WO2004113537A1 - 稔性回復遺伝子を複数の遺伝子座に配置させることを含むハイブリッド植物の稔性を向上させる方法 - Google Patents
稔性回復遺伝子を複数の遺伝子座に配置させることを含むハイブリッド植物の稔性を向上させる方法 Download PDFInfo
- Publication number
- WO2004113537A1 WO2004113537A1 PCT/JP2004/008025 JP2004008025W WO2004113537A1 WO 2004113537 A1 WO2004113537 A1 WO 2004113537A1 JP 2004008025 W JP2004008025 W JP 2004008025W WO 2004113537 A1 WO2004113537 A1 WO 2004113537A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fertility
- seq
- gene
- bases
- koshihikari
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
- A01H1/022—Genic fertility modification, e.g. apomixis
- A01H1/023—Male sterility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
Definitions
- a method for improving fertility of a hybrid plant comprising placing a fertility restoring gene at multiple loci
- the present invention relates to a hybrid plant in which a fertility restoring gene has been introduced into a plurality of loci and use thereof.
- the three-line method refers to a sterile line that has a male sterile cytoplasm, a restored line that has a gametotype fertility restoring gene, and a sterile line that has the same nuclear gene as the sterile line.
- This refers to a method using a maintenance line, which is a line that does not possess cytoplasm.
- hybrid seeds can be obtained by fertilizing pollen of the recovery line to the sterile line, and (ii) pollen of the maintenance line to the sterile line. Fertilization can maintain a sterile line.
- fertility restoring genes encoded in the male sterile cytoplasm and nucleus are used. Fertility-restoring genes are classified into gametoid and sporophyte types by their mechanism of action. In the gametophyte type, the pollen genotype determines whether or not pollen fertility is restored, and the fertility of rice against BT male sterile cytoplasm is determined. The reverted gene Rf-1 and the reverting gene for maize S-type male sterile cytoplasm are known.
- Patent Document 1 JP-A-2002-345485
- Patent Document 2 International Publication No. 02Z014506 A1 pamphlet
- Patent Document 3 International Publication No. 03Z027290 A1 pamphlet
- Patent Document 4 International Publication No.02Z019803 A1 pamphlet
- Non-Patent Document 1 Ahmed, MI, and Siddiq, EA (1998). Hybrid cultivar development, SS Banga and SK Banga, eds
- Non-Patent Document 2 Dhillon, B.S. (1998) .Maize.In Hybrid cultivar dev elopment, S.S.Banga and S.K.Banga, eds (Berlin: Springer Verlag, pp. 282-315.
- Non-Patent Document 3 Wen, L. & Chase, C.D. (1999) .Curr. Genet. 35, p. 521-526.
- Non-Patent Document 4 Fukuta et al. 1992, Jpn J. Breed. 42 (supl. 1) p. 1 64-165
- Non-patent document 5 Hiei et al., Plant Journal (1994), 6 (2), p. 272-282
- Non-patent document 6 Komari et al., Plant Journal (1996) 10, p. 165-174
- Non-patent Literature 7 Ditta et al., Proc. Natl. Acad. Sci. USA (1980), 77: p. 7347-7351
- Non-Patent Document 8 Lemas et al., Plasmid 1992, 27, p. 161-163
- Non-Patent Document 9 Cui, X., Wise, R.P. and Schanble, P.S. (1996)
- Non-Patent Document 10 Liu, F., Cui, X., Horner, H.T., Weiner, H. and
- Non-Patent Document 11 Michaels and Amasino 1998, The Plant Journal 14 (3) p. 381-385
- Non-Patent Document 12 Neff et al. 1998, The plant Journal 14 (3) p. 387-392
- Non-Patent Document 13 Komari, T., Saito, ⁇ ., Nakakido, F., and Kumashiro, T. (1989) .Efficient selection of somatic hybrids in Nicoti ana tabacum L. using a combination of drug—resistance markers i Appl. Genet. 77, 547-552
- Non-Patent Document 14 Altschul, SF, Gish, W., Miller, W., Myers, E.W., and Lipman, DJ (1990) .Basic J. Mol. Biol. 215, 403—410.
- Non-Patent Document 15 Komori, T., Yamamoto, ⁇ ., Takemori, ⁇ ., Kashihara, ⁇ ., Matsushima, ⁇ ., And Nitta, ⁇ . (2002). Fine mapping of a restorer gene, Rf— 1, that restores the BT— type cytoplas mic male sterility. Breed. Res. 4 (Suppl. 2), 243.
- Non-Patent Document 16 Harushima, Y., et al. (1998) .A high-density rice genetic linkage map with 2275 markers using a single F2 population.Genetics 148, 479-494.
- Non-Patent Document 17 Kariya, K. (1989) .Sterility caused by cooling treat ment at the flowering stage in rice plants III.Establishment of a method of in vitro pollen germination. Jap. J. Crop Sci. 58, 96-102 .
- An object of the present invention is to provide a hybrid plant having high fertility.
- the hybrid plant of the present invention is characterized by having two copies or more of the fertility restoring gene at two or more loci that are not in a complete linkage relationship.
- the loci that are not completely linked are preferably loci on different chromosomes.
- the fertility restoring gene is preferably a gametotype fertility restoring gene, and more preferably a rice BT type male sterility restoring gene.
- the present invention also introduces a fertility restoring gene by genetic engineering, and arranges two copies or more of the fertility restoring gene at two or more loci that are not completely linked. Including providing a method for producing the hybrid plant. You.
- the present invention provides a hybrid plant having high fertility.
- the hybrid plant of the present invention is characterized in that it has two copies or more of the fertility restoring gene at two or more loci that are not completely linked.
- Meiosis occurs during the formation of gametophyte pollen in plants, and homologous chromosomes of each set are separated. Therefore, when hybrid varieties are grown using the gametotype-type fertility-restoring gene and male-sterile cytoplasm, pollen with and without the fertility-restoring gene is separated 1: 1 in anthers of hybrid varieties. The target pollen fertility is 50%.
- the hybrid plants of the present invention have the following features: a) having two or more copies of the fertility restoring gene; and b) having them at two or more loci that are not in perfect linkage. Due to the characteristics, when pollen is formed by meiosis, there is an advantage that the likelihood of the presence of a gametotype restoring gene on any chromosome is increased.
- rice is obtained by repeating the transfer and crossing of a force gene having 12 sets of homologous chromosomes, for example, to restore the gametotype recovery gene to three places on chromosomes 6, 7, and 10. Is placed.
- homologous chromosomes with and without gametophytes when pollen is formed are segregated independently of segregation of other sets of homologous chromosomes.
- pollen with the gametotype fertility restoring gene in three places (chromosomes 6, 7, and 10), and pollen in two places (chromosomes 6 and 7, chromosomes 6 and 10 or Pollen at chromosome 7 and chromosome 1), pollen at chromosome 1 (any of chromosomes 6, 7, and 10), and pollen at chromosome 0 are formed at a ratio of 1: 3: 3: 1.
- the genetically engineered gametotype fertility-recovery gene functions in the same way as the endogenous gene, and that if the pollen has at least one gametotype-fertility-recovery gene, the fertility is restored. It was shown that pollen having multiple gametotype fertility-restoring genes can also grow normally.
- the object of the present invention is to “improve pollen fertility by arranging two copies or more of a fertility-restoring gene,” even if they are not inherited completely independently, unless they behave completely together. Can be achieved.
- not in a completely linked relationship means not only a so-called “independent relationship”, which is inherited completely independently as in the case of sitting on different chromosomes, but also This includes cases in which a person who is not independent is not in a complete chain but is in a close but gentle chain relationship.
- two loci are at a distance of about lcM or more, more preferably about 5 cM or more, they are inherited without complete behavior, i.e., "fully linked”. It doesn't matter.
- the fertility restoring gene Rf-1 for the BT cytoplasm exhibits partial fertility restoring ability for the WA cytoplasm. Also, the degree of recovery may be improved by arranging a plurality of Rf-1s. We are currently conducting experiments to confirm these points.
- the hybrid plant of the present invention has two copies or more of the fertility restoring gene at two or more loci that are not in a completely linked relationship. It has higher pollen fertility than a heterozygous 1-locus fertility gene having only one copy of the fertility restoring gene (prior art hybrid plant). Furthermore, the cold resistance, that is, the seed fertility under low temperature conditions is also improved (Example 7). "Low-temperature conditions” means that, for example, cultivation is performed under light conditions of 20 ° C to 28 ° C and dark conditions of 15 ° C to 23 ° C until the ripening period after transplantation.
- Example 7 from the transplantation to the ripening period, when cultivated under light conditions (24 ° C.) for 12 hours and in dark conditions (19 ° C.) for 12 hours, the hybrid plant (FR Koshihikari X 16T1-35 F) contains only one copy of the fertility-restoring gene.
- the hybrid plant of the present invention includes all states of pollen, seed, and adult.
- the genus and species of the hybrid plant obtained are not particularly limited.
- the "fertility-restoring gene" of the present invention includes both gametoid and sporophyte types.
- gametophyte type the pollen genotype determines whether or not pollen fertility is restored, and the fertility restoration gene Rf-1 for rice BT-type male sterile cytoplasm and maize S-type male sterile cells Restoring genes for quality are known.
- sporophyte type the genotype of the pollen-producing plant determines whether or not pollen fertility is restored, and the fertility restoration gene for rice WA-type male sterile cytoplasm (Ahmed and Siddiq, 1998) and Genes for restoring fertility to maize T-type male sterile cytoplasm are known (Dhillon, 1998).
- the “gametotype fertility restoring gene” a known gene can be used depending on the type of the hybrid plant.
- the BT type male sterility restoration gene Rf-1 of rice is available.
- the present inventors have isolated and identified the Rf-1 gene and filed a patent application.
- the Rf-1 gene is described in detail herein.
- recovery genes for S-type male sterile cytoplasm are known and described in, for example, Wen, L. & Chase, CD (1999) Curr. Genet. 35, p. 521-526. Have been.
- the hybrid plant of the present invention contains two or more copies of the fertility restoring gene.
- the present invention utilizes the property that genes that are not completely linked are inherited completely or partially independently. Therefore, it is desirable that a plurality of fertility restoring genes exist at a distance of about lcM or more, more preferably about 5 cM or more, even on the same chromosome. Most preferably, they are present on different chromosomes. Therefore, the fertility restoring gene is not particularly limited! /, But is preferably at most the number of chromosome sets.
- the hybrid plant of the present invention has two copies or more of the fertility restoring gene at two or more loci that are not completely linked. It is desirable that each gene be present at a locus that is not completely linked. However, 3 copies or more If multiple genes are present at a locus that is linked in a linked relationship, but some of the genes are located at loci that are not completely linked, a single copy (heterologous ), Higher fertility than that of the hybrid plant of the present invention. For example, a wild or hybrid plant containing four copies of a gene, two of which are located in linked loci on the same chromosome, and the other two are on separate chromosomes. Is included.
- Example 4 of the present invention hybrid rice having the fertility restoring gene Rf-1 at a maximum of 4 loci was prepared, and a value extremely close to theoretical pollen fertility of 93.75% was observed. This indicates that pollen having a plurality of, for example, four, fertility restoring genes can normally develop. Therefore, although not limited, in the hybrid plant of the present invention, the copy number of the fertility restoring gene is preferably 2 to the number of chromosome sets of the host plant, preferably 2 to 4.
- one copy of two or more copies of the fertility restoring gene is derived from a plant of a fertility restoring line that naturally has the fertility restoring gene. May be.
- the rice Rf-1 locus is known to be present on chromosome 10 (Fukuta et al. 1992, Jpn J. Breed. 42 (supl. 1) 16 4 165).
- Such an endogenous fertility restoring gene can be used for producing the hybrid plant of the present invention.
- the present invention also provides a method for producing the hybrid plant of the present invention with improved fertility.
- the method of the present invention comprises introducing a fertility restoring gene by genetic engineering, and placing two copies or more of the fertility restoring gene at two or more loci that are not in perfect linkage. Including.
- a preferred method of the present invention is:
- a method for introducing a fertility restoring gene into a plant is not particularly limited, and a known method according to the type of plant can be used.
- any suitable expression system may be used.
- the recombinant expression vector is introduced into a plant that is operably linked to a suitable transcription or translation control nucleotide sequence, such as from a mammalian, microbial, viral, or insect gene.
- a nucleic acid containing a fertility restoring gene eg, rice Rf-1).
- control sequences include transcription promoters, operators, or enhancers, mRNA ribosome binding sites, and appropriate sequences that regulate transcription and translation initiation and termination.
- a nucleotide sequence is operably linked when the control sequence is operatively related to the DNA sequence.
- a promoter nucleotide sequence is operably linked to a DNA sequence if the promoter nucleotide sequence regulates the transcription of a DNA sequence.
- An origin of replication which confers the ability to replicate in plants, and a selection gene that identifies transformants are generally incorporated into expression vectors.
- the selection marker a commonly used marker can be used by a conventional method. Examples thereof include tetracycline, ampicillin, or an antibiotic resistance gene such as kanamycin or neomycin, hygromycin, or spectinomycin.
- a sequence encoding an appropriate signal peptide may be incorporated into an expression vector, if necessary.
- the DNA sequence of the signal peptide secretory leader
- the DNA sequence of the signal peptide may be fused in-frame to the nucleic acid sequence so that the DNA is first transcribed and the mRNA is translated into a fusion protein containing the signal peptide.
- Methods for incorporating a DNA fragment of a gene into a vector such as a plasmid include, for example, Sambrook, J., and Russell, DW (2001). Molecular Cloning: A Laboratory Manual, 3rd ed. (New York: Cold Spring Harbor Laboratory Press) And the like. Conveniently, commercially available ligatures Yon kit (for example, manufactured by Takara Shuzo) can also be used.
- the thus obtained recombinant vector (for example, a recombinant plasmid) is introduced into a plant which is a host cell.
- the vector can be conveniently prepared by ligating a desired gene to a thread-changing vector (for example, plasmid DNA or the like) available in the art by a conventional method.
- a thread-changing vector for example, plasmid DNA or the like
- a plant transformation vector is particularly useful.
- the plant vector is not particularly limited as long as it has the ability to express the gene in a plant cell and produce the protein, and examples thereof include pBI221 and pBI121 (all manufactured by Clontech), and Vectors derived from In particular, for transformation of monocotyledonous plants, pIG121Hm, pTOK233 (above, Hiei et al., Plant J., 6, 271-282 (1994)), pSB424 ( Komari et al., Plant J., 10, 165-174) (1996)).
- the transformed plant is prepared by constructing a plant transformation vector by replacing the nucleic acid fragment of the present invention with the above-described vector at the site of the ⁇ -darcopenase (GUS) gene, and introducing the vector into a plant. can do.
- the plant transformation vector preferably contains at least a promoter, a translation initiation codon, a desired gene (a nucleic acid sequence of a fertility restoring gene or a part thereof), a translation termination codon, and a terminator. It may also contain a DNA encoding a signal peptide, an enhancer sequence, 5 ′ and 3 ′ untranslated regions of a desired gene, a selection marker region, and the like as appropriate.
- the promoter and terminator are not particularly limited as long as they function in plant cells.
- Examples of the promoter for constitutive expression include actin and ubiquitin gene promoters in addition to the 35S promoter previously incorporated into the above vector. Is exemplified.
- Plant cells can be transformed, for example, by the leaf disk method [Science, 227, 129 (1985)] or the electroporation method [Nature, 319, 791 (1986)].
- a method for introducing a gene into a plant a method using Agrobacterium (Horsche t al., Science, 227, 129 (1985), Hiei et al., Plant J., 6, 271-282 (1994)), elect opening method (Fromm et al., Nature, 319, 791 (1) 986)), PEG method (Paszkowski et al., EMBO J., 3, 2717 (1984)), microphone mouth injection method (Crossway et al., Mol. Gen. Genet., 202, 179 (1986)), And the minute object collision method (McCabe et al., Bio / Technology, 6, 923 (1988)).
- the method is not particularly limited as long as it is a method for introducing a nucleic acid into a desired plant.
- a method for producing a recovery line of a plant (for example, rice) using agrobacterium is described in, for example, Hiei et al., Plant J., 6, p. 271-282. (1994), Komari et al., Plant J., 10, p. 165-174 (1996), Ditta et al., Proc. Natl. Acad. Sci. USA 77: p. 7347-7351 (1980), etc. This is described!
- a plasmid vector containing the desired inserted! / Nucleic acid fragment is prepared.
- the plasmid vector for example, pSBll, pSB22, and the like, whose plasmid maps are described in Komari et al., Plant J., 10, p. 165-174 (1996), and the like, can be used.
- those skilled in the art can construct an appropriate vector by themselves based on the plasmid vectors such as pSB11 and pSB22.
- an intermediate vector PSB200 having a hygromycin resistance gene cassette was created and used based on pSBll.
- a terminator of nopaline synthase was connected to a ubiquitin promoter and a ubiquitin intron (Pubi-ubil). It is composed of Pubi-ubiI-HYG (R) -Tnos by inserting the hygromycin metabolic gene (HYG (R;)) between ubil-Tnos of the obtained Pubi-ubil-Tnos conjugation. I got a connection. This connection was ligated to the HindlllZEcoRI fragment of pSBll ( Komari et al., Supra) to obtain pKY205.
- Escherichia coli for example, DH5a, JM109, MV1184, etc., all of which can be purchased from, for example, TAKARA
- Escherichia coli are transformed with the recombinant vector containing the inserted nucleic acid.
- the Agrobacterium strain is preferably used together with a helper E. coli strain, for example, according to the method of Ditta et al (1980) for triparental mating. I do.
- Agrobacterium can be used, for example, Agrobacterium tumefaciens strains LBA4404 / pSB1, LBA4404 / pNB1, LBA4404ZpSB3 and the like. All of them are described in Komari et al., Plant J., 10, pp. 165-174 (1996), and described above. Those skilled in the art can use the vector by constructing a vector by himself, for example. Although not limited, HB10lZpRK2013 (available from Clontech) and the like can be used as the helper E. coli. Also, less commonly there are reports that can be used as E. coli is also a helper E.coli carrying the P RK2073 (Lemas et al., Plasmi d 1992, 27, p. 161-163).
- a male sterile plant such as rice is transformed according to, for example, the method of Hiei et al (1994).
- the immature rice seeds required for the transformation can be produced, for example, by applying pollen of a Japonica variety to male sterile rice.
- the recovery of fertility of the transformed plant can be examined, for example, about one month after heading, by examining the fertility of the seeds.
- the piloerection survey is a method of observing cultivation in a field or the like.
- a fertility test may be conducted in a laboratory to determine the fertility of the ear.
- the production of a plant of a fertility restoration line having the homozygous fertility restoration gene at two or more loci is not limited. For example, it can be performed as follows.
- a transformant whose fertility has been restored by the above-described method is subjected to genomic Southern analysis by extracting DNA according to a standard method.
- the probe used at that time is prepared from a part of the introduced gene fragment. Based on the analysis results, select one copy-introduced individuals.
- individuals homozygous for the transgene are selected from each inbred offspring (hereinafter, referred to as A individuals and B individuals). Selection can be performed by the genomic southern analysis described above, or by using a PCR marker designed based on information on the nucleotide sequence around the locus where the gene has been introduced. Can also be performed.
- the hybrids F obtained by crossing the natural recovery line XA is a method of the hybrids F obtained by crossing the natural recovery line XA.
- the genotype of a fertility restoration gene derived from a natural restoration line can be estimated, for example, by the method described in WO 03/027290 A1. As described above, the genotype of the fertility restoring gene derived from the individual A can be estimated by genomic Southern analysis, or can be estimated by a PCR marker.
- the terminator of nopaline synthase (Nos in FIG. 9) is incorporated into both the rice Rf-1 gene.
- the Tnos sequence is contained in the closing vector pBI121 (accession number AF485783) registered in the public database (Genbank).
- the introduced site on the chromosome of the transgene was identified using Nos.
- a primer eg, NosF2 in FIG. 9 based on a known Nos nucleotide sequence was prepared and subjected to PCR.
- the above-described confirmation method can be used for any plant.
- the base sequence of the genome is disclosed in data banks such as Genbank, EMBL, and DDBJ.
- the plant of the present invention can be obtained by crossing the plant of the fertility restoring line and the plant of the sterile line created in step 1).
- plants having two copies or more of the fertility restoring gene at two or more loci that are not completely linked can be selected.
- the presence of two or more copies of the fertility restoring gene in the plant can be confirmed by, for example, the number and the Z or the concentration of the bands in the Southern analysis.
- the present invention includes a plant of a fertility restoration line that homozygously has a fertility restoration gene at two or more loci created in step 1).
- a fertility restored line plant can be used to obtain the hybrid plant of the present invention by crossing with a desired male sterile line at an actual breeding site.
- Rf—1 a rice germline gene that binds to a BT-type male cell in rice
- the present inventors isolated'identified a fertility restoring gene Rf-1 for rice BT-type male sterile cytoplasm (Reference Example).
- hybrid rice was prepared using the Rf-1 gene as a gametotype fertility restoring gene.
- a separate patent application has been filed for the Rf-1 gene. The details will be described below.
- Japanese Patent Application 2001-285247, Japanese Patent Application 2001-309135 and Japanese Patent Application 2002-185709, WO 03/027290 A1 Japanese Patent Application 2002-197560, PCT / JP03 / 03154
- the present inventors first identified the location of Rf-1 in a very narrow range on chromosome 10. Based on the results, we developed PCR markers located near the Rf-1 locus, and detected the Rf-1 gene by utilizing the ability of these PCR markers to link to the Rf-1 locus. Was found. Specifically, by utilizing the fact that the Rf-1 locus sits between the PCR marker locus S12564 Tsp509I locus and the C1361 Mwol locus on rice chromosome 10, a new PCR By investigating the genotype of the marker locus, the presence or absence of the Rf-1 gene and the selection of individuals homozygous for the Rf-1 gene will be conducted.
- the present inventors further specified a region of the Rf-1 locus including the Rf-1 gene as a method for improving Japanese Patent Application No. 2000-247204, and disclosed the method in Japanese Patent Application No. 2001-285247 (September 19, 2001). ), Japanese Patent Application 2001-309135 (October 4, 2001;) and Japanese Patent Application 2002-185709 (June 26, 2002).
- an international patent application (PCTZJ P02Z09429) was filed.
- the present inventors proceeded with further research, identified the Rf-1 gene, and filed a patent application on July 5, 2002 (Japanese Patent Application No. 2002-197560).
- an international patent application (PCTZJP03Z03154) has been filed and published internationally as WO 03/02 7290 A1. The entire contents of these applications are incorporated herein by reference.
- the present inventors revealed that the Rf-1 locus sits between the DNA marker locus S12564 Tsp 5091 and the C1361 Mwol locus. — Contains PCR markers. The present inventors have further found that the region between the DNA marker locus S12564 Tsp509I and the C1361 Mwol locus, based on the close linkage between the Rf-1 locus and the DNA marker locus S12564 Tsp509I, Analysis of the region linked to the Rf-1 gene Examined. As a result, the Rf-1 locus region including the Rf-1 gene was identified up to about 76 kb, and the entire nucleotide sequence of the region was successfully determined.
- the 65 kb sequence contained in the chromosome region It was shown to include sequences that determine the function of the Rf-1 gene. This area is covered by a container that also comprises eight genomic clones. Each clone is approximately 12-22 kb in length with at least 4.7 kb of overlap. On the other hand, the length of rice genes is known to be as short or as long as possible. Most genes are considered to be within several kb in length. Therefore, it is predicted that at least one of these eight genomic clones will contain the full-length Rf-1 gene.
- the present inventors further performed a complementation test to further narrow down the Rf-1 gene region in the 76 kb chromosome region and directly prove the existence of the ability to restore fertility.
- XSF 18 lacks the intermediate bases 33947-38591 at the 5 'and 3' ends (bases 20328 and 41921 of SEQ ID NO: 1, respectively) which are identical to XSF20. This was because the clone XSF18 was first isolated, but it was found that the above-mentioned deletion occurred in the course of growth after isolation.Thus, by repeating the growth again, the complete clone was isolated, and XSF20 was isolated. It depends on the name. In addition, since the overlapping portion between clones XSG8 and XSH18 is rather small (approximately 7 kb), XSX1 was a new clone that contained sufficient overlapping portions from both clones by restriction enzyme treatment and ligation.
- Rf-1 is a dominant gene
- the introduced fragment completely contains the Rf-1 gene
- fertility is restored in the transgenic plant generation.
- transformation and seed fertility of each fragment were examined, and a transformant into which a 15.6 kb fragment (containing bases 38538-54123 of SEQ ID NO: 1) derived from X phage clone XSG16 was introduced.
- a transformant into which a 15.6 kb fragment (containing bases 38538-54123 of SEQ ID NO: 1) derived from X phage clone XSG16 was introduced. was found to have restored seed fertility (Reference Example 4).
- all the transformants were sterile. From these results, the above 15.6 It was shown that the kb fragment completely contained the Rf-1 gene.
- a method for introducing the Rf-1 gene by genetic engineering was provided, and its effectiveness was demonstrated.
- the present inventors further studied and identified a nucleic acid having a fertility-restoring function, and also revealed the amino acid sequence encoded thereby. Specifically, as described in Reference Example 5-6 [First, the DNA fragments corresponding to the ligament U number 1 43733-44038 and 48306-50226 were prepared using PCR. Using these two types of fragments as probes (probes P and Q), a library prepared was screened from a cDNA prepared from a line in which Rf-1 was introduced into Koshihikari.
- the terminal nucleotide sequence of the six clones matched the sequence of XSG16, and was isolated as a clone containing the Rf-1 gene, and the nucleotide sequence was analyzed (SEQ ID NOs: 43 to 48).
- the sequence of the difference between! And SEQ ID NO: 43 to 48 also encodes a protein having the amino acid sequence 1791 of SEQ ID NO: 49. Specifically, bases 215 to 2587 of SEQ ID NO: 43, bases 213 to 2585 of SEQ ID NO: 44, bases 218 to 2590 of SEQ ID NO: 45, bases 208 to 2580 of SEQ ID NO: 46, bases of IJ No. 47 149 2521 and the base 225-2597 of the IJ number 48, each of which encodes the amino acid sequence 1791 of SEQ ID NO: 49.
- the above base sequence corresponds to bases 43907-46279 of SEQ ID NO: 1.
- the sequence of the cDNA isolated this time was compared with the genomic sequence of IR24 (SEQ ID NO: 1), and the structures of exons and introns of the Rf-1 gene were clarified (FIG. 7). As a result, it was shown that various transcripts having different splicing modes and polyA addition positions were mixed in the plant. There are no introns in the coding region of the Rf-1 gene.
- the present inventors further performed a complementation experiment on the 6.8 kb fragment whose seed fertility was restored in the complementation experiment of Reference Example 4 (3). Specifically, in Reference Example 7, a 4.2 kb fragment (base 42132-46318 of SEQ ID NO: 1) containing the promoter region and the predicted translation region of the Rf-1 gene in the 6.8 kb fragment was used. When a complementation experiment was performed, seed fertility was restored.
- any of SEQ ID NOS: 54 to 59 is presumed to encode a protein having the amino acid sequence 1791 of SEQ ID NO: 49.
- nucleotides 229 to 2601 of SEQ ID NO: 54, nucleotides 175 to 2547 of SEQ ID NO: 55, nucleotides 227 to 2599 of SEQ ID NO: 56, nucleotides 220 to 2592 of SEQ ID NO: 57, and nucleotide 174 of SEQ ID NO: 58 2546 and nucleotides 90-2462 of SEQ ID NO: 59 each encode the amino acid sequence 1-791 of SEQ ID NO: 49.
- the above base sequence corresponds to bases 43907-46279 of SEQ ID NO: 1.
- the nucleic acid containing the fertility restoring gene (Rf-1) locus is a nucleic acid having the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence at least 70% identical to the nucleotide sequence of SEQ ID NO: 1; Includes functional nucleic acids. Furthermore, as described in Reference Example 4, it was confirmed that, in the nucleotide sequence of SEQ ID NO: 1, in particular, bases 38538-54123 completely contained the Rf-1 gene.
- the region containing the Rf-1 gene is further preferably bases 38538 to 54123 of SEQ ID NO: 1, more preferably bases 42357 to 53743, still more preferably bases 42132 to 48883, and still more preferably bases 42132 to 46318. It was identified.
- the above nucleotide sequence corresponds to g) bases 43907-46279 of SEQ ID NO: 1, and each encodes the amino acid sequence 1791 of SEQ ID NO: 49.
- base sequence of SEQ ID NO: 1 refers to the entirety of SEQ ID NO: 1 or a part thereof, which is involved in the function of restoring fertility, particularly, base 3853.
- nucleic acid containing a fertility restoring gene (Rf-1)
- Rf-1 a nucleic acid was isolated from an IR24 genomic library of Indy rice containing the Rf-1 gene, and the salt of SEQ ID NO: 1 was isolated. The base sequence was determined.
- the origin of the nucleic acid containing the fertility restoring gene (Rf-1) is not particularly limited as long as the nucleic acid is derived from an indible cultivar having the Rf-1 gene.
- the indica type varieties having the Rf-1 gene are not particularly limited, and include, for example, IR24, IR8, IR36, IR64, Chinsurah, and BoroII.
- Examples of Japonica varieties without the Rf-1 gene include, but are not limited to, Asomi Nori, Koshihikari, Kirara 397, Akihikari, Akitakomachi, Sasa-Shiki, Kinuhikari, Nipponbare, Hatsusei, Koganeharu , Hinohikari, Mina Asahi, Aichi Kaori, Hatsimo, Akebono, Fujihikari, Mine snowy, Coconoemochi, Fukubiki, Dontokoi, 500 million stones, Hanaetizen, Todorokise, Haenuki, Domanaka, Yamahikari etc. ing.
- Both "Indy-powered varieties” and “Japonica-type varieties” are well known to those skilled in the art, and those skilled in the art can easily judge what kind of rice varieties can be an object of the present invention.
- the nucleic acids usable in the present invention include genomic DNA (including its corresponding cDNA), chemically synthesized DNA, DNA amplified by PCR, and combinations thereof.
- the nucleic acid containing the Rf-1 gene preferably has the nucleotide sequence of SEQ ID NO: 1.
- One or more codons may encode the same amino acid and is called the degeneracy of the genetic code. For this reason, the DNA sequence may not completely match SEQ ID NO: 1. It may encode a protein having the exact same amino acid sequence as SEQ ID NO: 1.
- Such variant DNA sequences may result from silent mutations (eg, which occur during PCR amplification). Or may be the product of intentional mutagenesis of a native sequence.
- the Rf-1 gene preferably encodes the amino acid sequence of SEQ ID NO: 49.
- one or more amino acid sequences may be deleted, added, or substituted to have an amino acid sequence.
- amino acid mutations is one or more, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5.
- the amino acid sequence encoded by the Rf-1 gene differs from the amino acid sequence of SEQ ID NO: 49 by at least about 70%, preferably about 80% or more, more preferably 90% or more, and still more preferably 95% or more. Most preferably, it has 98% or more identity.
- the percent identity of amino acids may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two protein sequences is based on the algorithm of Needleman, SB and Wunsch, CD (J. Mol. Biol., 48: 443-453, 1970), and is based on the University of Wisconsin Genetics Computer Group (UWGCG). The determination may be made by comparing sequence information using a more available GAP computer program. Preferred default parameters of the GAP program include: (l) scoring as described in Henikoff, S and Henikoff, JG (Proc. Natl. Acad. Sci. USA, 89: 10915—10919, 1992). Matrix, blosum62; (2) 12 gap weights; (3) gap length weights of 4; and (4) no penalty for terminal gaps.
- the percent identity can be determined by comparing to sequence information using the BLAST program, described, for example, in Altschul et al. (Nucl. Acids. Res. 25., p. 3389-3402, 1997). It is. The program is available on the Internet from the National Center for Biotechnology Information (NCBI) or the website of the DNA Data Bank of Japan (DDBJ). Various conditions (parameters) for homology search using the BLAST program are described in detail on this site, and a force search in which some settings can be appropriately changed is usually performed using default values.
- NCBI National Center for Biotechnology Information
- DDBJ DNA Data Bank of Japan
- the Rf-1 gene may include such homologues and variants of the nucleotide sequence of SEQ ID NO: 1 as long as they have a fertility recovery function. "Having a fertility recovery function” means imparting fertility to a rice individual or a seed when the DNA fragment is introduced. Fertility recovery may be due to the expression of protein from the Rf-1 gene, or the nucleic acid (DNA or RNA) of the Rf-1 gene itself may have some function to impart fertility. , You can.
- a homologue or mutant of the Rf-1 gene has the ability to restore fertility can be examined, for example, as follows.
- the immature seeds obtained by applying Koshihikari pollen to MS Koshihikari (sterile lineage) are tested, and according to the method of Hiei et al (Plant Journal (1994), 6 (2), p. 272-282).
- a test nucleic acid fragment is introduced.
- seeds will fertilize only when the test nucleic acid fragment has a fertility recovery function.
- the nucleic acid derived from the corresponding region of the Japonica type Asinominori without the Rf-1 gene has the base sequence shown in SEQ ID NO: 2.
- the corresponding portions of SEQ ID NO: 2 and SEQ ID NO: 1 have about 98% overall identity.
- the nucleic acid containing the fertility restoring gene (Rf-1) locus should be at least about 70%, preferably about 80% or more, more preferably 90% or more, even more preferably 95% or more, and most preferably SEQ ID NO: 1. Have 98% or more identity.
- SEQ ID NO: 1 is particularly preferably g) bases 43907-46279 of SEQ ID NO: 1, or correspondingly, a) bases 215-2587 of SEQ ID NO: 43, b) bases 213- of SEQ ID NO: 44 258 5, c) bases 218-2590 of SEQ ID NO: 45, d) bases 208-2580 of SEQ ID NO: 46, e) bases 149-2521 of SEQ ID NO: 47, f) bases 225-2597, h) sequence of SEQ ID NO: 48 No.
- the percent identity of a nucleic acid may be determined by visual inspection and mathematical calculation.
- sequence information may be determined by comparing sequence information using.
- GAP program preference V default parameters include: (1) a single comparison matrix for nucleotides (including values of 1 for identical and 0 for non-identical), and supervision of Schwartz and Dayhoff, Atlas Calo-weight comparison matrices from Gribskov and Burgess, Nucl. Acids Res. 14: 6745 (1986), as described in the Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap; and (3) no penalty for terminal gaps.
- Other programs for sequence comparison used by those skilled in the art may also be used.
- a preferable nucleic acid of the present invention is a nucleic acid capable of hybridizing to the nucleotide sequence of SEQ ID NO: 1 under moderately stringent conditions and having a function of restoring fertility. It includes a nucleic acid capable of hybridizing to the nucleotide sequence of No. 1 under highly stringent conditions and having a function of restoring fertility.
- moderately stringent conditions can be readily determined by one of ordinary skill in the art, for example, based on the length of the DNA. . Basic conditions are shown in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Vol. 1, pp. 1. 101-104, Cold Spring Harbor Laboratory Press, (1989). For example, for a nitrocellulose filter, 5X SSC, 0.5% SDS, 1. Pre-wash solution of OmM EDTA (pH 8.0), about 40.
- hybridization solution such as Stark's solution
- 1X SSC to 6XSSC or about 50% formamide at about 42 ° C at 60 ° C
- washing conditions of about 60 ° C, 0.5X SSC, 0.1% SDS.
- the hybridization temperature is lowered by about 15 ° C. to 20 ° C.
- Very stringent conditions can also be readily determined by those skilled in the art, for example, based on the length of the DNA. In general, very stringent conditions include hybridization at higher temperatures and Z or lower salt concentrations, and Z or washing conditions, than the moderately stringent conditions, for example, about 60%.
- temperature and wash solution salt concentration may be adjusted as necessary according to factors such as the length of the probe.
- SEQ ID NO: 1 is particularly preferably g) bases 43907 to 46279 of SEQ ID NO: 1 or corresponding thereto, a) bases 215 to 2587 of SEQ ID NO: 43, b) bases of SEQ ID NO: 44 213-2585, c) bases 218-2590 of SEQ ID NO: 45, d) bases 208-2580 of SEQ ID NO: 46, e) bases 149-2521 of SEQ ID NO: 47, f) bases 225-2597 of SEQ ID NO: 48, h) SEQ ID NO: 54 bases 229—2601, i) SEQ ID NO: 55 bases 175—2547, j) SEQ ID NO: 56 bases 227—2599, k) SEQ ID NO: 57 bases 220—2592, 1) SEQ ID NO: 58 bases 174—2546 or m) bases 90—2462 of SEQ ID NO: 59!
- nucleic acids of the present invention include nucleic acids that differ from the base sequence of SEQ ID NO: 1 but have a fertility-restoring function due to deletion, insertion, or substitution of one or more bases.
- the number of bases to be deleted, inserted or substituted is not particularly limited as long as it has a fertility-recovering function, but is preferably 1 to several thousand, more preferably 1 to 1,000, and more preferably 1 to 1,000. No more than 500, even more preferably 1 to 200, most preferably 1 to 100.
- the Rf-1 gene is more specifically specified, and those skilled in the art can use the gene by removing nucleic acids such as a portion other than the Rf-1 gene or an intron portion in the Rf-1 gene. It is possible.
- a predetermined amino acid (particularly, the amino acid sequence of SEQ ID NO: 49) may be substituted with, for example, a residue having the same physical properties. Examples of such conservative substitutions are those that replace one aliphatic residue with another, for example, Ile, Val, Leu, or Ala; Lys and Arg, Glu and Asp, or between Gin and Asn.
- Other conservative substitutions, for example, substitutions of entire regions having similar hydrophobic properties, are well known.
- One skilled in the art would be able to make the desired deletions, insertions or substitutions by well-known genetic engineering techniques, eg, using site-directed mutagenesis as described in Sambrook et al. (2001) (supra). Is possible is there.
- the present inventors have registered the indy-force type IR24 (base sequence 27) having the Rf-1 gene, the V-type, Japonica-type Asominori (base sequence 28) and GenBank! Haru Nihon Haru BAC clone (accession number AC068923) was compared. As a result, they found that the indigenous Rf-1 region containing the Rf-1 gene had at least the following single nucleotide polymorphism (SNP).
- SNP single nucleotide polymorphism
- the nucleic acid containing the Rf-1 region of the present invention preferably satisfies one or all of the above conditions 1) and 8).
- the coding region is completely identical between Japonica's indian forces, only the promoter region differs, and only a portion of the promoter region and coding region are described above from the P4497 Mbol locus to the B56691 Xbal locus. Region (approximately 65 kb). Therefore, it cannot be determined that the above-mentioned shared indy-force type region (bases 1239 to 66267 of SEQ ID NO: 1) completely covers the entire Rf-1 gene. . The following reasons,
- Gene size is usually a few kb and rarely exceeds 10 kb;
- the 3 'end of SEQ ID NO: 1 is located 10096 bp downstream from the 3' end of the shared indy force region
- At least SEQ ID NO: 1 is considered to completely encompass the entire Rf-1 gene.
- the present inventors confirmed that the Rf-1 gene was completely contained in the nucleotide sequence of SEQ ID NO: 1, particularly at bases 38538-54123, by conducting a complementation test. Therefore, in one embodiment of the present invention, a nucleotide sequence at least 70% identical to the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of bases 3853 to 54123 of SEQ ID NO: 1 Meet at least one:
- the present inventors further specified the following regions as nucleic acids containing the Rf-1 gene.
- nucleic acids of the invention further include
- n) a nucleic acid that is at least 70% identical to any of the nucleic acids of a) to m) above and has a fertility-recovery function
- nucleic acid that hybridizes with any of the nucleic acids a) to m) above under moderate or high stringency conditions and has a fertility-recovering function
- the base 45461 of SEQ ID NO: 1 is: 1) base 1769 of SEQ ID NO: 43; 2) base 1767 of SEQ ID NO: 44; 3) base 1772 of SEQ ID NO: 45; 4) base 1762 of SEQ ID NO: 46; ) Base 1703 of SEQ ID NO: 47; 6) base 1779 of SEQ ID NO: 48; 7) base 1783 of SEQ ID NO: 54; 8) base 1729 of SEQ ID NO: 55; 9) base 1781 of SEQ ID NO: 56; 11) base 1728 of SEQ ID NO: 58 and 12) base 1644 of SEQ ID NO: 59.
- the nucleic acid used in the method of the invention preferably satisfies at least one of the following conditions 1) -12):
- FIG. 1 shows the results of chromosome walking starting from the RFLP marker locus S12564.
- FIG. 2 shows the positional relationship between BAC clone AC068923 and lambda clone container.
- Fig. 3 shows the chromosome composition near the Rf-1 locus of the recombinant pollen near the Rf-1 locus (there is also fertility) and the 10 individuals (RS1, RS2, RC1) generated from the pollen. — The results are based on the genotype of the marker locus in 8). The white part indicates the Japonica type area, and the black part indicates the Indy force type area.
- Fig. 4 shows the location of the Rf-1 locus on the linkage map based on the results of linkage analysis between the marker locus on chromosome 10 and the Rf-1 locus. The map distance was calculated from the separation data of 1042F1 individuals.
- FIG. 5 shows fragments derived from 10 genomic clones used for identification of the Rf-1 region by a complementation test.
- a complementation test was performed on a chromosome region indicated by a thick straight line. Since XSF18 was a clone containing the deletion, the deletion was indicated by a dotted line.
- FIG. 6 shows a complementation test using a 15.7 kb fragment derived from XSG16 (Reference Example 4) and a 16.2 kb fragment derived from XSF18 (including bases 21065 to 33946 and 38592-41921 of base number 1). The results of the experiment are shown. At 15.7 kb from XSG16, fertility is restored and rice ears are dripping.
- FIG. 7 shows a schematic diagram of the Rf-1 gene structure.
- White bars and black lines indicate exons and introns, respectively. For the exon part, the number of base pairs is indicated.
- FIG. 8 shows a schematic diagram of the positional relationship between the Rf-1 gene estimated from the IR24 genomic fragment subjected to the complementation test, the probe used for cDNA library screening, and the isolated cDNA.
- the white bars and black lines in the Rf-1 gene indicate exons and introns, respectively. For exon moieties, the number of base pairs is indicated.
- FIG. 9 is a schematic diagram showing positions of primers used for confirming an introduced Rf-1 site.
- Tnos terminator of nopaline synthase
- HPT noodystromycin resistance gene
- BR right border
- BL left border.
- FIG. 10 is a schematic diagram showing an example of a method for producing a hybrid plant according to the present invention and a conventional technique.
- the following Reference Example describes the isolation and identification of the rice BT type male sterility restoring gene Rf-1 and confirmation of fertility restoring activity.
- a homozygous individual with a genotype of S12564 Tsp509I locus is regarded as an individual produced by recombination between the Rf-1 locus and the S12564 Tsp509I locus, and a genotype of the C1361 Mwol locus with homozygous Koshihikari type Bodies were considered as individuals produced by recombination between the 1 ⁇ -1 and 1361 Mwol loci.
- a genomic library was prepared from the Lambda DASH II vector as described in JP-A-2002-345485 (or WO02 / 14506), Tested for walking.
- PCR was performed according to a standard method, using Asinomori total DNA as a template.
- the obtained amplification product of about 1200 bp was subjected to electrophoresis on agarose gel, and then purified using QIAEXIKQIA GEN.
- the purified DNA was labeled using a rediprime DNA labeling system (Amersham Pharmacia) to obtain a library screening probe (probe A, FIG. 1).
- an IR24 genomic library similarly prepared from the genomic DNA of the indian cultivar IR24 (Rf-1 stock) was subjected to chromosome walking.
- PCR was performed according to a standard method.
- the obtained 524 bp amplification product was purified'labeled by the method described above and used as a library screening probe (probe E, FIG. 1).
- Asominori genomic library screening yielded 15 clones, and analysis of the terminal nucleotide sequence and restriction fragment length analysis indicated that one of them (WSE8) had the positional relationship shown in Figure 1. Was done. By walking with the primers, the genome sequence of Asinominori corresponding to WSE8 was determined.
- XSE1 and XSE7 Seven clones were obtained by IR24 genomic library screening. Based on the results of the terminal nucleotide sequence analysis and restriction enzyme fragment length analysis, two of them (XSE1 and XSE7) showed the positional relationship shown in Fig. 1. It was shown to be. The IR24 genomic base sequence corresponding to XSE1 and XSE7 was determined by primer walking.
- the Asominori genomic library and IR24 genomic library described above were tested for chromosome walking.
- PCR was performed according to a standard method.
- the obtained 1159 bp amplification product was purified'labeled by the method described above and used as a probe for library screening (probe F, FIG. 1).
- XSF4 and XSF20 were obtained by IR24 genomic library screening. Based on the results of terminal nucleotide sequence analysis and restriction enzyme fragment length analysis, two of them (XSF4 and XSF20) showed the positional relationship shown in Fig. 1. It was shown to be. The IR24 genomic base sequence corresponding to XSF4 and XSF20 was determined by primer walking.
- the Asominori genomic library and IR24 genomic library described above were tested for chromosome walking.
- PCR was performed according to a standard method.
- the obtained 456 bp amplification product is purified and labeled by the method described above, and library screening is performed.
- Probe probe G, Fig. 1).
- IR24 genomic library screening 14 clones were obtained. From the results of the analysis of the terminal nucleotide sequence and restriction fragment length analysis, 3 clones (XSG8, XSG16 and XSG22) were located at the positions shown in Fig. 1. It was shown to be in a relationship. The IR24 genomic nucleotide sequence corresponding to XSG8, XSG16 and XSG22 was determined by primer walking.
- the aforementioned IR24 genomic library was subjected to chromosome walking.
- the present inventors browsed the public website of TIGR (The Institute for Genomic Research) and found that a BAC (Bacterial Artificia 1 Chromosome) clone (accession number AC068923) containing the RFLP marker S12564 was available in the public database. (GenBank). This BAC clone contains the genomic DNA of the japonica variety Haru Nihon. Based on a comparison of the nucleotide sequences, the BAC clone completely encompasses the Asominori prepared in (1)-(4) and the container region of IR24. (Fig. 2).
- PCR was performed using the IR24 total DNA as a template according to a standard method.
- the obtained amplification product of about 600 bp was purified'labeled by the method described above and used as a library screening probe (probe H, FIG. 1).
- IR24 genomic library screening yielded 15 clones. The results of the terminal nucleotide sequence analysis and restriction fragment length analysis indicated that one of them (XSH18) had the positional relationship shown in Figure 1. .
- the IR24 genomic nucleotide sequence corresponding to XSH18 was determined by primer walking.
- genomic nucleotide sequence SEQ ID NO: 1 corresponding to the IR24 container identified in Reference Example 2
- genomic nucleotide sequence SEQ ID NO: 2 corresponding to the Asominori container
- the amplification product from IR24 DNA has no Mbol recognition sequence (GATC) and is not cleaved by MboI treatment
- the amplification product from Asominori DNA has the Mbol recognition sequence and is cleaved by Mbol treatment. Therefore, the DNA strand length after Mbol treatment is different, and can be detected as a difference in mobility in agarose gel.
- the amplification product from IR24 DNA has no Bsll recognition sequence (CCNNNNNNNGG) and is not cleaved by Bsll treatment, whereas the amplification product from Asominori DNA has the Bsll recognition sequence and Bsll treatment.
- the DNA strand length after Bsll treatment differs, and this can be detected as a difference in mobility in an agarose gel.
- genomic nucleotide sequence SEQ ID NO: 1 corresponding to the IR24 container identified in Reference Example 2
- genomic nucleotide sequence SEQ ID NO: 2 corresponding to the Asominori container
- the amplification product can be visualized by electrophoresis on an agarose gel. That is, the amplification product from IR24 DNA has an Mbol recognition sequence (GATC) and is cleaved by Mbol processing, whereas the amplification product from Asominori DNA has no Mbol recognition sequence, and Since it is not cleaved by the treatment, the DNA strand length after the Mbol treatment is different, and can be detected as a difference in mobility in the agarose gel.
- GTC Mbol recognition sequence
- genomic nucleotide sequence SEQ ID NO: 1 corresponding to the IR24 container identified in Reference Example 2
- genomic nucleotide sequence SEQ ID NO: 2 corresponding to the Asominori container
- genomic nucleotide sequence SEQ ID NO: 1 corresponding to the IR24 container identified in Reference Example 2
- genomic nucleotide sequence SEQ ID NO: 2 corresponding to the Asominori container
- the amplified product from IR24 DNA has two BstUI recognition sequences (CGCG) and is cut into three fragments by BstUI treatment, whereas the amplified product from Asominori DNA is the BstUI recognition sequence. Has three locations and is cut into four fragments by the BstUI treatment, so that the DNA chain length after the BstUI treatment is different, which can be detected as a difference in mobility in an agarose gel.
- the amplification product from IR24 DNA does not have the Mspl recognition sequence (CCGG) and is not cleaved by Mspl treatment, whereas the amplification product from Nipponbare DNA has the Mspl recognition sequence and is cleaved by Mspl treatment.
- the DNA strand length after the Mspl treatment is different, and can be detected as a difference in mobility in an agarose gel.
- the dCAPS method was applied to the development of this marker. Specifically, by using the B60304 Mspi R primer, 56463 g of SEQ ID NO: 1 is replaced with t. As a result, the Mspl recognition sequence CCGG of 56460 to 56463 in SEQ ID NO: 1 becomes ccgt and is not cleaved by Mspl. Therefore, the fragment derived from IR24 has no Mspl recognition sequence. On the other hand, DNA derived from Nipponbare has one Mspl recognition sequence in the region corresponding to 56367-56370 of SEQ ID NO: 1.
- the base of 8923 was found to be C.
- the amplification product After the amplification product is treated with BstZ17I, it can be visualized by electrophoresis on an agarose gel. That is, the amplification product from IR24 DNA is the BstZ17I recognition sequence (GTAT (AC), and the DNA is cleaved by Xbal treatment, whereas the amplified product from Nipponbare DNA does not have the recognition sequence of BstZl71 and is not cleaved by BstZ17I treatment, so the DNA strand length after BstZ17I treatment is different. It can be detected as a difference in mobility in agarose gel.
- GTAT AC
- PCR markers (10) to (12) are all related to the study on the nucleotide sequence corresponding to the further downstream (3 ′ end) than the 3 ′ end 76363 of SEQ ID NO: 1.
- PCR amplification around the site is carried out using, and the amplified product can be visualized by Msel treatment and then electrophoresed on agarose gel. That is, the amplification product from MS-FR Koshihikari (Rf-1 Rf-1) DNA has an Msel recognition sequence (TTAA) and is cleaved by Msel processing, whereas the amplification product from Koshihikari DNA is Msel It has no recognition sequence and is not cleaved by Msel treatment. It can be detected as a difference in mobility in the loin gel.
- gagataggggacgacagacacgac— 3 (Rooster series No. 36)
- PCR was carried out using MS-FR Koshihikari (Rf-1 Rf-1) and total DNA of Koshihikari as a template according to a standard method.
- the obtained amplification product of about 1200 bp was subjected to electrophoresis on agarose gel and then purified using QIAEXII (QIAGEN).
- QIAEXII QIAGEN
- the nucleotide sequence of the purified DNA was analyzed using a DNA sequencer 377 (ABI), and as a result, polymorphisms were found in several places.
- PCR amplification around the site is carried out using Mwol, the amplified product is treated with Mwol, and then electrophoresed on agarose gel to visualize the product. That is, the amplification product from MS-FR Koshihikari (Rf-1 Rf-1) DNA does not have the Mwol recognition sequence (GCNNNNNNNGC) and is not cleaved by Mwol treatment, whereas the amplification product from Koshihikari DNA is Mwol Since it has a recognition sequence and is cleaved by Mwol treatment, the DNA chain length after Mwol treatment is different, and can be detected as a difference in mobility in agarose gel.
- PCR was carried out using MS-FR Koshihikari (Rf-1 Rf-1) and total DNA of Koshihikari as a template according to a standard method.
- the obtained amplification product of about 1300 bp was subjected to electrophoresis on agarose gel and then purified using QIAEXII (QIAGEN).
- QIAEXII QIAGEN
- the nucleotide sequence of the purified DNA was analyzed using a DNA sequencer 377 (ABI), and as a result, polymorphisms were found in several places.
- PCR amplification is performed around the relevant site using, and the amplified product is visualized by Bfal treatment and then electrophoresed on agarose gel. That is, the amplification product from MS-FR Koshihikari (Rf-1 Rf-1) DNA does not have a Bfal recognition sequence (CTAG) and is not cleaved by Bfal treatment, whereas the amplification product from Koshihikari DNA is Bfal Since the DNA has a recognition sequence of Bfal and is cleaved by Bfal treatment, the DNA strand length after Bfal treatment is different, and can be detected as a difference in mobility in agarose gel.
- CTAG Bfal recognition sequence
- Table 1 shows that all individuals have an Rf-1 chromosomal region derived from an Indian cultivar between P9493 Bsll and 59066 BsaJI. From these results, it was shown that the recombinant pollen having the chromosomal composition shown in Fig. 3 has the ability to fertilize pollen, that is, the Rf-1 gene functions. . This indicates that the presence of the Rf-1 gene in the indy-force region shared by these recombinant pollens, that is, the region from the P4497 Mbol locus to the B56691 Xbal locus (approximately 65 kb) at the maximum. It means that the sequence to be determined is included.
- Participant example 4 Complementation test on 15.7 kb fragment from XSG16
- the ⁇ phage clone XSG16 (FIGS. 1 and 5) was partially digested with Notl and electrophoresed on an agarose gel.
- the separated 15.7 kb fragment (containing bases 38538-54123 of SEQ ID NO: 1) was purified using QIAEXII (QIAGEN).
- an intermediate vector PSB200 having a hygromycin-based gene cassette was constructed based on pSBll ( Komari et al., Supra). Specifically, first, a nopaline synthase terminator (Tnos) was connected to a ubiquitin promoter and a ubiquitin intron (Pubi-ubil). By inserting a hygromycin regulatory gene (HYG (R)) between the ubil-Tnos of the Pubi-ubil-Tnos connection obtained from this, a connection consisting of Pubi-ubil-HYG (R) -Tnos was obtained. Obtained.
- pSBll Komari et al., Supra.
- E. coli selected as described above was tested together with the Agrobacterium tumefaciens strain LBA4404Z pSBl ( Komari et al, 1996) and the helper E. coli HBlOlZ pRK2013 (D itta et al, 1980) according to the method of Ditta et al (1980). Tribacterial mating was performed. Plasmids were isolated from six of the colonies that grew on the AB plate containing spectinomycin, and the desired agrobacterium was selected by examining the restriction fragment length pattern.
- MS Koshihikari which has BT cytoplasm and the nuclear gene is almost the same as Koshihikari
- the transformation of MS Koshihikari was carried out using the Agrobacterium terimum selected above according to the method of Hiei et al (1994). went.
- the immature seeds of MS Koshihikari required for the transformation were prepared by applying the pollen of Koshihikari to MS Koshihikari.
- the ⁇ phage clone XSG16 was completely digested with AlwNI and BsiWI, and the DNA was recovered by ethanol precipitation.
- the recovered DNA was dissolved in a TE solution, and then smoothed with a DNA Blunting Kit (TAKARA).
- the reaction solution was subjected to electrophoresis using agarose gel, and the separated 11.4 kb fragment was purified using QIAEXI QIAGEN.
- the plasmid vector pSBll ( Komari et al. Plant Journal, 1996) was completely digested with Smal, and the DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in a TE solution and dephosphorylated using CIAP (TAKARA). After the reaction solution was subjected to electrophoresis using agarose gel, the gel fragment vector fragment was purified using QIAEXII (QIAGEN).
- DNA Ligation Kit Ver. 1 DNA Ligation Kit Ver. 1
- DNA was recovered by ethanol precipitation.
- the recovered DNA was dissolved in pure water (prepared with a device manufactured by Millipore), mixed with Escherichia coli DH5a, and subjected to election port poration.
- the solution after electoration was shake-cultured in an LB medium (37 ° C, 1 hour), spread on an LB plate containing spectinomycin, and heated (37 ° C, 16 hours). Plasmids were isolated from 14 of the resulting colonies, and the desired Escherichia coli was selected by examining the restriction enzyme fragment length pattern and the boundary nucleotide sequence.
- the Escherichia coli selected as described above was transformed into Agrobacterium tumefaciens strain LBA4404Z pSB4U (Takakura et al., Japanese Patent Application No. 2001-269982 (WO02Z019803 A1)) and a helper.
- a test was conducted with Escherichia coli HB101Z pRK2013 (Ditta et al, 1980), and triplicate mating was performed according to the method of Ditta et al (l 980). Plasmids were isolated from 12 colonies formed on AB plates containing spectinomycin, and the desired agrobacterium was selected by investigating the restriction enzyme fragment length pattern.
- the transformed plants were transferred to a greenhouse under long-day conditions. After cultivation until a suitable transplantation period, 120 plants were transplanted into 1Z5000 arel Wagner pots (4 individual Z pots) and transferred to a greenhouse under short-day conditions about one month after transplantation. Approximately one month after heading, one standard ear was sampled from each individual, and the seed fertility (the ratio of fertile seed to the total number of firs) was examined.
- the introduced 11.4 kb fragment contains the Rf-1 gene region essential for expression of the fertility-restoring function. It was considered.
- the ⁇ phage clone XSG16 was completely digested with Hpal and AlwNI, and electrophoresed on an agarose gel. The separated 6.8 kb fragment was purified using QIAEXII (QIAGEN). The subsequent steps, including the preparation of the plasmid vector pSB11, were in accordance with the method described in (2) above.
- a line IL216 in which Rf-1 was introduced into Koshihikari by backcrossing (genotype: Rf-1 ZRf-1) was prepared.
- the IL216 was cultivated in a greenhouse by a conventional method, and young panicles were sampled at a growth stage of a length between leaves and ears—5-5 cm.
- Total RNA by SDS-phenol method (Watanabe, A. and Price, CA (1982) Translation of mRNAs for subunits of chlor oplast coupling factor 1 in spinach. Proceedings of the National Academy of Sciences of the USA, 79, 6304-6308) After extraction, QuickPrep mRNA Purification Kit (Amersham Pharmacia).
- Biotech was used to purify poly (A) + RNA.
- SEQ ID NOs: 50 and 51 correspond to bases 43733-43756 and 44038-44015 of SEQ ID NO: 1, respectively.
- an amplification product of about 300 bp was recovered from the agarose gel using the QIAEX II Gel Extraction Kit (QIA GEN). Rediprime II DNA 32 P—Labenolle was performed using a labeling system (Amersham Pharmacia Biotech) (hereinafter, referred to as “probe P”).
- PCR was carried out using IR24 genomic clone XSG16 as a template.
- SEQ ID NOs: 52 and 53 correspond to bases 48306-48329 and 50226-50203 of SEQ ID NO: 1, respectively.
- an amplification product of about 1900 bp was recovered from the agarose gel by the method described above.
- the recovered fragment was 32 P-labeled by the method described above (hereinafter, referred to as “probe Q”).
- Hybridization was performed using 250 mM Na HPO, ImM EDTA and 7% SDS.
- a probe was added to a hybridization solution containing the mixture, and the reaction was carried out at 65 ° C. for 16 hours. Washing is performed twice at 65 ° C for 15 minutes with a solution containing 1X SSC and 0.1% SDS, and then at 65 ° C for 15 minutes with a solution containing 0.1X SSC and 0.1% SDS. Went twice.
- the washed membrane was analyzed using FUJIX BAS 1000 (Fuji Photo Films).
- bases 215 to 2587 of SEQ ID NO: 43, bases 213 to 2585 of SEQ ID NO: 44, bases 218 to 2590 of SEQ ID NO: 45, bases 208 to 2580 of SEQ ID NO: 46, and base 149 of SEQ ID NO: 47 2521 and bases 225-2597 of SEQ ID NO: 48 each encode the amino acid sequence 1-791 of SEQ ID NO: 49.
- the above base sequence corresponds to bases 43907-46279 of SEQ ID NO: 1.
- the recovered DNA was dissolved in pure water (prepared with a device manufactured by Millipore), mixed with Escherichia coli DH5a, and subjected to election portation.
- the solution after electoration was shake-cultured in an LB medium (37 ° C, 1 hour), spread on an LB plate containing ampicillin, and heated (37 ° C, 16 hours). Plasmids were isolated from 12 of the resulting colonies, and the desired Escherichia coli was selected by examining the restriction fragment length pattern and the boundary nucleotide sequence.
- the plasmid isolated from the selected Escherichia coli was treated with BamHI and Sail, and electrophoresed on an agarose gel. A 4.2 kb fragment containing the Rf-1 promoter region and the predicted translation region was separated, and QIAEXII (QIAGEN) was used to recover from the gel.
- TnosJH0072 an intermediate vector having a nos terminator and an ampicillin resistance gene cassette
- BamHI and Sail electrophoresed on an agarose gel.
- the Okb fragment containing the nos terminator and the ampicillin resistance gene cassette was separated and recovered from the gel using QIAEXII (QIAGEN).
- the 4.2 kb fragment containing the Rf-1 promoter region and the predicted translation region and the fragment derived from TnosJHO072 were subjected to a ligation reaction and a poration by the methods described above. After spreading on an LB plate containing ampicillin and heating (37 ° C, 16 hours), plasmids were isolated from 12 of the resulting colonies, and the restriction fragment length pattern and border nucleotide sequence were examined. The desired E. coli was selected.
- the plasmid isolated from Escherichia coli selected as described above is treated with Sgfl, and then subjected to electrophoresis on an agarose gel, to include the promoter region of Rf-1 and the predicted translation region.4.
- the 2 kb fragment was separated and recovered from the gel using QIAEXII (QIAGEN).
- QIAEXII QIAGEN
- This 4.2 kb fragment was used as a sample together with pSB200Pac (an intermediate vector having a nodiglomycin resistance gene cassette) treated with Pacl and then treated with CIAP (TAKARA), and subjected to ligation reaction and poration by the above-mentioned method.
- This Escherichia coli was used together with Agrobacterium tumefaciens strain LB4404Zp SBl ( Komari et al, 1996) and helper Escherichia coli HBlOlZ pRK2013 (Ditta et al, 1980), and triparen tial mating was performed according to the method of Ditta et al (1980). Plasmids were isolated from six of the colonies formed on the AB plate containing spectinomycin, and the desired aglobataterium was selected by investigating the restriction enzyme fragment length pattern.
- Antisense primer 5 cactaaaccgttagacgagaaagc—3, (Rooster column number 61)
- SEQ ID NOs: 60 and 61 correspond to bases 45522-45545 and 45955-45932 of SEQ ID NO: 1, respectively.
- an amplification product of about 430 bp was recovered from the agarose gel using QIAEX II (QIAGEN).
- the recovered fragment was "2 P- labeled with Rediprime II DNA labelling system (Ame rsham Pharmacia Biotech) ( Probe R, FIG. 8).
- SEQ ID NOS: 54 to 85 is predicted to encode a protein having the amino acid sequence 1791 of SEQ ID NO: 49.
- nucleotides 229 to 2601 of SEQ ID NO: 54, nucleotides 175 to 2547 of SEQ ID NO: 55, nucleotides 227 to 2599 of SEQ ID NO: 56, nucleotides 220 to 2592 of SEQ ID NO: 57, and nucleotide 174 of SEQ ID NO: 58 2546 and nucleotides 90-2462 of SEQ ID NO: 59 each encode the amino acid sequence 1-791 of SEQ ID NO: 49.
- the above base sequence corresponds to bases 43907-46279 of SEQ ID NO: 1.
- Total DNA was extracted by the phenol method (Komari et al., 1989). Total DNA was digested with Sacl, subjected to agarose electrophoresis, transferred to Hybond-N + (Amersham Pharmacia Biotech) according to the manufacturer's instructions, and subjected to Southern analysis.
- a probe for Southern analysis was prepared as follows. First, two types of primers
- PCR was performed using the above-mentioned genomic clone XSG16 as a template. After electrophoresis, an amplification product of about 980 bp was recovered from the agarose gel using the QIAEX II Gel Extraction Kit (QIAGEN). The collected fragment was subjected to P-fuvenore using Rediprime II DNA labeling system (Amersham Pharmacia Biotech).
- Hybridization was performed using 250 mM Na HPO, ImM EDTA and 7% SDS.
- a probe was added to the hybridization solution containing the mixture, and the mixture was heated at 65 ° C. for 16 hours. Washing was performed twice at 65 ° C for 15 minutes with a solution containing 1X SSC and 0.1% SDS, and then at 65 ° C for 15 minutes with a solution containing 0.1X SSC and 0.1% SDS. Went twice.
- the membrane after washing was analyzed with FUJIX BAS 1000 (Fuji Photo Films). Other experimental procedures were performed with reference to the experimental manual (Sambrook et al., 2001, supra).
- Example 1 Four out of the six individuals (16T06, 16T0-26, 16T0-34, 16T0-35) among the six individuals shown to be single copy-introduced individuals in Example 1 were cultivated by six individuals, Total DNA was extracted by the method described in Example 1, and subjected to EcoRV digestion Southern analysis.
- the PCR conditions were as follows: After treating at 94 ° C for 2 minutes, heat denaturation at 94 ° C for 1 minute, annealing at 58 ° C for 1 minute, and elongation reaction power at 72 ° C for 2 minutes were repeated 30 times. Finally, treatment was performed at 72 ° C for 2 minutes.
- the PCR conditions were the same as in the first round.
- the second PCR reaction solution was subjected to agarose gel electrophoresis, and the amplified fragment was recovered from the agarose gel using the QIAEX II Gel Extraction Kit (QIAGE N), and the nucleotide sequence was analyzed.
- the second PCR reaction was subjected to agarose gel electrophoresis, and a fragment of about 500 bp was recovered.
- the terminal nucleotide sequence of the recovered fragment was determined, and a BLAST search (Altschul et al., 1990) was performed on the public database of Genbank. As a result, it was found that the sequence matched the complementary strand sequence of the genomic clone of Nipponbare No. 6 chromosome (accession number # 004007).
- PCR was performed using Koshihikari and the total DNA of 16T1-6 (transgene homozygous individual) described in Example 2 as templates.
- the PCR conditions were as follows: After treating at 94 ° C for 2 minutes, heat denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and extension reaction at 72 ° C for 30 seconds were repeated 35 times And finally treated at 72 ° C for 2 minutes.
- the PCR reaction mixture was subjected to agarose gel electrophoresis, it was shown that a fragment of the expected size (210 bp) was amplified from Koshihikari DNA.
- 16T1-6 the product was not amplified as expected.
- Example 1 After 16T0-26 DNA used in Example 1 was completely digested with Pstl, the introduced site was amplified by the method described in (1) above, and the nucleotide sequence was analyzed. However, GC Buffer (I) attached to TaKaRa LA Taq (TAKARA) was used as a buffer for PCR.
- GC Buffer (I) attached to TaKaRa LA Taq (TAKARA) was used as a buffer for PCR.
- the second PCR reaction was subjected to agarose gel electrophoresis, and a fragment of about 1700 bp was recovered.
- the terminal nucleotide sequence of the recovered fragment was determined, and a BLAST search (Altschul et al., 1990) was performed on the public database of Genbank. As a result, it was found that the sequence matched the sequence of Nipponbare chromosome 10 genomic clone (accession number AC026758).
- PCR was carried out under the above-mentioned conditions using the primer combination of Nos F2 and No26R and using as a template the total DNA of Koshihikari and 16T1-26.
- a fragment of the expected size (352 bp) was amplified from 16T1-26.
- the product was not amplified as expected.
- Example 1 After the 16T0-34 DNA used in Example 1 was completely digested with BamHI, the introduced site was amplified by the method described in (1) above, and the nucleotide sequence was analyzed.
- the second PCR reaction was subjected to agarose gel electrophoresis, and a fragment of about 1700 bp was recovered.
- the terminal nucleotide sequence of the recovered fragment was determined, and a BLAST search (Altschul et al., 1990) was performed on the public database of Genbank. As a result, as of September 9, 2002, a clone having this sequence was not found.
- the second PCR reaction was subjected to agarose gel electrophoresis, and a fragment of about 500 bp was recovered.
- the terminal nucleotide sequence of the recovered fragment was determined, and a BLAST search (Altschul et al., 1990) was performed on the public database of Genbank. As a result, Nipponbare No.7 It can be seen that the sequence matches the sequence of the chromosomal genomic clone (accession number AP004009).
- PCR was performed using Koshihikari and the total DNA of 16T1-35 (transgene homozygous individual) described in Example 2 as templates.
- the PCR conditions were as follows: After treating at 94 ° C for 2 minutes, heat denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and extension reaction at 72 ° C for 30 seconds, repeated 35 times Finally, it was treated at 72 ° C for 2 minutes.
- the PCR reaction solution was subjected to agarose gel electrophoresis, it was shown that a fragment of the expected size (235 bp) was amplified from Koshihikari DNA. On the other hand, from 16T1-35, the product was not amplified as expected.
- PCR was carried out under the above conditions using a primer combination of Nos F2 and No35R, and using as a template the total DNA of Koshihikari and 16T1-35. As a result, a fragment of the expected size (177 bp) was amplified from 16T1-35. On the other hand, from Koshihikari, the product was not amplified as expected.
- Tridentate Rf-1 hetero individuals and tetradentate Rf-1 hetero individuals of 8) and 9) were created as follows.
- DNA was adjusted from 39 plants obtained by crossing (FR Koshihikari X 16T1-6) X (FR Koshihikari X 16T1-35), and the Rf-1 of each individual was adjusted.
- the locus genotype, the translocated genotype of 16T1-6 (chromosome 6), and the translocated genotype of 16T1-35 (chromosome 7) were estimated using DNA markers as described below.
- the Rf1 locus genotype 62 plants obtained by crossing (16T1-34 X 16T1-6) X (FR Koshihikari X16T1-35), The translocated genotype of 16T16, the translocated genotype of 16T1-35, and the translocated genotype of 16T1-34 were estimated.
- the 16T1-34 transgene locus Nos F2 and
- the PCR conditions were as follows: After treating at 94 ° C for 2 minutes, heat denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and elongation reaction power at 72 ° C for 30 seconds were repeated 35 times. Finally, treatment was performed at 72 ° C for 2 minutes.
- the PCR reaction mixture was subjected to agarose gel electrophoresis, and when the 245 bp fragment was amplified, the genotype at the same locus was regarded as heterozygous. As a result of the marker test, 5 individuals in the population obtained by this mating Rf-1 locus, 16T1-6 translocation, 16T1-35 translocation, and 16T1-34 translocation loci was estimated to be heterogeneous.
- Table 2 shows the results of calculating the pollen fertility of each spikelet and calculating the average value and standard deviation of the pollen fertility of 8 spikelets for each cultivar 'line'.
- 16T2-6, 16T2-26, 16T2-34, and 16T2-35 showed pollen fertility comparable to that of FR Koshihikari, and in 6)
- MS Koshihikari X 16T1-6, MS Koshihikari X16T1-26, MS Koshihikari X16 ⁇ 1-34, and MS Koshihikari X16T1-35 showed pollen fertility comparable to that of MS Koshihikari XFR Koshihikari.
- the pollen fertility of FR Koshihikari X16T1-26 was 92%.
- the introduced Rf-1 gene of 16T1-26 is located on the chromosome 10 inside AC026758, and AC026758 corresponds to the RFLP marker locus C797.
- the endogenous Rf-1 gene of FR Koshihikari is closely linked to the RFLP marker locus S12564 on chromosome 10 (Komari et al., 2002). According to the RFLP linkage map (Harushima et al., 1998), the map distance between C797 and S12564 is about 20 cM.
- the pollen germination medium conforms to the previous report (Kariy a, 1989)! ⁇ , l 0 / o Agar, 20% sucrose, 20 ppm H BO
- Table 3 shows the results of calculating the germination rate for each spikelet, and calculating the average value and standard deviation of the germination rates of the 8 spikelets for each variety and line.
- the germination rates of Koshihikari and MS Koshihikari X FR Koshihikari were 93% and 39%, respectively.
- the germination rates of FR Koshihikari X16T1-6 and FR Koshihikari X16T1-35 were 58% and 66%, respectively, which were not as high as the germination rates of Koshihikari, but significantly higher than the germination rates of MS Koshihikari X FR Koshihikari. I got high strength.
- a two-locus Rf-1 homo-fertility restoration line was created as follows. Hybridization of FR Koshihikari X 16T1 — 6 DNA was prepared from 24 individuals of F, and Rf-1 locus and 16T1-6 of each individual were introduced.
- the genotype at the locus was estimated.
- the genotypic potential of the Komori et al., 2002 [Hot !], S12564 Tsp509I locus and C1361 Mwol locus was also estimated.
- the 16T1-6 transgene locus PCR using No6F and No6R described in Example 3 was performed, and if the 210 bp fragment was not amplified, the genotype at the locus was considered to be homozygous for the transgene.
- the marker test one of the individuals examined was presumed to be homozygous for the fertility recovery gene at both the Rf-1 locus and the 16T1-6 transgene locus.
- a three-locus Rf-1 homozygosity recovery line was prepared as follows. As described in Example 4, 39 plants obtained by crossing (FR Koshihikari X 16T1-6) X (FR Koshihikari X 16T1-35) DNA were prepared, and the Rf-1 locus of each individual was adjusted. The 16T1-6 transgene locus (chromosome 6) and the 16T1-35 translocus (chromosome 7) were estimated from DNA markers as follows. Rf—1 seat [Kotsu Pite Poma, Komori et al., 2002 [Kosubo!], S12564 Inferred from the genotypes of the Tsp509I locus and the C1361 Mwol locus.
- PCR using Nos F2 and No6R described in Example 3 was performed, and when the 234 bp fragment was amplified, the genotype at the locus was heterozygous. Was considered.
- PCR was performed using Nos F2 and No35 R described in Example 3, and when a 177 bp fragment was amplified, the genotype of the 16T1-35 translocus was considered to be heterozygous.
- the marker test one individual in the population obtained by this mating Rf-1 homozygous at the Rf-1 locus and at both the 16T1-6 translocation locus and the 16T1-35 translocation locus It was presumed terrorism.
- DNA was prepared from the 24 self-bred individuals of the next generation, and the genotype of each individual at the 16T1-6 transgene locus and 16T1-35 transgene locus was estimated.
- PCR using No6F and No6R was performed as described above, and if the 210 bp fragment was not amplified, the genotype at the locus was considered to be homozygous for the transgene.
- PCR using No35F and No35R described in Example 3 was performed. If the 235 bp fragment was not amplified, it was determined that the genotype at the locus was homozygous for the transgene. I considered it.
- the fertility-restoring gene was homozygous at both of the two loci, 16T1-6 and 16T1-35, at the two individuals examined. Since these individuals are Rf-1 homozygous at the Rf-1 locus, they are Rf-1 homozygous at the 3 loci.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Environmental Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Biochemistry (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/560,736 US7982109B2 (en) | 2003-06-18 | 2004-06-09 | Method for improving fertility of hybrid plants comprising placing fertility restorer genes into multiple gene loci |
JP2005507198A JPWO2004113537A1 (ja) | 2003-06-18 | 2004-06-09 | 稔性回復遺伝子を複数の遺伝子座に配置させることを含むハイブリッド植物の稔性を向上させる方法 |
AU2004249999A AU2004249999A1 (en) | 2003-06-18 | 2004-06-09 | Method of improving fertility of hybrid plant comprising locating fertility restoration genes on plural loci |
EP04745700A EP1645630A4 (en) | 2003-06-18 | 2004-06-09 | PROCESS FOR IMPROVING THE FERTILITY OF HYBRID PLANTS, CONSISTING OF LOCALIZING THE FERTILITY RESTAURANT GENES IN MULTIPLE LOCATIONS |
CA002535660A CA2535660A1 (en) | 2003-06-18 | 2004-06-09 | Method of improving fertility of hybrid plant comprising locating fertility restoration genes on plural loci |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2003173927 | 2003-06-18 | ||
JP2003-173927 | 2003-06-18 | ||
JP2003359158 | 2003-10-20 | ||
JP2003-359158 | 2003-10-20 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2004113537A1 true WO2004113537A1 (ja) | 2004-12-29 |
Family
ID=33543474
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/JP2004/008025 WO2004113537A1 (ja) | 2003-06-18 | 2004-06-09 | 稔性回復遺伝子を複数の遺伝子座に配置させることを含むハイブリッド植物の稔性を向上させる方法 |
Country Status (6)
Country | Link |
---|---|
US (1) | US7982109B2 (ja) |
EP (1) | EP1645630A4 (ja) |
JP (1) | JPWO2004113537A1 (ja) |
AU (1) | AU2004249999A1 (ja) |
CA (1) | CA2535660A1 (ja) |
WO (1) | WO2004113537A1 (ja) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9943048B2 (en) | 2011-03-18 | 2018-04-17 | Honda Motor Co., Ltd. | Method for producing rice F1 seed, rice F1 seed, and rice male sterile line |
KR102261338B1 (ko) * | 2020-05-15 | 2021-06-07 | 충북대학교 산학협력단 | 배의 세포질 유전자 웅성불임성 회복 관련 유전자의 유전자형을 판별하기 위한 InDel 분자마커 및 이의 용도 |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
UY33949A (es) * | 2011-03-18 | 2012-10-31 | Honda Motor Co Ltd | Procedimiento para producir semilla f1 de arroz, semilla f1 de arroz y línea macho estéril de arroz |
CA2867385A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
US9631203B2 (en) | 2012-03-13 | 2017-04-25 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
AU2013232334A1 (en) | 2012-03-13 | 2014-10-02 | E. I. Dupont De Nemours & Company | Genetic reduction of male fertility in plants |
CN114793890A (zh) * | 2022-03-17 | 2022-07-29 | 重庆市农业科学院 | 一种二系、三系兼用强优势恢复系的高效选育方法 |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002014506A1 (fr) * | 2000-08-17 | 2002-02-21 | Japan Tobacco Inc. | Procede d'estimation du genotype du locus de recuperation de fertilite affectant le cytoplasme de fertilite male de type bt du riz |
WO2003027290A1 (fr) * | 2001-09-19 | 2003-04-03 | Japan Tobacco Inc. | Procede pour conferer ou reguler la fertilite d'un cytoplasme a sterilite male de riz bt au moyen d'un gene de restauration de la fertilite, et procede d'estimation de la presence d'un gene de restauration de la fertilite |
WO2003057859A2 (en) * | 2002-01-10 | 2003-07-17 | Cornell Research Foundation, Inc. | Genes for altering mitochondrial function and for hybrid seed production |
WO2004005515A1 (ja) * | 2002-07-05 | 2004-01-15 | Japan Tobacco Inc. | イネbt型雄性不稔細胞質に対する稔性回復遺伝子 |
JP2004024126A (ja) * | 2002-06-26 | 2004-01-29 | Japan Tobacco Inc | イネbt型雄性不稔細胞質に対する稔性回復遺伝子の有無を簡便に判別する方法 |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ES2161681T3 (es) * | 1989-08-10 | 2001-12-16 | Aventis Cropscience Nv | Plantas con flores modificadas. |
JP2002345485A (ja) | 2000-08-17 | 2002-12-03 | Japan Tobacco Inc | イネbt型雄性不稔細胞質に対する稔性回復遺伝子座の遺伝子型を推定する方法 |
JP2002325519A (ja) | 2000-09-07 | 2002-11-12 | Japan Tobacco Inc | 病害抵抗性植物及びその作出方法 |
US7314971B2 (en) * | 2001-07-12 | 2008-01-01 | Basf Plant Science Gmbh | Nuclear fertility restorer genes and methods of use in plants |
-
2004
- 2004-06-09 EP EP04745700A patent/EP1645630A4/en not_active Withdrawn
- 2004-06-09 WO PCT/JP2004/008025 patent/WO2004113537A1/ja not_active Application Discontinuation
- 2004-06-09 CA CA002535660A patent/CA2535660A1/en not_active Abandoned
- 2004-06-09 JP JP2005507198A patent/JPWO2004113537A1/ja active Pending
- 2004-06-09 US US10/560,736 patent/US7982109B2/en not_active Expired - Fee Related
- 2004-06-09 AU AU2004249999A patent/AU2004249999A1/en not_active Abandoned
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002014506A1 (fr) * | 2000-08-17 | 2002-02-21 | Japan Tobacco Inc. | Procede d'estimation du genotype du locus de recuperation de fertilite affectant le cytoplasme de fertilite male de type bt du riz |
WO2003027290A1 (fr) * | 2001-09-19 | 2003-04-03 | Japan Tobacco Inc. | Procede pour conferer ou reguler la fertilite d'un cytoplasme a sterilite male de riz bt au moyen d'un gene de restauration de la fertilite, et procede d'estimation de la presence d'un gene de restauration de la fertilite |
WO2003057859A2 (en) * | 2002-01-10 | 2003-07-17 | Cornell Research Foundation, Inc. | Genes for altering mitochondrial function and for hybrid seed production |
JP2004024126A (ja) * | 2002-06-26 | 2004-01-29 | Japan Tobacco Inc | イネbt型雄性不稔細胞質に対する稔性回復遺伝子の有無を簡便に判別する方法 |
WO2004005515A1 (ja) * | 2002-07-05 | 2004-01-15 | Japan Tobacco Inc. | イネbt型雄性不稔細胞質に対する稔性回復遺伝子 |
Non-Patent Citations (2)
Title |
---|
MOHANTY A, ET AL: "Agrobacterium-mediated high frequency transformation of an elite indica rice variety pusa basmati 1 and transmission of the transgenes to R2 progeny", PLANT SCIENCE, vol. 147, 1999, pages 127 - 137, XP002980565 * |
See also references of EP1645630A4 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9943048B2 (en) | 2011-03-18 | 2018-04-17 | Honda Motor Co., Ltd. | Method for producing rice F1 seed, rice F1 seed, and rice male sterile line |
KR102261338B1 (ko) * | 2020-05-15 | 2021-06-07 | 충북대학교 산학협력단 | 배의 세포질 유전자 웅성불임성 회복 관련 유전자의 유전자형을 판별하기 위한 InDel 분자마커 및 이의 용도 |
Also Published As
Publication number | Publication date |
---|---|
AU2004249999A1 (en) | 2004-12-29 |
EP1645630A4 (en) | 2006-09-06 |
EP1645630A1 (en) | 2006-04-12 |
CA2535660A1 (en) | 2004-12-29 |
US7982109B2 (en) | 2011-07-19 |
JPWO2004113537A1 (ja) | 2006-08-24 |
US20070277255A1 (en) | 2007-11-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20220186238A1 (en) | Diplospory gene | |
US20220106607A1 (en) | Gene for parthenogenesis | |
US20230383308A1 (en) | Modified promoter of a parthenogenesis gene | |
US20220251592A1 (en) | Cold-tolerant plant | |
Ray et al. | Development of barnase/barstar transgenics for hybrid seed production in Indian oilseed mustard (Brassica juncea L. Czern & Coss) using a mutant acetolactate synthase gene conferring resistance to imidazolinone-based herbicide'Pursuit' | |
WO2004113537A1 (ja) | 稔性回復遺伝子を複数の遺伝子座に配置させることを含むハイブリッド植物の稔性を向上させる方法 | |
AU2002335163B2 (en) | Method of imparting or controlling fertility with the use of fertility restoring gene for rice BT-male sterility cytoplasm and method of judging the existence of fertility restoring gene | |
EP2489738A1 (en) | Gene controlling flowering habit/cleistogamy in plants, and use thereof | |
CN113943356B (zh) | 蛋白质phd11、其编码基因以及它们在选育玉米雄性不育系中的应用 | |
AU2003213397B2 (en) | Sterility recovery genes to rice BT type male sterile cytoplasm | |
EP4129050A1 (en) | Method for producing temperature-sensitive male sterile plant | |
CN1954070A (zh) | 含有使育性恢复基因置于多个基因位点的改善杂交植物育性的方法 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200480023799.0 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2005507198 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004745700 Country of ref document: EP Ref document number: 2004249999 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2535660 Country of ref document: CA |
|
WWP | Wipo information: published in national office |
Ref document number: 2004745700 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10560736 Country of ref document: US |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2004745700 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 10560736 Country of ref document: US |