WO2005021514A1

WO2005021514A1 - Novel unnatural histidine analog amino acid

Info

Publication number: WO2005021514A1
Application number: PCT/JP2004/011889
Authority: WO
Inventors: Kazunari Taira; Yutaka Ikeda
Original assignee: The University Of Tokyo
Priority date: 2003-08-29
Filing date: 2004-08-19
Publication date: 2005-03-10
Also published as: JP2005075765A

Abstract

It is intended to provide β-(1,2,3-triazol-4-yl)-DL-alanine which is a novel unnatural histidine analog. By using a histidine-requiring Escherichia coli strain, this novel amino acid is successfully transferred into a protein (chitin-binding domain). This unnatural histidine analog provides a new tool for imparting a new function to a protein.

Description

A new non-heavenly

Technical field

[0001] The present invention provides the following chemical formula

(Formula 1)

An amino acid having a structure consisting of: That is, the present invention relates to a novel non-natural histidine analog, β- (1,2,3-triazol-4-yl) -DL-alanine.

Background art

[0002] Natural proteins are composed of 20 types of amino acids, and among these 20 types of amino acids, there are those that function as acids, those that function as bases, those that are hydrophobic, those that are hydrophilic . Proteins perform a variety of functions as they form clever sequences and higher-order structures. Recently, protein engineering has been actively carried out by artificially designing this amino acid sequence or by in vivo or in vitro selection by random mutation.

[0003] However, naturally occurring amino acids alone have limitations in the chemical properties of amino acids (the strength of acidity and basicity), so that the pH or temperature dependence of enzyme activity is improved or altered. It seems that there is a limit even if we try to make it. In recent years, attempts have been made to synthesize non-naturally occurring amino acids, and as part of this, histidine analogs have been reported mainly in the United States. FIG. 1 shows the structures of histidine (compound 1) and its analog (compounds 2-5) used in the following Examples. [0004] For example, the amino acid of compound (3) in Fig. 1 was patented in the United States in 1955 (US Patent No. 2,719,849: Patent Document 1) and is said to be useful as an intermediate for hypertensive drugs. ing. The amino acids of compound (4) in Fig. 1

It has been suggested that N-methyl-D-aspartate (HMDA) receptor may be an antagonist (Bioorganic & Medical chemistry letters (1993) 3 (1) 43-48).

Disclosure of the invention

[0005] Therefore, the present inventors have considered designing and synthesizing a non-naturally occurring amino acid in order to obtain a new tool for modifying the function of a protein. Therefore, it is an object of the present invention to obtain a novel non-natural amino acid having a different chemical structure from a naturally occurring amino acid. Furthermore, it is also an object of the present invention to open the way to impart a new function to a protein by introducing the unnatural amino acid thus obtained into the protein.

[0006] Thus, the present invention has provided a novel unnatural histidine analog, β_ (1,2,3-triazol-4-yl) -DL-alanine. The amino acid provides a stronger analog than histidine as an acid. The novel amino acid was successfully introduced into a protein (chitin binding domain) using a system based on Escherichia coli.

[0007] Histidine has an acid dissociation constant of 7, and acts as an acid-base catalyst in various proteins. The imidazole group of histidine plays an important role in various enzymes. The non-natural histidine analog of the present invention is obtained by replacing the imidazole ring (two nitrogen atoms) of natural histidine with a triazole ring (three nitrogen atoms), and has a very similar structure. Therefore, it is thought that even if the unnatural histidine analog of the present invention is introduced into a protein, its structure is hardly distorted. The triazole ring contained in the novel histidine analog of the present invention is more acidic (pKa = 2) than the imidazole ring, and has a strong function as an acid catalyst. Therefore, if the histidine analog of the present invention is introduced into a portion where histidine acts as an acid in a protein, its activity is considered to be increased. 1 shows the structures of natural histidine (Formula 2) and a novel histidine analog of the present invention (Lig Formula 3).

[0008] (Chemical 2)

[0009]

O

It

H ₂ N— CH- C- OH

Brief Description of Drawings

FIG. 1 is a diagram showing the structure of histidine and its analog used in Examples of the present invention.

FIG. 2 is a diagram showing a synthesis scheme of the unnatural histidine analog of the present invention.

[FIG. 3] FIG. 3 is a photograph of a blotting showing incorporation of histidine and a histidine analog into a protein.

BEST MODE FOR CARRYING OUT THE INVENTION

[0011] β- (1,2,3-triazol-4-yl) -DL-alanine, which is an unnatural histidine analog of the present invention, is preferably synthesized by the synthetic scheme shown in FIG. The synthetic scheme is not limited to this, and it is naturally possible to use various modified methods commonly used in the field of chemical synthesis. Therefore, it should be understood that modifications and improvements of various synthesis methods by the ingenuity of those skilled in the art are also within the scope of the present invention.

[0012] In the following examples, β, which is an unnatural histidine analog of the present invention,

-(1,2,3_Triazole_4_yl) _0 _______________________________________________________________________ Re introduceded to the protein chitin binding domain using a histidine-requiring E. coli system. Non-heavenly of the present invention Of course, the protein into which the histidine analog is introduced is not limited to the chitin binding domain, and the non-natural histidine analog of the present invention can be introduced into various proteins depending on the purpose.

[0013] There are several methods available for introducing unnatural amino acids (Liu, DR, Schultz, PG (1999) Pro Natl. Acad. Sci. USA, 96, 4780-4785; Kochendoerfer, GG, Kent , SB (1999) Curr. Opin. Chem. Biol., 3, 665-671; Sisido, M., Hohsaka, T. (1999) Bull. Chem. Soc. Jpn., 72, 1409-1425). In addition, examples have been reported in which some analogs are introduced into proteins in addition to natural amino acids (Koide, H., Yokoyama S., Katayama, Υ ·, Muto, Υ ·, igawa, Ί., Kohno, Τ ·, Takusan, H., Uishi, M., Takahashi, S., Tsukumoto, K et al. (1994) Biochemistry., 33, 7470-7476;

Koide, H., Yokoyama S., Kawai, G., Ha JM., Oka, T., Kawai, S., Miyake, Τ ·, Fuwa, Τ ·, Miyazawa, T. (1988) Pro Natl. Acad. Sci. USA., 85, 6237-6241; van Hest, JCM, Kiick, K., Tirrell, DA (2000) J. Am. Chem. Soc "122, 1282-1288). Investigations on proteins have reported that unnatural amino acids have similar structures to natural amino acids (van Hest, JCM, Kiick, KL, Tirrell, DA (2000) J. Am. Chem. Soc, 122, 1282-1288).

Example

[0014] The following examples do not limit the scope of the invention in any way. The reagents used in this example and the experimental conditions used are as follows. The numbers given to each compound in the synthesis examples of Example 1 below are the numbers of the compounds in the synthesis scheme of FIG.

(a) DCC (2.2 eq), MeOH (1.5 eq), CH C1, room temperature, 12 hours

(b) LiBH (0.5 equivalent), refluxed in THF, 3 hours

(c) TBDMSCl (1.5 eq), imidazole (2.0 eq), DMF, room temperature, 24 hours

(d) n-BuLi (0.95 equivalent), trimethylsilyldiazomethane (1.2 equivalent), Et 0, 0 ° C, 3 hours

(e) TBAF (2.2 equivalents), THF, room temperature, 2 hours

(f) PDC (3.5 equivalents), DMF, room temperature, 24 hours

(g) TFA, CH CI, room temperature, 12 hours, Dowex 50WX-200. (Example 1: Synthesis of -1,2,3- (triazol-4-yl) -0 lealanine

(1) Synthesis of 2L-tert-butoxycarbonylamino-3-cyano-propionic acid methyl ether: Compound 7

Dissolve N_hi_Boc-L-asparagine (I-Dragon Compound 6) (l · 54 g, 6.65 mmol) in CH C1 (15 mL).

twenty two

DCC (3.02 g, 14.6 mmol) was added. After stirring at room temperature for 6 hours, methanol (400 μL, 9.98 mmol) was added, and the mixture was further stirred for 6 hours. The insoluble dicyclohexyl perea was removed by filtration and washed with 5% NaHCO. Then, wash with saturated saline and water and evaporate

Three

The solvent was removed with a solvent, and the residue was purified by a column to obtain 1.06 g (70%) of compound 7.

'Η NMR (CDCl): δ 1.41 (s, 9Η, C (CH)); 2.92 (dd, J = 16.8, 5.3, 2H, CH CN);

3 3

3.79 (s, 3H, CH); 4.49 (m, 1H, CH CH); 5.55 (m, 1H, NH). ¹³ C NMR (CDCl): δ

3 2 3

21.9, 28.4, 50.4, 53.5, 81.1, 116.5, 155.1, 169.7. IR (KBr): 3350 br (NH); 2253 (CN); 1739 (C = 〇, ester); 1678 (C = 〇, olebamate) HRMS found 229.1179. Calcd for (MH ⁺ ) CHNO: 229.1187.

10 17 2 4

(2) Synthesis of 2L-tert-butoxycarbonylamino-3 -cyano-propanol: Compound 8

2L-tert-butoxycarbonylamino-3-cyano-propionic acid methyl ether (7X1.48 g, 6.51 mmom) was dissolved in THF (6.8 mL) and LiBH (70.8 mg, 3.23 mmol) was added. Nitrification

Four

The reaction was performed under reflux for 3 hours. After 3 hours, cool down to 2 M KHSO

4 and acidified (pH 4). After filtration, the solvent was removed by evaporation. The residue was extracted with CHC1 and washed with water. Remove solvent by evaporation and purify by column

Three

This gave 1.17 g (90%) of compound 8.

¾ NMR (CDCl): δ 1.44 (s, 9Η, C (CH)); 2.22 (br s, 1H, CH OH); 2.71 (m, 2H,

3 3 3 2

CH CN); 3.77 (dd, J = 10.9, 4.1, 2H, CH OH); 3.93 (m, 1H, CH CH); 5.12 (m, 1H,

2 2 2

NH). ¹³ C NMR (CDCl): δ 20.3, 28.5, 49.0, 62.9, 80.6, 117.9, 155.7. IR (KBr) / cm

Three

— 3339 br (NH); 2253 (CN); 1695 (C = 〇). HRMS found MH + 201.1264. C H N〇

9 17 2 3 requires 201.1238.

(3) 2L_tert-Butoxycarbonylamino-3-cyano-propyl-tert-butyldimethylsilylene ether: Synthesis of Compound 9

2L_tert-Butoxycarbonylamino-3-cyano-propanol (I-Daijutsu 8) (1.17 g, 5.86 mmol) was dissolved in DMF, tert-butyldimethylchlorosilane (1.32 g, 8.79 mmol) and imidazonole (798 mg, 11.72 mmol) were added, and the mixture was stirred for one day. The solvent was removed by evaporation, and the residue was dissolved in CHC1 and washed with water. Remove solvent by evaporation

Three

Purification by ram gave 1.44 g (78%) of compound 9.

'Η NMR (CDCl): δ 0.06 (s, 6H, Si (CH)); 0.87 (s, 9H, SiC (CH)); 1.42 (s, 9H,

3 3 2 3 3

C (CH)); 2.61 (d, J = 6.6, 2H, CH CN); 3.68 (dd, J = 10.1, 5.0, 2H, CH〇Si); 3.92

3 3 2 2

(m, 1H, CH CH); 4.83 (m, 1H, NH). ¹³ C NMR (CDCl): δ 5.7, 18.0, 19.9, 25.7,

twenty three

28.2, 48.6, 63.1, 79.6, 117.2, 154.8. IR (KBr): 3358 br (NH); 2251 (CN); 1718 (C = 0) .HRMS found 314.2034.Calcd for (MH ⁺ ) CHNO Si: 314.2024.

15 30 2 3 1

[0018] (4) Synthesis of 2DL-tert-butoxycarbonylamino- (4_trimethylsilyl-1,2,3-triazole_5_inole) -propyl-tert-butyldimethylsilyl ether: i-conjugate 10

2.73 ml (4.34 mmol) of n_butyllithium (1.59 M hexane solution) was added to a solution of trimethinolecinolenoresazomethane (2.0 M hexane solution, 2.74 mL, 5.48 mmol) in getinoleateno (28 mL) at 0 ° C. Was dropped. After stirring for 20 minutes, a solution of compound 9 (1.44 g, 4.57 mmol) in dimethyl ether (14 mL) was added dropwise at 0 ° C, and the mixture was stirred for 3 hours. Three hours later, a saturated aqueous solution of ammonium chloride was added, and the mixture was extracted with getyl ether. The Jetillu-ter layer was washed with water, and then purified by a column after removing the solvent by evaporation to obtain 1.47 g (75%) of Compound 10.

^{J H NMR (CDCl): δ} 0.02 (s, 6H, Si (CH)); 0.35 (s, 9H, Si (CH)); 0.86 (s, 9H,

3 3 2 3 3

SiC (CH)); 1.34 (s, 9H, C (CH)); 3.00 (dd, J = 15.0, 5.4, 2H, CH C = C); 3.62 (dd,

3 3 3 3 2

J = 9.9, 6.0, 2H, CH OSi); 3.95 (m, 1H, CH CH); 5.34 (m, 1H, NH). ¹ C NMR

twenty two

(CDCl): δ 5.5, -1.0, 18.2, 25.9, 27.5, 28.3, 52.2, 58.1, 64.3, 79.0, 155.6.IR

Three

(KBr): 3134 br (NH); 1716 (C = 〇); 1687 (C = N). HRMS found MH + 429.2678. Calcd for C H N O Si: 429.2715.

19 41 4 3 2

(5) Synthesis of Compound 11: 2DL_tert_butoxycarbonylamino- (1,2,3-triazole_4-yl) -propanol

2DL-tert-butoxycarbonylamino _ (4-trimethylsilyl-1,2,3-triazol_5-yl) -propyl-tert-butyldimethylsilyl ether (I-conjugate 10) (1.46 g, 3.23 mmol) The residue was dissolved in THF (7.1 mL), TBAF (1.0 M THF solution, 7.1 mL, 7.1 mmol) was added, and the mixture was stirred for 2 hours. The THF was removed by evaporation, the ammonium salt was removed by an ion-exchange column (Dowex 50WX-200 ion-exchange resin), and the column was purified to obtain compound 11 (81%).

'Η NMR (CDCl): δ 1.32 (s, 9H, C (CH)); 2.98 (d, J = 6.6, 2H, CH C = C); 3.57 (d,

3 3 3 2

J = 3.9, 2H, CH OH); 3.88 (m, 1H, CH CH); 5.48 (m, 1H, NH); 7.55 (s, 1H,

twenty two

C = CH). ¹ C NMR (CDCl): δ 28.5, 52.2, 63.4, 80.1, 110.0, 156.4. IR (KBr) / cm— ¹ :

Three

3312br (NH I OH); 1685 (C = 0 IC = N). HRMS found MH ⁺ 243.1455. CHN〇

10 19 4 3 requires 243.1453.

[0020] (6) Synthesis of ^^ _ hi_800- / 3- (1,2,3-triazol_4-yl) -0-s-alanine: di-animal compound 12

Dissolve 2DL-tert-butoxycarbonylamino- (1,2,3-triazol-4-yl) -propanol (di-conjugated compound 11) (634 mg, 2.62 mmol) in DMF (25 mL) and add PDC (3.44 g, 9.17 mmol) and celite (5.1 g) were added, and the mixture was stirred for one day. Unnecessary substances were removed with Celite, and the solvent was removed with evaporation to obtain 658 mg (98%) of Compound 12.

HRMS found M ⁺ 256.1164.CHNO requires 256.1123.

10 16 4 4

[0021] (7) Synthesis of j3 -1,2,3- (triazol-4-yl) -DL-alanine

Ν-α-Boc-(1,2,3-triazol-4-yl) -DL-alanine (I-Danied Compound 12) (658 mg, 2.57 mmol) was dissolved in CH CI, and TFA and anisol were added. The mixture was stirred at room temperature for 12 hours. Solvent

twenty two

Was removed by evaporation and crystallized from getyl ether to give a salt of TFA. This salt was desalted with Dowex 50WX-200 ion-exchange-resin to obtain 612 mg (98%) of -1,2,3_ (triazole- _4- yl) _0 realanin.

mp 244-245 ° C, 'Η NMR (D O): δ 3.25 (m, 2H, CH); 3.95 (dd, J = 6.8, 5.2, 1H,

twenty two

CH); 7.69 (s, 1H, C = CH). IR (KBr) 3100 2000 br (NH); 1597 (C = 0); 1549

2

(C = N). Anal. Calcd for C H N O: C, 38.45; H, 5.17; N, 35.89. Found: C, 38.47;

5 8 4 2

H, 5.12; N, 35.46.

(Example 2: Introduction of unnatural histidine analog into protein)

Considering the amount of protein that can be prepared, simplicity, and economy, we attempted to use the E. coli system as a method for introducing unnatural amino acids into proteins. E. coli is usually histidine itself Histidine-deficient strains do not have this function. Therefore, the present inventors have studied whether the structure of the histidine analog synthesized this time is very similar to histidine, and it could be introduced simply by adding these unnatural amino acids to the medium. Therefore, the present inventors selected a protein called a chitin binding domain, and tried to introduce the β-1,2,3- (triazol-4-yl) -DL-alanine of the present invention into this protein.

(Construction of plasmid)

Expression vector fragments were prepared using normal inverse PCR. 1 μg of the synthetic DNA primer was mixed with commercially available pGEX-4T_3 (Pharmacia, Apsala, Sweden) containing the tac promoter for high expression, and PCR was performed with Ex.Taq DNA polymerase. Was. The sense and antisense primers used here were 5'-GCCAAAGCATATGGGATCCCCGAATTCCCG-3 'and 5'-CCGGGATCC, respectively.

CTCTTCATATTTTTCTTCAAGA-3 '. The sense primer had an EcoRI site and the antisense primer contained a BamHI site (underlined). The PCR product (ca. 4kbp) was isolated on 1% agarose gel electrophoresis and was digested with BamHI and EcoRI. The digested product was purified by phenol / chloroform extraction and ethanol precipitated.

[0024] The plasmid vector pHEX-CBD was constructed as follows. A commercially available CBD expression vector, pTYBl (New England Biolabs, Beverly, MA) was subjected to a PCR reaction with Ex.Taq DNA polymerase (Takara). The sequences of the sense and antisense primers were 5, _GCGGGATCCACGACAAATCCTGGTGTATC_3 'and 5,

-CGGAATTCTCATTGAAGCTGCCACAAGG-3. PCR products were isolated on 4% polyacrylamide gel electrophoresis and digested with EcoRI and BamHI. The digested product was purified by phenol / chloroform extraction, and ethanol precipitated. The precipitated DNA fragment was ligated to the EcoRI and BamHI sites of the above expression vector fragment.

E. coli JM109 strain was used to manipulate the pHEX plasmid and the pHEX_CBD plasmid described above. E. coli strains were transformed with each plasmid and bacteria were placed on LB containing ampicillin. A single colony was cultured in 3 ml of YT medium, and the plasmid was isolated using a plasmid miniprep kit (Qiagen, Hilden, Germany). Plasmid The sequence was confirmed by DNA sequence analysis.

[0026] (Expression of chitin binding domain)

UTH780 combi-tent cells, a histidine-requiring bacterial expression host, were transformed with the pHEX_CBD expression vector. The transformant was added to 5 ml of a minimal medium supplemented with 20 μg / ml of ampicillin (10 mg of Fe (NH 2) (SO 2)

4 2 4 3 4 2

55 mg, KH PO 4.4 g, K HPO-3H〇 6.0 g, NH CI 1.0 g, glucose 6 g, thiamine 10

2 4 2 4 2 4

mg, histidine 20 mg, pH 7) at 37 ° 〇 until the turbidity (A) force at 600 nm reaches

600

-He's done.

[0027] Bacteria were collected by centrifugation at 3000 rpm for 10 minutes, washed twice with M9 medium, and resuspended in 5 mL of minimal medium lacking histidine. Histidine in the cells was substantially removed by shaking the cells at 37 ° C for 20 minutes. Then, histidine or histidine equivalent was added to the medium. Induction was performed by addition of isopropyl j3_D-thiogalatatoside (IPTG, final concentration 0.4 mM), and the bacteria were further cultured at 37 ° C for 4 hours and collected by centrifugation at 3000 rpm for 10 minutes. The bacterial pellet was resuspended in 1 ml of 0.1% (v / v) Triton II-100 in PBS buffer (ρΗ7.4) and sonicated on ice (50 W, 5 times for 15 seconds). The lysate was centrifuged at 12000 卬 m for 1 minute, and the chitin binding domain protein in the supernatant was detected as described below.

(Detection of chitin binding domain mutated from wild type)

The SDS-PAGE was performed on a 15% gel to confirm that the chitin binding domain mutated from the wild type was generated. It was confirmed by performing Western blotting using an antibody. Apply a fixed amount (1 aL) of lysate to 9 μL of water and 2xSB (sample buffer; lOOMm Tris-HCl, pH6.8, 8% sodium dodecyl sulfate, 4% 2-mercaptoethanol, 24% glycerol, 0.01% Bromophenol blue). This solution was incubated at 95 ° C. for 5 minutes, 5 of the solution was subjected to gel electrophoresis, and an electric plot was made on a PVDF membrane. 37. Membrane in Tris-buffered saline (containing 20 mM Tris / HCl, 150 mM NaCl and 0.1% Tween_20). By incubating for 1 hour

Anti-chitin binding blocked with 3% BSA and diluted 1: 5000 in the same buffer Incubated with domain antibodies. After washing, the plate was incubated with an alkaline phosphatase-conjugated anti-Peacock IgG antibody diluted 1: 5000, and the blot was visualized using a Western Blue substrate (Promega, Madison, WI).

FIG. 3 is a photograph of a blotting showing the incorporation of histidine and histidine analog into a protein. In each lane, lane 1 is the result of a sample to which IPTG was not added, lane 2 was the result of a sample to which histidine was not added to the analog of the present invention, and lane 3 was the result of a sample to which histidine was added. Yes, lanes 4, 5, 6, and 7 are the results of samples analyzed for compounds 2, 3, 4, and 5 in FIG. In the photograph of FIG. 3, the introduction of the target amino acid was observed only in compounds 2 and 3. In other words, it was confirmed that the histidine analog of the present invention (I-Danied Compound 2) was efficiently introduced into the protein.

Industrial applicability

The histidine analog of the present invention is a novel unnatural amino acid. The histidine analog of the present invention has been reported to be effective as a medicament for other histidine analogs. May be useful as medicines. Further, since the triazole ring contained in the novel histidine analog of the present invention has a higher acidity and a stronger function as an acid catalyst than the imidazole ring, by introducing the histidine analog of the present invention into a protein, the acid catalyst of the protein can be obtained. Can increase activity.

Claims

Claims [1] The following chemical formula

(Formula 1)

0

II

H ₂ N— CH- C— OH

An amino acid having a strong structure.

[2] The following chemical formula

(Formula 2)

0

II

H ₂ N— CH- C— OH

A method for producing an amino acid having a strong structure.

[3] The following chemical formula

(Formula 3)

0

II

H ₂ —— CH- C—— OH

A protein characterized by the introduction of an amino acid having a strong structure. [4] The following chemical formula

(Formula 4)

0

II

H ₂ N— CH-C— OH

A method for producing a protein into which an amino acid having a structure comprising