WO2004113543A1 - Lipase vegetale - Google Patents

Lipase vegetale Download PDF

Info

Publication number
WO2004113543A1
WO2004113543A1 PCT/GB2004/002215 GB2004002215W WO2004113543A1 WO 2004113543 A1 WO2004113543 A1 WO 2004113543A1 GB 2004002215 W GB2004002215 W GB 2004002215W WO 2004113543 A1 WO2004113543 A1 WO 2004113543A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid molecule
cell
molecule
polypeptide
Prior art date
Application number
PCT/GB2004/002215
Other languages
English (en)
Inventor
Peter Eastmond
Original Assignee
The University Of York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0314098A external-priority patent/GB0314098D0/en
Priority claimed from GB0324617A external-priority patent/GB0324617D0/en
Application filed by The University Of York filed Critical The University Of York
Publication of WO2004113543A1 publication Critical patent/WO2004113543A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition

Definitions

  • the invention relates to nucleic acid molecules encoding plant lipase polypeptides; polypeptides and fragments thereof having lipase activity; transgenic cells expressing said lipase and bioreactors which utilise said lipase nucleic acid molecules and polypeptides.
  • Lipases are enzymes that degrade lipids.
  • the reaction catalysed is the hydrolysis of a fatty acid ester bond in triacylglycerol to release glycerol and fatty acids.
  • These proteins have important industrial uses as biocatalysts, for example in the food, textile, medical and pharmaceutical industries. Free fatty acids are important in providing flavour and texture to many foods (e.g. dairy products such as cheese and butter).
  • Lipases are produced by plants, animals, bacteria and moulds. Typically plant lipases are not used commercially although animal, bacterial and mould lipases are used extensively.
  • a lipase has been purified and characterised from Aspergillus niger, (see Tombs and Blake Biochem. Biophys, 1982, 700: 81-89) which is a dimer of two 25kD subunits which is glycosylated.
  • Iwai et al in Lipases: Borgstrom and Brockman, Elsevier, 1984 describes an extracellular lipase isolated from Aspergillus niger with a molecular weight of approximately 38kDa which is monomeric with a pi of 4.3 and a pH optimum for activity of 5.6. Torossian and Bell (Biotech. Appl.
  • Biochem 1991, 12: 205-211) describe a crude extract prepared from a Aspergillus niger cell extract with a molecular weight of 37kDa and a pi of 4.0.
  • plant lipases used commercially is disclosed in US3, 368, 903 which was prepared from rape seeds to provide a crude extract which was used in the baking industry.
  • oilseeds such as soybean, rapeseed and sunflower store trigycerides in their seeds which provide an energy store for germination and subsequent seedling development.
  • the oil globules form oil bodies in the cytoplasm that are membrane bound organelles that have protein in the membrane surface.
  • An example of a protein found associated with oil bodies is an oleosin.
  • the oleosins are a family of proteins that have divergent amino and carboxyl termini with more highly conserved lipophilic central domain. These proteins are associated with oil bodies and it is thought that the association is due in part to the lipophilic domain.
  • TAG triacylglycerol
  • TAG lipase EC: 3.1.1.3
  • TAG lipase activity is only detectable upon germination and increases concomitantly with the disappearance of TAG.
  • TAG lipase activity has been studied at the biochemical level in a variety of seeds and proteins have been purified. However no gene has so far been cloned from a plant that has been proven to encode a 'true' TAG lipase. This enzyme is distinguished from other esterases by its preference for an insoluble aggregated substrate and its capacity to hydrolyse long chain fatty acid esters, such as triolein.
  • OBL 1 is an acid lipase
  • OBL 2 is a neutral lipase
  • an isolated nucleic acid molecule or part thereof, which encodes a polypeptide wherein said nucleic acid molecule is selected from the group consisting of: i) a nucleic acid molecule comprising a nucleic acid sequence as represented in Figure la or 2a; ii) a nucleic acid molecule which hybridises to the nucleic acid molecule in (i) and which has lipase activity; iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) due to the degeneracy in the genetic code.
  • nucleic acid molecule hybridises under stringent hybridisation conditions to a nucleic acid molecule as represented in Figure la or 2a.
  • nucleic acid molecule consists of the nucleic acid sequence represented in Figure la or 2a.
  • said lipase is an acid lipase.
  • said lipase is a neutral lipase.
  • nucleic acid encodes a polypeptide with an oil body targeting domain.
  • said nucleic acid molecule that encodes a targeting domain comprises a nucleic acid sequence that encodes an amino acid sequence selected from the group consisting of: i) a nucleic acid molecule consisting of a nucleic acid sequence which encodes an amino acid sequence as represented in Figure 3; ii) a nucleic acid molecule which hybridises to the nucleic acid molecule in (i) and which specifically targets a polypeptide comprising said targeting domain to an oil body; and iii) a nucleic acid molecule which differs from the nucleic acid molecules of (i) and (ii) due to the degeneracy in the genetic code.
  • said targeting domain is encoded by a nucleic acid molecule comprising a nucleic acid sequence which hybridises under stringent hybridisation conditions to a nucleic acid molecule which encodes an amino acid sequence as represented in Figure 3.
  • Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in O.lx SSC,0.1% SDS at 60°C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. For example, hybridisation conditions can be determined by the GC content of the nucleic acid subject to hybridisation. Please see Sambrook et al (1989) Molecular Cloning; A Laboratory Approach. A common formula for calculating the stringency conditions required to achieve hybridisation between nucleic acid molecules of a specified homology is:
  • T m 81.5° C + 16.6 Log [Na + ] + 0.41[ % G + C] -0.63 (%formamide).
  • hybridisation conditions uses 4 - 6 x SSPE (20x SSPE contains 175.3g NaCl, 88.2g NaH 2 PO 4 H 2 O and 7.4g EDTA dissolved to 1 litre and the pH adjusted to 7.4); 5-10x Denhardts solution (50x Denhardts solution contains 5g FicoU (type 400, Pharmacia), 5g polyvinylpyrrolidone and 5g bovine serum albumen; lOO ⁇ g- l.Omg/ml sonicated salmon/herring DNA; 0.1-1.0% sodium dodecyl sulphate; optionally 40-60% deionised formamide.
  • Hybridisation temperature will vary depending on the GC content of the nucleic acid target sequence but will typically be between 42°- 65° C.
  • said nucleic acid molecule comprises a nucleic acid sequence that has at least 30% homology to the nucleic acid sequence represented in Figure la or 2a or a nucleic acid sequence which encodes an amino acid sequence as represented by Figure 3.
  • said homology is at least 40%; 50%; 60%; 70%; 80%; 90%; or at least 99% identity with the nucleic acid sequence represented in Figures la or 2a or a nucleic acid sequence which encodes a amino acid sequence as represented in Figure 3.
  • an isolated polypeptide which polypeptide is represented by an amino acid sequence as shown in Figure lb or 2b, or a variant polypeptide which is modified by addition, deletion or substitution of at least one amino acid residue wherein said polypeptide has lipase activity.
  • a variant polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations which may be present in any combination.
  • substitutions are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics.
  • amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan.
  • variants which retain or enhance the same biological function and activity as the reference polypeptide from which it varies.
  • deletion may be of entire functional domains. For example, the removal of a targeting domain from a polypeptide such that the lipase activity is retained by the deleted polypeptide.
  • a functionally equivalent polypeptide is a variant wherein one in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues, or one in which one or more amino acid residues includes a substituent group.
  • Conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between amide residues Asn and Gin; exchange of the basic residues Lys and Arg; and replacements among aromatic residues Phe and Tyr.
  • the invention features polypeptide sequences having at least 75% identity with the polypeptide sequences as herein disclosed, or fragments and functionally equivalent polypeptides thereof.
  • the polypeptides have at least 85% identity, more preferably at least 90% identity, even more preferably at least 95% identity, still more preferably at least 97% identity, and most preferably at least 99% identity with the amino acid sequences illustrated herein.
  • a vector comprising a nucleic acid molecule according to the invention.
  • said vector is an expression vector adapted for the expression of a polypeptide according to the invention.
  • the nucleic acid in the vector is operably linked to an appropriate promoter or other regulatory elements for transcription in a host cell such as a prokaryotic, (e.g. bacterial), or eukaryotic (e.g. fungal, plant, mammalian or insect cell).
  • a host cell such as a prokaryotic, (e.g. bacterial), or eukaryotic (e.g. fungal, plant, mammalian or insect cell).
  • the vector may be a bi-functional expression vector which functions in multiple hosts.
  • this may contain its native promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
  • promoter is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription.
  • Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design.
  • Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells.
  • Constitutive promoters include, for example CaMV 35S promoter (Odell et al (1985)
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- la promoter, which is activated by salicylic acid.
  • promoters of interest include steroid- responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellie et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline- repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and US Patent Nos. 5,814,618 and 5,789,156, herein incorporated by reference.
  • tissue-specific promoters can be utilised.
  • Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al (1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al (1996) Plant Physiol. 112(2): 525-535; Canevascni et al (1996) Plant Physiol.
  • tissue specific promoter is a promoter which is active during the accumulation of oil in developing oil seeds, (for example see Broun et al. (1998) Plant J. 13(2): 201-210.
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
  • the promoter is an inducible promoter or a developmentally regulated promoter.
  • nucleic acid constructs which operate as plant vectors.
  • Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors.
  • Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
  • Vectors may also include selectable genetic marker such as those that confer selectable phenotypes such as resistance to herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfiiron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
  • selectable genetic marker such as those that confer selectable phenotypes such as resistance to herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfiiron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
  • said vectors are vectors suitable for mammalian cell transfection or yeast cell transfection.
  • multi-copy vectors such as 2 ⁇ episomal vectors are preferred.
  • yeast CEN vectors and integrating vectors such as YTP vectors are suitable for transformation of yeast species such as Saccharomyces cerevisiae and Pichia spp.
  • a cell transfected or transformed with at least one nucleic acid molecule or vector according to the invention are provided.
  • said cell is eukaryotic cell.
  • said eukaryotic cell is selected from the group consisting of: mammalian cells (e.g. Chinese Hamster Ovary cells); yeast cells (e.g. Saccharomyces spp, Pichia spp); algal cells (e.g Phaeodactylum tricornutum, Chlamydomonas reinhardtii); insect cells (e.g. Spodoptera spp) or plant cells.
  • mammalian cells e.g. Chinese Hamster Ovary cells
  • yeast cells e.g. Saccharomyces spp, Pichia spp
  • algal cells e.g Phaeodactylum tricornutum, Chlamydomonas reinhardtii
  • insect cells e.g. Spodoptera spp or plant cells.
  • said cell is a plant cell.
  • said plant is selected from: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (lopmoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Anana comosus), citris tree (Cirrus' spp.) cocoa
  • plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, pea), and other root, tuber or seed crops.
  • Important seed crops are oil-seed rape, sugar beet, maize, sunflower, soybean,sorghum, and flax (linseed).
  • Horticultural plants to which the present invention may be applied may include lettuce, endive, and vegetable brassicas including cabbage, broccoli, and cauliflower.
  • the present invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato, pepper.
  • Grain plants that provide seeds of interest include oil-seed plants and leguminous plants.
  • Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc.
  • Oil seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc.
  • Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava been, lentils, chickpea, etc.
  • said cell is a prokaryotic cell.
  • a seed comprising a plant cell according to the invention.
  • said seed is from an oil seed plant.
  • said cell over-expresses the nucleic acid molecule according to the invention when compared to a non-transgenic reference cell of the same species.
  • said cell has increased lipase activity.
  • said cell over-expresses said nucleic acid molecule by at least 2-fold above basal level expression.
  • said cell over-expresses by at least 5-fold; 10-fold, 20-fold, 30-fold, 40-fold, or 50-fold.
  • said cell expresses said nucleic acid by at least 100-fold above basal level expression when compared to a non-transgenic cell of the same species.
  • a gene(s) may be placed under the control of a powerful promoter sequence or an inducible promoter sequence to elevate expression of mRNA encoded by said gene.
  • the modulation of mRNA stability is also a mechanism used to alter the steady state levels of an mRNA molecule, typically via alteration to the 5 ' or 3 ' untranslated regions of the mRNA.
  • said cell is modified such that the expression of the nucleic acid molecule according to the invention is decreased when compared to a non-transgenic reference cell of the same species.
  • said cell is modified to reduce the expression of said nucleic acid molecule wherein lipase activity is reduced by at least 10% when compared to a non-transgenic reference cell of the same species.
  • lipase activity is reduced by at least 10% when compared to a non-transgenic reference cell of the same species.
  • said activity is reduced by between about 10%-90%. More preferably said activity is reduced by at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or at least 90%.
  • said transgenic cell is null for a nucleic acid molecule comprising a sequence selected from the group consisting of: i) the nucleic acid molecule comprising a sequence as represented by Figure la or 2a; ii) nucleic acids which hybridise to the sequences of (i) above and which have lipase activity; and iii) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (i) and (ii) above.
  • Null refers to a cell that includes a non-functional copy of the nucleic acid sequence described above wherein the activity of the polypeptide encoded by said nucleic acid is ablated.
  • Methods to provide such a cell are well known in the art and include the use of antisense genes to regulate the expression of specific targets; insertional mutagenesis using T-DNA; the introduction of point mutations and small deletions into open reading frames and regulatory sequences; and double stranded inhibitory RNA (RNAi).
  • RNAi double stranded RNA
  • the RNAi molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule.
  • the RNAi molecule is typically derived from exonic or coding sequence of the gene which is to be ablated. Surprisingly, only a few molecules of RNAi are required to block gene expression that implies the mechanism is catalytic. The site of action appears to be nuclear as little if any RNAi is detectable in the cytoplasm of cells indicating that RNAi exerts its effect during mRNA synthesis or processing.
  • RNAi An alternative embodiment of RNAi involves the synthesis of so called "stem loop RNAi" molecules that are synthesised from expression cassettes carried in vectors.
  • the DNA molecule encoding the stem-loop RNA is constructed in two parts, a first part that is derived from a gene the regulation of which is desired. The second part is provided with a DNA sequence that is complementary to the sequence of the first part.
  • the cassette is typically under the control of a promoter that transcribes the DNA into RNA.
  • the complementary nature of the first and second parts of the RNA molecule results in base pairing over at least part of the length of the RNA molecule to form a double stranded hairpin RNA structure or stem-loop.
  • the first and second parts can be provided with a linker sequence.
  • Stem loop RNAi has been successfully used in plants to ablate specific mRNA's and thereby affect the phenotype of the plant , see, Smith et al (2000) Nature 407, 319-320.
  • said cell is transfected with a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of a lipase as herein described wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.
  • said cassette is provided with at least two promoters adapted to transcribe sense and antisense strands of said nucleic acid molecule.
  • said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.
  • a nucleic acid molecule comprising an expression cassette which cassette comprises a nucleic acid sequence which encodes at least part of a lipase as hereindescribed wherein said cassette is adapted such that both sense and antisense nucleic acid molecules are transcribed from said cassette.
  • said cassette comprises a nucleic acid molecule wherein said molecule comprises a first part linked to a second part wherein said first and second parts are complementary over at least part of their sequence and further wherein transcription of said nucleic acid molecule produces an RNA molecule which forms a double stranded region by complementary base pairing of said first and second parts.
  • said first and second parts are linked by at least one nucleotide base.
  • said first and second parts are linked by 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide bases, h a yet further preferred embodiment of the invention said linker is at least 10 nucleotide bases.
  • the length of the RNA molecule is between 10 nucleotide bases (nb) and lOOOnb.
  • said RNA molecule is at least lOOnb; 200nb; 300nb; 400nb; 500nb; 600nb; 700nb; 800nb; 900nb; or lOOOnb in length.
  • said RNA molecule is at least lOOOnb in length.
  • said RNA molecule is 21nb in length.
  • a polypeptide encoded by a nucleic acid according to the invention as a target for the discovery of agents that inhibit the lipase activity of said polypeptide.
  • a screening method for the identification of an agent with the ability to inhibit plant growth and/or viability comprising the steps of: i) providing a polypeptide encoded by the nucleic acid selected from the following group; a) a nucleic acid represented by Fig 1 a or 2a; b) nucleic acids which hybridise to the sequences of (i) above and which have lipase activity; and c) nucleic acid sequences which are degenerate as a result of the genetic code to the sequences defined in (a) and (b) above; ii) providing at least one candidate agent; iii) forming a preparation which is a combination of (i) and (ii); iv) determining the interaction of the polypeptide and said candidate agent; and testing the effect of the agent on the growth and/or viability of plants.
  • said agent is a herbicide.
  • a method to isolate a plant nucleic acid molecule encoding at least part of a polypeptide which has lipase activity comprising the steps of:
  • said plant nucleic acid is cDNA.
  • said nucleic acid is genomic DNA.
  • said lipase in an oil body lipase.
  • at least one first primer molecule anneals to a part of said plant nucleic acid molecule encoding said lipase between about amino acid residue + 245 and +253 and at least one second primer molecule anneals between about amino acid residue +414 and +421 of the consensus sequence shown in Figure 15.
  • said first primer molecule, or reverse sequence complement thereof is selected from the group consisting of;
  • RtY agY ttY aga ggc acH gaY c and said second primer molecule, or reverse sequence complement thereof, is selected from the group consisting of:
  • first and second oligonucleotide primer molecules or reverse sequence complements thereof wherein said first molecule is selected from the group consisting of;
  • said second molecule, or reverse sequence complement thereof is selected from the group consisting of ; gtB taY aaY aaY gaY atg gtl c gtB taY tgY aaY gaY atg gtl c gtB taY aaY aaY gaY atg gtl c gtB taY aaY aY gaY Rtl gtl c gtB taY tgY aaY gaY Rtl gtl c
  • an oil body lipase isolated by the method according to the in invention is provided.
  • kits comprising; oligonucleotide primer molecules according to the invention and polymerase chain reaction buffer, co-factors (e.g. divalent cation, dNTP's,) and thermophilic DNA polymerase.
  • co-factors e.g. divalent cation, dNTP's,
  • thermophilic DNA polymerase e.g. thermophilic DNA polymerase.
  • kit further comprises buffers suitable for the extraction of nucleic acid from plant tissue.
  • kit further comprises enzymes and co-factors typically used in the synthesis of cDNA.
  • said kit further comprises control nucleic acid wherein said control nucleic acid encodes an oil body lipase.
  • Figure la is the nucleic acid sequence of OBL1;
  • Figure lb is the amino acid sequence of OBL1 ;
  • Figure 2a is the nucleic acid sequence of OBL 2;
  • Figure 2b is the amino acid sequence of OBL2;
  • Figure 3 is the amino acid sequence of the hydrophobic domain of OBL 1;
  • Figure 4 is a summary of the isolation procedure for castor bean oil bodies;
  • Figure 5 compares the amino acid sequence of tryptic peptide fragments with other plant lipase fragments and including degenerate primers
  • Figure 6 shows the amino acid sequence of OBLl and a homology comparison with related fungal lipase polypeptides
  • Figure 7 represents a hydrophobicity plot for OBL 1
  • Figure 8 illustrates proteolytic cleavage of OBL 1 and fractionation
  • FIG. 9 illustrates the lipase activity of OBLl expressed in E.coli
  • Figure 10 is a sequence comparison of lipase-like genes from Arabidopsis spp;
  • Figure 11 illustrates PCR primers used to sub-clone homologues of OBL- 1 ;
  • Figure 12 illustrates the amino acid sequence of OBL2
  • Figure 13 illustrates the expression patterns of OBLl and OBL 2 during germination and post-germinative growth
  • Figure 14 is an amino acid comparison of OBL 1, OBL2 and including homologues of these proteins.
  • Figure 15a is an amino acid comparison of oil body lipase sequences including regions of said lipase to which oligonucleotide primer molecules are designed;
  • Figure 15b illustrates examples of degenerate primers used in the amplification of oil body lipase nucleic acid sequences.
  • Oil bodies were isolated from the endosperm of imbibed castor beans and the membranes delipidated using the methods of Hills et al., (2). Peripheral proteins were removed from the oil bodies using urea buffer, according to Millichip et al., (3). The membrane fraction was solublized in SDS-loading buffer, heated at 70°C for 10 min and the polypeptides separated on a 14% SDS-PAGE gel as described by Laemmli (5) and stained using 0.2% (w/v) Coomassie blue R-250 in methanol: acetic acid: water (4:1:5 v/v/v).
  • Tryptic digestion and peptide sequence analysis - fri-gel tryptic digestion was performed by washing the gel pieces in Eppendorf tubes three times with 50% (v:v) aqueous acetonitrile containing 25 mM ammonium bicarbonate and drying the gel pieces in a vacuum concentrator for 30 min. Sequencing-grade modified porcine trypsin (Promega) was dissolved in the 50 mM acetic acid supplied by the manufacturer, then diluted 5-fold by adding 25 mM ammonium bicarbonate containing 0.1% (v:v) octyl- ⁇ -D-glucopyranoside (Sigma) to give a final trypsin concentration is 0.02 ⁇ g/ ⁇ L.
  • Positive-ion MALDI mass spectra were obtained using an Applied Biosystems 4700 Proteomics Analyzer (CTS version, Applied Biosystems, Foster City, CA, USA) in reflectron mode with an accelerating voltage of 20 kV.
  • MS spectra were acquired with a total of 1000 laser pulses over a mass range of m/z 800-4000.
  • Final mass spectra were the summation of 20 sub-spectra, each acquired with 50 laser pulses, and internally calibrated using the tryptic peptides at m/z 842.509 and 2211.104.
  • Monoisotopic masses were obtained from centroids of raw, unsmoothed data.
  • a Source 1 accelerating voltage of 8 kV, a collision energy of 1 kV, and a Source 2 accelerating voltage of 15 kV were used. Air was used as the collision gas at the instrument's 'medium' pressure setting with a recharge threshold of 9.9xl0 "7 torr, which produced a Source 2 pressure of about lxlO "6 torr.
  • the precursor mass window was set to +/-10 "Da", and the metastable suppressor was enabled. The default calibration was used for MS/MS spectra.
  • Mass spectral data obtained in batch mode were submitted to database searching using a locally-running copy of the Mascot program (Matrix Science Ltd., versionl.7).
  • Batch-acquired MS and MS/MS spectral data were submitted to a combined peptide mass fingerprint and MS/MS ion search through the Applied Biosystems GPS Explorer software interface (version 1.0) to Mascot.
  • Peptide sequence tags were generated from CID-MS/MS spectra by manual interpretation or using a de novo sequencing program supplied by Applied Biosystems.
  • RN4 extraction, cDNA synthesis and PCR - Total R ⁇ A from various tissues was isolated using the R ⁇ easy kit from Qiagen.
  • the synthesis of single stranded cD ⁇ A was carried out using SuperscriptTM ⁇ R ⁇ ase H " reverse transcriptase from hivitrogen.
  • Degenerate primers corresponding to peptide sequences 1 and 2 were designed (5'-ttgatagtirtyagyttyaga and 5'-ctgtccraatgtrtaiarctt) and used to amplify a fragment of the acid lipase (RcOBLl) cD ⁇ A from imbibed seed endosperm.
  • Gene specific primers (5'-gaccacttggtatgggcatatgatgg and 5'-catgtcattgcagtaaaccaccctga) were then used to obtain the full-length cD ⁇ A sequence by 3'- and 5 '-RACE using the SMARTTM RACE cD ⁇ A AmpUfication kit from BD Biosciences, following the manufacturers protocols.
  • Primers to a castor actin-like gene (RcACT) (5'- cgttctctccttgtatgccagtggtc and 5'-gagctgctcttggcagtctcaagttc) were used as a constitutive control for RT-PCR experiments on various tissues.
  • a partial clone of RcOBL2 was obtained by performing PCR on cD ⁇ A from four-day old endosperm using different combinations of four pairs of degenerate primers designed using alignments of multiple OBL-like genes (5'- rtyagyttyagaggiachgarc or 5'-rtyagyttyagaggiachgayc or 5'-rtyagyttyagaggcachgarc or 5'- rtyagyttyagaggcachgayc with 5'-giaccatrtcrttrttrtabac or 5'-giaccatrtcrttrcartabac or 5'-giaciayrtcrtttrtabac or 5'-giaciayrtcrttrcartabac).
  • Gene specific primers (5'- taggtctgggcaacagaagtgacgctac and 5'-tgcccaaatgtgtatatgttcagcaacc) were then used to obtain the full-length RcOBL2 cD ⁇ A sequence by 3'- and 5 '-RACE using the SMARTTM RACE cD ⁇ A Amplification kit from BD Biosciences, following the manufacturers protocols.
  • RcOBLl and determination of lipase activity A fragment of the RcOBLl cDNA that lacks the hydrophobic N-terminus was amplified using primers 5'-gaattcgtgtcgcaccaggcagacgaagtgatttca and 5'-tctagactagtaaccttgtgccatcattttcagag and cloned into the pCR 2.1-TOPO vector from hivitrogen. The insert was then excised using EcoRl and Xbal and cloned into the pMAL-c2E vector from New England Biolabs. The cMBP fusion protein was expressed in BL21-Codon Plus-RTL cells from Stratagene.
  • the cells were cultured at 37°C and induced using 0.4 mM IPTG. Lipase activity was measured using u C-labelled triolein according to the method of Fuchs et al., (1). Protein content was determined as described by Bradford (4) using BSA as a standard.
  • TAG triacylglycerol
  • CHAPS 3-cholamidopropyl- dimethylammonio-1-propanesulphonate
  • PEP propyl endopeptidase
  • TFA trifluoroacetic acid
  • MALDI matrix-assisted laser desorption/ionization
  • MS mass spectrometry
  • CTD collision-induced dissociation
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase-PCR
  • RACE-PCR rapid amplification if cDNA ends- PCR
  • PAGE polyacrylamide gel electrophoresis
  • MBP maltose binding protein.
  • OBL oil body lipase
  • Castor beans contain an acid lipase activity, which is associated with the oil body membrane (8).
  • oil bodies were isolated from the endosperm of soaked castor beans by floatation centrifugation (10) and stripped of peripheral proteins using denaturing urea buffer (11). The remaining polypeptides that are intergral to the oil body membrane were separated by SDS-PAGE (Fig. 4).
  • a 58kDa band was excised, subjected to tryptic digestion and the resulting peptides analysed by MALDI and CED-MS/MS. The sequence of two peptides was interpreted from the CID-MS/MS spectra (Fig. 4).
  • Degenerate primers were designed, based on the peptide sequences and a cDNA fragment was amplified by RT-PCR from imbibed seed RNA. Gene specific primers were then used to obtain a full-length cDNA sequence by 3'- and 5 '-RACE. This sequence was designated oil body lipase 1 (OBLl) and submitted to the Geribank database (accession number XXX). The cDNA is 1870 bp and contains a 1578 bp putative open reading frame. The deduced RcOBLl protein is 525 amino acids (Fig. 6), has a calculated mass of 59.6 kDa and a predicted pi 6.68.
  • OBLl oil body lipase 1
  • Lipases from different organisms can vary considerably in their primary amino acid sequence however they are all 'serine esterases' and exhibit a common structural feature called an / ⁇ fold which consists of a central ⁇ -sheet composed of parallel strands that are linked via ⁇ -helices [15].
  • the nucleophilic serine forms part of a catalytic triad (S-[DE]-H) and is located in a sharp turn (nucleophilic elbow).
  • a conserved signature surrounds the serine residue (PROSITE accession number PS00120: [L ⁇ V]-X-[L ⁇ VFY]-[LIVMST]-G-[HYWV]-S-X-G-[GSTAC]).
  • the RcOBLl amino acid sequence (Fig. 6) contains both a putative catalytic triad (S340, D404, H497) and all but the first residue of the conserved signature (FVVTGHSLGG).
  • RcOBLl contains an N-terminal oil body anchor domain -
  • a hydrophobicity plot of RcOBLl showed that near the N-terminus there is an unusually long stretch of ⁇ 60 hydrophobic amino acids (Fig. 7).
  • Oil body proteins such as oleosin (Fig. 7) contain a characteristic 'H domain', consisting of -70 hydrophobic residues, which anchors the protein to the membrane (16).
  • the N-terminus of RcOBLl does not show significant sequence homology to oleosins the extent of the hydrophobic region suggests that it might play an analogous role.
  • RcOBLl is the acid lipase -
  • RcOBLl encodes the acid lipase
  • the enzyme was expressed heterologusly in E. coli.
  • the hydrophobic N-terminus was removed and the C-terminus fused to maltose binding protein (MBP).
  • MBP maltose binding protein
  • Acid lipase activity was measured in extracts from E. coli by following the hydrolysis of 14 C-triolein at pH 4.2. No activity was detected in cells that did not harbour the expression vector (data not shown). However in those that did, induction of cMBP -RcOBLl expression by B?TG resulted in a 20-fold increase in acid lipase activity (Fig. 9). When the pH of the assay was varied the optimum was found to be between 4 and 4.5 (Fig. 9). This value is the same as that reported for lipase activity from purified castor seed oil body membranes (8).
  • RT-PCR was used to show that RcOBLl transcripts are present in the endosperm of imbibed seed but that the level declines following germination (Fig. 13).
  • the expression of RcOBLl was not detected in the embryo of imbibed seed or in the leaves, stems or roots of mature plants (data not shown).
  • the catalytic properties of the acid lipase and its distribution have been defined previously in some detail (8-10).
  • a pH optima of -4.2 and localization to the seed endosperm can be considered as diagnostic.
  • RcOBLl -like proteins are present in many plants- An investigation of all available higher plant sequences indicates that there are RcOBLl homologues present in numerous species including; Ar ⁇ bidopsis thaliana, soybean (Glycine max), tomato (Lycopersicon esculentum), Lettuce (Lactuca sativa), rice (Oryza sativa) and wheat (Triticum aestivum).
  • a phylogenetic analysis was performed of Arabidopsis proteins with homology to fungal lipases. Arabidopsis contains five OBLl -like proteins (Fig. 5A) of which At3gl4360 is most similar to RcOBLl (-44% identity). All five proteins contain both the membrane anchor domain and the lipase catalytic domain, suggesting that they are also oil body lipases (Fig. 14).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des molécules d'acide nucléique codant des polypeptides de lipase végétale ; des polypeptides et des fragments de polypeptides ayant une activité lipasique ; des cellules transgéniques exprimant ladite lipase ; des bioréacteurs utilisant lesdites molécules d'acide nucléique de lipase et des polypeptides. L'invention concerne également des procédés permettant d'isoler lesdits molécules d'acide nucléique de lipase.
PCT/GB2004/002215 2003-06-18 2004-05-24 Lipase vegetale WO2004113543A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0314098.5 2003-06-18
GB0314098A GB0314098D0 (en) 2003-06-18 2003-06-18 Lipase
GB0324617.0 2003-10-22
GB0324617A GB0324617D0 (en) 2003-10-22 2003-10-22 Lipase

Publications (1)

Publication Number Publication Date
WO2004113543A1 true WO2004113543A1 (fr) 2004-12-29

Family

ID=33542668

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/002215 WO2004113543A1 (fr) 2003-06-18 2004-05-24 Lipase vegetale

Country Status (1)

Country Link
WO (1) WO2004113543A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006131750A2 (fr) * 2005-06-10 2006-12-14 The University Of York Polypeptide de la lipase
WO2014110540A1 (fr) 2013-01-11 2014-07-17 Maraxi, Inc. Succédanés de fromage d'origine non laitière comprenant un coacervat
US9011949B2 (en) 2011-07-12 2015-04-21 Impossible Foods Inc. Methods and compositions for consumables
US9700067B2 (en) 2011-07-12 2017-07-11 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US9808029B2 (en) 2011-07-12 2017-11-07 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US9826772B2 (en) 2013-01-11 2017-11-28 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US10039306B2 (en) 2012-03-16 2018-08-07 Impossible Foods Inc. Methods and compositions for consumables
US10172380B2 (en) 2014-03-31 2019-01-08 Impossible Foods Inc. Ground meat replicas

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999055883A2 (fr) * 1998-04-30 1999-11-04 E.I. Du Pont De Nemours And Company Triacylglycerol lipases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999055883A2 (fr) * 1998-04-30 1999-11-04 E.I. Du Pont De Nemours And Company Triacylglycerol lipases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALTAF A ET AL: "Acid lipase of castor bean lipid bodies: Isolation and characterisation", JOURNAL OF PLANT BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 6, no. 1, 1997, pages 13 - 18, XP009037294, ISSN: 0971-7811 *
WANG ET AL: "Cloning and expression of phosphatidylcholine-hydrolyzing phospholipase D from Ricunius communis L", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 269, no. 32, 12 August 1994 (1994-08-12), pages 20315 - 20317, XP002087693, ISSN: 0021-9258 *

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006131750A3 (fr) * 2005-06-10 2007-08-02 Univ York Polypeptide de la lipase
AU2006256531B2 (en) * 2005-06-10 2011-01-27 The University Of York Lipase polypeptide
US8093452B2 (en) 2005-06-10 2012-01-10 University Of York Reduced RDM-1 gene expression in plants
WO2006131750A2 (fr) * 2005-06-10 2006-12-14 The University Of York Polypeptide de la lipase
US10327464B2 (en) 2011-07-12 2019-06-25 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US9011949B2 (en) 2011-07-12 2015-04-21 Impossible Foods Inc. Methods and compositions for consumables
US9700067B2 (en) 2011-07-12 2017-07-11 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US9808029B2 (en) 2011-07-12 2017-11-07 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US10863761B2 (en) 2011-07-12 2020-12-15 Impossible Foods Inc. Methods and compositions for consumables
US9943096B2 (en) 2011-07-12 2018-04-17 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US10039306B2 (en) 2012-03-16 2018-08-07 Impossible Foods Inc. Methods and compositions for consumables
US10986848B2 (en) 2013-01-11 2021-04-27 Impossible Foods Inc. Methods and compositions for consumables
WO2014110540A1 (fr) 2013-01-11 2014-07-17 Maraxi, Inc. Succédanés de fromage d'origine non laitière comprenant un coacervat
US10314325B2 (en) 2013-01-11 2019-06-11 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US10172381B2 (en) 2013-01-11 2019-01-08 Impossible Foods Inc. Methods and compositions for consumables
EP3513664A1 (fr) 2013-01-11 2019-07-24 Impossible Foods Inc. Procédé de production d'un produit non-laitier fermenté et aromatisé
US11224241B2 (en) 2013-01-11 2022-01-18 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US9826772B2 (en) 2013-01-11 2017-11-28 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US11219232B2 (en) 2013-01-11 2022-01-11 Impossible Foods Inc. Methods and compositions for affecting the flavor and aroma profile of consumables
US10993462B2 (en) 2013-01-11 2021-05-04 Impossible Foods Inc. Methods and compositions for consumables
US11013250B2 (en) 2013-01-11 2021-05-25 Impossible Foods Inc. Methods and compositions for consumables
US10172380B2 (en) 2014-03-31 2019-01-08 Impossible Foods Inc. Ground meat replicas
US10798958B2 (en) 2014-03-31 2020-10-13 Impossible Foods Inc. Ground meat replicas
US11439166B2 (en) 2014-03-31 2022-09-13 Impossible Foods Inc. Ground meat replicas
US11819041B2 (en) 2014-03-31 2023-11-21 Impossible Foods Inc. Ground meat replicas

Similar Documents

Publication Publication Date Title
US20090205079A1 (en) ACETYL CoA CARBOXYLASE (ACCase) GENE FROM JATROPHA CURAS
CA2803098C (fr) Diminution de la teneur en acide gras sature de graines de plante
US20150329870A1 (en) Methods for Elevating Fat/Oil Content in Plants
US20150218578A1 (en) Methods of increasing tolerance to heat stress and amino acid content of plants
US20120079626A1 (en) Lipase polypeptide
CA2889985C (fr) Polynucleotides d'acyltransferase ameliores, polypeptides et procedes d'utilisation
WO2004113543A1 (fr) Lipase vegetale
MX2015005270A (es) Polinucleotidos, polipeptidos y metodos de uso novedosos de aciltransferasa.
US10421975B2 (en) 14-3-3 proteins enhance WRINKLED1 transcription factor-regulated oil production
WO2012049663A1 (fr) Obtention de plantes ayant une tolérance améliorée à un déficit hydrique
WO2019104509A1 (fr) Plants de riz transgéniques surexprimant la protéine 2 de liaison à l'acyl-coa, présentant une taille de grain améliorée
US20100184224A1 (en) Plant cell wall loosening activity of group 2/3 allergens of grass pollen
WO2018183734A1 (fr) Biosynthèse améliorée de lipides par l'intermédiaire de lipases plastidiales modifiées
US20040148653A1 (en) Triacylglycerol lipases
WO2014037735A1 (fr) Atsp1, une ubiquitine ligase e3, et son utilisation
US9347066B2 (en) Plants and seeds with altered storage compound levels, related constructs and methods involving genes encoding proteins with similarity to bacterial 2,4-dihydroxy-hept-2-ene-1,7-dioic acid class II-like aldolase proteins
US10570404B2 (en) Enhanced stability engineered WRINKLED1 transcription factor
Cho et al. Plasma membrane localization of soybean matrix metalloproteinase differentially induced by senescence and abiotic stress
US20240150785A1 (en) Conferring drought tolerance and biomass accumulation through the plant-specific rfs gene family
WO2002103001A1 (fr) Gdp-mannose-3',5'-epimerase et ses procedes d'utilisation
WO2004001028A1 (fr) Genes transferase derives des plantes
US20080010698A1 (en) Expansin Polypeptides
WO2023055291A2 (fr) Régulateur modifié pour rendement en huile végétale amélioré
WO2013095125A1 (fr) Procédé de production d'une plante ayant une résistance accrue aux maladies vis-à-vis des nématodes
CN118019852A (zh) 用于提高植物油产量的工程改造调节剂

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase