WO2005014786A2 - Enhanced engineered chromosome formation from alpha satellite with artificially increased density of cenp-b boxes - Google Patents

Enhanced engineered chromosome formation from alpha satellite with artificially increased density of cenp-b boxes Download PDF

Info

Publication number
WO2005014786A2
WO2005014786A2 PCT/US2004/022314 US2004022314W WO2005014786A2 WO 2005014786 A2 WO2005014786 A2 WO 2005014786A2 US 2004022314 W US2004022314 W US 2004022314W WO 2005014786 A2 WO2005014786 A2 WO 2005014786A2
Authority
WO
WIPO (PCT)
Prior art keywords
cenp
dna
engineered
chromosome
boxes
Prior art date
Application number
PCT/US2004/022314
Other languages
French (fr)
Other versions
WO2005014786A3 (en
Inventor
Gil B. Van Bokkelen
Joydeep Basu
Original Assignee
Athersys, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Athersys, Inc. filed Critical Athersys, Inc.
Publication of WO2005014786A2 publication Critical patent/WO2005014786A2/en
Publication of WO2005014786A3 publication Critical patent/WO2005014786A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/20—Pseudochromosomes, minichrosomosomes
    • C12N2800/204—Pseudochromosomes, minichrosomosomes of bacterial origin, e.g. BAC
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/20—Pseudochromosomes, minichrosomosomes
    • C12N2800/208—Pseudochromosomes, minichrosomosomes of mammalian origin, e.g. minichromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/90—Vectors containing a transposable element

Definitions

  • the invention relates to the field of artificial chromosomes and gene expression. It
  • Alpha satellite DNA is the major species of repetitive element found at the
  • centromeres of all normal primate chromosomes It is organized in a hierarchical structure
  • Centromeric alpha satellite acts to organize the recruitment of key centromeric proteins
  • CENPs kinetochore
  • alpha satellite (so called "neo-centromeres”; reviewed in (6)), only cloned alpha satellite
  • SMCs are useful as vectors in gene transfer (7,12); for example, SMCs containing the
  • HPRT genomic locus have been shown to complement HPRT-deficient cell lines (Rudd et).
  • the present disclosure reports a systematic analysis of the role of the CENP-B box in
  • box element is required for efficient de novo centromere formation and that increasing the
  • a first embodiment of the present invention relates to an engineered
  • higher order repeat DNA comprising one or more CENP-B boxes, wherein said one or more
  • CENP-B boxes are distributed on the engineered higher order repeat DNA in an
  • CENP-B box quantity and/or order Yet another embodiment relates to an engineered Attorney Docket No. ATI-0029PCT chromosome formed by introduction of the above-mentioned engineered chromosome
  • a most preferred embocdiment of the invention relates to an engineered
  • chromosome vector forms an engineered chromosome upon introduction into an
  • chromosome is mitotically stable inside an appropriate cell.
  • chromosome vector comprising a transposon
  • DNA array comprising constructing two or more engineered monomers of defined DNA
  • engineered higher order repeat DNA comprising constructing two or more engineered
  • CENP-B box sequences and directionally assembling said engineered monomers to form
  • a further embodiment of the invention relates to a higher order repeat
  • a desired higher order repeat DNA comprising engineering each monomer unit of said
  • chromosome vector wherein said vector when introduced in an appropriate cell forms an
  • Figure 1(A) depicts an outline of an iterative scheme for synthesis of mutant
  • HOR higher-order repeat
  • Sapl recognition sites at both ends as appropriate. Digestion with Sapl allows seamless
  • Figure 1(B) depicts an outline of a scheme for directional multimerization of
  • a synthetic alpha satellite array consisting of 32 tandemly
  • fragment 'A' digested with BamHI and Spel and the alpha satellite containing fragment (fragment 'A')
  • fragment 'A' fragment derived from fragment 'A.
  • fragment ⁇ ' is directional, resulting in head-to-tail multimerization of adjacent higher-order
  • FIG. 1(C) depicts pulsed Field Gel Electrophoresis (PFGE) analysis of
  • Lanes are labeled according to higher-order repeat copy
  • the insert in lane 4 is 2.7 kb and therefore too small to be resolved by PFGE in
  • Figure 2 depicts mobility shift analysis of synthetic CENP-B box enriched
  • CENP-B box null monomers. Ligated tetramers of CENP-B box-enriched and CENP-B
  • box-null monomers were electrophoresed through an agarose gel following incubation with Attorney Docket No. ATI-0029PCT purified recombinant CENP-B protein.
  • Lanes 1, 2, and 3 represent enriched tetramers
  • Figure 3 depicts cytogenetic detection of SMCs from synthetic chromosome 17-
  • CENP-C antibody (green) identifies functional centromeres. FISH with the synthetic alpha
  • FIG. 3(A) depicts generating HT1080 clone by transfection with pBAC17 ⁇ 32(All
  • CENP-B box+ showing the presence of two SMCs.
  • Figure 3(B) depicts generation of HT1080 clone by transfection with
  • Figure 3(C) depicts generation of HT1080 clone by transfection with
  • Pgk-puro puromycine resistance cassette
  • Neo/Kan residual neomycine/kanamycine
  • Figure 5 depicts the molecular analysis of unimolecular BAC-SMC vectors.
  • Figure 5 (A) depicts a schematic of the BAC-SMC vector used to generate these
  • microchromosomes An 86 kb synthetic chromosome 17 derived alpha satellite array is
  • the solid thin black line marks the 10 kb BAC vector backbone.
  • Figure 5 (B) depicts a Southern blot analysis of HT1080 clone containing SMC.
  • Lane 1 I-Ceul digest of the genomic DNA plugs. Lane 2: Asc-1/Mlul digest of the
  • Lanes 1-2 are I-ceul and Ascl /Mlul digests of a
  • Lanes 3-4 are I-ceul and Ascl /Mlul digests of another example.
  • Figure 6 also depicts molecular analysis of unimolecular BAC-SMC vectors.
  • Figure 6 (A) depicts a genomic plug southern, HT1080 control (lane 1) and clone
  • G6B -1 (lane 2) cut with I-Ceul.
  • the band of 200 kb is the linear form of the original G6
  • Figure 6 (B) depicts a Hirt gel, colonies generated from the Hirt prep and
  • centromeres is that it is composed of a major class of repetitive DNA known as alpha
  • This DNA also referred to as alphoid DNA, is comprised of a monomeric
  • alphoid subfamilies Numerous (at least about 33) different alphoid subfamilies or HOR
  • HOR structures have been identified to date. Some of these HOR structures are specific for a
  • chromosome single naturally-occurring chromosome, while others are common to a group of naturally- Attorney Docket No. ATI-0029PCT occurring chromosomes. Moreover, some chromosomes appear to have only a single
  • chromosomes For example, such information, including a derived evolutionary consensus
  • sequence for alpha satellite monomer consensus sequence is additionally provided by K.H.
  • alphoid DNA is highly repetitive DNA sequence.
  • Appropriate cell refers to a cell (e.g., mammalian, primate, human) that allows
  • Y alpha satellite and Y ⁇ are used interchangeably and refer to alpha satellite
  • 17 alpha satellite and 17 ⁇ are used interchangeably and refer to alpha satellite
  • chromosomes e.g. human, chromosomes.
  • the size of the array on each chromosome varies
  • suprachromosomal family 4 has a monomeric organization without a distinctive HOR
  • chromosomes for example, 21
  • chromosomes belong to other alphoid suprachromosomal
  • Centromere the region of the chromosome that is constricted and is the site of
  • Centromeric DNA comprises a DNA that
  • CENP-B Box The CENP-B box is the stretch of DNA, present on alphoid DNA
  • 5'aTTCGttggAaaCGGGa3' is a
  • fragment 1 that is to be constructed. It would NOT be “directionally ligating” if fragment 1
  • microchromosome The "top-down" approach starts with an existing human
  • chromosome which then becomes experimentally reduced in size to a rriinichromosome.
  • ECs engineered chromosomes
  • sequence motifs or structural elements that signal
  • telomere sequences at both ends of a linear chromosome (not
  • chromosome ends Most genomic DNA pieces larger than 20-30 kb carry some origins of
  • EC vector denotes a non-naturally occurring chromosome vector regardless of
  • an engineered HOR denotes a DNA molecule with the
  • HOR DNA may be considered
  • chromosome derived from a naturally occurring chromosome.
  • Enriched denotes an increase in a quantity. For example, "enriched in CENP-B
  • box sequences denotes an increase in the number of CENP-B box unit sequences
  • Essential chromosome functions include mitotic stability without experimental
  • telomere for linear chromosomes
  • origin of replication functions for linear chromosomes
  • ATI-0029PCT Exogenous DNA denotes DNA introduced into a cell from outside.
  • Heterologous a DNA sequence not found in the naturally-occurring genome of
  • HOR Higher Order Repeat
  • repeating unit of DNA that is itself composed of smaller (monomeric) repeating units also
  • alphoid (DNA) monomers referred to as alphoid (DNA) monomers (see Alphoid DNA, above).
  • human chromosome Y two (for example, in human chromosome 1) to greater than 30 (human chromosome Y).
  • Constiment monomers exhibit varying degrees of homology to one another, from
  • Isolated refers to DNA that has been removed from a cell.
  • Isoschizomer refers to a restriction enzyme that recognizes the same nucleotide
  • Non-isoschizomeric site refers to a restriction enzyme site that can be cut by one of
  • ATI-0029PCT Mammalian chromosome means a DNA molecule or genetic unit that functions
  • Naked DNA means DNA that is unassociated with any of the biological
  • chromosome for example histones, non-histone chromosomal proteins, RNA,
  • transcription factors include topoisomerases, scaffold proteins, centromere-binding proteins, and
  • telomere-binding proteins Such DNA can be isolated from cells and purified from the
  • non-DNA chromosomal components non-DNA chromosomal components.
  • this DNA can be synthesized in vitro.
  • Non-naturally occurring distribution of CENP-B boxes denotes a structural
  • CENP-B boxes as well as the number of CENP-B boxes may be altered to form a desired
  • a construct may contain a CENP-B box in every HOR or
  • constructs are useful per se (as for example, increasing efficiency of SMC formation) or
  • a purified DNA can
  • Replicon a segment of a genome in which DNA is replicated and by definition
  • Type IIS enzymes include the class of restriction enzymes known as Type IIS.
  • Type IIS enzymes include the class of restriction enzymes known as Type IIS.
  • enzymes are often of intermediate size, typically 400-650 amino acids in length, and they
  • Type IIS enzymes are much more active on DNA molecules that contain multiple amino acids that contain multiple amino acids
  • Restriction enzymes that cleave sites that occur naturally in the HOR Attorney Docket No. ATI-0029PCT may also be used to ligate fragments of synthetic alphoid DNA that have been modified as
  • Synthetic centromeric alpha-satellite DNA denotes a DNA molecule with the
  • centromeric alpha-satellite DNA is made using any laboratory technique (such as chemical,
  • Centromeric alpha-satellite DNA may be considered synthetic whether because it has been
  • Synthetic or artificial chromosome are used interchangeably.
  • “artificial” chromosome is a construct that has essential chromosome functions but which
  • the chromosome Since the chromosome is composed entirely of exogenous DNA, it is referred to as
  • the size of the artificial chromosome is smaller than a natural chromosome (generally, that is
  • a synthetic microchromosome is an artificial or synthetic chromosome, and an artificial or
  • synthetic chromosome may be made as large or larger than the naturally-occurring
  • Engineered Chromosome denotes a polynucleotide molecule, made by man (i.e., non-
  • a chromosome it is more appropriately referred to as an EC. Nevertheless, it should be
  • an EC is useful as a vector for delivering, propagating, and/or expressing other
  • an EC can act as a vector when a
  • Mitotic stability as used with regard to a chromosome, such as an EC or SMC,
  • the preferred ranges of recombination frequency are less than
  • CENP-B box enriched HOR CENP-B box enriched HOR.
  • human cells is substantially 1:1, meaning that during each cell division of a cell that
  • daughter cell will receive a single copy of the EC.
  • nucleic acids introduction of nucleic acids into a cell.
  • the nucleic acid thus introduced is not naturally in
  • the cell in the sequence introduced, the physical configuration, or the copy number.
  • Telomere denotes the end of a chromosome comprising simple repeat DNA that
  • telomere is synthesized by a ribonucleoprotein enzyme called telomerase.
  • the function is to allow
  • CENP-B boxes and de novo centromere seeding efficiency (15, 19).
  • repeats contains either a consensus CENP-B box or a related sequence element derived
  • CENP-B is a constitutively present DNA-binding protein found in the underlying
  • CENP-B corresponding DNA sequence element that defines the cognate binding site
  • chromosome 21 centromere (21-1) forms de novo centromeres in an SMC system
  • alpha satellite from a neighboring CENP-B box depleted region (21-11) is inefficient (19).
  • CENP-B participates in nucleosome positioning (36, 37).
  • a general preferred approach for building up the array is to start with a construct
  • X may equal 1, 2, 4, 8, 16, 32 copies of the
  • A fragment consisting of the HOR plus a small amount of vector
  • CENP-B box sequences used in the present invention may be isolated from
  • alpha-satellite DNA of a given chromosome or it may be fully or pardy synthesized
  • a preferred embodiment of the invention is directed to increasing the frequency of
  • the frequency rate may be
  • the preferred engineered chromosome of the invention is mitotically stable
  • EC vector that contains at least 32 copies of natural or CENP-B box enriched HOR.
  • the mitotic segregation pattern of the EC in human cells is substantially 1:1
  • the present invention may be preferably practiced by making a transposon vector
  • Figures 4 depicts an example of such transposon vector which was
  • such transposon vector includes additional elements such as one or
  • Such a vector may include one or more selectable markers, and/or telomeric DNA, as described herein.
  • Such a vector may
  • Plasmids that contain the desired gene(s) of interest and the transposon may then be
  • the transposon based approach may be used to
  • the transposon vector may also be engineered to include elements that
  • viral capsids such as HSV-1 particles
  • the present invention may also be practiced by constructing SMC vectors that are
  • alpha satellite higher-order repeat units can seed formation of de novo centromeres in human
  • HT1080 cells (8, 10, 15-18; Rudd et al. (Nov 2003), Mol Cell. Bio. 23(21):7689-7697).
  • each of the 16 monomer units contained the consensus CENP-B box element 5': TTT
  • TGG TGG AAA AGG AA, which lacks CENP-B-binding activity ('CENP-B box null').
  • Each of the 16 modified monomer units was then synthesized by ligation of two to three
  • the SMC system provides a platform to systematically evaluate the functional
  • the higher- Attorney Docket No. ATI-0029PCT order repeat unit of D17Z1 alpha satellite consists of 16 monomer units (11).
  • Adjacent monomer units could then be gel-purified and
  • dimers ligated to form dimers.
  • Each dimer was PCR-amplified to introduce a restriction site such as
  • Sapl which cuts outside its recognition sequence and can generate custom-made
  • CENP-B boxes are required for efficient centromere formation de novo
  • CENP-B box null array was shown by loss of mobility shift in a gel shift assay ( Figure 2).
  • CENP-B boxes was indeed critical for de novo centromere formation, it might be possible to
  • Another embodiment includes the introduction of sequences that
  • SMC vectors would include, for example, the elements
  • arrays optionally a gene (or genes) of interest, including elements that control gene
  • vector should also contain elements that faciUtate such packaging, such as the HSV-1 viral
  • pac packaging sequence
  • oriS repUcation origin
  • Neocentromeres and human artificial chromosomes an unnatural act. ProcNatlAcadSci USA., 98(10):5374-6 10. Harrington JJ, Van Bokkelen G, Mays RW, Gustashaw K, WiUard HF. (1997)
  • CENP-B a major human centromere protein located beneath the kinetochore. / G?// ⁇ 3w/ 110(5):1475-88 22.
  • a human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satelUte. J CellBiol, 109(5):1963-73
  • CENP-B causes nucleosome positioning.
  • Genes Cells, 3(8):533-48 Attorney Docket No. ATI-0029PCT

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to the discovery that the distribution of CENP-B boxes on the alpha-satellite DNA affects efficiency of the centromere and thereby, affects efficiency of chromosome formation. Therefore, engineered chromosome vectors with altered distribution of CENP-B boxes are described that can alter the rate of chromosome formation as desired. Engineered HORs, chromosome vectors, and chromosomes as well as methods of making the same are described and claimed.

Description

Attorney Docket No. ATI-0029PCT TITLE OF INVENTION
Enhanced Engineered Chromosome Formation from Alpha Satellite with Artificially Increased Density of CENP-B Boxes
BACKGROUND OF THE INVENTION
1. Field of the Invention
The invention relates to the field of artificial chromosomes and gene expression. It
is demonstrated that using alpha satellite DNA containing an increased number of CENP-
B boxes enhances the efficiency of de novo artificial chromosome formation.
2. Background of the Related Art
Alpha satellite DNA is the major species of repetitive element found at the
centromeres of all normal primate chromosomes. It is organized in a hierarchical structure
based on a ~171 bp monomeric unit that is multimerized in a tandem manner into a
higher-order repeat, which is further multimerized over hundreds to thousands of kilobases
at the centromeres of all normal human chromosomes (reviewed in 1, 2, 3 ,4).
Centromeric alpha satellite acts to organize the recruitment of key centromeric proteins
(CENPs) to form a trilaminar protein/DNA complex, the kinetochore. The kinetochore
mediates the interactions between the chromosome and the spindle apparatus that are
responsible for coordinated chromosome movements during cell division (5). While
functional kinetochores have been observed at chromosomal locations not containing any
alpha satellite (so called "neo-centromeres"; reviewed in (6)), only cloned alpha satellite
DNA has thus far been shown to form centromeres de novo when introduced into the cell Attorney Docket No. ATI-0029PCT nucleus by transfection or microinjection in synthetic microchromosome (SMC) assays (7,
8, 9).
The ability to create SMCs de novo was pioneered through the development of
techniques to synthesize extended length alpha satellite arrays in vitro, including megabase
size synthetic arrays (10), starting with a single cloned copy of a higher-order repeat (11).
These SMCs are useful as vectors in gene transfer (7,12); for example, SMCs containing the
HPRT genomic locus have been shown to complement HPRT-deficient cell lines (Rudd et
al., manuscript in preparation, 13, 14), and the present inventors have observed sustained
expression of the β-globin gene from SMCs carrying the entire 150 kb β-globin genomic
region (Basu et al, in preparation). In addition, SMC and artificial chromosome vectors
provide a methodological platform for the identification and functional analysis of
elements in alpha satellite that are critical for centromere function (Rudd et al. (Nov 2003),
Mol. Cell. Bio. 23(21)0689-7697; also see 15, 16, 17, 10).
SUMMARY OF THE INVENTION
The presence of binding sites for the centromere protein CENP-B (the 'CENP-B
box') has been correlated with the ability of alpha satellite DNA to form centromeres de
novo in synthetic microchromosome (SMC) assays. However, the effect of the density of
CENP-B boxes on the frequency of SMC formation has not previously been explored.
The present disclosure reports a systematic analysis of the role of the CENP-B box in
human alpha satellite DNA, using the formation of SMCs as an assay for the establishment
of centromere function. Synthetic alpha satellite arrays were created based on the 16- Attorney Docket No. ATI-0029PCT monomer repeat length typical of natural chromosome 17-derived D17Z1 arrays. In these
synthetic arrays, the consensus CENP-B box elements were either completely absent (0/16
monomers) or were increased in density (16/16 monomers) compared to D17Z1 alpha
satellite (5/16 monomers). The test results demonstrated that the presence of CENP-B
box element is required for efficient de novo centromere formation and that increasing the
density of CENP-B box elements in the alpha satellite DNA results in enhancement of the
efficiency of de novo centromere formation. These findings have implications for the
design of strategies to construct novel SMC vectors for functional genomics and potential
therapeutic applications. Accordingly, a first embodiment of the present invention relates to an engineered
higher order repeat DNA comprising one or more CENP-B boxes, wherein said one or
more CENP-B boxes are distributed on the engineered higher order repeat DNA in an
order other than that of CENP-B boxes on a naturally-occurring higher order repeat DNA.
A second embodiment of the invention relates to an engineered alphoid DNA
comprising one or more CENP-B boxes, wherein said one or more CENP-B boxes are
distributed on the alphoid DNA in an order other than that of CENP-B boxes on a
naturally occurring alphoid DNA.
Hence, certain embodiments of the invention relate to engineered higher order
repeat DNA and/or alphoid DNA enriched in CENP-B box sequences. Other embodiments of the invention relate to engineered chromosomes and
chromosome vectors containing the alphoid DNA or the HOR DNA that is enriched in
CENP-B box quantity and/or order. Yet another embodiment relates to an engineered Attorney Docket No. ATI-0029PCT chromosome formed by introduction of the above-mentioned engineered chromosome
into an appropriate cell.
In a preferred embodiment of the invention, when the engineered chromosome
vector enriched in CENP-B boxes is introduced into an appropriate cell it forms an
engineered chromosome at an efficiency rate greater than an engineered chromosome
vector containing a higher order repeat DNA with a naturally-occurring frequency or
distribution order of CENP-B boxes.
A most preferred embocdiment of the invention relates to an engineered
chromosome vector enriched in its number of CENP-B boxes, wherein said engineered
chromosome vector forms an engineered chromosome upon introduction into an
appropriate cell at an efficiency rate of greater than about 1-5%, about 5-15%, about 10-
20%, or about 15-25% compared to a corresponding engineered chromosome vector
which is not enriched in its number of CENP-B boxes.
Yet another preferred embodiment of the invention relates to an engineered
chromosome enriched in its number of CENP-B boxes, wherein said engineered
chromosome is mitotically stable inside an appropriate cell. A most preferred embodiment
of the invention relates to a mitotically stable engineered chromosome with a mitotic
segregation pattern that is substantially 1:1.
Another most preferred embodiment of the invention is an engineered
chromosome vector comprising a transposon.
Another embodiment of the invention relates to a method of increasing efficiency
of formation of an engineered chromosome containing alphoid DNA comprising adding Attorney Docket No. ATI-0029PCT one or more CENP-B boxes to the alphoid DNA used to form said engineered
chromosome.
A further embodiment of the invention relates to a method of making an alphoid
DNA array comprising constructing two or more engineered monomers of defined DNA
sequences; wherein at least one monomer is enriched in CENP-B box sequences; and
assembling said engineered monomers to form said alphoid DNA array. Accordingly, an
embodiment of the invention relates to an engineered alphoid DNA array made by this
process.
Yet another embodiment of the invention relates to a method of making an
engineered higher order repeat DNA comprising constructing two or more engineered
monomers of defined DNA sequences; wherein at least one monomer is enriched in
CENP-B box sequences; and directionally assembling said engineered monomers to form
said higher order repeat DNA.
Accordingly, a further embodiment of the invention relates to a higher order repeat
DNA made by the above method.
A further preferred embodiment of the invention relates to a method of engineering
a desired higher order repeat DNA comprising engineering each monomer unit of said
desired higher order repeat DNA as one or more oligonucleotide(s); wherein at least one
monomer is enriched in CENP-B box sequences; and directionally ligating pairs of adjacent
monomer units to form repeating monomeric units to form the desired higher order repeat
DNA. Attorney Docket No. ATI-0029PCT Accordingly, a further preferred embocliment of the invention relates to a higher
order repeat DNA made by the above method.
A most preferred embodiment of the invention relates to an engineered
chromosome vector, wherein said vector when introduced in an appropriate cell forms an
engineered chromosome at an efficiency rate higher than an engineered chromosome
vector containing higher order repeat DNA with fewer CENP-B boxes.
Additional advantages, objects, and features of the invention will be set forth in part
in the description which follows and in part will become apparent to those having ordinary
skill in the art upon examination of the following or may be learned from practice of the
invention. The objects and advantages of the invention may be realized and attained as
particularly pointed out in the appended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention will be described in detail with reference to the following drawings: Figure 1(A) depicts an outline of an iterative scheme for synthesis of mutant
versions of chromosome 17 alpha satellite arrays. Each of the 16 individual monomers
comprising a single higher-order repeat (HOR) was synthesized as 2-3 oligonucleotide pairs
(60-100 bp each), which were direcdy ligated together and gel purified. Adjacent repeat
units were subsequendy ligated to form dimers as shown and PCR-modified to introduce
Sapl recognition sites at both ends as appropriate. Digestion with Sapl allows seamless
ligation of adjacent dimers to create tetramers without introduction of extraneous non-
alpha satellite sequences. Two additional rounds of serial ligation resulted in formation of a Attorney Docket No. ATI-0029PCT complete synthetic higher-order repeat unit, which was subcloned into the BAC vector
pBeloBAC (Shizuya et al., 1992), creating pBAC17αl(all CENP-B box+/all CENP-B box-
)• Figure 1(B) depicts an outline of a scheme for directional multimerization of
engineered higher-order repeats. A synthetic alpha satellite array consisting of 32 tandemly
multimerized copies of the higher-order repeat was created as follows: pBAC17αl was
digested with BamHI and Spel and the alpha satellite containing fragment (fragment 'A')
isolated and gel purified. The same construct was separately digested with Bglll and Spel,
and the larger fragment (fragment 'B') isolated and gel purified. Ligation of fragment 'A' to
fragment Ε' is directional, resulting in head-to-tail multimerization of adjacent higher-order
repeats. The resulting pBAC17α2 construct was then isolated following transformation of
the ligation reaction into E.coli. This process was repeated iteratively to create the final
pBAC17α32 arrays.
Figure 1(C) depicts pulsed Field Gel Electrophoresis (PFGE) analysis of
intermediates in the construction of 17α32 HOR/BeloBAC constructs. Each intermediate
was digested with Notl, which excises the entire subcloned alpha satellite array from the
pBeloBAC vector backbone. Lanes are labeled according to higher-order repeat copy
number. The insert in lane 4 is 2.7 kb and therefore too small to be resolved by PFGE in
the example shown. Figure 2 depicts mobility shift analysis of synthetic CENP-B box enriched and
CENP-B box null monomers. Ligated tetramers of CENP-B box-enriched and CENP-B
box-null monomers were electrophoresed through an agarose gel following incubation with Attorney Docket No. ATI-0029PCT purified recombinant CENP-B protein. Lanes 1, 2, and 3 represent enriched tetramers,
while lanes 4, 5, and 6 contain null species. Tetramer DNAs (lOOng) were pre-incubated
with varying quantities of CENP-B protein for 25 minutes at room temperature and
subsequendy loaded into a 2% agarose gel. Lanes 2 and 5 (20μg protein) as well as lanes 3
and 6 (40μg protein) contain protein/DNA mixtures. Comparison of lanes 2 and 3 to
lanes 5 and 6 reveals a marked difference in mobility shift in the CENP-B box-enriched
subunits, while only a modest shift is seen with CENP-B box-null DNA. This slight
mobility shift is likely due to salt effects as similar results are observed with a buffer-only
control (data not shown). Figure 3 depicts cytogenetic detection of SMCs from synthetic chromosome 17-
derived alpha satellite arrays. Arrows designate SMCs. Immunostaining with an anti-
CENP-C antibody (green) identifies functional centromeres. FISH with the synthetic alpha
satellite as probe (red) hybridizes with the synthetic microchromosome as well as to the
centromeres of the endogenous chromosome 17s. DAPI stained DNA is shown in blue. Figure 3(A) depicts generating HT1080 clone by transfection with pBAC17α32(All
CENP-B box+), showing the presence of two SMCs.
Figure 3(B) depicts generation of HT1080 clone by transfection with
pBAC17α32(natural). A single SMC is visible.
Figure 3(C) depicts generation of HT1080 clone by transfection with
pBAC17α32(CENP-B Box null). Two putative SMCs are present in this clone, but none
were detected in all other clones obtained with the CENP-B box null construct. Attorney Docket No. ATI-0029PCT Figure 4 depicts a transposon vector for rapid retrofitting of genomic BACs into
unimolecular BAC-SMC vectors. The 86 kb 17α32HOR alphoid array was subcloned as a
BamHl /Bgl2 fragment into the BamHl site of the transposon vector. This implies that
digestion of a genomic BAC with BamHl will indicate the approximate size of the alphoid
array inserted therein. Tel=telomere; ME=transposase recognition site; 17α32HOR=32
copies of the 2.7 kb Higher Order Repeat derived from the centromere of chromosome 17;
Pgk-puro=puromycine resistance cassette; Neo/Kan=dual neomycine/kanamycine
resistance marker.
Figure 5 depicts the molecular analysis of unimolecular BAC-SMC vectors. Figure 5 (A) depicts a schematic of the BAC-SMC vector used to generate these
microchromosomes. An 86 kb synthetic chromosome 17 derived alpha satellite array is
marked with XXXX. The solid thin black line marks the 10 kb BAC vector backbone.
Digestion of a SMC generated from this BAC with Iceu-1 is predicted to generate a single,
discrete band of approximately 100 kb, as seen in Figure B, lane 1, and Figure C, lanes 1
and 3. Digestion with Ascl and Mlul generates an 86 kb alpha satellite containing insert
and a 10 kb vector dropout, as seen in Figure B, lane 2 and Figure C, lanes 2 and 4.
Figure 5 (B) depicts a Southern blot analysis of HT1080 clone containing SMC.
Lane 1: I-Ceul digest of the genomic DNA plugs. Lane 2: Asc-1/Mlul digest of the
genomic DNA plugs. Digests were separated by PFGE, transferred and hybridized with a
BAC vector backbone specific probe. Attorney Docket No. ATI-0029PCT Figure 5 (C) depicts PFGE analysis of BACs rescued by Hirt extraction of HT1080
clones identified by southern analysis. Lanes 1-2: are I-ceul and Ascl /Mlul digests of a
typical clone. Lanes 3-4: are I-ceul and Ascl /Mlul digests of another example.
Figure 6 also depicts molecular analysis of unimolecular BAC-SMC vectors. Figure 6 (A) depicts a genomic plug southern, HT1080 control (lane 1) and clone
G6B -1 (lane 2) cut with I-Ceul. The band of 200 kb is the linear form of the original G6
B+ head to head construct.
Figure 6 (B) depicts a Hirt gel, colonies generated from the Hirt prep and
transformation into bacteria. Digested colony from clone G6 B-l (lanes 3 and 4), I-Ceul
and Not 1, respectively. Control G6 B+ head to head DNA cut with I-Ceul and Not 1
(lanes 1 and 2).
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
It is well recognized that the formation of a functional centromere is at the heart of
making synthetic chromosomes. A characteristic of primate, including human,
centromeres is that it is composed of a major class of repetitive DNA known as alpha
satellite DNA. This DNA, also referred to as alphoid DNA, is comprised of a monomeric
repeating unit of about 171 bp. These monomeric units are organized into different
tandem arrays that constitute clearly definable higher-order repeating (HOR) structures or
alphoid subfamilies. Numerous (at least about 33) different alphoid subfamilies or HOR
structures have been identified to date. Some of these HOR structures are specific for a
single naturally-occurring chromosome, while others are common to a group of naturally- Attorney Docket No. ATI-0029PCT occurring chromosomes. Moreover, some chromosomes appear to have only a single
HOR structure within their centromeres, whereas others may be comprised of several
different HOR structures. More detailed information is available and known to skilled
artisans regarding the genomic distribution of alpha satellite DNA on all human
chromosomes. For example, such information, including a derived evolutionary consensus
sequence for alpha satellite monomer consensus sequence is additionally provided by K.H.
Choo et al. in N c. Acid Research, Vol. 19, No. 6, pp.l 179-1182 (1991), which is herein
incorporated by reference in its entirety. It should be noted that alphoid DNA is highly
polymorphic, and such polymorphic sequences, as well as mutants (especially silent
mutants), are useful in the practice of the present invention.
All terms pertaining to recombinant DNA technology are used in their art-
recognized manner and would be evident to one of ordinary skill in the art.
Appropriate cell: refers to a cell (e.g., mammalian, primate, human) that allows
formation therein of an engineered chromosome. Y alpha satellite and Yα: are used interchangeably and refer to alpha satellite
DNA derived from the Y chromosome.
17 alpha satellite and 17α: are used interchangeably and refer to alpha satellite
DNA derived from chromosome 17.
Alphoid (DNA), alphoid (DNA) monomer, monomer repeats: Alphoid DNA
is the only repetitive satellite DNA sequence found in the centromeric region of primate,
e.g. human, chromosomes. In humans, the size of the array on each chromosome varies
between approximately 78 kb and 5 Mb (see, Yang, J.W., et al. (2000) Human mini- Attorney Docket No. ATI-0029PCT chromosomes with minimal centromeres. Hum. Mo/. Genet. 9: 1891-1902). Alphoid DNA
consists of 171 base pair monomer repeats organized into larger higher-order repeat
(HOR) units. There are at least 12 distinct monomer types, classified into five
suprachromosomal families according to the organization of the monomer units (see, Lee,
C, et al. (1997) Human Centromeric DNAs Hum. Genet. 100:291-304). For example, 17α
belongs to suprachromosomal family 3 and consists of type W monomers repeated as a
pentamer (Wl-5) forming a characteristic HOR. Y , on the other hand, is classified in
suprachromosomal family 4 and has a monomeric organization without a distinctive HOR
and exhibits only the type M alphoid monomers of this family. The other family 4
chromosomes (for example, 21), however, belong to other alphoid suprachromosomal
families as well, and contain monomers of the D and/or R types in addition to M; see Lee
(1997).
Centromere: the region of the chromosome that is constricted and is the site of
attachment of the spindle during meiosis or mitosis. It is necessary for the stability and
proper segregation of chromosomes during meiosis and mitosis and is therefore an
essential component of artificial chromosomes. Centromeric DNA comprises a DNA that
directs or supports kinetochore formation and thereby enables proper chromosome
segregation. Centromeric DNA at active, functional, centromeres is associated with
CENP-E during mitosis, as demonstrated by immunofluorescence or immunoelectron
microscopy. By "associated" is meant that the centromeric DNA and CENP-B co-localize
by FISH and immunofluorescence. Attorney Docket No. ATI-0029PCT CENP-B Box: The CENP-B box is the stretch of DNA, present on alphoid DNA
monomers from all human chromosomes except Y. It is minimally responsible for
mediating binding of the constitutive centromere protein CENP-B to human alpha satellite
DNA. At present, the biochemically-defined 17-bp degenerate sequence motif
"5'PyTTCGTTGGAAPuCGGGA3"' is a structure determined in the art to be capable of
providing this binding function (20, 21). For example, 5'aTTCGttggAaaCGGGa3' is a
typical CENP-B box sequence, wherein the bases indicated by capital letters are the most
important for the binding of the CENP-B protein, whereas the bases indicated by lower
case letters may be substituted with other bases. Directionally as in directionally ligating: refers to the order of the fragments that
are ligated together in a sequential order, following the sequence of the DNA unit that is
being constructed. For example, in constructing a fragment with the following sequence
"ATTΓΓΓΓAGCGCCCGGTTTATTTACCCCCCCC," the smaller fragments that are first
constructed span the full length of the larger fragment. For example, 4 smaller fragments
may be constructed with the following sequences: Fragment 1 = ATTT TTA; Fragment 2
= GCGCCCGG; Fragment 3 = TTTATTTA; and Fragment 4 = CCCCCCCC By
"directionally ligating" the smaller fragments, therefore, it is meant that small fragment 1 is
ligated to small fragment 2 and the small fragment 3 is ligated to small fragment 4, all in
the same sequential orientation 5' to 3' or 3' to 5', to maintain the sequence of the larger
fragment that is to be constructed. It would NOT be "directionally ligating" if fragment 1
were to be ligated to fragment 3 or 4 and/or if the 5' to 3' direction of the sequence of any
one small fragment was disrupted (as in ligating the small fragment 1 in its 5'-3' direction to Attorney Docket No. ATI-0029PCT the small fragment 2 in its 3'-5' direction, resulting in a larger fragment with the sequence
ATTTTTTA + GGCCCGCG, instead of the directional ligation sequence of ATTTTTTA
+ GCGCCCGG).
Engineered Chromosome (EC): refers to any form of episomal vectors whether
obtained by the so-called "bottom-up" or "top-down" methodologies. The bottom-up
approach aims to assemble a new chromosome de novo from its constituent DNA elements,
and the product is commonly referred to as an artificial or synthetic chromosome or
microchromosome. The "top-down" approach starts with an existing human
chromosome, which then becomes experimentally reduced in size to a rriinichromosome.
For convenience, the products generated by both these strategies are referred to collectively
as engineered chromosomes (ECs). The minimum components that a successful EC needs
to have are: (1) sequence motifs or structural elements (such as hairpin loops) that signal
DNA replication, necessary for the self-propagation of the chromosome; (2) a centromere,
which is essential for the accurate segregation of the replicated sister chromatids to
daughter cells; and (3) telomere sequences at both ends of a linear chromosome (not
necessary for non-linear, e.g. circular chromosomes) to provide structural stability to the
chromosome ends. Most genomic DNA pieces larger than 20-30 kb carry some origins of
replication, an EC of a size around or greater than a mega-base (Mb) should, therefore,
typically contain these motifs. EC vector: denotes a non-naturally occurring chromosome vector regardless of
how it is made. Attorney Docket No. ATI-0029PCT Endogenous DNA: denotes DNA naturally contained within a given cell as
opposed to any DNA that might have been introduced into the cell from the outside, such
as a vector DNA.
Engineered: As opposed to naturally-occurring, "engineered" denotes man-made
or -designed. For example, an engineered HOR denotes a DNA molecule with the
repetitive sequence structure of a higher order repeat DNA unit; wherein unlike the
naturally occurring HOR, the engineered HOR is made using any suitable laboratory
technique (chemical synthesis, isolation from nature, full or part amplification of the DNA,
site-directed mutagenesis, recombination and breakage of naturally-occurring or synthetic
DNA, ligation of two or more DNA fragments, or any combination of methodologies
known to the skilled artisans for making the molecule). HOR DNA may be considered
engineered whether because it has been fully or partially synthesized, expressed,
constructed, or assembled de novo or because it has been obtained by altering the namral
centromeric alpha-satellite DNA of a naturally-occurring chromosome or of an engineered
chromosome derived from a naturally occurring chromosome.
Enriched: denotes an increase in a quantity. For example, "enriched in CENP-B
box sequences" denotes an increase in the number of CENP-B box unit sequences
compared to a corresponding DNA unit containing fewer number of CENP-B boxes (e.g.,
a na rally-occurring HOR or an engineered chromosome with fewer CENP-B boxes, etc). Essential chromosome functions: include mitotic stability without experimental
selective pressure, substantially 1:1 segregation, autonomous replication, i.e., centromere,
telomere (for linear chromosomes), and origin of replication functions. Attorney Docket No. ATI-0029PCT Exogenous DNA: denotes DNA introduced into a cell from outside. Another
copy of the same DNA may already exist in the cell, which would be called the endogenous
copy of that DNA.
Heterologous: a DNA sequence not found in the naturally-occurring genome of
the cell in which the artificial mammalian chromosome is introduced. Additionally, if the
sequence is found in the genome of the cell, any additional copies that might be discovered
in the cell upon transfection are considered "heterologous" because they are not found in
that form in the naturally-occurring genome.
Higher Order Repeat (HOR) unit: HOR, as described above, refers to a
repeating unit of DNA that is itself composed of smaller (monomeric) repeating units also
referred to as alphoid (DNA) monomers (see Alphoid DNA, above). Monomers are
organized into chromosome-specific higher order repeating units, which are also tandemly
repetitive. The number of constiment monomers in a given HOR varies, from as little as
two (for example, in human chromosome 1) to greater than 30 (human chromosome Y).
Constiment monomers exhibit varying degrees of homology to one another, from
approximately 60% to virtual sequence identity. However, HORs retain a high degree of
homology throughout most of a given alphoid (DNA) array.
Isolated: refers to DNA that has been removed from a cell.
Isoschizomer refers to a restriction enzyme that recognizes the same nucleotide
sequence as another restriction enzyme and cleaves that same sequence. Therefore, a
"Non-isoschizomeric site" refers to a restriction enzyme site that can be cut by one of
two restriction enzymes, but not by both. Attorney Docket No. ATI-0029PCT Mammalian chromosome: means a DNA molecule or genetic unit that functions
as a chromosome in a mammalian cell.
Naked DNA: means DNA that is unassociated with any of the biological
(chromosomal or cellular) components with which it is normally associated in a naturally-
occurring chromosome, for example histones, non-histone chromosomal proteins, RNA,
transcription factors, topoisomerases, scaffold proteins, centromere-binding proteins, and
telomere-binding proteins. Such DNA can be isolated from cells and purified from the
non-DNA chromosomal components. Alternatively, this DNA can be synthesized in vitro.
Naturally-occurring: denotes events or objects that occur in nature and are not
experimentally-induced or made.
Non-naturally occurring distribution of CENP-B boxes: denotes a structural
arrangement within a HOR unit that differs from a naturally-occurring HOR in that the
number (including absence thereof) and/or the position of the CENP-B boxes has been
altered from the natural arrangement. In the present invention, both the distribution of the
CENP-B boxes as well as the number of CENP-B boxes may be altered to form a desired
DNA construct. For example, a construct may contain a CENP-B box in every HOR or
one in every other HOR, or none in the first 5 HOR, and so on and so forth. Such
constructs are useful per se (as for example, increasing efficiency of SMC formation) or
useful in a variety of ways in the elucidation of the role of various permutations of the
molecular structure of HORs in centromere formation and function. Both increases and
decreases in the efficiency of artificial chromosome formation may be desired in order to
achieve a particular effect, for example, control gene expression levels. Attorney Docket No. ATI-0029PCT Origin of replication: a site or region of initiation of DNA synthesis. Purified DNA: refers to isolated DNA that has been substantially completely
separated from non-DNA components of a cell or to DNA that has been synthesized in
vitro and separated substantially completely from the materials used for synthesis that would
interfere with the construction of the chromosome from the DNA. A purified DNA can
also be a DNA sequence isolated from the DNA sequences with which it is naturally
associated.
Replicon: a segment of a genome in which DNA is replicated and by definition
contains an origin of replication. Seamless restriction enzyme: any restriction enzyme that would allow ligation of
two DNA fragments of a higher repeat order DNA (such as the pairs of adjacent dimers
shown in Figure 1A) to form a larger fragment (such as the tetramers shown in Figure 1A)
without introduction of extraneous non-alpha satellite sequences. Examples of "Seamless"
enzymes include the class of restriction enzymes known as Type IIS. Type IIS enzymes
like Fokl and Alwl cleave outside of their recognition sequence to one side. These
enzymes are often of intermediate size, typically 400-650 amino acids in length, and they
recognize sequences that are continuous and asymmetric. They comprise two distinct
domains, one for DNA binding, the other for DNA cleavage. They are thought to bind to
DNA as monomers for the most part, but to cleave DNA cooperatively, through
dimerization of the cleavage domains of adjacent enzyme molecules. For this reason, some
Type IIS enzymes are much more active on DNA molecules that contain multiple
recognition sites. Restriction enzymes that cleave sites that occur naturally in the HOR Attorney Docket No. ATI-0029PCT may also be used to ligate fragments of synthetic alphoid DNA that have been modified as
described herein, such as the enrichment or ehmination of CENP-B boxes in a monomer
or assembled HOR.
Synthetic centromeric alpha-satellite DNA: denotes a DNA molecule with the
repetitive sequence structure of a centromeric alpha-satellite DNA, wherein the synthetic
centromeric alpha-satellite DNA is made using any laboratory technique (such as chemical,
recombinant DNA methodology) suitable for obtaining a centromeric alpha-satellite DNA.
Centromeric alpha-satellite DNA may be considered synthetic whether because it has been
fully or partially synthesized, expressed, constructed, or assembled de novo or because it has
been obtained by altering the namral centromeric alpha-satellite DNA of a naturally-
occurring chromosome.
Synthetic or artificial chromosome: are used interchangeably. A "synthetic" or
"artificial" chromosome is a construct that has essential chromosome functions but which
is not naturally-occurring. It has been created by introducing exogenous DNA into a cell.
Since the chromosome is composed entirely of exogenous DNA, it is referred to as
synthetic or artificial. A synthetic microchromosome more precisely points out that the
size of the artificial chromosome is smaller than a natural chromosome (generally, that is
because it does not carry as many exons and introns as a natural chromosome). However,
a synthetic microchromosome is an artificial or synthetic chromosome, and an artificial or
synthetic chromosome may be made as large or larger than the naturally-occurring
chromosomes if desirable. Attorney Docket No. ATI-0029PCT Engineered Chromosome (EC) vector: sometimes used interchangeably with
Engineered Chromosome (EC) denotes a polynucleotide molecule, made by man (i.e., non-
naturally occurring), having the minimum structural requirements for forming a functional
chromosome. As long as this polynucleotide has not been yet interacted with other factors
(such as the required proteins - whether outside or inside a cell) to form a functional SMC,
it is preferably referred to as an EC vector. However, once it is functional and behaving as
a chromosome, it is more appropriately referred to as an EC. Nevertheless, it should be
noted that an EC is useful as a vector for delivering, propagating, and/or expressing other
desired DNA; hence, continuing to preserve its use as a vector even after it has become a
functional engineered chromosome. For example, an EC can act as a vector when a
desired DNA sequence is transposed onto it.
Mitotic stability: as used with regard to a chromosome, such as an EC or SMC,
denotes the structural integrity and segregation pattern of such chromosome inside an
appropriate cell after at least about 30 generations of growth with a low or non-existent
recombination frequency. The preferred ranges of recombination frequency are less than
about 0.5 per generation for an EC vector that contains at least 32 copies of namral or
CENP-B box enriched HOR. Similarly, the mitotic segregation pattern of the EC in
human cells is substantially 1:1, meaning that during each cell division of a cell that
contains a single copy of the EC, there is better than about a 95% probability that each
daughter cell will receive a single copy of the EC. Preferably, there is a better than 99%
probability that each daughter cell will receive a single copy of the EC. Attorney Docket No. A'i'I -0029 PCT Transfecting or transforming: as used interchangeably herein denotes the
introduction of nucleic acids into a cell. The nucleic acid thus introduced is not naturally in
the cell in the sequence introduced, the physical configuration, or the copy number.
Telomere: denotes the end of a chromosome comprising simple repeat DNA that
is synthesized by a ribonucleoprotein enzyme called telomerase. The function is to allow
the ends of a linear DNA molecule to be replicated and structurally stabilized.
The inventors have observed variations in the efficiency of de novo centromere
formation between alpha satellite templates derived from different human chromosomes
(18, 8, 16), and have proposed that a causal link exists between the presence of sequence
elements called CENP-B boxes and de novo centromere seeding efficiency (15, 19).
While there was clear evidence implicating the presence of CENP-B boxes in de novo
centromere formation (15), it was not clear to what extent the density of CENP-B boxes
might influence the efficiency of SMC formation. Thus, in order to address the functional
significance of the CENP-B box in human alpha satellite and in SMC formation, the
inventors developed methodologies to directly vary the density and distribution of CENP-
B boxes in the D17Z1, chromosome 17-derived HOR, which in its natural configuration
contains a CENP-B box in 5 of its 16 constiment monomers. Hence, entirely synthetic
D17Z1 HOR derivatives were constructed, in which each of the 16 tandem monomeric
repeats contains either a consensus CENP-B box or a related sequence element derived
from Y chromosome alpha satellite, which does not bind CENP-B (22, 23). It was
observed and is herein reported that the efficiency of formation of SMCs is directly
proportional to the density of CENP-B boxes in the SMC vector, thus demonstrating a Attorney Docket No. ATI-0029PCT requirement for CENP-B boxes in centromeric chromatin assembly. As the methods
presented here are generally applicable, these data have implications for the design and
further development of SMCs for potential applications in protein production as well as
human gene therapy. Since the original report of de novo centromere and SMC formation (10), a number
of groups have described related approaches to further develop and optimize artificial
chromosome systems (reviewed by 7, 26, 12). The creation of SMCs has now been
established as a tractable approach to systematically identify and dissect elements that are
critical for chromosome function (15, 16, and Rudd et al. (Nov 2003), Mo/. Cell. Bio.
23(21):7689-7697). The present disclosure describes, inter alia, the further refinement of the
SMC system as a methodological platform to undertake a functional analysis of the role of
the density of CENP-B box elements in human alpha satellite DNA.
CENP-B is a constitutively present DNA-binding protein found in the underlying
centric heterochromatin of all human chromosomes except the Y chromosome. The
corresponding DNA sequence element that defines the cognate binding site, the CENP-B
box, has been identified as PyTTCGTTGGAAPuCGGGA (20, 22) and is found
distributed within some, but not all, of the monomer units of alpha satellite DNA from
most human centromeres (25, 16, 27). However, the role of CENP-B if any, in specifying
centromeric identity globally remains unsettled (28). Y chromosome centromeres do not
associate with CENP-B (23), and African Green Monkey centromeres lack CENP-B boxes
even though the CENP-B protein itself is present (29). Furthermore, Cenp-B knockout Attorney Docket No. ATI-0029PCT mice show only modest phenotypic effects and appear to have fully functional centromeres
as evidenced by the lack of chromosome mis- segregation phenotypes (30, 31, 32).
Notwithstanding this mechanistic uncertainty, studies of de novo centromere
formation with cloned alpha satellite arrays support a direct correlation between the
presence of CENP-B boxes and the competence of a construct for de novo centromere
formation. For example, comparison of cloned alpha satellite arrays from chromosomes Y,
X, 17 and 21 show that 17- and 21 -derived arrays form de novo centromeres much more
efficiently than X- and Y-derived arrays (Rudd et al. (Nov 2003), Mol. Cell. Bio. 23(21):7689-
7697; and 8, 18). In addition, alpha satellite from a CENP-B box rich region of the
chromosome 21 centromere (21-1) forms de novo centromeres in an SMC system, while
alpha satellite from a neighboring CENP-B box depleted region (21-11) is inefficient (19).
Further, the de novo centromere nucleation ability of the 21-I-derived alpha satellite array
can be disrupted by mutation of its constituent CENP-B boxes (15), an outcome that
parallels the presently presented observations on mutation of CENP-B boxes in D17Z1-
derived alpha satellite. Finally, it has also been established that CENP-B boxes outside the
context of alpha satellite DNA are not competent to nucleate de novo centromere assembly
(15), establishing that sequence features other than CENP-B boxes are also required for
centromere function. Taken together, the presendy disclosed data and the earlier
observations unambiguously establish the presence of CENP-B and its cognate binding
element as a requirement for efficient de novo centromere formation in SMC or artificial
chromosome assays. Attorney Docket No. ATI-0029PCT Despite the clear role of the CENP-B box in assembly of SMCs, the role of CENP-
B in its endogenous chromosomal context remains open to debate. At least three CENP-
B-like proteins have been identified in fission yeast, and double mutants exhibit severe
chromosome segregation defects (33). Such functional redundancy may explain the lack of
a major phenotype in mouse knockouts of Cenp-B (29, 30, 31) and why Cenp-B appears
dispensable for function of the Y chromosome in both mice and men, as well as for
function of neocentromeres and certain dicentric chromosomes (34, 35). In addition, it
remains to be established whether the position of CENP-B boxes within an array of
monomers or even within a single monomer is also of importance, as might be expected if
CENP-B participates in nucleosome positioning (36, 37).
In addition to the effect of manipulating CENP-B boxes demonstrated here and by
Ohzeki et al. (15), it is apparent that other sequences within alpha satellite may influence
the efficiency of SMC formation, as even arrays with a similar number of CENP-B boxes
can differ quite substantially in their ability to seed SMCs (Rudd et al. (Nov 2003), Mol. Cell.
Bio. 23(21):7689-7697; and 25). This possibility may now be investigated systematically
using synthetic alpha satellite arrays where the distribution of CENP-B boxes and/or other
sequences in each monomer has been manipulated, using the approach outlined here.
Determination of the ideal density and distribution of such sequences in alpha satellite will
maximize the efficiency with which SMC vectors carrying therapeutic genes might
eventually be assembled in human cells (14, 7, 12).
The methodology described in the examples of the present disclosure for making
the synthetic HOR and alpha satellite array as well as the synthetic artificial mammalian Attorney Docket No. ATI-0029PCT chromosome is preferred. However, any modifications of the disclosed methodology or
other methodologies known to the skilled artisans may be used as well. The manipulation
of efficiency of chromosome formation is achieved by altering the density and distribution
of the CENP-B box and it is not critical how this objective is achieved. For example,
USPN 5,695,967 (Van Bokkelen et al), which is incorporated in its entirety herein by
reference, provides detailed description of a method for making repeating tandem arrays of
DNA which is useful in making the synthetic HORs and the synthetic centromeric alpha
satellite DNA of the present invention. USPN 6,348,353 Bl (Harrington et al), which is
incorporated in its entirety herein by reference, sets forth a preferred method of making
artificial mammalian chromosomes that are useful for making the claimed invention.
A general preferred approach for building up the array is to start with a construct
such as the pBeloBAC17alpha X HOR CENP-B box saturated/null. X is the number of
copies of the HOR in a given iteration. X may equal 1, 2, 4, 8, 16, 32 copies of the
approximately 2.6 kilobase HOR, etc. Taking the embodiment where X = 1, as shown in
Figure IB, digestion of the starting construct with BamHl and Spel creates an insert
fragment, referred to as "A," consisting of the HOR plus a small amount of vector
sequence. Digestion of the starting construct with Bgl2 and Spel creates the
corresponding vector fragment or "B," consisting of the starting vector minus the small
amount of sequence between the Bgl2 and Spel sites. A is now cloned into B to give the
pBeloBAC17alpha2HOR, shown on the right, in Figure IB. Reiteration of this process
builds up the array to pBeloBAC17alpha32HOR and so forth. Attorney Docket No. ATI-0029PCT The CENP-B box sequences used in the present invention may be isolated from
alpha-satellite DNA of a given chromosome or it may be fully or pardy synthesized
chemically and the partial DNA sequences maybe ligated together by any means known in
the art in order to form a CENP-B box DNA unit. A preferred embodiment of the invention is directed to increasing the frequency of
formation of an engineered chromosome, e.g., SMC, by increasing the number of CENP-B
boxes present on the centromeric alphoid DNA array. The frequency rate may be
increased by any percentage or fraction thereof, for example, by greater than about 5-10%,
10-15%, 15-20%, 20-25% frequency rate of EC formation of a corresponding EC vector
differing only in that it contains fewer CENP-B boxes. Hence, the preferred embodiment
of the present invention enables making engineered chromosome vectors with improved
frequency rate of formation of engineered chromosomes, e.g., a SMC.
The preferred engineered chromosome of the invention is mitotically stable,
meaning that it is capable of being propagated in an appropriate host cell for at least about
30 generations of growth with a low or non-existent recombination frequency. The
preferred ranges of recombination frequency are less than about 0.5 per generation for an
EC vector that contains at least 32 copies of natural or CENP-B box enriched HOR.
Similarly, the mitotic segregation pattern of the EC in human cells is substantially 1:1,
meaning that during each cell division of a cell that contains a single copy of the EC, there
is better than about a 95% probability that each daughter cell will receive a single copy of
the EC. Preferably, there is a better than 99% probability that each daughter cell will
receive a single copy of the EC. Attorney Docket No. ATI-0029PCT The present invention may be preferably practiced by making a transposon vector
that contains a synthetic alpha satellite array (either naturally occurring or enriched for
CENP-B boxes). Figures 4 depicts an example of such transposon vector which was
specifically designed for rapid retrofitting of genomic BACs into unimolecular BAC-SMC
vectors. Transposon systems and their use in vector construction are known in the art (see
for example, Goryshin, I.Y. and Reznikoff, W.S. (1998) /. Biol. Chem. 273, 7367 and USPN
5,965,443, herein incorporated by reference, as well as Davies, D.R. et al. (2000) Science 289
(5476), 77).
Optionally, such transposon vector includes additional elements such as one or
more selectable markers, and/or telomeric DNA, as described herein. Such a vector may
also be transposed into another plasmid that contains any desired fragment of DNA, for
example including human genomic DNA that contains a gene (or multiple genes) of
interest. Plasmids that contain the desired gene(s) of interest and the transposon may then
be screened and structurally analyzed in order to identify a vector clone that possesses the
desired structural configuration (e.g. insertion of the transposon vector into the appropriate
region of the target plasmid). In this way, the transposon based approach may be used to
rapidly retrofit any BAC vector that contains a DNA construct or fragment of interest,
including cloned fragments of human DNA.
Optionally, the transposon vector may also be engineered to include elements that
facilitate packaging of newly constructed vectors into viral capsids, such as HSV-1 particles,
using a viral amplicon system, such as those described in the literature. Preferably, such Attorney Docket No. ATI-0029PCT vectors should be of appropriate size so as to be efficiendy accommodated into the viral
capsid upon vector packaging, as described in the literature.
The present invention may also be practiced by constructing SMC vectors that are
packaged into viral capsids using techniques that are known to those skilled in the art (see
for example E. Antonio Chiocca et al, "Viral delivery Systems for Infectious Transfer of
Large Genomic DNA Inserts" Pub. No.: U.S. 2002/0110543 Al (Pub Date August 15,
2002; and Howard J. Federoff et al, "Helper Virus-Free Amplicon Particles and Uses
Thereof Pub. No.: U.S. 2003/0027322 Al (Pub Date Feb 6, 2003). Such SMC vectors
have a variety of uses such as in vitro protein expression or gene therapy. Examples
Previous studies have established that vectors. containing multiple copies of certain
alpha satellite higher-order repeat units can seed formation of de novo centromeres in human
HT1080 cells (8, 10, 15-18; Rudd et al. (Nov 2003), Mol Cell. Bio. 23(21):7689-7697).
However, the overall frequency of generation of SMCs has been reported to be quite
variable and often quite low (Rudd et al., in press; 25, 15, 8, 18), depending at least in part
on the chromosomal origin of the alpha satellite array and on the presence or absence of
CENP-B boxes. Therefore, the inventors developed, and herein describe, a general
approach to maximize the efficiency of SMC formation and to evaluate the sequence-
dependency of de novo centromere seeding.
Materials & Methods
The following materials and methods were used by the inventors which provide
specific teachings as well as general guidelines for making and using the claimed invention. Attorney Docket No. ATI-0029PCT
All the materials & methods as well as the experiments described in the Examples provide
sufficient guidance to persons of skill in the art to carry out the invention and are in no way
intended to limit the scope of the claims.
Synthesis of modified 2.7 kb chromosome 17-derived higher-order repeats
The sequence of the 2.7 kb D17Z1 higher-order repeat (11) was modified such that
each of the 16 monomer units contained the consensus CENP-B box element 5': TTT
CGT TGG AAA CGG GA: 3' (22) or the related Y alpha satellite-derived element AGA
TGG TGG AAA AGG AA, which lacks CENP-B-binding activity ('CENP-B box null').
Each of the 16 modified monomer units was then synthesized by ligation of two to three
pairs of overlapping oligonucleotides (Operon Technologies, CA). Adjacent pairs of
mutated monomer units were then ligated together to form dimers. In addition, the EcoRI
sites of monomers 1 and 16 were altered to create a BamHl site at the 5' end of monomer
1 and a Bglll site at the 3' end of monomer 16. Each gel-purified dimer was then PCR
amplified with a Bsal or Sapl restriction site, such that upon digestion each dimer would
produce a defined overhang exacdy complementary to an overhang in the adjacent dimer.
The resultant tetramers (containing no extraneous sequence) were then T/A subcloned
into pGem-Teasy (Promega) and sequence verified. Adjacent tetrameric subunits were
then ligated together using Sapl (or Notl and Sapl for monomers 1 and 16) to generate the
appropriate overhang. The resultant octamers were further gel purified and ligated
together to produce the completed synthetic 16-mer, representing a single D17Z1 higher-
order repeat unit, with Notl overhangs. This higher-order repeat was then subcloned as a Attorney Docket No. ATI-0029PCT
Notl fragment into the BAC cloning vector pBeloBAC 11 (24). The overall strategy is
outlined in Figure 1A.
Directional multimerization of the synthetic higher-order repeats
The 2.7 kb CENP-B box enriched or CENP-B box null D17Z1 higher-order repeat
was multimerized directionally as follows. The cloned synthetic higher-order repeat (in
pBeloBACll) was digested with BamHl and Spel, and this band (fragment 'A') was gel
purified by standard procedures (Qiagen). A second fragment ('B') was generated by
digesting the same cloned repeat with Bglll and Spel. The appropriate fragment 'B' was
subsequendy gel purified and ligated to the BamHI/Spel digested fragment 'A'. This
ligation reaction was transformed into E.coli (GibcoBRL), and recombinant clones
identified by Notl digestion of the resultant clones and pulsed field gel electrophoresis (Fig.
IB). This process was repeated iteratively to create clones containing 4, 8, 16 and 32 copies
of the CENP-B box enriched/CENP-B box null chromosome 17 based higher-order
repeat in pBeloBAC (Fig. 1C). Finally, for use as a selectable marker in mammalian cells, a
cDNA cassette conferring resistance to puromycin was introduced into 17α32(CENP-B
box enriched/null) unit/pBeloBAC by transposition of the puroR cassette into the
pBeloBAC vector backbone (Epicentre). An ~86 kb synthetically assembled alpha satellite array, derived from directional
multimerization of the naturalyl occurring 2.7 kb D17Z1 repeat unit (pl7H8, see 8, 10, 11),
was subcloned as a BamHI/Bglll fragment into the BamHl site of pBeloBACll. This Attorney Docket No. ATI-0029 CT construct, 17α32(natural)/pBeloBAC, was further modified by transposition with a
puromycin resistance selectable marker (Epicentre). The structural integrity of all modified
higher-order repeats and of the original higher-order repeat array was confirmed by
sequencing, restriction digestion and FISH hybridizations using the array as probe.
Mobility shift analysis
The effect of mutations described above on CENP-B binding to the synthetic HOR
was evaluated by a gel mobility shift assay. Cloned tetramer units assembled from CENP-
B box-enriched and CENP-B box-null monomers were digested with Notl and inserts
were gel purified. Subsequent to incubation with purified recombinant CENP-B protein
(Diarect, Germany) for 25 minutes at room temperature in CENP-B binding buffer (20),
protein/DNA complexes were electrophoresed through a 2% agarose gel in 0.5xTBE
buffer. Following electrophoresis, SybrGold (Molecular Probes) stain was used to visualize
DNA bands.
Cell transfection
Human HT1080 cells (gift of Dr. Brenda Grimes, Case Western Reserve University)
were transfected using the Fugene 6 (Roche) reagent according to the manufacturer's
instructions, and stable clones identified on the basis of resistance to puromycin (Kayla) at
3 μg/ml. Clones appeared after 7-10 days and were subsequendy expanded to generate
clonal lines for further analysis. Attorney Docket No. ATI-0029PCT
Cytogenetic analysis and validation of SMCs
Clonal populations of cells containing potential SMCs were analyzed, generally as
described (8, 16, 10). Briefly, cells were arrested at metaphase using colchicine (Gibco) at
40 ug/ml for 45 minutes at 37 degrees Celsius, then treated with hypotonic solution (0.075
M KC1, 12 minutes, 37 degrees Celsius) and applied to slides using the Shandon Cytospin
3. Slides were subsequendy fixed in 2% formaldehyde solution and immunoreacted with
rabbit anti-CENP-C antibody (10) at a concentration of 1/2000 in PBS and detected with
goat anti-rabbit IgG (H + L) ( Molecular Probes). DNA probes were labeled by nick
translation using the Vysis system according to the manufacturer's instructions.
Immunoreacted slides were fixed (3:1, me thanol: acetic acid), subjected to denamration
(70% formamide, 72 degrees Celsius, 8 minutes), and hybridized to denatured probes as
described (8).
Putative artificial chromosomes were scored if they showed a positive hybridization
signal with a FISH probe derived from the synthetic array as well as positive CENP-C
immunoreactivity. Mitotic stability was evaluated by growth in the absence of drug
selection for up to six weeks.
Construction of Engineered, D17Zl-based higher-order repeats
The SMC system provides a platform to systematically evaluate the functional
significance of sequence elements within human alpha satellite DNA. The inventors
developed methodologies to construct modified synthetic D17Z1 units that are either
enriched or depleted in the density of CENP-B box DNA binding elements. The higher- Attorney Docket No. ATI-0029PCT order repeat unit of D17Z1 alpha satellite consists of 16 monomer units (11). In order to
generate engineered higher-order repeats, each of the 16 monomer units was synthesized
by the serial stepwise assembly of oligonucleotide pairs, each between 60 and 100 bp in
length, as shown in Figure 1A. Adjacent monomer units could then be gel-purified and
ligated to form dimers. Each dimer was PCR-amplified to introduce a restriction site such
as Sapl (which cuts outside its recognition sequence and can generate custom-made
overhangs that can be ligated seamlessly), thereby generating tetramers without the addition
of any extraneous sequence. This process of PCR and ligation assembly was serially
repeated until the complete 16-mer repeat unit was constructed. The resulting synthetic
higher-order repeat was then subcloned and directionally concatamerized to 32 copies
(Figure IB, C), using methods previously developed in the inventors' lab (10).
CENP-B boxes are required for efficient centromere formation de novo
The inventors used the approach described above to create a modified variant of
D17Z1 alpha satelUte in which all the consensus CENP-B boxes or elements resembling
the consensus in each of the 16 monomer units were replaced with a sequence derived
from Y chromosome alpha satellite. This approach allowed them to knockout any
interaction between CENP-B and its biochemically defined consensus element, as well as
any interactions between CENP-B and elements resembling the consensus that might
potentially occur in vivo. Confirmation of abolishment of CENP-B binding to the synthetic
CENP-B box null array was shown by loss of mobility shift in a gel shift assay (Figure 2).
Constructs based on the naturally occurring, unmodified D17Z1 have been used
previously to generate mitotically stable SMCs in greater than 10% of drug-resistant clones Attorney Docket No. ATI-0029PCT after transfection into human HT1080 cells (Rudd et al., in press; 8, 10, 18). Here, SMCs
were identified in 4 of 38 colonies (Table 1), consistent with earlier data. However, when
using the CENP-B box null construct in which all CENP-B boxes had been modified, only
a single clone was identified to have a putative SMC out of 40 clones screened,
representing a maximum de novo centromere formation frequency of 2.5 % (Table 1). The
fact that the observed rate of de novo SMC formation is low but is not zero is consistent
with other reports that some alpha satellite arrays that do not contain CENP-B boxes can
in fact mediate apparent SMC formation at very low frequencies (25, 18), although the
possibility that these represent SMCs that have acquired endogenous centromere sequences
has not been rigorously excluded. Indeed, previous data have demonstrated that the
likelihood of such an acquisition event is increased when the de novo centromere
competency of the transfected DNA is lowest, as in the case of CENP-B box null
constructs (8, Rudd et al. (Nov 2003), Mol. Cell. Bio. 23(21):7689-7697). The data presented
herein are in agreement with those recendy reported by Masumoto and colleagues, who
used a similar approach to abolish CENP-B boxes in a higher-order repeat derived from
chromosome 21 (15). Combined, the two studies provide strong evidence that CENP-B
boxes are required generally for efficient formation of de novo centromeres in SMC systems.
Creation of more efficient centromere constructs by increasing the density of
CENP-B boxes
Several studies have now suggested a relationship between the presence of CENP-B
boxes in cloned alpha satelUte and the abiUty to form de novo centromeres from BAC or Attorney Docket No. ATI-0029PCT
YAC vectors containing the cloned arrays (8, 10, 15-19). As an extension of the data
presented above and by Ohzeki et al. (15), the inventors reasoned that if the density of
CENP-B boxes was indeed critical for de novo centromere formation, it might be possible to
create synthetic alpha satelUte arrays with a CENP-B box density even higher than their
naturally occurring counterparts. These novel synthetic arrays might form a more efficient
template for centromere formation de novo than natural arrays.
To evaluate this hypothesis, the inventors used the strategy described above to
construct a synthetic D17Z1 -derived alpha satelUte array supersaturated with CENP-B
boxes, such that each of the 16 monomers in the HOR contained a consensus CENP-B
box. Notably, upon introduction into HT1080 cells by transfection, these supersaturated
synthetic arrays formed SMCs de novo more than twice as efficiendy as arrays containing the
natural density of CENP-B boxes (Table 1). The frequency of SMCs within any one clone
was observed to vary from 10% to 100%, similar to the ranges observed in cell Unes
derived from transfection with the control natural arrays (8, 17). No integration events
were observed cytogenetically, although Southern blot data (not shown) demonstrated the
presence of BAC-specific DNA.
Initial cytogenetic estimates suggested that the SMCs (from aU versions of the array)
are several megabases in size; hence, suggesting recombination and rearrangement events.
However, further reisolation, digestion, physical resolution and characterization revealed
that many of the SMCs were not rearranged and were in fact, intact, and circular plasmids
that maintained the precise structure of the original vector introduced into the human ceU
Une (see Figures 4-6). In addition multiple examples of SMC vectors that contain cloned Attorney Docket No. ATI-0029PCT human genomic DNA fragments in addition to the synthetic alpha satelUte arrays and other vector sequences shown were obtained, demonstrating that vectors containing desired genomic fragments of interest may be introduced into human ceUs, with the result that mitoticaUy stable SMCs are formed that are unrearranged from the original vector sequence. In aU cases, SMCs were shown to be mitoticaUy stable in the absence of selection for a minimum of six weeks and to bind the centromere-specific protein CENP- C.
TABLE ONE Effect of CENP-B box density on efficiency of SMC formation
Figure imgf000037_0001
The foregoing embodiments and advantages are merely exemplary and are not to be construed as Umiting the present invention. The present teaching can be readily apphed to other types of artificial chromosomes. The description of the present invention is intended Attorney Docket No. ATI-0029PCT to be iUustrative, and not to limit the scope of the claims. Many alternatives, modifications,
and variations wUl be apparent to those skilled in the art.
For example, another embodiment includes the introduction of sequences that
faciUtate the packaging of a SMC vector into a modified viral deUvery system, such as the
HSV-1 ampUcon systems that have been described previously (see for example Chiocca et
al, and Federoff et al). These SMC vectors would include, for example, the elements
described herein, such as the synthetic (CENP-B box enriched) or natural alpha satellite
arrays, optionally a gene (or genes) of interest, including elements that control gene
expression, and if desired, additional segments of cloned genomic DNA, which may be
derived from human genomic DNA or another desired species. In the example described,
in order to faciUtate packaging of the vector into the viral particles used for deUvery, the
vector should also contain elements that faciUtate such packaging, such as the HSV-1 viral
packaging (pac) sequence, and repUcation origin (oriS) as are defined in the Uterature.
REFERENCES
1. SuUivan BA, Blower MD, Karpen GH. (2001) Determining centromere identity: cycUcal stories and forking paths. Nat Rev Genet, 2(8):584-96
2. Lee C, Wevrick R, Fisher RB, Ferguson-Smith MA, Lin CC Human centromeric DNAs. (1997) Hum Genet, 100; 291-304
3. Choo KH, Vissel B, Nagy A, Earle E, KaUtsis P. (1991) A survey of the genomic distribution of alpha satelUte DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res., 19(6):1179-82
4. WiUard HF. (1991) Evolution of alpha satelUte. Curr Opin Genet Dev., 1(4):509-14
5. Pluta AF, Mackay AM, Ainsztein AM, Goldberg IG, Earnshaw WC. (1997) The centromere: hub of chromosomal activities. Science, 270; 1591-1594 Attorney Docket No. ATI-0029 CT
6. Amor DJ, Choo KH. (2002) Neocentromeres: role in human disease, evolution, and centromere study. Am J Hum Genet, 71(4):695-714
7. Saffery R and Choo KH. (2002) Strategies for engineering human chromosomes with therapeutic potential. /. Gene Med., 4; 5-13 8. Grimes BR, Rhoades AA, WiUard HF. (2002) Alpha-sateUite DNA and vector composition influence rates of human artificial chromosome formation. Mol Then, 5(6)098-805
9. WiUard HF. (2001) Neocentromeres and human artificial chromosomes: an unnatural act. ProcNatlAcadSci USA., 98(10):5374-6 10. Harrington JJ, Van Bokkelen G, Mays RW, Gustashaw K, WiUard HF. (1997)
Formation of de novo centromeres and construction of first-generation human artificial microchromosomes. Nat Genet, 15(4):345-55
11. Waye JS, WiUard HF. (1986) Structure, organization, and sequence of alpha satelUte DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome. Mol CellBiol, 6(9):3156-65
12. WiUard HF. (2000) Genomics and gene therapy. Artificial chromosomes coming to Ufe. Science, 17;290(5495): 1308-9
13. MejiaJE, Willmott A, Levy E, Earnshaw WC, Larin Z. (2001) Functional complementation of a genetic deficiency with human artificial chromosomes.
Am] Hum Genet, 69(2):315-26
14. Grimes BR, Schindelhauer D, McGill NI, Ross A, Ebersole TA,
Cooke HJ (2001) Stable gene expression from a mammaUan artificial chromosome. EMBO Rep. 2(10):910-4 15. Ohzeki J, Nakano M, Okada T, Masumoto H. (2002) CENP-B box is required for de novo centromere chromatin assembly on human alphoid DNA. J CellBiol, 159(5):765-75 16. Schueler MG, Higgins AW, Rudd MK, Gustashaw K, WiUard HF. (2001) Genomic and genetic definition of a functional human centromere. Science. 294(5540): 109-15 Attorney Docket No. ATI-0029PCT
17. Ikeno M, Grimes B, Okazaki T, Nakano M, Saitoh K, Hoshino H, McGiU NI, Cooke H, Masumoto H. (1998) Construction of YAC-based mammaUan artificial chromosomes. NatBiotechnol, 16(5):431-9
18. Mejia JE, Alazami A, Willmott A, MarschaU P, Levy E, Earnshaw WC, Larin Z. (2002) Efficiency of de novo centromere formation in human artificial chromosomes. Genomics, 79(3):297-304
19. Masumoto H, Ikeno M, Nakano M, Okazaki T, Grimes B, Cooke H, Suzuki N. (1998) Assay of centromere function using a human artificial chromosome. Chromosoma, 107(6-7):406-16 20. Muro Y, Masumoto H, Yoda K, Nozaki N, Ohashi M, Okazaki T. (1992) Centromere protein B assembles human centromeric alpha-satellite DNA at the 17-bp sequence,
CENP-B box. / CellBiol, 116(3):585-96
21. Cooke CA, Bernat RL, Earnshaw WC. (1990) CENP-B: a major human centromere protein located beneath the kinetochore. / G?//ϊ3w/ 110(5):1475-88 22. Masumoto H, Masukata H, Muro Y, Nozaki N, Okazaki T. (1989) A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satelUte. J CellBiol, 109(5):1963-73
23. Earnshaw WC, SulUvan KF, MachUn PS, Cooke CA, Kaiser DA, Pollard TD, Rothfield NF, Cleveland DW. (1987) Molecular cloning of cDNA for CENP-B, the major human centromere autoantigen. / CellBiol, 104(4):817-29
24. Shizuya H, Birren B, Kim UJ, Mancino V, Slepak T, Tachiiri Y, Simon M.
(1992) Cloning and stable maintenance of 300-kUobase-pair fragments of human DNA in Escherichia coU using an F-factor-based vector. Pro Natl Acad Sci U SA., 89(18):8794-7
25. Kouprina N, Ebersole T, Koriabine M, Pak E, Rogozin IB, Katoh M, Oshimura M, Ogi K, Peredelchuk M, Solomon G, Brown W, Barrett JC, Larionov V. (2003) Cloning of human centromeres by transformation-associated recombination in yeast and generation of functional human artificial chromosomes. Nucleic Acids Res., 31(3):922-34
26. Grimes BR, Warburton PE, Farr CJ. (2002) Chromosome engineering: prospects for gene therapy. Gene Ther., 9(11):713-8 Attorney Docket No. ATI-0029PCT
27. Alexandrov I, Kazakov A, Tumeneva I, Shepelev V, Yurov Y. (2001) Alpha- satelUte DNA of primates: old and new families. Chromosoma, 110(4):253-66.
28. KipUng D, Warburton PE. (1997) Centromeres, CENP-B and Tigger too. Trends Genet., 13(4):141-5 29. Goldberg IG, Sawhney H, Pluta AF, Warburton PE, Earnshaw WC. (1996)
Surprising deficiency of CENP-B binding sites in African green monkey alpha-sateUite DNA: impUcations for CENP-B function at centromeres. Mol CellBiol. 16(9):5156-68
30. Kapoor M, Montes de Oca Luna R, Liu G, Lozano G, Cummings C, Mancini M, Ouspenski I, Brinkley BR, May GS. (1998) The cenpB gene is not essential in mice. Chromosoma., 107(8):570-6
31. Perez-Castro AV, Shamanski FL, Meneses JJ, Lovato TL, Vogel KG, Moyzis RK, Pedersen R. (1998) Centromeric protein B nuU mice are viable with no apparent abnormaUties. Dev Biol, 201(2):135-43
32. Hudson DF, Fowler KJ, Earle E, Saffery R, KaUtsis P, TroweU H, Hill J, Wreford NG, de Kretser DM, Cancilla MR, Howman E, HU L, Cutts SM,
Irvine DV, Choo KH. (1998) Centromere protein B nuU mice are mitoticaUy and meiotically normal but have lower body and testis weights. / CellBiol, 141(2):309-19
33. Irelan JT, Gutkin GI, Clarke L. (2001) Functional redundancies, distinct locaUzations and interactions among three fission yeast homologs of centromere protein-B. Genetics, 157(3):1191-203
34. Choo KH. (1997) Centromere DNA dynamics: latent centromeres and neocentromere formation. Am J Hum Genet., 61(6):1225-33
35. Earnshaw WC, Ratrie H 3rd, Stetten G. (1989) VisuaUzation of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma, 98(1): 1-12
36. Yoda K, Ando S, Okuda A, Kikuchi A, Okazaki T. (1998) In vitro assembly of the CENP-B/alpha-satelUte DNA/core histone complex: CENP-B causes nucleosome positioning. Genes Cells, 3(8):533-48 Attorney Docket No. ATI-0029PCT
37. Warburton PE, Waye JS, WiUard HF. (1993) Nonrandom locaUzation of recombination events in human alpha satelUte repeat unit variants: impUcations for higher- order structural characteristics within centromeric heterochromatin. Mol CellBiol. 13(10):6520-9.

Claims

Attorney Docket No. ATI-0029PCT
WHAT IS CLAIMED IS: 1. An engineered higher order repeat DNA comprising one or more CENP-B boxes, wherein said one or more CENP-B boxes are distributed on the engineered higher order repeat DNA in an order other than that of CENP-B boxes on a naturaUy-occurring higher order repeat DNA.
2. An engineered alphoid DNA comprising one or. more CENP-B boxes, wherein said one or more CENP-B boxes are distributed on the alphoid DNA in an order other than that of CENP-B boxes on a naturaUy occurring alphoid DNA.
3. An engineered higher order repeat DNA enriched in CENP-B box sequences.
4. An engineered alphoid DNA enriched in CENP-B box sequences.
5. An engineered alphoid DNA comprising an engineered higher order repeat as claimed in claims 1 and 3.
6. An engineered chromosome vector containing the alphoid DNA of the claims 2, 4, or 5.
Attorney Docket No. ATI-0029PCT 7. An engineered chromosome comprising the engineered higher order repeat DNA or the engineered alphoid DNA of any of the claims 1-5.
8. An engineered chromosome formed by introduction of the engineered chromosome vector of claim 6 into an appropriate ceU.
9. The engineered chromosome vector of claim 6, wherein said vector when introduced into an appropriate cell forms an engineered chromosome at an efficiency rate greater than an engineered chromosome vector containing a higher order repeat DNA with a naturaUy-occurring frequency or distribution order of CENP-B boxes.
10. An engineered chromosome vector enriched in its number of CENP-B boxes, wherein said engineered chromosome vector forms an engineered chromosome upon introduction into an appropriate ceU at an efficiency rate of greater than about 1-5%, about 5-15%, about 10-20%, or about 15-25% compared to a corresponding engineered chromosome vector which is not enriched in its number of CENP-B boxes.
11. An engineered chromosome enriched in its number of CENP-B boxes, wherein said engineered chromosome is mitoticaUy stable inside an appropriate ceU. Attorney Docket No. ATI-0029PCT
12. The engineered chromosome vector of claim 6, wherein said vector comprises a transposon.
13. The engineered chromosome of claim 11, wherein said engineered chromosome has a mitotic segregation pattern that is substantially 1:1.
14. A method of increasing efficiency of formation of an engineered chromosome containing alphoid DNA comprising adding one or more CENP-B boxes to the alphoid DNA used to form said engineered chromosome.
15. A method of making an alphoid DNA array comprising:
(a) constructing two or more engineered monomers of defined DNA sequences; wherein at least one monomer is enriched in
CENP-B box sequences;
(b) assembUng said engineered monomers to form said alphoid DNA array.
16. An engineered alphoid DNA array made by the process of claiml 5.
17. A method of making an engineered higher order repeat DNA comprising: Attorney Docket No. ATI-0029PCT (a) constructing two or more engineered monomers of defined DNA sequences; wherein at least one monomer is enriched in CENP-B box sequences;
(b) directionaUy assembUng said engineered monomers to form said higher order repeat DNA.
18. A higher order repeat DNA made by the method of claim 17.
19. A method of engineering a desired higher order repeat DNA comprising: (a) engineering each monomer unit of said desired higher order repeat DNA as one or more oUgonucleotide(s); wherein at least one monomer is enriched in CENP-B box sequences; (b) directionally Ugating pairs of adjacent monomer units to form repeating monomeric units to form the desired higher order repeat DNA.
20. A higher order repeat DNA made by the method of claim 19.
21. The engineered chromosome vector of claim 6, wherein said vector when introduced in an appropriate cell forms an engineered chromosome at an efficiency rate higher than an engineered chromosome vector containing higher order repeat DNA with fewer CENP-B boxes.
PCT/US2004/022314 2003-08-07 2004-08-09 Enhanced engineered chromosome formation from alpha satellite with artificially increased density of cenp-b boxes WO2005014786A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US49296503P 2003-08-07 2003-08-07
US60/492,965 2003-08-07

Publications (2)

Publication Number Publication Date
WO2005014786A2 true WO2005014786A2 (en) 2005-02-17
WO2005014786A3 WO2005014786A3 (en) 2005-09-22

Family

ID=34135185

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/022314 WO2005014786A2 (en) 2003-08-07 2004-08-09 Enhanced engineered chromosome formation from alpha satellite with artificially increased density of cenp-b boxes

Country Status (1)

Country Link
WO (1) WO2005014786A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9139849B2 (en) 2005-04-08 2015-09-22 The United States of America as Represented by the Government of the Department of Health and Human Services Rapid generation of long synthetic centromeric tandem repeats for mammalian artificial chromosome formation
EP3765516A2 (en) * 2018-03-14 2021-01-20 Elstar Therapeutics, Inc. Multifunctional molecules and uses thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6348353B1 (en) * 1995-06-07 2002-02-19 Case Western Reserve University Artificial mammalian chromosome

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9139849B2 (en) 2005-04-08 2015-09-22 The United States of America as Represented by the Government of the Department of Health and Human Services Rapid generation of long synthetic centromeric tandem repeats for mammalian artificial chromosome formation
EP3765516A2 (en) * 2018-03-14 2021-01-20 Elstar Therapeutics, Inc. Multifunctional molecules and uses thereof

Also Published As

Publication number Publication date
WO2005014786A3 (en) 2005-09-22

Similar Documents

Publication Publication Date Title
Sultana et al. Integration site selection by retroviruses and transposable elements in eukaryotes
AU724695B2 (en) Synthetic mammalian chromosome and methods for construction
AU2006235356B2 (en) Rapid generation of long synthetic centromeric tandem repeats for mammalian artificial chromosome formation
US6391642B1 (en) Transformation-associated recombination cloning
Basu et al. Rapid creation of BAC-based human artificial chromosome vectors by transposition with synthetic alpha-satellite arrays
WO1995003400A1 (en) Recombinationally targeted cloning in yeast artificial chromosomes
Klar et al. A unique DNA recombination mechanism of the mating/cell‐type switching of fission yeasts: a review
US7083971B1 (en) Hybrid yeast-bacteria cloning system and uses thereof
Noskov et al. A general cloning system to selectively isolate any eukaryotic or prokaryotic genomic region in yeast
Laner et al. Bacterial transfer of large functional genomic DNA into human cells
Grimes et al. Artificial and engineered chromosomes: developments and prospects for gene therapy
Wang et al. Plant artificial chromosomes: construction and transformation
US20040081982A1 (en) Neocentromere-based mini-chromosomes or artificial chromosomes
Kumar et al. Insertional mutagenesis: transposon-insertion libraries as mutagens in yeast
Davis et al. Investigation of coelectroporation as a method for introducing small mutations into embryonic stem cells
Brune et al. Manipulating cytomegalovirus genomes by BAC mutagenesis: strategies and applications
WO2005014786A2 (en) Enhanced engineered chromosome formation from alpha satellite with artificially increased density of cenp-b boxes
Ruzsics et al. Mutagenesis of the cytomegalovirus genome
Feederle et al. Efficient somatic gene targeting in the lymphoid human cell line DG75
Nehlsen et al. Replicating minicircles: overcoming the limitations of transient and stable expression systems
JP2004337066A (en) Vectors and methods for improving the stability of genes transfected into mammalian cells
Kaname et al. Alphoid DNA from different chromosomes forms de novo minichromosomes with high efficiency
AU761362B2 (en) Synthetic mammalian chromosome and methods for construction
García-Carnero et al. DNA Cloning Vectors
WO2024148206A1 (en) Methods and systems for engineering cells and for target validation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase