first and second parts are linked by 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide bases. In a yet further preferred embodiment of the invention said linker is at least 10 nucleotide bases.

hi a further preferred embodiment of the invention the length of the RNA molecule or antisense RNA is between 10 nucleotide bases (nb) and lOOOnb. Preferably said RNA molecule or antisense RNA is lOOnb; 200nb; 300nb; 400nb; 500nb; 600nb; 700nb; 800nb; 900nb; or lOOOnb in length. More preferably still said RNA molecule or antisense RNA is at least lOOOnb in length.

More preferably still the length of the RNA molecule or antisense RNA is at least lOnb; 20nb; 30nb; 40nb; 50nb; 60nb; 70nb; 80nb; or 90nb in length.

More preferably still said RNA molecule is 21nb in length.

In a further preferred embodiment of the invention said expression cassette is part of a vector.

Preferably the nucleic acid in the vector is operably linked to an appropriate promoter or other regulatory elements for transcription in a host plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts, hi the example of nucleic acids according to the invention this may contain its native promoter or other regulatory elements.

By "promoter" is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells. Constitutive promoters include, for example CaMV 35S promoter (Odell et al (1985) Nature 313, 9810-812); rice actin (McElroy et al (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al . (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.

Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize hι2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- la promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid- responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellie et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline- repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and US Patent Nos. 5,814,618 and 5,789,156, herein incorporated by reference.

Where enhanced expression in a particular tissue is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al (1996) Plant Physiol. 112(2): 525-535; Canevascni et al (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al (1993) Proc. Natl. Acad. Sci. USA 90(20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.

"Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.

In a preferred embodiment the promoter is an inducible promoter or a developmentally regulated promoter.

Particular vectors are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148). Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).

Vectors may also include selectable genetic marker such as those that confer selectable phenotypes such as resistance to herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuiOn, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).

hi a further preferred embodiment of the invention said cell is additionally transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter, said sequence selected from the group consisting of: i) a nucleic acid molecule consisting of a nucleic acid sequence as represented in Figure 9; ii) a nucleic acid molecule which hybridises to the nucleic acid molecule in (i) and which has glycerol-3 -phosphate phosphatase activity; and iii) a nucleic acid molecule consisting of a nucleic acid sequence which is degenerate as a consequence of the genetic code to the sequences defined in (i) and (ii).

In a still further preferred embodiment of the invention said cell is additionally transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter, said sequence selected from the group consisting of:

i) a nucleic acid molecule consisting of a nucleic acid sequence as represented in Figure 10; ii) a nucleic acid molecule which hybridises to the nucleic acid molecule in (i) and which has glycerol-3-phosphate dehydrogenase activity; and iii) a nucleic acid molecule consisting of a nucleic acid sequence which is degenerate as a consequence of the genetic code to the sequences defined in (i) and (ii).

hi a preferred embodiment of the invention said plant cell nucleic acid molecule is part of a vector as herein described.

According to a further aspect of the invention there is provided a plant comprising a cell according to the invention.

In a preferred embodiment of the invention there is provided a plant selected from the group consisting of: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Iopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Cirrus' spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia inter grifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables.

Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea), and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, sorghum, and flax (linseed).

Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, and pepper.

Particularly preferred species are those of ornamental plants.

Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.

According to a yet further aspect of the invention there is provided a seed comprising a cell according to the invention.

According to a further aspect of the invention there is provided a method to regulate glycerol kinase activity in a plant comprising the steps of: i) providing a transformed cell according to the invention; ii) regenerating said cell into a plant; iii) monitoring glycerol kinase activity of said plant.

In a preferred method of the invention said plant has elevated glycerol content when compared to a non-transformed reference plant of the same species. Preferably the seed glycerol content of said plant is elevated.

According to a further aspect of the invention there is provided a method to extract glycerol, or a derivative thereof, from a plant or plant cell or seed comprising the steps: i) cultivating a plant cell or plant according to the invention or providing a seed according to the invention; and ii) extracting and optionally purifying glycerol, or derivative thereof, from said plant cell or plant or seed.

According to a further aspect of the invention there is provided a method to cultivate a plant according to invention under abiotic stress conditions comprising providing a plant or seed according to the invention and providing conditions suitable for the growth and/or germination of said plant.

An embodiment of the invention will now be described by example only and with reference to the following figures:

Figure 1 illustrates the effect of glycerol on root growth of five day-old wild type (colO) and glycerol resistant (glr) Arabidopsis mutants. (A) The effect of increasing glycerol concentration on root growth. (B) The effect of 20 mM glycerol on root growth of wild type and glycerol resistant mutants. Values are the mean ±SE of measurements made on three separate batches of 25 seedlings; Figure 2 illustrates the effect of sucrose and glycerol on the hypocotyls length (A) and lipid content (B) of 5-day old wild type and mutant Arabidopsis seedlings grown in the dark. Values are the mean ±SE of measurements made on three separate batches of 25 seedlings;

Figure 3 illustrates the effect of varying day length (A) and light intensity (B) on the frequency of survival of germinating wild type and mutant seeds. Values are expressed as the % of 500 seeds. The light intensities used were 160, 80 and 40 μmol Photosynthetic Photon Flux Density m^"2 s^"1 (continuous light) and the photoperiods used were 16, 12 and 8 hours (at 160 μmol PPFD m^"2 s^"1). Seedlings were scored two weeks after imbibition and survival defined by the ability to develop beyond cotyledon expansion and produce true leaves;

Figure 4 illustrates (A) A schematic diagram of AtGLRl that shows the locations of mutations in three girl alleles. (B) Predicted amino acid sequence of AtGLRl. Features of the protein sequence are underlined. FGGY family carbohydrate kinase signature 1 ([MFYGS]-x-[PST]-x(2)-K-[LIVMFYW]-x-W-[LiVMF]-x-

[DENQTKR]-[ENQH]) and signature 2 ([GSA]-x-[LIVMFYW]-x-G-[LιVM]-x(7,8)-

[HDENQ]-[LΓVMF]-X(2)-[AS]-[STALΓVM]-[LΓVMFY]-[DEQ]);

Figure 5 illustrates (A) Complementation of E. coli glpK deletion strain DGl by AtGLRl. DGl was transformed with pBluescript plus or minus AtGLRl. The medium consisted of MacConkey agar base, ampicillin, IPTG and either lactose or glycerol as a sole carbon source. (B) Saturation kinetics of glycerol kinase activity in DGl cells over-expressing AtGLRl. Glycerol and ATP concentrations were varied independently. Values are the mean ±SE of measurements made on three separate protein extracts. K_m values were calculated from double reciprocal plots;

Figure 6 illustrates real time quantitative RT-PCR analysis of the expression of AtGLRl. Germinating seeds and seedlings were two- and five-days post imbibition, respectively. Levels of transcript are relative to that of the constitutive control gene AtACT2;

Figure 7 illustrates a schematic diagram of storage lipid breakdown in germinating Arabidopsis seeds showing the relationship between fatty acid and glycerol catabolism. TAG is triacylglycerol, FA is fatty acids, OAA is oxaloacetic acid and DHAP is dihydroxyacetone phosphate, girl is glycerol kinase and icl-2 is isocitrate lyase;

Figure 8 illustrates the DNA sequence of A. thaliana GLR1;

Figure 9 illustrates the DNA sequence of S. cerevisiae glycerol-3-phosphate phosphatase 1 (GPP1);

Figure 10 illustrates the DNA sequence of S. cerevisiae glycerol-3 -phosphate dehydrogenase 1 (GPD1);

Figure 11 a schematic representation of glycerol metabolism DHAP is dihydroxyacetone phosphate, G-3-P is glycerol-3-phosphate, DHA is dihydroxyacetone, GPD is G-3-P dehydrogenase, GPP is G-3-P phosphatase, GK is glycerol kinase, AT is acyltransferase, AH is acylhydrolase, GDH is glycerol dehydrogenase, DHAK is DHA kinase;

Figure 12 illustrates glycerol accumulation in glrl-1 and wild-type Arabidopsis thaliana seeds during germination. Values are the mean ±SE of measurements made on three separate batches of 500 seedlings;

Figure 13a and 13b illustrates germination efficiency in the presence of increasing osmotic stress caused by (A) mannitol and (B) NaCl in glrl-1 and wild-type Arabidopsis thaliana. Values are the % of 1000 seeds scored for radicle emergence after one week; Figure 14 illustrates survival of glrl-1 and wild-type Arabidopsis thaliana after cold stress caused by freezing. Values are the % survival of 500 seeds after thawing.

Materials and Methods

Plant material and growth conditions

Wild-type Arabidopsis thaliana (ecotype ColO) and SALK T-DNA line N567205 (glrl-3) were obtained from the Nottingham Arabidopsis Stock Centre (University of Nottingham, UK). E. coli glpK deletion strain DGl [15] was a gift from Dr. Donald W. Pettigrew (Texas A&M University, USA). M2 EMS mutagenized ColO seed was obtained from Lehle Seeds (Round Rock, TX, USA). Seeds were surface sterilised and imbibed for 4 days at 4°C in the dark on 0.8% (w/v) agar plates containing half strength Murashige and Skoog media (Sigma co.). They were then germinated and grown in various light conditions at 22°C. Seeds were germinated on NaCl and mannitol as described by Shi et al [16]. The freezing tolerance of germinating seedlings was tested using the method of Zin and Browse [17]. Desiccation experiments were performed by germinating seeds on wet filter paper (until radicle emergence) then drying the seed on the paper at 22°C, -30% relative humidity, in the flow hood at ~lm/s air flow for six hours. The pre-germinated seed was then rehydrated and the number of seedlings that developed scored.

Tissue extraction, enzyme assays and fatty acid and glycerol measurements

Crude tissue extracts were prepared from approximately 1000 two-day old seedlings. The tissue was ground in 1ml of extraction buffer (150 mM Tris/HCl pH 7.5, 10 mM KC1, 1 mm EDTA, 1 mm DTT) using a glass homogeniser. The extract was then centrifuged at 13,000g for 20 min. The supernatant was removed and the proteins precipitated using 80% ammonium sulphate. The pellet was then re-suspended in 200 μl of extraction buffer and desalted using a Sephadex G-25 column. Glycerol kinase assays were performed on plant tissue and bacterial cell extracts using a spectrophotometric method described by Liu et al., [18]. Mitochondrial FAD⁺- dependent glycerol-3-phosphate dehydrogenase activity was assayed according to Huang [12]. Protein content was determined as described by Bradford [19] using BSA as a standard. Fatty acids were measured using the method of Browse et al., [20]. Glycerol was measured using a commercial glycerol analysis kit (Roche Molecular Biochemicals).

Cloning and over-expression of AtGLRl

A fragment of AtGLRl (~lkb) was generated from Arabidopsis genomic DNA using PCR primers GLR1S (5'-tgaagacacttggcataccg) and GLR1A (5'-atgttctttccaccgctttg). A λZAPII cDNA library constructed from 2-day old arabidopsis seedlings was then screened by colony hybridisation according to Sambrook et al., [21] using the PCR product as a probe. Six putative AtGLRl clones were identified and sequenced. Among these was an AtGLRl cDNA, which was in frame with the N-terminus of the pBluescript β-galactosidase gene and could be expressed as a fusion protein following induction of E. coli cells with IPTG. This clone was transformed into DGl, an E. coli strain in which the endogenous glycerol kinase gene glpK is deleted [15]. For complementation studies cells were plated on MacConkey agar-glycerol- ampicillin plates [15] plus 0.4 mM IPTG. For kmetic analysis cells were grown at 37°C to an optical density of 0.5 at 600nm in LB media. 0.4 mM IPTG was then added to the culture and the cells grown over night at 28°C. The culture was centrifuged at 700 g for 10 min and the pellet re-suspended in extraction buffer (150 mM Tris/HCl pH 7.5, 10 mM KC1, 1 mm ΕDTA, 1 mm DTT). The cells were lysed by sonication and cell debris removed by centrifugation at 21000 g for 10 min. Assays were performed on the supernatant.

RNA extraction and reverse transcriptase-PCR

Total RNA from various tissues was isolated using the RNeasy kit (Qiagen) or the Purescript RNA isolation kit (Flowgen). Reverse transcription was performed using Superscript II RNase H^" Reverse Transcriptase ( ivitrogen) according to the manufacturers protocol. Real time PCR was carried out on an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems) using the SYBR green PCR master mix. The primers used were GLR1QS (5'-gcgggtctgaaaactttgga), GLR1QA (5'-tgggattctggaaggaagca), ACT2QS (5'-tgagagattcagatgcccagaa) and ACT2QA (5'- tggattccagcagcttccat).

EXAMPLE 1

Isolation of glycerol resistant mutants

To investigate the effect of glycerol on Arabidopsis post-germinative growth seeds were germinated on medium containing a range of glycerol concentrations. Glycerol was found to inhibit root growth at concentrations above 5 mM (Fig. 1A). At 100 mM glycerol also inhibited cotyledon expansion, greening and the development of true foliar leaves (not shown). Glycerol is likely to be taken up into Arabidopsis by aquaglyceroporins, some of which are predominantly expressed in the roots [22]. It has been suggested that the toxicity of glycerol to plants is a consequence of its metabolism [13]. If true then the disruption of genes involved in glycerol uptake or catabolism might lead to glycerol resistance. 40,000 M2 ethyl methane sulfonate (EMS) mutageinzed Arabidopsis seed were germinated on 20 mM glycerol and after five days glycerol resistant (glr) seedlings were selected. Seven lines were identified which were able to grow roots (Fig. IB) and develop true leaves. All the lines were recessive and allelism tests showed that they fall into three complementation groups (girl, glr2 and glr 3). EXAMPLE 2 Characterization of slrl

To investigate whether any of the glr mutants were unable to take up and metabolise glycerol they were crossed into an icl-2 background. The icl-2 mutant cannot convert storage oil to sugar since it is deficient in the glyoxylate cycle enzyme isocitrate lyase [14]. Consequently hypocotyl growth of dark grown icl-2 seedlings is inhibited. However, icl-2 growth can be rescued by providing an alternative source of carbon such as sucrose [14]. Glycerol is also able to rescue icl-2 hypocotyl growth (Fig. 2 A), demonstrating that it can be taken up and utilized as a carbon source. Of the three double mutants generated (glrl-1 icl-2, glr2-l icl-2 and glr3-l icl-2) only girl icl-2 hypocotyl growth could not be rescued by glycerol (Fig. 2A). Therefore the GLR1 gene product is required for glycerol uptake and / or catabolism while GLR2 and GLR3 are not.

The fresh weight and lipid content of girl seeds were not significantly different from wild type (not shown). However, further analysis of girl revealed there was a very small reduction in hypocotyl elongation of dark grown girl seedlings as compared to wild type (Fig. 2A). This phenotype indicated that glycerol released from the breakdown of storage oil makes a detectable contribution to post-germinative growth. The growth defect could be rescued by sucrose but not glycerol (Fig. 2A). Furthermore, growth of the girl icl-2 double mutant was more severely retarded than that of icl-2. Therefore the growth that does occur in icl-2 is supported in part by endogenous glycerol.

Measurement of the fatty acid content in five-day old etiolated seedlings shows that lipid breakdown is not impaired in girl (Fig. 2B). The breakdown of fatty acids in icl-2 is partially inhibited while girl icl-2 is unable to break down lipids (Fig. 2B). However, both icl-2 and girl icl-2 are able to break down lipids when they are provided with sucrose. Presumably this lipid is respired since in the absence of ICL it cannot be converted to sugars [14].

To investigate whether the survival of girl seedlings is affected by their inability to draw on glycerol seeds were germinated and grown under various light conditions (Fig. 3). In continuous light or at high light intensity (160 μmol m^"2 s^"1 PPFD) the frequency of seedling establishment was the same as wild type (Fig. 3). However in short photoperiods (8 h) or at low light intensity (40 μmol m^"2 s^"1 PPFD) the frequency of establishment was slightly lower than wild type (Fig. 3). Therefore a block in glycerol catabolism impacts on the survival of germinating Arabidopsis seed only when growth conditions severely delay or reduce photosynthesis. When grown in the greenhouse under standard conditions (22°C, 16h light) girl lacked any obvious morphological phenotype throughout the rest of its life cycle.

The growth of icl-2 is more severely impaired in poor light conditions than girl but many seedlings do survive. Hence the conversion of lipid to sugars is not essential [14]. Interestingly the girl icl-2 double mutant is unable to survive (Fig. 3), demonstrating that the reason the glyoxylate cycle is redundant in Arabidopsis is because glycerol can contribute enough carbon to gluconeogenesis and glycolysis to allow some seedlings to establish photosynthetic competence.

EXAMPLE 3

Identification of GLR1

To address the possibility that GLR1 encodes an enzyme of glycerol catabolism glycerol kinase and FAD⁺-dependent glycerol-3-phosphate dehydrogenase enzyme assays were performed on extracts from 2-day old girl and wild type seedlings (Table 1). Both girl alleles lacked glycerol kinase activity. A BLAST search of the Arabidopsis genome using known glycerol kinases revealed a putative homologue (MIPS code: Atlg80460). The glycerol kinase gene was sequenced from girl genomic DNA and independent point mutations identified in both alleles (Fig. 4A). i glrl-1 and glrl-2 single nucleotide G to A substitution were found at positions +1524 and +663, respectively (where 1 is the A of ATG). hi glrl-1 the mutation gives rise to a premature stop codon (TGG to TAG), h glrl-2 the mutation disrupts the exon/intron junction, following the second exon (AG/gt to AGAT). A T-DNA tagged allele of girl (N567205) was also obtained from the Nottingham Arabidopsis Stock Centre. This mutant (glr 1-3) contained an insertion at position +1598, in the third exon of AtGLRl (Fig. 2A), exhibited the same phenotype as the EMS mutants and was allelic (Fig. IB).

EXAMPLE 4

Cloning and characterization of GLRl

An AtGLRl PCR product was used as a probe to screen a cDNA library constructed from 2-day old germinating seedlings. Six putative AtGLRl clones were identified, sequenced and assembled. The AtGLRl cDNA was 1739 bp long and contained 1569 bp putative open reading frame. The deduced AtGLRl protein is 522 amino acids long (Fig. 4B), has a calculated molecular mass of 56437.07 Da and an isoelectric point of 5.88. No putative targeting signals could be identified. AtGLRl is likely to be a cytosolic protein as previously indicated by biochemical studies [12]. A similarity search revealed that AtGLRl shares 53, 37 and 46 % amino acid identity with glycerol kinases from H. sapiens, S. cerevisiae and E. coli, respectively. AtGLRl also contains a complete FGGY carbohydrate kinase signature 1 and all but one amino acid of signature 2 (Fig 4B). These signatures are conserved in fucolokinase, gluconokinase, xylulokinase and glycerokinase. An investigation of all available higher plant sequences indicates that there are GLRl homologues present in a taxonomicalfy diverse set of species including: potato (Solanum tuberosum) soybean (Glycine max), barley (Hordeum vulgare), poplar (Populus tremula) and pine (Pinus taeda).

To confirm the function of AtGLRl the cDNA was over-expressed in DGl, an E. coli glpK deletion strain [15], as a β-galactosidase fusion protein. DGl is unable to grow on glycerol as a sole carbon source. However, AtGLRl was able to complement growth of DGl on MacConkey agar-glycerol plates (Fig. 5A). Recombinant AtGLRl activity was studied in crude cell extracts from DGl cells grown on LB medium (Fig. 5B). The pH optimum was 8.5-9.0 and the apparent K_m values for the substrates glycerol and ATP were -60 and -280 μM, respectively (Fig. 5B). These values are similar to those previously reported for partially purified glycerol kinase from cucumber (Cucumis sativus) [23]. The catalytic activity of E. coli glycerol kinase is inhibited allosterically by fructose 1,6-bisphosphate [15]. However, AtGLRl activity was not affected in vitro by fructose 1,6-bisphosphate (not shown).

Real time quantitative RT-PCR was used to analyse the expression of AtGLRl over the course of germination and early post-germinative growth and in various tissues. AtGLRl transcripts were detected in all the tissues investigated (Fig. 6). Only trace levels of transcripts could be detected in imbibed seed. However, the levels increased upon germination, peaked two days after imbibition and declined by five days (Fig. 6). This pattern is consistent with a role for AtGLRl in storage oil breakdown, which is most rapid two days after imbibition [6]. AtGLRl was also up-regulated in senescing leaves (Fig. 6). AtGLRl transcripts were not detected by RT-PCR in two- day old girl -3 seedlings (data not shown).

hi order to characterize the pathway of glycerol catabolism in plants we have performed a genetic screen and identified three Arabidopsis mutants that have a glycerol resistant phenotype (girl, glr 2 and glr 3). Of the three mutants only girl is unable to metabolise glycerol. The girl mutant germinates and grows normally under standard glasshouse and growth room conditions. It is only very slightly impaired in post-germinative growth in low light and short photoperiods. Although the molar ratio of free fatty acids to glycerol from storage oil is 3:1, glycerol accounts for only an estimated 5% of the total carbon. Furthermore Arabidopsis seeds also contain significant amounts of storage protein and soluble carbohydrates [6].

Two distinct pathways have been described for glycerol utilization by various organisms [9,10] (Fig. 11). h the first pathway glycerol is initially converted to glycerol-3-phosphate and subsequently to dihydroxyacetone phosphate. In the second pathway glycerol is first converted to dihydroxyacetone and then to dihydroxyacetone phosphate. The Arabidopsis girl mutant is disrupted in a gene that encodes a glycerol kinase, establishing that in plants glycerol catabolism proceeds by the first pathway (Fig. 7). This is in agreement with a biochemical study, which reported that glycerol kinase activity is present in germinating oilseeds whereas glycerol dehydrogenase activity is not [12]. The second enzyme in the pathway has yet to be characterized in plants but is likely to be a mitochondrial FAD⁺-dependent glycerol-3-phosphate dehydrogenase [12]. The Arabidopsis genome contains a putative homologue of this gene (At3gl0370), which is 48% identical to that of humans.

AtGLRl is expressed in all Arabidopsis tissues but is up-regulated during germination and senescence. This expression pattern is similar to that of many genes involved in fatty acid catabolism [6]. In addition to its role in germinating oilseeds fatty acid β-oxidation is thought to be involved in recycling carbon from fatty acids when membrane lipids are turned over (particularly in senescing . tissues) [6]. Glycerol is also likely to be produced as a consequence of membrane lipid turnover. This carbon could be recycled via AtGLRl .

The glycerol resistant phenotype of girl confirms that the toxicity of glycerol (up to 100 mM) is a result of its catabolism. glr2 and glr 3 are not defective in glycerol catabolism but must convey resistance or insensitivity to its effect(s). The precise reason why glycerol is so toxic remains unclear. However, it is plausible that glycerol phosphorylation could cause cell phosphate levels to become depleted or that the glycerol-3-phosphate produced might interfere with various key metabolic processes. The molecular identity of GLR2 and GLR3 will help resolve this question.

EXAMPLE 5

Applications for engineering glycerol accumulation in plants

Drought, high salinity and low temperatures are all environmental factors that limit growth, hi response to abiotic stresses such as these, which affect intracellular water balance, many organisms accumulate non-toxic low molecular weight compounds that are osmotically active (called osmolytes) [24]. In some organisms (e.g. Saccharomyces cerevisiae) the principal osmolyte is glycerol [1]. hi addition to its role in maintaining intracellular water balance there is evidence that glycerol also stabilizes proteins, protein complexes and membranes and protects the cell against oxidative damage [1,3,24]. The latter could be achieved by preventing hydroxyl radical production and also by scavenging reactive oxygen intermediates [1,3,24]. Glycerol has been detected in a few plants such as gardenia, apple, mountain ash and pomegranate [25]. However high levels of glycerol are not common in plants, which appear to have evolved to use a variety of other osmolytes [24]. In response to hyper- osmotic stress S. cerevisiae synthesises glycerol from the glycolytic intermediate dihydroxyacetone phosphate via a two-step pathway (Fig. 11). Dihydroxyacetone phosphate is converted to glycerol-3-phosphate by NAD+-glyceraldehyde-3- phosphate dehydrogenase (GPD) and subsequently to glycerol by glycerol-3- phosphate phosphatase (GPP) [1,3].

Plants can also synthesise glycerol-3 -phosphate, which serves as a substrate for the formation of glycerolipids, an essential component of membranes (Fig. 11). However, GPP activity is likely to be either very low or absent in plants. Searching all the publicly available plant sequences has not revealed any proteins that are significantly homologues to known GPPs. It is therefore probable that most plants cannot synthesise glycerol directly from glycerol-3-ρhosphate because they lack GPP. Several attempt have been made to engineer plants to accumulate various osmolytes with the objective of improving stress tolerance [24,26]. Some have resulted in moderate increases in stress tolerance [24,26]. However, in many cases the levels of osmolytes that accumulate are relatively low and negative effects on growth have often been observed [24,26]. A major objective remains to elevate a specific osmolytes to high enough levels as to be effective without detrimental effects on crop yield [26].

Because the girl mutant cannot breakdown glycerol derived from TAG the glycerol accumulates during gennination and early-postgerminative growth (Fig. 12). The levels of sucrose and glucose are not affected. To investigate whether glycerol accumulation can enhance plant tolerance to hyper-osmotic stress girl seeds were germinated on medium containing sodium chloride or an external osmoticum (mannitol) [16]. In both cases girl seeds were more resistant than wild type (Fig. 13). The girl seeds that germinated on sodium chloride or mannitol were able to develop green cotyledons before eventually stalling. To test whether girl seedlings are more desiccation tolerant the seeds were germinated (radicle emerged), dried (at 22°C, -30% relative humidity, wind speed lm/s) for six hours and then re-hydrated. Using a sample size of 1000 seeds we found that 84 % of girl survived this treatment while only 2% of wild type survived. Glycerol is known to be a very effective cryopreservative [27]. To investigate the cold tolerance of girl we used essentially the same procedure as described by Zin and Browse [17]. We found that two-day old girl seedlings could survive freezing for ten hours at temperatures ~10°C lower (without cold acclimation) than wild type (Fig. 14). The cellular concentration of glycerol in girl peaks at an estimated 100-200 mM shortly after radicle emergence (assuming a cytosolic localization). Plants are known to have various permeases that can transport glycerol [22] and the extent of intra- and inter-cellular transport is not known. However, glycerol is retained in the seedling since dry seeds contain -400 ng of glycerol (in the form of TAG) and almost all of this remains 5 days after imbibition (Fig. 12). The estimated concentration of glycerol in girl seedlings is also quite modest and on its own it might not be expected to have a strong affect on the osmotic potential of the cytosol. Nevertheless our data clearly demonstrate that glycerol accumulation in plants leads to a very significant increase in tolerance to various abiotic stresses. Osmolytes are known to differ in their physical properties [24] and glycerol could act at several different levels to effectively protect plant cells against stress [1,3].

Drought, salt and frost tolerance are traits of high agronomic important and engineering glycerol accumulation into various crops could significantly increase productivity in the field. The accumulation of glycerol during germination and early post-germinative growth alone may be very beneficial. The transition from seed to seedling is a fragile one. To fulfil their genetic potential, seeds must germinate and seedlings emerge, quickly and uniformly throughout the field so that light, water and soil nutrients may be used for maximum efficiency. This seldom occurs in marginal environments and increased stress tolerance at this critical stage would be beneficial.

Priming seeds with various treatments is a common agricultural practice to make germination more uniform and growth more rapid [28]. Many seeds can be germinated and then dried. Upon re-hydration they develop more quickly. However desiccation tolerance is lost rapidly upon germination and the seed must be dried very slowly under elaborate and closely controlled conditions if any are to remain viable. The discovery that blocking glycerol catabolism allows germinated Arabidopsis seed to survive rapid drying may therefore be of major importance to the seed industry.

In commercial terms glycerol is also an important substance in its own right. At present the majority of glycerol used by industry is prepared synthetically either from propylene or by hydrogenolysis of carbohydrates. Glycerol has diverse properties and is used extensively. If plants can be made to accumulate high levels of glycerol in storage tissues such as tubers and seeds it could serve as a new designer crop.

EXAMPLE 6

Expression of S. cerevisiae GPPl (and GPPl) in Arabidopsis.

To increase glycerol levels in mature Arabidopsis plants S. cerevisiae GPD1 and GPPl will be expressed heterologously. By over-expressing these genes in wild-type and girl it will be possible to determine whether glycerol accumulates in these genetic backgrounds and whether growth is inhibited. Our working hypothesis is that if glycerol is synthesised in wild type plants accumulation will be impaired by breakdown and this will also causes toxic effects on growth. However, if GPD1 and GPPl are introduced into girl glycerol will accumulate and not inhibit growth. Importantly girl is not only glycerol resistant during germination but also throughout its life cycle. GPDl and GPPl will be expressed constirutively using the standard CaMV35S promoter. They will also be placed under the control of an inducible promoter so that the timing, tissue specificity and level of expression can be controlled. This will be important should expression cause toxic effects because it will allow glycerol accumulation to be maximized while minimizing the effect on growth. We will use the dexamethasone (DEX) inducible system [29]. This is a two- component system. One construct (LhGR) consists of a chimaeric transcription factor that is constirutively expressed and moves from the cytosol to the nucleus when DEX is applied. The second construct consists of an open reading frame (in this case GPDl or GPPl) driven by a promoter that is activated by the transcription factor. The LhGR line will be crossed into girl and the line transformed with the GPDl and GPPl containing constructs. Since plants are known to have NAD⁺-GPD activity it may only be necessary to express GPPl to produce glycerol. However expressing both GPDl and GPPl is likely to result in a higher rate of carbon flux.

EXAMPLE 7

Analysis of glycerol accumulation and stress tolerance in transgenic Arabidopsis plants

Upon induction the accumulation of glycerol in various tissues of the transgenic plants will be determined (as in Fig. 12) and the activities of GPP (and GPD) measured using standard assays [3]. The effect of glycerol synthesis on whole plant growth and development will be assessed. The effect on metabolism will also be studied by measuring photosynthesis, respiration, lipid and sugar levels. Creating a sink for the glycolytic intennediate dihydroxyacetone phosphate might to have a negative impact on these and other metabolic processes. To maximize glycerol accumulation while minimizing growth defects it may be necessary to express GPPl (and GPDl) at low levels and/or restrict expression to specific tissues. Logically to generate glycerol as an end product it would be most efficient to synthesis it in a sink tissue such as seeds or tubers using specific promoters.

If glycerol can be made to accumulate in mature Arabidopsis plants their stress tolerance will be investigated using essentially the same standard approaches that were used for germinating girl seedlings. In addition resistance to oxidative stress caused by high light levels and heat will be investigated. Glycerol is known to scavenge reactive oxygen intermediates [3] that can damage components of the cell such as membranes and the photosystem π complex [3,24]. Glycerol production can then be transferred to crop plants, notably Brassicas such as oilseed rape for increased stress tolerance or to produce glycerol as an industrial feed stock.

References

1. Hohmann (2002) Microbiol. Mol. Biol. Rev. 66, 300-372.

2. Ben-Amotz et al (1994) Experientia 38, 49-52.

3. Pahhnan et al (2001) J. Biol. Chem. 276, 3555-3563.

4. Wang et al (1994) J. Bacteriology 176, 7091-7095. 5. Bewley & Black (1985) Seeds: Physiology of Development and Germination, (Plenum Publishing Corp., New York)

6. Graham & Eastmond (2002). Prog Lipid Res. 41, 156-81.

7. Cornah & Smith (2002) in Plant Peroxisomes: Biochemistry, Cell Biology and Biotechnological Applications (Baker, A and Graham, LA. ed.) pp. 57-101, Kluwer Academic Publishers, Dordrecht.

8. Beevers (1956) Plant Physiol. 31, 440-445

9. Lin (1976) Annu. Rev. Microbiol. 30, 535-578.

10. Lin (1977) Annu. Rev. Biochem. 46, 765-795.

11. Parsonage et al (1998) J Biol. Chem. 273, 23812-23822 12. Huang (1975) Plant Physiol. 55, 555-558.

13. Morcuende et al (1997) Photosynthetica 33, 179-188. 14. Eastmond et al (2000) PNAS 97, 5669-5614.

15. Pettigrew et al (1998) Arch. Biochem. Biophys. 349, 236-245.

16. Shi et al (2002) Plant Cell 14, 575-588.

17. Zin & Browse (1998) PNAS 95, 7799-7804. 18. Liu et al (1994) Biochemistry 33, 10120-10126.

19. Bradford (1976) Anal. Biochem. 72, 248-254.

20. Browse et al (1986) Anal. Biochem. 152, 141-145.

21. Sambrook et al (1989) Molecular Cloning: A laboratory Manual, 2^nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 22. Weig & Jakob (2000) FEBSLett. 481, 293-298.

23. Sadava & Moore (1987) Biochem. Biophys. Res. Commun. 143, 977-983.

24. Hasegawa et al (2000) Annu. Rev. Plant Physiol. Plant Mol. Biol. 51, 463-499.

25. Sakai (1961) Nature 189, 416-417.

26. Chen & Murata (2000) Curr. Opin. Plant Biol. 5, 250-257. 27. Turner et al (2001) Plant Sci. 160, 489-497.

28. McDonald (2000) In: Seed technology and its biological basis. Sheffield Academic Press Ltd. pp 287-325.

29. Moore et al (1998) PNAS 95, 376-381.

Table 1.

Line Activity (nmol mg protein^"1 min^"1) glycerol kinase FAD⁺-glycerol-3-phosphate dehydrogenase

ColO 0.6 ±0.1 34.9 ±2.7 glrl-1 Nd 33.7 +3.2 glrl-2 Nd 40.1 ±5.3 glrl-3 (T-DNA) Nd 35.2 ±1.6 glr2-l 0.4 +0.1 36.6 ±2.8 glr2-2 0.5 +0.1 29.1 ±4.6 glr3-l 0.7 +0.1 27.9 ±3.5 glr3-2 0.4 +0.1 31.7 ±7.1 glr3-3 0.5 +0.1 33.3 ±0.9

Activity was measured in extracts from two-day old seedlings, nd is not detected. Values are the mean ±SE of measurements made on three separate batches of seedlings.

Claims

1. A transgenic plant cell wherein the genome of said cell is modified such that the activity of glycerol kinase is reduced when compared to a non-transgenic reference cell of the same species.

2. A cell according to Claim ,1 wherein said cell is transformed with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence operably linked to a promoter, said sequence selected from the group consisting of: i) a sequence, or part thereof, comprising an antisense sequence of the sequence presented in Figure 8; ii) antisense sequences which hybridise to the sense sequence presented in Figure 8 and which inhibit the activity of glycerol kinase.

3. A cell according to Claim 1 wherein said cell is transformed with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of glycerol kinase wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.

4. A cell according to Claim 3 wherein said nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of: i) a nucleic acid sequence, or part thereof, represented by the sequence in Figure

5. A cell according to Claim 3 or 4 wherein said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.

6. A cell according to Claim 3 or 4 wherein said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.

7. A cell according to Claim 6 wherein said first and second parts are linked by at least one nucleotide base.

8. A cell according to Claim 7 wherein said first and second parts are linked by 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide bases.

9. A cell according to Claim 6 wherein said linker is at least 10 nucleotide bases.

10. A cell according to any of Claims 2-9 wherein the length of the RNA molecule or antisense RNA is between 10 nucleotide bases (nb) and lOOOnb.

11. A cell according to Claim 10 wherein said RNA molecule or antisense RNA is lOOnb; 200nb; 300nb; 400nb; 500nb; 600nb; 700nb; 800nb; 900nb; or lOOOnb in length.

12. A cell according to any of Claims 2-9 wherein said RNA molecule or antisense RNA is at least lOOOnb in length.

13. A cell according to any of Claims 2-9 wherein the length of the RNA molecule or antisense RNA is at least lOnb; 20nb; 30nb; 40nb; 50nb; 60nb; 70nb; 80nb; or 90nb in length.

14. A cell according to any of Claims 3-9 wherein said RNA molecule is 21nb in length.

15. A cell according to any of Claims 2-14 wherein said expression cassette is part of a vector.

16. A cell according to any of Claims 2-15 wherein said cell is additionally transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter, said sequence selected from the group consisting of: i) a nucleic acid molecule consisting of a nucleic acid sequence as represented in Figure 9; ii) a nucleic acid molecule which hybridises to the nucleic acid molecule in (i) and which has glycerol-3-phosphatase activity; and iii) a nucleic acid molecule consisting of a nucleic acid sequence which is degenerate as a consequence of the genetic code to the sequences defined in (i) and (ii).

17. A cell according to any of Claims 1-16 wherein said cell is additionally transformed with a nucleic acid molecule comprising a nucleic acid sequence operably linked to a promoter, said sequence selected from the group consisting of:

18. A plant comprising a cell according to any of Claims 1-17.

19. A seed comprising a cell according to any of Claims 1-17.

20. A method to regulate glycerol kinase activity in a plant comprising the steps of: i) providing a cell according to any of Claims 1-17; ii) regenerating said cell into a plant; iii) monitoring glycerol kinase activity of said plant.

21. A method according to Claim 20 wherein said plant has elevated glycerol content.

22. A method according to Claim 21 wherein the seed glycerol content of said plant is elevated.

23. A method to extract glycerol, or a derivative thereof, from a plant or plant cell or seed comprising the steps: i) cultivating a plant cell or plant according to any of Claims 1-18 or providing a seed according to Claim 19; and ii) extracting, and optionally purifying glycerol, or derivative thereof, from said plant cell or plant or seed.

24. A method to cultivate a plant according to Claim 18 under abiotic stress conditions comprising providing a plant or seed according to Claim 19 and providing_' conditions suitable for the growth and/or germination of said plant.