WO2005031363A1 - Preparation membranaire tiree de pichia pastoris pour tester l'activite gamma-secretase - Google Patents

Preparation membranaire tiree de pichia pastoris pour tester l'activite gamma-secretase Download PDF

Info

Publication number
WO2005031363A1
WO2005031363A1 PCT/US2004/031230 US2004031230W WO2005031363A1 WO 2005031363 A1 WO2005031363 A1 WO 2005031363A1 US 2004031230 W US2004031230 W US 2004031230W WO 2005031363 A1 WO2005031363 A1 WO 2005031363A1
Authority
WO
WIPO (PCT)
Prior art keywords
pichia pastoris
secretase
secretase activity
presenilin
psl
Prior art date
Application number
PCT/US2004/031230
Other languages
English (en)
Inventor
Sangram S. Sisodia
Chunjiang Yu
Original Assignee
University Of Chicago
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Chicago filed Critical University Of Chicago
Publication of WO2005031363A1 publication Critical patent/WO2005031363A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics

Definitions

  • the present invention relates generally to screening methods for identifying molecules that interact with and regulate proteins of interest. More particularly, it concerns the development of screening methods to identify molecules that inhibit ⁇ -secretase activity.
  • AD Alzheimer's disease
  • AD is the most common type of progressive dementia in the elderly. AD is characterized by initial memory loss, followed by progressive loss of neurons leading to dementia and loss of all nervous functions, and eventually death. AD is now the fourth-largest killer of adults 65 and older, and this disease impacts about one of every three families in the United States, and affects over 13 million people world- wide. As the population trends lead to an increase in the number of older people, this figure will only increase. A subset of AD is classified as familial early-onset AD (FAD) where onset of the disease begins as early as the fourth to sixth decade of life. FAD is an inherited autosomal dominant disorder.
  • FAD familial early-onset AD
  • PS polytopic membrane proteins
  • PSl and PS2 polytopic membrane proteins
  • FAD protein-induced taurine deposition
  • a ⁇ ⁇ -amyloid
  • APP amyloid precursor protein
  • PSl and PS2 Two lines of evidence demonstrate the involvement of PS (PSl and PS2) in A ⁇ production. First, A ⁇ production is abrogated in PSl deficient PS1 " " ) cells.
  • FAD-linked mutant PSl increases the production of highly fibrillogenic A ⁇ 42 peptides.
  • the PS proteins mediate the cleavage of APP and also facilitate proteolytic processing of other transmembrane (TM) proteins such as APP homologues, APLPl, Notch 1, Irel, and likely other yet unidentified proteins.
  • TM transmembrane
  • PSl SEQ ID NO:l, nucleotide; SEQ ID NO:2, amino acid
  • a 467 amino acid polytopic membrane protein accumulates as -30 kDa N-terminal (NTF) and ⁇ 20 kDa C-terminal (CTF) derivatives in mammalian cells and tissues.
  • NTF N-terminal
  • CTF C-terminal
  • the conversion of PSl holoprotein to the activated NTF/CTF form is necessary for ⁇ -secretase activity.
  • the NTF and CTF are the "functional" units, and are known to associate with additional membrane proteins, termed nicastrin, APH-1 and PEN-2 in high molecular weight complexes. The accumulation of each of these constituents is dependant on the expression of other components of the complex.
  • PSl presenilin 1
  • a ⁇ small ⁇ 4 kDa peptides
  • ⁇ -secretase activity can be reconstituted in Saccharomyces cerevisiea, an organism lacking endogenous ⁇ -secretase activity, by co-expressing PSl, nicastrin, APH-1, and PEN-2. Nucleotide and amino acid sequences for any of these genes can readily be obtained by methods known to those of skill in the art from publications and computer databases such as Genbank. While Edbauer et al. provides proof of principle that ⁇ -secretase activity can be reconstituted in an amenable model system, it fails to suggest that such a system could be used to identify compounds that modulate ⁇ -secretase activity nor does it suggest any parameters that could be changed to enhance the system's ability to identify ⁇ -secretase modulators.
  • the present invention overcomes the above-described deficiencies in the art and provides a transgenic Pichia pastoris and screening methods for the identification of compounds that modulate ⁇ -secretase activity.
  • the inventors have generated P. pastoris strains that express PSl, APH-1, nicastrin, and PEN-2 individually, and in all possible combinations.
  • the inventors have generated similar P. pastoris strains in which PSl is epitope tagged with a Tandem Affinity Purification tag (TAP) that allows the purification of the complex away from other proteins present in the solubilized membrane preparation.
  • TAP Tandem Affinity Purification tag
  • the inventors have also generated a P. pastoris strain that expresses PS 1 , APH-1 , nicastrin, PEN-2, and APP C99.
  • the invention provides a transgenic Pichia pastoris comprising at least one of a presenilin 1, APH-1, nicastrin, or PEN-2 encoding transgene.
  • the transgenic P. pastoris comprises presenilin 1, APH-1, nicastrin, and PEN-2 encoding transgenes. More preferably, the transgenic P. pastoris comprising presenilin 1, APH-1, nicastrin, and PEN-2 encoding transgenes exhibits ⁇ -secretase activity.
  • the transgenic P. pastoris further comprises a transgene encoding amyloid precursor protein (APP) or a derivative of APP.
  • APP amyloid precursor protein
  • the APP derivative is a carboxyl-terminal derivative termed C99.
  • One or more of presenilin 1, APH-1, nicastrin, PEN-2, and APP may be epitope tagged, h a preferred embodiment, presenilin 1 is epitope tagged. More, particularly, the epitope tag is a Tandem Affinity Purification (TAP) tag.
  • presenilin 1 is a mutant presenilin 1.
  • the mutant presenilin 1 contains a mutation associated with FAD.
  • the presenilin 1 mutation is M146L, E280A, or G384A. In some aspects of the invention the mutant presenilin 1 is epitope tagged.
  • the invention provides a transgenic P. pastoris comprising APH-1, nicastrin, PEN-2, and mutant presenilin 1 encoding transgenes, wherein the P. pastoris exhibits no ⁇ -secretase activity.
  • the mutant presenilin 1 is D385A.
  • the mutant presenilin 1 is epitope tagged.
  • mutations in APP, APH-1, nicastrin, or PEN-2 could be studied using using the methods and compositions of the present invention.
  • PS2 could be studied using the methods and compositions of the present invention.
  • the invention provides methods of producing a transgenic P.
  • the invention provides methods of identifying compounds that inhibit ⁇ -secretase activity.
  • the invention provides a method of identifying a compound that inhibits ⁇ -secretase comprising: a) preparing a solubilized membrane preparation from a transgenic P. pastoris comprising presenilin 1, APH-1, nicastrin, and PEN-2 encoding transgenes, wherein the P.
  • the substrate for ⁇ -secretase is /3-amyloid precursor protein or a derivative of /3-amyloid precursor protein.
  • the invention provides methods of identifying a compound that inhibits ⁇ -secretase activity comprising: a) preparing a solubilized membrane preparation from a transgenic P.
  • ⁇ -secretase activity comprising presenilin 1, APH-1, nicastrin, and PEN-2 encoding transgenes, wherein the P. pastoris exhibits ⁇ -secretase activity; b) isolating ⁇ -secretase away from the solubilized membrane preparation; c) contacting the isolated ⁇ -secretase with a substrate for ⁇ -secretase and a test compound; and d) determining whether ⁇ -secretase activity is decreased in the presence of the test compound, the decrease in ⁇ -secretase activity being an indication that the test compound inhibits ⁇ -secretase activity.
  • the substrate for ⁇ -secretase is /3-amyloid precursor protein or a derivative of /3-amyloid precursor protein.
  • the invention provides methods of identifying a compound that inhibits ⁇ -secretase activity comprising: a) contacting a transgenic P. pastoris comprising presenilin 1, APH-1, nicastrin, PEN-2, and APP C99 encoding transgenes, wherein the P.
  • the invention also provides methods of treating Alzheimer's disease.
  • the invention provides methods of treating Alzheimer's disease comprising: a) identifying a patient suffering from or at risk for Alzheimer's disease; and b) administering to the patient a compound that inhibits ⁇ -secretase activity, wherein the compound is identified by a method comprising: preparing a solubilized membrane preparation from a transgenic P.
  • ⁇ -secretase activity comprising presenilin 1, APH-1, nicastrin, and PEN-2 encoding transgenes, wherein the P. pastoris exhibits ⁇ -secretase activity; contacting the solubilized membrane preparation with a substrate for ⁇ -secretase and a test compound; and determining whether ⁇ -secretase activity is decreased in the presence of the test compound, the decrease in ⁇ -secretase activity being an indication that the test compound inhibits ⁇ -secretase activity.
  • the invention provides methods of treating Alzheimer's disease comprising: a) identifying a patient suffering from or at risk for Alzheimer's disease; and b) administering to the patient a compound that inhibits ⁇ -secretase activity, wherein the compound is identified using a method comprising: preparing a solubilized membrane preparation from a transgenic Pichia pastoris comprising presenilin 1, APH-1, nicastrin, and PEN-2 encoding transgenes, wherein the Pichia pastoris exhibits ⁇ -secretase activity; isolating ⁇ -secretase away from the solubilized membrane preparation; contacting the isolated ⁇ -secretase with a substrate for ⁇ -secretase and a test compound; and determining whether ⁇ -secretase activity is decreased in the presence of the test compound, the decrease in ⁇ -secretase activity being an indication that the test compound inhibits ⁇ -secretase activity.
  • the invention provides methods of treating Alzheimer's disease comprising: a) identifying a patient suffering from or at risk for Alzheimer's disease; and b) administering to the patient a compound that inhibits ⁇ -secretase activity, wherein the compound is identified using a method comprising: contacting a transgenic P. pastoris comprising presenilin 1, APH-1, nicastrin, PEN-2, and APP C99 encoding transgenes, wherein the P. pastoris exhibits ⁇ -secretase activity, with a test compound; and determining whether ⁇ -secretase activity is decreased in the presence of the test compound, the decrease in ⁇ -secretase activity being an indication that the test compound inhibits ⁇ -secretase activity.
  • the compound identified according to a method of the present invention is an aspartyl protease inhibitor.
  • the compound identified according to a method of the present invention is L685,458, pepstatin, pepstatin methylester, pepstatin A, JKL2, aryksykfibanude 1, benzodiazepine 2 (compound E), compound WPE-HI-31C, DAPT ⁇ N-[N-(3,5-di-uorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester ⁇ , L852,646, NVP-AHW700-NX, or an analog of one of the above-mentioned compounds.
  • an “analog” refers to a structural derivative of a parent chemical compound that often differs from the parent compound by a single element. The difference between the structural derivative and the parent compound may be, for example, the replacement of one atom by an atom of a different element or the presence or absence of a particular functional group.
  • “a” or “an” may mean one or more.
  • the words “a” or “an” when used in conjunction with the word “comprising”, the words “a” or “an” means one or more than one.
  • “another” may mean at least a second or more.
  • FIG. 1 The expression of PS 1 , APH- 1 , PEN-2, and nicastrin in P. pastoris.
  • FIG. 2 The conversion of PSl holoprotein to PSl NTF and PSl CTF in the presence of APH-1, PEN-2, and nicastrin.
  • FIG. 3 Reconstitution of ⁇ -secretase activity in soluble membrane preparations from P. pastoris. Inhibition of ⁇ -secretase activity in soluble membrane preparations from P. pastoris with ljuM L685,458.
  • FIG. 4A and FIG. 4B In vivo ⁇ -secretase activity in P. pastoris. DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
  • PSl is a 467 amino acid polypeptide predicted to contain 8 transmembrane (TM) spanning domains with its N-terminus, C-terminus and a large hydrophilic "loop" region located between TMs 6 and 7 all oriented towards the cytosol.
  • TM transmembrane
  • PSl is synthesized as a 42- to 43-kD polypeptide, the preponderant PSl -related species that accumulate in vivo are the N- terminal (NTF) and the C-terminal (CTF) proteolytic derivatives.
  • PSl derivatives are generated by endoproteolyis at Met 292 (and to a lesser extent, Met 298) within the cytoplasmic "loop" domain between TMs 6 and 7.
  • PSl and PS2 also undergo additional cleavage within the hydrophilic loop domain, dubbed “alternative cleavage,” that is mediated by caspases.
  • Presenilins (PS) including PSl and PS2 are involved in the pathogenesis of Alzheimer's Disease (AD) and mutations in presenilins have been associated in -50% of pedigrees with familial early-onset AD (FAD).
  • PSl is necessary for ⁇ -secretase cleavage of the Alzheimer's precursor protein (APP) and during APP cleavage FAD-linked PSl and PS2 mutants have been shown to selectively enhance the production of the A ⁇ 42 peptides in transfected mammalian cells, in the brains of transgenic mice, as well as in patients with AD (Borchelt et al, 1996; Duff et al, 1996; Scheuner et al, 1996; Tomita et al, 1997; Borchelt et al, 1997; Holcomb et al, 1998).
  • AD Alzheimer's precursor protein
  • a ⁇ 42 peptides are more fibrillogenic than the shorter A ⁇ 40 peptides and thus, FAD-linked mutant PS proteins lead to the production of highly amyloidogenic A ⁇ species which leads to A ⁇ deposition in brain.
  • a ⁇ 42 peptides are more fibrillogenic than the shorter A ⁇ 40 peptides, and are more prominent in the amyloid lesions of patients with AD (Jarrett et al, 1993; Iwatsubo et al, 1994; Gravina et al, 1995).
  • FAD-linked mutant PS bias this cleavage toward the production of highly amyloidogenic A ⁇ 42 species that foster A ⁇ deposition in brain.
  • the mechanism(s) by which mutant PS influences the production of A ⁇ 42 peptides are uncertain, but FAD-linked mutant PS proteins appear to cause aberrant gain, rather than loss, of function (Sisodia et al, 1999). Understanding how PS proteins influence the production of A ⁇ 42 peptides is of central importance to AD research.
  • Presenilins Facilitate Intramembranous Processing of APP Analysis of APP processing in neurons from mice containing a targeted deletion of PSl revealed that PSl is required for ⁇ -secretase cleavage of APP; PSl deficiency is associated with defects in the secretion of A ⁇ peptides and intracellular accumulation of APP C-terminal fragments (CTFs) bearing varying extents of the A ⁇ region (De Strooper et al, 1998; Naruse et al, 1998).
  • the present invention provides methods for identifying inhibitors of ⁇ -secretase activity.
  • the screening assays may comprise random screening of large libraries of test compounds. Alternatively, the assays may be used to focus on particular classes of compounds selected with an eye towards structural attributes that are believed to make them more likely to modulate ⁇ - secretase activity. Thus, the screening assays will assay for increases or decreases in levels of ⁇ - secretase activity in response to a test compound. Alternatively, one may assay for a change in function or activity of PSl, APH-1, nicastrin, and PEN-2. The change may be an increase or a decrease in activity or function of the protein.
  • any protein related biological activity such as an increased/decreased enzyme activity, an increased/decreased electrical activity corresponding to increased/decreased levels of ion channels, transcriptional activity measured directly or via promoter assays (CAT assays or luciferase assays), Ca* "1" imaging, cell surface expression of marker proteins, cell survival or cell death, etc.
  • CAT assays or luciferase assays transcriptional activity measured directly or via promoter assays
  • Ca* "1" imaging cell surface expression of marker proteins, cell survival or cell death, etc.
  • PSl holoprotein to NTF/CTF.
  • To identify a compound that inhibits ⁇ -secretase one generally will determine the level of ⁇ -secretase activity in the presence and absence of a test compound.
  • the methods of the invention comprise: a) preparing a solubilized membrane preparation from Pichia pastoris with ⁇ - secretase activity; b) contacting the solubilized membrane preparation with a substrate for ⁇ -secretase and a test compound; and c) determining whether ⁇ -secretase activity is decreased in the presence of the test compound, the decrease in ⁇ -secretase activity being an indication that the test compound inhibits ⁇ -secretase activity.
  • the methods of the invention comprise: a) contacting a transgenic P.
  • test compound refers to any molecule that may potentially inhibit ⁇ -secretase activity.
  • the test compound may be a protein or fragment thereof, a small molecule, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds will be compounds that are structurally related to PSl, APH-1, nicastrin, PEN-2, or APP.
  • the most useful pharmacological compounds will be compounds that are structurally related to a substrate of ⁇ -secretase.
  • ⁇ -secretase inhibitors There are several known ⁇ -secretase inhibitors.
  • L685,458 an aspartyl protease inhibitor, is a specific ⁇ -secretase inhibitor.
  • ⁇ -secretase inhibitors include: pepstatin, pepstatin methylester, pepstatin A, JKL2, aryksykfibanude 1, benzodiazepine 2 (compound E), compound WPE- ⁇ i-31C, DAPT ⁇ N-[N-(3,5-di-uorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester ⁇ , L852,646, and NVP-AHW700-NX.
  • Useful pharmacological compounds will include compounds that are, or are structurally or functionally related to, known ⁇ -secretase inhibitors, which have the structures set forth below.
  • NVP-AHW700-NX Whatever the structure or the nature of the compounds identified by the methods of the present invention one can use the identified compounds to further develop compounds for therapeutic uses.
  • Using lead compounds to help develop improved compounds is known as "rational drug design" and includes not only comparisons with know inhibitors and activators, but predictions relating to the structure of target molecules.
  • the goal of rational drug design is to produce structural analogs of biologically active polypeptides or other compounds. By creating such analogs, it is possible to fashion drags, which are more active or stable than the natural molecules, which have different susceptibility to alteration or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for a target molecule, or a fragment thereof.
  • Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.
  • one may simply acquire, from various commercial sources, small molecule libraries that are believed to meet the basic criteria for useful drugs in an effort to "brute force" the identification of useful compounds.
  • Screening of such libraries including combinatorially generated libraries (e.g., peptide libraries), is a rapid and efficient way to screen large number of related (and unrelated) compounds for activity.
  • Combinatorial approaches also lend themselves to rapid evolution of potential drugs by the creation of second, third and fourth generation compounds modeled of active, but otherwise undesirable compounds.
  • Test compounds may include fragments or parts of naturally-occurring compounds, or may be found as active combinations of known compounds, which are otherwise inactive.
  • the candidate substance identified by the present invention may be peptide, polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known inhibitors or stimulators.
  • suitable modulators include antisense molecules, ribozymes, aptamers, and antibodies (including single chain antibodies), each of which would be specific for the target molecule.
  • an antisense molecule that bound to a translational or transcriptional start site, or splice junctions would be ideal candidate inhibitors.
  • the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the structure of the modulators. Such compounds, which may include peptidomimetics of peptide modulators, may be used in the same manner as the initial modulators.
  • Those of skill in the art will be familiar with a number of assays useful in evaluating a compound for the ability to inhibit ⁇ -secretase activity. A quick, inexpensive and easy assay to ran is an in vitro assay.
  • Such assays generally use isolated molecules, can be run quickly and in large numbers, thereby increasing the amount of information obtainable in a short period of time.
  • a variety of vessels may be used to run the assays, including test tubes, plates, dishes and other surfaces such as dipsticks or beads.
  • One example of a cell free assay is a binding assay.
  • the ability of a modulator to bind to a target molecule in a specific fashion is strong evidence of a related biological effect. For example, binding of a molecule to an enzyme may block the catalysis of a substrate.
  • a test compound could be screened for its ability to bind to PSl, APH-1, nicastrin, PEN-2, or APP.
  • the interaction may be due to steric, allosteric or charge-charge interactions.
  • the protein or protein complex may be either free in solution, fixed to a support, expressed in or on the surface of a cell. Either the protein or the compound may be labeled, thereby permitting determining of binding. Usually, the protein will be the labeled species, decreasing the chance that the labeling will interfere with or enhance binding.
  • Competitive binding formats can be performed in which one of the agents is labeled, and one may measure the amount of free label versus bound label to determine the effect on binding.
  • a solubilized membrane preparation or ⁇ -secretase isolated away from the solubilized membrane preparation from Pichia pastoris engineered to express one or more of PSl, APH-1, nicastrin, PEN-2, and APP is contacted with one or more test compounds, and the ability of the test compound(s) to alter ⁇ -secretase activity is determined, as compared to a similar transgenic P. pastoris not treated with the test compound(s), to identify an inhibitor.
  • ⁇ -secretase activity one may also determine other characteristics of the proteins that may be altered by the test compound. For example, the conversion of PSl holoprotein to NTF/CTF could be determined. Alternatively, ⁇ -secretase complex formation could be determined by, for example, co-immunoprecipitation assays. A technique for high throughput screening of compounds is described in WO 84/03564.
  • In vivo assays of the invention involve the use of transgenic Pichia pastoris that have been engineered to express one or more of PSl, APH-1, nicastrin, PEN-2, and APP. Generally, the transgenic P. pastoris used for in vivo assays will co-express all five of the proteins listed above. In addition, it may be desirable to express a mutant protein. For example, PSl M146L, E280A, G384A, or D385A may be expressed in place of, or along with, wild-type PSl.
  • the transgenic P. pastoris is contacted with one or more test compounds, and the ability of the test compound(s) to alter ⁇ -secretase activity is determined, as compared to a similar transgenic P. pastoris not treated with the test compound(s), to identify an inhibitor.
  • ⁇ -secretase activity one may also determine other characteristics of the proteins that may be altered by the test compound. For example, the conversion of PSl holoprotein to NTF/CTF could be determined. Alternatively, ⁇ -secretase complex formation could be determined by, for example, co-immunoprecipitation assays.
  • the present invention provides methods of screening for a test compound that modulates ⁇ -secretase activity.
  • the present invention is directed to a method for determining the ability of a test compound to inhibit ⁇ secretase activity, generally including the steps of: contacting a test compound to the transgenic P. pastoris; and determining the ability of the test compound to inhibit ⁇ -secretase activity.
  • the invention also contemplates in vivo studies involving various animal models to further characterize compounds identified as modulators of ⁇ -secretase activity. Animal models include transgenic animals that have been engineered to have specific defects, or carry markers that can be used to measure the ability of a compound to reach and effect different cells within the organism. Due to their size, ease of handling, and information on their physiology and genetic make-up, mice are a preferred embodiment, especially for transgenics.
  • Assays for modulators may be conducted using an animal model derived from any of these species.
  • one or more test compounds are administered to an animal, and the ability of the test compound(s) to alter the level of ⁇ -secretase activity are measured, as compared to a similar animal not treated with the test compound(s), identifies a modulator.
  • ⁇ - secretase activity one may also measure other characteristics.
  • the present invention provides methods of screening for a test compound that modulates the activity of ⁇ -secretase.
  • the present invention is directed to a method for determining the ability of a test compound to inhibit ⁇ -secretase activity, generally including the steps of: administering a test compound to the animal; and determining the ability of the test compound to reduce one or more characteristics of a disease or pathology caused by ⁇ -secretase activity or symptoms associate with the same.
  • the disease or pathology is Alzheimer's disease.
  • Treatment of these animals with test compounds will involve the administration of the compound, in an appropriate form, to the animal.
  • Administration will be by any route that could be utilized for clinical or non-clinical purposes, including but not limited to oral, nasal, buccal, or even topical.
  • administration may be by intracerebral injection, intratracheal instillation, bronchial instillation, intradermal injection, subcutaneous injection, intramuscular injection, intraperitoneal injection or intravenous injection.
  • Specifically contemplated routes are systemic intravenous injection, regional administration via blood or lymph supply, or directly to an affected site. Determining the effectiveness of a compound in vivo may involve a variety of different criteria.
  • Clinical responses may be defined by acceptable measure. For example, a complete response may be defined by complete disappearance of the neurological disease or condition, whereas a partial response may be defined by about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or about a 95% reduction of the disease or condition.
  • the typical course of treatment will vary depending upon the individual patient and disease being treated in ways known to those of skill in the art.
  • the present invention also concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biological components.
  • the steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Nakamura et al. (1987), incorporated herein by reference.
  • Immunoassays in their most simple and direct sense, are binding assays.
  • Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA) and immunobead capture assay. Immunohistochemical detection using tissue sections also is particularly useful.
  • immunobinding methods include obtaining a yeast cell transformed with an expression construct expressing a protein or peptide and contacting the sample with an antibody to the protein or peptide in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.
  • the immunobinding methods of this invention include methods for detecting or quantifying the amount of A/3 in a sample. Here, one would obtain a soluble membrane preparation from P.
  • a substrate e.g., APP ClOOFlag
  • An antibody to A ⁇ is then used to detect or quantify the amount of immune complexes formed under the specific conditions.
  • the P. pastoris cell is contacted with a test compound and an antibody to A/3 is used to detect or quantify the amount of A/3 secreted from the cell.
  • immune complexes are generally a matter of simply adding the composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to, any antigens present.
  • the sample-antibody composition such as an ELISA plate, dot blot or Western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.
  • the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches.
  • the encoded protein, peptide or corresponding antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined.
  • the first added component that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the encoded protein, peptide or corresponding antibody.
  • the second binding ligand may be linked to a detectable label.
  • the second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody.
  • the primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes.
  • the secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected. Further methods include the detection of primary immune complexes by a two step approach.
  • a second binding ligand such as an antibody, that has binding affinity for the encoded protein, peptide or corresponding antibody is used to form secondary immune complexes, as described above.
  • compositions of the present invention comprise an effective amount of one or more ⁇ -secretase inhibitors identified as described by the present invention dissolved or dispersed in a pharmaceutically acceptable carrier.
  • phrases "pharmaceutical” or “pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • the preparation of an pharmaceutical composition that contains at least one ⁇ -secretase inhibitor or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 1990, incorporated herein by reference.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, antioxidants, salts, coatings, surfactants, preservatives (e.g., methyl or propyl p-hydroxybenzoate, sorbic acid, antibacterial agents, antifungal agents), isotonic agents, solution retarding agents (e.g. paraffin), absorbents (e.g. kaolin clay, bentonite clay), drag stabilizers (e.g. sodium lauryl sulphate), gels, binders (e.g.
  • syrup acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidinone, carboxy-methyl-cellulose, alginates), excipients (e.g. lactose, milk sugar, polyethylene glycol), disintegration agents (e.g. ager-ager, starch, lactose, calcium phosphate, calcium carbonate, alginic acid, sorbitol, glycine), wetting agents (e.g. cetyl alcohol, glycerol monostearate), lubricants, absorption accelerators (e.g. quaternary ammonium salts), edible oils (e.g.
  • sweetening agents e.g. sweetening agents, flavoring agents, coloring agents, fillers, (e.g. starch, lactose, sucrose, glucose, mannitol, slilcic acid), tabletting lubricants (e.g. magnesium stearate, starch, glucose, lactose, rice flower, chalk), carriers for inhalation (e.g. hydrocarbon propellants), buffering agents, or such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 1990, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
  • the composition may comprise various antioxidants to retard oxidation of one or more component.
  • antioxidants includes ascorbic acid, cysteine hydrochloride, sodium sulfite, sodium bisulfite, sodium metabisulfite, ascorbyl palmitate, butylated hydroxytoluene, butylaed hydroxyanisole, lecithin, propyl gallate, and -tocopherol.
  • the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, tbimerosal or combinations thereof).
  • preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, tbimerosal or combinations thereof).
  • parabens e.g., methylparabens, propylparabens
  • chlorobutanol phenol
  • sorbic acid tbimerosal or combinations thereof
  • Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric, hydrobromic, or phosphoric acids; or such organic acids as acetic, oxalic, tartaric, benzoic, lactic, phosphorific, citric, maleaic, fumaric, succinic, tartaric, napsylic, clavulanic, stearic, or mandelic acid.
  • inorganic acids such as for example, hydrochloric, hydrobromic, or phosphoric acids
  • organic acids such as acetic, oxalic, tartaric, benzoic, lactic, phosphorific, citric, maleaic, fumaric, succinic, tartaric, napsylic, clavulanic, stearic, or mandelic acid.
  • Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium magnesium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
  • a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods.
  • a coating such as lecithin
  • surfactants such as, for example hydroxypropylcellulose
  • the ⁇ -secretase inliibitor may also comprise different types of carriers depending on whether it is to be administered in solid or liquid form, and whether it need to be sterile for such routes of administration as injection.
  • the present invention can be administered orally, intradermally, subcutaneously, topically, by injection, infusion, continuous infusion, localized perfusion, bathing target cells directly, via a catheter, via a lavage, or by other methods or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 1990, incorporated herein by reference).
  • the ⁇ -secretase inhibitor when administered orally may be in the form of tablets, capsules, sachets, vials, powders, granules, lozenges, reconstirutable powders, liquid preparations.
  • the ⁇ -secretase inhibitor may be admistered via transdermal delivery using a skin- patch formulation.
  • the ⁇ -secretase inhibitor may be dispersed in a pressure sensitive adhesive which adheres to the skin such that it can diffuse through the skin for delivery to the patient.
  • Transdermal adhesives such as natural rubber or silicone are known in the art.
  • Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and/or the other ingredients.
  • the preferred methods of preparation are vacuum-drying or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof.
  • the liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose.
  • the preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.
  • the actual dosage amount of a composition of the present invention administered to a patient can be determined by physical and physiological factors such as body weight, gender, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, time of the administration, rate of excretion of the particular compound, and on the route of administration.
  • the practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • the dosage will also depend upon the bioavailability and activity of the particular ⁇ -secretase inhibitor.
  • the composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • endotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.
  • prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.
  • the wild-type PS 1 expression plasmid was generated as follows. Wild-type PSl (PS1WT) was released from pAG3-PSlWT by restriction enzymes Kpnl and BamH I, and inserted into pD34 vector at the corresponding sites to generate pD34-PSlWT.
  • the PSl D385A mutant expression plasmid, pD34-PSlD385A was similarly constructed with pAG3-PS 1D385 A and pIB4 vectors.
  • TAP Tandem Affinity Purification
  • PSl WT digested with Hind III and BamH I were then ligated with pIB4 vector, which was already cut with Sma I and BamH I, to generate pIB4-TAP PSl WT.
  • the PSl M146L mutant expression plasmid, pD34-TAP PSl M146L was constructed as follows. A fragment containing the PSl M146L mutation was released from pAG3-PSl M146L by SnaB I and BamH I. This fragment was then ligated with ⁇ IB4-TAP PSl WT, which was digested with enzyme SnaB I and BamH I.
  • the same strategy was used to construct the following expression plasmids: pIB4-TAP PSl E280A, pIB4-TAP PSl G384A, pIB4-TAP PSl D385A, pIB4-PSl M146L, pIB4- PSl E280A, pIB4-PSl G384A, pIB4-PSl D385A.
  • the APH-1 expression plasmid was generated as follows. Two primers were used to PCRTM amplify a 900bp fragment encoding APHloL fused to c-myc and hexahistidine from the vector pcDNA4- APHloL (from Dr. G.
  • the forward primer is APHI ⁇ El Fr: GGC GAA TTC ACC ATG GGG GCT GCG GTG T (SEQ ID NO:3) ; and the reverse primer is HISstop El Re: GGC GAA TTC TCA ATG GTG ATG GTG ATG (SEQ ID NO:4).
  • the amplified DNA fragment was digested with EcoR I and ligated into a vector pBLURA-IX linearized with EcoR I.
  • the resulting plasmid is pBLURAIX-APHl.
  • the sequence of the region amplified with PCRTM was confirmed by sequence reaction analysis.
  • the nicastrin expression plasmid was generated as follows.
  • Nicastrin cDNA was PCRTM amplified from pAG3-NCT plasmid with a forward primer NCT Mfe Fr: GCC CAATTG ACC ATG GCT ACG GCA GGG GGT (SEQ ID NO:5); and a reverse primer NCT Mfe Re: GCC
  • the PCRTM product was digested with Mfe I and inserted into the vector pBLADE-IX linearized with EcoR I. This resulted in a plasmid pBLADEIX-NCT. NCT sequence was confirmed by sequencing reaction.
  • the PEN-2 expression plasmid was generated as follows.
  • PEN2 cDNA was PCRTM amplified from the plasmid pAG3-PEN2 with a forward primer PEN2 El Fr: GGC GAA TTC ACC ATG AAC CTG GAG CGA GTG (SEQ ID NO:7), and a reverse primer PEN2 El Re: GGC GAA TTC TCA GGG GGT GCC CAG GGG TAT (SEQ ID NO:8).
  • the PCRTM product was digested with EcoR I and inserted into the vector pBLADE-IX linearized with EcoR I. This resulted in a plasmid pBLARGIX-PEN2.
  • PEN-2 sequence was confirmed by sequencing reaction.
  • the APP C99 expression plasmid was generated as follows.
  • the APP C99 cDNA was amplified from pCB6-APPswe by PCRTM with forward primer TCTCTCGAGAAAAGAGATGCAGAATTCCGACATGAC (SEQ ID NO:9) and reverse primer GGCTCTAGACCGTTCTGCATCTGCTCAAAGAAC (SEQ ID NO: 10).
  • the PCRTM product was digested with Xhol and Xbal and inserted into the Pichia expression vector pGAPoA linearized with Xhol and Xbal. This resulted in a plasmid pGAPZoA-CTF.
  • the APP C99 sequence was confirmed by sequencing reaction.
  • the protein encoded by the pGAPZ ⁇ A- CTF plasmid contains the yeast c-factor signal sequence fused to APP C99 followed by a myc- 6XHis epitope tag.
  • PEP4 promoter DNA was amplified from Pichia genomic DNA by PCRTM with forward primer Ppep4Fr2 GCCAGATCTCATCTTGTGACTGGTTGATC (SEQ ID NO: 11) and reverse primer Ppep4Re CGCGGATCCGTAGTACCGTCAAATATCATC (SEQ ID NO: 12).
  • PCRTM product was digested with Bgl II and BamHI and inserted into the APP C99 expression plasmid pGAPZoA-CTF linearized with Bgl II, resulting in a plasmid pGAPZoA-CTF-Ppep4.
  • PEP4 terminator DNA was amplified from Pichia genomic DNA by PCRTM with forward primer Tpep4Fr CGCGGATCCAGGTAGTGAAGATGTAGAG (SEQ ID NO: 13) and reverse primer Tpep4Re (SEQ ID NO: 14) GGCAGATCTGAGCCATACTTCCAACTATC.
  • the PCRTM product was digested with Bgl II and BamHI and inserted into the APP C99 expression plasmid pGAPZoA-CTF-Ppep4 linearized with Bgl II, resulting in a plasmid pGAPZoA-CTF- PEP4KO.
  • This plasmid was linearized with Bgl II and integrated into PEP4 genomic locus.
  • Example 2 Generation of Transgenic Pichia pastoris The P. pastoris strain JC308 (adel arg4 his4 ura3) was used as a parent strain. Yeast transformation was performed according to the procedure of Sears et al. (1998). For double integration at two loci in a single transformation reaction, 4 ⁇ g of DNA of each plasmid was used. pIB4-PSl expression plasmid series was linearized with EcoN I to integrate plasmids into the HIS4 locus.
  • pBLURAIX-APHl ⁇ L was digested with Sal I to integrate the plasmid into the URA3 locus, pBLADELX-NCT with Spe I digestion to integrate into the ADEl locus, pBLARGIX-PEN2 with Avr II digestion to integrate into the ARG4 locus, and pGAPZoA-CTF- PEP4KO with Bgl II digestion to integrate at the PEP4 locus.
  • the selection markers were His4 for PSl, Ura3 for APH-1, Adel for NCT, Arg4 for PEN-2, and Sh ble Zeocin® for APP C99. Integrations of plasmids encoding APH-1, PSl, PEN-2, or NCT in the P.
  • APH-1 was amplified with primers 5' AOX1 and 6xHis Re.
  • a 400 bp fragment of PSl was amplified with primers BamH I L365Fr and 3' AOX1.
  • a 400bp fragment of PEN-2 was amplified with primers PEN2Fr and 3 AOX1.
  • a 1600 bp fragment of NCT was amplified with primers 5 AOX1 and GST As.
  • the antibody PSl NT was used to detect PSl holoprotein and PSl NTF
  • the antibody PSl Loop was used to detect PSl holoprotein and PSl CTF
  • the antibody PNT-2 was used to detect PEN-2
  • the antibody NCT #54 was used to detect nicastrin
  • a commercial monoclonal c-myc antibody, 9E10 was used to detect APH-1 (a myc tag was fused to the C-terminus of APH-1).
  • Buffer B 50mM MES, pH6.0, 150mM KCl, 5mM CaC12, 5mM MgC12
  • Microsome membranes were harvested from post-nuclear supernatant by centrifugation under 100,000x g for 1 hour. Conversion of the PSl holoprotein to PSl NTF and PSl CTF was verified by western blot analysis (FIG. 2). The antibody PSl NT was used to detect PSl holoprotein and PSl NTF.
  • Example 5 In Vitro ⁇ -Secretase Activity
  • the ⁇ -secretase assay was modified from the procedure by Li et al. (2000), with 0.1% phosphotidylcholine (PC) and 0.05% phosphatidylethanolamine (PE) in Buffer A to solubilize ⁇ - secretase from membrane preparations, and with 0.1% PC and 0.025% PE in final reaction.
  • Soluble membrane preparations were made from P. pastoris strains expressing various combinations of PSl, APH-1, PEN-2, and nicastrin, as indicated in FIG. 3. Soluble membrane preparations from 293 cells were included as a positive control.
  • the substrate APP ClOOFlag was added into the soluble membrane preparation.
  • the ⁇ -secretase cleavage products CTF ⁇ and A/3 were analyzed by western blot (FIG. 3).
  • the antibody 26D6 was used to detect APP ClOOFlag and A ⁇ , and the CT15 antibody for APP ClOOFlag and CTF ⁇ .
  • CTF ⁇ and A/3 were detected only in the 293 cells and P. pastoris strains co-expressing PSl, APH-1, PEN-2, and nicastrin.
  • the ⁇ -secretase assay was modified from the procedure by Li et al. (2000), with 0.1 % phosphotidylcholine (PC) and 0.05% phosphatidylethanolamine (PE) in Buffer A to solubilize ⁇ - secretase from membrane preparations, and with 0.1% PC and 0.025% PE in final reaction.
  • Soluble membrane preparations were made from P. pastoris strains expressing various combinations of PSl, APH-1, PEN-2, and nicastrin, as indicated in FIG. 3. Soluble membrane preparations from 293 cells were included as a positive control.
  • the substrate APP ClOOFlag and the ⁇ -secretase inhibitor L685,458 were added into the soluble membrane preparation.
  • the ⁇ -secretase cleavage products CTF ⁇ and A/3 were analyzed by western blot (FIG. 3).
  • the antibody 26D6 was used to detect APP ClOOFlag and A/3, and the CT15 antibody for APP ClOOFlag and CTF ⁇ .
  • the presence of CTF ⁇ and A ⁇ was greatly reduced in the soluble membrane preparations treated with L685,458 as compared to preparations without L685,458.
  • P. pastoris JC308 adel arg4 his4 ura3 strain in which a cDNA (SEQ ID NO: 15) encoding an epitope-tagged APP C99 polypeptide (SEQ ID NO: 16) is stably integrated into the PEP 4 locus.
  • the ⁇ -factor signal sequence efficiently targets APP C99 into the intracellular membrane, but it is cleaved from the fusion protein after translocation into the ER, resulting in a C99 fusion protein without this signal sequence.
  • the myc-6XHis facilitates the detection and purification for this fusion protein.
  • Processing of the mat ⁇ -APP C99 fusion protein by the yeast KEX2 protease immediately carboxyl to the dibasic lys-arg sequence (amino acids 84 and 85 of SEQ ID NO: 16) is expected to generate an amino-terminus A ⁇ fragment and a carboxyl-terminus C99 fragment. As shown in FIG.
  • the inventors did not observe production of A ⁇ peptides under conditions where the ⁇ -secretase components are in basal, uninduced conditions. However, the inventors observed production of A ⁇ 3-40 and A ⁇ 3-42 and shorter A ⁇ derivatives in cell lysates upon induction of the ⁇ -secretase components. The inventors also observed low levels of A ⁇ . species in the pellet fraction, but undetectable levels in the supernatant fraction from the samples shown respectively in FIG. 4A, lane 7 and lane 6. Finally, A ⁇ peptide variants were detected in the conditioned medium from induced cells, but not in the conditioned medium from uninduced cells. The finding that all A ⁇ peptide species begin at +3 was not anticipated.
  • yeast protease STE13 is known to cleave dipeptides containing the sequence Glu Ala. Therefore, the first two amino acids (Asp Ala) in A ⁇ are very likely being liberated by STE13, resulting in A ⁇ species that start at the +3 position.
  • Soluble membrane preparations made from P. pastoris strains expressing PSl, APH-1, PEN-2, and nicastrin may be used to screen for inhibitors of ⁇ -secretase activity.
  • the ⁇ -secretase assay may be modified from the procedure by Li et al. (2000), with 0.1% phosphotidylcholine (PC) and 0.05% phosphatidylethanolamme (PE) in Buffer A to solubilize ⁇ -secretase from membrane preparations, and with 0.1% PC and 0.025% PE in final reaction.
  • a test compound can be added to the soluble membrane preparation along with a ⁇ -secretase substrate, e.g., APP ClOOFlag.
  • the presence of a ⁇ -secretase cleavage product could then be determined by western blot or electrochemilumenescence (ECL) assay.
  • ECL assay may be performed as follows.
  • A/340 can be selectively separated from the soluble membrane preparation by a specific antibody.
  • a second antibody ruthenylated with TAG-N-hydroxysuccinamide ester recognizing only A/340 can then be added to bind A/340.
  • the ruthenylated antibody will emit light under laser light to give an arbitrary unit for the amount of A/340.
  • the quantity of A/340 generated in the assay can be determined.
  • a ruthenylated A/342 antibody can be used to measure the amount of A/342. A decrease in the amount of A/3 generated in the presence of the test compound would indicate that the compound is an inhibitor of ⁇ -secretase activity.

Abstract

La présente invention concerne des procédés de recherche systématique permettant d'identifier des composés qui inhibent l'activité ?-secrétase. Ces procédés de recherche systématique nécessitent de produire une levure Pichia pastoris transgénique exprimant les PS1, APH-1, PEN-2 et la nicastrine. Les composés de test se prêtent à la recherche systématique de l'aptitude à moduler l'activité ?-secrétase in vivo ou in vitro.
PCT/US2004/031230 2003-09-24 2004-09-23 Preparation membranaire tiree de pichia pastoris pour tester l'activite gamma-secretase WO2005031363A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50560103P 2003-09-24 2003-09-24
US60/505,601 2003-09-24

Publications (1)

Publication Number Publication Date
WO2005031363A1 true WO2005031363A1 (fr) 2005-04-07

Family

ID=34393041

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/031230 WO2005031363A1 (fr) 2003-09-24 2004-09-23 Preparation membranaire tiree de pichia pastoris pour tester l'activite gamma-secretase

Country Status (1)

Country Link
WO (1) WO2005031363A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1821103A1 (fr) * 2006-02-17 2007-08-22 Cellzome Ag Procédé d'identification de modulateurs de gamma-sécrétase
WO2008068024A2 (fr) * 2006-12-06 2008-06-12 Universität Zürich Moyens et procédés pour isoler et déterminer de nouvelles cibles pour le traitement de maladies neurodégénératrices, neurologiques ou neuropsychiatriques et compositions les comprenant
KR20170012547A (ko) * 2014-06-13 2017-02-02 화이트헤드 인스티튜트 포 바이오메디칼 리서치 아밀로이드 베타 발현 작제물 및 이에 대한 용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998015828A1 (fr) * 1996-10-07 1998-04-16 Scios Inc. METHODE D'IDENTIFICATION DES INHIBITEURS DIRECTS DE L'ENZYME η-SECRETASE PRODUISANT LE β-AMYLOIDE
WO2001016355A2 (fr) * 1999-08-28 2001-03-08 Boehringer Ingelheim Pharma Kg SYSTÈME DE TEST IN VITRO POUR LA η-SECRÉTASE

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998015828A1 (fr) * 1996-10-07 1998-04-16 Scios Inc. METHODE D'IDENTIFICATION DES INHIBITEURS DIRECTS DE L'ENZYME η-SECRETASE PRODUISANT LE β-AMYLOIDE
WO2001016355A2 (fr) * 1999-08-28 2001-03-08 Boehringer Ingelheim Pharma Kg SYSTÈME DE TEST IN VITRO POUR LA η-SECRÉTASE

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
EDBAUER D ET AL: "RECONSTITUTION OF GAMMA-SECRETASE ACTIVITY", NATURE CELL BIOLOGY, MACMILLAN PUBLISHERS, GB, vol. 5, no. 5, May 2003 (2003-05-01), pages 486 - 488, XP001156572, ISSN: 1465-7392 *
EVIN GENEVIEVE ET AL: "Presenilin I expression in yeast lowers secretion of the amyloid precursor protein", NEUROREPORT, vol. 11, no. 2, 7 February 2000 (2000-02-07), pages 405 - 408, XP009042566, ISSN: 0959-4965 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1821103A1 (fr) * 2006-02-17 2007-08-22 Cellzome Ag Procédé d'identification de modulateurs de gamma-sécrétase
WO2008068024A2 (fr) * 2006-12-06 2008-06-12 Universität Zürich Moyens et procédés pour isoler et déterminer de nouvelles cibles pour le traitement de maladies neurodégénératrices, neurologiques ou neuropsychiatriques et compositions les comprenant
WO2008068024A3 (fr) * 2006-12-06 2008-07-24 Univ Zuerich Moyens et procédés pour isoler et déterminer de nouvelles cibles pour le traitement de maladies neurodégénératrices, neurologiques ou neuropsychiatriques et compositions les comprenant
KR20170012547A (ko) * 2014-06-13 2017-02-02 화이트헤드 인스티튜트 포 바이오메디칼 리서치 아밀로이드 베타 발현 작제물 및 이에 대한 용도
EP3155003A4 (fr) * 2014-06-13 2018-04-18 Whitehead Institute for Biomedical Research Constructions d'expression de la protéine bêta-amyloïde et leurs utilisations
KR102342622B1 (ko) * 2014-06-13 2021-12-22 화이트헤드 인스티튜트 포 바이오메디칼 리서치 아밀로이드 베타 발현 작제물 및 이에 대한 용도

Similar Documents

Publication Publication Date Title
De Strooper et al. Learning by failing: ideas and concepts to tackle γ-secretases in Alzheimer's disease and beyond
Hostenbach et al. The pathophysiological role of astrocytic endothelin-1
US6521414B2 (en) Methods for identifying a modulator of the interaction of NMDA receptor with protein tyrosine phosphatase L1
US8410054B2 (en) Methods for treating pain by inhibition of the SCN9A channel
US20060241038A1 (en) Therapeutic agent for Abeta related disorders
A. Leventis et al. Drosophila amphiphysin is a post‐synaptic protein required for normal locomotion but not endocytosis
Lee et al. Angiotensin converting enzyme inhibitors and angiotensin receptor blockers rescue memory defects in Drosophila-expressing alzheimer’s disease-related transgenes independently of the canonical renin angiotensin system
US7179613B2 (en) Methods of screening for a candidate modulator of glucokinase
WO2005031363A1 (fr) Preparation membranaire tiree de pichia pastoris pour tester l'activite gamma-secretase
US7695903B2 (en) Low-density lipoprotein receptor related protein-1 (LRP-1)in clearance of alzheimer's amyloid-beta peptide from the central nervous system
Spanier et al. Caenorhabditis elegans neprilysin NEP-1: an effector of locomotion and pharyngeal pumping
EP1272517B1 (fr) Matiere biologique et utilisations de celle-ci
WO2008008472A2 (fr) Méthodes et compositions pour moduler une formation de synapses
US20090016963A1 (en) Genes involved in neurodegenerative conditions
US20110086908A9 (en) Use of phosphatase inhibitors for the treatment of neurodegenerative diseases
JP2004508288A (ja) 記憶固定を調節する方法及び組成物
US7230155B2 (en) Method for identifying an agonist of neuronal calcium sensor-1 (NCS-1), for therapy of CNS disorders
Hadzibegovic Behavioral, molecular and electrophysiological characterization of the learning and memory deficits induced in mouse models of Alzheimer’s disease
US20050048462A1 (en) Markers and screens
EP1705256A1 (fr) Procédé de traitement de résistance à l'insuline et d'états pathologiques caractérisés par une résistance à l'insuline
Jaen et al. Patent Update Central & Peripheral Nervous System: Alzheimer's disease and β-amyloid: patent activity between May 1993 and June 1994
Li PGC-1α in neurodegeneration and ageing
Yang The potential role for the EGF receptor system in the circadian regulation of locomotor activity
Hung Regulation of expression and processing of the beta-amyloid precursor protein of Alzheimer's disease
Maier et al. Lipoprotein Receptors in Alzheimers Disease: Beyond Lipoprotein Transport

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase