US20080209597A1 - Transgenic Cells Expressing Glucosyltransferase Nucleic Acids - Google Patents

Transgenic Cells Expressing Glucosyltransferase Nucleic Acids Download PDF

Info

Publication number
US20080209597A1
US20080209597A1 US11/966,280 US96628007A US2008209597A1 US 20080209597 A1 US20080209597 A1 US 20080209597A1 US 96628007 A US96628007 A US 96628007A US 2008209597 A1 US2008209597 A1 US 2008209597A1
Authority
US
United States
Prior art keywords
nucleic acid
seq
acid molecule
transgenic
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/966,280
Inventor
Diana Joy Bowles
Yi Li
Eng-Kiat Lim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of York
Original Assignee
University of York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of York filed Critical University of York
Priority to US11/966,280 priority Critical patent/US20080209597A1/en
Publication of US20080209597A1 publication Critical patent/US20080209597A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • C12N9/1051Hexosyltransferases (2.4.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8255Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis

Definitions

  • the invention relates to transgenic cells which have been transformed with glucosyltransferase (GTases) nucleic acids.
  • GTases glucosyltransferase
  • GTases are enzymes which post-translationally transfer glucosyl residues from an activated nucleotide sugar to monomeric and polymeric acceptor molecules such as other sugars, proteins, lipids and other organic substrates. These glucosylated molecules take part in diverse metabolic pathways and processes. The transfer of a glucosyl moiety can alter the acceptor's bioactivity, solubility and transport properties within the cell and throughout the plant.
  • One family of GTases in higher plants is defined by the presence of a C-terminal consensus sequence.
  • the GTases of this family function in the cytosol of plant cells and catalyse the transfer of glucose to small molecular weight substrates, such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones.
  • small molecular weight substrates such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones.
  • GTases enzymes can be highly specific, such as the maize and Arabidopsis GTases that glucosylate indole-3-acetic acid (IAA).
  • Wood used in the paper industry is initially particulated, typically by chipping, before conversion to a pulp which can be utilised to produce paper.
  • the pulping process involves the removal of lignin.
  • Lignin is a major non-carbohydrate component of wood and comprises approximately one quarter of the raw material in wood pulp.
  • the removal of lignin is desirable since the quality of the paper produced from the pulp is largely determined by the lignin content.
  • Many methods have been developed to efficiently and cost effectively remove lignin from wood pulp. These methods can be chemical, mechanical or biological. For example, chemical methods to pulp wood are disclosed in WO9811294, EP0957198 and WO0047812.
  • Biological methods to remove lignin are known. There are however disadvantages associated with such methods. For example it is important to provide micro-organisms (eg bacteria and/or fungi) which only secrete ligninolytic enzymes which do not affect cellulose fibres. This method is also very time consuming (can take 3-4 weeks) and expensive due to the need to provide bioreactors. Biological treatment can also include pre-treatment of wood chips to make them more susceptible to further biological or chemical pulping.
  • micro-organisms eg bacteria and/or fungi
  • Biological treatment can also include pre-treatment of wood chips to make them more susceptible to further biological or chemical pulping.
  • transgenic means a plant which has been genetically modified to include a nucleic acid sequence not naturally found in said plant.
  • plant cell wall properties may be altered through increasing the flux through biosynthetic intermediates that are obligatory for incorporation and assembly of the lignin polymer.
  • reduction of the monolignol glucoside pools such as through the use of nucleic acid comprising GTase sequences in antisense configuration may lead to altered properties through reducing the flux through specific intermediates.
  • lignin composition and increase the lignin content of a plant cell to increase the mechanical strength of wood. This would have utility in, for example the construction industry or in furniture making.
  • lignin content and the level of cross-linking of polysaccharide polymers within plant cell walls also play an important role in determining texture and quality of raw materials through altering the cell walls and tissue mechanical properties. For example, there is considerable interest in reducing cell separation in edible tissues since this would prevent over-softening and loss of juiciness.
  • Phenolics, such as ferulic acid play an important role in cell adhesion since they can be esterified to cell wall polysaccharides during synthesis and oxidatively cross-linked in the wall, thereby increasing rigidity. Most non-lignified tissues contain these phenolic components and their levels can be modified by altering flux through the same metabolic pathways as those culminating in lignin.
  • GTase nucleic acid in sense and/or antisense configurations can be used to affect levels of ferulic acid and related phenylpropanoid derivatives that function in oxidative cross-linking. These changes in content have utility in the control of raw material quality of edible plant tissues.
  • Lignin and oxidative cross-linking in plant cell walls also play important roles in stress and defence responses of most plant species. For example, when non-woody tissues are challenged by pests or pathogen attack, or suffer abiotic stress such as through mechanical damage or UV radiation, the plant responds by localised and systemic alteration in cell wall and cytosolic properties, including changes in lignin content and composition and changes in cross-linking of other wall components. Therefore, it can also be anticipated that cell- or tissue-specific changes in these responses brought about by changed levels of the relevant GTase activities will have utility in protecting the plant to biotic attack and biotic/abiotic stresses.
  • GTases also have utility with respect to the modification of antioxidants.
  • Reactive oxygen species are produced in all aerobic organisms during respiration and normally exist in a cell in balance with biochemical anti-oxidants.
  • Environmental challenges such as by pollutants, oxidants, toxicants, heavy metals and so on, can lead to excess reactive oxygen species which perturb the cellular redox balance, potentially leading to wide-ranging pathological conditions.
  • cardiovascular diseases, cancers, inflammatory and degenerative disorders are linked to events arising from oxidative damage.
  • Anti-oxidant micronutrients obtained from vegetables and fruits, teas, herbs and medicinal plants are thought to provide significant protection against health problems arising from oxidative stress.
  • Well known anti-oxidants from plant tissues include for example: quercetin, luteolin, and the catechin, epicatechin and cyanidin groups of compounds.
  • Caffeic acid (3,4-dihydroxycinnamic acid) is a further example of an anti-oxidant with beneficial therapeutic properties.
  • Certain plant species, organs and tissues are known to have relatively high levels of one or more compounds with anti-oxidant activity. Greater accumulation of these compounds in those species, their wider distribution in crop plants and plant parts already used for food and drink production, and the increased bioavailability of anti-oxidants (absorption, metabolic conversions and excretion rate) are three features considered to be highly desirable.
  • GTase sequences can also be expressed in prokaryotes or simple eukaryotes, such as yeast, to produce enzymes for biotransformations in those cells, or as in vitro processing systems.
  • transgenic cell comprising a nucleic acid molecule which encodes a polypeptide which has:
  • nucleic acid molecule anneals under stringent hybridisation conditions to the sequence presented in FIGS. 1A , 2 A, 3 A, 4 A, 5 A, 6 A, 7 A, 8 A, 9 A, 10 A, 11 A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
  • nucleic acid molecule is selected from FIGS. 7A , 8 A, 9 A, 10 A, 15 , 18 , 19 , 28 or 31 .
  • Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in 0.1 ⁇ SSC, 0.1% SDS at 60° C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is:
  • T m 81.5° C.+16.6 Log [Na + ]+0.41[% G+C] ⁇ 0.63 (% formamide).
  • said transgenic cell is a eukaryotic cell.
  • said eukaryotic cell is a plant cell or yeast cell.
  • said transgenic cell is a prokaryotic cell.
  • the nucleic acid molecule is selected from the group comprising: antisense sequences of the sequences of any one of FIGS. 1C , 2 C, 3 C, 4 C, 5 C, 6 C, 7 C, 8 C, 9 C, 10 C and 11 C or parts thereof, or antisense sequences of the sense sequences presented in FIGS. 12-32 . More preferably still said antisense sequence is selected from FIG. 7C or 9 C
  • nucleic acid is cDNA.
  • said nucleic acid is genomic DNA.
  • said plant is a woody plant selected from: poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak; spruce.
  • said woody plant is a plant used typically in the paper industry, for example poplar.
  • said plant is selected from: corn ( Zea mays ), canola ( Brassica napus, Brassica rapa ssp.), alfalfa ( Medicago sativa ), rice ( Oryza sativa ), rye ( Secale cerale ), sorghum ( Sorghum bicolor, Sorghum vulgare ), sunflower ( helianthus annuas ), wheat ( Tritium aestivum ), soybean ( Glycine max ), tobacco ( Nicotiana tabacum ), potato ( Solanum tuberosum ), peanuts ( Arachis hypogaea ), cotton ( Gossypium hirsutum ), sweet potato ( Iopmoea batatus ), cassaya ( Manihot esculenta ), coffee ( Cofea spp.), coconut ( Cocos nucifera ), pineapple ( Anana comosus ), citris tree ( Citrus spp.) cocoa
  • plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassaya, barley, pea, and other root, tuber or seed crops.
  • Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum.
  • Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, and carnations and geraniums.
  • the present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, chrysanthemum.
  • Grain plants that provide seeds of interest include oil-seed plants and leguminous plants.
  • Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc.
  • Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica , maize, alfalfa, palm, coconut, etc.
  • Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.
  • a vector comprising the nucleic acid according to the invention operably linked to a promoter.
  • Vector includes, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissable or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication ie an episomal vector).
  • Suitable vectors can constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • appropriate regulatory sequences including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • shuffle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
  • a vector including nucleic acid according to the invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the gene.
  • the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell.
  • a host cell such as a microbial, (e.g. bacterial), or plant cell.
  • the vector may be a bi-functional expression vector which functions in multiple hosts. In the case of GTase genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
  • promoter is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.
  • Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like.
  • Other constitutive promoters include those in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid.
  • promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156, herein incorporated by reference.
  • tissue-specific promoters can be utilised.
  • Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol.
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is “under transcriptional initiation regulation” of the promoter.
  • the promoter is an inducible promoter or a developmentally regulated promoter.
  • nucleic acid constructs which operate as plant vectors.
  • Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148.
  • Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
  • selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
  • herbicides e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate.
  • a method of enhancing monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase nucleic acid according to the invention in a plant.
  • the plant is a woody plant species.
  • a method of inhibiting monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase antisense nucleic acid according to the invention in a plant.
  • the plant is a woody plant species.
  • Inhibition of GTase expression may, for instance, be achieved using anti-sense technology.
  • a nucleotide sequence is placed under the control of a promoter in a “reverse orientation” such that transcription yields RNA which is complementary to normal mRNA transcribed from the “sense” strand of the target gene.
  • Antisense technology is also reviewed in Bourque (1995), Plant Science 105, 125-149, and Flavell (1994) PNAS USA 91, 3490-3496.
  • nucleotide sequence encoding an antisense RNA molecule complementary to a sense mRNA molecule encoding for a polypeptide having a glucosyl transferase activity in the biosynthesis of at least a monolignol glucoside in lignin biosynthesis in a plant, which nucleotide sequence is under transcriptional control of a promoter and a terminator, both promoter and terminator capable of functioning in plant cells.
  • Suitable promoters and terminators are referred to hereinabove.
  • a nucleotide sequence according to the invention comprising a transcriptional regulatory sequence, a sequence under the transcriptional control thereof which encodes an RNA which consists of a plurality of subsequences, characterised in that the RNA subsequences are antisense RNAs to mRNAs of proteins having a GTase activity in the lignin biosynthesis pathway in plant cells.
  • RNA subsequences are antisense RNAs to mRNAs of GTase having a GTase activity in the lignin biosynthesis pathway in plant cells, such as the GTase of FIGS. 1-11(C)
  • the nucleotide sequence may encode an RNA having any number of subsequences.
  • the number of subsequences lies between 2 and 7 (inclusive) and more preferably lies between 2-4.
  • a host cell transformed with nucleic acid or a vector according to the invention, preferably a plant or a microbial cell.
  • the microbial cell may be prokaryotic (eg Escherchia coli, Bacillus subtilis ) or eukaryotic (eg Saccharomyces cerevisiae ).
  • the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
  • a method of transforming a plant cell comprising introduction of a vector into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the invention into the genome.
  • Plants transformed with a DNA construct of the invention may be produced by standard techniques known in the art for the genetic manipulation of plants.
  • DNA can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transferability (EP-A-270355, EP-A-0116718, NAR 12(22):8711-87215 (1984), Townsend et al., U.S. Pat. No. 5,563,055); particle or microprojectile bombardment (U.S. Pat. No. 5,100,792, EP-A-444882, EP-A-434616; Sanford et al, U.S. Pat. No. 4,945,050; Tomes et al.
  • Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl. Genet. 76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al.
  • Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective.
  • a combination of different techniques may be employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium -coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233).
  • Plants which include a plant cell according to the invention are also provided.
  • the present invention embraces all of the following: a clone of such a plant, seed, selfed of hybrid progeny and descendants (e.g. F1 and F2 descendants).
  • nucleic acid molecule obtainable from Arabidopsis thaliana which comprises a nucleic acid sequence encoding a polypeptide having
  • GTase functionality is capable of adding a glucosyl group via an O-glucosidic linkage to form
  • cinnamic acid p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol; and sinapyl alcohol.
  • polypeptide encoded by an isolated nucleic acid molecule of the present invention wherein the said polypeptide is selected from the polypeptides of FIGS. 1B , 2 B, 3 B, 4 B, 5 B, 6 B, 7 B, 8 B, 9 B, 10 B and 111 B or functional variants and/or parts thereof.
  • the polypeptide is selected from the group of polypeptides of FIGS. 2B , 3 B, 4 B, 6 B, 7 B and 9 B or functional variants and/or parts thereof.
  • the polypeptide is selected from the group of polypeptides selected from FIGS. 2B , 3 B, 7 B and 9 B or functional variants and/or parts thereof.
  • polypeptide is one of the polypeptides shown in FIGS. 2B , 3 B, 7 B or 9 B.
  • Polypeptides encoded by the sense nucleic acid sequences presented in FIGS. 12-32 are also provided and readily derived from these sense sequences.
  • Variants of sequences having substantial identity or homology with the GTase molecules of the invention may be utilized in the practices of the invention. That is, the GTase of FIGS. 1A-11A may be modified yet still remain functional. Generally, the GTase will comprise at least about 40%-60%, preferably about 60%-80%, more preferably about 80%-95% sequence identity with a GTase nucleotide sequence of FIGS. 1A-32 herein.
  • the activity of functional variant polypeptides may be assessed by transformation into a host capable of expressing the nucleic acid of the invention. Methodology for such transformation is described in more detail below.
  • a method of producing a derivative nucleic acid comprising the step of modifying any of the sequences disclosed above, particularly the coding sequence of FIGS. 1A , 2 A, 3 A, 4 A, 5 A, 6 A, 7 A, 8 A, 9 A, 10 A, 11 A, 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32
  • changes to a sequence may produce a derivative by way of one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution or one or more amino acids in the encoded polypeptide.
  • Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide or to produce dominant negative variants which may alter the flux through lignin biosynthetic pathways to alter the amount of lignin or an intermediate in the lignin biosynthetic pathway.
  • FIG. 1A Sense nucleotide sequence of A062 (SEQ ID NO: 1). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 1B The amino acid sequence of A062 (SEQ ID NO: 2);
  • FIG. 1C The antisense nucleotide sequence of A062 (SEQ ID NO:3);
  • FIG. 2A Sense nucleotide sequence of A320 (SEQ ID NO: 4). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 2B The amino acid sequence of A320 (SEQ ID NO: 5);
  • FIG. 2C The antisense nucleotide sequence of A320 (SEQ ID NO: 6);
  • FIG. 3A Sense nucleotide sequence of A41 (SEQ ID NO: 7). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 3B The amino acid sequence of A41 (SEQ ID NO: 8);
  • FIG. 3C The antisense nucleotide sequence of A41 (SEQ ID NO: 9);
  • FIG. 4A Sense nucleotide sequence of A42 (SEQ ID NO: 10). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 4B The amino acid sequence of A42 (SEQ ID NO: 1);
  • FIG. 4C The antisense nucleotide sequence of A42 (SEQ ID NO: 12);
  • FIG. 5A Sense nucleotide sequence of A43 (SEQ ID NO: 13). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 5B The amino acid sequence of A43 (SEQ ID NO: 14);
  • FIG. 5C The antisense nucleotide sequence of A43 (SEQ ID NO: 15);
  • FIG. 6A Sense nucleotide sequence of A911 (SEQ ID NO: 16). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 6B The amino acid sequence of A911 (SEQ ID NO: 17);
  • FIG. 6C The antisense nucleotide sequence of A911 (SEQ ID NO: 18);
  • FIG. 7A Sense nucleotide sequence of A119 (SEQ ID NO: 19). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 7B The amino acid sequence of A119 (SEQ ID NO: 20);
  • FIG. 7C The antisense nucleotide sequence of A119 (SEQ ID NO: 21);
  • FIG. 8A Sense nucleotide sequence of A233 (SEQ ID NO: 22). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 8B The amino acid sequence of A233 (SEQ ID NO: 23);
  • FIG. 8C The antisense nucleotide sequence of A233 (SEQ ID NO: 24);
  • FIG. 9A Sense nucleotide sequence of A407 (SEQ ID NO: 25). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 9B The amino acid sequence of A407 (SEQ ID NO: 26);
  • FIG. 9C The antisense nucleotide sequence of A407 (SEQ ID NO: 27);
  • FIG. 10A Sense nucleotide sequence of A961 (SEQ ID NO: 28). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 10B The amino acid sequence of A961 (SEQ ID NO: 29);
  • FIG. 10C The antisense nucleotide sequence of A961 (SEQ ID NO: 30);
  • FIG. 11A Sense nucleotide sequence of A962 (SEQ ID NO: 31). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 11B The amino acid sequence of A962 (SEQ ID NO: 32);
  • FIG. 11C The antisense nucleotide sequence of A962. (SEQ ID NO: 33);
  • FIG. 12 The sense nucleotide sequence of UGT71B5 (SEQ ID NO: 34);
  • FIG. 13 The sense nucleotide sequence of UGT71C3 (SEQ ID NO: 35);
  • FIG. 14 The sense nucleotide sequence of UGT71C5 (SEQ ID NO: 36);
  • FIG. 15 The sense nucleotide sequence of UGT71D1 (SEQ ID NO: 37);
  • FIG. 16 The sense nucleotide sequence of UGT73B1 (SEQ ID NO: 38);
  • FIG. 17 The sense nucleotide sequence of UGT73B2 (SEQ ID NO: 39);
  • FIG. 18 The sense nucleotide sequence of UGT73B4 (SEQ ID NO: 40);
  • FIG. 19 The sense nucleotide sequence of UGT73B5 (SEQ ID NO: 41);
  • FIG. 20 The sense nucleotide sequence of UGT73C1 (SEQ ID NO: 42);
  • FIG. 21 The sense nucleotide sequence of UGT731C (SEQ ID NO: 43);
  • FIG. 22 The sense nucleotide sequence of UGT73C5 (SEQ ID NO: 44);
  • FIG. 23 The sense nucleotide sequence of UGT73C6 (SEQ ID NO: 45);
  • FIG. 24 The sense nucleotide sequence of UGT73C7 (SEQ ID NO: 46);
  • FIG. 25 The sense nucleotide sequence of UGT74F2 (SEQ ID NO: 47);
  • FIG. 26 The sense nucleotide sequence of UGT76E1 (SEQ ID NO: 48);
  • FIG. 27 The sense nucleotide sequence of UGT76E11 (SEQ ID NO: 49);
  • FIG. 28 The sense nucleotide sequence of UGT76E12 (SEQ ID NO: 50);
  • FIG. 29 The sense nucleotide sequence of UGT76E2 (SEQ ID NO: 51);
  • FIG. 30 The sense nucleotide sequence of UGT78D1 (SEQ ID NO: 52);
  • FIG. 31 The sense nucleotide sequence of UGT89B1 (SEQ ID NO: 53);
  • FIG. 32 The sense nucleotide sequence of UGT72B3 (SEQ ID NO: 54);
  • FIG. 33 shows recombinant GST-UGT71C1 fusion protein purified from E. coli using glutathione-coupled Sepharose. The protein (5 ⁇ g) was analyzed using 10% SDS-PAGE and was visualized with Coomassive staining;
  • FIG. 34 shows three different glucose conjugates of caffeic acid, (caffeoyl-3-O-glucoside, caffeoyl-4-O-glucoside and 1-O-caffeoylglucose), obtained from the glucosyltransferase reactions containing the recombinant UGT71C1, UGT73B3 and UGT84A1 respectively.
  • Each assay contained 1-2 ⁇ g of recombinant UGT, 1 mM caffeic acid, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min and was analyzed by reverse-phase HPLC subsequently. Linear gradient (10-16%) of acetonitrile in H 2 O at 1 ml/min over 20 min was used to separate the glucose conjugates from caffeic acid.
  • FIG. 35A shows the pH optima of UGT71C1 glucosyltransferase activity measured over the range pH 5.5-8.0 in the reactions containing 50 mM buffer, 1 ⁇ g of UGT71C1, 1 mM caffeic acid, 5 mM UDP-glucose and 1.4 mM 2-mercaptoethanol.
  • the mix was incubated at 30° C. for 30 min.
  • the reaction was stopped by the addition of 20 ⁇ l of trichloroacetic acid (240 mg/ml) and was analyzed by reverse-phase HPLC subsequently.
  • the specific enzyme activity was expressed as nanomoles of caffeic acid glucosylated per second (nkat) by 1 mg of protein in 30 min of reaction time at 30° C.
  • FIG. 35A shows the pH optima of UGT71C1 glucosyltransferase activity measured over the range pH 5.5-8.0 in the reactions containing 50 mM buffer, 1 ⁇ g of UGT71C1, 1 mM ca
  • FIG. 36 shows UGT71C1 transgenic Arabidopsis thaliana plants and their ability to glucosylate caffeic acid
  • FIG. 37 summarises the GTase activities of various GTase polypeptides with respect to various anti-oxidant substrates.
  • the GTase sequence identification was carried out using GCG software (Wisconsin package, version 8.1). Blasta programme was used to search Arabidopsis protein sequences containing a PSPG (plant secondary product UDP-glucose glucosyltransferase) signature motif (Hughes and Hughes (1994) DNA Sequence 5, 41-49) in EMBL and GenBank sequence database.
  • PSPG plant secondary product UDP-glucose glucosyltransferase signature motif
  • the GTase sequences were amplified from Arabidopsis thaliana Columbia genomic DNA with specific primers (Table 2), following standard methodologies (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2 nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). 50 ng of genomic DNA isolated from Arabidopsis thaliana Columbia were incubated with 1 ⁇ pfu PCR buffer (Stratagene), 250 ⁇ M dNTPS, 50 pmole primer for each end, and 5 units of pfu DNA polymerase (Stratagene) in a total of 100 ⁇ l. The PCR reactions were carried out as outlined in the programme described in Table 3.
  • E. coli cells carrying recombinant plasmid DNA as described above were grown at 37° C. overnight on 2YT (16 g bacto tryptone, 10 g bacto-yeast extract, 5 g NaCl per litre) agar (1.8% w/v) plate which contained 50 ⁇ g/ml ampicillin. A single colony was picked into 2 ml of 2YT containing the same concentration of ampicillin. The bacterial culture was incubated at 37° C. with moderate agitation for 6 h. The bacterial culture was transferred into 1 L of 2YT and incubated at 20° C. subsequently. 0.1 mM IPTG was added when the culture reached logarithmic growth phase (A 600 nm 0.5).
  • the bacterial culture was incubated for another 24 h.
  • the cells were collected by a centrifugation at 7,000 ⁇ g for 5 min at 4° C. and resuspended in 5 ml spheroblast buffer (0.5 mM EDTA, 750 mM sucrose, 200 mM Tris, pH 8.0). Lysozyme solution was added to a final concentration of 1 mg/ml. 7-fold volume of 0.5 ⁇ spheroblast buffer was poured into the suspension immediately and the suspension was incubated for 4° C. for 30 min under gentle shaking.
  • the spheroblasts were collected by a centrifugation at 12,000 ⁇ g for 5 min at 4° C., and resuspended in 5 ml ice cold PBL buffer (140 mM NaCl, 80 mM, NA 2 HPO 4 , 15 mM KH 2 PO 4 ). 2 mM of PMSF was added into suspension immediately and the suspension was centrifuged at 12,000 ⁇ g for 20 min at 4° C. in order to remove the cell debris. After the centrifugation, the supernatant was transferred to a 15 ml tube. 200 ⁇ l of 50% (v/v) slurry of Glutathione-coupled Sepharose 4B were added into the tube and the mixture was mixed gently for 30 min at room temperature.
  • the mixture was then centrifuged at a very slow speed (500 ⁇ g) for 1 min. the supernatant was discarded.
  • the beads were washed with 5 ml ice cold PBS buffer three times. After each wash, a short centrifugation was applied as described above to sediment the Sepharose beads.
  • 100 ⁇ l of 20 mM reduced glutathione were used to resuspend the beads. After 10 min incubation at room temperature, the beads were collected and the supernatant containing the expressed protein was collected. The elution step was repeated once, and both supernatant fractions were combined and stored at 4° C. for protein assay and further studies.
  • the protein assays were carried out by adding 10 ⁇ l of protein solution into 900 ⁇ l of distilled water and 200 ⁇ l of Bio-Rad Protein Assay Dye. The absorbance at 595 nm was read. A series of BSA (bovine serium albumin) at different concentration was used as standard. Regression line was plotted based on the coordinates of the BSA concentration against the reading at 595 nm. The concentration of protein sample was therefore estimated from the regression line after the protein assay.
  • BSA bovine serium albumin
  • a standard glucosylation reaction was set up by mixing 2 ⁇ g of recombinant proteins with 14 mM 2-mercaptoethanol, 5 mM UDP-glucose, 1 mM of various lignin or antioxidant substrate, 100 mM Tris, pH 7.0, to a total volume of 200 ⁇ l. The reaction was carried out at 30° C. for 30 min and stopped by the addition of 20 ⁇ l trichloroacetic acid (240 mg/ml). All the samples were stored at ⁇ 20° C. before the liquid chromatographic assay.
  • Reverse-phase HPLC Waters Separator 2690 and Waters Tunable Absorbance Detector 486, Waters Limited, Herts, UK
  • a Columbus 5 ⁇ C 18 column 250 ⁇ 4.60 mm, Phenomenex
  • Linear gradient of acetonitrile in H 2 O all solutions contained 0.1% trifluoroacetic acid
  • HPLC methods were described as the following: cinnamic acid, ⁇ 288 nm , 10-55% acetonitrile; p-coumaric acid, ⁇ 311 nm, 10 -25% acetonitrile; caffeic acid, ⁇ 311 nm, 10 -16% acetonitrile; ferulic acid, ⁇ 311 nm, 10 -35% acetonitrile; sinapic acid, ⁇ 306 nm, 10 -40% acetonitrile; p-coumaryl aldehyde, ⁇ 315 nm, 10 -46% acetonitrile; coniferyl aldehyde, ⁇ 283 nm, 10 -47% acetonitrile; sinapyl aldehyde, ⁇ 280 nm, 10 -47% acetonitrile; p-coumaryl alcohol, p 283 nm, 10 -27% acetonitrile
  • the recombinant GTases were shown to have GTase activity towards the major intermediates of the lignin biosynthesis pathway (Tables 5 and 6). It is clear from these results that the GTases display different specific activity reaction profiles relative to each other on the various lignin precursor substrates utilised. Michaelis-Menten kinetics were also studied on several of the GTases against their preferred substrates (Tables 7 and 8). It is clear from these results that the GTases display different enzyme kinetics for different substrates.
  • A119 and A407 are down regulated using an antisense strategy (A). Expression of the A119 and A407 antisense sequences is driven by the gene's own promoter.
  • An alternative approach (B) is to modify the UDP-glucose binding motif through an in vitro mutagenesis method (Lim et al., 1998) such that the mutant protein is able to bind the monolignol substrates but loses its catalytic activity. Such mutant proteins are thought to compete with the functional native protein by binding specifically to monolignols, thereby reducing the formation of monolignol glucosides.
  • the A119 and A407 cDNA fragments are amplified from pGEXA119 and pGEXA407 by PCR. The fragments are then ligated correspondingly into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the antisense orientation.
  • the DNA fragments containing the A119 and A407 antisense chimaeric genes are amplified by PCR from the chimaeric constructs described in (A)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.
  • In vitro site mutagenesis is carried by PCR to modify the sequences encoding the UDPglucose binding motif in A119 and A407 (Lim et al., 1998).
  • the constructs pGEXA119 and pGEXA407 are used in the DNA templates in the PCR reaction.
  • the A119 and A407 mutant genes are amplified from the pGEXA119 and pGEXA407 mutant constructs described in (B)-(1) by PCR.
  • the A119 and A407 mutant gene fragments are then ligated into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the sense orientation.
  • the DNA fragments containing the A119 and A407 mutant chimaeric genes are amplified by PCR from the chimaeric constructs described in (B)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.
  • the CaMV 35S promoter fragment is used to drive the expression of A119 and A497.
  • DNA fragments containing A119 and A407 ORF sequences are amplified from pGEXA119 and pGEXA407 correspondingly by PCR.
  • the DNA fragments are ligated downstream of the CaMV 35S promoter.
  • the constructs are used to transform plants such that the lignin content and composition is altered.
  • Stage I (1 cycle) Stage II (40 cycles) Stage III (1 cycle) 95° C. 5 min 95° C. 1 min 95° C. 2 min 55° C. 2 min 55° C. 1 min 55° C. 2 min 72° C. 3 min 72° C. 2 min 72° C. 5 min
  • Each assay contained 1 ⁇ g of UGT71C1, 1 mM phenolic compound, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min. The reaction was stopped by the addition of 20 ⁇ l of trichloroacetic acid (240 mg/ml) and was analysed by reverse-phase HPLC subsequently. The results represent the mean of three replicates ⁇ standard deviation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Paper (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to transgenic cells which have been transformed with nucleic acids encoding glycosyltransferase polypeptides (GTases) and vectors for use in transformation of said cells.

Description

    CROSS REFERENCE TO RELATED APPLICATIONS
  • This application is a continuation of application Ser. No. 10/203,319 filed Aug. 9, 2002, which is a 371 national stage entry of international patent application no. PCT/GB2001/00477, filed Feb. 8, 2001, designating the United States of America, and published in United Kingdom on Aug. 16, 2001, as WO 2001/59140, the entire disclosure of which is incorporated herein by reference. Priority is claimed based on United Kingdom patent application no. 0002814.2, filed Feb. 9, 2000.
  • BACKGROUND OF THE INVENTION
  • The invention relates to transgenic cells which have been transformed with glucosyltransferase (GTases) nucleic acids.
  • GTases are enzymes which post-translationally transfer glucosyl residues from an activated nucleotide sugar to monomeric and polymeric acceptor molecules such as other sugars, proteins, lipids and other organic substrates. These glucosylated molecules take part in diverse metabolic pathways and processes. The transfer of a glucosyl moiety can alter the acceptor's bioactivity, solubility and transport properties within the cell and throughout the plant. One family of GTases in higher plants is defined by the presence of a C-terminal consensus sequence. The GTases of this family function in the cytosol of plant cells and catalyse the transfer of glucose to small molecular weight substrates, such as phenylpropanoid derivatives, coumarins, flavonoids, other secondary metabolites and molecules known to act as plant hormones. Available evidence indicates that GTases enzymes can be highly specific, such as the maize and Arabidopsis GTases that glucosylate indole-3-acetic acid (IAA).
  • The production and use of paper has increased in the last 10 years. For example, between 1989 and 1999 the production of paper and board in the UK has increased from 4.6 to 6.6 million tonnes. Worldwide consumption has also reflected a general increase in paper usage. For example, in the UK per capita consumption of paper is over 200 kg per annum. In the USA this figure is over 300 kg per annum.
  • Wood used in the paper industry is initially particulated, typically by chipping, before conversion to a pulp which can be utilised to produce paper. The pulping process involves the removal of lignin. Lignin is a major non-carbohydrate component of wood and comprises approximately one quarter of the raw material in wood pulp. The removal of lignin is desirable since the quality of the paper produced from the pulp is largely determined by the lignin content. Many methods have been developed to efficiently and cost effectively remove lignin from wood pulp. These methods can be chemical, mechanical or biological. For example, chemical methods to pulp wood are disclosed in WO9811294, EP0957198 and WO0047812. Although chemical methods are efficient means to remove lignin from pulp it is known that chemical treatments can result in degradation of polysaccharides and is expensive. Moreover, to remove residual lignin from pulp it is necessary to use strong bleaching agents which require removal before the pulp can be converted into paper. These agents are also damaging to the environment.
  • Biological methods to remove lignin are known. There are however disadvantages associated with such methods. For example it is important to provide micro-organisms (eg bacteria and/or fungi) which only secrete ligninolytic enzymes which do not affect cellulose fibres. This method is also very time consuming (can take 3-4 weeks) and expensive due to the need to provide bioreactors. Biological treatment can also include pre-treatment of wood chips to make them more susceptible to further biological or chemical pulping.
  • It is therefore desirable to provide further means by which lignin can be efficiently and cost effectively removed from wood pulp which do not have the disadvantages associated with prior art methods.
  • For the sake of clarity reference herein to transgenic means a plant which has been genetically modified to include a nucleic acid sequence not naturally found in said plant. For example, by over-expression of monolignol glucosyltransferases in planta, plant cell wall properties may be altered through increasing the flux through biosynthetic intermediates that are obligatory for incorporation and assembly of the lignin polymer. Conversely, reduction of the monolignol glucoside pools, such as through the use of nucleic acid comprising GTase sequences in antisense configuration may lead to altered properties through reducing the flux through specific intermediates. Changes in lignin composition, such as with decreased ratios of coniferyl alcohol to sinapyl alcohol are highly desirable in paper and pulping processes, because the more highly methylated lignin (sinapyl alcohol) is more easily removed during pulping processes (Chiang et al (1988) TAPPI J. 71, 173-176).
  • In some applications it may be desirable to change lignin composition and increase the lignin content of a plant cell to increase the mechanical strength of wood. This would have utility in, for example the construction industry or in furniture making.
  • Both lignin content and the level of cross-linking of polysaccharide polymers within plant cell walls, also play an important role in determining texture and quality of raw materials through altering the cell walls and tissue mechanical properties. For example, there is considerable interest in reducing cell separation in edible tissues since this would prevent over-softening and loss of juiciness. Phenolics, such as ferulic acid, play an important role in cell adhesion since they can be esterified to cell wall polysaccharides during synthesis and oxidatively cross-linked in the wall, thereby increasing rigidity. Most non-lignified tissues contain these phenolic components and their levels can be modified by altering flux through the same metabolic pathways as those culminating in lignin. Therefore, in the same way as for the manipulation of lignin composition and content, GTase nucleic acid in sense and/or antisense configurations can be used to affect levels of ferulic acid and related phenylpropanoid derivatives that function in oxidative cross-linking. These changes in content have utility in the control of raw material quality of edible plant tissues.
  • Lignin and oxidative cross-linking in plant cell walls also play important roles in stress and defence responses of most plant species. For example, when non-woody tissues are challenged by pests or pathogen attack, or suffer abiotic stress such as through mechanical damage or UV radiation, the plant responds by localised and systemic alteration in cell wall and cytosolic properties, including changes in lignin content and composition and changes in cross-linking of other wall components. Therefore, it can also be anticipated that cell- or tissue-specific changes in these responses brought about by changed levels of the relevant GTase activities will have utility in protecting the plant to biotic attack and biotic/abiotic stresses.
  • GTases also have utility with respect to the modification of antioxidants. Reactive oxygen species are produced in all aerobic organisms during respiration and normally exist in a cell in balance with biochemical anti-oxidants. Environmental challenges, such as by pollutants, oxidants, toxicants, heavy metals and so on, can lead to excess reactive oxygen species which perturb the cellular redox balance, potentially leading to wide-ranging pathological conditions. In animals and humans, cardiovascular diseases, cancers, inflammatory and degenerative disorders are linked to events arising from oxidative damage.
  • Because of the current prevalence of these diseases, there is considerable interest in anti-oxidants, consumed in the diet or applied topically such as in UV-screens. Anti-oxidant micronutrients obtained from vegetables and fruits, teas, herbs and medicinal plants are thought to provide significant protection against health problems arising from oxidative stress. Well known anti-oxidants from plant tissues include for example: quercetin, luteolin, and the catechin, epicatechin and cyanidin groups of compounds.
  • Caffeic acid (3,4-dihydroxycinnamic acid) is a further example of an anti-oxidant with beneficial therapeutic properties.
  • Certain plant species, organs and tissues are known to have relatively high levels of one or more compounds with anti-oxidant activity. Greater accumulation of these compounds in those species, their wider distribution in crop plants and plant parts already used for food and drink production, and the increased bioavailability of anti-oxidants (absorption, metabolic conversions and excretion rate) are three features considered to be highly desirable.
  • It will be apparent that changed levels of the relevant GTase activities capable of glucosylating anti-oxidant compounds in planta will allow the production of anti-oxidants with beneficial properties. GTase sequences can also be expressed in prokaryotes or simple eukaryotes, such as yeast, to produce enzymes for biotransformations in those cells, or as in vitro processing systems.
  • SUMMARY OF THE INVENTION Statements of Invention
  • According to an aspect of the invention there is provided a transgenic cell comprising a nucleic acid molecule which encodes a polypeptide which has:
    • i) glucosyltransferase activity:
    • ii) is selected from the group comprising sequences of FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
    • iii) nucleic acids which hybridise to the sequences represented in (ii) above; and
    • iv) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
  • In a further preferred embodiment of the invention said nucleic acid molecule anneals under stringent hybridisation conditions to the sequence presented in FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
  • More preferably still said nucleic acid molecule is selected from FIGS. 7A, 8A, 9A, 10A, 15, 18, 19, 28 or 31.
  • Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in 0.1×SSC, 0.1% SDS at 60° C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is:

  • T m=81.5° C.+16.6 Log [Na+]+0.41[% G+C]−0.63 (% formamide).
  • In a preferred embodiment of the invention said transgenic cell is a eukaryotic cell. Preferably said eukaryotic cell is a plant cell or yeast cell.
  • In an alternative embodiment of the invention said transgenic cell is a prokaryotic cell.
  • In a further preferred embodiment of the invention the nucleic acid molecule is selected from the group comprising: antisense sequences of the sequences of any one of FIGS. 1C, 2C, 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C and 11C or parts thereof, or antisense sequences of the sense sequences presented in FIGS. 12-32. More preferably still said antisense sequence is selected from FIG. 7C or 9C
  • In a further preferred embodiment of the invention said nucleic acid is cDNA.
  • In a yet further preferred embodiment of the invention said nucleic acid is genomic DNA.
  • In yet still a further preferred embodiment of the invention said plant is a woody plant selected from: poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak; spruce. Preferably said woody plant is a plant used typically in the paper industry, for example poplar.
  • Methods to transform woody species of plant are well known in the art. For example the transformation of poplar is disclosed in U.S. Pat. No. 4,795,855 and WO9118094. The transformation of eucalyptus is disclosed in EP1050209 and WO9725434. Each of these patents is incorporated in their entirety by reference.
  • In a still further preferred embodiment of the invention said plant is selected from: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (helianthus annuas), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Iopmoea batatus), cassaya (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables and ornamentals.
  • Preferably, plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassaya, barley, pea, and other root, tuber or seed crops. Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean, and sorghum. Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower, and carnations and geraniums. The present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper, chrysanthemum.
  • Grain plants that provide seeds of interest include oil-seed plants and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.
  • According to a further aspect of the invention there is provided a vector comprising the nucleic acid according to the invention operably linked to a promoter.
  • “Vector” includes, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissable or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication ie an episomal vector).
  • Suitable vectors can constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: Laboratory Manual: 2nd edition, Sambrook et al. 1989, Cold Spring Habor Laboratory Press or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. Eds., John Wiley & Sons, 1992.
  • Specifically included are shuffle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
  • A vector including nucleic acid according to the invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the gene.
  • Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g. bacterial), or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of GTase genomic DNA this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
  • By “promoter” is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.
  • Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156, herein incorporated by reference.
  • Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3): 495-50.
  • “Operably linked” means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is “under transcriptional initiation regulation” of the promoter. In a preferred aspect, the promoter is an inducible promoter or a developmentally regulated promoter.
  • Particular of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
  • If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibodies or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
  • According to a further aspect of the invention there is provided a method of enhancing monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase nucleic acid according to the invention in a plant. Preferably the plant is a woody plant species.
  • According to a further aspect of the invention there is provided a method of inhibiting monolignol glucoside synthesis in a plant comprising causing or allowing expression of at least one GTase antisense nucleic acid according to the invention in a plant. Preferably the plant is a woody plant species.
  • Inhibition of GTase expression may, for instance, be achieved using anti-sense technology.
  • In using anti-sense genes or partial gene sequences to down-regulate gene expression, a nucleotide sequence is placed under the control of a promoter in a “reverse orientation” such that transcription yields RNA which is complementary to normal mRNA transcribed from the “sense” strand of the target gene. See, for example, Rothstein et al, 1987; Smith et al, (1998), Nature 334, 724-726; Zhang et al (1992) The Plant Cell 4, 1575-1588, English et al. (1996) The Plant Cell 8, 179 188. Antisense technology is also reviewed in Bourque (1995), Plant Science 105, 125-149, and Flavell (1994) PNAS USA 91, 3490-3496.
  • According to a further aspect of the invention there is provided a nucleotide sequence encoding an antisense RNA molecule complementary to a sense mRNA molecule encoding for a polypeptide having a glucosyl transferase activity in the biosynthesis of at least a monolignol glucoside in lignin biosynthesis in a plant, which nucleotide sequence is under transcriptional control of a promoter and a terminator, both promoter and terminator capable of functioning in plant cells.
  • Suitable promoters and terminators are referred to hereinabove.
  • According to a further aspect of the invention there is provided a nucleotide sequence according to the invention comprising a transcriptional regulatory sequence, a sequence under the transcriptional control thereof which encodes an RNA which consists of a plurality of subsequences, characterised in that the RNA subsequences are antisense RNAs to mRNAs of proteins having a GTase activity in the lignin biosynthesis pathway in plant cells.
  • In particular, the said RNA subsequences are antisense RNAs to mRNAs of GTase having a GTase activity in the lignin biosynthesis pathway in plant cells, such as the GTase of FIGS. 1-11(C)
  • The nucleotide sequence may encode an RNA having any number of subsequences. Preferably, the number of subsequences lies between 2 and 7 (inclusive) and more preferably lies between 2-4.
  • According to a further aspect of the invention there is provided a host cell transformed with nucleic acid or a vector according to the invention, preferably a plant or a microbial cell. The microbial cell may be prokaryotic (eg Escherchia coli, Bacillus subtilis) or eukaryotic (eg Saccharomyces cerevisiae).
  • In the transgenic plant cell the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
  • According to a yet further aspect of the invention there is provided a method of transforming a plant cell comprising introduction of a vector into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the invention into the genome.
  • Plants transformed with a DNA construct of the invention may be produced by standard techniques known in the art for the genetic manipulation of plants. DNA can be introduced into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transferability (EP-A-270355, EP-A-0116718, NAR 12(22):8711-87215 (1984), Townsend et al., U.S. Pat. No. 5,563,055); particle or microprojectile bombardment (U.S. Pat. No. 5,100,792, EP-A-444882, EP-A-434616; Sanford et al, U.S. Pat. No. 4,945,050; Tomes et al. (1995) “Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment”, in Plant Cell, Tissue and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6: 923-926); microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al. 91987) Plant Tissue and Cell Culture, Academic Press, Crossway et al. (1986) Biotechniques 4:320-334); electroporation (EP 290395, WO 8706614, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606; D'Halluin et al. 91992). Plant Cell 4:1495-1505) other forms of direct DNA uptake (DE 4005152, WO 9012096, U.S. Pat. No. 4,684,611, Paszkowski et al. (1984) EMBO J. 3:2717-2722); liposome-mediated DNA uptake (e.g. Freeman et al (1984) Plant Cell Physiol, 29:1353); or the vortexing method (e.g. Kindle (1990) Proc. Nat. Acad. Sci. USA 87:1228). Physical methods for the transformation of plant cells are reviewed in Oard (1991) Biotech. Adv. 9:1-11. See generally, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Sciences and Technology 5:27-37; Christou et al. (1988) Plant Physiol. 87:671-674; McCabe et al. (1988) Bio/Technology 6:923-926; Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182; Singh et al. (1988) Theor. Appl. Genet. 96:319-324; Datta et al. (1990) Biotechnology 8:736-740; Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85: 4305-4309; Klein et al. (1988) Biotechnology 6:559-563; Tomes, U.S. Pat. No. 5,240,855; Buising et al. U.S. Pat. Nos. 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol 91: 440-444; Fromm et al (1990) Biotechnology 8:833-839; Hooykaas-Von Slogteren et al. 91984). Nature (London) 311:763-764; Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349; De Wet et al. (1985) in The Experimental Manipuation of Ovule Tissues ed. Chapman et al. (Longman, New York), pp. 197-209; Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566; Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and Ford (1995) Annals of Botany 75: 407-413; Osjoda et al. (1996) Nature Biotechnology 14:745-750, all of which are herein incorporated by reference.
  • Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama et al. (1988) Bio/Technology 6: 1072-1074; Zhang et al. (1988) Plant Cell rep. 7379-384; Zhang et al. (1988) Theor. Appl. Genet. 76:835-840; Shimamoto et al. (1989) Nature 338:274-276; Datta et al. (1990) Bio/Technology 8: 736-740; Christou et al. (1991) Bio/Technology 9:957-962; Peng et al (1991) International Rice Research Institute, Manila, Philippines, pp. 563-574; Cao et al. (1992) Plant Cell Rep. 11: 585-591; Li et al. (1993) Plant Cell Rep. 12: 250-255; Rathore et al. (1993) Plant Mol. Biol. 21:871-884; Fromm et al (1990) Bio/Technology 8:833-839; Gordon Kamm et al. (1990) Plant Cell 2:603-618; D'Halluin et al. (1992) Plant Cell 4:1495-1505; Walters et al. (1992) Plant Mol. Biol. 18:189-200; Koziel et al. (1993). Biotechnology 11194-200; Vasil, I. K. (1994) Plant Mol. Biol. 25:925-937; Weeks et al (1993) Plant Physiol. 102:1077-1084; Somers et al. (1992) Bio/Technology 10:1589-1594; WO 92/14828. In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient transformation method in monocots. (Hiei, et al. (1994) The Plant Journal 6:271-282). See also, Shimamoto, K. (1994) Current Opinion in Biotechnology 5:158-162; Vasil, et al. (1992) Bio/Technology 10:667-674; Vain, et al. (1995) Biotechnology Advances 13(4):653-671; Vasil, et al. (1996) Nature Biotechnology 14: 702).
  • Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, e.g. bombardment with Agrobacterium-coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233).
  • Plants which include a plant cell according to the invention are also provided.
  • In addition to the regenerated plant, the present invention embraces all of the following: a clone of such a plant, seed, selfed of hybrid progeny and descendants (e.g. F1 and F2 descendants).
  • According to a further aspect of the invention there is provided an isolated nucleic acid molecule obtainable from Arabidopsis thaliana which comprises a nucleic acid sequence encoding a polypeptide having
  • (1) GTase functionality; and
    (2) is capable of adding a glucosyl group via an O-glucosidic linkage to form
  • (a) a glucosyl ester of at least one of:
      • cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; and sinapic acid; and/or
  • (b) a 4-O-glucoside of at least one of:
  • cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol; and sinapyl alcohol.
  • In a further aspect of the invention there is provided a polypeptide encoded by an isolated nucleic acid molecule of the present invention wherein the said polypeptide is selected from the polypeptides of FIGS. 1B, 2B, 3B, 4B, 5B, 6B, 7B, 8B, 9B, 10B and 111B or functional variants and/or parts thereof. Preferably the polypeptide is selected from the group of polypeptides of FIGS. 2B, 3B, 4B, 6B, 7B and 9B or functional variants and/or parts thereof. Preferably still the polypeptide is selected from the group of polypeptides selected from FIGS. 2B, 3B, 7B and 9B or functional variants and/or parts thereof. Most preferably the polypeptide is one of the polypeptides shown in FIGS. 2B, 3B, 7B or 9B. Polypeptides encoded by the sense nucleic acid sequences presented in FIGS. 12-32 are also provided and readily derived from these sense sequences.
  • Variants of sequences having substantial identity or homology with the GTase molecules of the invention may be utilized in the practices of the invention. That is, the GTase of FIGS. 1A-11A may be modified yet still remain functional. Generally, the GTase will comprise at least about 40%-60%, preferably about 60%-80%, more preferably about 80%-95% sequence identity with a GTase nucleotide sequence of FIGS. 1A-32 herein.
  • The activity of functional variant polypeptides may be assessed by transformation into a host capable of expressing the nucleic acid of the invention. Methodology for such transformation is described in more detail below.
  • In a further aspect of the invention there is disclosed a method of producing a derivative nucleic acid comprising the step of modifying any of the sequences disclosed above, particularly the coding sequence of FIGS. 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, 9A, 10A, 11A, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
  • Alternatively, changes to a sequence may produce a derivative by way of one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution or one or more amino acids in the encoded polypeptide.
  • Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide or to produce dominant negative variants which may alter the flux through lignin biosynthetic pathways to alter the amount of lignin or an intermediate in the lignin biosynthetic pathway.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The invention will now be described with reference to the following Figures and Examples which are not to be construed as limiting the invention.
  • Scheme 1: The major intermediates in lignin biosynthesis pathway.
  • FIG. 1A: Sense nucleotide sequence of A062 (SEQ ID NO: 1). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 1B: The amino acid sequence of A062 (SEQ ID NO: 2);
  • FIG. 1C: The antisense nucleotide sequence of A062 (SEQ ID NO:3);
  • FIG. 2A Sense nucleotide sequence of A320 (SEQ ID NO: 4). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 2B The amino acid sequence of A320 (SEQ ID NO: 5);
  • FIG. 2C: The antisense nucleotide sequence of A320 (SEQ ID NO: 6);
  • FIG. 3A: Sense nucleotide sequence of A41 (SEQ ID NO: 7). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 3B: The amino acid sequence of A41 (SEQ ID NO: 8);
  • FIG. 3C: The antisense nucleotide sequence of A41 (SEQ ID NO: 9);
  • FIG. 4A: Sense nucleotide sequence of A42 (SEQ ID NO: 10). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 4B: The amino acid sequence of A42 (SEQ ID NO: 1);
  • FIG. 4C: The antisense nucleotide sequence of A42 (SEQ ID NO: 12);
  • FIG. 5A: Sense nucleotide sequence of A43 (SEQ ID NO: 13). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 5B: The amino acid sequence of A43 (SEQ ID NO: 14);
  • FIG. 5C: The antisense nucleotide sequence of A43 (SEQ ID NO: 15);
  • FIG. 6A: Sense nucleotide sequence of A911 (SEQ ID NO: 16). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 6B: The amino acid sequence of A911 (SEQ ID NO: 17);
  • FIG. 6C: The antisense nucleotide sequence of A911 (SEQ ID NO: 18);
  • FIG. 7A: Sense nucleotide sequence of A119 (SEQ ID NO: 19). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 7B: The amino acid sequence of A119 (SEQ ID NO: 20);
  • FIG. 7C: The antisense nucleotide sequence of A119 (SEQ ID NO: 21);
  • FIG. 8A: Sense nucleotide sequence of A233 (SEQ ID NO: 22). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 8B: The amino acid sequence of A233 (SEQ ID NO: 23);
  • FIG. 8C: The antisense nucleotide sequence of A233 (SEQ ID NO: 24);
  • FIG. 9A: Sense nucleotide sequence of A407 (SEQ ID NO: 25). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 9B: The amino acid sequence of A407 (SEQ ID NO: 26);
  • FIG. 9C: The antisense nucleotide sequence of A407 (SEQ ID NO: 27);
  • FIG. 10A: Sense nucleotide sequence of A961 (SEQ ID NO: 28). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 10B: The amino acid sequence of A961 (SEQ ID NO: 29);
  • FIG. 10C: The antisense nucleotide sequence of A961 (SEQ ID NO: 30);
  • FIG. 11A: Sense nucleotide sequence of A962 (SEQ ID NO: 31). The coding region starts from the first nucleotide and ends at the last nucleotide;
  • FIG. 11B: The amino acid sequence of A962 (SEQ ID NO: 32);
  • FIG. 11C: The antisense nucleotide sequence of A962. (SEQ ID NO: 33);
  • FIG. 12: The sense nucleotide sequence of UGT71B5 (SEQ ID NO: 34);
  • FIG. 13 The sense nucleotide sequence of UGT71C3 (SEQ ID NO: 35);
  • FIG. 14 The sense nucleotide sequence of UGT71C5 (SEQ ID NO: 36);
  • FIG. 15 The sense nucleotide sequence of UGT71D1 (SEQ ID NO: 37);
  • FIG. 16 The sense nucleotide sequence of UGT73B1 (SEQ ID NO: 38);
  • FIG. 17 The sense nucleotide sequence of UGT73B2 (SEQ ID NO: 39);
  • FIG. 18 The sense nucleotide sequence of UGT73B4 (SEQ ID NO: 40);
  • FIG. 19 The sense nucleotide sequence of UGT73B5 (SEQ ID NO: 41);
  • FIG. 20 The sense nucleotide sequence of UGT73C1 (SEQ ID NO: 42);
  • FIG. 21 The sense nucleotide sequence of UGT731C (SEQ ID NO: 43);
  • FIG. 22 The sense nucleotide sequence of UGT73C5 (SEQ ID NO: 44);
  • FIG. 23 The sense nucleotide sequence of UGT73C6 (SEQ ID NO: 45);
  • FIG. 24 The sense nucleotide sequence of UGT73C7 (SEQ ID NO: 46);
  • FIG. 25 The sense nucleotide sequence of UGT74F2 (SEQ ID NO: 47);
  • FIG. 26 The sense nucleotide sequence of UGT76E1 (SEQ ID NO: 48);
  • FIG. 27 The sense nucleotide sequence of UGT76E11 (SEQ ID NO: 49);
  • FIG. 28 The sense nucleotide sequence of UGT76E12 (SEQ ID NO: 50);
  • FIG. 29 The sense nucleotide sequence of UGT76E2 (SEQ ID NO: 51);
  • FIG. 30 The sense nucleotide sequence of UGT78D1 (SEQ ID NO: 52);
  • FIG. 31 The sense nucleotide sequence of UGT89B1 (SEQ ID NO: 53);
  • FIG. 32 The sense nucleotide sequence of UGT72B3 (SEQ ID NO: 54);
  • FIG. 33 shows recombinant GST-UGT71C1 fusion protein purified from E. coli using glutathione-coupled Sepharose. The protein (5 μg) was analyzed using 10% SDS-PAGE and was visualized with Coomassive staining;
  • FIG. 34 shows three different glucose conjugates of caffeic acid, (caffeoyl-3-O-glucoside, caffeoyl-4-O-glucoside and 1-O-caffeoylglucose), obtained from the glucosyltransferase reactions containing the recombinant UGT71C1, UGT73B3 and UGT84A1 respectively. Each assay contained 1-2 μg of recombinant UGT, 1 mM caffeic acid, 5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl, pH 7.0. The mix was incubated at 30° C. for 30 min and was analyzed by reverse-phase HPLC subsequently. Linear gradient (10-16%) of acetonitrile in H2O at 1 ml/min over 20 min was used to separate the glucose conjugates from caffeic acid.
  • FIG. 35A shows the pH optima of UGT71C1 glucosyltransferase activity measured over the range pH 5.5-8.0 in the reactions containing 50 mM buffer, 1 μg of UGT71C1, 1 mM caffeic acid, 5 mM UDP-glucose and 1.4 mM 2-mercaptoethanol. The mix was incubated at 30° C. for 30 min. The reaction was stopped by the addition of 20 μl of trichloroacetic acid (240 mg/ml) and was analyzed by reverse-phase HPLC subsequently. The specific enzyme activity was expressed as nanomoles of caffeic acid glucosylated per second (nkat) by 1 mg of protein in 30 min of reaction time at 30° C. FIG. 35B, the time course of UGT71C1 glucosyltransferase activity was studied by measuring the amount of caffeic acid glucosylated by 1 μg of UGT71C1 in 50 mM TRIS-HCll, pH 7.0. The reactions were carried out and analyzed as described in A;
  • FIG. 36 shows UGT71C1 transgenic Arabidopsis thaliana plants and their ability to glucosylate caffeic acid; and
  • FIG. 37 summarises the GTase activities of various GTase polypeptides with respect to various anti-oxidant substrates.
  • EXAMPLES Materials and Methods Transformation of Woody Plant Species
  • The transformation of woody plant species is known in the art. See U.S. Pat. No. 4,795,855 and WO9118094; EP1050209 and WO9725434. Each of these patents are incorporated in their entirety by reference.
  • Transformation of Non-Woody Plant Species
  • Methods used in the transformation of plant species other than woody species are well known in the art and are extensively referenced herein.
  • Identification of GTase sequences
  • The GTase sequence identification was carried out using GCG software (Wisconsin package, version 8.1). Blasta programme was used to search Arabidopsis protein sequences containing a PSPG (plant secondary product UDP-glucose glucosyltransferase) signature motif (Hughes and Hughes (1994) DNA Sequence 5, 41-49) in EMBL and GenBank sequence database. The database information on the GTases described in the present invention are listed in Table 1.
  • Amplification and Cloning of the GTase Sequences
  • The GTase sequences were amplified from Arabidopsis thaliana Columbia genomic DNA with specific primers (Table 2), following standard methodologies (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). 50 ng of genomic DNA isolated from Arabidopsis thaliana Columbia were incubated with 1× pfu PCR buffer (Stratagene), 250 μM dNTPS, 50 pmole primer for each end, and 5 units of pfu DNA polymerase (Stratagene) in a total of 100 μl. The PCR reactions were carried out as outlined in the programme described in Table 3.
  • After PCR amplification, the products were double digested by appropriate restriction enzymes listed in Table 2 (bold type). The digested DNA fragments were purified using an electro-eluction method (Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and ligated into the corresponding cloning site on pGEX2T plasmid DNA (Pharmacia) by T4 DNA ligase (NEB) at 16° C. overnight. The resulting recombinant plasmid DNA was amplified in E. coli XL1-blue cells and was confirmed with the restriction enzymes listed in Table 2 (bold type) following the method described by Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Habor Laboratory, Cold Spring Harbor, N.Y.).
  • Preparation of Glucosyltransferase Recombinant Proteins
  • E. coli cells carrying recombinant plasmid DNA as described above were grown at 37° C. overnight on 2YT (16 g bacto tryptone, 10 g bacto-yeast extract, 5 g NaCl per litre) agar (1.8% w/v) plate which contained 50 μg/ml ampicillin. A single colony was picked into 2 ml of 2YT containing the same concentration of ampicillin. The bacterial culture was incubated at 37° C. with moderate agitation for 6 h. The bacterial culture was transferred into 1 L of 2YT and incubated at 20° C. subsequently. 0.1 mM IPTG was added when the culture reached logarithmic growth phase (A 600 nm 0.5). The bacterial culture was incubated for another 24 h. The cells were collected by a centrifugation at 7,000×g for 5 min at 4° C. and resuspended in 5 ml spheroblast buffer (0.5 mM EDTA, 750 mM sucrose, 200 mM Tris, pH 8.0). Lysozyme solution was added to a final concentration of 1 mg/ml. 7-fold volume of 0.5× spheroblast buffer was poured into the suspension immediately and the suspension was incubated for 4° C. for 30 min under gentle shaking. The spheroblasts were collected by a centrifugation at 12,000×g for 5 min at 4° C., and resuspended in 5 ml ice cold PBL buffer (140 mM NaCl, 80 mM, NA2 HPO4, 15 mM KH2PO4). 2 mM of PMSF was added into suspension immediately and the suspension was centrifuged at 12,000×g for 20 min at 4° C. in order to remove the cell debris. After the centrifugation, the supernatant was transferred to a 15 ml tube. 200 μl of 50% (v/v) slurry of Glutathione-coupled Sepharose 4B were added into the tube and the mixture was mixed gently for 30 min at room temperature. The mixture was then centrifuged at a very slow speed (500×g) for 1 min. the supernatant was discarded. The beads were washed with 5 ml ice cold PBS buffer three times. After each wash, a short centrifugation was applied as described above to sediment the Sepharose beads. To recover the expressed protein from Sepharose beads, 100 μl of 20 mM reduced glutathione were used to resuspend the beads. After 10 min incubation at room temperature, the beads were collected and the supernatant containing the expressed protein was collected. The elution step was repeated once, and both supernatant fractions were combined and stored at 4° C. for protein assay and further studies.
  • Protein Concentration Assay
  • The protein assays were carried out by adding 10 μl of protein solution into 900 μl of distilled water and 200 μl of Bio-Rad Protein Assay Dye. The absorbance at 595 nm was read. A series of BSA (bovine serium albumin) at different concentration was used as standard. Regression line was plotted based on the coordinates of the BSA concentration against the reading at 595 nm. The concentration of protein sample was therefore estimated from the regression line after the protein assay.
  • Assay for Enzyme Activity
  • A standard glucosylation reaction was set up by mixing 2 μg of recombinant proteins with 14 mM 2-mercaptoethanol, 5 mM UDP-glucose, 1 mM of various lignin or antioxidant substrate, 100 mM Tris, pH 7.0, to a total volume of 200 μl. The reaction was carried out at 30° C. for 30 min and stopped by the addition of 20 μl trichloroacetic acid (240 mg/ml). All the samples were stored at −20° C. before the liquid chromatographic assay.
  • High-Performance Liquid Chromatographic
  • Reverse-phase HPLC (Waters Separator 2690 and Waters Tunable Absorbance Detector 486, Waters Limited, Herts, UK) using a Columbus 5μ C18 column (250×4.60 mm, Phenomenex). Linear gradient of acetonitrile in H2O (all solutions contained 0.1% trifluoroacetic acid) at 1 ml/min over 20 min, was used to separate the glucose conjugates from their aglycone. The HPLC methods were described as the following: cinnamic acid, λ288 nm, 10-55% acetonitrile; p-coumaric acid, λ311 nm, 10-25% acetonitrile; caffeic acid, λ311 nm, 10-16% acetonitrile; ferulic acid, λ311 nm, 10-35% acetonitrile; sinapic acid, λ306 nm, 10-40% acetonitrile; p-coumaryl aldehyde, λ315 nm, 10-46% acetonitrile; coniferyl aldehyde, λ283 nm, 10-47% acetonitrile; sinapyl aldehyde, λ280 nm, 10-47% acetonitrile; p-coumaryl alcohol, p283 nm, 10-27% acetonitrile; coniferyl alcohol, λ306 nm, 10-25% acetonitrile; sinapyl alcohol, λ285 nm, 10-25% acetonitrile. The retention time (Rt) of the glucose conjugates analysed is listed in the following: cinnamoylglucose, Rt=12.3 min; p-coumaroylglucose, Rt=10.6 min; caffeoylglucose, Rt=8.5 min; feruloylglucose, Rt=10.3 min; sinapoylglucose, Rt=9.7 min; caffeoyl-4-O-glucoside, Rt=6.8 min; feruloyl-4-O-glucoside, Rt=7.8 min; sinapoyl-4-O-glucoside, Rt=8.2 min; coniferin, Rt=8.2 min; syringin, Rt=9.1 min.
  • The recombinant GTases were shown to have GTase activity towards the major intermediates of the lignin biosynthesis pathway (Tables 5 and 6). It is clear from these results that the GTases display different specific activity reaction profiles relative to each other on the various lignin precursor substrates utilised. Michaelis-Menten kinetics were also studied on several of the GTases against their preferred substrates (Tables 7 and 8). It is clear from these results that the GTases display different enzyme kinetics for different substrates.
  • The results (in total) indicate that certain GTases show a greater potential for use in the alteration of lignin biosynthesis inplanta than others.
  • Reducing the Formation of Monolignol Glucosides In Planta
  • In one approach to reduce the formation of monolignol glucosides in planta, A119 and A407 are down regulated using an antisense strategy (A). Expression of the A119 and A407 antisense sequences is driven by the gene's own promoter. An alternative approach (B) is to modify the UDP-glucose binding motif through an in vitro mutagenesis method (Lim et al., 1998) such that the mutant protein is able to bind the monolignol substrates but loses its catalytic activity. Such mutant proteins are thought to compete with the functional native protein by binding specifically to monolignols, thereby reducing the formation of monolignol glucosides.
  • Anti-Sense Approach Amplification and Cloning of the A119 and A407 Promoter Sequences
  • Approximately 2 kb of the 5′ flanking sequences of A119 and A407 are amplified directly from genomic DNA by PCR. The promoter fragments are then cloned into a pBluescript plasmid vector (Sambrook et al., 1989).
  • Construct Chimaeric Genes of A119 and A407 Promoter and Their ORF Region in Antisense Orientation.
  • The A119 and A407 cDNA fragments are amplified from pGEXA119 and pGEXA407 by PCR. The fragments are then ligated correspondingly into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the antisense orientation.
  • Preparation of Binary Construct Containing the A119 and A407 Antisense Chimaeric Gene
  • The DNA fragments containing the A119 and A407 antisense chimaeric genes are amplified by PCR from the chimaeric constructs described in (A)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.
  • Mutant Gene Approach In Vitro Site Mutagenesis to Modify the UDPglucose Binding Motif in A119 and A407
  • In vitro site mutagenesis is carried by PCR to modify the sequences encoding the UDPglucose binding motif in A119 and A407 (Lim et al., 1998). The constructs pGEXA119 and pGEXA407 are used in the DNA templates in the PCR reaction.
  • Construct Chimaeric Mutant Genes Regulated by A119 and A407 Promoters
  • The A119 and A407 mutant genes are amplified from the pGEXA119 and pGEXA407 mutant constructs described in (B)-(1) by PCR. The A119 and A407 mutant gene fragments are then ligated into the A119 and A407 promoter constructs described in (A)-(1) with the ORF region in the sense orientation.
  • Preparation of Binary Construct Containing the Chimaeric Mutant Genes A119 and A407
  • The DNA fragments containing the A119 and A407 mutant chimaeric genes are amplified by PCR from the chimaeric constructs described in (B)-(2). The fragments are then ligated into a binary vector (Sambrook et al., 1989). The final constructs are transformed into plants subsequently.
  • Enhancing the Formation of Monolignol Glucosides in Planta
  • The CaMV 35S promoter fragment is used to drive the expression of A119 and A497. DNA fragments containing A119 and A407 ORF sequences are amplified from pGEXA119 and pGEXA407 correspondingly by PCR. The DNA fragments are ligated downstream of the CaMV 35S promoter. The constructs are used to transform plants such that the lignin content and composition is altered.
  • TABLE 1
    Database information on eleven Arabidopsis GTase genes
    Gene Database BAC/P1 gene name in
    name protein_id chromosome acc. no. clone database
    A062 Gi|3935156 I ac005106 T25N20 T25N20.20
    A320 Not annotated III ab019232 MIL23 not annotated
    A41 Emb|CAB10326.1 IV z97339 FCA4 d13780c
    A42 Emb|CAB10327.1 IV z97339 FCA4 d13785c
    A43 Emb|CAB10328.1 IV z97339 FCA4 d13790c
    A911 Gi|2642451 II ac002391 T20D16 T20D16.11
    A119 Not annotated V ab018119 MSN2 not annotated
    A233 Wrongly annotated IV al021961 F28A23 wrongly annotated
    A407 Gi|3319344 V af077407 F9D12 F9D12.4
    A961 Gi|3582329 II ac005496 T27A16 T27A16.15
    A962 Gi|3582341 II ac005496 T27A16 T27A16.16
  • Parameters used for the search of the above Arabidopsis sequences and the programme used are as follows:
  • NETBLAST with the default settings:
  • Infile2=nr Matrix=Blosum 62 Translate=1 Dbtranslate=1
  • TABLE 2
    DNA sequences and restriction enzyme sites in primers used in
    amplification of 11 Arabidopsis Gtase sequences from genomic
    DNA.
    Sequence complementary to either end of the ORFs are under-
    lined. Restriction enzyme sites that were used in making
    expression constructs were in BOLD type.
    restriction
    primer DNA sequence (5′→3′) enzyme sites
    A062
    5′ CGGGTGATCAGGTACCATGGCGCCACCGCATTTTC BclI and KpnI
    SEQ ID NO: 55
    A062 3′ CGGAATTCGTCGAGTTACTTTACTTTTACCTCCTC EcoRI and SalI
    SEQ. ID NO: 56
    A320 5′ CCCCCGGGTACCATGGAGCTAGAATCTTCTCTCC SmaI and KpnI
    SEQ. ID NO: 57
    A320 3′ CGGAATTCTCGAGTTAAAAGGTTTTGATTGATCC EcoRI and XhoI
    SEQ. ID NO: 58
    A41 5′ TGGGATCCATATCAGAAATGGTGTTC BamHI
    SEQ. ID NO: 59
    A41 3′ GGGAATTCCTAGTATCCATTATCTTTAGTC EcoRI
    SEQ. ID NO: 60
    A42 5′ GGGGATCCATGGACCCGTCTCGTCATACTC BamHI
    SEQ. ID NO: 61
    A42 3′ GGGAATTCCACTAGTGTTCTCCGTTGTCTTC EcoRI
    SEQ. ID NO: 62
    A43 5′ GGGGATCCAATATGGAGATGGAATCGTCGTTAC BamHI
    SEQ. ID NO: 63
    A43 3′ GGGAATTCCTTACACGACATTATTAATGTTTG EcoRI
    SEQ. ID NO: 64
    A911 5′ GGGGTACCTGATCAATAATGGGCAGTAGTGAGGG KpnI and BclI
    SEQ. ID NO: 65
    A911 3′ CGGAATTCGTCGACGAGTTAGGCGATTGTGATATC EcoRI and SalI
    SEQ. ID NO: 66
    A119 5′ CGGGATCCGGTACCATGCATATCACAAAACCACAC BamHI and KpnI
    SEQ. ID NO: 67
    A119 3′ CGGAATTCGCTAGCTAAGCACCACGTGACAAGTCC EcoRI and NheI
    SEQ. ID NO: 68
    A233 5′ CGGGATCCGGTACCATGAGTAGTGATCCTCATCGT BamHI and KpnI
    SEQ. ID NO: 69
    A233 3′ CGGGATCCGAATTCTAGGAGGTAAACTCTTCTATG BamHI and
    SEQ. ID NO: 70 EcoRI
    A407
    5′ CGGGATCCGGTACCATGCATATCACAAAACCACAC BamHI and KpnI
    SEQ. ID NO: 71
    A407 3′ CGGAATTCGTCGACCTAAGCACCACGTCCCAAG EcoRI and SalI
    SEQ. ID NO: 72
    A961 5′ GGGTGATCAGGTACCATGGGGAAGCAAGAAGATG BclI and KpnI
    SEQ. ID NO: 73
    A961 3′ CGGAATTCGTCGACTACTTACTTATAGAAACGCCG EcoRI and SalI
    SEQ. ID NO: 74
    A962 5′ GAAGATCTGGTACCATGGCGAAGCAGCAAGAAG BglII and KpnI
    SEQ. ID NO: 75
    A962 3′ CGGAATTCGTCGACCGATGAAAGCCCATCTATG EcoRI and SalI
    SEQ. ID NO: 76
  • TABLE 3
    PCR programme
    Stage I (1 cycle) Stage II (40 cycles) Stage III (1 cycle)
    95° C. 5 min 95° C. 1 min 95° C. 2 min
    55° C. 2 min 55° C. 1 min 55° C. 2 min
    72° C. 3 min 72° C. 2 min 72° C. 5 min
  • TABLE 4
    The HPLC conditions
    Detector
    Acetonitrile Wavelength
    Lignin Precursors Gradient (%) (nm)
    cinnamic acid 10-55 288
    p-coumaric acid 10-25 311
    caffeic acid 10-16 311
    ferulic acid 10-35 311
    sinapic acid 10-40 306
    p-coumaryl aldehyde 10-46 315
    coniferyl aldehyde 10-47 283
    sinapyl aldehyde 10-47 280
    p-coumaryl alcohol 10-27 283
    coniferyl alcohol 10-25 306
    sinapyl alcohol 10-25 285
  • TABLE 5
    Specific activity of the recombinant GTases producing glucose ester
    against lignin precursors
    Each assay contained 0.5 m□ of potential substrates, 5 mM UDPG and
    0.2 μg of recombinant GTases in a total volume of 200 μl. The reactions
    were incubated at 20° C. for 30 min and were stopped by addition
    of 20 μl TCA (240 mg/ml). Each reaction mix was then analysed using
    HPLC. The specific activity (nkat/mg) of the recombinant GTase is
    defined as the amount of substrate (nmole) converted to glucose ester
    per second by 1 mg of protein at 20° C. under the reaction conditions.
    A41 A320 A42 A43 A911 A062
    Cinnamic acid 0.30 0.06 14.21 0.02 8.77 1.62
    p-coumaric acid 13.53 0.05 4.69 0.03 4.31 2.54
    Caffeic acid 2.61 0.05 0.62 0.01 0.77 0.26
    Ferulic acid 6.64 0.54 15.63 0.04 2.88 0.08
    Sinapic acid 5.35 15.58 11.97 0.05 0.15 0.1
  • TABLE 6
    Specific activity of the recombinant GTases producing O-glucosides
    against lignin precursors
    The reactions were set up following the conditions described in Table 1.
    All the reactions, except those containing the aldehydes, were stopped
    by the addition of TCA. The aldehyde assay mixs were injected into
    HPLC immediately after the reactions were completed. The
    specific activity (nkat/mg) of the recombinant GTase is defined as
    the amount of substrate (nmole) converted to 4-O-glucoside per
    second by 1 mg of protein at 30° C. under the reaction conditions.
    A233 A119 A407 A961 A962
    Cinnamic acid NDa ND ND ND ND
    p-coumaric acid 0.09 0.02 0.01 0.01 0.01
    caffeic acid 0.48 0.13 0.07 0.07 ND
    ferulic acid 0.37 14.48  0.25 ND ND
    sinapic acid 0.39 102.56  65.39  0.01 0.01
    p-coumaryl aldehyde ND 0.03 ND 0.01 0.02
    Coniferyl aldehyde ND 1.08 ND 0.16 0.34
    sinapyl aldehyde ND 4.55 ND 0.57 0.50
    p-coumaryl alcohol ND ND ND ND ND
    Coniferyl alcohol 0.46 67.53  2.78 0.57 0.49
    sinapyl alcohol 0.05 126.16  114.76  0.35 0.45
    aND, not detected
  • TABLE 7
    Kinetic studies on the recombinant GTases producing glucose esters against lignin
    precursors
    A41 A320 A42 A911 A062
    Km Vmax Km Vmax Km Vmax Vmax Vmax
    MM nkat/mg mM nkat/mg mM nkat/mg Km mM nkat/mg Km mM nkat/mg
    1.51 1.80 0.72 1.05 2.36
    0.49 19.42 0.05 9.06 4.33 2.87
    0.10 16.13 0.40  6.67 0.39 11.10  5.05 4.91
    0.06 20.24 0.20  1.67 0.23 1.18
    0.35 11.35 0.36 18.35 0.34 6.91
    0.24  6.78 0.06 8.37 0.13 12.80
  • TABLE 8
    Kinetic studies on the recombinant GTases producing O-glucosides
    against lignin precursors
    A119 A407
    Km Vmax Km Vmax
    mM nkat/mg mM nkat/mg
    UDPG 0.93 0.89
    ferulic acid 0.25  18.87
    sinapic acid 0.51 131.58 0.14  75.19
    coniferyl 0.26  92.59
    alcohol
    sinapyl alcohol 1.10 322.58 1.07 357.10
  • TABLE 9
    1H and 13C NMR spectra were recorded in deuterated methanol at
    500 MHz and 125 MHz respectively. Chemical shifts are given on δ scale
    with TMS as internal standard. The position on the aromatic ring begins with
    the carbon joining the propanoic acid. d, doublet; dd, doublet of
    doublets; m, multiplet; J, coupling constant.
    Caffeic acid Caffeoyl-3-O-glucoside
    Position δH δC δH δC
    C1 128.1 127.6
    C2 7.02 (1H, d, J = 2.0 Hz) 115.2 7.47 (1H, d, J = 2.0 Hz) 117.0
    C3 146.7 146.0
    C4 149.4 150.6
    C5 6.77 (1H, d, J = 8.0 Hz) 116.6 6.84 (1H, d, J = 8.5 Hz) 117.8
    C6 6.92 (1H, dd, J = 8.0, 2.0 Hz) 122.8 7.13 (1H, dd, J = 8.5, 2.0 Hz) 125.6
    C7 7.53 (1H, d, J = 16.0 Hz) 146.9 7.45 (1H, d, J = 14.5 Hz) 146.6
    C8 6.21 (1H, d, J = 15.5 Hz) 116.3 6.33 (1H, d, J = 14.5 Hz) 116.1
    C9 171.5 170.4
    Glc-1 ~4.86 (signal interrupted) 103.9
    Glc-2 74.5
    Glc-3 78.0
    Glc-4 {close oversize brace} 3.40-3.50 (4H, m) 71.0
    Glc-5 77.2
    Glc-6 3.93 (1H, dd, J = 12.0, 2.0 Hz) 62.4
    3.71 (1H, dd, J = 12.0, 5.5 Hz)
  • TABLE 10
    Each assay contained 1 □g of UGT71C1, 1 mM phenolic compound,
    5 mM UDP-glucose, 1.4 mM 2-mercaptoethanol and 50 mM TRIS-HCl,
    pH 7.0. The mix was incubated at 30° C. for 30 min. The reaction
    was stopped by the addition of 20 □l of trichloroacetic acid (240 mg/ml)
    and was analysed by reverse-phase HPLC subsequently. The results
    represent the mean of three replicates ± standard deviation.
    Specific activity
    Substrate nkat/mg
    o-Coumaric acid 1.5 ± 0.2
    m-Coumaric acid 1.2 ± 0.2
    p-Coumaric acid 0
    Caffeic acid 2.9 ± 0.8
    Ferulic acid 0
    Sinapic acid 0
    Esculetin 34.8 ± 4.2 
    Scopoletin 29.4 ± 3.9 
    Salicylic acid 0
    4-hydroxybenzoic acid 0
    3,4-dihydroxybenzoic acid 0
    Eriodictyol 0
    Luteolin 0.7 ± 0.1
    Quercetin 1.4 ± 0.4
    Catechin 0
    Cyanidin 0

Claims (18)

1. A transgenic plant comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity and is encoded by
i) a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54; or
ii) a nucleic acid molecule which hybridizes to SEQ ID NO: 19 or any of the sequences represented in (i) above and which modifies biosynthetic intermediates in lignin polymerization; or
iii) a nucleic acid molecule which is degenerate as a result of the genetic code to SEQ ID NO: 19 or any of the sequences defined in (i) and (ii) above.
2. A transgenic plant according to claim 1, wherein said intermediates are selected from the group consisting of: cinnamic acid; p-coumaric acid; caffeic acid; ferulic acid; sinapic acid; p-coumaryl aldehyde; coniferyl aldehyde; sinapyl aldehyde; p-coumaryl alcohol; coniferyl alcohol and sinapyl alcohol.
3. A transgenic plant according to claim 1, wherein the nucleic acid molecule anneals under stringent hybridization conditions to a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.
4. A transgenic plant according to claim 1, wherein the nucleic acid molecule is SEQ ID NO: 25, and the intermediates are monolignol glucosides.
5. A transgenic plant comprising a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of:
i) antisense sequences selected from the group consisting of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, parts thereof, and antisense sequence of the sense sequences presented in SEQ ID NOS: 34-54; and
ii) antisense sequences which hybridize to any of the sense sequences according to claim 1 and which inhibit GTase activity.
6. A transgenic plant according to claim 5, wherein the antisense sequence hybridizes to a sequence selected from the group consisting of SEQ ID NOS: 19 and 25.
7. A transgenic plant according to claim 1, wherein the nucleic acid is cDNA.
8. A transgenic plant according to claim 1, wherein the nucleic acid is genomic DNA.
9. A transgenic plant according to claim 1, wherein the plant is a woody plant selected from the group consisting of poplar; eucalyptus; Douglas fir; pine; walnut; ash; birch; oak; teak and spruce.
10. A transgenic plant according to claim 9, wherein said plant is poplar.
11. A transgenic plant according to claim 1, wherein the plant is a non-woody plant species.
12. A method for the manufacture of paper or paperboard comprising:
i) pulping transgenic wood material derived from a transgenic woody plant according to claim 8; and
ii) producing paper or paperboard from the pulped transgenic wood material.
13. A transgenic eukaryotic cell comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity; said nucleic acid molecule being selected from the group consisting of:
i) nucleic acid molecules comprising a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54;
ii) nucleic acid molecules which hybridize to any of the sequences represented in (i) above and which glucosylate an anti-oxidant; and
iii) nucleic acid molecules which are degenerate as a result of the genetic code to any of the sequences defined in (i) and (ii) above.
14. A transgenic eukaryotic cell according to claim 13, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.
15. A transgenic eukaryotic cell according to claim 14, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 7, 10, 13, 19, 22, 25 and 28.
16. A transgenic prokaryotic cell comprising a nucleic acid molecule which encodes a polypeptide which has glucosyltransferase activity and is encoded by:
i) a nucleic acid molecule selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54; or
ii) a nucleic acid molecule which hybridizes to any of the sequences represented in (i) above and which glucosylates an anti-oxidant; or
iii) a nucleic acid molecule which is degenerate as a result of the genetic code to any of the sequences defined in (ii) and (iii) above.
17. A transgenic prokaryotic cell according to claim 16, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 and 54.
18. A transgenic prokaryotic cell according to claim 17, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1, 7, 10, 13, 19, 22, 25 and 28.
US11/966,280 2000-02-09 2007-12-28 Transgenic Cells Expressing Glucosyltransferase Nucleic Acids Abandoned US20080209597A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/966,280 US20080209597A1 (en) 2000-02-09 2007-12-28 Transgenic Cells Expressing Glucosyltransferase Nucleic Acids

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GBGB0002814.2A GB0002814D0 (en) 2000-02-09 2000-02-09 Nucleic acids and their uses
GB0002814.2 2000-02-09
PCT/GB2001/000477 WO2001059140A1 (en) 2000-02-09 2001-02-08 Transgenic cells expressing glucosyltransferase nucleic acids
US10/203,319 US7335814B2 (en) 2000-02-09 2001-02-08 Transgenic cells expressing glucosyltransferase nucleic acids
US11/966,280 US20080209597A1 (en) 2000-02-09 2007-12-28 Transgenic Cells Expressing Glucosyltransferase Nucleic Acids

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/GB2001/000477 Continuation WO2001059140A1 (en) 2000-02-09 2001-02-08 Transgenic cells expressing glucosyltransferase nucleic acids
US10/203,319 Continuation US7335814B2 (en) 2000-02-09 2001-02-08 Transgenic cells expressing glucosyltransferase nucleic acids

Publications (1)

Publication Number Publication Date
US20080209597A1 true US20080209597A1 (en) 2008-08-28

Family

ID=9885125

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/203,319 Expired - Fee Related US7335814B2 (en) 2000-02-09 2001-02-08 Transgenic cells expressing glucosyltransferase nucleic acids
US11/966,280 Abandoned US20080209597A1 (en) 2000-02-09 2007-12-28 Transgenic Cells Expressing Glucosyltransferase Nucleic Acids

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/203,319 Expired - Fee Related US7335814B2 (en) 2000-02-09 2001-02-08 Transgenic cells expressing glucosyltransferase nucleic acids

Country Status (11)

Country Link
US (2) US7335814B2 (en)
EP (1) EP1254243A1 (en)
JP (1) JP2003522531A (en)
CN (1) CN1313616C (en)
AU (1) AU784030B2 (en)
CA (1) CA2412143A1 (en)
GB (1) GB0002814D0 (en)
MX (1) MXPA02007752A (en)
NO (1) NO20023739L (en)
NZ (1) NZ520251A (en)
WO (1) WO2001059140A1 (en)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ543553A (en) 2003-05-27 2008-12-24 Univ York Bioreactor containing cells expressing glycosyltransferase nucleic acids
US7056742B2 (en) * 2003-06-16 2006-06-06 E. I. Du Pont De Nemours And Company High Level production of arbutin in green plants
WO2004111254A1 (en) 2003-06-19 2004-12-23 Poalis A/S A method of producing a low molecular weight organic compound in a cell
GB0323813D0 (en) * 2003-10-13 2003-11-12 Univ York Glucosyltransferases
GB0519231D0 (en) * 2005-09-21 2005-10-26 Univ York Regioselective glycosylation
CN102409059B (en) * 2010-09-21 2013-03-13 四川大学 Method for improving plant drought hardiness
KR101326017B1 (en) * 2010-10-27 2013-11-07 한국생명공학연구원 Salt-resistant SyGT gene from Synechocystis and uses thereof
CN102533849A (en) * 2012-03-26 2012-07-04 山东大学 Application of poplar glycosyl transferase gene PtGT1 in improving plant lignin content and promoting blossom
CN103614437A (en) * 2013-11-26 2014-03-05 山东大学 Application of Arabidopsis thaliana glycosyltransferase UGT84A1 in catalytic synthesis of auxin sugar ester
CN103614436A (en) * 2013-11-26 2014-03-05 山东大学 Application of Arabidopsis thaliana glycosyltransferase UGT75D1 in catalytic synthesis of auxin sugar ester
CN104357419B (en) * 2014-11-06 2017-10-27 中国科学院天津工业生物技术研究所 A kind of fleabane flower glycosyl transferase, preparation method and applications
WO2016124515A1 (en) * 2015-02-04 2016-08-11 Basf Plant Science Company Gmbh Method of increasing resistance against soybean rust in transgenic plants by increasing the scopoletin content
CN104928304A (en) * 2015-07-01 2015-09-23 山东大学 Application of Arabidopsis thaliana glycosyl transferase gene UGT76E11 in improving plant salt tolerance
CN107148971B (en) * 2017-04-28 2020-06-02 河南大学 Application of sinapic acid in seed germination, root growth and seedling development

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5981837A (en) * 1995-12-22 1999-11-09 Purdue Research Foundation Method for regulation of plant lignin composition
US5985666A (en) * 1995-06-07 1999-11-16 Pioneer Hi-Bred International, Inc. Forages

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL8200523A (en) 1982-02-11 1983-09-01 Univ Leiden METHOD FOR TRANSFORMING IN VITRO PLANT PROTOPLASTS WITH PLASMIDE DNA.
EP0290799B9 (en) 1983-01-13 2004-09-01 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Transgenic dicotyledonous plant cells and plants
CA1280081C (en) 1984-09-24 1991-02-12 Calgene, Inc. Plant cell microinjection technique
US5100792A (en) 1984-11-13 1992-03-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
WO1987006614A1 (en) 1986-04-30 1987-11-05 Boyce Thompson Institute For Plant Research, Inc. Electric field mediated dna transformation of plant cells and organelles
US5004863B2 (en) 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
CA1328236C (en) 1987-05-05 1994-04-05 Novartis Ag Plant tissue transformation
EP0331083A3 (en) 1988-03-02 1990-11-28 Schweizerische Eidgenossenschaft Eidgenössische Technische Hochschule (Eth) Method for the production of transgenic plants
US5108921A (en) 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
US5240855A (en) 1989-05-12 1993-08-31 Pioneer Hi-Bred International, Inc. Particle gun
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
ATE130371T1 (en) 1989-12-19 1995-12-15 Ciba Geigy Ag METHOD AND DEVICE FOR THE GENETIC TRANSFORMATION OF CELLS.
DE4005152A1 (en) 1990-02-17 1991-08-22 Guenter Prof Dr Kahl Transforming plant protoplast(s) with DNA-histone complex - providing high and reproducible transfer rate, and expression of foreign genes
CA2036935A1 (en) 1990-02-26 1991-08-27 Paul Christou Plant transformation process with early identification of germ line transformation events
CA2096843C (en) 1990-11-23 2007-08-07 Kathleen D'halluin Process for transforming monocotyledonous plants
US5324646A (en) 1992-01-06 1994-06-28 Pioneer Hi-Bred International, Inc. Methods of regeneration of Medicago sativa and expressing foreign DNA in same
AU4539593A (en) 1992-06-23 1994-01-24 South Dakota State University Transformation of plants by direct injection of dna
WO1994002620A2 (en) 1992-07-27 1994-02-03 Pioneer Hi-Bred International, Inc. An improved method of agrobacterium-mediated transformation of cultured soybean cells
EP0771878A1 (en) 1995-10-31 1997-05-07 Plant Genetic Systems N.V. Plants with reduced glucosinolate content
GB9525459D0 (en) * 1995-12-13 1996-02-14 Zeneca Ltd Genetic control of fruit ripening
ATE387493T1 (en) * 1997-07-25 2008-03-15 Int Flower Dev Pty Ltd GENES ENCODING PROTEINS WITH TRANSGLYCOLYZING ACTIVITY.
FR2780415A1 (en) * 1998-06-26 1999-12-31 Rhone Poulenc Agrochimie Novel glucosylation process for aromatic compounds to increase genetically modified plants resistance to pathogens

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5985666A (en) * 1995-06-07 1999-11-16 Pioneer Hi-Bred International, Inc. Forages
US5981837A (en) * 1995-12-22 1999-11-09 Purdue Research Foundation Method for regulation of plant lignin composition

Also Published As

Publication number Publication date
GB0002814D0 (en) 2000-03-29
US20030226162A1 (en) 2003-12-04
NO20023739L (en) 2002-10-07
US7335814B2 (en) 2008-02-26
NO20023739D0 (en) 2002-08-07
NZ520251A (en) 2004-02-27
CA2412143A1 (en) 2001-08-16
MXPA02007752A (en) 2004-09-10
EP1254243A1 (en) 2002-11-06
AU784030B2 (en) 2006-01-19
WO2001059140A1 (en) 2001-08-16
CN1404528A (en) 2003-03-19
JP2003522531A (en) 2003-07-29
AU3200601A (en) 2001-08-20
CN1313616C (en) 2007-05-02

Similar Documents

Publication Publication Date Title
US20080209597A1 (en) Transgenic Cells Expressing Glucosyltransferase Nucleic Acids
Jeon et al. Developing xylem‐preferential expression of PdGA20ox1, a gibberellin 20‐oxidase 1 from Pinus densiflora, improves woody biomass production in a hybrid poplar
Bouvier d'Yvoire et al. Disrupting the cinnamyl alcohol dehydrogenase 1 gene (Bd CAD 1) leads to altered lignification and improved saccharification in Brachypodium distachyon
Lee et al. Antisense suppression of 4-coumarate: coenzyme A ligase activity in Arabidopsis leads to altered lignin subunit composition.
US5981837A (en) Method for regulation of plant lignin composition
US20210115462A1 (en) NOVEL MUTANT PLANT CINNAMOYL-CoA REDUCTASE PROTEINS
US7071376B2 (en) Genes encoding p-coumarate 3-hydroxylase (C3H) and methods of use
Möller et al. Gene silencing of cinnamyl alcohol dehydrogenase in Pinus radiata callus cultures
WO2005038004A2 (en) Method to product para-hydroxybenzoic acid in the stem tissue of green plants by using a tissue-specific promter
US20120047600A1 (en) Caffeoyl coa reductase
Sirisha et al. Cloning, characterization and impact of up-and down-regulating subabul cinnamyl alcohol dehydrogenase (CAD) gene on plant growth and lignin profiles in transgenic tobacco
US20100281567A1 (en) Transgenic plants having altered levels of aromatic amino acids and metabolites derived therefrom
AU2004284283B2 (en) Glucosyltransferases
CN101809147A (en) Modified xylan production
US20060150268A1 (en) Plant-derived transferase genes
US20040241850A1 (en) Glucosyltransferases which glucosylate abscisic acid
WO2003106688A1 (en) Glucosyltransferases which clucosylate salicylic acid
WO2004101755A2 (en) Ref1 modified plants and plant seeds
WO2002103022A2 (en) Transgenic cells expressing clucosyltransferases which glucosylate parabenzoic acid
Dixon et al. Plant secondary metabolism: control points and prospects for genetic manipulation of phenylpropanoid biosynthesis
WO2004003208A2 (en) Stress tolerant plant
Zhou et al. Overexpression of the Eucalyptus cinnamoyl-CoA reductase (CCR) gene in Arabidopsis alters lignin content and composition of Arabidopsis stems
AU2010258280A1 (en) Production of plants with reduced lignin content

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION