WO2005007150A2

WO2005007150A2 - Method for inhibiting protein synthesis in sperm

Info

Publication number: WO2005007150A2
Application number: PCT/IL2004/000648
Authority: WO
Inventors: Haim Breitbart; Yael Gur
Original assignee: Bar-Ilan University
Priority date: 2003-07-17
Filing date: 2004-07-18
Publication date: 2005-01-27
Also published as: WO2005007150A3

Abstract

A method and pharmaceutical composition for inhibiting translation in sperm cells during capacitation. The pharmaceutical composition comprises a substance that is an inhibitor of translation by 55S, 70S-like, or mitochondrial ribosomes. The substance may be, for example, D-Chloramphenicol, gentamycin, or tetracycline. The substance may also be a polynucleotide that is antisense to a sperm mRNA that is transcribed by 55S, 70S-like, or mitochondrial ribosomes, or a ribonucleozyme that cleaves a sperm mRNA that is transcribed by 55S, 70S-like, or mitochondrial ribosomes. Such an mRNA may be, for example, a sperm mRNA encoding for AT1-R, PKC , Progesterone receptor, Catsper1 or Na-K ATPase 4. The method of the invention comprises administering to sperm cells the pharmaceutical composition of the invention. The method may be used for inhibiting capacitation in sperm cells or for inhibiting a capacitation dependent process in sperm cells such as acrosome reaction, motility, oocyte penetration, in vitro fertilization or in vivo fertilization.

Description

METHOD AND PHARMACEUTICAL COMPOSITION FOR INHIBITING PROTEIN SYNTHESIS IN SPERM

FIELD OF THE INVENTION This invention relates to methods and pharmaceutical compositions for the treatment of sperm.

BACKGROUND OF THE INVENTION Sperm cells carry out transcription of mitochondrial DNA and translation of the transcribed mRNA (3,26,27). The sperm nucleus also contains RNA, (11,24). Recent studies have revealed several kinds of mRNA molecules in mature spermatozoa, such as mRNA encoding for the progesterone receptor (30), phosphodiesterase (31), and calcium channels (9). After ejaculation, spermatozoa undergo a prolonged process in the female reproductive tract called capacitation in which the sperm acquire the ability to fertilize oocytes (46). During this period, the spermatozoon undergoes a cascade of biochemical changes that enable it to bind to the zona pellucida, undergo acrosomal exocytosis and penetrate the oocyte through the zona pellucida (47). It is still uncertain what triggers sperm capacitation although signal cascades, including protein kinase A (PKA) activation leading to tyrosine phosphorylation of various proteins, plays a major role (42). Intracellular changes during capacitation include cholesterol efflux from the plasma membrane (43), polymerization of actin (36), and changes in swimming patterns and chemotactic motility (4). WO02090567 discloses nucleic acid and protein sequences relating to a sperm specific cation channel known as Catsperl. The Catsper protein is known to be necessary for sperm motility. This publication also disclose methods of in vitro fertilization conception and contraception

SUMMARY OF THE INVENTION The present invention is based on the surprising and unexpected finding that translation of nuclear and mitochondrial proteins occurs in mammalian spermatozoa during capacitation. Incorporation of [³⁵S] Met-[³⁵S] Cys into sperm proteins during capacitation is completely blocked by bacterial or mitochondrial translation inhibitors, such as D-Chloramphenicol, (CP) gentamycin, and tetracycline but not by eukaryotic or cytoplasmic protein translation inhibitors such as cycloheximide (CH). 55S ribosomes, also known as 70S-like ribosomes are only known to exist in mitochondria. Thus, in its first aspect, the invention provides a pharmaceutical composition for inhibiting translation in sperm cells during capacitation. The pharmaceutical composition comprises a substance that is an inhibitor of translation by 55S, 70S-like, or mitochondrial ribosomes. The substance may be, for example, D-Chloramphenicol, gentamycin, or tetracycline. The substance may also be a polynucleotide that is antisense to a sperm mRNA that is transcribed by 55S, 70S-like, or mitochondrial ribosomes, or a ribonucleozyme that cleaves a sperm mRNA that is transcribed by 55 S, 70S-like, or mitochondrial ribosomes. The substance may also be a polynucleotide that is antisense to an RNA molecule of sperm 70S-like ribosomes, sperm mitochondrial ribosomes or sperm 55S ribosomes. Such an mRNA may be, for example, a sperm mRNA encoding for AT1-R, PKCα, Progesterone receptor, Catsperl or Na- ATPase α4. The method of the invention comprises administering to sperm cells the pharmaceutical composition of the invention. The method may be used for inhibiting capacitation in sperm cells or for inhibiting a capacitation dependent process in sperm cells such as acrosome reaction, motility, oocyte penetration, in vitro fertilization or in vivo fertilization. The pharmaceutical composition may be administered to a male or to a female. BRIEF DESCRIPTION OF THE DRAWINGS In order to understand the invention and to see how it may be carried out in practice, a preferred embodiment will now be described, by way of non- limiting example only, with reference to the accompanying drawings, in which: Fig. 1 shows [³⁵S] methionine-[³⁵S] cysteine incorporation into proteins during capacitation; Fig 2 shows protein labeling by lysyl-transfer RNA tagged with BODIPY; Fig 3 shows inhibition of protein synthesis by CP treatment during capacitation as seen by Western blotting; Fig 4 shows reduction in sperm proteins during capacitation by CP in bovine sperm; Fig 5 shows RT-PCR for sperm specific genes in mature sperm cells; Fig 6 shows immunoprecipitation of [ S]Met-[ S]Cys incorporated proteins during capacitation; Fig 7 shows immunocytochemistry of ATI and progesterone receptors during capacitation in the presence of CP; Fig 8 shows sperm motility during capacitation; Fig 9 shows assessment of the acrosome reaction during capacitation; Fig 10 shows in vitro fertilization assays to assess protein synthesis necessity during capacitation; Figll shows in-situ hybridization of mRNA in mouse sperm; Fig 12 shows immunogold localization of DIG-labeled mRNA antisense molecules; Fig. 13 shows immunogold labeling of proteins on microsections by electron microscopy; Fig. 14 shows inhibition of capacitation parameters by specific antisense molecules; Fig. 15 shows control experiments for immunogold-labeled in situ hybridization for intracellular localization of mRNAs; and Fig. 16 shows controls for immunogold labeling of proteins on sperm sections.

RESULTS

Fig 1 shows [³⁵S] methionine-[³⁵S] cysteine incorporation into sperm proteins during capacitation. In vitro fertilization was carried out as described in (46). Protein synthesis during capacitation was examined in sperm cells (human, bovine, mouse and rat) by the addition of [³⁵S]Met- [³⁵S]Cys (30 μCi/ml) to the capacitation medium in the presence of 100 μg/ml D-Chloramphenicol (CP), lmg/ml Cycloheximide (CH), or no addition ("Cont"). As shown in Fig. 1A, a marked reduction in protein synthesis was observed in the presence of CP, a known inhibitor of 55S ribrosomes (also known as 70S-like or mitochondrial ribrosomes), while CH, a known inhibitor of cytoplasmic or 80S ribrosomes, appeared to have no effect. In Figs. IB and IC, sperm cells in either capacitation medium or non-capcitating medium (i.e. medium without the capacitation factors: BSA, Na₂HC0 , CaCl₂, and heparin). were presented with 4μM FCCP (FC), a mitochondrial uncoupler, lmg/ml Actinomycin D (AD), a transcription inhibitor or no additive (cont). Sperm cell proteins were extracted from 10⁸ bovine cells in capacitation medium and separated on SDS-PAGE, then transferred to nitrocellulose membrane, stained for total protein with Ponceau S and dried before exposure to a phosphoimager screen overnight (Fig. IC). As can be seen, protein synthesis was completely inhibited in the presence of CP and FC, while CH had not detectable effect. In Fig. ID, proteins from 10⁸ bovine sperm cells were extracted at 2, 5,

10, 15, 30, 45, and 60 minutes during capacitation to assess the rate of protein synthesis. Sperm incubation under non-capacitating conditions (UN) (i.e. in medium devoid of calcium, bicarbonate, BSA and heparin revealed) no [³⁵S] Met-[ S] Cys incorporation (Fig IC), showing a correlation between protein synthesis and capacitation.

Fig 2 shows protein labeling by lysyl-transfer RNA tagged with BODIPY. BODIPY-lysine-tRNA^Lys [4,4-difiuoro-5,7-dimethyl-4-bora- 3a,4a-diaza-s- indacene-3-propanoyl-lysyl-tRNALys] is used for fluorescent detection of proteins synthesized in in-vitro translation systems. This labeled amino acid was used to localize newly made proteins in spermatozoa cells by histochemistry in the presence and absence of D-chloramphenicol. The amount and localization of BODIPY-incorporated proteins were observed by confocal microscopy. After four hours of incubation under capcitating conditions labeled proteins were seen mainly in the midepiece and in the head of the cell (Fig 2A). In the CP treated cells, only 97% of the cells responded to CP while the remaining 3% incorporated BODIPY. A high labeling along the cells was observed (XI 00). The fluorescence intensity in four sperm regions during four hours of capacitating conditions was quantitatively analyzed at various times using "Image J" software (Fig 2B). Determination of the fluorescence intensity during capacitation revealed maximal labeling within lhour of capacitation (Fig. IB), which is similar to the kinetics observed in [³⁵S] Met- [³⁵S] Cys incorporation (Fig ID). In order to follow the cytolocalization of the newly synthesized proteins, the image of each cell was divided into 4 regions, and the intensity in each region was quantitatively measured using "Image J" software. High intensity was measured in the midpiece, post-acrosomal region and in the acrosome area (head), while only a slight increase was seen in the sperm tail (Fig 2B). AT1-R (10,15), EGFR (3), PKCα and PKCβl (8), are involved in sperm capacitation and acrosome reaction, so these proteins were selected as a representative sample for protein changes during capacitation. Cytochrome C is known to be translated by the mitochondrial machinery; therefore it was important to show the inhibitory effect of CP on its translation. Fig 3 Row A shows that CP treatment during capacitation reduces synthesis of these proteins. Sperm proteins (human, bovine or mouse) from 10⁸ cells were extracted after incubation under capacitation conditions with or without CP. The proteins were separated on SDS-PAGE, transferred to a nitrocellulose membrane and exposed to a specific first and second antibody. CP inhibited the synthesis of the following proteins: PKCβl (80 kD ), PKCα (80kD ), bovine ATI receptor (b-ATl) (60kD), Cyt C (11.4 kD), Catsperl (80kD), EGFR (170 kD), ATPase α4 (120 kD), mouse PKA-Cs (mCs) (38kD), ovine PKA-Cs (OCs) (38kD). As an indication of the total amount of protein in each lane, the nitrocellulose membrane was probed with anti-α tubulin (55kD) (Row B) showing that each lane was loaded with the same amount of protein. Fig 4 shows reduction in the amount of various protein kinases during capacitation by CP in bovine sperm. Human, bovine, mouse and rat sperm proteins were extracted from 10 cells after 6,10, 8, and 7 hours, respectively, of incubation under capacitation conditions with or without CP.-The proteins were extracted and separated on an SDS-PAGW gel, transferred to a nitrocellulose membrane and exposed to specific antibodies. The nitrocellulose membrane was also probed with anti-tubulin-tyrosine (55kD) to determine the relative quantity loaded. Bands were quatitated by "Image J" software In order to translate new proteins, sperm must transcribe DNA to generate mRNA molecules or use stable mRNA molecules that were generated during spermatogenesis. As shown in Fig. IC, [ S] Met-[ S] Cys incorporation was uninhibited by Actinomycin D. This shows that the decrease in protein synthesis is due to a decrease in translation, and not to a decrease in transcription. RT-PCR was performed with specific primers using mRNA isolated from ejaculated spermatozoa. Since RT-PCR is a very sensitive technique, for amplifying as little as a single molecule of mRNA, it was essential to prove that detected transcripts are purified from the sperm cells and not from somatic contaminating cells or microorganisms in the semen. That forced us to focus on sperm specific proteins: human and mouse Catsperl and Catsper2 (25,29), human and rat Na-K ATPase α (44), mouse and ovine PKA-Catalytic subunit (48). Fig 5 shows RT-PCR for several sperm specific mRNAs. By using RNaquse-4-PCR (Ambion) mRNA was purified from the sperm and specific transcripts were amplified by RT-PCR. The RT-PCR products were as follows: lane 1- mouse Catsperl, 2- human Catsperl, 3- mouse Catsper2, 4- huma ATPase α4, 5- rat ATPase α4, 6- human ATI receptor, 7- bovine ATI receptor, 8- control- PCR product without RT, 9-human PKCβl, 10-human PKCα, 11- mouse PKA-Cs, 12-bovine PKA-Cs (lane M is molecular weight standards). There are 2906 mRNA species in human sperm (49). The results show the existence of the mRNA of several of the proteins whose synthesis is shown in Fig. 3 to be inhibited by CP. . In order to verify the identification of the RT_PCR producets shown in Fig. 5, each product was cut with a restriction enzyme. A list of the restriction enzymes used for each PCR fragment is detailed in Table 1 :

The observed fragment sizes correlated with the predicted sizes. Thus, the identification of the RT-PCT products shown in Fig. 5 has been verified. To further support the CP inhibition of translation seen by Western-blot (Fig 3), and since their mRNA molecules were found (Fig 5) we used immuno precipitation of [ S] Met-[ S] Cys incorporated proteins by specific antibody. Bovine sperm cells were incubated in capacitation medium in the presence of [³⁵S]Met-[³⁵S]Cys for 4 hours ± CP or ±CH. Total proteins were extracted from the cells and immunoprecipitated with different antibodies. The results are shown in Fig. 6. Al- Ponceau S staining of the nitrocellulose membrane for staining of the total proteins after immunoprecipitation (only the heavy subunit of the antibody is seen (~55 Kda), A2- immunoprecipitation of PKCα was inhibited by CP and unaffected by CH, Bl -ponceau S staining, B2-immunoprecipitation of PR-R, CI- Ponceau S staining, C2- Immunoprecipitation AT1-R. Fig 7 shows immunocytochemistry of ATI and progesterone receptors during capacitation in the presence of CP. In order to determine the in situ localization of the ATI receptor and progesterone receptor molecules in sperm cells during capacitation, a specific antibody was used to immunolocalize the proteins. Bovine sperm cells after 4 hours of capacitation in the presence or absence of CP were dried on slides and exposed to an anti-ATI or anti PR-R antibody, followed by a second rhodamine-conjugated antibody. In both cases, the amount of these receptors in the cells was significantly reduced in the presence of CP, confirming that the synthesis of these receptors occurs in sperm cells during capacitation. The motility of CP-treated spermatozoa was studied, since motility is a critical pre-condition for fertilization. Sperm motility was measured by using the "Sperm Motility Counter" that defines motility as Sperm Motility Index (SMI) units and by interval sampling and light- microscopy observation (50). As shown in Fig. 8, within 4 and 6 hours of incubation, CP reduced the motility of bovine spermatozoa by 50% and 70% respectively. Moreover, the difference between the motility observed in the CP-treated and the control cells increased over time . The final step of capacitation is acquiring the ability of acrosome-intact spermatozoa to undergo the acrosome reaction in response to its interaction with the zona pellucida (ZP, the egg's extracellular matrix). Acrosome reaction can be induced by multiple physiological inducers including progesterone, EGF, Angiotensin II (32,16,33,10) and the calcium ionphore A23187. The ability of spermatozoa to undergo acrosome reaction depends on completing the biochemical changes that occur during the capacitation. Fig 9. Shows assessment of the acrosome reaction during capacitation.

Sperm were incubated under capacitating conditions for 4 hours in the presence or absence of CP and than stained with Coomassie-blue to identify acrosome intact cells. CP reduced the ability of the cells to undergo acrosome reaction to 60% at the end of the 4 hours of capacitation. At least 100 cells were counted double blind in duplicate. Each result represents the mean of 6 different experiments (Fig. 9b). The most conclusive assay to assess the necessity of protein translation is in-vitro and in vivo fertilization. BALB/C female mice were treated with PMSG and hCG to induce over-ovulation. The females were sacrificed and Mil oocytes were collected and treated with Hoechst for 30 min to mark the chromosomes. CP was added to sperm capacitation medium and, at specified times during incubation, sperm cells were washed and added to the oocytes (10 sperm cells/200μl of -50 oocytes). After a 24h incubation the washed oocytes were fixed and examined by fluorescence microscopy to distinguish between fertilized and unfertilized oocytes The appearance of two-cell-stage embryos, or Hoechst labeled oocytes having chromosomes with a characteristic fertilized shape, was taken to indicate successful penetration of sperm and subsequent activation of fertilization. In every experiment ~60 oocytes were examined in each treatment and the results repeated in 10 different experiments. CP inhibited the IVF outcome and the percent of inhibition increased with time (40%, 51% and 62% inhibition for 3,6,or 12h respectively) (Fig 10). Similar results were obtained in a bovine IVF assay (results not shown). In order to localize specific mRNA in the cell, Digoxigenine (DIG)- labeled PCR fragments of the following three translatable mRNA sequences were used: bovine- ATI receptor, mouse-mCs (a sperm specific protein), and mouse-Catsperl (a sperm specific protein). These DNA sequences are at antisense orientation to the mRNA (the sense strand) and therefore can hybridize with the sense mRNA molecule to create stable double stranded DNA-RNA molecules. Localization of these molecules was done at the intracellular level and intra organelle level: I. In-situ hybridization of DIG- conjugated antisenses on permeabelized cells and anti-DIG fluorescence antibody by confocal microscopy. II. Immunogold labeling on sperm sections by DIG- conjugated antisenses and gold anti-DIG antibody by electron microscopy. Fig. 11 shows in-situ hybridization of mRNA in mouse sperm. The cells were smeared on slides and permeabelized. In-situ hybridization was performed by DIG- conjugated mouse-Catsperl antisense on permeabelized cells, probed by anti-DIG fluorescence antibody and observed by confocal microscopy. As a control for the specificity for the hybridization, DIG-EGFP antisense, DIG-SL (a protozoan ribosomal subunit that exists only in protozoa) and secondary antibody without antisense were used. All of these controls gave negative results (data not shown). The localization of the mRNA molecules at the organelle level was also investigated using immunogold electron microscopy. All of the three different mRNA sequences were found predominantly inside the mitochondria and in the nucleus. Fig. 12 shows immunogold localization of DIG-labeled antisenses of mRNAs carried out as described in (51). DIG- labeled antisenses to the bovine-ATI receptor mRNA (Fig. 12a); mouse PKA-Cs mRNA (Fig. 12b), and mouse Catsperl mRNA (Fig. 12c) were hybridized on sperm microtome sections. After hybridization the sections were incubated with gold-labeled anti-DIG antibody (0.8nm gold particle) and treated with silver enhancement for 2min. The sections were observed by electron microscopy at a magnification of 15,000-25,000X.

Fig. 13 shows immunogold labeling of proteins on microsections by electron microscopy. Sperm sections were incubated with protein specific antibody (anti-ATI receptor (Fig. 13a), anti-mouse Catsperl (Fig. 13b), anti- mouse PKA-Cs (Fig. 13 c)) and with secondary anti rabbit gold-conjugated antibody (15 nm gold particle) and were observed by electron microscope X15000-25000. All three of the examined protein/mRNA types were localized inside the mitochondria. Bovine ATI receptor was also found inside the head. The other two proteins were located to the mitochondria and along the tail. As a control for the specificity for the hybridization, DIG-EGFP antisense, DIG-SL (a protozoan ribosomal subunit that exists only in protozoa) was used with a secondary antibody without antisense. Sections were treated with (A) RNase A (100 μg / ml; 30 min; 37°C) before hybridization, (B) an anti-SL antisense probe to a transcript that is not found in mammals instead of an antisense probe to a transcript of interest, and (C) the anti-DIG gold-conjugated secondary antibody without any specific antisense. Other than the changes described above, the same experimental protocol that was used for the immunogold in situ hybridization experiments were used. Three control experiments were performed to confirm the specificity of the detected signal in the in situ hybridization experiments (Fig. 15 Al, Bl, CI: mouse sperm, A2, B2, C2: bovine sperm.). First, to test that the probe hybridizes specifically to RNA, sections were treated before hybridization with RNase A, in order to digest the RNA in the cell (Fig. 15 A). A positive signal would indicate that the probe hybridized non-specifically to components of the cell besides mRNA. Second, sections were incubated with antisense probes to mRNA transcripts that are not normally present in mammalian cells - anti-EGFP (Enhanced Green Fluorescent Protein) and anti-SL (Splice Leader from Tryponsoma) (Fig. 15B). This ensures that the antisense probe used in the experiment hybridized with its intended specific sequence and not with any of the other types of mRNA transcripts in the cell. Third, sections were incubated with the secondary anti-DIG gold- conjugated antibody without the antisense probe (Fig. 15C). This was to make sure that the secondary antibody does not associate with non-specific binding sites in the cell and give a false positive signal. Some unexpected but interesting images were obtained from sperm sections that were treated with RNase. The mitochondria of bovine and mouse sperm became hollow after treatment with RNase, and a significant portion of the mitochondria seemed to have disappeared (Fig. 15 A). This finding indicates that mitochondria normally contain a large mass of RNA transcripts that are degraded by RNase. There was no immunogold labeling in any of the control experiments that were described above (Fig.15), confirming the reliability of the results. The most precise and important control is hybridization with antisense against mRNA that is not present in the cell. Antisense to EGFP and SL, do not exist in mammalian cells including spermatozoa. Hybridization with these antisense probes did not give any signal whatsoever, and by that ratified the specificity of each of the examined antisense probes. In contrast, the signal obtained with the three specific antisense probes was clear and bright with undetectable levels of background signal. It can thus be concluded that AT1-R, PKA-Cs and CatSper mRNAs do in fact exist inside sperm mitochondria. In order to verify the specificity of protein binding, two controls for protein localization were conducted. Sections from mouse and bovine spermatozoa were probed with secondary gold-conjugated antibody without primary antibody (Fig. 16A). Sections from mouse and bovine spermatozoa were pre-treated with proteinase K (500 μg/ml, 30 min. 30^°C) before incubation with specific antibodies to ATI, CatSper, and PKA-Cs proteins (Fig. 16B). Al, Bl: mouse sperm, A2, B2: bovine sperm. The sections were probed with secondary gold-conjugated antibodies. Two types of secondary antibodies were used with different gold particle sizes of 15 and 20 nm, respectively. Binding of the secondary antibody without prior exposure to the primary antibody produced no signal (Fig. 16A). Second, sections were preincubated with proteinase K prior to antibody binding. Proteinase K digests most of cellular proteins and eliminates possible binding sites for antibodies. After pretreatment with proteinase K, the immunogold- labeling technique did not produce any signal (Fig. 16B). Fig. 14 shows inhibition of capacitation parameters by antisenses for sperm proteins. Hybridization of the antisense to the complementary mRNA results in RNase H cleavage of the mRNA, which prevents protein synthesis and thereby blocks gene expression. The rates of acrosome reaction, and in-vitro fertilization were examined as described above. The rate of actin polymerization was measured as described in (52). The antisenses were added to the capacitation medium with Fugene 6 as a transfector. The cells were incubated in the capacitaion medium in the presence of an antisense. Fig. 14 shows inhibition of the synthesis of these proteins using their specific antisense. The results revealed significant inhibition of actin polymerization (F-actin), acrosome reaction and in- vitro fertilization (IVF) The effect of anti-sense poly-nucleotides to Catsperl and PKA-Cs on fertilization was studied in an in vivo mouse model. EGFP (enhanced green fluorescent protein) which is not naturally expressed in eukaryotes, was used as a control anti-sense. The DNA antisenses used were as follows: I. Catsperl anti-sense 1. A DNA fragment of 516 bp, complementary for mouse Catsperl mRNA having Genebank accession number AF407332, and having the following sequence: tggg cctggagtat ttttatgacc catggaacaa cctggacttc ttcatcatgg tcatggcagt gctggacttt gtgctccttc agataaactc gctctcatat tcattctaca accacagcct gttccggatt ctcaaagtct tcaaaagtat gcgggccctg agggccatcc gggttcttcg gaggctcagc atcctgacca gcctccacga agtggccggg actctgagtg gatctttacc atccatcacg gccatcctca ccctcatgtt tacctgcctc ttcctcttct ctgtggttct ccgagcactg tttcaggact cagaccccaa gcgcttccag aacatcttta ccacactctt caccctgttc accatgctca ccctggacga ctggtccctc atctacatag acaacagggc ccaaggcgcc tggtacatca taccgatcct catgatttac attgtcatcc agtacttcat cttcctcaac ctggtgattg ctgtcctggt agat 2. Antisense modified oligonucleotides (Mod.oligo.) of 20 bp, which are a chimera of DNA-RNA containing phosphorothioate and 2'-0-Methyl modifications for stabilization of the DNA/RNA heteroduplex, which is a substrate for endogenous cellular RNase H) These nucleotides were obtained from "IDT Integrated DNA Technologies, Inc. Coralville, IA, and have the following sequence:

5'- *mA*mA*mU*mA*C*T*C*C*A*G*G*C^!! ^ *-_nA*mG*mG*mG^ϊ!! mC -3', wherein * designates phosphorothioate and m designates 2'-0- Methyl

1. B. PKA-Cs 1. A DNA fragment of 373 bp, complementary to the PKA-Cs mRNA having the Genebank accession number AF239743, and the following sequence: . ctgtt cccaccctat cactccctgg ctccctctac aggcagggct cccccccagg actggcagcc.aaactgctgc agcagatctt atgaggcttc cgagccaccg taatgctagt gccctgagaa agactgagtg atggcttcca gctccaacga tgtgaaagag ttcctagcca aagccaagga agatttcctg aaaaaatggg agaccccttc tcagaataca gcccagttgg atcagtttga tagaatcaag acccttggca ccggctcctt tgggcgagtg atgctggtga agcacaagga gagtgggaac cactacgcca tgaagatctt agacaagcag aaggtggtga agctaaagca gatcgagc

C. Negative control 1. EGFP (Enhanced Green Fluorescent Protein) gene, which is not complementary for any endogenous genes in eukaryotes. This a DNA fragment of 349 bp having the following sequence: acctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctc gtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaa catcctggggcacaagctggagtacaactacaacagccacaacgtc 2. Antisense introduction to the animals. The testes are separated from the rest of the body as a restricted organ by the blood-testis barrier (BTB). In order to deliver the antisenses as close as possible the genes of interest, the antisense DNA was injected directly into the testes (intra-testicular, IT) of C57 black male mice. In addition, in order to examine the ability of the antisenses to penetrate the BTB, the antisenses were injected intra-peritoneally (IP). In either case, the treated males were isolated from females and not allowed to mate four days following the injection.

3. Mating procedure. Female C57 black mice were super-ovulated by a single subcutaneous injection of 10 units of PMSG (pregnant mare serum gonadotrophin, Sigma) and 10 units of hCG (human chorionic gonadotrophin, Sigma) 46-48 h and- 14 h, respectively, before mating. Each C57 black male mouse was placed in an individual cage and was allowed to mate with one or two females for one night only. The females were then separated from the male for at least 8-10 days for pregnancy development. At time intervals of 3-5 days, a different female was presented to the male, and the days of sterility were counted until the first female became pregnant. When this occurred, the male received another injection.

(a)The following two experiments were carried out: l.Experiment I

All the antisenses are DNA-fragments (AL, Bl., CI.) l.Experiment II

All of the antisenses are complementary to a segment of Catsperl mRNA (with the exception of treatment 5 which is a control treatment that does not have a complementary sequence in the genome). Results for experiment I: A. Mice treated with anti Catsperl antisense:

II. Mice treated with anti PKA-Cs antisense:

III. Mice treated with the control antisense anti EGFP:

Summary of the results for the first mating - experiment II:

References

1. Amikura, R, Kashikawa, M, Nakamura, A, and Kobayashi, S. (2001). Presence of mitochondria-type ribosomes outside mitochondria in germ plasm of Drosophila embryos. Proc. Natl. Acad. Sci. U. S. A 98: 9133-9138. 2. Bragg, PW and Handel, MA. (1979). Protein synthesis in mouse spermatozoa. Biol. Reprod. 20: 333-337. 3. Breitbart, H. (2002). Intracellular calcium regulation in sperm capacitation and acrosomal reaction. Mol. Cell Endocrinol. 187: 139-144. 4. Cohen-Dayag, A, Tur-Kaspa, I, Dor, J, Mashiach, S, and

Eisenbach, M. (1995). Sperm capacitation in humans is transient and correlates with chemotactic responsiveness to follicular factors. Proc. Natl. Acad. Sci. USA 92: 11039-11043. 5. Doersen, CJ, Guerrier-Takada, C, Altman, S, and Attardi, G. (1985). Characterization of an RNase P activity from HeLa cell mitochondria.

Comparison with the cytosol RNase P activity. J. Biol. Chem. 260: 5942-5949. 6. Elder, JH and Morre, DJ. (1976). Synthesis in vitro of intrinsic membrane proteins by free, membrane-bound, and Golgi apparatus-associated polyribosomes from rat liver. J. Biol. Chem. 251: 5054-5068. 7. Entelis, NS, Kolesnikova, OA, Martin, RP, and Tarassov, IA.

(2001). RNA delivery into mitochondria. Adv. DrugDeliv. Rev. 49: 199-215. 8. Garbi, M, Rubinstein, S, Lax, Y, and Breitbart, H. (2000). Activation of protein kinase Ca in the lysophosphatidic acid-induced bovine sperm acrosome reaction and phospholipase Dl regulation. Biol. Reprod. 63: 1271-1277. 9. Goodwin, LO, Karabinus, DS, Pergolizzi, RG, and Benoff, S. (2000). L-type voltage-dependent calcium channel alpha- IC subunit mRNA is present in ejaculated human spermatozoa. Mol. Hum. Reprod. 6: 127-136. 10. Gur Y, Breitbart H, Lax Y, Rubinstein S, Zamir N. Angiotensin II induces acrosomal exocytosis in bovine spermatozoa. Am. J. Physiol. (1998).

275.E87-E93. 11. Hecht, NB and Williams, JL. (1978). Synthesis of RNA by separated heads and tails from bovine spermatozoa. Biol. Reprod. 19: 573-579. 12. Iborra, FJ, Jackson, DA, and Cook, PR. (2001). Coupled transcription and translation within nuclei of mammalian cells. Science 293: 1139-1142. 13. Kashikawa, M, Amikura, R, Nakamura, A, and Kobayashi, S. (1999).

Mitochondrial small ribosomal RNA is present on polar granules in early cleavage, embryos of Drosophila melanogaster. Dev. Growth Differ. 41: 495- 502. 14. Kobayashi, S, Amikura, R, and Okada, M. (1993). Presence of mitochondrial large ribosomal RNA outside mitochondria in germ plasm of

Drosophila melanogaster. Science 260: 1521-1524. 15. Kohn, FM, Muller, C, Schill, WB. Effect of Angiotensin converting enzyme (ACE) and angiotensins on human sperm functions. (1998). Andrologia 30:207-215. 16. Lax Y, Rubinstein S, Breitbart H. Epidermal growth factor induces acrosomal exocytosis in bovine sperm. (1994). FEBSLett. 339:234-8. 17. Li, K, Smagula, CS, Parsons, WJ, Richardson, JA, Gonzalez, M, Hagler, HK, and Williams, RS. (1994). Subcellular partitioning of MRP RNA assessed by ultrastructural and biochemical analysis. J. Cell Biol. 124: 871-882. 18. Magalhaes, PJ, Andreu, AL, and Schon, EA. (1998). Evidence for the presence of 5S rRNA in mammalian mitochondria. Mol. Biol. Cell 9: 2375-2382. 19. Miller, D, Briggs, D, Snowden, H, Hamlington, J, Rollinson, S, Lilford, R, and Krawetz, SA. (1999). A complex population of RNAs exists in human ejaculate spermatozoa: implications for understanding molecular aspects of spermiogenesis. Gene 237: 385-392. 20. Mollenhauer, HH and Morre, DJ. (1978). Polyribosomes associated with forming acrosome membranes in guinea pig spermatids. Science 200: 85- 86. 21. Ogawa, M, Amikura, R, Akasaka, K, Kinoshita, T, Kobayashi, S, and Shimada, H. (1999). Asymmetrical distribution of mitochondrial rRNA into small micromeres of sea urchin embryos. Zoological Science 16: 445-451. 22. Oka, T, Amikura, R, Kobayashi, S, Yamamoto, H, and Nishida, H. (1999). Localization of mitochondrial large ribosomal RNA in the myoplasm of the early ascidian embryo. Dev. Growth Differ. 41: 1-8. 23. Oka, T, Amikura, R, Kobayashi, S, Yamamoto, H, and Nishida, H. (1999). Localization of mitochondrial large ribosomal RNA in the myoplasm of the early ascidian embryo. Dev. Growth Differ. 41: 1-8. 24. Pessot, CA, Brito, M, Figueroa J, Concha II, Yafiz, Y, Burzio

LO.(1989). Presence of RNA in the sperm nucleus. Boichem. Biophys. Res.

Comm. 158: 272-278. 25. Quill, TA, Reή D, Clapham DE, Garbers D. A voltege-gated ion channel expressed specifically in spermatozoa. (2001). PNAS. 98:12527-12531. 26. Premkumar, E and Bhargava, PM. (1972). Transcription and translation in bovine spermatozoa. Nat. New Biol. 240: 139-143. 27. Premakumar,E, and Bhargava PM. (1973). Isolation & characterization of newly synthesizes RNA & protein in mature bovine spermatozoa & effect of inhibitors on these syntheses. Indian J. Biochem. Biophis. 10: 239-253. 28. Primakoff, P and Myles, DG. (2000). The ADAM gene family: surface proteins with adhesion and protease activity. Trends Genet. 16: 83-87. 29. Ren, D, Navarro, B, Perez, G, Jackson, AC, Hsu, S, Shi, Q, Tilly, JL, and Clapham, DE. (2001). A sperm ion channel required for sperm motility and male fertility. Nature 413: 603-609. 30.Sachdeva G, Sash AC, Puri CP. Detection of progesterone receptor transcript in human spermatozoa. Bio. Reprod. (2000). 62:1610-1614. 31. Richter, W, Dettmer, D, Glander, HJ. Detection of mRNA transcripts of cyclic nucleotide phosphodiesterase subtypes , in ejaculated human spermatozoa. Mol. Hum. Reprod. (1999). 5(8): 732-736. 32. Roldan ERS, Murase T, Shi QX. Exocytosis in spermatozoa in response to progesterone and zona pellucida. (1994). Science. 266:1578-1581. 33. Rotem R, Zamir N, Keynan N, Barkan D, Brietbart H, Naor z. Atrial natriureticpeptide induces acrosomal exocytosis of human spermatozoa. (1998). Am J Physiol. ^~274: E218-E223. 34. Sato, K, Sugita, T, Kobayashi, K, Fujita, K, Fujii, T, Matsumoto, Y, Mikami, T, Nishizuka, N, Nishizuka, S, Shojima, K, Suda, M, Takahashi, G, Himeno, H, Muto, A, and Ishida, S. (2001). Localization of mitochondrial ribosomal RNA on the chromatoid bodies of marine planarian polyclad embryos. Dev. Growth Differ. 43: 107-114. 35. Spirin AS. (1994). Storage of mRNA in eukaryotes: envelopment with protein, translational barrier at 5' side, or conformational masking by 3' side? Mol. Reprod. Dev. 38:107-117. 36. Spungin, B, Margalit, I, and Breitbart, H. (1995). Sperm exocytosis reconstructed in a cell- free system. Evidence for the involvement of phospholipase C and actin filaments in membrane fusion. J. Cell Sci. 108: 2525- 2535. 37. Steger K (1999). Transcriptional and translational regulation of gene expression in haploid spermatids. Anat. E mbryol. 199:471-487. 38. Steger K (2001). Haploid spermatids exhibit translationally repressed mRNAs. Anat. Embryol. 203:323-334. 39. Villegas, J, Araya, P, Bustos-Obregon, E, and Burzio, LO. (2002).

Localization of the 16S mitochondrial rRNA in the nucleus of mammalian spermatogenic cells. Mol. Hum. Reprod. 8: 977-983. 40. Villegas, J, Zarraga, AM, Muller, I, Montecinos, L, Werner, E, Brito,

M, Meneses, AM, and Burzio, LO. (2000). A novel chimeric mitochondrial RNA localized in the nucleus of mouse sperm. DNA Cell Biol. 19: 579-588. 41. Visconti, PE and Kopf, GS. (1998). Regulation of protein phosphorylation during sperm capacitation. Biol. Reprod. 59: 1-6. 42. Visconti, PE, Moore, GD, Bailey, XL, Laclerc, P, Connors, SA, Pan, D, Olds-Clarke, P, and Kopf, G-S. (1995). Capacitation in mouse spermatozoa. II. Protein tyrosine phosphorylation and capacitation are regulated by a cAMP- dependent pathway. Development 121: 1139-1150. 43. Visconti, PE, Ning, X, Fornes, MW, Alvarez, JG, Stein, P, Connors,

SA, and Kopf, GS. (1999). Cholesterol efflux-mediated signal transduction in mammalian sperm: cholesterol release signals an increase in protein tyrosine phosphorylation during mouse sperm capacitation. Dev. Biol. 214: 429-443. 44. Woo, AL, James, PF, and Lingrel, JB. (2000). Sperm motility is dependent on a unique isoform of the Na,K- ATPase. J. Biol. Chem. 275: 20693- 20699. . 45. Wykes, SM, Visscher, DW, and Krawetz, SA. (1997). Haploid transcripts persist in mature human spermatozoa. Mol. Hum. Reprod. 3: 15-19. 46. Yanagimachi, R. (1994). Mammalian fertilization. In: The Physiology of Reproduction. Knobil, E and Neil, JD, eds. New York: Raven

Press, Vol. 1, Chap. 5, pp. 189-317. 47. Yanagimachi, R and Chang, MC. (1963). Fertilization of hamster eggs in vitro. Nature 200: 281-282. 48. San Agustin JT, Witman GB. (2001). Differential expression of the Cs and Cαl isoforms of the catalytic subunit of cyclic 3'5'-adenosine monophosphate-dependent protein kinase in testicular cells. Biol. Reprod. 65: 151-164. 49. Ostermeien GC, Dix DJ, Miller D, Khatri P, Krawetz SA. Spermatozoal RNA profiles of normal fertile men. Lance 2002, 360, 772-777. 50. Bartoov B, Ben Barak J, Mayevsky A, Sneider M, Yogev L, Lightman

A. Sperm motility index: a new parameter for human sperm evaluation. Fertil. Steril. 1991, 56, 108-112. 51. DIG Application Manual, Roche Applied Science, Second Edition-pages 116-117

Claims

CLAIMS: 1. A method for inhibiting translation in sperm cells during capacitation comprising administering to the sperm cells a substance selected from the group comprising at least the following substances: (a) an inhibitor of translation by 70S-like ribosomes; (b) an inhibitor of translation of sperm mitochondrial ribosomes; (c) an inhibitor of translation of 55S ribosomes; and (d) an inhibitor of CP sensitive translation; 2. The method according to Claim 1, wherein the substance is selected from the group comprising at least the following substances: (a) D-Chloramphenicol; (b) gentamycin; (c) tetracycline; (d) a polynucleotide that is antisense to a sperm mRNA that is translated by 70S-like ribosomes, sperm mitochondrial ribosomes or sperm 55S ribosomes; (e) a poly nucleotide that is antisense to an RNA molecule of sperm 70S-like ribosomes, sperm mitochondrial ribosomes or sperm 55S ribosomes; (f) a ribonucleozyme that cleaves a sperm mRNA that is translated by 70S-like ribosomes; and (g) a ribonucleozyme that cleaves a sperm mRNA that is translated by sperm mitochondrial ribosomes; 3. The method according to Claim 2 wherein the substance is a polynucleotide selected from the group comprising at least the following polynucleotides: (a) A DNA fragment of 516 bp, complementary for mouse Catsperl mRNA having Genebank accession number AF407332, and having the following sequence: tggg cctggagtat ttttatgacc catggaacaa cctggacttc ttcatcatgg tcatggcagt gctggacttt gtgctccttc agataaactc gctctcatat tcattctaca accacagcct gttccggatt ctcaaagtct tcaaaagtat gcgggccctg agggccatcc gggttcttcg gaggctcagc atcctgacca gcctccacga agtggccggg actctgagtg gatctttacc atccatcacg gccatcctca ccctcatgtt tacctgcctc ttcctcttct ctgtggttct ccgagcactg tttcaggact cagaccccaa gcgcttccag aacatcttta ccacactctt caccctgttc accatgctca ccctggacga ctggtccctc atctacatag acaacagggc ccaaggcgcc tggtacatca taccgatcct catgatttac attgtcatcc agtacttcat cttcctcaac ctggtgattg ctgtcctggt agat; (b) An antisense modified oligonucleotide which is a chimera of DNA-RNA containing phosphorothioate and 2'-0-Methyl modifications, having the following sequence: » 5'- *mA*mA*mU*nιA*C*T*C*C*A^:1:G*G*C^:1:C*C*mA*mG*mG^!!!mG^!l: mC -3'; wherein * designates phosphorothioate and m designates 2'-0-Methyl ,and

(c) A DNA fragment complementary to the PKA-Cs mRNA having the Genebank accession number AF239743, and the following sequence: . ctgtt cccaccctat cactccctgg ctccctctac aggcagggct cccccccagg actggcagcc.aaactgctgc agcagatctt atgaggcttc cgagccaccg taatgctagt gccctgagaa agactgagtg atggcttcca gctccaacga tgtgaaagag ttcctagcca aagccaagga agatttcctg aaaaaatggg agaccccttc tcagaataca gcccagttgg atcagtttga tagaatcaag acccttggca ccggctcctt tgggcgagtg atgctggtga agcacaagga gagtgggaac cactacgcca tgaagatctt agacaagcag aaggtggtga agctaaagca gatcgagc 4. The method according to any one of the previous claims wherein the substance is a polynucleotide that is antisense to a sperm mRNA encoding for a protein selected from the group comprising at least the following proteins: (a) AT1-R; (b) PKCα; (c) Progesterone receptor; (d) Catsperl; (e) Na-K ATPase α4; and (f) Protein kinase A catalytic subunit PKA-cs 5. The method according to any one of claims 1 to 4 wherein the substance is administered to a male intrapertoneally. 6. The method according to any one of claims 1 to 4 wherein the substance is administered to a male intra-testicularly. 7. The method according to any one of Claims 1 to 4 wherein the substance is administered per os or percutaneously. 8. The method according to any one of Claims 1 to 4 wherein the substance, is administered by injection into the blood. 9. The method according to any one of the previous claims wherein the substance is administered to a male. 10. The method according to any one of Claims 1 to 8 wherein the substance is administered to a female. 11. The method according to any one of Claims 1 to 4 wherein the substance is administered to sper cells ex vivo. 12. A method for inhibiting a capacitation in sperm cells comprising inhibiting translation in sperm cells during capacitation by the method of any one of

Claims 1 to 11. 13. A method for inhibiting a capacitation dependent process in sperm cells comprising inhibiting capacitation in the cells by the method of Claim 12. 14. The method according to Claim 13 wherein the capacitation dependent process is selected from the group comprising at least: (a) acrosome reaction; (b) motility; (c) oocyte penetration; (d) in vitro fertilization; and (e) in vivo fertilization. 15. A pharmaceutical composition for inhibiting translation in sperm cells during capacitation comprising a substance selected from the group comprising at least the following substances: (a) an inhibitor of translation by 70S-like ribosomes; (b) an inhibitor of translation of sperm mitochondrial ribosomes; (c) an inhibitor of translation of 55S ribosomes; and (d) an inhibitor of CP sensitive translation; 16. The pharmaceutical composition according to Claim 15, wherein the substance is selected from the group comprising at least the following substances: (a) D-Chloramphenicol; (b) gentamycin; (c) tetracycline; (d) a polynucleotide that is antisense to a sperm mRNA that is translated by 70S-like ribosomes, sperm mitochondrial ribosomes, or 55S ribosomes; (e) a ribonucleozyme that cleaves a sperm mRNA that is translated by 70S-like ribosomes; (f) a polynucleotide that is antisense to a sperm mRNA that is translated by 70S-like ribosomes, sperm mitochondrial ribosomes or sperm 55S ribosomes; and (g) a ribonucleozyme that cleaves a sperm mRNA that is translated by sperm mitochondrial ribosomes. 17. The pharmaceutical composition according to Claim 16 wherein the substance is a polynucleotide selected from the group comprising at least the following polynucleotides: (a) A DNA fragment of 516 bp, complementary for mouse Catsperl mRNA having Genebank accession number AF407332, and having the following sequence: tggg cctggagtat ttttatgacc catggaacaa cctggacttc ttcatcatgg tcatggcagt gctggacttt gtgctccttc agataaactc gctctcatat tcattctaca accacagcct gttccggatt ctcaaagtct tcaaaagtat gcgggccctg agggccatcc gggttcttcg gaggctcagc atcctgacca gcctccacga agtggccggg actctgagtg gatctttacc atccatcacg gccatcctca ccctcatgtt tacctgcctc ttcctcttct ctgtggttct ccgagcactg tttcaggact cagaccccaa gcgcttccag aacatcttta ccacactctt caccctgttc accatgctca ccctggacga ctggtccctc atctacatag acaacagggc ccaaggcgcc tggtacatca taccgatcct catgatttac attgtcatcc agtacttcat cttcctcaac ctggtgattg ctgtcctggt agat;

(b) An antisense modified oligonucleotide which is a chimera of DNA-RNA containing phosphorothioate and 2'-0-Methyl modifications, having the following sequence:

5'-mA*mA*mA*mU*mA*C *C*C*A*G*G*C*C*C*mA^!l!mG^!!;mG^!i! mG* mC -3'; wherein * designates phosphorothioate and m designates 2'-0- Methyl, and

(c) A DNA fragment complementary to the PKA-Cs mRNA having the Genebank accession number AF239743, and the following sequence: . ctgtt cccaccctat cactccctgg ctccctctac aggcagggct cccccccagg actggcagcc.aaactgctgc agcagatctt atgaggcttc cgagccaccg taatgctagt gccctgagaa agactgagtg atggcttcca gctccaacga tgtgaaagag ttcctagcca aagccaagga agatttcctg aaaaaatggg agaccccttc tcagaataca gcccagttgg atcagtttga tagaatcaag acccttggca ccggctcctt tgggcgagtg atgctggtga agcacaagga gagtgggaac cactacgcca tgaagatctt agacaagcag aaggtggtga agctaaagca gatcgagc 18. The pharmaceutical composition according to any one of Claims 14 to

17 wherein the substance is a polynucleotide that is antisense to a sperm RNA encoding for a protein selected from the groupe comprising at least the following proteins: (a) AT1-R; (b) PKCα; (c) Progesterone receptor; (d) Catsperl; and (e) Na-K ATPase α4 19. The pharmaceutical composition according to any one of claims 15o 184 wherein the substance is adininistered to a male intrapertoneally. 20. The pharmaceutical composition according to any one of claims 15 to 18 wherein the substance is administered to a male intra-testicularly. 21. The pharmaceutical composition according to any one of Claims 15 to 18 wherein the substance is administered per os or percutaneously. 22. The pharmaceutical composition according to any one of Claims 15 to 18 wherein the substance is administered by injection into the blood. 23. The pharmaceutical composition according to any one of Claims 15 to

18 wherein the substance is administered to a male. 24. The pharmaceutical composition according to any one of Claims 15 to 22 wherein the substance is administered to a female. 25. The pharmaceutical composition according to any one of Claims 15 to 18 wherein the substance is ackninistered to sperm cells ex vivo. 26. The pharmaceutical composition according to any one of Claims 15 to 25 for use in inhibiting capacitation in sperm cells. 27. The pharmaceutical composition according to Claim 26 for inhibiting a capacitation dependent process in sperm cells 28. The pharmaceutical composition according to Claim 27 wherein the capacitation dependent process is selected from the group comprising at least: (a) acrosome reaction; (b) motility; (c) oocyte penetration; and (d) in vitro or in vivo fertilization.