WO2005040191A2 - Ccn1 compositions and methods - Google Patents

Ccn1 compositions and methods Download PDF

Info

Publication number
WO2005040191A2
WO2005040191A2 PCT/US2004/019766 US2004019766W WO2005040191A2 WO 2005040191 A2 WO2005040191 A2 WO 2005040191A2 US 2004019766 W US2004019766 W US 2004019766W WO 2005040191 A2 WO2005040191 A2 WO 2005040191A2
Authority
WO
WIPO (PCT)
Prior art keywords
ccnl
fragment
modulator
integrin
signaling molecule
Prior art date
Application number
PCT/US2004/019766
Other languages
French (fr)
Other versions
WO2005040191A3 (en
Inventor
Lester F. Lau
Original Assignee
Munin Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Munin Corporation filed Critical Munin Corporation
Priority to EP04809453A priority Critical patent/EP1636251A4/en
Priority to CN2004800232747A priority patent/CN1835763B/en
Publication of WO2005040191A2 publication Critical patent/WO2005040191A2/en
Publication of WO2005040191A3 publication Critical patent/WO2005040191A3/en
Priority to HK07102927.7A priority patent/HK1095743A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/515—Angiogenesic factors; Angiogenin
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants

Definitions

  • the present invention relates to materials and methods involving extracellular matrix signaling molecules in the form of polypeptides involved in cellular responses to growth factors. More particularly, the invention is directed to CCNl -related peptides, compositions thereof, and methods of using these polypeptides. The invention is also directed to anti-CCNl antibodies.
  • Angiogenesis or the formation of new blood vessels from pre-existing ones, is a complex process requiring the coordinated execution of multiple cellular events. See Risau (1997) Nature 386, 671-674. The sprouting of vessels requires degradation of the basement membrane surrounding the parental vessel, migration of vascular endothelial cells towards the angiogenic stimulus, proliferation of endothelial cells and their alignment into tubular structures, and coalescence of new vessels into circular loops to provide blood supply to the target tissue. See Risau. Angiogenesis is essential for embryogenesis, and in the adult, it is important in the female reproductive cycle and in wound healing. Angiogenesis may underlie a number of pathological conditions including diabetic retinopathy, arthritis, arteriosclerosis, psoriasis, and cancer.
  • the CCN family of matricellular proteins are cysteine-rich, secreted proteins that are associated with the extracellular matrix (ECM) but serve regulatory rather than structural functions.
  • Members of the CCN family which include CCNl (CYR61), CCN2 (CTGF), CCN3 (NOV), CCN4 (WISP-1), CCN5 (WISP-2), and CCN6 (WISP-3)(See Brigstock (1999) Endocr.Rev. 20, 189-206; Lau et al. (1999) Exp.Cell Res.
  • CCNl and CCN2 have been most extensively characterized. Both proteins stimulate cell migration, promote cell survival, and augment growth factor-induced mitogenesis. See Kireeva et al. (1991) Exp. Cell Res. 233, 63-77; Jedsadayanmata et al. (1999) JBiolChem. 274, 24321-24327; Babic et ⁇ /. (1999) Mol. Cell Biol 19, 2958-2966; Schober et al. (2002) Blood 99, 4457-4465; Leu et al. (2002) J.BiolChem. 277, 46248-46255.
  • CC ⁇ 1 (cysteine-rich 61, CYR61), an angiogenic inducer encoded by a growth factor- inducible immediate-early gene, is a novel integrin ligand whose expression is essential for proper embryonic development.
  • CCNl cyste-rich 61
  • CYR61 angiogenic inducer encoded by a growth factor- inducible immediate-early gene
  • CC ⁇ 1 Upon synthesis, CC ⁇ 1 is secreted and becomes associated with the cell surface or the ECM. See Yang et al. (1991) Cell Growth & Differentiation 2, 351-357. Previous studies have shown that CC ⁇ 1 supports cell adhesion, induces cell migration, enhances growth factor-induced mitogenesis, and promotes cell survival under apoptotic conditions. See Kireeva et al. (1996) Mol. Cell. Biol. 16, 1326-1334; Leu et al. (2002) J. Biol Chem. 277, 46248-46255. These cellular activities of CC ⁇ 1 can be attributed in part to its ability to interact with integrin adhesion receptors.
  • CC ⁇ 1 induces neovascularization in the rat corneal micropocket assay. See Babic et al. (1998) Proc. Natl.Acad. Sci. U.S.A. 95, 6355-6360. Consistent with these in vivo findings, CC ⁇ 1 promotes tubule formation of human umbilical vein endothelial cells (HUNECs) in a collagen gel assay, and this process is dependent on integrins ⁇ 6 ⁇ and ⁇ v ⁇ 3 . See Leu et al (2002) J. Biol. Chem. 277, 46248-46255.
  • HUNECs human umbilical vein endothelial cells
  • Integrin ⁇ 6 ⁇ has been shown to mediate a number of CCNl activities in several cell types. CCNl supports fibroblast adhesion through interaction with integrin ⁇ 6 ⁇ and cell surface heparin sulfate proteoglycans (HSPGs), leading to extensive formation of filopodia and lamellipodia with ⁇ 6 ⁇ -containing focal complexes localized at leading edges of the pseudopods. See Chen et al. (2001) J.BiolChem. 276, 10443-10452.
  • integrin-dependent outside-in signaling are induced resulting in the activation of focal adhesion kinase, paxillin, Rac, and mitogen-activated protein kinases, and upregulation of several angiogenic regulators. See Chen et al. (2001) J. Biol. Chem. 276, 47329-47337; Chen et al. (2001) J.BiolChem. 276, 10443- 10452.
  • CCNl also interacts with integrin cc ⁇ i on vascular smooth muscle cells and vascular endothelial cells. See Grzeszkiewicz et al. (2002) Endocrinology 143, 1441-1450; Leu et al.
  • CCN2 connective tissue growth factor, CTGF
  • CCN3 nephroblastoma-overexpressed, NON
  • Wnt-inducible secreted proteins CC ⁇ 4 WISP-1
  • CCN5 WISP-2
  • CCN6 WISP-3)(22-24).
  • CCN proteins are organized into four distinct modular domains: I) an insulin-like growth factor binding protein homology domain, II) a von Willebrand factor (vWF) type C repeat domain, III) a thrombospondin type I repeat (TSP1) domain, and IV) a carboxyl terminal (CT) domain with heparin binding motifs and sequence similarities to the C-termini of vWF and mucins (see Fig. 1 A).
  • vWF von Willebrand factor
  • TSP1 thrombospondin type I repeat
  • CT carboxyl terminal
  • HSPGs heparin sulfate proteoglycans
  • activity of CCNl is affected by heparin binding sites HI and H2 as well as Tl.
  • the heparin binding sites HI and H2 are required for prolonged activation of MAPKs as well as upregulation of Vegf and MMP-1 expression, which are relevant to angiogenesis and matrix metabolism.
  • synthetic peptides derived from the Tl sequence specifically block ⁇ 6 ⁇ i -dependent cell adhesion, our newly identified ⁇ 6 ⁇ binding site in CCNl may serve as a basis for the development of antagonists to integrin ⁇ 6 ⁇ .
  • This newly identified ⁇ 6 ⁇ j binding site in CCNl may serve as a basis for the development of antagonists to integrin ⁇ 6 ⁇
  • the present invention provides extracellular matrix (ECM) signaling molecule-related materials and methods.
  • ECM extracellular matrix
  • the present invention is directed to CCNl -related peptides, compositions thereof, and methods of using these polypeptides.
  • the invention is also directed to anti-CCNl antibodies.
  • One aspect of the present invention relates to a CCNl fragment comprising a sequence selected from the group consisting of amino acids 224-240 of murine CCNl, amino acids.231- 240 of murine CCNl, amino acids 226-242 of human CCNl, and amino acids 233-242 of human CCNl.
  • the CCNl fragment may comprise from 8 to 50 amino acids.
  • the present invention also relates to variants, analogs, homologs or derivatives of the CCNl fragments.
  • Another aspect of the present invention relates to a method of screening for a modulator of angiogenesis comprising contacting a test biological sample capable of undergoing angiogenesis with an ECM signaling molecule and a suspected modulator. As a control, a second biological sample is also contacted with an ECM signaling molecule.
  • a modulator of angiogenesis is identified by the ability to alter the level of angiogenesis in the test sample.
  • the ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof.
  • Another aspect of the present invention relates to a modulator identified by the present method.
  • Another aspect of the present invention relates to a method of screening for a modulator of angiogenesis comprising implanting a test implant into a test animal, wherein the test implant comprises a suspected modulator and an ECM signaling molecule.
  • a second implant comprising an ECM signaling molecule is implanted into a test animal, which may be the same animal or a different test animal.
  • a modulator of angiogenesis is identified by its ability to alter the level of blood vessel development in the test implant when compared to the control sample.
  • the ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homo log or a derivative thereof.
  • Another aspect of the present invention relates to a modulator identified by the present method.
  • Another aspect of the present invention relates to a method of screening for a modulator of oncogenesis comprising contacting a tumor with a suspected modulator along with an ECM signaling molecule. As a control, a second tumor is also contacted with an ECM signaling molecule.
  • a modulator of oncogenesis may be identified by its ability to alter the level of oncogenesis of the test tumor when compared to the control tumor.
  • the ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof.
  • Another aspect of the present invention relates to a modulator identified by the present method.
  • Another aspect of the present invention relates to a method of screening for a modulator of cell adhesion comprising contacting a test biological sample on a surface compatible with cell adherence with a suspected modulator along with an ECM signaling molecule. As a control, a second biological sample on a surface compatible with cell adherence is also contacted with an ECM signaling molecule.
  • a modulator of cell adhesion is identified by its ability to alter the level of cell adhesion of the test sample when compared to the control sample.
  • the ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof.
  • Another aspect of the present invention relates to a modulator identified by the present method.
  • Another aspect of the present invention relates to a method of screening for a modulator of cell migration comprising seeding cells capable of undergoing cell migration onto a test gel matrix comprising a suspected modulator and an ECM signaling molecule.
  • a test gel matrix comprising a suspected modulator and an ECM signaling molecule.
  • cells capable of undergoing cell migration are also seeded onto a second biological sample gel matrix comprising an ECM signaling molecule.
  • a modulator of cell adhesion may be identified by its ability to alter the level of cell migration in the test matrix when compared to the control matrix.
  • the ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof.
  • Another aspect of the present invention relates to a modulator identified by the present method.
  • Another aspect of the present invention relates to an antibody that specifically binds to a CCNl fragment, or a variant, analog, homolog or derivative of said CCNl fragment.
  • Another aspect of the present invention relates to a composition comprising an antibody that specifically binds to a CCNl fragment, or a variant, analog, homolog or derivative of said CCNl fragment.
  • Fig. 1 demonstrates the protein purity of recombinant CCNl domain fragments and their ability to support cell adhesion.
  • Recombinant CCNl domain fragments were produced as hexahistidine-tagged fusion proteins by a baculovirus-expression system and purified by chromatography on cobalt-agarose.
  • A a schematic representation of the structural domains of full-length CCNl and the isolated domain fragments. The Tl sequence in domain III (TSP1 domain) is indicated by the shaded area.
  • B recombinant CCNl domain fragments and full-length CCNl (2 ⁇ g) were electrophoresed on 15% SDS-polyacrylamide gel and detected by Coomassie Blue staining.
  • Fig. 2 demonstrates that Domain III (TSP1 domain) of CCNl supports fibroblast adhesion through integrin ⁇ 6 ⁇ .
  • Fibroblast adhesion to microtiter wells coated with full-length CCNl (20 ⁇ g/ml) or domain III fragment (50 ⁇ g/ml ) was performed as described in the legend of Fig. 1. -4, where indicated, cells were suspended in serum-free medium containing EDTA (2.5 mM), Mg ++ (5 mM), Ca "1 ⁇ (5 mM), or Mn ⁇ (0.5 mM) before plating.
  • EDTA 2.5 mM
  • Mg ++ 5 mM
  • Ca "1 ⁇ 5 mM
  • Mn ⁇ 0.5 mM
  • FIG. 3 demonstrates that recombinant GST-T1 fusion protein supports ⁇ 6 ⁇ j-dependent fibroblast adhesion.
  • A Microtiter wells were coated with 200 ⁇ g/ml recombinant GST-peptide fusion proteins with their sequences shown in Table I. Protein coating was performed overnight at 4°C followed by blocking with 1% BSA. Fibroblast adhesion was assessed as described in the legend of Fig. ⁇ .
  • Fig. 4 demonstrates that synthetic Tl peptide supports ⁇ 6 ⁇ i -dependent cell adhesion.
  • A microtiter wells were coated with synthetic Tl, T2, T3, or T4 peptides (0.2 mM) overnight at 4°C and blocked with 1% BSA. Fibroblast were allowed to adhere to the peptide-coated wells for 20 min at 37°C.
  • B cells were preincubated with vehicle buffer (No Add) or the indicated monoclonal antibodies for 60 min prior to plating onto Tl-coated wells. Data are means ⁇ S.D. of triplicate determinations and are representative of three experiments.
  • Fig. 5 demonstrates that soluble Tl peptide inhibits ⁇ 6 ⁇ -dependent cell adhesion.
  • A microtiter wells were coated with CCNl (1 ⁇ g/ml), CCN2 (2 ⁇ g/ml), or CCN3 (5 ⁇ g/ml) and blocked with 1% BSA. Washed fibroblasts were pre-treated with vehicle buffer (No Add) or with soluble Tl, T2, T3 or T4 peptides (0.2 mM) for 30 min and plated onto wells coated with the indicated CCN proteins.
  • Tl peptide various concentrations were added to the cell suspension prior to plating onto wells coated with fibronectin (FN, 2 ⁇ g/ml), vitronectin (VN, 0.4 ⁇ g/ml), type I collagen (0.5 ⁇ g/ml), laminin (LN, 5 ⁇ g/ml) or CCNl (1 ⁇ g/ml).
  • Recombinant murine CCNl protein was purified from serum-free insect cell conditioned media using the baculovirus expression system as described. See Kireeva et al. (1996) Mol Cell. Biol. 16, 1326-1334. Rat Type I collagen, vitronectin, laminin, and fibronectin were purchased from Collaborative Biomedical (Bedford, MA). Cell adhesion was assayed as described in the legend of Fig. 1. Data are means ⁇ S.D. of triplicate determinations and are representative of three experiments.
  • Fig. 6 demonstrates that the TTSWSQCSKS sequence in Tl contains critical determinants for ⁇ 6 ⁇ i -dependent cell adhesion.
  • Site-directed alanine substitutions of the Tl sequence in the Tl-GST fusion protein were performed as described in Materials and Methods. Wild type Tl fusion protein (GST-Tl-WT), its scrambled variant (GST-Tl -Scram) or the alanine substituted mutants was coated onto microtiter wells at a protein concentration of 200 ⁇ g/ml. After blocking with 1% BSA, fibroblast adhesion proceeded as described. Results are means ⁇ S.D. of triplicate determinations and are representative of three experiments.
  • Fig. 7 demonstrates affinity purification of integrin 6 ⁇ from fibroblast lysates on GST- Tl -coupled Affi-gel.
  • Cell surface proteins on fibroblasts were radio-iodinated by the lactoperoxidase-glucose oxidase method as described in Materials and Methods. Labeled cells were solubilized in starting buffer containing 200 mM octylglucoside and 0.5 mM Mxi *.
  • the cell lysates (lane 1) were applied to affinity columns of Affi-gel agarose coupled with GST- scrambled Tl in A or GST-Tl in B.
  • Fig. 8 demonstrates that the Tl peptide blocks CCNl -induced endothelial tubule formation in a collagen gel matrix.
  • Unstimulated HUVECs were plated on 24-well plates precoated with type I collagen gels (2 mg/ml) in the absence (No Add) or presence of 50 ⁇ g/ml CCNl, and a second layer of gels was overlaid on the attached cells as described in Materials and Methods. Where indicated, cell suspension was incubated with the tested peptides for 30 min prior to plating. Tubule formation was assessed 16-20 h thereafter. Results are representative of three separate experiments (magnification x 100).
  • FIG. 9 depicts the construction and expression of CCNl and mutants.
  • WT wild type CCNl
  • mutants either bearing the K239E point mutation in Tl (SM), disruptions in HI and H2 (DM), or combined mutations in Tl, HI, and H2 (TM).
  • SM K239E point mutation in Tl
  • DM disruptions in HI and H2
  • TM combined mutations in Tl, HI, and H2
  • Each construct is similarly endowed with an N-terminal secretory signal and a C-terminal FLAG epitope tag.
  • Recombinant proteins were expressed in insect cells via a baculovirus vector. Wild type Tl, HI, and H2 sequences and specific a.a. changes in the mutants are shown.
  • fibroblasts were plated on microtiter wells coated with either GST, GST-Tl peptide fusion, or GST-Tl (K239E) peptide fusion protein (50 ⁇ g/ml each). Cells were allowed to adhere at 37°C for 20 min. After washing, adherent cells were fixed, stained with methylene blue, and quantified by absorbance at 620 nm.
  • C Coomassie brilliant blue stained 10% SDS-PAGE in which FLAG affinity-purified recombinant proteins (2 ⁇ g each) were electrophoretically separated. Molecular mass (kDa) of markers are shown at left. The gel was immunoblotted with polyclonal anti-CCNl antibodies and shown in the lower panel.
  • Fig. 10 demonstrates that fibroblast adhesion to mutant SM is heparin-sensitive.
  • A,1064SK human fibroblasts were plated on microtiter wells coated with the indicated amounts of recombinant WT CCNl or SM mutant, and cell adhesion was assessed as described in Fig. 1.
  • B, fibroblasts were untreated, or treated with either heparinase I (2 units/ml) or chondroitinase ABC (2 units/ml) prior to adhesion to microtiter wells coated with WT CCNl (2 ⁇ g/ml), SM (2 ⁇ g/ml) or VN (0.5 ⁇ g/ml). Where indicated, soluble heparin was present at 1 ⁇ g/ml in the culture medium. Data shown are mean ⁇ S.D. of three determinations and representative of three experiments.
  • Fig. 11 demonstrates DM supported Qfe/3 1 -mediated cell adhesion.
  • A fibroblasts were plated on microtiter wells coated with the indicated amounts of DM or TM and cell adhesion was evaluated.
  • B cells were preincubated with 40 ⁇ g/ml of function-blocking mAb against integrin ⁇ vi ⁇ 3 (LM609), integrin a (GoH3), or integrin ⁇ subunit (P4C10, 1:50 ascites) at room temperature for 1 h prior to plating. Cell adhesion was assessed as above. Data shown are mean ⁇ S.D. of three determinations and representative of three experiments. [0028] Fig.
  • Clarified lysates were separated on 10% SDS-PAGE, and i munoblotted with polyclonal anti-MAPK antibodies, or antibodies against dually phosphorylated active p42/p44 MAPKs.
  • B regulation of gene expression.
  • Primary human skin fibroblasts were serum-starved 24 hours before being treated with 10 ⁇ g/ml each of WT CCNl (WT), mutant proteins (SM, DM and TM), or BSA control (B) for 24 hours and total cellular RNA was isolated.
  • Vegf and MMP-1 were evaluated by RNA blotting (20 ⁇ g of total RNA in each lane) following electrophoresis, and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was monitored as a control.
  • Glyceraldehyde 3-phosphate dehydrogenase Glyceraldehyde 3-phosphate dehydrogenase
  • Fig. 13 demonstrates HUVEC adhesion and migration to CCNl mutants through integrin , ⁇ 3 .
  • A HUVECs detached in 2.5 mM EDTA and resuspended in serum-free medium were adhered to wells pre-coated with 15 ⁇ g/ml of CCNl wild type CCNl (WT) or SM, or 50 ⁇ g/ml of DM or TM.
  • Fig. 14 demonstrats that CCNl mutants may enhance VEGF-induced DNA synthesis through integrin ⁇ v /3 3 .
  • HUVECs were preincubated with vehicle buffer (No Add), LM609 (25 ⁇ g/ml), GoH3 (25 ⁇ g/ml), or normal mouse IgG (25 ⁇ g/ml) for lh.
  • Cells were then treated with VEGF (5 ng/ml) and/or CCNl or mutant proteins (5 ⁇ g/ml each) in the presence of [ 3 H]thymidine, incorporation of which was assessed 48 h thereafter.
  • Data shown are mean ⁇ S.D. of three determinations and representative of three experiments.
  • Fig. 15 demonstrates that CCNl mutants may promote HUVEC survival.
  • Serum-starved HUVECs were allowed to attach to coverslips pre-coated with 20 ⁇ g/ml laminin (LN) for 4 hr, followed by addition of serum, CCNl or mutant proteins (5 ⁇ g/ml each) for an additional 16 h.
  • Cells were fixed and apoptosis was monitored by using a TUNEL assay.
  • polyclonal anti-CCNl antibodies were preincubated with test reagents for 30 min prior to addition into medium. Data shown are mean ⁇ S.D. of three determinations and representative of three experiments.
  • Fig. 16 demonstrates that CCNl mutants may induce integrin ⁇ v /3 3 -dependent endothelial tubule formation.
  • HUVECs were either treated with vehicle buffer (no add) or stimulated with 5 nM PMA in serum-free medium before being plated on 24-well plates pre-coated with type I collagen gel (2 mg/ml) in the absence (-) or presence of CCNl (WT) or TM (20 ⁇ g/ml each).
  • WT CCNl
  • TM 20 ⁇ g/ml each
  • a second layer of gel of identical formulation was overlaid on the attached cells, and tubule formation was assessed 16 h thereafter.
  • LM609 40 ⁇ g/ml
  • GoH3 40 ⁇ g/ml
  • CCNl is an angiogenic inducer that plays an essential role in normal vascular development during embryogenesis. See Mo et al. (2002) Mol. Cell Biol. 22, 8709-8720. See also U.S. Pat. No. 6,413,735, and U.S. Application Serial No. 09/495,448 (allowed), both- incorporated herein by reference. We have recently shown that the proangiogenic activities of CCNl are mediated through integrins 6 ⁇ i and ⁇ v ⁇ in unactivated and activated HUVECs, respectively. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255.
  • administer means a single dose or multiple doses of a composition of the present invention.
  • the term "treat” or "treating" when referring to protection of a mammal from a condition means preventing, suppressing, repressing, or eliminating the condition.
  • Preventing the condition involves administering a composition of the present invention to a mammal prior to onset of the condition.
  • Suppressing th econdition involves administering a composition of the present invention to a mammal after induction of the condition but before its clinical appearance.
  • Repressing the condition involves administering a composition of the present invention to a mammal after clinical appearance of the condition such that the condition is reduced or maintained.
  • Elimination of the condition involves administering a composition of the present invention to a mammal after clinical appearance of the condition such that the mammal no longer suffers the condition.
  • Tl sequence as an integrin ⁇ 6 ⁇ binding site in CCNl based on the following observations: 1) a Tl-GST fusion protein and a synthetic Tl peptide specifically support ⁇ 6 ⁇ dependent cell adhesion (Figs. 3 and 4); 2) integrin ⁇ 6 ⁇ is purified from a detergent lysate of fibroblasts on a Tl-GST affinity matrix, demonstrating direct interaction between integrin ⁇ 6 ⁇ j and the Tl sequence (Fig.
  • soluble Tl peptide inhibits cell adhesion to ⁇ 6 ⁇ ligands including CCNl, CCN2, CCN3 and laminin, but not to other integrin ligands such as fibronectin, vitronectin and collagen (Fig. 5); and 4) Tl peptide also blocks ⁇ 6 ⁇ i-dependent tubule formation of unactivated HUVECs in a collagen matrix containing CCNl (Fig. 8). It is noteworthy that soluble Tl peptide is an effective inhibitor on ot ⁇ i -dependent cellular activities. Half maximal inhibition of cell adhesion occurs at a peptide concentration of 25-50 mM (Fig. 5C).
  • the inhibitory potency of Tl is comparable to linear RGD peptides that inhibit adhesive functions of other integrins, such as ⁇ v ⁇ , also at the micromolar range. See Ruoslahti (1996) Ann. Rev. CellDev. Biol. 12, 697-715.
  • mutants disrupted at the HI and H2 sites could support fibroblast adhesion only at an elevated concentration
  • mutants disrupted only at the Tl site were still able to support fibroblast adhesion at a level near that of the wild type.
  • Heparin binding at HI and H2 of CCNl may also be shown to affect the sustained activation of p42/p44 MAPKs.
  • TTSWSQCSKS C- terminal portion of Tl
  • T231A/T232A and W234A/K239A substitutions that result in complete loss of its capacity to support cell adhesion.
  • This 10-residue segment is highly conserved among other CCN family members with only two non-conserved substitutions among CCNl, CCN2 and CCN3. Therefore, it is conceivable that 6 ⁇ also binds to the corresponding Tl sequences in other CCN proteins.
  • Integrin ⁇ 6 ⁇ has a limited ligand spectrum that includes laminin, CCN proteins, invasin, fertilin and a collagen fragment known as tumstatin. See Sonnenberg et al. 1990) J. Cell Biol. 110, 2145-2155; Maeshima et al. (2001) JBiolChem. 216, 15240-15248; Isberg et al. (1990) Cell 60, 861-871; Almeida et al. (1995) Cell 81, 1095-1104. These diverse ⁇ 6 ⁇ ⁇ ligands that are involved in various biological processes are not structurally related.
  • ⁇ 6 ⁇ j binding sequences have been identified by screening synthetic peptides derived from some of these ⁇ 6 ⁇ ligands. These include the NPWHSIYITRFG and TWYKIAFQRNRK sequences from the laminin al chain. See Sonnenberg et al. 1990) J. Cell Biol 110, 2145-2155; Nomizu t ⁇ /. (1995) J. Biol. Chem. 270, 20583-20590; Nakahara et al. (1996) J. Biol. Chem. 271, 27221- 27224.
  • TDE-containing peptides from the disintegrin domain of the fertilin b subunit disrupt sperm-egg fusion presumably by blocking integrin ⁇ g ⁇ i-fertilin interaction.
  • Several other ⁇ 6 ⁇ j binding peptides have also been isolated by screening phage display and synthetic peptide combinatorial libraries; however, these sequences are not present in any known ⁇ 6 ⁇ ligand. See Murayama et al. (1996) J. Biochem. (Tokyo) 120, 445-451; Pennington et ⁇ /. (1996) Mol.Divers.
  • CCNl is an activation-independent ligand of integrin ⁇ 6 ⁇ in non-stimulated endothelial cells, mediating both cell adhesion and tubule formation through this integrin receptor. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255. Whereas intact CCNl is an angiogenic inducer, the Tl peptide acts as an ⁇ 6 ⁇ ! antagonist to block CCN1- induced tubule formation of unactivated endothelial cells.
  • thrombospondin is an inhibitor of angiogenesis with its anti-angiogenic activity being localized to the procollagen homology region and the properdin-like type 1 repeat.
  • a number of anti-angiogenic peptides have been derived from thrombospondin, including the CSVTCG-containing peptides that interact with CD36 on endothelial cells. See Jimenez et al. (2000) Nat. Med. 6, 41-48; Dawson et al. (1997) J. Cell Biol. 138, 707-717.
  • CD36 Interaction of CD36 with the TSP1 domain of CCN proteins has not been demonstrated; however, CD36 has been shown to associate with integrin ⁇ 6 ⁇ on human platelets and melanoma cells. Miao et al. (2001) Blood 91, 1689-1696; Thome et al. (2000) J. Biol Chem. 275, 35264-35275. If the CD36- ⁇ 6 ⁇ complex also exists on endothelial cells, it is an intriguing possibility that these two cell surface receptors may act in concert to regulate angiogenesis through interaction with proximal recognition sequences in the thrombospondin type 1 repeat of matricellular proteins.
  • the present invention relates to peptide fragments ' of CCNl that modulate the activity of CCNl .
  • the peptides may be used in therapeutic strategies designed to inhibit or induce the activity of CCNl .
  • the peptides may be natural, synthetic or recombinant.
  • One approach is to produce a peptide comprising a sequence selected from the group consisting of: amino acids 224- 240 of murine CCNl, amino acids 231-240 of murine CCNl, amino acids 226-242 of human CCNl, and amino acids 233-242 of human CCNl.
  • a peptide comprising conserved amino acids may compete with native CCNl for its binding sites on integrins and other proteins.
  • the present invention also relates to fragments of the CCNl fragments.
  • the peptides may be from 8 to 50 amino acids in length.
  • the inhibitory peptides may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 amino acids in length.
  • the peptides may also be homologs of the above-described CCNl peptides. Homologs of the CCNl peptides are peptides sharing a common evolutionary with CCNl.
  • the peptides may also be variants of the above-described CCNl peptides and homologs. peptide variants are peptides that differ in amino acid sequence from a native CCNl peptide by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity of a native CCNl peptide.
  • biological activity of a CCNl peptide includes, but is not limited to, the above-described activities of full-length CCNl, the ability to modulate activities of CCNl and the ability to be bound by an antibody specific for CCNl.
  • a conservative substitution of an amino acid i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophihcity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids, as understood in the art. Kyte et al, J. Mol. Biol. 757.105-132 (1982). A listing of the hydropathic indices of amino acids may be found in U.S. Pat. No. 6,639,054, which is incorporated herein by reference.lt is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of ⁇ 2 are substituted.
  • hydrophihcity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function.
  • a consideration of the hydrophihcity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophihcity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity.
  • a listing of hydrophihcity indices of amino acids may be found in U.S. Patent No. 4,554,101, which is incorporated herein by reference.
  • Substitution of amino acids having similar hydrophihcity values can result in peptides retaining biological activity, for example immunogenicity, as is understood in the art.
  • substitutions are performed with amino acids having hydrophihcity values within ⁇ 2 of each other.
  • Both the hyrophobicity index and the hydrophihcity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophihcity, charge, size, and other properties.
  • the peptides may also be analogs of the above-described CCNl peptides, homologs and variants comprising non-standard amino acid or other structural variation from the conventional set of amino acids.
  • the peptides may also be derivatives of the above-described CCNl peptides, homologs, variants and analogs that differ in ways other than primary structure (amino acids and amino acid analogs).
  • derivatives may differ from native CCNl peptides, homologs and variants by being glycosylated, one form of post-translational modification.
  • polypeptides may exhibit glycosylation patterns due to expression in heterologous systems.
  • these peptides retain at least one biological activity of native CCNl, then these peptides are CCNl derivatives according to the invention.
  • Other derivatives include, but are not limited to, fusion peptides having a covalently modified N- or C-terminus, PEGylated peptides, peptides associated with lipid moieties, alkylated peptides, peptides linked via an amino acid side-chain functional group to other peptides or chemicals, and additional modifications as would be understood in the art.
  • the invention contemplates CCN1- related peptides that bind to a CCNl receptor, as described below.
  • the various peptides of the present invention may be provided as discrete peptides or be linked, e.g., by covalent bonds, to other compounds.
  • immunogenic carriers such as Keyhole Limpet Hemocyanin may be bound to a CCNl peptide of the invention.
  • the various fragments, variants, analogs, homologs or derivatives described above maybe 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the peptides.
  • the present invention is also related to isolated nucleic acids encoding the peptides.
  • the present invention also involves a pharmaceutical composition comprising peptides of the present invention.
  • the present invention also involves a pharmaceutical composition
  • a pharmaceutical composition comprising an ⁇ antibody that specifically binds to the CCNl peptides of the present invention and a pharmaceutically acceptable adjuvant, diluent, or carrier.
  • the antibody may be produced as described below, or as described in WO 01/55210, the contents of which are hereby inco ⁇ orated by reference in their entirety.
  • the antibodies of the present invention include antibodies of classes IgG, IgM, IgA, IgD, and IgE, and fragments and derivatives thereof including Fab and F(ab') 2 .
  • the antibodies may also be recombinant antibody products including, but not limited to, single chain antibodies, chimeric antibody products, "humanized” antibody products, and CDR-grafted antibody products.
  • the antibodies of the present invention include monoclonal antibodies, polyclonal antibodies, affinity purified antibodies, or mixtures thereof which exhibit sufficient binding specificity to the CCNl fragments.
  • antibody fragments are also contemplated by the invention.
  • the antibody products include the aforementioned types of antibody products used as isolated antibodies or as antibodies attached to labels.
  • Labels can be signal-generating enzymes, antigens, other antibodies, lectins, carbohydrates, biotin, avidin, radioisotopes, toxins, heavy metals, and other compositions known in the art; attachment techniques are also well known in the art.
  • Anti-CCNl antibodies are useful in diagnosing the risk of oncogenesis.
  • anti- CCN1 antibodies may be used in therapies designed to deliver specifically-targeted cytotoxins to cells expressing CCNl, e.g., cells participating in the neovascularization of solid tumors. These antibodies are delivered by a variety of administrative routes, in pharmaceutical compositions comprising carriers or diluents, as would be understood by one of skill in the art.
  • the present invention involves screening for modulators of activities associated with CCNl.
  • Modulators may be identified that interact with the integrin binding site of CCNl, thereby preventing CCNl from interacting with target integrins and other proteins.
  • Modulators may also be identified that directly bind to targets integrins and other proteins of CCNl, thereby preventing CCNl from productively interacting with said target integrins and other proteins.
  • Modulators may also be identified which indirectly affect binding of CCNl to target proteins.
  • an "ECM signaling molecule” refers to a CCNl fragment described above.
  • the use of “ECM signaling molecule” also contemplates one or more additional CCN polypeptides.
  • the one or more additional CCN polypeptides include, but are not limited to, CCNl, CCN2, CCN4, CCN5 and CCN6, as well as fragments, variants, analogs, homologs or derivatives of said one or more additional CCN polypeptides.
  • the methods of the present invention relate to screening for a modulator of angiogenesis.
  • a biological sample capable of undergoing angiogenesis is contacted with a suspected modulator in vitro along with an ECM signaling molecule.
  • a second biological sample is also contacted with an ECM signaling molecule.
  • a modulator of angiogenesis may be identified by its ability to alter the level of angiogenesis of the test sample when compared to the control sample.
  • an implant comprising a suspected modulator and an ECM signaling molecule is implanted into a test animal.
  • a second implant comprising an ECM signaling molecule is implanted into a test animal, which may be the same animal or a different test animal.
  • a modulator of angiogenesis may be identified by its ability to alter the level of blood vessel development in the test implant when compared to the control sample.
  • the methods of the present invention also relate to screening for a modulator of oncogenesis.
  • a tumor is contacted with a suspected modulator along with an ECM signaling molecule.
  • a second tumor is also contacted with an ECM signaling molecule.
  • a modulator of oncogenesis may be identified by its ability to alter the level of oncogenesis of the test tumor when compared to the control tumor.
  • the methods of the present invention also relate to screening for a modulator of cell adhesion.
  • a biological sample on a surface compatible with cell adherence is contacted with a suspected modulator along with an ECM signaling molecule.
  • a second biological sample on a surface compatible with cell adherence is also contacted with an ECM signaling molecule.
  • a modulator of cell adhesion may be identified by its ability to alter the level of cell adhesion of the test sample when compared to the control sample. d.
  • the methods of the present invention also relate to screening for a modulator of cell migration.
  • Cells capable of undergoing cell migration are seeded onto a gel matrix comprising a suspected modulator and an ECM signaling molecule.
  • As a control cells capable of undergoing cell migration are also seeded onto a second biological sample gel matrix comprising an ECM signaling molecule.
  • a modulator of cell adhesion may be identified by its ability to alter the level of cell migration in the test matrix when compared to the control matrix.
  • the present invention also involves modulators of CCNl activity identified using the above-described screening methods.
  • the identified modulators of CCNl activity may be formulated in a pharmaceutical composition comprising a pharmaceutically acceptable adjuvant, diluent, or carrier.
  • the pharmaceutical composition comprising the modulator of CCNl activity may be administered to a patient for the treatment of disease associated with angiogenesis, oncogenesis, or chondrogenesis.
  • the pharmaceutical composition may be administered alone or in combination with other compositions, such as a chemotherapeutic.
  • Compositions of the present invention may be administered in a standard manner including, but not limited to, orally, parenterally, sublingually, transdermally, rectally, . transmucosally, topically, via inhalation, or via buccal administration.
  • Parenteral administration includes, but is not limited to, intravenous, intraareterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intraarticular.
  • Example 1 discloses that domain III of CCNl supports ⁇ 6 ⁇ i -dependent cell adhesion.
  • Example 2 discloses that the Tl sequence in domain III of CCN contains an integrin 6 ⁇ binding site.
  • Example 3 describes the effect of soluble Tl peptide on ct ⁇ -i -dependent cell adhesion.
  • Example 4 describes the effect of alanine substitutions in the Tl sequence on cell adhesion.
  • Example 5 describes affinity purification of integrin ⁇ gft using a Tl -coupled affinity matrix.
  • Example 6 describes the effect of soluble Tl peptide on
  • Example 7 describes the construction of mutant peptides inactivated at Tl binding site for integrin
  • Example 8 describes evaluation of adhesion of mutant CCNl peptide inactivated at Tl binding site for integrin c ⁇ ⁇ .
  • Example 9 describes construction of mutant CCNl inactivated at Tl binding site for integrin
  • Examples 10-14 describe cell adhesive properties of CCNl mutants.
  • Example 10 describes an
  • Example 11 describes an SM Assay using a disrupted Tl binding site, with inhibition of heparin binding sites.
  • Example 12 describes a DM assay using an uninterrupted Tl binding site with a disrupted heparin binding site.
  • Example 13 describes a TM assay using a disrupted Tl binding site, and a disrupted heparin binding site.
  • Example 14 describes the use of anti-integrins to evaluate cell adhesion of DM.
  • Examples 15-16 describe the effect of disruption of HI and H2 on CCN1- dependent MAPK activation and regulation of gene expression.
  • Example 15 describes MAPK activation.
  • Example 16 describes regulation of gene expression.
  • Examples 17-21 describe the dissociation of CCNl activities mediated through ⁇ v /3 3 and a$ ⁇ ⁇ -HSPGs.
  • Example 17 describes
  • Example 18 describes migration of HUVECS to CCNl or mutants.
  • Example 19 describes enhancement of VEGF- induced DNA Synthesis through integrin c ⁇ ft-
  • Example 20 describes the effect of CCNl mutants on HUVEC survival.
  • Example 21 describes tubule formation.
  • PCR products were digested with BamHl and EcoRl, and ligated into pMelBac B.
  • Each expressed recombinant polypeptide contained the V5 epitope and a polyhistidine tag at the C-terminus, and was purified from Sf9 cells using a serum-free baculovirus expression system as described. See Grzeszkiewicz et al (2001) JBiol. Chem. 276, 21943-21950.
  • EX-CELL 400 medium JRH Biosciences, Lenexa, KS
  • EX-CELL 400 medium JRH Biosciences, Lenexa, KS
  • the collected medium was cleared by centrifuge and subsequently concentrated by 10-15 folds using the Biomax-5 centrifugal filter (Millipore, Billerica, MA), and dialyzed against native buffer (50 mM sodium phosphate and 10 mM Hepes at pH 7.4, 0.5 M NaCl) overnight at 4°C and then applied to a TALON cobalt-agarose column (Clontech, Palo Alto, CA).
  • the column was washed with native binding buffer at pH 7.0, before being eluted in 50 mM phosphate at pH 7.0, 0,3 M NaCl, and 150 mM imidazole. Products were analyzed by SDS- PAGE followed by Coomassie Brilliant Blue staining and immunoblotting. The pooled fractions for each domain fragment were dialyzed against 20 mM Hepes at pH 7.4, 150 mM NaCl overnight at 4°C to remove imidazole. Each domain fragment had the expected molecular mass ( ⁇ 11 kDa, 18 kDa, and 9 kDa for domains I, II, and III, respectively), and were immunoreactive with an anti-CCNl polyclonal antibody (Fig. IB and C).
  • CCNl domain polypeptides were covalently linked to maleic anhydride Reacti-Bind microtiter plates (Pierce, Rockford, IL) at 4°C overnight followed by blocking with BSA at 37°C for 2 h.
  • Cell adhesion was conducted using washed subconfluent cells resuspended in serum-free basal medium at 5 x 10 5 cells/ml as described. See Chen et al. (2001) JBiolChem. 276, 10443-10452. Where indicated, cells were preincubated with EDTA, peptides, or function-blocking mAbs for 30 min prior to plating.
  • Microtiter wells were coated with hexahistadine-tagged proteins or BSA (50 ml/well) overnight at 4°C, followed by blocking with 1% BSA for 2 h at room temperature. Protein coating efficiency was examined by incubation with an anti-polyhistidine mAb (Invitrogen) (2 h at 37°C) followed by an horseradish peroxidase-conjugated secondary antibody (Amersham Pharmacia Biotech- Piscataway, NJ) (1 h at 37°C). The color reaction was developed and quantified by A 420 measurements.
  • PCR products were purified on polyacrylamide gels, digested with BamHI and EcoRI, and ligated into the pG ⁇ X-4T-2 vector (Amersham Pharmacia Biotech). All cloning steps were confirmed by sequence analysis.
  • GST-peptide fusion proteins were produced in E. coli strain BL21 and purified by glutathione affinity chromatography (Amersham Pharmacia Biotech), followed by extensive dialysis against PBS overnight at 4°C.
  • fusion proteins were purified to near homogeneity, and had similar levels of coating efficiency in microtiter wells as detected by ELISA using an anti-GST antibody (data not shown).
  • the ability of each peptide-GST fusion protein to support fibroblast adhesion was assessed. Only one peptide-fusion protein, namely Tl from Domain III, was able to support cell adhesion (Fig. 3 A). Again, fibroblast adhesion to Tl-GST was inhibited by EDTA and Ca " " " , and promoted by Mn* " in the assay media (Fig. 3B).
  • Tl-GST cell adhesion to Tl-GST was blocked by preinbubation of cells with anti-a 6 (GoH3) or anti-bt (P4C10) mAb, but unaffected by other integrin-disrupting agents such as GRGDSP peptide (Life Technologies/Gibco-BRL) or anti- v ⁇ 3 (LM609) (Fig. 3C), indicating that the Tl-GST fusion protein supports the adhesion of fibroblasts through integrin 6 ⁇ ! .
  • Tl-GST also supported ⁇ 6 ⁇ j-mediated cell adhesion in other cell types, including endothelial cells, smooth muscle cells, and PC3 prostate cancer cells (data not shown).
  • Tl sequence contains a binding site for integrin ⁇ 6 ⁇ l5
  • four peptides spanning the CCNl domain III (Table 1) were synthesized and tested for the abilities to support cell adhesion.
  • the synthetic peptides were prepared by ResGen Inc. (Huntsville, AL), followed by purification on reverse-phase high performance liquid chromatography and analysis by mass spectroscopy. Similar to the results obtained with GST-peptide fusion proteins, synthetic Tl peptide, but not the other 3 peptides (T2, T3 and T4), supported fibroblast adhesion (Fig. 4A).
  • Tl contains an integrin ⁇ 6 ⁇ i binding site.
  • soluble Tl peptide is capable of blocking cell adhesion to substrates known to bind integrin ⁇ 6 ⁇ -
  • addition of 0.2 mM Tl to the cell suspension effectively blocked fibroblast adhesion to CCNl, whereas T2, T3, or T4 had no effect.
  • the inhibitory effect of Tl on cell adhesion to CCNl was dose-dependent, achieving maximal inhibition at 100 ⁇ M (Fig. 5C).
  • CCN2 CCN2
  • CCN3 NOV
  • Fig. 5A shows that Tl also specifically inhibited cell adhesion to CCN2 and CCN3, suggesting that the Tl sequence in CCN proteins is a common binding site for integrin ⁇ 6 ⁇ .
  • Tl had no significant effect on the adhesion of fibroblasts to fibronectin (ligand of integrin ⁇ 5 ⁇ ), vitronectin (ligand of a v integrins), and collagen (ligand of ⁇ -integrins) (Fig. 5B).
  • Fig. 5C cell adhesion to CCNl
  • a known ligand for integrin 6 ⁇ 1? was partially inhibited by the Tl peptide (-15 %).
  • Tl peptide binds directly to integrin ⁇ 6 ⁇
  • affinity chromatography using cell surface proteins on fibroblasts to isolate integrin ⁇ 6 ⁇ on a Tl- coupled affinity column.
  • Subconfluent 1064SK fibroblasts were detached with 2 mM EDTA and 0.05%BSA in PBS, washed thrice and resuspended in PBS containing 20 mM glucose at 2 x 10 7 cells/ml.
  • the cell suspension was incubated with 100 mU/ml glucose oxidase, 200 mg/ml lactoperoxidase (Calbiochem-Novabiochem, La Jolla, CA), and -400 mCi/ml carrier-free Na 125 I (Amersham Pharmacia Biotech) for 30-60 min at 4°C with gentle rotation.
  • 10 ml cell culture medium was added.
  • the labeled cells were washed and solubilized in 1 ml of lysis buffer (50 mM Hepes, pH 7.4, 200 mM octyl-b-D- glucopyranoside, proteinase inhibitor cocktail, and 0.5 mM Mn ).
  • GST-Tl or GST-scrambled Tl protein was coupled to Affi-Gel 10 (Bio-Rad Laboratories, Hercules, CA) at 10 mg/ml gel suspension.
  • the labeled cell lysates were applied onto the affinity matrices (3 ml ml gel) and incubated for 2 h at 4 C.
  • the columns were washed with 30 column volumes of lysis buffer followed by elution with 0.35 M NaCl in the lysis buffer.
  • the labeled proteins in the eluted fractions were analyzed by electrophoresis on 7% polyacrylamide gels under non-reducing conditions followed by autoradiography.
  • labeled proteins were incubated with 5 mg anti-a 6 (GoH3) or anti-a v (P3G8) mAbs (Chemicon, Temecula, CA) as indicated.
  • the immunoprecipitated proteins were collected on protein G- Sepharose and resolved on 7% polyacrylamide gels under non-reducing conditions.
  • a control column was prepared using GST fused to a scrambled Tl sequence, and no labeled protein band was eluted from the scrambled Tl-GST column (Fig.- 7A).
  • Tl-GST affinity column two protein bands with apparent molecular weights corresponding to integrin a 6 (-150 kDa) and b (-130 kDa) subunits were eluted at 0.35 M NaCl (lanes 5-7, Fig. 7B).
  • CCN proteins including CCNl, CCN2, and CCN3 are potent angiogenic inducers. See Babic et al. (1998) Proc. Natl.Acad. Sci. U.S.A. 95, 6355-6360; Lin et al. (2003) J.BiolChem. In press; Babic et al. (1999) Mol.CellBiol 19, 2958-2966. Furthermore, when formulated into collagen gel, CCNl is capable of inducing tubule formation of unactivated human umbilical vein endothelial cells (HUVECs), and this process is blocked by the anti-a 6 mAb GoH3. See Leu et al. (2002) J. Biol. Chem.
  • Tl sequence represents a major binding site for integrin ⁇ 6 ⁇ in CCNl
  • human umbilical vein endothelial cells (HUVECs) were examined in a three-dimensional collagen gel in the presence or absence of test proteins or peptides as described. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255.
  • Mouse CCNl engineered with a C-terminal FLAG tag was constructed by using the primer sets upon the mouse Ccnl cDNA as template
  • PCR product containing the last codon of Ccnl followed by the FLAG tag coding sequence and a stop codon.
  • the PCR product was double digested with Ncol and EcoRI, and ligated into pre-cut vector to substitute the Ncol, Ec ⁇ RI-digested fragment of the full-length mouse Ccnl cD ⁇ A in pBlueBac4.5 vector (Grzeszkiewicz, T. M., Kirschling, D. J., Chen, ⁇ ., and Lau, L. F. (2001) J. Biol. Chem. 276, 21943-21950).
  • WT CC ⁇ 1 and all mutants used in this study were similarly constracted with the same ⁇ -terminal secretory signal and C-terminal FLAG epitope tag.
  • This construct also created a silent mutation at C237, thereby providing a screening marker by eliminating a BSP12861 restriction site.
  • the outside primers used in PCR were FI and F2 as described in Example Ai above.
  • SM was constructed using the mouse Ccnl cDNA with a FLAG tag as PCR template.
  • SM may still support cell adhesion through the cts ⁇ -HSPGs coreceptors, indicating that there may be other potential ⁇ ei ⁇ HSPG-bindmg sites not yet identified, or that the HI and H2 heparin binding sites may be sufficient to support cell adhesion through the coreceptor complex.
  • SM retains intact heparin binding sites
  • Control cells were left untreated. Where indicated, soluble heparin was present at 1 ⁇ g/ml in the culture medium.
  • DM has lost heparin binding activity but retains the Tl binding site, we postulated that DM would be compromised in ⁇ 6 /3 ⁇ -coreceptor-mediated activities, but might be able to support cell adhesion through at high coating concentrations analogous to cell adhesion to GST-Tl peptide fusion proteins (Fig. 9B).
  • TM was unable to support cell adhesion at any concentration tested, remaining completely ineffective even when coated at 250 ⁇ g/ml. This observation indicates that DM may be able to support cell adhesion specifically through oi ⁇ i, and this activity is eliminated by the K239E mutation in the Tl binding site for
  • CCNl has the unusual ability to induce sustained activation of p42/p44 MAPKs as an adhesion substrate (Chen, C-C, Chen, N., and Lau, L. F. (2001) J. Biol. Chem, 276, 10443- 10452).
  • fibroblasts were adhered to WT CCNl, SM, DM, or laminin for various durations (Fig. 12A).
  • 1064SK fibroblasts were serum-starved, resuspended in serum- free medium at 6 x 10 5 cells/ml and plated on 35 mm dishes pre-coated with CCNl (10.
  • Clarified- cell lysates were electrophoresed on 10% SDS-PAGE and immunoblotted with polyctonal anti- MAPK antibodies, or antibodies specific for dually phosphorylated p42/p44 MAPKS (Progema, Madison, WI).
  • CCNl activates a genetic program in fibroblasts, leading to the upregulation of genes encoding proteins involved in angiogenesis and matrix metabolism, including the angiogenic inducer VEGF and matrix metalloproteinase MMP-1 (Chen, C-C, Chen, N., and Lau, L. F. (2001) J. Biol. Chem. 276, 10443-10452). Because activated MAPKs are translocated into the nucleus where they can phosphorylate and activate transcription factors (Hazzalin, C. A. and Mahadevan, L. C (2002) Nat. Rev. Mol. Cell Biol. 3, 30-40), the loss of sustained MAPK activation may alter the ability of CCNl to regulate gene expression.
  • SM was able to upregulate Vegf and MMP-1 expression similar to WT CCNl, whereas DM and TM were completely defective in this activity.
  • heparin binding sites HI and H2 are required for both prolonged activation of MAPKs and upregulation of Vegf and MMP-1 expression.
  • CCNl enhances growth factor-induced DNA synthesis without being mitogenic on its own. See Kireeva, M. L., Mo, F.-E., Yang, G. P., and Lau, L. F. (1996) Mol Cell Biol. 16, 1326-1334.
  • VEGF 5 ng/ml
  • CCNl or mutant proteins 5 ⁇ g/ml each
  • Data shown are mean ⁇ S.D. of three determinations and representative of three experiments.
  • VEGF vascular endothelial growth factor
  • CCNl also induces tubule formation in activated endothelial cells through integrin ⁇ v /3 when cultured in collagen gel. See Leu, S.-J., Lam, S. C. T., and Lau, L. F. (2002) J. Biol. Chem.
  • HUVECs were either treated with vehicle buffer (no add) or stimulated with 5 nM PMA in serum-free medium before being plated on 24-well plates pre-coated with type I collagen gel (2 mg/ml) in the absence (-) or presence of CCNl (WT) or TM (20 ⁇ g/ml each).
  • WT CCNl
  • TM TM (20 ⁇ g/ml each.
  • a second layer of gel of identical formulation was overlaid on the attached cells, and tubule formation was assessed 16 h thereafter.
  • LM609 40 ⁇ g/ml
  • GoH3 40 ⁇ g/ml

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Vascular Medicine (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The angiogenic inducer CCN1 (cysteine-rich 61, CYR61), a secreted matricellular protein of the CCN family, is a ligand of multiple integrins including α6β1. Previous studies have shown that CCN1 interaction with integrin α6β1 mediates adhesion of fibroblasts, endothelial cells, and smooth muscle cells, as well as migration of smooth muscle cells. Recently, we have reported that CCN1-induced tubule formation of unactivated endothelial cells is also mediated through integrin α6β1. In this study, we demonstrate that human skin fibroblasts adhere specifically to the T1 sequence (GQKCIVQTTSWSQCSKS) within domain III of CCN1, and this process is blocked by anti-a6 and anti-b1 monoclonal antibodies. Alanine substitution mutagenesis of the T1 sequence further defines the sequence TTSWSQCSKS as the critical determinant for mediating α6β1-dependent adhesion. Soluble T1 peptide specifically inhibits fibroblast adhesion to CCN1 in a dose-dependent manner. Furthermore, T1 also inhibits cell adhesion to other α6β1 ligands including CCN2 (CTGF), CCN3 (NOV), and laminin, but not to ligands of other integrins. In addition, T1 specifically inhibits α6β1-dependent tubule formation of unactivated endothelial cells in a CCN1-containing collagen gel matrix. To confirm that T1 binds integrin α6β1 directly, we perform affinity chromatography and show that integrin α6β1 is isolated from an octylglucoside extract of fibroblasts on T1-coupled Affi-gel. Taken together, these findings define the T1 sequence in CCN1 as a novel binding motif for integrin α6β1, and form the basis for the development of peptide mimetics to examine the functional role of α6β1 in angiogenesis.

Description

CCNl COMPOSITIONS AND METHODS
FIELD OF THE INVENTION
[0001] The present invention relates to materials and methods involving extracellular matrix signaling molecules in the form of polypeptides involved in cellular responses to growth factors. More particularly, the invention is directed to CCNl -related peptides, compositions thereof, and methods of using these polypeptides. The invention is also directed to anti-CCNl antibodies.
BACKGROUND
[0002] Angiogenesis, or the formation of new blood vessels from pre-existing ones, is a complex process requiring the coordinated execution of multiple cellular events. See Risau (1997) Nature 386, 671-674. The sprouting of vessels requires degradation of the basement membrane surrounding the parental vessel, migration of vascular endothelial cells towards the angiogenic stimulus, proliferation of endothelial cells and their alignment into tubular structures, and coalescence of new vessels into circular loops to provide blood supply to the target tissue. See Risau. Angiogenesis is essential for embryogenesis, and in the adult, it is important in the female reproductive cycle and in wound healing. Angiogenesis may underlie a number of pathological conditions including diabetic retinopathy, arthritis, arteriosclerosis, psoriasis, and cancer. See Folkman (1995) Nature Medicine 1, 27-31. It is now clear that angiogenesis is regulated by a network of multiple inducers and inhibitors. See Bouck et al. (1996) Adv. Cancer Res. 69, 135-174 and Davis et al. (1999) Curr.Top.MicrobiolImmunol 237, 173-185.
[0003] The CCN family of matricellular proteins are cysteine-rich, secreted proteins that are associated with the extracellular matrix (ECM) but serve regulatory rather than structural functions. Members of the CCN family, which include CCNl (CYR61), CCN2 (CTGF), CCN3 (NOV), CCN4 (WISP-1), CCN5 (WISP-2), and CCN6 (WISP-3)(See Brigstock (1999) Endocr.Rev. 20, 189-206; Lau et al. (1999) Exp.Cell Res. 248, 44-57), are composed of an N- terminal secretory signal peptide followed by four conserved domains with homology to insulinlike growth factor binding protein, von Willebrand factor type C repeat, thrombospondin type 1 repeat, and a C-terminal domain (CT) with heparin-binding motifs and sequence similarity to the C-termini of von Willebrand factor and mucin. See Bork (1993) FEBSLett. 327, 125-130. In keeping with their homology to ECM proteins and localization to the ECM, several CCN proteins have been shown to support cell adhesion, induce focal adhesion complexes and stimulate adhesive signaling. See Kireeva et al. (1996) Mol. Cell. Biol. 16, 1326-1334; Chen et al. (2001) J. Biol. Chem. 276, 10443-10452; Chen (2001) J Biol. Chem. 276, 47329-47337.
[0004] Among members of the CCN family, CCNl and CCN2 have been most extensively characterized. Both proteins stimulate cell migration, promote cell survival, and augment growth factor-induced mitogenesis. See Kireeva et al. (1991) Exp. Cell Res. 233, 63-77; Jedsadayanmata et al. (1999) JBiolChem. 274, 24321-24327; Babic et α/. (1999) Mol. Cell Biol 19, 2958-2966; Schober et al. (2002) Blood 99, 4457-4465; Leu et al. (2002) J.BiolChem. 277, 46248-46255. Both proteins are known to induce angiogenesis and chondrogenesis; See Babic et al; Wong et al. (1997) Dev.Biol 192, 492-508; Babic et al. (1998) Proc. atl. Acad. Sci. USA. 95, 6355-6360; Shimo et al (1999) J.Biochem. (Tokyo.) 126, 137-145; Ivkovic et α/. (2003) Development 130, 2779-2791. Although CCN proteins do not contain a RGD sequence motif, both CCNl and CCN2"are direct ligands of multiple integrin receptors, which mediate many of their activities. See Jedsadayanmata et al (1999) JBiol Chem. 274, 24321-24327; Schober et al. (2002) Blood 99, 4457-4465; Leu et al. (2002) J.BiolChem. 277, 46248-46255; Kireeva et al. (1998) J.BiolChem. 273, 3090-3096; Chen et al. (2000) J.BiolChem. 275, 24953- 24961; Grzeszkiewicz et al. (2001) JBiolChem. 216, 21943-21950; Grzeszkiewicz et al. (2002) Endocrinology 143, 1441-1450. Targeted disruption of the CCNl gene in mice resulted in embryonic lethality due to vascular defects, whereas CCN2-null mice die perinatally due to respiratory failure as a consequence of skeletal malformation. See (Mo et al. (2002) Mol. Cell Biol 22, 8709-8720); Ivkovic et al. (2003) Development 130, 2779-2791. These findings indicate that members of the CCΝ family serve essential and non-redundant functions during development.
[0005] CCΝ1 (cysteine-rich 61, CYR61), an angiogenic inducer encoded by a growth factor- inducible immediate-early gene, is a novel integrin ligand whose expression is essential for proper embryonic development. Recent studies by targeted disruption of the CCNl gene in mice shows that CCNl -null embryos suffer embryonic death due primarily to vascular defects in both the placenta and the embryo. See Mo et al. (2002) Mol. Cell Biol. 22, 8709-8720. In addition to embryonic angiogenesis, CCΝ1 may also promote pathological angiogenesis under such conditions as tumor growth and wound healing. Stable transfection of CCNl in tumor cell lines that do not otherwise express CCNl enhances tumorigenicity with an increased vascularization of the CCNi-expressing tumors. See Babic et al. (1998) Proc. Natl.Acad. Sci. U.S.A. 95, 6355- 6360; Xie et al (2001) J. Biol. Chem. 216, 14187-14194; Tsai et al. (2002) Oncogene 21, 8178- 8185. Furthermore, estrogen-induced CCNl expression has been associated with advanced human breast cancer. See Xie et al. (2001) Cancer Res. 61, 8917-8923; Sampaih et al. (2001) Endocrinology 142, 2540-2548; Tsai et al. (2000) Cancer Res. 60, 5603-5607. Overexpression of CCNl has also been observed in restenosed blood vessels and advanced atherosclerotic lesions, underscoring its pathologic importance in vascular diseases. See Hilfiker et al. (2002) Circulation 106, 254-260; Wu et al. (2000) Int.JMol.Med. 6, 433-440; Grzeszkiewicz et al. (2002) Endocrinology 143, 1441-1450; Schober et al. (2002) Blood 99, 4457-4465. In addition, the expression of CCNl in cutaneous healing wounds, coupled with its ability to activate a genetic program for wound healing in human skin fibroblasts, suggests an important role for CCΝ1 in injury repair. See Latinkic et al. (1991) Nucleic Acids. Res. 19, 3261-3267; Chen et al. (2001) J. Biol. Chem. 276, 47329-47337.
[0006] Upon synthesis, CCΝ1 is secreted and becomes associated with the cell surface or the ECM. See Yang et al. (1991) Cell Growth & Differentiation 2, 351-357. Previous studies have shown that CCΝ1 supports cell adhesion, induces cell migration, enhances growth factor-induced mitogenesis, and promotes cell survival under apoptotic conditions. See Kireeva et al. (1996) Mol. Cell. Biol. 16, 1326-1334; Leu et al. (2002) J. Biol Chem. 277, 46248-46255. These cellular activities of CCΝ1 can be attributed in part to its ability to interact with integrin adhesion receptors. To date, five integrins, 6βι, αvβ3, αvβ5, αιibβ3, and αMβ2, have been identified as CCΝ1 receptors in various cell types. See Schober et al. (2002) Blood 99, 4457- 4465; Kireeva et al. (1998) J. Biol. Chem. 273, 3090-3096; Jedsadayanmata et al. (1999) JBiol Chem. 274, 24321-24327; Grzeszkiewicz et al. (2001) JBiol. Chem. 276, 21943-21950; Chen et al. (2000) J.BiolChem. 275, 24953-24961. In an earlier study, we have demonstrated that CCΝ1 induces neovascularization in the rat corneal micropocket assay. See Babic et al. (1998) Proc. Natl.Acad. Sci. U.S.A. 95, 6355-6360. Consistent with these in vivo findings, CCΝ1 promotes tubule formation of human umbilical vein endothelial cells (HUNECs) in a collagen gel assay, and this process is dependent on integrins α6βι and αvβ3. See Leu et al (2002) J. Biol. Chem. 277, 46248-46255. [0007] Integrin α6βι has been shown to mediate a number of CCNl activities in several cell types. CCNl supports fibroblast adhesion through interaction with integrin α6βι and cell surface heparin sulfate proteoglycans (HSPGs), leading to extensive formation of filopodia and lamellipodia with α6βι -containing focal complexes localized at leading edges of the pseudopods. See Chen et al. (2001) J.BiolChem. 276, 10443-10452. Moreover, integrin-dependent outside-in signaling are induced resulting in the activation of focal adhesion kinase, paxillin, Rac, and mitogen-activated protein kinases, and upregulation of several angiogenic regulators. See Chen et al. (2001) J. Biol. Chem. 276, 47329-47337; Chen et al. (2001) J.BiolChem. 276, 10443- 10452. In addition to fibroblasts, CCNl also interacts with integrin ccββi on vascular smooth muscle cells and vascular endothelial cells. See Grzeszkiewicz et al. (2002) Endocrinology 143, 1441-1450; Leu et al. (2002) J. Biol. Chem. 277, 46248-46255. Recently, we have shown that pro-angiogenic activities of CCNl are differentially mediated through integrin α6βι and αvβ in unactivated and activated HUVECs, respectively. Leu et al. (2002) J Biol. Chem. 277, 46248- 46255.
[0008] In addition to CCNl, other members of the CCN family include CCN2 (connective tissue growth factor, CTGF), CCN3 (nephroblastoma-overexpressed, NON), and the Wnt-inducible secreted proteins CCΝ4 (WISP-1), CCN5 (WISP-2), and CCN6 (WISP-3)(22-24). CCN proteins are organized into four distinct modular domains: I) an insulin-like growth factor binding protein homology domain, II) a von Willebrand factor (vWF) type C repeat domain, III) a thrombospondin type I repeat (TSP1) domain, and IV) a carboxyl terminal (CT) domain with heparin binding motifs and sequence similarities to the C-termini of vWF and mucins (see Fig. 1 A). Several CCN proteins have been shown to interact with multiple integrins, and therefore, localization of the integrin binding sites in CCN proteins will provide new insights into the structure-function relationship of this newly established family of matricellular proteins. We previously found that a truncated CCNl lacking the C-terminal domain is capable of inducing smooth muscle cell migration through integrin α6βj. See Grzeszkiewicz et al. (2001) JBiol. Chem. 216, 21943-21950. These findings suggest that the integrin α6βι binding site(s) resides within the first three domains of CCNl. We herein identify a novel 17-residue sequence, designated Tl, in the CCNl thrombospondin type I repeat domain that mediates α6βι-dependent cell adhesion. By affinity chromatography, we demonstrate direct interaction of α6β! with the Tl sequence. In addition, we demonstrate that through a coreceptor complex
Figure imgf000007_0001
and heparin sulfate proteoglycans (HSPGs), activity of CCNl is affected by heparin binding sites HI and H2 as well as Tl. The heparin binding sites HI and H2 are required for prolonged activation of MAPKs as well as upregulation of Vegf and MMP-1 expression, which are relevant to angiogenesis and matrix metabolism. We also demonstrate that synthetic peptides derived from the Tl sequence specifically block α6βi -dependent cell adhesion, our newly identified α6βι binding site in CCNl may serve as a basis for the development of antagonists to integrin α6βι . This newly identified α6βj binding site in CCNl may serve as a basis for the development of antagonists to integrin α6β
SUMMARY
[0009] The present invention provides extracellular matrix (ECM) signaling molecule-related materials and methods. In particular, the present invention is directed to CCNl -related peptides, compositions thereof, and methods of using these polypeptides. The invention is also directed to anti-CCNl antibodies.
[0010] One aspect of the present invention relates to a CCNl fragment comprising a sequence selected from the group consisting of amino acids 224-240 of murine CCNl, amino acids.231- 240 of murine CCNl, amino acids 226-242 of human CCNl, and amino acids 233-242 of human CCNl. The CCNl fragment may comprise from 8 to 50 amino acids. The present invention also relates to variants, analogs, homologs or derivatives of the CCNl fragments.
[0011] Another aspect of the present invention relates to a method of screening for a modulator of angiogenesis comprising contacting a test biological sample capable of undergoing angiogenesis with an ECM signaling molecule and a suspected modulator. As a control, a second biological sample is also contacted with an ECM signaling molecule. A modulator of angiogenesis is identified by the ability to alter the level of angiogenesis in the test sample. The ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof. Another aspect of the present invention relates to a modulator identified by the present method.
[0012] Another aspect of the present invention relates to a method of screening for a modulator of angiogenesis comprising implanting a test implant into a test animal, wherein the test implant comprises a suspected modulator and an ECM signaling molecule. As a control, a second implant comprising an ECM signaling molecule is implanted into a test animal, which may be the same animal or a different test animal. A modulator of angiogenesis is identified by its ability to alter the level of blood vessel development in the test implant when compared to the control sample. The ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homo log or a derivative thereof. Another aspect of the present invention relates to a modulator identified by the present method.
[0013] Another aspect of the present invention relates to a method of screening for a modulator of oncogenesis comprising contacting a tumor with a suspected modulator along with an ECM signaling molecule. As a control, a second tumor is also contacted with an ECM signaling molecule. A modulator of oncogenesis may be identified by its ability to alter the level of oncogenesis of the test tumor when compared to the control tumor. The ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof. Another aspect of the present invention relates to a modulator identified by the present method.
[0014] Another aspect of the present invention relates to a method of screening for a modulator of cell adhesion comprising contacting a test biological sample on a surface compatible with cell adherence with a suspected modulator along with an ECM signaling molecule. As a control, a second biological sample on a surface compatible with cell adherence is also contacted with an ECM signaling molecule. A modulator of cell adhesion is identified by its ability to alter the level of cell adhesion of the test sample when compared to the control sample. The ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof. Another aspect of the present invention relates to a modulator identified by the present method.
[0015] Another aspect of the present invention relates to a method of screening for a modulator of cell migration comprising seeding cells capable of undergoing cell migration onto a test gel matrix comprising a suspected modulator and an ECM signaling molecule. As a control, cells capable of undergoing cell migration are also seeded onto a second biological sample gel matrix comprising an ECM signaling molecule. A modulator of cell adhesion may be identified by its ability to alter the level of cell migration in the test matrix when compared to the control matrix. The ECM signaling molecule may be a CCNl fragment or a fragment, variant, analog, homolog or a derivative thereof. Another aspect of the present invention relates to a modulator identified by the present method.
[0016] Another aspect of the present invention relates to an antibody that specifically binds to a CCNl fragment, or a variant, analog, homolog or derivative of said CCNl fragment. Another aspect of the present invention relates to a composition comprising an antibody that specifically binds to a CCNl fragment, or a variant, analog, homolog or derivative of said CCNl fragment.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Fig. 1 demonstrates the protein purity of recombinant CCNl domain fragments and their ability to support cell adhesion. Recombinant CCNl domain fragments were produced as hexahistidine-tagged fusion proteins by a baculovirus-expression system and purified by chromatography on cobalt-agarose. A, a schematic representation of the structural domains of full-length CCNl and the isolated domain fragments. The Tl sequence in domain III (TSP1 domain) is indicated by the shaded area. B, recombinant CCNl domain fragments and full-length CCNl (2 μg) were electrophoresed on 15% SDS-polyacrylamide gel and detected by Coomassie Blue staining. C, the resolved proteins were subjected to immunoblotting with polyclonal anti- CCN1 antibodies. See Kireeva et al. (1996) Mol Cell. Biol. 16, 1326-1334. Molecular mass markers are indicated in kDa on the left. D, maleic anhydride Reacti-Bind microtiter wells were coated with purified recombinant CCNl domain fragments or bovine serum albumin (BSA) (50 μg/ml, 50 μl/well) overnight at 4°C and blocked with 1% BSA. Protein coating efficiency was detected by an enzyme-linked immunosorbent assay (ELISA) using an anti-polyhistidine . monoclonal antibody (mAb). E, washed 1064SK fibroblasts, resuspended in serum-free medium, were plated onto wells (3 x 104 cells per well) precoated with CCNl (20 μg/ml) or the indicated domain fragments (50 μg/ml). Cells were allowed to adhere for 20 min at 37°C. Adherent cells were fixed, stained with methylene blue, and quantified by absorbance at 620 nm. Data are means ± S.D. of triplicate determinations. Panels D and E are representative of three experiments.
[0018] Fig. 2 demonstrates that Domain III (TSP1 domain) of CCNl supports fibroblast adhesion through integrin α6βι. Fibroblast adhesion to microtiter wells coated with full-length CCNl (20 μg/ml) or domain III fragment (50 μg/ml ) was performed as described in the legend of Fig. 1. -4, where indicated, cells were suspended in serum-free medium containing EDTA (2.5 mM), Mg++ (5 mM), Ca"1^ (5 mM), or Mn^ (0.5 mM) before plating. B, cells were preincubated with vehicle buffer (No Add), normal mouse IgG (100 μg/ml), anti-αvβ3 mAb LM609 (50 μg/ml) (Chemicon-Temecula, CA), anti-a6 mAb GoH3 (50 μg/ml) (Immunotech-Marseille, France), or anti-bi mAb P4C10 (1:50 ascites) (Life Technologies/Gibco-BRL) for 60 min prior to plating. Data are means ± S.D. of triplicate determinations and are representative of three experiments.
[0019] Fig. 3 demonstrates that recombinant GST-T1 fusion protein supports α6βj-dependent fibroblast adhesion. A, Microtiter wells were coated with 200 μg/ml recombinant GST-peptide fusion proteins with their sequences shown in Table I. Protein coating was performed overnight at 4°C followed by blocking with 1% BSA. Fibroblast adhesion was assessed as described in the legend of Fig. \. B, Cells were suspended in serum-free medium containing EDTA (2.5 mM), Mg"1-1" (5 mM), Ca"1-1" (5 mM), or Mn"" (0.5 mM) and plated onto the microtiter wells coated with glutathione S-transferase (GST) (50 μg/ml), GST-T1 (50 μg/ml), or CCNl (1 μg/ml). C, cells were preincubated with vehicle buffer (No Add), normal mouse IgG (100 μg/ml), anti-αvβ3 mAb LM609 (50 μg/ml), anti-a6 mAb GoH3 (50 μg/ml), or anti-b! mAb clone P4C10 (1:50 ascites) for 60 min prior to plating. Data are means ± S.D. of triplicate determinations and are representative of three experiments.
[0020] Fig. 4 demonstrates that synthetic Tl peptide supports α6βi -dependent cell adhesion. A, microtiter wells were coated with synthetic Tl, T2, T3, or T4 peptides (0.2 mM) overnight at 4°C and blocked with 1% BSA. Fibroblast were allowed to adhere to the peptide-coated wells for 20 min at 37°C. B, cells were preincubated with vehicle buffer (No Add) or the indicated monoclonal antibodies for 60 min prior to plating onto Tl-coated wells. Data are means ± S.D. of triplicate determinations and are representative of three experiments.
[0021] Fig. 5 demonstrates that soluble Tl peptide inhibits α6βι -dependent cell adhesion. A, microtiter wells were coated with CCNl (1 μg/ml), CCN2 (2 μg/ml), or CCN3 (5 μg/ml) and blocked with 1% BSA. Washed fibroblasts were pre-treated with vehicle buffer (No Add) or with soluble Tl, T2, T3 or T4 peptides (0.2 mM) for 30 min and plated onto wells coated with the indicated CCN proteins. B and C, various concentrations of Tl peptide were added to the cell suspension prior to plating onto wells coated with fibronectin (FN, 2 μg/ml), vitronectin (VN, 0.4 μg/ml), type I collagen (0.5 μg/ml), laminin (LN, 5 μg/ml) or CCNl (1 μg/ml). Recombinant murine CCNl protein was purified from serum-free insect cell conditioned media using the baculovirus expression system as described. See Kireeva et al. (1996) Mol Cell. Biol. 16, 1326-1334. Rat Type I collagen, vitronectin, laminin, and fibronectin were purchased from Collaborative Biomedical (Bedford, MA). Cell adhesion was assayed as described in the legend of Fig. 1. Data are means ± S.D. of triplicate determinations and are representative of three experiments.
[0022] Fig. 6 demonstrates that the TTSWSQCSKS sequence in Tl contains critical determinants for α6βi -dependent cell adhesion. Site-directed alanine substitutions of the Tl sequence in the Tl-GST fusion protein were performed as described in Materials and Methods. Wild type Tl fusion protein (GST-Tl-WT), its scrambled variant (GST-Tl -Scram) or the alanine substituted mutants was coated onto microtiter wells at a protein concentration of 200 μg/ml. After blocking with 1% BSA, fibroblast adhesion proceeded as described. Results are means ± S.D. of triplicate determinations and are representative of three experiments.
[0023] Fig. 7 demonstrates affinity purification of integrin 6βι from fibroblast lysates on GST- Tl -coupled Affi-gel. Cell surface proteins on fibroblasts were radio-iodinated by the lactoperoxidase-glucose oxidase method as described in Materials and Methods. Labeled cells were solubilized in starting buffer containing 200 mM octylglucoside and 0.5 mM Mxi *. The cell lysates (lane 1) were applied to affinity columns of Affi-gel agarose coupled with GST- scrambled Tl in A or GST-Tl in B. After washing with the starting buffer (lanes 2-4), the columns were eluted with 0.35 M NaCl (lane 5-8). Proteins in the eluted fractions were resolved on 7% SDS-polyacrylamide gels under non-reducing conditions and detected by autoradiography. In C, the high salt eluates from the GST-Tl column were pooled and subjected to immunoprecipitation with anti-a6 (GoH3), or anti-av (P3G8) mAb. The immunoprecipitated proteins were analyzed under non-reducing conditions. Molecular mass markers are indicated in kDa on the left. Results are representative of two experiments.
[0024] Fig. 8 demonstrates that the Tl peptide blocks CCNl -induced endothelial tubule formation in a collagen gel matrix. Unstimulated HUVECs were plated on 24-well plates precoated with type I collagen gels (2 mg/ml) in the absence (No Add) or presence of 50 μg/ml CCNl, and a second layer of gels was overlaid on the attached cells as described in Materials and Methods. Where indicated, cell suspension was incubated with the tested peptides for 30 min prior to plating. Tubule formation was assessed 16-20 h thereafter. Results are representative of three separate experiments (magnification x 100).
[0025] Fig. 9 depicts the construction and expression of CCNl and mutants. A, schematic diagram of constructs of wild type CCNl (WT) and mutants either bearing the K239E point mutation in Tl (SM), disruptions in HI and H2 (DM), or combined mutations in Tl, HI, and H2 (TM). Each construct is similarly endowed with an N-terminal secretory signal and a C-terminal FLAG epitope tag. Recombinant proteins were expressed in insect cells via a baculovirus vector. Wild type Tl, HI, and H2 sequences and specific a.a. changes in the mutants are shown. B, fibroblasts were plated on microtiter wells coated with either GST, GST-Tl peptide fusion, or GST-Tl (K239E) peptide fusion protein (50 ©g/ml each). Cells were allowed to adhere at 37°C for 20 min. After washing, adherent cells were fixed, stained with methylene blue, and quantified by absorbance at 620 nm. C, Coomassie brilliant blue stained 10% SDS-PAGE in which FLAG affinity-purified recombinant proteins (2 μg each) were electrophoretically separated. Molecular mass (kDa) of markers are shown at left. The gel was immunoblotted with polyclonal anti-CCNl antibodies and shown in the lower panel.
[0026] Fig. 10 demonstrates that fibroblast adhesion to mutant SM is heparin-sensitive. A,1064SK human fibroblasts were plated on microtiter wells coated with the indicated amounts of recombinant WT CCNl or SM mutant, and cell adhesion was assessed as described in Fig. 1. B, fibroblasts were untreated, or treated with either heparinase I (2 units/ml) or chondroitinase ABC (2 units/ml) prior to adhesion to microtiter wells coated with WT CCNl (2 μg/ml), SM (2 μg/ml) or VN (0.5 μg/ml). Where indicated, soluble heparin was present at 1 μg/ml in the culture medium. Data shown are mean ± S.D. of three determinations and representative of three experiments.
[0027] Fig. 11 demonstrates DM supported Qfe/31 -mediated cell adhesion. A, fibroblasts were plated on microtiter wells coated with the indicated amounts of DM or TM and cell adhesion was evaluated. B, cells were preincubated with 40 μg/ml of function-blocking mAb against integrin αviδ3 (LM609), integrin a (GoH3), or integrin β\ subunit (P4C10, 1:50 ascites) at room temperature for 1 h prior to plating. Cell adhesion was assessed as above. Data shown are mean ± S.D. of three determinations and representative of three experiments. [0028] Fig. 12 demonstrates effects of CCNl mutants on MAPK activation and gene expression. A. MAPK activation. 1064SK fibroblasts were serum-starved and resuspended in serum-free medium at 6 x 105 cells/ml. Cells were plated on 1 ml/dish (35-mm dishes) coated with WT CCNl (10 μg/ml), SM (10 μg/ml), DM (250 μg/ml), or laminin (LN, 10 μg/ml) for 1-5 hrs as indicated. Clarified lysates were separated on 10% SDS-PAGE, and i munoblotted with polyclonal anti-MAPK antibodies, or antibodies against dually phosphorylated active p42/p44 MAPKs. B, regulation of gene expression. Primary human skin fibroblasts were serum-starved 24 hours before being treated with 10 μg/ml each of WT CCNl (WT), mutant proteins (SM, DM and TM), or BSA control (B) for 24 hours and total cellular RNA was isolated. Expression of Vegf and MMP-1 was evaluated by RNA blotting (20 μg of total RNA in each lane) following electrophoresis, and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was monitored as a control.
[0029] Fig. 13 demonstrates HUVEC adhesion and migration to CCNl mutants through integrin ,β3. A, HUVECs detached in 2.5 mM EDTA and resuspended in serum-free medium were adhered to wells pre-coated with 15 μg/ml of CCNl wild type CCNl (WT) or SM, or 50 μg/ml of DM or TM. Where indicated, cells were treated with EDTA (5 mM), GRGDSP peptide (RGDS, 0.2 mM), anti- αvlS3 mAb LM609 (40 μg/ml), anti-Ofe mAb GoH3 (40 μg/ml) for 60 min prior to plating. Cell adhesion was measured as described. B, migration of HUNECs to CCΝ1 or mutants were evaluated using Transwell chambers. 15 μg/ml of CCΝ1 WT or mutant SM, 50 ■ μg ml of mutant DM or TM was immobilized on the lower surface of the Transwell membrane that separated the two chambers. HUNECs were treated with 100 nM PMA (Sigma, St. Louis, MO) for 30 min to activate integrin receptors. Where indicated, prior to plating in the upper chamber, cells were preincubated with vehicle buffer (No Add), normal mouse IgG (100 μg/ml), GoH3 (50 μg/ml), LM609 (50 μg/ml) for another 30 min. Cells were allowed to migrate for 8 h, and those migrated to the lower chamber were counted in 10 random high power fields. Data shown are mean ± S.D. of three determinations and representative of three experiments.
[0030] Fig. 14 demonstrats that CCNl mutants may enhance VEGF-induced DNA synthesis through integrin αv/33. HUVECs were preincubated with vehicle buffer (No Add), LM609 (25 μg/ml), GoH3 (25 μg/ml), or normal mouse IgG (25 μg/ml) for lh. Cells were then treated with VEGF (5 ng/ml) and/or CCNl or mutant proteins (5 μg/ml each) in the presence of [3H]thymidine, incorporation of which was assessed 48 h thereafter. Data shown are mean ± S.D. of three determinations and representative of three experiments.
[0031] Fig. 15 demonstrates that CCNl mutants may promote HUVEC survival. Serum-starved HUVECs were allowed to attach to coverslips pre-coated with 20 μg/ml laminin (LN) for 4 hr, followed by addition of serum, CCNl or mutant proteins (5 μg/ml each) for an additional 16 h. Cells were fixed and apoptosis was monitored by using a TUNEL assay. Where indicated, polyclonal anti-CCNl antibodies were preincubated with test reagents for 30 min prior to addition into medium. Data shown are mean ± S.D. of three determinations and representative of three experiments.
[0032] Fig. 16 demonstrates that CCNl mutants may induce integrin αv/33-dependent endothelial tubule formation. HUVECs were either treated with vehicle buffer (no add) or stimulated with 5 nM PMA in serum-free medium before being plated on 24-well plates pre-coated with type I collagen gel (2 mg/ml) in the absence (-) or presence of CCNl (WT) or TM (20 μg/ml each). A second layer of gel of identical formulation was overlaid on the attached cells, and tubule formation was assessed 16 h thereafter. Where indicated, LM609 (40 μg/ml) or GoH3 (40 μg/ml) was added to cell suspensions prior to plating. Results are representative of three experiments (x 200 magnification).
DETAILED DESCRIPTION
[0033] CCNl is an angiogenic inducer that plays an essential role in normal vascular development during embryogenesis. See Mo et al. (2002) Mol. Cell Biol. 22, 8709-8720. See also U.S. Pat. No. 6,413,735, and U.S. Application Serial No. 09/495,448 (allowed), both- incorporated herein by reference. We have recently shown that the proangiogenic activities of CCNl are mediated through integrins 6βi and αvβ in unactivated and activated HUVECs, respectively. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255. In addition to integrin α6βi interaction with the Tl sequence in the TSP1 domain of CCNl, adhesion of fibroblasts and unactivated endothelial cells to CCNl also requires heparin sulfate proteoglycans to act as co- receptors which interact with the heparin binding motifs in the CCNl C-terminal domain. See Chen et al. (2000) JBiol. Chem. 275, 24953-24961. In this study, we have employed functional and biochemical analyses to define a 17-residue Tl sequence (GQKCF/QTTSWSQCSKS) in the CCNl domain III as a novel integrin 6βj binding site. We have also determined that heparin binding sites HI and H2 are influential in the activity of the α6βι-HSPG coreceptor complex in functions such as cell adhesion that are an important part of angiogenesis. These findings provide a basis for the development of 6βι antagonists and a target for mutational analyses to examine the role of integrin α6βι-CCNl interaction in angiogenesis.
Definitions
[0034] As used herein, the term "administer" means a single dose or multiple doses of a composition of the present invention.
[0035] As used herein, the term "treat" or "treating" when referring to protection of a mammal from a condition, means preventing, suppressing, repressing, or eliminating the condition. Preventing the condition involves administering a composition of the present invention to a mammal prior to onset of the condition. Suppressing th econdition involves administering a composition of the present invention to a mammal after induction of the condition but before its clinical appearance. Repressing the condition involves administering a composition of the present invention to a mammal after clinical appearance of the condition such that the condition is reduced or maintained. Elimination of the condition involves administering a composition of the present invention to a mammal after clinical appearance of the condition such that the mammal no longer suffers the condition.
Cell Adhesion is modulated by the OtøSi-HSPG coreceptor complex
[0036] Consistent with our earlier findings that a truncated mutant encompassing domains I-III of CCNl is capable of inducing α6βι -dependent smooth muscle cell migration (see Grzeszkiewicz et al. (2002) Endocrinology 143, 1441-1450), we find that a recombinant fragment corresponding to the isolated domain III (TSP1 domain) of murine CCNl is sufficient to support 6βι -dependent fibroblast adhesion. Along with 6βι, heparin sulfate proteoglycans (HSPGs) operate as co-receptors of that interaction. See Chen, N., Chen, C. C, and Lau, L. F. (2000) J. Biol. Chem. 275, 24953-24961 and Leu, S.-J., Lam, S. C. T., and Lau, L. F. (2002) J Biol. Chem. 277, 46248-46255. The specificity of α6β! interaction with the murine CCNl domain III is confirmed by the failure of the murine CCNl domain I and domain II fragments to support cell adhesion, and by the observation that anti- 6 and anti-βj mAbs specifically block cell adhesion to the murine CCNl domain III (Figs. 1 and 2). [0037] Within domain III, we have further pin-pointed the Tl sequence as an integrin α6βι binding site in CCNl based on the following observations: 1) a Tl-GST fusion protein and a synthetic Tl peptide specifically support α6β dependent cell adhesion (Figs. 3 and 4); 2) integrin α6βι is purified from a detergent lysate of fibroblasts on a Tl-GST affinity matrix, demonstrating direct interaction between integrin α6β j and the Tl sequence (Fig. 7); 3) soluble Tl peptide inhibits cell adhesion to α6βι ligands including CCNl, CCN2, CCN3 and laminin, but not to other integrin ligands such as fibronectin, vitronectin and collagen (Fig. 5); and 4) Tl peptide also blocks α6βi-dependent tubule formation of unactivated HUVECs in a collagen matrix containing CCNl (Fig. 8). It is noteworthy that soluble Tl peptide is an effective inhibitor on otββi -dependent cellular activities. Half maximal inhibition of cell adhesion occurs at a peptide concentration of 25-50 mM (Fig. 5C). Thus, the inhibitory potency of Tl is comparable to linear RGD peptides that inhibit adhesive functions of other integrins, such as αvβ , also at the micromolar range. See Ruoslahti (1996) Ann. Rev. CellDev. Biol. 12, 697-715.
[0038] Inasmuch as the Tl site maybe shown to affect the binding of CCNl with 6βι, we have further shown that heparin binding sites HI and H2 account for the remainder of α6βι-dependent activities of CCNl . Upon preparation of full-length CCNl -GST fusion proteins having mutations at the Tl site and the HI and H2 heparin binding sites, mutants disrupted at all three of the sites lost all ability to support α6βι -mediated fibroblast adhesion. As described in Examples 11-13, while mutants disrupted at the HI and H2 sites could support fibroblast adhesion only at an elevated concentration, mutants disrupted only at the Tl site were still able to support fibroblast adhesion at a level near that of the wild type.
[0039] Heparin binding at HI and H2 of CCNl may also be shown to affect the sustained activation of p42/p44 MAPKs.
[0040] By alanine substitution mutagenesis of the Tl-GST fusion protein, we showed that the C- terminal portion of Tl (TTSWSQCSKS) contains critical determinants for α6βι -dependent cell adhesion. Of note is the double T231A/T232A and W234A/K239A substitutions that result in complete loss of its capacity to support cell adhesion. This 10-residue segment is highly conserved among other CCN family members with only two non-conserved substitutions among CCNl, CCN2 and CCN3. Therefore, it is conceivable that 6βι also binds to the corresponding Tl sequences in other CCN proteins. Consistent with this notion, soluble Tl peptide also inhibits α6βι -dependent fibroblast adhesion to CCN2 and CCN3. These results lead us to conclude that the conserved TT WS CSKS sequence (X represents a non-conserved residue) in CCN proteins defines a novel recognition motif for integrin α6βι- An important feature of this sequence is that any single alanine substitution of the conserved residues (i.e., T232A, W234A, S235A, S238A, and K239A) results in a drastic loss of α6βi binding activity, suggesting that it requires multiple coordination interaction with the ligand binding pocket in integrin 6βι.
[0041] Integrin α6βι has a limited ligand spectrum that includes laminin, CCN proteins, invasin, fertilin and a collagen fragment known as tumstatin. See Sonnenberg et al. 1990) J. Cell Biol. 110, 2145-2155; Maeshima et al. (2001) JBiolChem. 216, 15240-15248; Isberg et al. (1990) Cell 60, 861-871; Almeida et al. (1995) Cell 81, 1095-1104. These diverse α6βϊ ligands that are involved in various biological processes are not structurally related. Several α6βj binding sequences have been identified by screening synthetic peptides derived from some of these α6βι ligands. These include the NPWHSIYITRFG and TWYKIAFQRNRK sequences from the laminin al chain. See Sonnenberg et al. 1990) J. Cell Biol 110, 2145-2155; Nomizu t α/. (1995) J. Biol. Chem. 270, 20583-20590; Nakahara et al. (1996) J. Biol. Chem. 271, 27221- 27224. In addition, TDE-containing peptides from the disintegrin domain of the fertilin b subunit disrupt sperm-egg fusion presumably by blocking integrin αgβi-fertilin interaction. See Myles et al. (1994) Proc. Natl Acad. Sci. U.S.A. 91, 4195-4198. Several other α6βj binding peptides have also been isolated by screening phage display and synthetic peptide combinatorial libraries; however, these sequences are not present in any known α6βι ligand. See Murayama et al. (1996) J. Biochem. (Tokyo) 120, 445-451; Pennington et α/. (1996) Mol.Divers. 2, 19-28; DeRoock et al. (2001) Cancer Res. 61, 3308-3313. A comparison of the 6βι binding sequences reported to date reveals no consensus sequence that acts as an α6βj binding motif. Furthermore, our newly identified Tl sequence in CCNl does not exhibit any sequence similarity to these α6βι binding peptides. Thus, integrin α6βι, like ccMβ2, is capable of recognizing a broad range of binding sequences. At present, whether these vastly different peptide sequences bind to the same or different sites in α6βι remains to be determined. Nonetheless, given that integrin α6βι has been implicated in a multitude of biological processes, different α6βι binding sequences may interact with distinct coordination sites within the α6β! ligand binding pocket to induce different signaling pathways that mediate disparate biological activities.
[0042] To date, three CCN proteins have been shown to induce neovascularization in vivo. See Babic et al. (1998) Proc. Natl.Acad. Sci. U.S.A. 95, 6355-6360; Lin et al. (2003) J.BiolChem. In press; Babic et al. (1999) Mol.Cell.Biol 19, 2958-2966; Shimo et al. (1999) J Biochem. (Tokyo.) 126, 137-145; Fataccioli et al. (2002) Hum. Gene Ther. 13, 1461-1470. Endothelial cell migration, proliferation, and differentiation into tubule structures are essential for the formation of new blood vessels. CCNl is an activation-independent ligand of integrin α6βι in non-stimulated endothelial cells, mediating both cell adhesion and tubule formation through this integrin receptor. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255. Whereas intact CCNl is an angiogenic inducer, the Tl peptide acts as an α6β! antagonist to block CCN1- induced tubule formation of unactivated endothelial cells. Interestingly, the Tl sequence resides within the thrombospondin type 1 repeat homology domain of CCNl, and thrombospondin is an inhibitor of angiogenesis with its anti-angiogenic activity being localized to the procollagen homology region and the properdin-like type 1 repeat. See Tolsma et al. (1993) J. Cell Biol. 122, 497-511. A number of anti-angiogenic peptides have been derived from thrombospondin, including the CSVTCG-containing peptides that interact with CD36 on endothelial cells. See Jimenez et al. (2000) Nat. Med. 6, 41-48; Dawson et al. (1997) J. Cell Biol. 138, 707-717. Interaction of CD36 with the TSP1 domain of CCN proteins has not been demonstrated; however, CD36 has been shown to associate with integrin α6βι on human platelets and melanoma cells. Miao et al. (2001) Blood 91, 1689-1696; Thome et al. (2000) J. Biol Chem. 275, 35264-35275. If the CD36-α6βι complex also exists on endothelial cells, it is an intriguing possibility that these two cell surface receptors may act in concert to regulate angiogenesis through interaction with proximal recognition sequences in the thrombospondin type 1 repeat of matricellular proteins.
1. CCNl Fragments
[0043] The present invention relates to peptide fragments' of CCNl that modulate the activity of CCNl . The peptides may be used in therapeutic strategies designed to inhibit or induce the activity of CCNl . The peptides may be natural, synthetic or recombinant. One approach is to produce a peptide comprising a sequence selected from the group consisting of: amino acids 224- 240 of murine CCNl, amino acids 231-240 of murine CCNl, amino acids 226-242 of human CCNl, and amino acids 233-242 of human CCNl. For example, a peptide comprising conserved amino acids may compete with native CCNl for its binding sites on integrins and other proteins. This competition may thereby inhibit the action of native CCNl. The present invention also relates to fragments of the CCNl fragments. The peptides may be from 8 to 50 amino acids in length. The inhibitory peptides may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 amino acids in length.
[0044] The peptides may also be homologs of the above-described CCNl peptides. Homologs of the CCNl peptides are peptides sharing a common evolutionary with CCNl. The peptides may also be variants of the above-described CCNl peptides and homologs. peptide variants are peptides that differ in amino acid sequence from a native CCNl peptide by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity of a native CCNl peptide. For purposes of the present invention, "biological activity of a CCNl peptide" includes, but is not limited to, the above-described activities of full-length CCNl, the ability to modulate activities of CCNl and the ability to be bound by an antibody specific for CCNl.
[0045] A conservative substitution of an amino acid, i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophihcity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids, as understood in the art. Kyte et al, J. Mol. Biol. 757.105-132 (1982). A listing of the hydropathic indices of amino acids may be found in U.S. Pat. No. 6,639,054, which is incorporated herein by reference.lt is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of ±2 are substituted.
[0046] The hydrophihcity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophihcity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophihcity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity. A listing of hydrophihcity indices of amino acids may be found in U.S. Patent No. 4,554,101, which is incorporated herein by reference. Substitution of amino acids having similar hydrophihcity values can result in peptides retaining biological activity, for example immunogenicity, as is understood in the art. In one aspect, substitutions are performed with amino acids having hydrophihcity values within ±2 of each other. Both the hyrophobicity index and the hydrophihcity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophihcity, charge, size, and other properties.
[0047] Additionally, computerized algorithms are available to assist in predicting amino acid sequence domains likely to be accessible to an aqueous solvent. These domains are known in the art to frequently be disposed towards the exterior of a peptide, thereby potentially contributing to binding determinants, including antigenic determinants.
[0048] The peptides may also be analogs of the above-described CCNl peptides, homologs and variants comprising non-standard amino acid or other structural variation from the conventional set of amino acids. The peptides may also be derivatives of the above-described CCNl peptides, homologs, variants and analogs that differ in ways other than primary structure (amino acids and amino acid analogs). By way of illustration, derivatives may differ from native CCNl peptides, homologs and variants by being glycosylated, one form of post-translational modification. For example, polypeptides may exhibit glycosylation patterns due to expression in heterologous systems. If these peptides retain at least one biological activity of native CCNl, then these peptides are CCNl derivatives according to the invention. Other derivatives include, but are not limited to, fusion peptides having a covalently modified N- or C-terminus, PEGylated peptides, peptides associated with lipid moieties, alkylated peptides, peptides linked via an amino acid side-chain functional group to other peptides or chemicals, and additional modifications as would be understood in the art. In addition, the invention contemplates CCN1- related peptides that bind to a CCNl receptor, as described below. [0049] The various peptides of the present invention, as described above, may be provided as discrete peptides or be linked, e.g., by covalent bonds, to other compounds. For example, immunogenic carriers such as Keyhole Limpet Hemocyanin may be bound to a CCNl peptide of the invention. The various fragments, variants, analogs, homologs or derivatives described above maybe 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the peptides. The present invention is also related to isolated nucleic acids encoding the peptides. The present invention also involves a pharmaceutical composition comprising peptides of the present invention.
2. Antibodies
[0050] The present invention also involves a pharmaceutical composition comprising an < antibody that specifically binds to the CCNl peptides of the present invention and a pharmaceutically acceptable adjuvant, diluent, or carrier. The antibody may be produced as described below, or as described in WO 01/55210, the contents of which are hereby incoφorated by reference in their entirety.
[0051] The antibodies of the present invention include antibodies of classes IgG, IgM, IgA, IgD, and IgE, and fragments and derivatives thereof including Fab and F(ab')2. The antibodies may also be recombinant antibody products including, but not limited to, single chain antibodies, chimeric antibody products, "humanized" antibody products, and CDR-grafted antibody products. The antibodies of the present invention include monoclonal antibodies, polyclonal antibodies, affinity purified antibodies, or mixtures thereof which exhibit sufficient binding specificity to the CCNl fragments.
[0052] Also contemplated by the invention are antibody fragments. The antibody products include the aforementioned types of antibody products used as isolated antibodies or as antibodies attached to labels. Labels can be signal-generating enzymes, antigens, other antibodies, lectins, carbohydrates, biotin, avidin, radioisotopes, toxins, heavy metals, and other compositions known in the art; attachment techniques are also well known in the art.
[0053] Anti-CCNl antibodies are useful in diagnosing the risk of oncogenesis. In addition, anti- CCN1 antibodies may be used in therapies designed to deliver specifically-targeted cytotoxins to cells expressing CCNl, e.g., cells participating in the neovascularization of solid tumors. These antibodies are delivered by a variety of administrative routes, in pharmaceutical compositions comprising carriers or diluents, as would be understood by one of skill in the art.
3. Screening for Modulators of CCNl
[0054] The present invention involves screening for modulators of activities associated with CCNl. Modulators may be identified that interact with the integrin binding site of CCNl, thereby preventing CCNl from interacting with target integrins and other proteins. Modulators may also be identified that directly bind to targets integrins and other proteins of CCNl, thereby preventing CCNl from productively interacting with said target integrins and other proteins. Modulators may also be identified which indirectly affect binding of CCNl to target proteins.
[0055] For puφoses of the invention, an "ECM signaling molecule" refers to a CCNl fragment described above. The use of "ECM signaling molecule" also contemplates one or more additional CCN polypeptides. The one or more additional CCN polypeptides include, but are not limited to, CCNl, CCN2, CCN4, CCN5 and CCN6, as well as fragments, variants, analogs, homologs or derivatives of said one or more additional CCN polypeptides. a. Angiogenesis
[0056] The methods of the present invention relate to screening for a modulator of angiogenesis. In one embodiment of the present invention, a biological sample capable of undergoing angiogenesis is contacted with a suspected modulator in vitro along with an ECM signaling molecule. As a control, a second biological sample is also contacted with an ECM signaling molecule. A modulator of angiogenesis may be identified by its ability to alter the level of angiogenesis of the test sample when compared to the control sample.
[0057] In another embodiment of the present invention, an implant comprising a suspected modulator and an ECM signaling molecule is implanted into a test animal. As a control, a second implant comprising an ECM signaling molecule is implanted into a test animal, which may be the same animal or a different test animal. A modulator of angiogenesis may be identified by its ability to alter the level of blood vessel development in the test implant when compared to the control sample. b. Oncogenesis
[0058] The methods of the present invention also relate to screening for a modulator of oncogenesis. A tumor is contacted with a suspected modulator along with an ECM signaling molecule. As a control, a second tumor is also contacted with an ECM signaling molecule. A modulator of oncogenesis may be identified by its ability to alter the level of oncogenesis of the test tumor when compared to the control tumor. c. Cell Adhesion
[0059] The methods of the present invention also relate to screening for a modulator of cell adhesion. A biological sample on a surface compatible with cell adherence is contacted with a suspected modulator along with an ECM signaling molecule. As a control, a second biological sample on a surface compatible with cell adherence is also contacted with an ECM signaling molecule. A modulator of cell adhesion may be identified by its ability to alter the level of cell adhesion of the test sample when compared to the control sample. d. Cell Migration
[0060] The methods of the present invention also relate to screening for a modulator of cell migration. Cells capable of undergoing cell migration are seeded onto a gel matrix comprising a suspected modulator and an ECM signaling molecule. As a control, cells capable of undergoing cell migration are also seeded onto a second biological sample gel matrix comprising an ECM signaling molecule. A modulator of cell adhesion may be identified by its ability to alter the level of cell migration in the test matrix when compared to the control matrix. e. Methods of Treatment
[0061] The present invention also involves modulators of CCNl activity identified using the above-described screening methods. The identified modulators of CCNl activity may be formulated in a pharmaceutical composition comprising a pharmaceutically acceptable adjuvant, diluent, or carrier. The pharmaceutical composition comprising the modulator of CCNl activity may be administered to a patient for the treatment of disease associated with angiogenesis, oncogenesis, or chondrogenesis. The pharmaceutical composition may be administered alone or in combination with other compositions, such as a chemotherapeutic. [0062] Compositions of the present invention may be administered in a standard manner including, but not limited to, orally, parenterally, sublingually, transdermally, rectally, . transmucosally, topically, via inhalation, or via buccal administration. Parenteral administration includes, but is not limited to, intravenous, intraareterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intraarticular.
[0063] Having now generally described the invention, other aspects and advantages of the present invention will be understood upon consideration of the following illustrative examples.
These examples are for pmposes of illustration only and are not intended to limit the scope of the invention as set out in the appended claims. Example 1 discloses that domain III of CCNl supports α6βi -dependent cell adhesion. Example 2 discloses that the Tl sequence in domain III of CCN contains an integrin 6βι binding site. Example 3 describes the effect of soluble Tl peptide on ctζβ-i -dependent cell adhesion. Example 4 describes the effect of alanine substitutions in the Tl sequence on cell adhesion. Example 5 describes affinity purification of integrin αgft using a Tl -coupled affinity matrix. Example 6 describes the effect of soluble Tl peptide on
CCNl-induced endothelial tubule formation. Example 7 describes the construction of mutant peptides inactivated at Tl binding site for integrin
Figure imgf000024_0001
Example 8 describes evaluation of adhesion of mutant CCNl peptide inactivated at Tl binding site for integrin c^β\. Example 9 describes construction of mutant CCNl inactivated at Tl binding site for integrin
Figure imgf000024_0002
Examples 10-14 describe cell adhesive properties of CCNl mutants. Example 10 describes an
SM assay using a disrupted Tl binding site with an uninterrupted heparin binding site. Example
11 describes an SM Assay using a disrupted Tl binding site, with inhibition of heparin binding sites. Example 12 describes a DM assay using an uninterrupted Tl binding site with a disrupted heparin binding site. Example 13 describes a TM assay using a disrupted Tl binding site, and a disrupted heparin binding site. Example 14 describes the use of anti-integrins to evaluate cell adhesion of DM. Examples 15-16 describe the effect of disruption of HI and H2 on CCN1- dependent MAPK activation and regulation of gene expression. Example 15 describes MAPK activation. Example 16 describes regulation of gene expression. Examples 17-21 describe the dissociation of CCNl activities mediated through αv/33 and a$β \ -HSPGs. Example 17 describes
HUVEC adhesion and migration to CCNl mutants through integrin αv/33. Example 18 describes migration of HUVECS to CCNl or mutants. Example 19 describes enhancement of VEGF- induced DNA Synthesis through integrin c^ft- Example 20 describes the effect of CCNl mutants on HUVEC survival. Example 21 describes tubule formation. These examples are intended to be illustrative of the present invention and should not be construed to limit the scope of the invention.
EXAMPLE 1 Domain III (TSPl-homoIogy Domain) of CCNl Supports α6βrdependent Cell Adhesion
[0064] Previous studies have established that primary human skin fibroblasts adhere to CCNl through integrin α6βι and heparin sulfate proteoglycans, inducing the formation of α6βr containing focal complexes and the activation of focal adhesion kinase, paxillin, and Rac. See Chen et al (2000) J.BiolChem. 215, 24953-24961; Chen et al. (2001) J.BiolChem. 276, 10443- 10452. Deletion analysis showed that a C-terminal truncated CCNl mutant containing only the first three domains retains the ability to induce chemotaxis in smooth muscle cells through integrin α6βι, thus localizing an integrin α6βι binding site within the first three domains. See Grzeszkiewicz et al. (2002) Endocrinology 143, 1441-1450.
[0065] To define the CCNl structural domain that interacts with integrin α6βι, we expressed each of these three domains in insect cells via a baculovirus vector (Fig. 1 A). To enhance protein secretion, we employed the pMelBac B vector (Invitrogen Incoφ.) to provide anN- terminal honeybee melittin secretion signal peptide. To produce the coding sequences for domain I (IGFBP), domain II (VWC), and domain III (TSP1), we used the following respective primer sets for PCR upon the CCNl cDNA:
5 '-CGCGGATCCGGCGCTCTCCACCTGC-3 ' and 5'-GGAATTCCCTCTGCAGATCCCTTTCAGAGCGG-3'
5 '-CGCGGATCCGGCTCAGTCAGAAGGCAGAC-3 ' and 5 '-GGAATTCCCAGGAAGCCTCTTCAGTGAGCTGCC-3 '
5'-CGCGGATCCGGTCTTTGGCACC-3' and 5 '-GGAATTCCCTTTTAGGCTGCTGTACACTGGTTGTC-3 '
[0066] The PCR products were digested with BamHl and EcoRl, and ligated into pMelBac B. Each expressed recombinant polypeptide contained the V5 epitope and a polyhistidine tag at the C-terminus, and was purified from Sf9 cells using a serum-free baculovirus expression system as described. See Grzeszkiewicz et al (2001) JBiol. Chem. 276, 21943-21950.
[0067] Briefly, cells were maintained under serum-free conditions in EX-CELL 400 medium (JRH Biosciences, Lenexa, KS), infected at a multiplicity of infection of 10, and collected 42-46 h post-infection. The collected medium was cleared by centrifuge and subsequently concentrated by 10-15 folds using the Biomax-5 centrifugal filter (Millipore, Billerica, MA), and dialyzed against native buffer (50 mM sodium phosphate and 10 mM Hepes at pH 7.4, 0.5 M NaCl) overnight at 4°C and then applied to a TALON cobalt-agarose column (Clontech, Palo Alto, CA). The column was washed with native binding buffer at pH 7.0, before being eluted in 50 mM phosphate at pH 7.0, 0,3 M NaCl, and 150 mM imidazole. Products were analyzed by SDS- PAGE followed by Coomassie Brilliant Blue staining and immunoblotting. The pooled fractions for each domain fragment were dialyzed against 20 mM Hepes at pH 7.4, 150 mM NaCl overnight at 4°C to remove imidazole. Each domain fragment had the expected molecular mass (~11 kDa, 18 kDa, and 9 kDa for domains I, II, and III, respectively), and were immunoreactive with an anti-CCNl polyclonal antibody (Fig. IB and C).
[0068] We employed human 1064SK fibroblasts to address the ability of each domain to support cell adhesion. Primary human foreskin fibroblast 1064SK (ATCC CRL-2076, passage 2) were kept in Iscove's modified Dulbecco's medium (Invitrogen, Carlsbad, CA) with 10% fetal bovine serum (Intergen, Purchase, NY) at 37°C with 5% CO2. Cells were used within the 5th to 20th passages for all experiments. Test proteins were coated onto 96-well microtiter plates (Becton Dickinson, NJ) in PBS (50 ml per well), and wells were blocked with 1% BSA (Sigma, St. Louis, MO) at room temperature for 1 h. To enhance coating efficiency, CCNl domain polypeptides were covalently linked to maleic anhydride Reacti-Bind microtiter plates (Pierce, Rockford, IL) at 4°C overnight followed by blocking with BSA at 37°C for 2 h. Cell adhesion was conducted using washed subconfluent cells resuspended in serum-free basal medium at 5 x 105 cells/ml as described. See Chen et al. (2001) JBiolChem. 276, 10443-10452. Where indicated, cells were preincubated with EDTA, peptides, or function-blocking mAbs for 30 min prior to plating.
[0069] All three domains were coated onto microtiter wells with similar efficiency. Microtiter wells were coated with hexahistadine-tagged proteins or BSA (50 ml/well) overnight at 4°C, followed by blocking with 1% BSA for 2 h at room temperature. Protein coating efficiency was examined by incubation with an anti-polyhistidine mAb (Invitrogen) (2 h at 37°C) followed by an horseradish peroxidase-conjugated secondary antibody (Amersham Pharmacia Biotech- Piscataway, NJ) (1 h at 37°C). The color reaction was developed and quantified by A420 measurements.
[0070] Only Domain III was able to support fibroblast adhesion (Fig. ID and E). Fibroblast adhesion to Domain III was inhibited by EDTA (2.5 mM), and this inhibition was relieved by the addition of Mg^ (5 mM) in the assay media (Fig. 2A). Cell adhesion was also inhibited by Ca -1" (5 mM) and promoted by Mn + (0.5 mM). This divalent-cation sensitivity profile is similar to that of full-length CCNl, and is consistent with cell adhesion through integrin α6βj. See Chen et al. (2000) J.BiolChem. 275, 24953-24961. To ascertain which specific integrin receptor mediated cell adhesion to Domain III, we tested the inhibitory attributes of function-blocking mAbs. Preincubation of fibroblasts with mAbs against a (GoH3) or b! (P4C10) obliterated cell adhesion to Domain III as well as full-length CCNl, whereas mAb against integrin αvβ3 (LM609) or control mouse IgG had no effect (Fig. 2B). Together, these results show that human skin fibroblasts adhesion to the isolated Domain III of CCNl, like adhesion to full-length CCNl, is mediated through integrin α6βι.
EXAMPLE 2 The Tl Sequence in Domain III of CCNl Contains an Integrin α6βi Binding Site
[0071] We employed another systematic screening strategy to pinpoint the integrin 6β] binding site in CCNl. A series of overlapping peptides (Table 1) that covers the entire first three domains of CCNl was prepared by expression of the peptides as fusion proteins linked to GST. The coding sequences for various peptides (Fig. 3) were amplified by polymerase chain reactions (PCR) upon the CCNl cDNA as template. Primers used corresponded to the appropriate coding sequences and contain the BairiΑl and EcoRI restriction sites for cloning. For example, the following primers were used to generate the Tl peptide coding sequence:
5'-CGGGATCCGCGGGCCAGAAATGCATCGTT-3' and 5 '-CCGGAATTCCGCTCTTGGAGCACTGGGACC-3 '
PCR products were purified on polyacrylamide gels, digested with BamHI and EcoRI, and ligated into the pGΕX-4T-2 vector (Amersham Pharmacia Biotech). All cloning steps were confirmed by sequence analysis. GST-peptide fusion proteins were produced in E. coli strain BL21 and purified by glutathione affinity chromatography (Amersham Pharmacia Biotech), followed by extensive dialysis against PBS overnight at 4°C.
[0072] These fusion proteins were purified to near homogeneity, and had similar levels of coating efficiency in microtiter wells as detected by ELISA using an anti-GST antibody (data not shown). The ability of each peptide-GST fusion protein to support fibroblast adhesion was assessed. Only one peptide-fusion protein, namely Tl from Domain III, was able to support cell adhesion (Fig. 3 A). Again, fibroblast adhesion to Tl-GST was inhibited by EDTA and Ca""", and promoted by Mn* " in the assay media (Fig. 3B). Also, cell adhesion to Tl-GST was blocked by preinbubation of cells with anti-a6 (GoH3) or anti-bt (P4C10) mAb, but unaffected by other integrin-disrupting agents such as GRGDSP peptide (Life Technologies/Gibco-BRL) or anti- vβ3 (LM609) (Fig. 3C), indicating that the Tl-GST fusion protein supports the adhesion of fibroblasts through integrin 6β!. Likewise, Tl-GST also supported α6βj-mediated cell adhesion in other cell types, including endothelial cells, smooth muscle cells, and PC3 prostate cancer cells (data not shown).
[0073] To establish further that the Tl sequence contains a binding site for integrin α6βl5 four peptides spanning the CCNl domain III (Table 1) were synthesized and tested for the abilities to support cell adhesion. The synthetic peptides were prepared by ResGen Inc. (Huntsville, AL), followed by purification on reverse-phase high performance liquid chromatography and analysis by mass spectroscopy. Similar to the results obtained with GST-peptide fusion proteins, synthetic Tl peptide, but not the other 3 peptides (T2, T3 and T4), supported fibroblast adhesion (Fig. 4A). Moreover, cell adhesion to immobilized Tl peptide was inhibited by anti-a6 (GoH3) or anti-bj (P4C10), but not by anti-αvβ3 (LM609) or control mouse IgG (Fig. 4B). These results again indicate that Tl contains an integrin α6βi binding site.
EXAMPLE 3 Soluble Tl peptide Inhibits α6βrdependent Cell Adhesion
[0074] We anticipated that soluble Tl peptide is capable of blocking cell adhesion to substrates known to bind integrin α6βι- As shown in Fig. 5A, addition of 0.2 mM Tl to the cell suspension effectively blocked fibroblast adhesion to CCNl, whereas T2, T3, or T4 had no effect. The inhibitory effect of Tl on cell adhesion to CCNl was dose-dependent, achieving maximal inhibition at 100 μM (Fig. 5C). Other members of the CCN protein family, CCN2 (CTGF) and CCN3 (NOV), have also been shown to support fibroblast adhesion through integrin α^ (See Chen et al. (2001) J.Biol. Chem. 276, 10443-10452; Lin et al (2003) J.Biol Chem. In press), and a high degree of homology exists among the corresponding Tl sequences in these CCN proteins. Fig. 5A shows that Tl also specifically inhibited cell adhesion to CCN2 and CCN3, suggesting that the Tl sequence in CCN proteins is a common binding site for integrin α6βι.
[0075] To demonstrate further the specificity of Tl inhibition, we examined its ability to block cell adhesion to substrates that bind other integrins. In contrast to its dose-dependent inhibitory effect of cell adhesion to CCNl (Fig.5C), Tl had no significant effect on the adhesion of fibroblasts to fibronectin (ligand of integrin α5βι), vitronectin (ligand of av integrins), and collagen (ligand of β -integrins) (Fig. 5B). Cell adhesion to laminin, a known ligand for integrin 6β1? was partially inhibited by the Tl peptide (-15 %). This partial inhibition was similar to that achieved by the anti-a6 mAb GoH3 (data not shown). Incomplete inhibition by Tl and GoH3 was likely due to the presence of other integrins, such as α2βl5 that also serve as adhesion receptors for laminin. Together, these results show that the soluble Tl peptide specifically inhibits αeβi -dependent cell adhesion, thus providing further support that the Tl sequence contains a binding site for integrin α6βι. EXAMPLE 4 Effect of Alanine Substitutions in the Tl Sequence on Cell Adhesion .
[0076] To determine which residues within the Tl sequence are critical determinants for α6β dependent cell adhesion, we prepared a series of GST-peptide fusions that carries the Tl backbone with single or double alanine substitutions at residues conserved among CCNl, CCN2, and CCN3, and tested their abilities to support cell adhesion. To generate site-directed alanine substitutions for the Tl peptide (Fig. 6), synthetic oligonucleotides were annealed for PCR to generate the appropriate coding sequences and cloned into pGEX-4T-2. The following primers were used to prepare the coding sequence for the Tl sequence and cloned into pGEX-4T-2:
5'-GATCCGGTCAAAAATGTATTGTT.CAAACTACTTCTTGG TCTCAATGCTCTAAATCTGG-3' and
5 ' -AATTCC AGATTTAGAGCATTGAGACCAAGAAGTAGTA GTTTGAACAAT ACATTTTTGACCG-3 '
To create the mutant peptides, relevant codons were changed to either GCA or GCT for alanine.
[0077] As shown in Fig. 6, alanine substitutions at residues K226, 1228, or Q230 did not affect the peptide's ability to support cell adhesion. While single mutation at either T231 or T232 resulted in partial reduction of cell adhesion, combined alanine substitutions of T231 and T232 completely abolished the ability of Tl to support cell adhesion. In addition, single substitutions in W234, S235, S238, or K239 resulted in >90% loss of Tl activity. When mutations in W234 and K239 were combined, cell adhesion was completely obliterated. These results indicate that TTSWSQCSKS is the core sequence in Tl for mediating α6βι binding. These data also explain the inability of the T2 peptide, which overlaps with the Tl peptide but lacks the TT residues of the core sequence, to inhibit α6βι -dependent cell adhesion. EXAMPLE 5 Affinity Purification of Integrin α6βι Using a Tl-coupled Affinity Matrix
[0078] To confirm that the Tl peptide binds directly to integrin α6β we performed affinity chromatography using cell surface proteins on fibroblasts to isolate integrin α6βι on a Tl- coupled affinity column. Subconfluent 1064SK fibroblasts were detached with 2 mM EDTA and 0.05%BSA in PBS, washed thrice and resuspended in PBS containing 20 mM glucose at 2 x 107 cells/ml. For surfacing labeling, the cell suspension was incubated with 100 mU/ml glucose oxidase, 200 mg/ml lactoperoxidase (Calbiochem-Novabiochem, La Jolla, CA), and -400 mCi/ml carrier-free Na125I (Amersham Pharmacia Biotech) for 30-60 min at 4°C with gentle rotation. To terminate labeling, 10 ml cell culture medium was added. The labeled cells were washed and solubilized in 1 ml of lysis buffer (50 mM Hepes, pH 7.4, 200 mM octyl-b-D- glucopyranoside, proteinase inhibitor cocktail, and 0.5 mM Mn ). For affinity chromatography, GST-Tl or GST-scrambled Tl protein was coupled to Affi-Gel 10 (Bio-Rad Laboratories, Hercules, CA) at 10 mg/ml gel suspension. The labeled cell lysates were applied onto the affinity matrices (3 ml ml gel) and incubated for 2 h at 4 C. The columns were washed with 30 column volumes of lysis buffer followed by elution with 0.35 M NaCl in the lysis buffer. The labeled proteins in the eluted fractions were analyzed by electrophoresis on 7% polyacrylamide gels under non-reducing conditions followed by autoradiography. In immunoprecipitation analyses, labeled proteins were incubated with 5 mg anti-a6 (GoH3) or anti-av (P3G8) mAbs (Chemicon, Temecula, CA) as indicated. The immunoprecipitated proteins were collected on protein G- Sepharose and resolved on 7% polyacrylamide gels under non-reducing conditions.
[0079] A control column was prepared using GST fused to a scrambled Tl sequence, and no labeled protein band was eluted from the scrambled Tl-GST column (Fig.- 7A). By contrast, from the Tl-GST affinity column, two protein bands with apparent molecular weights corresponding to integrin a6 (-150 kDa) and b (-130 kDa) subunits were eluted at 0.35 M NaCl (lanes 5-7, Fig. 7B). To confirm that the bound labeled proteins was indeed the integrin α6βι complex, the eluates were subjected to immunoprecipitation using GoH3 (anti-a6) or P3G8 (anti- ay) as a control. Fig. 7C shows that GoH3 immunoprecipitated the labeled protein bands from the eluate, wherease P3G8 failed to pull down the protein complex in the control sample. Collectively, we conclude that integrin α6βι binds directly to the Tl sequence in CCNl. EXAMPLE 6 Soluble Tl peptide Disrupts CCNl-induced Endothelial Tubule Formation
[0080] Several CCN proteins including CCNl, CCN2, and CCN3 are potent angiogenic inducers. See Babic et al. (1998) Proc. Natl.Acad. Sci. U.S.A. 95, 6355-6360; Lin et al. (2003) J.BiolChem. In press; Babic et al. (1999) Mol.CellBiol 19, 2958-2966. Furthermore, when formulated into collagen gel, CCNl is capable of inducing tubule formation of unactivated human umbilical vein endothelial cells (HUVECs), and this process is blocked by the anti-a6 mAb GoH3. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255. Since the Tl sequence represents a major binding site for integrin α6βι in CCNl, we examined whether soluble Tl peptide would inhibit CCNl-induced tubule formation of unactivated HUVECs. To assay for endothelial cell tubule formation, human umbilical vein endothelial cells (HUVECs) were examined in a three-dimensional collagen gel in the presence or absence of test proteins or peptides as described. See Leu et al. (2002) J. Biol. Chem. 277, 46248-46255.
As shown in Fig. 8, when collagen gels are formulated with CCNl, human umbilical vein endothelial cells are induced to form tubules. Preincubation of HUVECs with Tl (0.2 mM) for 30 min prior to plating completely inhibited CCNl-induced tubule formation. By contrast, the control T2, T3 and T4 peptides had no effect. Together, these results indicate that Tl inhibits CCNl-induced tubule formation by blocking the interaction of CCNl with integrin α6βi on unactivated HUVECs.
EXAMPLE 7 Construction of mutant peptides inactivated at Tl binding site for, integrin
Figure imgf000032_0001
[0081] Several CCN proteins including CCNl, CCN2, and CCN3 are potent angiogenicWhile useful in the determination of a novel
Figure imgf000032_0002
binding site, the alanine-substituted GST-Tl fusion peptides described in Example 4 proved unsuitable for determination of the functional role of the Tl site in CCNl activities. The expressed mutants aggregated and formed inclusion bodies inside the cell (data not shown), suggesting that these mutants adopted detrimental conformations that prevented them from being secreted. To create mutants specifically inactivated in Gfeβj-HSPG-mediated activities while preserving other functions, we constructed
fusion proteins using two algorithms, PSJJPRED and FRAGFOLD (McGuffm, L. J., Bryson, K., and Jones, D. T. (2000) Bioinformatics. 16, 404-405, and Jones, D. T. (2001) Proteins Suppl 5, 127-132) to predict possible changes in secondary structures that could result from possible mutations.
[0082] We prepared GST fusion proteins of CCNl peptides and mutant peptides according to methods described in Leu, S. J., Liu, Y., Chen, N., Chen, C. C, Lam, S. C, and Lau, L. F. (2003) J. Biol. Chem. 278, 33801-33808.
[0083] Mouse CCNl engineered with a C-terminal FLAG tag was constructed by using the primer sets upon the mouse Ccnl cDNA as template
FI: 5'-CGCAATTGGAAAAGGCAGCTCACTGAAGAGGC-3* and
F2:5'-CCGGAATTCCTACTTGTCATCGTCATCCTTGTAGTCGTCCCTGAA CTTGTGGATGTCATTG-3',
thus yielding a PCR product containing the last codon of Ccnl followed by the FLAG tag coding sequence and a stop codon. The PCR product was double digested with Ncol and EcoRI, and ligated into pre-cut vector to substitute the Ncol, EcøRI-digested fragment of the full-length mouse Ccnl cDΝA in pBlueBac4.5 vector (Grzeszkiewicz, T. M., Kirschling, D. J., Chen, Ν., and Lau, L. F. (2001) J. Biol. Chem. 276, 21943-21950). For consistency, WT CCΝ1 and all mutants used in this study were similarly constracted with the same Ν-terminal secretory signal and C-terminal FLAG epitope tag.
[0084] Consistent with the inability of alanine substitution mutants to be secreted, the Tl region of CCΝ1 appeared highly sensitive to perturbation. Substitutions in the critical Tl residues (W234, S235, S238, K239) with nearly any amino acid resulted in drastic changes in the predicted protein structure. However, we found one mutation, namely K239E, that did not elicit a predicted conformational change. To test the efficacy of this mutation in disrupting interaction with otββi, we constructed a fusion protein with GST linked to the Tl peptide where the Tl peptide carried the K239E mutation (GQKCINATTSWSQCSES).
EXAMPLE 8 Evaluation of adhesion of mutant CCΝ1 peptide inactivated at Tl binding site for integrin (%>β\
[0085] We assessed fibroblast adhesion to the T1(K293E) mutant peptide constructed according to Example 7 as compared to GST-Tl fusion with the WT sequence. GST-Tl and GST- Tl (K239E) have similar coating efficiency as determined by ELISA (data not shown).
[0086] We plated fibroblasts on microtiter wells coated with either GST, GST-Tl peptide fusion, or GST-Tl (K239E) peptide fusion protein (50 μg/ml each). Cells were allowed to adhere at 37°C for 20 min. After washing, adherent cells were fixed, stained with methylene blue, and quantified by absorbance at 620 nm.
[0087] As expected, fibroblasts adhered to the GST-Tl fusion but not to BSA nor the GST control (Fig. 9B). See also Leu, S. J., Liu, Y., Chen, Ν., Chen, C. C, Lam, S. C, and Lau, L. F. (2003) J. Biol Chem. 278, 33801-33808. GST-T1(K239E) was completely unable to support cell adhesion, indicating that the charge-reversed K239E mutation may be sufficient to abolish Tl binding to integrin o^β .
EXAMPLE 9 Construction of mutant CCΝ1 inactivated at Tl binding site for integrin
Figure imgf000034_0001
[0088] We constmcted the K239E single mutation in the context of full length CCΝ1, designated SM (Fig. 9A) using site-directed mutagenesis using a two-step PCR procedure as described in Koskinen, P., Lehvaslaiho, H., MacDonald Bravo, H., Alitalo, K., and Bravo, R. (1990) Oncogene. 5, 615-618. The internal primer sets were 5'-GTCTTGGTCCCAGTGTTCCGAGAGCTGCGG-3' and 5'-CACTGGGACCAAGACGTGGTCTGAACGATGC-3'.
This construct also created a silent mutation at C237, thereby providing a screening marker by eliminating a BSP12861 restriction site. The outside primers used in PCR were FI and F2 as described in Example Ai above. SM was constructed using the mouse Ccnl cDNA with a FLAG tag as PCR template.
[0089] We also constructed the DM coding sequence, which has disrupted heparin binding sites HI and H2 as shown in Fig. 9A. These mutations changed HI from KGKKCSKTKKSPEPVR to AGAACSATAKSPEPVR and H2 from FTYAGCSSVKKYRPKY to FTYAGCSSVAAYAPKY, in the same background as CCNl. We used the DM coding sequence to generate the DM construct with a FLAG tag using the procedure described above. We created the TM sequence using DM as a template to generate the K239E mutation using the methods described above. All constructs were confirmed by direct sequence analysis.
EXAMPLE 10 SM Assay-Disrupted Tl binding site, uninterrupted heparin binding sites
[0090] We plated 1064SK human fibroblasts on microtiter wells coated with the indicated amounts of recombinant WT CCNl or SM mutant, and assessed cell adhesion as described in Example 1. Surprisingly, SM was able to support fibroblast adhesion in a dose-dependent manner much like WT CCNl, achieving maximal cell adhesion at a coating concentration of 1 μg/ml (Fig. 10A). This result demonstrates that SM may still support cell adhesion through the ctsβ -HSPGs coreceptors, indicating that there may be other potential αeiδ HSPG-bindmg sites not yet identified, or that the HI and H2 heparin binding sites may be sufficient to support cell adhesion through the
Figure imgf000035_0001
coreceptor complex.
EXAMPLE 11 SM Assay-Disrupted Tl binding site, inhibition of heparin binding sites
[0091] Because SM retains intact heparin binding sites, we tested whether cell adhesion to SM is dependent on HSPGs. We treated fibroblasts with either heparinase I (2 units/ml) or chondroitinase ABC (2 units/ml) (both from Sigma, St. Louis, MO) prior to adhesion to microtiter wells coated with WT CCNl' (2 μg/ml), SM (2 μg/ml) or VN (0.5 μg/ml). Control cells were left untreated. Where indicated, soluble heparin was present at 1 μg/ml in the culture medium.
[0092] As expected, either the presence of soluble heparin that saturates the CCNl heparin binding sites, or treatment of cells with heparinase I to damage cell surface HSPGs was able to block cell adhesion to WT CCNl. See Chen, N., Chen, C. C, and Lau, L. F. (2000) J. Biol. Chem. 275, 24953-24961. Likewise, cell adhesion to SM was similarly inhibited by soluble heparin and heparinase treatment, indicating that interaction of cell surface HSPGs with SM is critical for cell adhesion to this CCNl mutant. Treatment of cells with chondroitinase ABC had no effect, confirming the specific involvement of HSPGs rather than chondroitin sulfate proteoglycans in CCNl actions.
EXAMPLE 12 DM Assay - Uninterrupted Tl binding site, disrupted heparin binding site
[0093] To further assess the role of heparin binding in CCNl functions, we examined the effects of eliminating heparin binding activity using DM mutants as described at Example 9. Mutations in the basic residues of HI or H2, reduced heparin binding, and combining mutations in both HI and H2 as shown in Fig. 9A obliterated heparin binding activity in CCNl (Chen, N., Chen, C. C, and Lau, L. F. (2000) J. Biol. Chem. 275, 24953-24961). Because DM has lost heparin binding activity but retains the Tl
Figure imgf000036_0001
binding site, we postulated that DM would be compromised in θ6/3ι-coreceptor-mediated activities, but might be able to support cell adhesion through
Figure imgf000036_0002
at high coating concentrations analogous to cell adhesion to GST-Tl peptide fusion proteins (Fig. 9B).
[0094] Indeed, whereas cell adhesion to CCNl reached a plateau at 1 μg/ml (Fig. 10A), DM failed to support cell adhesion unless coated at much higher concentrations as an adhesive substrate, with maximal adhesion occurring at 50-100 μg/ml (Fig. 11A).
EXAMPLE 13 TM Assay - Disrupted Tl binding site, disrupted heparin binding site .
[0095] As described in Example 9, we also created a mutant (TM) that combined the K293E mutation in the DM background, thereby disrupting the Tl binding site for ct$β\ as well as the HI and H2 binding sites for heparin.
[0096] Strikingly, TM was unable to support cell adhesion at any concentration tested, remaining completely ineffective even when coated at 250 μg/ml. This observation indicates that DM may be able to support cell adhesion specifically through oiββi, and this activity is eliminated by the K239E mutation in the Tl binding site for
Figure imgf000037_0001
EXAMPLE 14 Use of anti-integrins to evaluate cell adhesion of DM
[0097] To verify the elimination of c^β\ adhesion activity by the K239E Tl mutation, we examined whether DM-supported cell adhesion was mediated through
Figure imgf000037_0002
We preincubated cells with 40 μg/ml of function-blocking mAb against integrin αv/33 (LM609), integrin ofe (GoH3), or integrin β\ subunit (P4C10, 1:50 ascites) at room temperature for 1 h prior to plating. We then assessed cell adhesion as described above.
[0098] Consistently, anti-integrin % (GoH3) or β (P4C10) mAbs blocked DM- or CCN1- supported fibroblast adhesion, whereas the anti-αvft mAb LM609 had no effect (Fig. 1 IB). Together, these results show that fibroblast adhesion to CCNl requires the
Figure imgf000037_0003
coreceptors interacting with three binding sites: Tl, HI, and H2. Mutations in HI and H2 (DM) still allow cell adhesion through
Figure imgf000037_0004
at high coating concentrations, whereas disruption of all three sites (TM) completely abolishes cell adhesion through Oδft-HSPGs (Fig. 11 A).
EXAMPLE 15 MAPK activation
[0099] CCNl has the unusual ability to induce sustained activation of p42/p44 MAPKs as an adhesion substrate (Chen, C-C, Chen, N., and Lau, L. F. (2001) J. Biol. Chem, 276, 10443- 10452). To test the effect of mutations in the Tl, HI and H2 binding sites for this activity, fibroblasts were adhered to WT CCNl, SM, DM, or laminin for various durations (Fig. 12A). To evaluate MAPK activation, 1064SK fibroblasts were serum-starved, resuspended in serum- free medium at 6 x 105 cells/ml and plated on 35 mm dishes pre-coated with CCNl (10. μg/ml), SM (10 μg/ml), DM (250 μg/ml), or laminin (10 μg/ml) for 1-5 hrs as indicated. Clarified- cell lysates were electrophoresed on 10% SDS-PAGE and immunoblotted with polyctonal anti- MAPK antibodies, or antibodies specific for dually phosphorylated p42/p44 MAPKS (Progema, Madison, WI).
[0100] As shown in Fig. 12 A, cells adhered to laminin resulted in a rapid and transient activation of p42/p44 MAPKs typical of cell adhesion to ECM substrates, with activation reaching maximal level 1 hr after plating and declining to background level thereafter. In contrast, activation of MAPKs in cells adhered to WT CCNl or SM was sustained to a large extent even 5 hrs after plating. This prolonged MAPK activation was lost in cells adhered to DM. Thus, mutations in the HI and H2 sites had no effect on short-term activation of MAPKs, but specifically abrogated the ability of CCNl to induced sustained MAPK activation.
EXAMPLE 16 Regulation of gene expression
[0101] CCNl activates a genetic program in fibroblasts, leading to the upregulation of genes encoding proteins involved in angiogenesis and matrix metabolism, including the angiogenic inducer VEGF and matrix metalloproteinase MMP-1 (Chen, C-C, Chen, N., and Lau, L. F. (2001) J. Biol. Chem. 276, 10443-10452). Because activated MAPKs are translocated into the nucleus where they can phosphorylate and activate transcription factors (Hazzalin, C. A. and Mahadevan, L. C (2002) Nat. Rev. Mol. Cell Biol. 3, 30-40), the loss of sustained MAPK activation may alter the ability of CCNl to regulate gene expression.
[0102] To test the loss of sustained MAPK activity on the ability of soluble CCNl (WT) and CCNl mutants (SM, DM, TM) to regulate gene expression, we treated serum-starved primary human skin fibroblasts with 10 μg/ml of protein in serum- free condition for 24 hrs. Total cellular RNA was isolated, resolved on agarose-formaldehyde gel and blotted onto nylon membrane using standard protocols. We generated radioactive cDNA probes by random primer labeling incoφorating 32P-dCTP into human NEGF-A, MMP-1, and GAPDH cDΝAs as described (Chen, C-C, Chen, Ν., and Lau, L. F. (2001) J. Biol. Chem. 276, 10443-10452). We then washed the blots at high stringency (0.1 x SSC; 0.1% SDS at 65°C) and analyzed them using Phosphorimager (Molecular Dynamics, Sunnyvale, CA). Expression of Feg and MMP-1 was evaluated by RNA blotting (20 μg of total RNA in each lane) following electrophoresis, and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was monitored as a control.
[0103] As shown in Fig. 12B, SM was able to upregulate Vegf and MMP-1 expression similar to WT CCNl, whereas DM and TM were completely defective in this activity. Thus, the heparin binding sites HI and H2 are required for both prolonged activation of MAPKs and upregulation of Vegf and MMP-1 expression.
EXAMPLE 17 HUVEC adhesion and migration to CCNl mutants through integrin αv/33
[0104] We examined the adhesion of activated HUVECs to CCNl mutants. HUVECs detached in 2.5 mM EDTA and resuspended in serum-free medium were adhered to wells pre-coated with 15 μg/ml of wild type CCNl (WT) or SM, or 50 μg/ml of DM or TM. Where indicated, we treated the cells with EDTA (5 mM), GRGDSP peptide (RGDS, 0.2 mM), anti- vβ3 mAb LM609 (40 μg/ml), anti-c^ mAb GoH3 (40 μg/ml) for 60 min prior to plating. Cell adhesion was measured as described.
[0105] Both WT CCNl and SM supported cell adhesion to a similar extent (Fig. 13 A). HUVEC adhesion to both WT and SM were completely inhibited by EDTA and partially inhibited by GRGDSP peptide or the anti-αv/33 mAb LM609, indicating the involvement of integrin αvβ3. Cell adhesion was also partially inhibited by the anti-c^ mAb GoH3, consistent with a contribution from the α βi -HSPG coreceptors (Leu, S.-J., Lam, S. C. T., and Laii, L. F. (2002) J. Biol. Chem. 277, 46248-46255). In contrast, HUVEC adhesion to DM and TM was completely inhibited by EDTA, GRGDSP peptide and LM609, but not at all by GoH3. These results indicate that DM and TM can support activated HUVEC adhesion through αV|S3, but have lost the ability to support
Figure imgf000039_0001
adhesion. EXAMPLE 18 Migration of HUVECs to CCNl or mutants
[0106] Using a modified Boyden chamber assay, we found that WT CCNl and mutants in the ct β i -HSPG binding sites were able to stimulate HUVEC migration (Fig. 13B). Migration of HUVECs to CCNl or mutants were evaluated using Transwell chambers. 15 μg/ml of CCNl WT or mutant SM, 50 μg/ml of mutant DM or TM was immobilized on the lower surface of the Transwell membrane that separated the two chambers. HUVECs were treated with 100 nM PMA for 30 min to activate integrin receptors. Where indicated, prior to plating in the upper, chamber, cells were preincubated with vehicle buffer (No Add), normal mouse IgG (100 μg/ml) (Sigma, St. Louis, MO), GoH3 (50 μg/ml) (Chemicon, Temecula, CA), LM609 (50 μg/ml) (Immuno tech, Marseille, France) for another 30 min. Cells were allowed to migrate for 8 h, and those migrated to the lower chamber were counted in 10 random high power fields.
[0107] Cell migration to CCNl and all mutants was completely inhibited by the anti- v/33 mAb LM609, whereas the anti-ofe mAb GoH3 had no effect. Thus, CCNl mutants with disrupted c^β HSPG binding sites are capable of stimulating γ β3-dependent HUVEC migration, similar to WT.
EXAMPLE 19 Enhancement of VEGF-induced DNA Synthesis through integrin avβ3
[0108] CCNl enhances growth factor-induced DNA synthesis without being mitogenic on its own. See Kireeva, M. L., Mo, F.-E., Yang, G. P., and Lau, L. F. (1996) Mol Cell Biol. 16, 1326-1334. We preincubated HUVECs with vehicle buffer (No Add), LM609 (25 μg/ml), GoH3 (25 μg/ml), or normal mouse IgG (25 μg/ml) for lh. We then treated the cells with VEGF (5 ng/ml) and/or CCNl or mutant proteins (5 μg/ml each) in the presence of [3H]thymidine, incoφoration of which was assessed 48 h thereafter. Data shown are mean ± S.D. of three determinations and representative of three experiments.
[0109] As expected, VEGF (5 ng/ml) treatment induced DNA synthesis in HUVECs, whereas addition of CCNl or mutants by themselves had no effect (Fig. 14). Treatment of cells with CCNl, SM, DM or TM in the presence of VEGF, however, enhanced VEGF-induced DNA synthesis by -2 -fold. LM609 blocked this enhancement, thus reducing DNA synthesis to the level induced by VEGF alone. In contrast, neither control IgG nor GoH3 had any effect. Thus, SM, DM and TM are all able to enhance growth factor-induced DNA synthesis in endothelial cells through integrin a β 3, similar to WT CCNl .
EXAMPLE 20 CCNl mutants promote HUVEC survival
[0110] We have previously established that CCNl promotes endothelial cell survival under conditions of growth factor deprivation through integrin αv/33. See Leu, S.-J., Lam, S. C. T., and Lau, L. F. (2002) J. Biol. Chem. 277, 46248-46255. To ascertain whether the CCNl mutants can promote cell survival, we examined their effects in HUVECs plated on laminin using a TUNEL assay (Fig. 15). Serum-starved HUVECs were allowed to attach to coverslips pre-coated with 20 μg/ml laminin (LN) for 4 hr. We then added serum, CCNl or mutant proteins (5 μg/ml each) for an additional 16 h. Cells were fixed and apoptosis was monitored by using a TUNEL assay. Where indicated, we preincubated polyclonal anti-CCNl antibodies with test reagents for 30 min prior to addition into medium.
[0111] Very few apoptotic cells were detected when cells were maintained in 20% serum, whereas >70% of cells were apoptotic in serum-free medium. The addition of CCNl, SM, DM, or TM all reduced the number of apoptotic cells by -40%. This effect was reversed by the presence of anti-CCNl antibodies, indicating that promotion of cell survival is an activity of the CCNl polypeptides. HUVECs treated under the same conditions were also monitored for DNA synthesis (data not shown). Consistent with results shown in Fig. 14, the rate of DNA synthesis was unaffected by the presence of CCNl or mutants alone, indicating that the increase of non- apoptotic cells was not due to increased cell proliferation. These results show that the CCNl mutants are still able to promote endothelial cell survival under conditions of growth factor deprivation, an activity mediated through αv/33.
EXAMPLE 21 Tubule formation
[0112] CCNl also induces tubule formation in activated endothelial cells through integrin αv/3 when cultured in collagen gel. See Leu, S.-J., Lam, S. C. T., and Lau, L. F. (2002) J. Biol. Chem.
277, 46248-46255. To examine this activity in the CCNl mutants, HUVECs were either treated with vehicle buffer (no add) or stimulated with 5 nM PMA in serum-free medium before being plated on 24-well plates pre-coated with type I collagen gel (2 mg/ml) in the absence (-) or presence of CCNl (WT) or TM (20 μg/ml each). A second layer of gel of identical formulation was overlaid on the attached cells, and tubule formation was assessed 16 h thereafter. Where indicated, LM609 (40 μg/ml) or GoH3 (40 μg/ml) was added to cell suspensions prior to plating. Results are representative of three experiments (x 200 magnification).
[0113] Unstimulated HUVECs showed no tubule formation in the absence of CCNl, and 20 μg/ml CCNl did not induce tubule formation (Fig. 16). PMA-activated HUVECs, however, responded to WT CCNl or TM by forming tubules. Addition of LM609 (40 μg/ml) to cell suspension prior to plating inhibited tubule formation, whereas addition of GoH3 (40 μg/ml) had no effect. The same results were obtained with SM and DM (Data not shown). These results show that CCNl mutants are capable of inducing αvft-dependent tubule formation in activated endothelial cells.

Claims

CLAIMS 1. An isolated CCNl fragment comprising x amino acids, wherein the sequence of said fragment is within a sequence selected from the group consisting of: (a) amino acids 224-240 of murine CCNl ; (b) amino acids 231-240 of murine CCNl; (c) amino acids 226-242 of human CCNl; and (d) amino acids 233-242 of human CCNl, or a variant, analog, homolog or derivative of said fragment, provided that x is from 8 to 50.
2. A method of screening for a modulator of angiogenesis comprising: (a) contacting a first biological sample capable of undergoing angiogenesis with an ECM signaling molecule and a suspected modulator; (b) contacting a second biological sample with an ECM signaling molecule; and (c) comparing the level of angiogenesis resulting from step (a) and from step (b), whereby a modulator of angiogenesis is identified by its ability to alter the level of angiogenesis when compared to step (b), wherein said ECM signaling molecule is a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative thereof.
3. The method of claim 2 wherein the biological samples of steps (a) and (b) are also contacted with one or more CCN polypeptides selected from the group consisting of CCNl, CCN2, CCN3, CCN4, CCN5 and CCN6, or a fragment, variant, analog, homolog or derivative of said one or more CCN polypeptides.
4. A method of screening for a modulator of angiogenesis comprising: (a) implanting a first implant comprising an ECM signaling molecule and a suspected modulator in a first cornea of a test animal; (b) implanting a second implant comprising an ECM signaling molecule in a second cornea of said test animal; (c) comparing the development of blood vessels from step (a) and step (b), whereby a modulator of angiogenesis is identified by its ability to alter the level of blood vessel development in step (a) when compared to the blood vessel development in step (b). wherein said ECM signaling molecule is a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative thereof.
5. The method of claim 4 wherein the implants of steps (a) and (b) further comprise one or more CCN polypeptides selected from the group consisting of CCNl, CCN2, CCN3, CCN4, CCN5 and CCN6, or a fragment, variant, analog, homolog or derivative of said one or more CCN polypeptides.
6. A method of screening for a modulator of oncogenesis comprising: (a) administering an ECM signaling molecule and a suspected modulator to a first tumor; (b) administering an ECM signaling molecule to a second tumor; and (c) comparing the level of oncogenesis resulting from step (a) and from step (b), whereby a modulator of oncogenesis is identified by its ability to alter the level of oncogenesis when compared to step (b), wherein said ECM signaling molecule is a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative thereof.
7. The method of claim 6 wherein the tumors of steps (a) and (b) are also administered one or more CCN polypeptides selected from the group consisting of CCNl, CCN2, CCN3, CCN4, CCN5 and CCN6, or a fragment, variant, analog, homolog or derivative of said one or more CCN polypeptides.
8. A method of screening for a modulator of cell adhesion comprising: (a) adding an ECM signaling molecule and a suspected modulator to a first biological sample on a surface compatible with cell adherence; (b) adding an ECM signaling molecule to a second biological sample on a surface compatible with cell adherence; and (c) comparing the levels of cell adhesion measured in step (a) and step (b), whereby a modulator of cell adhesion is identified by its ability to alter the level of cell adhesion when compared to step (b), wherein said ECM signaling molecule is a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative thereof.
9. The method of claim 8 wherein the biological samples of steps (a) and (b) are also administered one or more CCN polypeptides selected from the group consisting of CCNl, CCN2, CCN3, CCN4, CCN5 and CCN6, or a fragment, variant, analog, homolog or derivative of said one or more CCN polypeptides.
10. A method of screening for a modulator of cell migration comprising the steps of: (a) seeding cells capable of undergoing cell migration onto a first gel matrix comprising an ECM signaling molecule and a suspected modulator; (b) seeding cells capable of undergoing cell migration onto a second gel matrix comprising an ECM signaling molecule; and (c) comparing the levels of cell migration measured in step (a) and step (b), whereby a modulator of cell migration is identified by its ability to alter the level of cell migration when compared to step (b), wherein said ECM signaling molecule is a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative thereof.
11. The method of claim 10 wherein the matrixes of (a) and (b) further comprise one or more CCN polypeptides selected from the group consisting of CCNl, CCN2, CCN3, CCN4, CCN5 and CCN6, or a fragment, variant, analog, homolog or derivative of said one or more CCN polypeptides.
12. A modulator identified by any one of the methods according to claims 2-11.
13. A pharmaceutical composition comprising a modulator according to claim 12 and a pharmaceutically acceptable adjuvant, diluent, or carrier.
14. A pharmaceutical composition comprising a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative thereof, and a pharmaceutically acceptable adjuvant, diluent, or carrier.
15. An antibody that specifically binds to a CCNl fragment according to claim 1 or a fragment, variant, analog, homolog or a derivative of said CCNl fragment.
16. A pharmaceutical composition comprising an antibody according to claim 15 and a pharmaceutically acceptable adjuvant, diluent, or carrier.
17. A method of modulating CCNl in a patient comprising administering to a patient in need thereof a compositon according to any one of claims 14-16.
PCT/US2004/019766 2003-06-20 2004-06-21 Ccn1 compositions and methods WO2005040191A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP04809453A EP1636251A4 (en) 2003-06-20 2004-06-21 Ccn1 compositions and methods
CN2004800232747A CN1835763B (en) 2003-06-20 2004-06-21 CCN1 compositions and methods
HK07102927.7A HK1095743A1 (en) 2003-06-20 2007-03-19 Ccn1 compositions and methods ccn1

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US48016103P 2003-06-20 2003-06-20
US60/480,161 2003-06-20

Publications (2)

Publication Number Publication Date
WO2005040191A2 true WO2005040191A2 (en) 2005-05-06
WO2005040191A3 WO2005040191A3 (en) 2006-03-23

Family

ID=34519960

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/019766 WO2005040191A2 (en) 2003-06-20 2004-06-21 Ccn1 compositions and methods

Country Status (5)

Country Link
EP (1) EP1636251A4 (en)
CN (1) CN1835763B (en)
HK (1) HK1095743A1 (en)
TW (1) TWI356097B (en)
WO (1) WO2005040191A2 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010139469A2 (en) 2009-06-04 2010-12-09 F. Hoffman-La Roche Ag Antibodies against human ccn1 and uses thereof
WO2011014594A1 (en) * 2009-07-29 2011-02-03 Corning Incorporated Peptide-polymer cell culture articles and methods of making
US8563312B2 (en) 2008-01-30 2013-10-22 Geron Corporation Synthetic surfaces for culturing stem cell derived cardiomyocytes
US8828417B2 (en) 2007-08-06 2014-09-09 Corlife Ohg Bioactive coating for an implantable device or bioprosthesis
CN107312864A (en) * 2017-08-14 2017-11-03 中国医学科学院北京协和医院 A kind of WISP3 gene mutations and its application for PPD auxiliary diagnosis
US10221390B2 (en) 2008-01-30 2019-03-05 Asterias Biotherapeutics, Inc. Synthetic surfaces for culturing stem cell derived oligodendrocyte progenitor cells

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104749371B (en) * 2013-12-30 2016-09-28 神州细胞工程有限公司 People's nephroblastoma overepressed gene encoding proteins enzyme linked immunological kit
CN105396136B (en) * 2015-11-23 2018-10-30 上海交通大学医学院附属第九人民医院 CCN1（Cyr61）Application in treatment skin injury and atrophoderma relevant disease
CN107505462A (en) * 2017-08-14 2017-12-22 上海市同仁医院 A kind of Cyr61 protein detection kits and its application method
EP3795170B1 (en) * 2018-05-17 2024-03-20 Olives Biotherapeutics Inc. Pharmaceutical composition comprising ccn5 as active ingredient for preventing or treating retinal diseases
CN114324526B (en) * 2021-12-27 2023-06-27 青岛农业大学 Biosensor for detecting prostate specific antigen in human serum and preparation method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1071954A (en) * 1992-11-20 1993-05-12 沈阳市胸科医院 Method for pretreatment of specimen used in examining tubercle bacillus by polyase chain reaction
DK0888452T3 (en) * 1996-03-15 2004-06-14 Munin Corp Human CYR61, an extracellular matrix signaling molecule
ATE360643T1 (en) * 2000-01-31 2007-05-15 Munin Corp HUMANE CYR61

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None
See also references of EP1636251A4

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8828417B2 (en) 2007-08-06 2014-09-09 Corlife Ohg Bioactive coating for an implantable device or bioprosthesis
US8563312B2 (en) 2008-01-30 2013-10-22 Geron Corporation Synthetic surfaces for culturing stem cell derived cardiomyocytes
US9745550B2 (en) 2008-01-30 2017-08-29 Asterias Biotherapeutics, Inc. Synthetic surfaces for culturing stem cell derived cardiomyocytes
US10221390B2 (en) 2008-01-30 2019-03-05 Asterias Biotherapeutics, Inc. Synthetic surfaces for culturing stem cell derived oligodendrocyte progenitor cells
WO2010139469A2 (en) 2009-06-04 2010-12-09 F. Hoffman-La Roche Ag Antibodies against human ccn1 and uses thereof
US8207307B2 (en) 2009-06-04 2012-06-26 Hoffmann-La Roche Inc. Antibodies against human CCN1 and uses thereof
WO2011014594A1 (en) * 2009-07-29 2011-02-03 Corning Incorporated Peptide-polymer cell culture articles and methods of making
CN107312864A (en) * 2017-08-14 2017-11-03 中国医学科学院北京协和医院 A kind of WISP3 gene mutations and its application for PPD auxiliary diagnosis
CN107312864B (en) * 2017-08-14 2021-03-05 中国医学科学院北京协和医院 WISP3 gene mutation for PPD auxiliary diagnosis and application thereof

Also Published As

Publication number Publication date
CN1835763A (en) 2006-09-20
TW200513531A (en) 2005-04-16
HK1095743A1 (en) 2007-05-18
EP1636251A4 (en) 2009-07-29
EP1636251A2 (en) 2006-03-22
CN1835763B (en) 2011-04-20
WO2005040191A3 (en) 2006-03-23
TWI356097B (en) 2012-01-11

Similar Documents

Publication Publication Date Title
US5641869A (en) Method for purifying heregulin
US5607918A (en) Vascular endothelial growth factor-B and DNA coding therefor
US5367060A (en) Structure, production and use of heregulin
EP1469878B1 (en) Fgfr agonists
CA2038398C (en) Dna encoding a growth factor specific for epithelial cells
Nishiyama et al. Expression of NG2 proteoglycan causes retention of type VI collagen on the cell surface.
US20050221434A1 (en) Receptor of the EDb-fibronectin domains
US20090123462A1 (en) Fgfr agonists
WO2005040191A2 (en) Ccn1 compositions and methods
JP2005170952A (en) Slit polypeptide and method of modulation of robo with ligand
US8512960B2 (en) 88kDa tumorigenic growth factor and antagonists
AU3656893A (en) Polypeptides with fibronectin binding sites as modulators for matrix assembly
US7276587B2 (en) Antibodies to EGFH2 polypeptides
EP1608970A2 (en) Ccn3 compositions and methods
US7192702B2 (en) Modulators of the interaction between Arp2/3 and cortactin or HS-1
US20040234526A1 (en) Use of a compound antagonist of esm-1 protein for producing a medicine for treating cancer
JP2003510029A (en) EGFH2 gene and gene product
ZA200302629B (en) Receptor in the EDb fibronectin domain.
CA2595935A1 (en) Therapeutic peptides derived from urokinase plasminogen activator receptor
UA78684C2 (en) METHOD FOR DETECTING CHEMICAL COMPOUNDS THAT BOND TO EDb DOMAIN OR EDb DOMAIN RECEPTOR OF COLD-INSOLUBLE GLOBULIN
MXPA97009294A (en) Tissue growth factor connect

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480023274.7

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004809453

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2004809453

Country of ref document: EP