WO2004113510A2 - Production of pantothenate using microorganisms incapable of sporulation - Google Patents

Production of pantothenate using microorganisms incapable of sporulation Download PDF

Info

Publication number
WO2004113510A2
WO2004113510A2 PCT/EP2004/006619 EP2004006619W WO2004113510A2 WO 2004113510 A2 WO2004113510 A2 WO 2004113510A2 EP 2004006619 W EP2004006619 W EP 2004006619W WO 2004113510 A2 WO2004113510 A2 WO 2004113510A2
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
pantothenate
gene
sporulation
spooa
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2004/006619
Other languages
French (fr)
Other versions
WO2004113510A3 (en
Inventor
John Perkins
Zoltan Pragai
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DSM IP Assets BV
Original Assignee
DSM IP Assets BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DSM IP Assets BV filed Critical DSM IP Assets BV
Priority to JP2006515998A priority Critical patent/JP4713469B2/en
Priority to CN2004800171442A priority patent/CN1809631B/en
Priority to KR1020057024232A priority patent/KR101185656B1/en
Publication of WO2004113510A2 publication Critical patent/WO2004113510A2/en
Publication of WO2004113510A3 publication Critical patent/WO2004113510A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N3/00Spore forming or isolating processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/02Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes

Definitions

  • Pantothenate is a member of the B complex of vitamins and is a nutritional requirement for mammals including humans, e.g., from food, sources, as a water-soluble vitamin supplement or as a feed additive. In cells, pantothenate is used primarily for the biosynthesis of coenzyme A and acyl carrier protein. These essential coenzymes function in the metabolism of acyl moieties, which form thioesters with the sulfhydryl group of the 4'- phosphopantethein portion of these molecules.
  • Pantothenate has been synthesized conventionally via chemical synthesis from bulk chemicals.
  • the substrates required for chemical synthesis are expensive and the racemic intermediates have to be optically resolved.
  • bacterial or microbial systems have been employed that produce enzymes useful in pantothenate biosynthesis processes.
  • bioconversion processes have been evaluated as a means of favoring production of preferred isomer of pantothenic acid.
  • methods of direct microbial synthesis have recently been examined as a means of facilitating D-pantothenate production.
  • Patent applications WO 01/21772, WO 02/057474, and WO 02/061108 described a method to produce pantothenate using strains of B. subtilis 168 that have higher expression levels of biosynthetic genes involved in pantothenate production. These genes include panB, panC, panD, panE (ylbQ), ilvB, ilvN, ilvC, ilvD, glyA, and serA. To achieve higher expression levels of these genes, standard genetic recombinant methods were used that are known in the art. Pantothenate production of these engineered strains ranged from between 37 g/liter to 85 g/liter in 48 hour fed-batch fermentation.
  • sporulation-deficient strains of B. subtilis are used in fermentative processes (e.g. riboflavin - US5,837,528; biotin - US6,057,136).
  • the spoOA mutation is used to arrest sporulation.
  • the spoOA gene encodes a protein that regulates the initiation of sporulation.
  • WO 97/03185 describes a method to produce commercially important enzymes that uses a mutation in the Bacillus licheniformis spollAC which encodes a sporulation-specific transcription sigma factor, ⁇ F , to obtain bacteria of the genus Bacillus other than B. subtilis that are incapable of sporulating.
  • Spo0A ⁇ P concentration then reaches a higher critical level, it activates genes (sinl, spollG, spollE, spollA, etc.) required for the entry and commitment to sporulation. Since Spo0A ⁇ P represses transcription of abrB and AbrB represses transcription of sigH, therefore Spo0A ⁇ P indirectly activates genes that are in the regulon for ⁇ H , an alternative sigma factor governing the transcription of genes (spoOA, spoOF, spollA, phrC, phrE, etc.) involved in stationary growth phase and the early stages of sporulation (Britton et al., 2002).
  • genes and gene products that increase or decrease the level of Spo0A ⁇ P and AbrB include, but are not limited to, abrB, kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, sigH, spoOA, spoOB, spoOE and spoOF.
  • proteins that influence SpoOA ⁇ P-dependent binding at promoter sites to activate gene expression include, but are not limited to, SpoOJA and SpoOJB.
  • signals that increase or decrease the level of Spo0A ⁇ P and AbrB include, but are not limited to, nutritional, metabolic, DNA status, cell density (pheromones and quorum-sensing molecules) and cell cycle signals.
  • the cell divides asymmetrically to generate two compartments of unequal size and dissimilar developmental fates (Piggot and Losick, 2002).
  • the smaller compartment, the forespore develops into the spore, whereas the larger compartment, the mother cell, nurtures the developing spore.
  • the mother cell lyses to liberate the mature spore. Differentiation involves the action of four cell-specific sigma factors: ⁇ F , ⁇ E , ⁇ G and ⁇ ⁇ .
  • ⁇ F and ⁇ E factors are activated shortly after asymmetric division (polar septation, stage II.) when ⁇ F directs gene expression in the forespore (Margoiis et al., 1991) and ⁇ E directs gene expression in the mother cell (Dirks and Losick, 1991 ). Later in sporulation ⁇ F is replaced in the forespore by ⁇ G and ⁇ E is replaced by ⁇ ⁇ in the mother cell (Losick and Stragier, 1992; Li and Piggot, 2001).
  • ⁇ E is derived from an inactive proprotein called pro- ⁇ E (LaBell et al., 1987). Synthesis of pro- ⁇ E commences prior to septation (Satola et al., 1992), but the proteolytic processing of pro- ⁇ E to mature ⁇ E occurs after asymmetric division in the mother cell. This reaction is mediated by a sporulation-specific protease, SpolIGA, that cleaves 27 amino acids from the pro- ⁇ E amino terminus (Stragier et al., 1988; Jonas et al., 1988; Peters and Haldenwang, 1994).
  • SpolIGA sporulation-specific protease
  • pantothenate-producing B. subtilis 168 strains that are described in WO 01/21772, WO 02/057474, and WO 02/061108 are all wild-type for sporulation. No example is provided that shows the production of pantothenate in a sporulation-deficient strain.
  • the present invention therefore relates to a sporulation-deficient microorganism being capable of overproducing a pantothenate compound.
  • the microorganism may be modified such that the activity of SigE is reduced compared to the non-modified form of the microorganism.
  • SigE is the gene product encoded by the gene spollGB.
  • Reduced SigE activity may be caused by lack of spollGB expression, a decrease or lack of expression of the protease encoded by spollGA, a decrease or lack of expression of other upstream regulating genes or proteins, and the like.
  • the modification of the microorganism comprises a mutation that causes reduced SigE activity. More preferably, the mutation affects one or more genes selected from the group consisting of the genes spollGA, spollGB, spollR and spoil AC.
  • the microorganism may be modified such that the activity of both SpoOA and AbrB is reduced compared to the non-modified form of the microorganism.
  • SpoOA and AbrB are gene products encoded by the spoOA and abrB genes, respectively.
  • Reduced SpoOA and AbrB activity may be caused by lack of gene expression, a decrease or lack of signals (nutritional, metabolic, DNA status, cell density [pheromones and quorum-sensing molecules] and cell cycle signals), a decrease or lack of expression of other upstream regulating genes or proteins, and the like.
  • the modification of the microorganism comprises a mutation that causes reduced SpoOA/AbrB activity.
  • the mutation affects one, two or more genes selected from the group consisting of the genes abrB, kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, scoC, sigH, sinR, sinl, spoOA, spoOB, spoOE, spoOF, spoOJA and spoOJB.
  • the microorganism may be eukaryotic or prokaryotic.
  • the microorganism is prokaryotic.
  • the prokaryotic microorganism may be Gram positive or Gram negative.
  • Gram positive microorganisms include but are not limited to microorganisms belonging to one of the genera Bacillus, Corynebacterium, Lactobacillus, Lactococci and Streptomyces.
  • the microorganism belongs to the genus Bacillus. Examples are Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus puntis, Bacillus halodurans, etc.
  • the microorganism is Bacillus subtilis.
  • the corresponding wild type forms of the microorganisms of the invention are spore-forming microorganisms.
  • pantothenate compound preferably is pantothenate.
  • Pantothenate compounds further include intermediate compounds in the biosynthetic pathway of pantothenate biosynthesis such as pantoate, ⁇ -ketopantoate, ⁇ -ketoisovalerate and the like.
  • the invention encompasses any mutation to a gene of the microorganism resulting in a reduced function of the sigE gene product (SigE protein). SigE function may be assayed in a sporulation assay known to those skilled in the art.
  • the microorganism of the invention may have a mutation in its spollGB (sigE) gene resulting in the absence or decreased expression of functional sigE gene product.
  • the invention further encompasses any mutation in genes known to activate spollGB (sigE). These include, but are not limited to, spollGA, spollR, and spollAC (sigF) (Helmann and Moran, 2002).
  • the microorganism of the invention may have a mutation in its spollGA gene resulting in the absence or decreased expression of functional spollGA gene product.
  • the microorganism of the invention may have a mutation in its spollR gene resulting in the absence or decreased expression of functional spollR gene product.
  • the microorganism of the invention may have a mutation in its spollAC gene resulting in the absence or decreased expression of functional spollAC gene product.
  • expression denotes the transcription of a nucleic acid sequence and/or the subsequent translation of the transcribed sequence into an amino acid sequence.
  • a decreased expression of a nucleic acid may be achieved by introducing a mutation to a gene, e.g. by deleting a gene; nucleotide additions or subtractions that inactivate or decrease the activity of the encoded protein through formation of a frame shift of the reading frame or premature termination of translation through introduction of a stop codon; modifying regulatory sequences such as promoters, ribosome binding sites, and other techniques described herein.
  • a “mutation” may be a deletion, substitution or addition in the sequence of a gene.
  • the mutation may be a disruption, frame shift mutation or nonsense mutation.
  • the mutation may be a disruption affecting the entire sequence of the gene or a portion thereof.
  • the mutation may affect the coding or the non-coding sequence, e.g., the promoter, of the gene.
  • the mutation may result in complete lack of transcription of the gene or in premature termination of translation.
  • the mutation may be located in a preceding (or "upstream") gene, which disrupts transcription of the adjacent (or "downstream”) gene(s) by a process referred to as polarity.
  • the mutation may have the effect that the translated protein carries a mutation in comparison with the wild type protein that renders the protein nonfunctional.
  • Methods of introducing suitable mutations into a gene are known to those skilled in the art. These methods include, but are not limited to, introduction of point mutations into the bacteria chromosome (Cutting and Vander Horn, 1990), removal of a chromosomal DNA segment and replacing the segment with an antibiotic resistance gene (Perego, 1993), direct insertion of a transposable element, such a transposon or mini (Youngman, 1990; Petit et al., 1990), or plasmids such as pMUTIN (Vagner et al., 1998).
  • the sporulation-deficient microorganism having a reduced function of its sigE gene product is capable of overexpressing spoOA, more preferably it overexpresses spoOA.
  • Overexpression of spoOA may be achieved as described herein.
  • Increased expression or overexpression of a gene may be achieved in a variety of ways.
  • One approach to obtain microorganisms overexpressing one or more genes is to alter or modify regulatory sequences or sites associated with the expression of a particular gene, e.g. by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive. Further techniques are described infra.
  • a “promoter” is a DNA sequence upstream from the start of transcription of a gene and involved in recognition and binding of RNA polymerase and/or other proteins to initiate transcription of the gene. Usually, the promoter determines under what conditions the gene is expressed.
  • an "inducible promoter” is one which causes mRNA synthesis of a gene to be initiated temporally under specific conditions, (i) Promoters may be regulated primarily by an ancillary factor such as a repressor or an activator.
  • the repressors are sequence-specific DNA binding proteins that repress promoter activity. The transcription can be initiated from this promoter in the presence of an inducer that prevents binding of the repressor to the operator of the promoter.
  • promoters from Gram-positive microorganisms include, but are not limited to, gnt (gluconate operon promoter); penP from Bacillus licheniformis; glnA (glutamine synthetase); xylAB (xylose operon); araABD (L-arabinose operon) and P spac promoter, a hybrid SPO1//ac promoter that can be controlled by inducers such as isopropyl- ⁇ -D-thiogalactopyranoside [IPTG] (Yansura and Henner, 1984).
  • inducers such as isopropyl- ⁇ -D-thiogalactopyranoside [IPTG] (Yansura and Henner, 1984).
  • Activators are also sequence-specific DNA binding proteins that induce promoter activity.
  • promoters from Gram-positive microorganisms include, but are not limited to, two-component systems (PhoP-PhoR, DegU-DegS, SpoOA-Phosphorelay), LevR, Mry and GltC.
  • Production of secondary sigma factors can be primarily responsible for the transcription from specific promoters.
  • Examples from Gram-positive microorganisms include, but are not limited to, the promoters activated by sporulation specific sigma factors: ⁇ F , ⁇ E , ⁇ G and ⁇ ⁇ and general stress sigma factor, ⁇ B .
  • the ⁇ B -mediated response is induced by energy limitation and environmental stresses (Hecker and V ⁇ lker, 1998).
  • Attenuation and antitermination also regulates transcription.
  • Gram-positive microorganisms include, but are not limited to, trp operon and sacB gene,
  • Other regulated promoters in expression vectors are based on the temperature-sensitive immunity repressor from phage ⁇ 105 (Osbourne et al., 1985) and the sacR regulatory system conferring sucrose inducibility (Klier and Rapoport, 1988).
  • a “constitutive” promoter is one that permits the gene to be expressed under virtually all environmental conditions, i.e. a promoter that directs constant, non-specific gene expression.
  • a “strong constitutive promoter” is one which causes mRNAs to be initiated at high frequency compared to a native host cell. Strong constitutive promoters are well known and an appropriate one may be selected according to the specific sequence to be controlled in the host cell. Examples of such strong constitutive promoters from Gram-positive microorganisms include, but are not limited to, SP01-26, SP01-15, veg, pyc (pyruvate carboxylase promoter), and amyE.
  • promoters from Gram-negative microorganisms include, but are not limited to, tac, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, 73, gal, trc, are, SP6, ⁇ -P R , and ⁇ -P L .
  • the invention further encompasses any mutation to one or more genes resulting in a reduced function of both SpoOA and AbrB.
  • SpoOA and AbrB function may be assayed in an enzyme assay for ⁇ -glutamyltranspeptidase (Xu and Strauch, 1996) and with microarray technology known to those skilled in the art.
  • SpoOA function may be assayed in a sporulation assay; and AbrB function may be assayed with lacZ reporter gene fused to AbrB-regulated promoters (spoOVG, tycA, abrB, etc.).
  • the microorganism may have at least one mutation in its spoOA gene and at least one mutation in its abrB gene. The mutations result in the absence or decreased expression of functional spoOA gene product and in the absence or decreased expression of functional abrB gene product.
  • Mutations to one or more genes resulting in a reduced function of SpoOA include mutations to genes known to activate spoOA. These include, but are not limited to, spoOB, spoOF, kinA, kinB, kinC, kinD, kinE and sigH.
  • the microorganism of the invention may have a mutation in its spoOB resulting in the absence or decreased expression of functional spoOB gene product.
  • the microorganism of the invention may have a mutation in its spoOF resulting in the absence or decreased expression of functional spoOF gene product.
  • the mutation resulting in a reduced SigE function and the mutations resulting in a reduced function of both SpoOA and AbrB may be combined. Accordingly, the preferred embodiments of the various mutations and modifications described herein may be combined. This applies to the method described infra mutatis mutandis.
  • the microorganism of the invention is capable of overproducing a pantothenate compound under suitable conditions.
  • the term "overproducing a pantothenate compound” refers to significantly increased production of the pantothenate compound by the microorganism of the invention in comparison to the wild type form of said microorganism.
  • overproduction of pantothenate means production of at least 50 mg, 100 mg, 200 mg, 500 mg, 1 g, 3 g, 5 g or 10 g pantothenate per liter culture medium.
  • a population of the microorganisms of the invention produces at least 100 mg, preferably at least 125 mg, more preferably at least 140 mg, more preferably at least 200 mg, still more preferably at least 300 mg, even more preferably at least 400 mg, most preferably at least 500 mg pantothenate per liter culture medium when cultured under the conditions as described in Example II. In this example culturing in minimal medium is described.
  • a population of the microorganisms of the invention may produce at least 100 mg, preferably at least 125 mg, more preferably at least 140 mg, more preferably at least 200 mg, still more preferably at least 300 mg, even more preferably at least 400 mg, most preferably at least 500 mg pantothenate per liter culture medium when cultured under the conditions as described in Example IV or V.
  • a population of the microorganisms of the invention produces at least 5 g, preferably at least 7.5 g, most preferably at least 10 g pantothenate per liter culture medium when cultured under conditions as described in Example III.
  • This example describes fed-batch fermentation.
  • the level of pantothenate production by the sporulation-deficient microorganisms of the invention is comparable to the level of pantothenate production by control cells. Therefore, the amount of the pantothenate compound produced by a population of the microorganisms of the invention may be greater than 50%, preferably greater than 75%, more preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient when cultured under identical conditions.
  • the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient.
  • the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75%, most preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient.
  • the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75%, most preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient.
  • the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75%, most preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient.
  • the "corresponding microorganism not being sporulation-deficient" is preferably a microorganism which has not been modified such that it exhibits reduced SigE function or a reduced SpoOA and ArbB function.
  • the corresponding microorganism not being sporulation- deficient is a microorganism that is substantially identical with the exception that is has no mutation in its spollGA gene. The same applies to mutations in other genes.
  • pantothenate compound can be achieved in a variety of ways. Methods of preparing strains of Bacillus subtilis overproducing pantothenate are described in, e.g., WO 01/21772, WO 02/057474, and WO 02/061108.
  • One approach to obtain pantothenate- overproducing microorganisms is to overexpress one or more genes involved in the pantothenate biosynthetic pathway.
  • the term "overexpressed” or "overexpression” includes expression of a gene product at a level higher than that expressed prior to modification of the microorganism or in a comparable microorganism which has not been modified.
  • the microorganism of the invention overexpresses one or more genes selected from the group consisting of panB, panC, panD, panE, ilvB, ilvN, ilvC, ilvD, glyA, and serA, ylmA as well as the gcv genes involved in the glycine cleavage pathway.
  • Overexpression of a gene in a microorganism can be performed according to any methodology described herein including, but not limited to, deregulation of a gene and/or overexpression of at least one gene.
  • the microorganism can be genetically manipulated, e.g., genetically engineered, to overexpress a level of gene product greater than that expressed prior to modification of the microorganism or in a comparable microorganism which has not been modified.
  • Genetic manipulation can include, but is not limited to, altering or modifying regulatory sequences or sites associated with the expression of a particular gene, e.g., by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive, modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as ribosome binding site or transcription terminator, increasing the copy number of a particular gene, modifying proteins, e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like, involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventional means of deregulating expression of a particular gene routine in the art (including, but not limited to, the use of antisense nucleic acid molecules, e.g., to block expression of repressor proteins).
  • Suitable promoters are, but are not limited to, P veg , P 15 and P 26 (Lee et al., 1980, Mol. Gen. Genet. 180:57-65 and Moran et al., 1982, Mol. Gen. Genet. 186:339-46.
  • the microorganism can be physically or environmentally manipulated to overexpress a level of gene product greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which has not been manipulated.
  • a microorganism can be treated with or cultured in the presence of an agent known or suspected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased.
  • a microorganism can be cultured at a temperature selected to increase the transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased.
  • deregulated includes the alteration of modification of at least one gene in a microorganism such that the level or activity of the gene product in a microorganism is altered or modified.
  • at least one gene is altered or modified such that the gene product is enhanced or increased.
  • the invention further relates to a method for the preparation of a sporulation-deficient microorganism capable of overproducing a pantothenate compound.
  • a microorganism capable of overproducing a pantothenate compound may be modified such that it contains a mutation in a gene regulating SigE function and optionally an increased function of SpoOA.
  • the method comprises
  • step (c) introducing in the microorganism of step (a) or (b) a mutation that causes reduced SigE function such that a sporulation-deficient microorganism is obtained.
  • the order of steps (b) and (c) may be changed.
  • the method may comprise
  • step (b) introducing in the microorganism of step (a) mutations that cause reduced SpoOA function and reduced ArbB function such that a sporulation-deficient microorganism is obtained.
  • the mutation of the sigE gene or the mutations of the spoOA gene and of the arbB gene may be introduced prior to carrying out the mutations leading to overproduction of the pantothenate compound.
  • the method comprises
  • step (b) introducing in the microorganism of step (a) a mutation that causes reduced SigE activity or introducing in the microorganism of step (a) mutations that cause reduced SpoOA activity and reduced AbrB activity such that a sporulation-deficient microorganism is obtained, and
  • step (c) modifying the sporulation-deficient microorganism obtained in step (b) such that it is capable of overproducing the pantothenate compound.
  • step (b) of this method may comprise the optional step of introducing in the microorganism of step (a) or (b) or (c) a DNA sequence (e.g. promoter) or a mutation that causes increased SpoOA function.
  • a DNA sequence e.g. promoter
  • Another aspect of the invention is a method for producing a pantothenate compound comprising (a) culturing a microorganism according to the invention under conditions such that the pantothenate compound is produced; and (b) optionally recovering the pantothenate compound from the cell culture medium.
  • the method of the invention comprises the step of culturing the modified microorganisms under conditions such that a pantothenate compound is produced.
  • the term "culturing” includes maintaining and/or growing a living microorganism of the present invention.
  • a microorganism of the invention is cultured in liquid media.
  • a microorganism is cultured in solid media or semi-solid media.
  • the microorganism of the invention is cultured in liquid media comprising nutrients essential or beneficial to the maintenance and/or growth of the microorganism.
  • nutrients include, but are not limited to, carbon sources or carbon substrates, e.g. complex carbohydrates such as bean or grain meal, starches, sugars, sugar alcohols, hydrocarbons, oils, fats, fatty acids, organic acids and alcohols; nitrogen sources, e.g.
  • animal sources such as meat, milk and animal byproducts such as peptones, meat extracts and casein hydrolysates
  • inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium nit
  • microorganisms are preferably cultured under controlled pH.
  • microorganisms are cultured at a pH of between 6.0 and 8.5, more preferably at a pH of about 7.
  • the desired pH may be maintained by any method known to those skilled in the art.
  • the microorganisms are further cultured under controlled aeration and under controlled temperatures.
  • the controlled temperatures include temperatures between 15 and 70°C, preferably the temperatures are between 20 and 55°C, more preferably between 30 and 45°C or between 30 and 50°C.
  • the microorganisms may be cultured in liquid media either continuously or intermittently, by conventional culturing methods such as standing culture, test tube culture, shaking culture, aeration spinner culture or fermentation.
  • the microorganisms are cultured in a fermentor.
  • Fermentation processes of the invention include batch, fed-batch and continuous methods of fermentation. A variety of such processes have been developed and are well known in the art. The culturing is usually continued for a time sufficient to produce the desired amount of the pantothenate compound.
  • the method further comprises the step of recovering the pantothenate compound.
  • the term "recovering” includes isolating, extracting, harvesting, separating or purifying the compound from culture media. Isolating the compound can be performed according to any conventional isolation or purification methodology known in the art including, but not limited to, treatment with a conventional resin, treatment with a conventional adsorbent, alteration of pH, solvent extraction, dialysis, filtration, concentration, crystallization, recrystallization, pH adjustment, lyophilisation and the like.
  • the pantothenate compound can be recovered from culture medium by first removing the microorganisms from the culture.
  • Media is then passed through or over a cation exchange resin to remove unwanted cations and then through or over an anion exchange resin to remove unwanted inorganic anions and organic acids having stronger acidities than the compound of interest, e.g. pantothenate.
  • a cation exchange resin to remove unwanted cations
  • an anion exchange resin to remove unwanted inorganic anions and organic acids having stronger acidities than the compound of interest, e.g. pantothenate.
  • the resulting pantothenate can subsequently be converted to salt as described herein.
  • the compound is "isolated" when the resulting preparation is substantially free of other components.
  • the preparation has a purity of greater than about 80% (by dry weight) of the desired compound (e.g. less than about 20% of all the media, components or fermentation byproducts) more preferably greater than about 90% of the desired compound, even more preferably greater than about 95% of the desired compound and most preferably greater than about 98 to 99% of the desired compound.
  • the desired compound is not purified from the microorganism or the culture.
  • the entire culture or the culture supernatant may be used as a source of the product.
  • the culture or the culture supernatant is used without modification.
  • the culture or the culture supernatant is concentrated, dried and/or lyophilized.
  • Bacillus subtilis strains of the present invention are derived from strain 1A747 (Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA), which is a prototrophic derivative of B. subtilis 168 (trpC2).
  • the chloramphenicol-resistance gene (cat) cassette was obtained from plasmid pC194 (GeneBank M19465, Cat# 1 E17 Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA).
  • the P 15 promoter of the B. subtilis bacteriophage SPO1 (Lee et al., 1980, Mol. Gen. Genet.
  • BHI [trpC2 pheA1 spoOHAHind ⁇ -EcoR ⁇ ::cat] (BHI is a derivative of BH100 in ref. Healy et al., 1991 , Mol. Microbiol. 5:477-487), 650 [trpC2 ilvB2 leuB16 spollAABC::caf ⁇ (Pragai et al., 2004, J Bacteriol. 186:1182-1190), 731 [trpC2 spolllG .ermC] (Partridge and Errington,
  • Standard minimal medium (MM) for B. subtilis contains 1X Spizizen salts, 0.04% sodium glutamate, and 0.5% glucose.
  • Standard solid complete medium is Tryptone Blood Agar Broth (TBAB, Difco).
  • Standard liquid complete medium is Veal Infusion-Yeast Extract broth (VY). The compositions of these media are described below:
  • TBAB medium 33g Difco Tryptone Blood Agar Base (Catalog # 0232), 1 L water.
  • VY medium 25g Difco Veal Infusion Broth (Catalog # 0344), 5g Difco Yeast Extract
  • 10X Spizizen salts 140g K 2 HPO 4 ; 20g (NH 4 ) 2 SO 4 ; 60g KH 2 PO 4 ; 10g Na 3 citrate.2H 2 O; 2g
  • P-medium 100 ml 10X PAM; 100ml 10X Spizizen salts; 10 ml 50% glucose; 790 ml sterile distilled water.
  • P-agar medium 100 ml 10X PAM; 100ml 10X Spizizen salts; 10 ml 50% glucose; 790 ml sterile distilled water containing 15 g of agar.
  • 10X VFB minimal medium (10X VFB MM): 2.5g Na-glutamate; 15.7g KH 2 PO 4 ; 15.7g
  • Fe solution 0.21 g FeSO 4 .7H 2 0; qsp 10 ml water.
  • Mg/Zn solution 100g MgSO 4 .7H 2 O; 0.4g ZnSO 4 .7H 2 O; qsp 200 ml water.
  • VFB MM medium 100 ml 10X VFB MM; 10 ml 50% glucose; 2 ml Trace elements solution;
  • VFB MMGT medium 100 ml 10X VFB MM; 100 ml 0.5 M Tris (pH 6.8); 44 ml 50% glucose;
  • VF fermentation batch medium Sterilized in place in solution: 0.75g sodium glutamate;
  • VF fermentation feed medium 660g glucose-H 2 O; qsp 1 L. Autoclave. Add 2g MgSO 4 -7H 2 O;
  • Pantothenate assays Pantothenate was assayed using three biological and one physical (HPLC) methods:
  • Pantothenate was assayed on agar plates using an indicator derived from Salmonella typhimurium using known methods.
  • Strain DM3 panC355 (D. Downs, University of Wisconsin at Madison, Madison, Wisconsin USA) responds only to pantothenate.
  • 10 ml of P-agar medium containing 10 7 cells/ml of S. typhimurium DM3 (panC355) indicator strain and 40 ⁇ g/ml of 2,3,5-triphenyltetrazoiium chloride (Fluka; Catalog # 93140) was layered above 20 ml of P-agar medium used as a bottom agar in a standard Petri dish.
  • Biological assay II - test tube bioassay Pantothenate was assayed in liquid using test tube cultures. To assay ⁇ . subtilis cultures, supernatants were filtered sterilized and dilutions prepared using 1X pantothenate assay medium (PAM) in test tubes. The total volume of the dilutions was 5.0 ml. To these dilution test tubes, 0.1 ml of a 200-fold dilution of the DM3 indicator stock (in 1X PAM) was added. The test tubes were then incubated in a roller-drum- type shaker at 37°C for 18-24 hours.
  • PAM pantothenate assay medium
  • Turbidity readings were made at 600 nm (OD 60 o) and compared to a standard curve of known quantities of pantothenate.
  • the standard curve was prepared by diluting authentic pantothenate to levels of 0.8, 4, 20, 50, and 100 ⁇ g/liter, adding to each dilution the indicator as prepared above, and measuring turbidity after 18-24 hours at 37°C (same incubation time as the unknown samples). The linear portion of the standard curve was used to generate a logarithmic regression equation. This equation was then used to calculate pantothenate concentrations in unknown samples using the OD 6 oo values of the diluted samples.
  • Biological assay 111 - 96-well microtiter plate bioassay Pantothenate was also assayed in liquid using a 96-well microtiter plate format. 180 ⁇ l of pantothenate assay medium (PAM) containing 5.5x10 5 cell/ml of S. typhimurium DM3 was loaded into each well of the 96-well microtiter plate. To assay B. subtilis cultures, 60 ⁇ l of filtered sterilized supernatant of the cultures were added into the wells in column 1 , rows B-H. After mixing, 60 ⁇ l of the samples were transferred into the next wells in column 2. These 4-fold dilution steps were repeated until column 12.
  • PAM pantothenate assay medium
  • each well contained 180 ⁇ l of samples.
  • Adhesive film was place onto the plate to avoid evaporation and the cultures were incubates at 37°C for 17 h with an agitation of 300 rpm. Turbidity readings were made at 600 nm and compared to a standard curve of known quantities of pantothenate (Pan)
  • Pan standard curve was prepared by adding 60 ⁇ l of Pan standard (100 mg/ml) into the well in column 1 and row A of each microtiter plate. Dilution, incubation and measuring turbidity of the Pan standard was done as described above with the unknown samples.
  • HPLC assay Chromatography of samples was performed on a Phenomenex LUNA C8 column, using an Agilent 1100 HPLC system equipped with a thermostatted autosampler and a diode array detector. The column dimensions are 150 x 4.6 mm, particle size 5 micron. The column temperature was kept constant at 20°C. The mobile phase is a mixture of 0.1 % acetic acid (A) and methanol (B). Gradient elution is applied, ranging from 1 % B to 45% B in 15 minutes. The flow rate is 1 ml/min. Pantothenate was monitored using UV absorption at 220 nm, and is eluted at approximately 9.6 min. The calibration range of the method is from 1 to 100 mg/l pantothenate.
  • Sporulation assay 1 ml of sample was taken from the B. subtilis cultures and 10-fold dilution series was prepared in sterile distilled water. After a 20 min heat-treatment at 80°C, dilutions were plated on TBAB agar, incubated for 20 h at 37°C and then the number of 'heat-resistant' colony forming units (cfu) in 1 ml of the original culture was determined. Sporulation frequency was calculated by dividing the titer (cfu/ml) of heat resistant spores by the titer (cfu/ml) of bacterial cells before heat treatment.
  • Pantothenate producing strains were grown in stirred tank fermentors, for example, in BIOFLO 3000 New Brunswick 2 liter vessels initially containing 1.4 liters of VF fermentation batch medium with glucose/salt solution.
  • Computer control was done by NBS Biocommand 32 commercial software (New Brunswick Scientific Co., Inc., Edison, NJ, USA); Lucullus software (Biospektra AG, Schlieren, Switzerland) was used for data collection and controlling the glucose feeding.
  • the inoculum was prepared for the fermentation.
  • the first seed consisted of inoculating 25 ml of VY medium containing 10 g/liter sorbitol with 50 ⁇ l of a frozen bacterial stock culture and growing the culture for 6 hours at 37°C. 1 OD of cells was then used to inoculate 60 ml of VF Fermentation batch medium containing 10 g/liter sorbitol (no glucose) and this second seed was grown for 8-12 hours at 37°C. This second seed was then used to inoculate the fermentation vessel, the amount of which is usually 4-5% of the initial media volume.
  • Fermentations can be batch processes but are preferably, carbohydrate-limited, fed-batch processes. Therefore a defined VF fermentation feed solution (see above) was provided to the reactor after consumption of the initial glucose which was usually the case after 6-8 hours process time. At that time, a constant addition of the feed solution was initiated at a rate of 14 g/h.
  • This example describes the construction of pantothenate-overproducing strains of B. subtilis.
  • PCR Polymerase Chain Reaction
  • Two PCR fragment bombardarms were then generated: 0.2 ⁇ l of a 100 mM solution of primer panB/up2/for/R1 and panB/up2/rev/Clal or primers panB/down2/for/Nhel and panB/down2/rev/Bam (Table 1) were added to 0.1 ⁇ g 1A747 chromosomal DNA in a 50 ⁇ l reaction volume containing 1 ⁇ l of 40 mM dNTP's, 5 ⁇ l of 10X buffer and 0.75 ⁇ l PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science).
  • the PCR reaction was performed for 30 cycles, using an annealing temperature of 58 °C and an elongation time of 60 seconds.
  • the resulting fragments called F1 and F2, respectively, were purified, and inserted sequentially, respectively between the EcoRI and C/al sites (for F1) and the Nhe ⁇ and ⁇ a HI (for F2).
  • Ligated DNA was transformed into E. coli TOP10 cells (Invitrogen), selecting for ampicillin- resistance at 100 ⁇ g/ml concentration. This resulted in the E. coli plasmid pPA5.
  • the ApanBp.:cat deletion cassette was then next introduced into the chromosome of B.
  • subtilis 1A747 by DNA transformation, selecting for chloramphenicol-resistance (Cm r ) on TBAB agar plates containing 5 ⁇ g/ml chloramphenicol (Cm) using standard conditions.
  • Cm r chloramphenicol-resistance
  • a single Cm r colony containing a deletion in the panB promoter region was isolated and named PA1 (ApanBp.-.cat).
  • PA1 was also a pantothenate auxotroph (Pan " ), which requires pantothenate for growth on minimal medium.
  • the deletion mutation was confirmed by diagnostic PCR using panB/up2/for/R1 and panB/down2/rev/Bam primers (Table 1 ), again using standard reaction conditions.
  • Nucleotide sequence 5'>3'
  • the next step was to introduce a strong constitutive promoter upstream of the panB gene.
  • a strong constitutive promoter upstream of the panB gene Any number of such promoters are described in the literature, including those derived from the SP01 bacteriophage of B. subtilis, P 15 and P 26 (Lee et al., 1980). Long Flanking Homology Polymerase Chain Reaction (LFH-PCR) was used to generate DNA fragments containing P 15 upstream of the ribosome binding site (RBS) of panB.
  • LDH-PCR Long Flanking Homology Polymerase Chain Reaction
  • PCR fragment bombardments were first created: 0.2 ⁇ l of a 100 mM solution of primer PlpanBCD and P2panBCD or primers P3panBCD and P4panBCD (Table 2) were added to 0.1 ⁇ g 1A747 chromosomal DNA in a 50 ⁇ l reaction volume containing 1 ⁇ l of 40 mM dNTP's, 5 ⁇ l of 10X buffer and 0.75 ⁇ l PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7 °C and an elongation time of 45 seconds.
  • F3 and F4 were purified and next used as primers in a second round of PCR.
  • F3 and F4 fragments were diluted 50-fold and 1 ⁇ l of each was added to 0.1 ⁇ g of linearized plasmid pXI23roDTD-SPO1-15 (containing the P 15 promoter) in a 50 ⁇ l reaction volume.
  • an annealing temperature of 63 °C and an elongation time of 6 minutes was used.
  • the elongation time was extended by 20 seconds after each cycle.
  • the resulting products were then used in a third round of PCR as a template.
  • the PCR products were diluted 50-fold and 1 ⁇ l was combined with 0.2 ⁇ l of a 100 mM solution of primer PlpanBCD and P4panBCD in a 50 ⁇ l reaction volume containing dNTP's, buffer, and enzyme as described above.
  • the PCR reaction parameters were identical to those used in the second round PCR.
  • the finished PCR fragments were next transformed into the panB promoter-deleted strain PA1 by DNA transformation, selecting for pantothenate prototrophy (Pan + ) on minimal medium agar plates using standard conditions. These Pan + colonies were also chloramphenicol sensitive (Cm s ), confirming the insertion of the promoter cassette.
  • a single Pan + Cm s colony containing a panBCD operon expressed from the P ⁇ 5 promoter was isolated and named PA12 (P 15 panBCD).
  • the presence of the P 15 promoter upstream of panB gene was confirmed by diagnostic PCR using P15seq and P4panBCD primers (Table 2), again using standard reaction conditions.
  • PA12 produced approximately 100 mg/liter pantothenate in VFB MM medium and 250 mg/liter pantothenate in VFB MMGT medium (based on HPLC/MS assays) whereas the 1A747 control produced less than 1 mg/liter pantothenate.
  • PA12 In standard fed-batch fermentation using VF medium and growth conditions, PA12 produced around 10-14 g/liter pantothenate at 48 hours.
  • Table 2 Primers used to generate a B. subtilis strain containing a P 15 panBCD expression cassette.
  • a deletion mutation was first constructed. Inspection of the panE gene reveals two potential start sites: Start Site 1 (5' - AAATTGGGTG - 3' (RBS)- 7 nt - ATG) that overlaps a ⁇ spHI site and is 33 bp upstream from Start Site 2 (5' - GGAGG - 3' (RBS) - 5 nt - TTG) that overlaps a ⁇ saXI site. Consequently, a 219 bp deletion of the panE/ylbQ promoter region was constructed by LFH-PCR using a S.
  • aureus erythromycin resistance (Em r ) gene GeneBank V012778.
  • Em r aureus erythromycin resistance
  • two PCR fragment bombardarms were first created: 0.2 ⁇ l of a 100 mM solution of primer Pl panE and P2panE/Er or primers P3panE/Er/2 and P4panE (Table 3) were added to 0.1 ⁇ g 1A747 chromosomal DNA in a 50 ⁇ l reaction volume containing 1 ⁇ i of 40 mM dNTP's, 5 ⁇ l of 10X buffer and 0.75 ⁇ l PCR enzyme (Taq and Tgo), as described by the manufacture (Expand High fidelity PCR System-Roche Applied Science).
  • the PCR reaction was performed for 30 cycles using an annealing temperature of 55.7°C and an elongation time of 45 seconds.
  • the resulting fragments called F1 and F2 respectively, were purified and next used as primers in a second round of PCR.
  • F1 and F2 fragments were diluted 50-fold and 1 ⁇ l of each was added to 0.1 ⁇ g of linearized plasmid pDG646 (containing the erm cassette; Guerout-Fleury et al., 1995) in a 50 ⁇ l reaction volume.
  • an annealing temperature of 63°C and an elongation time of 6 minutes was used.
  • the elongation time was extended by 20 seconds after each cycle.
  • the resulting products were then used in a third round of PCR as a template.
  • the PCR products were diluted 50-fold and 1 ⁇ l was combined with 0.2 ⁇ l of a 100 mM solution of primer Pl panE and P4panE in a 50 ⁇ l reaction volume containing dNTP's, buffer, and enzyme as described above.
  • the PCR reaction parameters were identical to those used in the second round PCR.
  • the finished PCR fragments were next transformed into the PA4 (Trp + colonies obtained from B. subtilis CU550 trpC2 ilvC4 leu-124 by transformation with 1A747 chromosomal DNA) resulted in Em r colonies that were pantothenate auxotrophs.
  • panE p ApanE p ::erm ilvC leuC
  • Diagnostic PCR was used to confirm the structure of the deletion.
  • panB promoter deletion was introduced into PA5 by transformation of PA1 chromosomal DNA at non- legislative concentration to generate PA6 (ilvC leuC ApanB p ::cat ApanE p ::erm).
  • the next step was to introduce simultaneously strong constitutive P ⁇ 5 promoters upstream of the both panB and panE.
  • LFH-PCR was used again to generate DNA fragments containing P 15 upstream of open reading frame of panB and containing P 15 upstream of the open reading frame of panE.
  • panB and P ⁇ 5 panE PCR fragments were then transformed together into the panB and panE promoters deleted strain PA6 (ilvC leuC ApanB p ::cat ApanE p ::erm) by DNA transformation, selecting for pantothenate prototrophy (Pan + ) on minimal medium agar plates using standard conditions. Recovered Pan + colonies were also Cm s and erythromycin sensitive (Em s ), confirming the insertion of the promoter cassettes.
  • a single Pan + Cm s Em s colony containing both panBCD operon and panE gene expressed from the P 15 promoter was isolated and named PA32.
  • panB gene The presence of the P 15 promoter upstream of panB gene was confirmed by diagnostic PCR using P15seq and P4panB primers (Tables 1 and 2), again using standard reaction conditions. An identical control was performed on the panE gene using P15seq and P4panE primers (Tables 3 and 4). Subsequent sequencing of the Pis promoter in front of panE, however, revealed a partial deletion of the P « promoter.
  • the ApanE p ::erm mutation was re-introduced into PA32 by DNA transformation using chromosomal DNA from PA5 (ApanE p ::erm ilvC leuC) and selecting for erythromycin- resistance.
  • PA41 P 15 panBCD ApanE p ::erm HvC leuC
  • PA49 produced on average approximately 400 mg/liter pantothenate in VFB MMGT medium (based on HPLC/MS assays).
  • This example describes the construction and testing of B. subtilis pantothenate overproducing strains containing sporulation-deficient mutations spoOA, spoOH, spollA (sigF) spollG (sigE) and spolllG (sigG). Construction of B. subtilis mutants deficient in spore formation.
  • Sporulation-deficient mutations were introduced into 1A747 (wild-type strain) and PA12, a pantothenate-overproducing strain by transformation of chromosomal DNA from strains SWV215 (spoOAr.kan), BHI (spo0H ⁇ H//7dlll-EcoRI::cat), 650 (spollAABCwcaf), 901 (spollGA::aphA-3) and 731 (spolllGwermC), respectively.
  • Extraction of chromosomal DNA and transformation of B. subtilis strains by the 'Groningen' method was according to Bron (1990).
  • Transformants were selected on TBAB agar medium containing 0.3 ⁇ g/ml of erythromycin (Em) and 25 ⁇ g/ml of lincomycin (Lm) for ermC gene; 6 ⁇ g/ml of Cm for cat gene; and 10 ⁇ g/ml of kanamycin (Km) for kan and aphA-3 genes.
  • Em erythromycin
  • Lm lincomycin
  • Km kanamycin
  • Kanamycin-resistant (Km r ) transformants from SWV215 DNA were named
  • pantothenate production of mutants 1A747_spoO/4, PA12_spoO ⁇ , 1A747_s/gH and PA12_s/o7- decreased 2 to 3 fold compared to the parent strains (Table 5), indicating that the lack of SpoOA and ⁇ H functions negatively affected the pantothenate production.
  • production of pantothenate was similar to control levels within experimental error, indicating that mutations blocking sporulation in later stages had little or no effect on pantothenate production.
  • the cell biomass of all mutants was similar to that of the parental controls.
  • the sporulation frequency of the parent strains 1A747 and PA12 was approximately 0.3-1%. Spores were never detected in mutants lacking SpoOA, ⁇ H , and ⁇ E .
  • a small number of heat-resistant cells was detected in the cultures of 1A747_s/ ' gFand PA12_s/gF (Table 5), showing that mutations in the spollAABC genes did not result in complete loss of spore formation. Based on these results, only strains containing mutations in the sigma E gene both produced control levels of pantothenate and were completely devoid of spore-forming bacteria.
  • PA12_spoOA (spoOAr.kan) 50 0
  • PA12_s/gH (spoOHAHindW- 60 0
  • This example describes the fermentation of ⁇ . subtilis pantothenate-overproducing strains containing sporulation-deficient mutations spoOA or spollG (sigE).
  • the sigE mutant (PA12_s/gE), the spoOA mutant (PA12_spoOA), and their parent, PA12, were grown in standard fed-batch fermentations using 2-liter lab scale fermentors for 48 hours. Both pantothenate levels and spore formation frequency of bacteria were measured during the course of the fermentation. As shown in Table 6, pantothenate production was similar in both the parent and the sigE mutant, but was reduced approximately 85% in the spoOA mutant. The yield of pantothenate on glucose was again similar between the sigE mutant and the parent strain. Spores were detected in the parent, but not in either mutant. Table 6. Sporulation and pantothenate production of ⁇ . subtilis strains PA12, PA12_spoOA, and PA12_s/g£ grown in 2-liter bench scale fermentation for 48 hours.
  • PA12_spoOA (spoOAr.kan) 1.4 0
  • This example describes the construction and testing of B. subtilis pantothenate overproducing strains containing null-mutations in spoOA and abrB.
  • Single and double abrB and spoOA mutations were introduced into PA49, a pantothenate- overproducing strain by transformation of chromosomal DNA from strains SWV215 (spoOAr.kan) and SWV119 (abrBrtet).
  • Transformants were selected on TBAB agar medium containing 10 ⁇ g/ml of Km for kan gene; and 10 ⁇ g/ml of tetracycline (Tc) for tet gene.
  • the transformation efficiency was 2x10 3 transformants/ ⁇ g DNA for spoOAr.kan, 4x10 2 transformants/ ⁇ g DNA for abrBr.tet and 4 transformants/ ⁇ g DNA for double spoOAr.kan and abrBrtet mutant.
  • the resulting strains were:
  • Tetracycline-resistant (Tc r ) transformant from SWV119 DNA was named PA1037;
  • PA1051 (spoOAr.kan abrBr.tet) 600 0
  • This example describes the construction and testing of B. subtilis pantothenate overproducing strain that overexpresses spoOA and contains a sporulation-deficient mutation (spollGA).
  • Example II it was shown that the lack of SpoOA decreased pantothenate production 2 to 3 fold compared to the parent strains.
  • an IPTG-inducible P spac -spoOA fusion was introduced into amyE gene of PA49 by transformation of chromosomal DNA from strain AH 1763 (amyEr.Pspa c spoOA[caf ⁇ ). Transformants were selected on TBAB agar medium containing 6 ⁇ g/ml of Cm and the resulted Cm r strain was named PA1025.
  • a sporulation-deficient mutation in spollGA was introduced into PA1025 by transformation of chromosomal DNA from strain 901 (spollGA::aphA-3). Transformants were selected on TBAB agar medium containing 6 ⁇ g/ml of Cm for cat gene and 10 ⁇ g/ml of Km for aphA-3 gene and the resulted Cm r and Km r strain was named PA1064.
  • PA1025 (P spac spoOA) 0 400 2.5x10 2
  • PA1025 (P spac spo0A) 10 670 3.7x10 3
  • Sporulation-specific sigma factor sigma 29 of Bacillus subtilis is synthesized from a precursor protein, p31. Proc. Natl Acad. Sci. USA 84: 1784-1788.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides sporulation-deficient microorganisms that are capable of overproducing pantothenate. A mutation in a gene which influences SigE function, or mutations in genes which influence Spo0A function and AbrB function render the microorganisms incapable of sporulation but substantially retain their capability of overproducing pantothenate. The microorganisms of the invention are particularly useful for the industrial production of pantothenate.

Description

Production of Pantothenate Using Microorganisms Incapable of Sporulation
Pantothenate is a member of the B complex of vitamins and is a nutritional requirement for mammals including humans, e.g., from food, sources, as a water-soluble vitamin supplement or as a feed additive. In cells, pantothenate is used primarily for the biosynthesis of coenzyme A and acyl carrier protein. These essential coenzymes function in the metabolism of acyl moieties, which form thioesters with the sulfhydryl group of the 4'- phosphopantethein portion of these molecules.
Pantothenate has been synthesized conventionally via chemical synthesis from bulk chemicals. However, the substrates required for chemical synthesis are expensive and the racemic intermediates have to be optically resolved. Accordingly, bacterial or microbial systems have been employed that produce enzymes useful in pantothenate biosynthesis processes. In particular, bioconversion processes have been evaluated as a means of favoring production of preferred isomer of pantothenic acid. Moreover, methods of direct microbial synthesis have recently been examined as a means of facilitating D-pantothenate production.
Patent applications WO 01/21772, WO 02/057474, and WO 02/061108 described a method to produce pantothenate using strains of B. subtilis 168 that have higher expression levels of biosynthetic genes involved in pantothenate production. These genes include panB, panC, panD, panE (ylbQ), ilvB, ilvN, ilvC, ilvD, glyA, and serA. To achieve higher expression levels of these genes, standard genetic recombinant methods were used that are known in the art. Pantothenate production of these engineered strains ranged from between 37 g/liter to 85 g/liter in 48 hour fed-batch fermentation.
From environmental and governmental regulatory viewpoints, it is important that genetically modified microorganisms do not have the ability to live in the natural environment if they escape from the manufacturing plant during the fermentation process or during disposal of the biomass. For this reason, sporulation-deficient strains of B. subtilis are used in fermentative processes (e.g. riboflavin - US5,837,528; biotin - US6,057,136). Typically, the spoOA mutation is used to arrest sporulation. The spoOA gene encodes a protein that regulates the initiation of sporulation. Inactivation of spoOA through either point, frame-shift, or deletion mutations arrests sporulation at its earliest stage, resulting in strains that are no longer resistant to chemical solvents, radiation and/or heat. In addition to mutations in spoOA, WO 97/03185 describes a method to produce commercially important enzymes that uses a mutation in the Bacillus licheniformis spollAC which encodes a sporulation-specific transcription sigma factor, σF, to obtain bacteria of the genus Bacillus other than B. subtilis that are incapable of sporulating.
The process of endospore formation (sporulation) in β. subtilis and other related Gram- positive bacteria consists of several stages. The entry into sporulation is governed by the phosphorylated SpoOA (Spo0A~P), a DNA-binding principal response regulator (Fawcett et al., 2000). Spo0A~P plays two crucial roles (Phillips and Strauch, 2002). At low intracellular concentrations, Spo0A~-P represses transcription of abrB that leads to lifting AbrB- dependent regulation of transition-state-associated gene expression. If the Spo0A~P concentration then reaches a higher critical level, it activates genes (sinl, spollG, spollE, spollA, etc.) required for the entry and commitment to sporulation. Since Spo0A~P represses transcription of abrB and AbrB represses transcription of sigH, therefore Spo0A~P indirectly activates genes that are in the regulon for σH, an alternative sigma factor governing the transcription of genes (spoOA, spoOF, spollA, phrC, phrE, etc.) involved in stationary growth phase and the early stages of sporulation (Britton et al., 2002). Examples of genes and gene products that increase or decrease the level of Spo0A~P and AbrB include, but are not limited to, abrB, kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, sigH, spoOA, spoOB, spoOE and spoOF. Examples of proteins that influence SpoOA~P-dependent binding at promoter sites to activate gene expression, include, but are not limited to, SpoOJA and SpoOJB. Examples of signals that increase or decrease the level of Spo0A~P and AbrB include, but are not limited to, nutritional, metabolic, DNA status, cell density (pheromones and quorum-sensing molecules) and cell cycle signals.
After these steps, the cell divides asymmetrically to generate two compartments of unequal size and dissimilar developmental fates (Piggot and Losick, 2002). The smaller compartment, the forespore, develops into the spore, whereas the larger compartment, the mother cell, nurtures the developing spore. When the spore morphogenesis is complete the mother cell lyses to liberate the mature spore. Differentiation involves the action of four cell- specific sigma factors: σF, σE, σG and σκ. The σF and σE factors are activated shortly after asymmetric division (polar septation, stage II.) when σF directs gene expression in the forespore (Margoiis et al., 1991) and σE directs gene expression in the mother cell (Dirks and Losick, 1991 ). Later in sporulation σF is replaced in the forespore by σG and σE is replaced by σκ in the mother cell (Losick and Stragier, 1992; Li and Piggot, 2001).
σE is derived from an inactive proprotein called pro-σE(LaBell et al., 1987). Synthesis of pro- σE commences prior to septation (Satola et al., 1992), but the proteolytic processing of pro- σEto mature σE occurs after asymmetric division in the mother cell. This reaction is mediated by a sporulation-specific protease, SpolIGA, that cleaves 27 amino acids from the pro-σE amino terminus (Stragier et al., 1988; Jonas et al., 1988; Peters and Haldenwang, 1994). Prior to the processing SpolIGA is activated by a secreted signalling protein (SpollR) that is produced in the forespore under the control of σF (Londono-Vallejo and Stragier, 1995; Hofmeister et al., 1995; Karow et al., 1995). Additional information on the activation of σE and other sigma factors is reviewed by Helmann and Moran (2002).
Combining sporulation mutations with other mutations into a single bacterium has been shown to result in unexpected gene activation. For example, the expression of ggt, a gene encoding γ-glutamyltranspeptidase, which is decreased in the absence of Spo0A~P, can be enhanced three- to four-fold above the wild-type expression level in a double abrB and spoø/A-null mutant (Xu and Strauch, 1996). Such strains are also unable to sporulate. It has not been recognized, however, that these strains may show pantothenate production at a level similar to or higher than that of control cells. In particular, the cells described in Xu and Strauch are not capable of overproducing a pantothenate compound.
Interestingly, the genetically modified pantothenate-producing B. subtilis 168 strains that are described in WO 01/21772, WO 02/057474, and WO 02/061108 are all wild-type for sporulation. No example is provided that shows the production of pantothenate in a sporulation-deficient strain.
It is an object of the present invention to provide sporulation-deficient microorganisms that are capable of overproducing pantothenate. It is a further object of the invention to provide a method for the preparation of sporulation-deficient microorganisms that is suitable also for Bacillus subtilis. It has been found that the commonly used spoOA mutation leads to a significant decrease in pantothenate production. However, it has been found that Bacillus subtilis cells lacking SigE activity or lacking both SpoOA and AbrB together were completely devoid of spore formation and showed pantothenate production at a level similar to or higher than that of control cells.
The present invention therefore relates to a sporulation-deficient microorganism being capable of overproducing a pantothenate compound. The microorganism may be modified such that the activity of SigE is reduced compared to the non-modified form of the microorganism. SigE is the gene product encoded by the gene spollGB. Reduced SigE activity may be caused by lack of spollGB expression, a decrease or lack of expression of the protease encoded by spollGA, a decrease or lack of expression of other upstream regulating genes or proteins, and the like. Preferably, the modification of the microorganism comprises a mutation that causes reduced SigE activity. More preferably, the mutation affects one or more genes selected from the group consisting of the genes spollGA, spollGB, spollR and spoil AC.
It has further been found that increasing the expression of the spoOA gene by use of constitutive or inducible promoters further increases pantothenate production in a B. subtilis pantothenate overproducing strain. Since this strain still forms spores, introduction of a sigE mutation will result in a B. subtilis strain that produces similar amount of pantothenate compared to the spoOA overproducing parent strain, and forms no spores. In a preferred embodiment of the invention, the microorganism having reduced SigE activity combined with higher SpoOA~P levels is therefore capable of producing more pantothenate without the formation of spores.
In another aspect of the invention, the microorganism may be modified such that the activity of both SpoOA and AbrB is reduced compared to the non-modified form of the microorganism. SpoOA and AbrB are gene products encoded by the spoOA and abrB genes, respectively. Reduced SpoOA and AbrB activity may be caused by lack of gene expression, a decrease or lack of signals (nutritional, metabolic, DNA status, cell density [pheromones and quorum-sensing molecules] and cell cycle signals), a decrease or lack of expression of other upstream regulating genes or proteins, and the like. Preferably, the modification of the microorganism comprises a mutation that causes reduced SpoOA/AbrB activity. More preferably, the mutation affects one, two or more genes selected from the group consisting of the genes abrB, kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, scoC, sigH, sinR, sinl, spoOA, spoOB, spoOE, spoOF, spoOJA and spoOJB.
The microorganism may be eukaryotic or prokaryotic. Preferably, the microorganism is prokaryotic. The prokaryotic microorganism may be Gram positive or Gram negative. Gram positive microorganisms include but are not limited to microorganisms belonging to one of the genera Bacillus, Corynebacterium, Lactobacillus, Lactococci and Streptomyces. Preferably the microorganism belongs to the genus Bacillus. Examples are Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus puntis, Bacillus halodurans, etc. Most preferably, the microorganism is Bacillus subtilis. The corresponding wild type forms of the microorganisms of the invention are spore-forming microorganisms.
The "pantothenate compound" preferably is pantothenate. Pantothenate compounds further include intermediate compounds in the biosynthetic pathway of pantothenate biosynthesis such as pantoate, α-ketopantoate, α-ketoisovalerate and the like.
The invention encompasses any mutation to a gene of the microorganism resulting in a reduced function of the sigE gene product (SigE protein). SigE function may be assayed in a sporulation assay known to those skilled in the art. The microorganism of the invention may have a mutation in its spollGB (sigE) gene resulting in the absence or decreased expression of functional sigE gene product. The invention further encompasses any mutation in genes known to activate spollGB (sigE). These include, but are not limited to, spollGA, spollR, and spollAC (sigF) (Helmann and Moran, 2002). The microorganism of the invention may have a mutation in its spollGA gene resulting in the absence or decreased expression of functional spollGA gene product. The microorganism of the invention may have a mutation in its spollR gene resulting in the absence or decreased expression of functional spollR gene product. The microorganism of the invention may have a mutation in its spollAC gene resulting in the absence or decreased expression of functional spollAC gene product.
The term "expression" denotes the transcription of a nucleic acid sequence and/or the subsequent translation of the transcribed sequence into an amino acid sequence. A decreased expression of a nucleic acid may be achieved by introducing a mutation to a gene, e.g. by deleting a gene; nucleotide additions or subtractions that inactivate or decrease the activity of the encoded protein through formation of a frame shift of the reading frame or premature termination of translation through introduction of a stop codon; modifying regulatory sequences such as promoters, ribosome binding sites, and other techniques described herein.
A "mutation" may be a deletion, substitution or addition in the sequence of a gene. The mutation may be a disruption, frame shift mutation or nonsense mutation. The mutation may be a disruption affecting the entire sequence of the gene or a portion thereof. The mutation may affect the coding or the non-coding sequence, e.g., the promoter, of the gene. The mutation may result in complete lack of transcription of the gene or in premature termination of translation. Likewise, the mutation may be located in a preceding (or "upstream") gene, which disrupts transcription of the adjacent (or "downstream") gene(s) by a process referred to as polarity. Alternatively, the mutation may have the effect that the translated protein carries a mutation in comparison with the wild type protein that renders the protein nonfunctional.
Methods of introducing suitable mutations into a gene are known to those skilled in the art. These methods include, but are not limited to, introduction of point mutations into the bacteria chromosome (Cutting and Vander Horn, 1990), removal of a chromosomal DNA segment and replacing the segment with an antibiotic resistance gene (Perego, 1993), direct insertion of a transposable element, such a transposon
Figure imgf000007_0001
or mini
Figure imgf000007_0002
(Youngman, 1990; Petit et al., 1990), or plasmids such as pMUTIN (Vagner et al., 1998).
Preferably, the sporulation-deficient microorganism having a reduced function of its sigE gene product is capable of overexpressing spoOA, more preferably it overexpresses spoOA. Overexpression of spoOA may be achieved as described herein.
Increased expression or overexpression of a gene may be achieved in a variety of ways. One approach to obtain microorganisms overexpressing one or more genes is to alter or modify regulatory sequences or sites associated with the expression of a particular gene, e.g. by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive. Further techniques are described infra.
A "promoter" is a DNA sequence upstream from the start of transcription of a gene and involved in recognition and binding of RNA polymerase and/or other proteins to initiate transcription of the gene. Usually, the promoter determines under what conditions the gene is expressed.
An "inducible promoter" is one which causes mRNA synthesis of a gene to be initiated temporally under specific conditions, (i) Promoters may be regulated primarily by an ancillary factor such as a repressor or an activator. The repressors are sequence-specific DNA binding proteins that repress promoter activity. The transcription can be initiated from this promoter in the presence of an inducer that prevents binding of the repressor to the operator of the promoter. Examples of such promoters from Gram-positive microorganisms include, but are not limited to, gnt (gluconate operon promoter); penP from Bacillus licheniformis; glnA (glutamine synthetase); xylAB (xylose operon); araABD (L-arabinose operon) and Pspac promoter, a hybrid SPO1//ac promoter that can be controlled by inducers such as isopropyl-β-D-thiogalactopyranoside [IPTG] (Yansura and Henner, 1984). Activators are also sequence-specific DNA binding proteins that induce promoter activity. Examples of such promoters from Gram-positive microorganisms include, but are not limited to, two-component systems (PhoP-PhoR, DegU-DegS, SpoOA-Phosphorelay), LevR, Mry and GltC. (ii) Production of secondary sigma factors can be primarily responsible for the transcription from specific promoters. Examples from Gram-positive microorganisms include, but are not limited to, the promoters activated by sporulation specific sigma factors: σF, σE, σG and σκ and general stress sigma factor, σB. The σB-mediated response is induced by energy limitation and environmental stresses (Hecker and Vόlker, 1998). (iii) Attenuation and antitermination also regulates transcription. Examples from Gram-positive microorganisms include, but are not limited to, trp operon and sacB gene, (iv) Other regulated promoters in expression vectors are based on the temperature-sensitive immunity repressor from phage ^105 (Osbourne et al., 1985) and the sacR regulatory system conferring sucrose inducibility (Klier and Rapoport, 1988).
A "constitutive" promoter is one that permits the gene to be expressed under virtually all environmental conditions, i.e. a promoter that directs constant, non-specific gene expression. A "strong constitutive promoter" is one which causes mRNAs to be initiated at high frequency compared to a native host cell. Strong constitutive promoters are well known and an appropriate one may be selected according to the specific sequence to be controlled in the host cell. Examples of such strong constitutive promoters from Gram-positive microorganisms include, but are not limited to, SP01-26, SP01-15, veg, pyc (pyruvate carboxylase promoter), and amyE. Examples of promoters from Gram-negative microorganisms include, but are not limited to, tac, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, 73, gal, trc, are, SP6, λ-PR, and λ-PL.
The invention further encompasses any mutation to one or more genes resulting in a reduced function of both SpoOA and AbrB. SpoOA and AbrB function may be assayed in an enzyme assay for γ-glutamyltranspeptidase (Xu and Strauch, 1996) and with microarray technology known to those skilled in the art. In addition, SpoOA function may be assayed in a sporulation assay; and AbrB function may be assayed with lacZ reporter gene fused to AbrB-regulated promoters (spoOVG, tycA, abrB, etc.). The microorganism may have at least one mutation in its spoOA gene and at least one mutation in its abrB gene. The mutations result in the absence or decreased expression of functional spoOA gene product and in the absence or decreased expression of functional abrB gene product.
Mutations to one or more genes resulting in a reduced function of SpoOA include mutations to genes known to activate spoOA. These include, but are not limited to, spoOB, spoOF, kinA, kinB, kinC, kinD, kinE and sigH. The microorganism of the invention may have a mutation in its spoOB resulting in the absence or decreased expression of functional spoOB gene product. The microorganism of the invention may have a mutation in its spoOF resulting in the absence or decreased expression of functional spoOF gene product.
In a specific embodiment of the invention, the mutation resulting in a reduced SigE function and the mutations resulting in a reduced function of both SpoOA and AbrB may be combined. Accordingly, the preferred embodiments of the various mutations and modifications described herein may be combined. This applies to the method described infra mutatis mutandis.
The microorganism of the invention is capable of overproducing a pantothenate compound under suitable conditions. As used herein, the term "overproducing a pantothenate compound" refers to significantly increased production of the pantothenate compound by the microorganism of the invention in comparison to the wild type form of said microorganism. Preferably, overproduction of pantothenate means production of at least 50 mg, 100 mg, 200 mg, 500 mg, 1 g, 3 g, 5 g or 10 g pantothenate per liter culture medium.
In one embodiment, a population of the microorganisms of the invention produces at least 100 mg, preferably at least 125 mg, more preferably at least 140 mg, more preferably at least 200 mg, still more preferably at least 300 mg, even more preferably at least 400 mg, most preferably at least 500 mg pantothenate per liter culture medium when cultured under the conditions as described in Example II. In this example culturing in minimal medium is described. Alternatively, a population of the microorganisms of the invention may produce at least 100 mg, preferably at least 125 mg, more preferably at least 140 mg, more preferably at least 200 mg, still more preferably at least 300 mg, even more preferably at least 400 mg, most preferably at least 500 mg pantothenate per liter culture medium when cultured under the conditions as described in Example IV or V.
In another aspect, a population of the microorganisms of the invention produces at least 5 g, preferably at least 7.5 g, most preferably at least 10 g pantothenate per liter culture medium when cultured under conditions as described in Example III. This example describes fed-batch fermentation.
The level of pantothenate production by the sporulation-deficient microorganisms of the invention is comparable to the level of pantothenate production by control cells. Therefore, the amount of the pantothenate compound produced by a population of the microorganisms of the invention may be greater than 50%, preferably greater than 75%, more preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient when cultured under identical conditions. When cultured under the conditions described in Example II, it is preferred, that the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient. When cultured under the conditions described in Example III, it is preferred, that the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75%, most preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient. When cultured under the conditions described in Example IV, it is preferred, that the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75%, most preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient. When cultured under the conditions described in Example V, it is preferred, that the amount of the pantothenate compound produced by a population of the microorganisms of the invention is greater than 50%, preferably greater than 75%, most preferably greater than 100% of the amount of the pantothenate compound produced by a population of the corresponding microorganisms not being sporulation-deficient.
The "corresponding microorganism not being sporulation-deficient" is preferably a microorganism which has not been modified such that it exhibits reduced SigE function or a reduced SpoOA and ArbB function. For example if the microorganism of the invention has a mutation in its spollGA gene, then the corresponding microorganism not being sporulation- deficient is a microorganism that is substantially identical with the exception that is has no mutation in its spollGA gene. The same applies to mutations in other genes.
Overproduction of a pantothenate compound can be achieved in a variety of ways. Methods of preparing strains of Bacillus subtilis overproducing pantothenate are described in, e.g., WO 01/21772, WO 02/057474, and WO 02/061108. One approach to obtain pantothenate- overproducing microorganisms is to overexpress one or more genes involved in the pantothenate biosynthetic pathway. The term "overexpressed" or "overexpression" includes expression of a gene product at a level higher than that expressed prior to modification of the microorganism or in a comparable microorganism which has not been modified. In one embodiment, the microorganism of the invention overexpresses one or more genes selected from the group consisting of panB, panC, panD, panE, ilvB, ilvN, ilvC, ilvD, glyA, and serA, ylmA as well as the gcv genes involved in the glycine cleavage pathway.
Overexpression of a gene in a microorganism can be performed according to any methodology described herein including, but not limited to, deregulation of a gene and/or overexpression of at least one gene. In one embodiment, the microorganism can be genetically manipulated, e.g., genetically engineered, to overexpress a level of gene product greater than that expressed prior to modification of the microorganism or in a comparable microorganism which has not been modified. Genetic manipulation can include, but is not limited to, altering or modifying regulatory sequences or sites associated with the expression of a particular gene, e.g., by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive, modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as ribosome binding site or transcription terminator, increasing the copy number of a particular gene, modifying proteins, e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like, involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventional means of deregulating expression of a particular gene routine in the art (including, but not limited to, the use of antisense nucleic acid molecules, e.g., to block expression of repressor proteins). Examples of suitable promoters are, but are not limited to, Pveg, P15 and P26 (Lee et al., 1980, Mol. Gen. Genet. 180:57-65 and Moran et al., 1982, Mol. Gen. Genet. 186:339-46.
In another embodiment, the microorganism can be physically or environmentally manipulated to overexpress a level of gene product greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which has not been manipulated. For example, a microorganism can be treated with or cultured in the presence of an agent known or suspected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased. Alternatively, a microorganism can be cultured at a temperature selected to increase the transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased.
The term "deregulated" or "deregulation" includes the alteration of modification of at least one gene in a microorganism such that the level or activity of the gene product in a microorganism is altered or modified. Preferably, at least one gene is altered or modified such that the gene product is enhanced or increased.
The invention further relates to a method for the preparation of a sporulation-deficient microorganism capable of overproducing a pantothenate compound. A microorganism capable of overproducing a pantothenate compound may be modified such that it contains a mutation in a gene regulating SigE function and optionally an increased function of SpoOA. According to this embodiment, the method comprises
(a) providing a microorganism that is capable of overproducing the pantothenate compound,
(b) optionally introducing in the microorganism a DNA sequence (e.g. promoter) or a mutation that causes increased SpoOA function, and
(c) introducing in the microorganism of step (a) or (b) a mutation that causes reduced SigE function such that a sporulation-deficient microorganism is obtained. The order of steps (b) and (c) may be changed.
Alternatively, the method may comprise
(a) providing a microorganism that is capable of overproducing the pantothenate compound, and
(b) introducing in the microorganism of step (a) mutations that cause reduced SpoOA function and reduced ArbB function such that a sporulation-deficient microorganism is obtained.
In another embodiment, the mutation of the sigE gene or the mutations of the spoOA gene and of the arbB gene may be introduced prior to carrying out the mutations leading to overproduction of the pantothenate compound. In accordance with that embodiment, the method comprises
(a) providing a microorganism that is incapable of overproducing the pantothenate compound,
(b) introducing in the microorganism of step (a) a mutation that causes reduced SigE activity or introducing in the microorganism of step (a) mutations that cause reduced SpoOA activity and reduced AbrB activity such that a sporulation-deficient microorganism is obtained, and
(c) modifying the sporulation-deficient microorganism obtained in step (b) such that it is capable of overproducing the pantothenate compound.
If in step (b) of this method a mutation is introduced that causes reduced SigE activity, the method may comprise the optional step of introducing in the microorganism of step (a) or (b) or (c) a DNA sequence (e.g. promoter) or a mutation that causes increased SpoOA function.
Another aspect of the invention is a method for producing a pantothenate compound comprising (a) culturing a microorganism according to the invention under conditions such that the pantothenate compound is produced; and (b) optionally recovering the pantothenate compound from the cell culture medium. The method of the invention comprises the step of culturing the modified microorganisms under conditions such that a pantothenate compound is produced. The term "culturing" includes maintaining and/or growing a living microorganism of the present invention. In one embodiment, a microorganism of the invention is cultured in liquid media. In another embodiment, a microorganism is cultured in solid media or semi-solid media. Preferably, the microorganism of the invention is cultured in liquid media comprising nutrients essential or beneficial to the maintenance and/or growth of the microorganism. Such nutrients include, but are not limited to, carbon sources or carbon substrates, e.g. complex carbohydrates such as bean or grain meal, starches, sugars, sugar alcohols, hydrocarbons, oils, fats, fatty acids, organic acids and alcohols; nitrogen sources, e.g. vegetable proteins, peptones, peptides and amino acids derived from grains, beans and tubers, proteins, peptides and amino acids derived from animal sources such as meat, milk and animal byproducts such as peptones, meat extracts and casein hydrolysates; inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium nitrate and ammonium phosphate; phosphorous sources, e.g. phosphoric acid, sodium and potassium salts thereof; trace elements, e.g. magnesium, iron, manganese, calcium, copper, zinc, boron, molybdenum and/or cobalt salts; as well as growth factors such as amino acids, vitamins, growth promoters and the like.
The microorganisms are preferably cultured under controlled pH. In one embodiment, microorganisms are cultured at a pH of between 6.0 and 8.5, more preferably at a pH of about 7. The desired pH may be maintained by any method known to those skilled in the art.
Preferably, the microorganisms are further cultured under controlled aeration and under controlled temperatures. In one embodiment, the controlled temperatures include temperatures between 15 and 70°C, preferably the temperatures are between 20 and 55°C, more preferably between 30 and 45°C or between 30 and 50°C.
The microorganisms may be cultured in liquid media either continuously or intermittently, by conventional culturing methods such as standing culture, test tube culture, shaking culture, aeration spinner culture or fermentation. Preferably, the microorganisms are cultured in a fermentor. Fermentation processes of the invention include batch, fed-batch and continuous methods of fermentation. A variety of such processes have been developed and are well known in the art. The culturing is usually continued for a time sufficient to produce the desired amount of the pantothenate compound.
In another aspect of the invention, the method further comprises the step of recovering the pantothenate compound. The term "recovering" includes isolating, extracting, harvesting, separating or purifying the compound from culture media. Isolating the compound can be performed according to any conventional isolation or purification methodology known in the art including, but not limited to, treatment with a conventional resin, treatment with a conventional adsorbent, alteration of pH, solvent extraction, dialysis, filtration, concentration, crystallization, recrystallization, pH adjustment, lyophilisation and the like. For example, the pantothenate compound can be recovered from culture medium by first removing the microorganisms from the culture. Media is then passed through or over a cation exchange resin to remove unwanted cations and then through or over an anion exchange resin to remove unwanted inorganic anions and organic acids having stronger acidities than the compound of interest, e.g. pantothenate. The resulting pantothenate can subsequently be converted to salt as described herein.
Usually, the compound is "isolated" when the resulting preparation is substantially free of other components. In one embodiment, the preparation has a purity of greater than about 80% (by dry weight) of the desired compound (e.g. less than about 20% of all the media, components or fermentation byproducts) more preferably greater than about 90% of the desired compound, even more preferably greater than about 95% of the desired compound and most preferably greater than about 98 to 99% of the desired compound.
In another embodiment, the desired compound is not purified from the microorganism or the culture. The entire culture or the culture supernatant may be used as a source of the product. In a specific embodiment, the culture or the culture supernatant is used without modification. In a further embodiment, the culture or the culture supernatant is concentrated, dried and/or lyophilized.
The various embodiments of the invention described herein may be cross-combined.
The following non-limiting examples further illustrate the invention. EXAMPLES
General Methodology
Strains and plasmids. Bacillus subtilis strains of the present invention are derived from strain 1A747 (Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA), which is a prototrophic derivative of B. subtilis 168 (trpC2). The chloramphenicol-resistance gene (cat) cassette was obtained from plasmid pC194 (GeneBank M19465, Cat# 1 E17 Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA). The P15 promoter of the B. subtilis bacteriophage SPO1 (Lee et al., 1980, Mol. Gen. Genet. 180:57-65) was obtained from plasmid pXI23roDTD-SPO1- 15, a derivative of plasmid pX12 (Hϋmbelin et al., 1999, J. Ind. Microbiol. Biotech. 22:1-7) containing the SP01-15 promoter from RB50::[pRF69]::[pRF93] (Perkins et al., 1999, J. Ind. Microbiol. Biotech. 22:8-18). Mutations in sporulation genes were derived from strains SWV215 [trpC2 pheA1 spoOAr.kan] (Xu and Strauch, 1996, J. Bacteriol. 178:4319-4322), BHI [trpC2 pheA1 spoOHAHind\\\-EcoR\::cat] (BHI is a derivative of BH100 in ref. Healy et al., 1991 , Mol. Microbiol. 5:477-487), 650 [trpC2 ilvB2 leuB16 spollAABC::caf\ (Pragai et al., 2004, J Bacteriol. 186:1182-1190), 731 [trpC2 spolllG .ermC] (Partridge and Errington,
1993, Mol. Microbiol. 8:945-955), and 901 [trpC2 spollG A:\aphA-3] (Wu and Errington,
1994, Science 264:572-575). Mutation in abrB gene was derived from strain SWV119 [trpC2 pheA1 abrB::tet] (Xu and Strauch, 1996). For overexpression of spoOA gene, Pspacspo0A fusion was derived from strain AH 1763 [trpC2 metC3 spo0A::neo amyE::Pspac spoOA(cat)] (Henriques, A, personal communication).
Media. Standard minimal medium (MM) for B. subtilis contains 1X Spizizen salts, 0.04% sodium glutamate, and 0.5% glucose. Standard solid complete medium is Tryptone Blood Agar Broth (TBAB, Difco). Standard liquid complete medium is Veal Infusion-Yeast Extract broth (VY). The compositions of these media are described below:
TBAB medium: 33g Difco Tryptone Blood Agar Base (Catalog # 0232), 1 L water.
Autoclave.
VY medium: 25g Difco Veal Infusion Broth (Catalog # 0344), 5g Difco Yeast Extract
(Catalog #0127), 1 L water. Autoclave. Minimal Medium (MM): 100ml 10X Spizizen salts; 10 ml 50% glucose; 1 ml 40% sodium glutamate, qsp 1 L water.
10X Spizizen salts: 140g K2HPO4; 20g (NH4)2SO4; 60g KH2PO4; 10g Na3 citrate.2H2O; 2g
MgSO4.7H2O; qsp 1 L with water.
P-medium: 100 ml 10X PAM; 100ml 10X Spizizen salts; 10 ml 50% glucose; 790 ml sterile distilled water.
P-agar medium: 100 ml 10X PAM; 100ml 10X Spizizen salts; 10 ml 50% glucose; 790 ml sterile distilled water containing 15 g of agar.
10X Pantothenate Assay Medium (10X PAM): 73g Difco pantothenate assay medium
(Catalog # 260410), 1 L water. Autoclave.
10X VFB minimal medium (10X VFB MM): 2.5g Na-glutamate; 15.7g KH2PO4; 15.7g
K2HPO4; 27.4 g Na2HPO4.12H2O; 40g NH4CI; 1 g citric acid; 68 g (NH4)2SO4; qsp 1 L water.
Trace elements solution: 1.4g MnSO4-H2O; 0.4g CoCI2-6H2O; 0.15g (NH4)6Mo7O24-4H2O;
0.1 g AICI3-6H20; 0.075g CuCI22H2O; qsp 200 ml water
Fe solution: 0.21 g FeSO4.7H20; qsp 10 ml water.
CaCI? solution: 15.6g CaCI2.2H2O; qsp 500 ml water.
Mg/Zn solution: 100g MgSO4.7H2O; 0.4g ZnSO4.7H2O; qsp 200 ml water.
VFB MM medium: 100 ml 10X VFB MM; 10 ml 50% glucose; 2 ml Trace elements solution;
2 ml Fe solution; 2 ml CaCI2 solution; 2 ml Mg/Zn solution; 882 ml sterile distilled water.
VFB MMGT medium: 100 ml 10X VFB MM; 100 ml 0.5 M Tris (pH 6.8); 44 ml 50% glucose;
2 ml Trace elements solution; 2 ml Fe solution; 2 ml CaCI2 solution; 2 ml Mg/Zn solution;
748 ml sterile distilled water.
VF fermentation batch medium: Sterilized in place in solution: 0.75g sodium glutamate;
4.71 g KH2PO4; 4.71 g K2HPO4; 8.23g Na2HPO4-12H2O; 0.23g NH4CI; 1.41g (NH4)2SO4;
11.77g Yeast extract (Merck); 0.2 ml Basildon antifoam; qsp 1L.
Added as autoclaved solution to the fermentor: 27.3g glucose-H2O; qsp 1 L.
Added as filter-sterilized solution to the fermentor: 2ml trace elements solution; 2ml CaCI2- solution; 2ml Mg/Zn-solution; 2ml Fe-solution; qsp 1 L.
VF fermentation feed medium: 660g glucose-H2O; qsp 1 L. Autoclave. Add 2g MgSO4-7H2O;
14.6mg MnSO4-H2O; 4mg ZnSO4-H2O; qsp 1L (autoclaved).
Pantothenate assays. Pantothenate was assayed using three biological and one physical (HPLC) methods:
Biological assay I - plate bioassav: Pantothenate was assayed on agar plates using an indicator derived from Salmonella typhimurium using known methods. Strain DM3 (panC355) (D. Downs, University of Wisconsin at Madison, Madison, Wisconsin USA) responds only to pantothenate. 10 ml of P-agar medium containing 107 cells/ml of S. typhimurium DM3 (panC355) indicator strain and 40 μg/ml of 2,3,5-triphenyltetrazoiium chloride (Fluka; Catalog # 93140) was layered above 20 ml of P-agar medium used as a bottom agar in a standard Petri dish. Using sterile pipette tips, bacteria from single colonies, grown on TBAB agar, were transferred onto the bioassay P-agar plates. After over-night incubation at 37°C, observable purple halos of S. typhimurium DM3 were formed around the B. subtilis colonies, that produced more than -10 mg/l Pan. The size of the halo correlated with the Pan production of the B. subtilis strain.
Biological assay II - test tube bioassay: Pantothenate was assayed in liquid using test tube cultures. To assay β. subtilis cultures, supernatants were filtered sterilized and dilutions prepared using 1X pantothenate assay medium (PAM) in test tubes. The total volume of the dilutions was 5.0 ml. To these dilution test tubes, 0.1 ml of a 200-fold dilution of the DM3 indicator stock (in 1X PAM) was added. The test tubes were then incubated in a roller-drum- type shaker at 37°C for 18-24 hours. Turbidity readings were made at 600 nm (OD60o) and compared to a standard curve of known quantities of pantothenate. Specifically, the standard curve was prepared by diluting authentic pantothenate to levels of 0.8, 4, 20, 50, and 100 μg/liter, adding to each dilution the indicator as prepared above, and measuring turbidity after 18-24 hours at 37°C (same incubation time as the unknown samples). The linear portion of the standard curve was used to generate a logarithmic regression equation. This equation was then used to calculate pantothenate concentrations in unknown samples using the OD6oo values of the diluted samples.
Biological assay 111 - 96-well microtiter plate bioassay: Pantothenate was also assayed in liquid using a 96-well microtiter plate format. 180 μl of pantothenate assay medium (PAM) containing 5.5x105 cell/ml of S. typhimurium DM3 was loaded into each well of the 96-well microtiter plate. To assay B. subtilis cultures, 60 μl of filtered sterilized supernatant of the cultures were added into the wells in column 1 , rows B-H. After mixing, 60 μl of the samples were transferred into the next wells in column 2. These 4-fold dilution steps were repeated until column 12. At column 12 after mixing the samples, 60 μl was discarded and in this way each well contained 180 μl of samples. Adhesive film was place onto the plate to avoid evaporation and the cultures were incubates at 37°C for 17 h with an agitation of 300 rpm. Turbidity readings were made at 600 nm and compared to a standard curve of known quantities of pantothenate (Pan) The standard curve was prepared by adding 60 μl of Pan standard (100 mg/ml) into the well in column 1 and row A of each microtiter plate. Dilution, incubation and measuring turbidity of the Pan standard was done as described above with the unknown samples.
HPLC assay: Chromatography of samples was performed on a Phenomenex LUNA C8 column, using an Agilent 1100 HPLC system equipped with a thermostatted autosampler and a diode array detector. The column dimensions are 150 x 4.6 mm, particle size 5 micron. The column temperature was kept constant at 20°C. The mobile phase is a mixture of 0.1 % acetic acid (A) and methanol (B). Gradient elution is applied, ranging from 1 % B to 45% B in 15 minutes. The flow rate is 1 ml/min. Pantothenate was monitored using UV absorption at 220 nm, and is eluted at approximately 9.6 min. The calibration range of the method is from 1 to 100 mg/l pantothenate.
Molecular and genetic techniques. Standard genetic and molecular biology techniques are generally know in the art and have been previously described. DNA transformation, PBS1 generalized transduction, and other standard B. subtilis genetic techniques are also generally know in the art and have been described previously (Harwood and Cutting, 1992).
Sporulation assay. 1 ml of sample was taken from the B. subtilis cultures and 10-fold dilution series was prepared in sterile distilled water. After a 20 min heat-treatment at 80°C, dilutions were plated on TBAB agar, incubated for 20 h at 37°C and then the number of 'heat-resistant' colony forming units (cfu) in 1 ml of the original culture was determined. Sporulation frequency was calculated by dividing the titer (cfu/ml) of heat resistant spores by the titer (cfu/ml) of bacterial cells before heat treatment.
Fermentations. Pantothenate producing strains were grown in stirred tank fermentors, for example, in BIOFLO 3000 New Brunswick 2 liter vessels initially containing 1.4 liters of VF fermentation batch medium with glucose/salt solution. Computer control was done by NBS Biocommand 32 commercial software (New Brunswick Scientific Co., Inc., Edison, NJ, USA); Lucullus software (Biospektra AG, Schlieren, Switzerland) was used for data collection and controlling the glucose feeding.
To prepare the inoculum for the fermentation, a two-seed culture protocol was used. The first seed consisted of inoculating 25 ml of VY medium containing 10 g/liter sorbitol with 50 μl of a frozen bacterial stock culture and growing the culture for 6 hours at 37°C. 1 OD of cells was then used to inoculate 60 ml of VF Fermentation batch medium containing 10 g/liter sorbitol (no glucose) and this second seed was grown for 8-12 hours at 37°C. This second seed was then used to inoculate the fermentation vessel, the amount of which is usually 4-5% of the initial media volume. Frozen bacterial stocks were prepared by growing bacteria in VY medium to late exponential stage (OD600 = 0.8-1.0), adding sterile glycerol to a final concentration of 20%, and then freezing 1 ml samples on dry ice and storing the frozen bacteria at -80°C.
During fermentation, a pH of 6.8 was kept constantly in the reactor by the automatic addition of ammonium hydroxide solution (28% in water). The fermentation temperature was 39°C. A minimum concentration of 15% dissolved oxygen (pO2) was achieved by automatic cascading of the stirrer (ranging from 400 rpm to 1000 rpm) and manually maintaining the airflow between 1-2 vvm. Antifoam (Basildon) was added manually as needed.
Fermentations can be batch processes but are preferably, carbohydrate-limited, fed-batch processes. Therefore a defined VF fermentation feed solution (see above) was provided to the reactor after consumption of the initial glucose which was usually the case after 6-8 hours process time. At that time, a constant addition of the feed solution was initiated at a rate of 14 g/h.
EXAMPLE I
This example describes the construction of pantothenate-overproducing strains of B. subtilis.
B. subtilis strain PA12
Polymerase Chain Reaction (PCR) was used to generate a deletion mutation in the promoter region of the panBCD operon of a B. subtilis prototroph strain 1A747, in which a 215 bp-long nucleotide region between birA and panB was replaced with the chloramphenicol resistance (cat) cassette from Staphylococcus aureus (GeneBank M58515). To do this, the cat cassette was first introduced between the Nhel and C/al sites of the pBR322 plasmid (GeneBank J01749) in an orientation opposite to the transcriptionai direction of panB. Two PCR fragment „arms" were then generated: 0.2 μl of a 100 mM solution of primer panB/up2/for/R1 and panB/up2/rev/Clal or primers panB/down2/for/Nhel and panB/down2/rev/Bam (Table 1) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles, using an annealing temperature of 58 °C and an elongation time of 60 seconds. The resulting fragments called F1 and F2, respectively, were purified, and inserted sequentially, respectively between the EcoRI and C/al sites (for F1) and the Nhe\ and βa HI (for F2). Ligated DNA was transformed into E. coli TOP10 cells (Invitrogen), selecting for ampicillin- resistance at 100 μg/ml concentration. This resulted in the E. coli plasmid pPA5. The ApanBp.:cat deletion cassette was then next introduced into the chromosome of B. subtilis 1A747 by DNA transformation, selecting for chloramphenicol-resistance (Cmr) on TBAB agar plates containing 5 μg/ml chloramphenicol (Cm) using standard conditions. A single Cmr colony containing a deletion in the panB promoter region was isolated and named PA1 (ApanBp.-.cat). As expected PA1 was also a pantothenate auxotroph (Pan"), which requires pantothenate for growth on minimal medium. The deletion mutation was confirmed by diagnostic PCR using panB/up2/for/R1 and panB/down2/rev/Bam primers (Table 1 ), again using standard reaction conditions.
Table 1. Primers used to generate a B. subtilis strain containing a ApanBp::cat deletion mutation.
Name Nucleotide sequence (5'>3') SEQ ID NO: cat for/Nhel ATGCGCTAGCCGAAAATTGGATAAAGTGGG 1 cat/rev/Clal ATGCATCGATAAGTACAGTCGGCATTATCTCATA 2 panB/up2/for/R1 ATGCGAATTCGGGTATGGCATTCTCAAGAAGG 3 panB/down2/rev/Bam ATGCGGATCCGCCGTCAAGCACTGTCTGG 4 panB/up2/rev/Clal ATGCATCGATGGAAGTATACCAAAATCAACGG 5 panB/down2/for/Nhel ATGCGCTAGCATGAAAACAAAACTGGATTTTC 6
The next step was to introduce a strong constitutive promoter upstream of the panB gene. Any number of such promoters are described in the literature, including those derived from the SP01 bacteriophage of B. subtilis, P15 and P26 (Lee et al., 1980). Long Flanking Homology Polymerase Chain Reaction (LFH-PCR) was used to generate DNA fragments containing P15 upstream of the ribosome binding site (RBS) of panB. To do this, two PCR fragment „arms" were first created: 0.2 μl of a 100 mM solution of primer PlpanBCD and P2panBCD or primers P3panBCD and P4panBCD (Table 2) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7 °C and an elongation time of 45 seconds. The resulting fragments called F3 and F4 respectively, were purified and next used as primers in a second round of PCR. F3 and F4 fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pXI23roDTD-SPO1-15 (containing the P15 promoter) in a 50 μl reaction volume. In the first 10 cycles, an annealing temperature of 63 °C and an elongation time of 6 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50-fold and 1 μl was combined with 0.2 μl of a 100 mM solution of primer PlpanBCD and P4panBCD in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were next transformed into the panB promoter-deleted strain PA1 by DNA transformation, selecting for pantothenate prototrophy (Pan+) on minimal medium agar plates using standard conditions. These Pan+ colonies were also chloramphenicol sensitive (Cms), confirming the insertion of the promoter cassette. A single Pan+ Cms colony containing a panBCD operon expressed from the Pι5 promoter was isolated and named PA12 (P15 panBCD). The presence of the P15 promoter upstream of panB gene was confirmed by diagnostic PCR using P15seq and P4panBCD primers (Table 2), again using standard reaction conditions. In shake-flask cultures, PA12 produced approximately 100 mg/liter pantothenate in VFB MM medium and 250 mg/liter pantothenate in VFB MMGT medium (based on HPLC/MS assays) whereas the 1A747 control produced less than 1 mg/liter pantothenate. In standard fed-batch fermentation using VF medium and growth conditions, PA12 produced around 10-14 g/liter pantothenate at 48 hours. Table 2. Primers used to generate a B. subtilis strain containing a P15 panBCD expression cassette.
Name Nucleotide sequence (5'>3') SEQ ID NO:
PlpanBCD CCTTATTGAATTATTTTCTCAGGCCG 7
P2panBCD GGACTGATCTCCAAGCGATGGATGGAAGTATACCAAAATCAACGGC 8 P3panBCD TCGAGAATTAAAGGAGGGTTTCATATGAAAACAAAACTGGATTTTCT 9 P4panBCD CGGATATGCTTCAAAATCTTCATTAGG 10
P15seq CTACTATTTCAACACAGCTATCTGC 11
S. subtilis strain PA49
To construct a strain that also contained a strong constitutive promoter upstream of the panE gene (ylbQ), a deletion mutation was first constructed. Inspection of the panE gene reveals two potential start sites: Start Site 1 (5' - AAATTGGGTG - 3' (RBS)- 7 nt - ATG) that overlaps a βspHI site and is 33 bp upstream from Start Site 2 (5' - GGAGG - 3' (RBS) - 5 nt - TTG) that overlaps a βsaXI site. Consequently, a 219 bp deletion of the panE/ylbQ promoter region was constructed by LFH-PCR using a S. aureus erythromycin resistance (Emr) gene (GeneBank V01278). To do this, two PCR fragment „arms" were first created: 0.2 μl of a 100 mM solution of primer Pl panE and P2panE/Er or primers P3panE/Er/2 and P4panE (Table 3) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μi of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacture (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7°C and an elongation time of 45 seconds. The resulting fragments called F1 and F2 respectively, were purified and next used as primers in a second round of PCR. F1 and F2 fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pDG646 (containing the erm cassette; Guerout-Fleury et al., 1995) in a 50 μl reaction volume. In the first 10 cycles, an annealing temperature of 63°C and an elongation time of 6 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50-fold and 1 μl was combined with 0.2 μl of a 100 mM solution of primer Pl panE and P4panE in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were next transformed into the PA4 (Trp+ colonies obtained from B. subtilis CU550 trpC2 ilvC4 leu-124 by transformation with 1A747 chromosomal DNA) resulted in Emr colonies that were pantothenate auxotrophs. This strain was called PA5 (ApanEp::erm ilvC leuC). Diagnostic PCR was used to confirm the structure of the deletion. Subsequently, the panB promoter deletion was introduced into PA5 by transformation of PA1 chromosomal DNA at non- congressional concentration to generate PA6 (ilvC leuC ApanBp::cat ApanEp::erm).
Table 3. Primers used to generate a β. subtilis strain containing a ApanEp::cat deletion mutation.
Name Nucleotide sequence (5'>3') SEQ ID NO:
PlpanE GGCAGCCTGTGGTTTCAGGTGG 12
P2panE/Er ATTATGTCTTTTGCGCAGTCGGCCGTCTGCTTATCAACTATAAA 13
ACGC
P3panE/Er/2 CATTCAATTTTGAGGGTTGCCAGGCCTATTATTTGTCACTTTAT 14
CACG
P4panE CCAGTCTTTCGCGCCACATGTCC 15
The next step was to introduce simultaneously strong constitutive Pι5 promoters upstream of the both panB and panE. LFH-PCR was used again to generate DNA fragments containing P15 upstream of open reading frame of panB and containing P15 upstream of the open reading frame of panE. To do this, two PCR fragment „arms" were created for panB and for panE using primers PlpanB and P2panB/P15 (F1 ) and primers P3panB/P15 and P4panB (F2) (Tables 1 and 2, P1spanB construction), and PlpanE and P2panE/P15 (F1 ) and P3panE/P15 and P4panE (F2) (Tables 3 and 4, P15 panE construction), using the same PCR protocol used to construct PA12 (see above).
Table 4. Primers used to generate a B. subtilis strain containing a Pι5panE expression cassette.
Name Nucleotide sequence (5'>3') SEQ ID NO:
P2panE/P15 GGACTGATCTCCAAGCGATGGGAATTTTTTAAATAAAGCGTTTA 16
CAATAT
P3panE/P15 TCGAGAATTAAAGGAGGGTTTCATATGAAAATTGGAATTATCGG 17
CGGAG The finished P15panB and Pι5panE PCR fragments were then transformed together into the panB and panE promoters deleted strain PA6 (ilvC leuC ApanBp::cat ApanEp::erm) by DNA transformation, selecting for pantothenate prototrophy (Pan+) on minimal medium agar plates using standard conditions. Recovered Pan+ colonies were also Cms and erythromycin sensitive (Ems), confirming the insertion of the promoter cassettes. A single Pan+ Cms Ems colony containing both panBCD operon and panE gene expressed from the P15 promoter was isolated and named PA32. The presence of the P15 promoter upstream of panB gene was confirmed by diagnostic PCR using P15seq and P4panB primers (Tables 1 and 2), again using standard reaction conditions. An identical control was performed on the panE gene using P15seq and P4panE primers (Tables 3 and 4). Subsequent sequencing of the Pis promoter in front of panE, however, revealed a partial deletion of the P« promoter.
To replaced the partially deleted « panE gene with the correct construction, the ApanEp::erm mutation was re-introduced into PA32 by DNA transformation using chromosomal DNA from PA5 (ApanEp::erm ilvC leuC) and selecting for erythromycin- resistance. This resulted in strain PA41 (P15 panBCD ApanEp::erm HvC leuC). PιSpanE DNA fragments, generated by LFH-PCR as described before, was then transformed into PA41, selecting for Pan+ prototrophs. This resulted in strains PA43 (ilvC leuC P15 panBCD P15 panE). This llv" Leu" auxotrophic strain was then transduced to llv+ Leu+ prototrophy using a PBS1 phage lysate prepared on wild-type β. subtilis 1A747, using standard procedures. This resulted in strain PA49 (P15 panBCD P15 panE) .
In shake-flask cultures, PA49 produced on average approximately 400 mg/liter pantothenate in VFB MMGT medium (based on HPLC/MS assays).
EXAMPLE II
This example describes the construction and testing of B. subtilis pantothenate overproducing strains containing sporulation-deficient mutations spoOA, spoOH, spollA (sigF) spollG (sigE) and spolllG (sigG). Construction of B. subtilis mutants deficient in spore formation.
Sporulation-deficient mutations were introduced into 1A747 (wild-type strain) and PA12, a pantothenate-overproducing strain by transformation of chromosomal DNA from strains SWV215 (spoOAr.kan), BHI (spo0HΔH//7dlll-EcoRI::cat), 650 (spollAABCwcaf), 901 (spollGA::aphA-3) and 731 (spolllGwermC), respectively. Extraction of chromosomal DNA and transformation of B. subtilis strains by the 'Groningen' method was according to Bron (1990). Transformants were selected on TBAB agar medium containing 0.3 μg/ml of erythromycin (Em) and 25 μg/ml of lincomycin (Lm) for ermC gene; 6 μg/ml of Cm for cat gene; and 10 μg/ml of kanamycin (Km) for kan and aphA-3 genes. The transformation efficiency was approximately 5x104 transformants/μg chromosomal DNA and resulted in the generation of the following strains:
(i) Kanamycin-resistant (Kmr) transformants from SWV215 DNA were named
1A747_spo0/l and PA12_spoOA; (ii) Cmr transformants from BHI DNA were named 1A747_s/gH and PA12_s/gH; (iii) Cmr transformants from 650 DNA were named 1 A747_sigF and PA12_s/gF; (iv) KrrT transformants from 901 DNA were named 1 A747_sigE and PA12_s/gE; (v) Erythromycin/Lincomycin-resistant (Em7Lmr) transformants from 731 DNA were named 1A747_s/gG and PA12_s/'gG.
In addition to being key regulators of the initial steps of sporulation, SpoOA and sigma H (σH) also play a critical role in the formation of the aerial structures that serve as sites of sporulation within surface associated B. subtilis communities (Branda et al., 2001). Therefore 1A747_spoO4 and PA12_spoO>4, lacking SpoOA, produced mucoid, unstructured colonies on TBAB agar plates and 1A747_s/gH and PA^2_sigH, lacking σH, showed similar but less severe phenotypes (less intensive spreading on the agar surface). In contrast, the other mutants lacking sigma F (σF), sigma E (σE) and sigma G (σG) formed colonies that closely resembled the colony morphology of the wild-type strain.
The effect of sporulation-deficient mutations on the pantothenate production and spore formation in B. subtilis.
From each transformation experiment described above, 25 independently isolated colonies were tested for pantothenate production using the plate halo test. Two colonies of each mutant having a halo size representative to the majority of tested colonies were analysed in shake flask cultures. Single colonies grown on TBAB plates supplemented with the appropriate antibiotics were used to inoculate 20 ml of VFB MM in a 250-ml Erlenmeyer flask with baffles. The bacteria were grown at 37°C with an agitation of 250 rpm. When the cultures reached late stationary growth phase (after -18 hours growth), cell turbidity was measured at 600 nm (OD6oo) and the number of 'heat-resistant' cfu was determined using sporulation assay. The cells were then removed by filtration through a 0.45 μm pore-size filter and the pantothenate content in the spent medium was assayed using both biological and HPLC assay methods. Results showed that the total pantothenate production of mutants 1A747_spoO/4, PA12_spoO \, 1A747_s/gH and PA12_s/o7- decreased 2 to 3 fold compared to the parent strains (Table 5), indicating that the lack of SpoOA and σH functions negatively affected the pantothenate production. In the mutants lacking σF or σE, production of pantothenate was similar to control levels within experimental error, indicating that mutations blocking sporulation in later stages had little or no effect on pantothenate production. The cell biomass of all mutants, as determined by OD60o measurements of the cultures, was similar to that of the parental controls. The sporulation frequency of the parent strains 1A747 and PA12 was approximately 0.3-1%. Spores were never detected in mutants lacking SpoOA, σH, and σE. However, a small number of heat-resistant cells was detected in the cultures of 1A747_s/'gFand PA12_s/gF (Table 5), showing that mutations in the spollAABC genes did not result in complete loss of spore formation. Based on these results, only strains containing mutations in the sigma E gene both produced control levels of pantothenate and were completely devoid of spore-forming bacteria.
Strains containing the σG mutation produced a distinct phenotype not exhibited by the other spo mutants. When introduced into 1A747 wild type cells, the resulting mutant produced normal levels of pantothenate and no spores. However, in the engineered PA12 strain, the resulting strain produced very low levels of pantothenate and no spores (Table 5). These results suggested that disruption of σG by the erm gene blocked high level expression of pantothenate either by preventing expression of a Sigma G-transcribed gene whose protein product is involved in pantothenate production (or excretion), or by blocking transcription of a downstream gene by polarity. Inspection of DNA sequence downstream of spolllG revealed the presence of a single gene, ylmA, that could be co-transcribed with spolllG. The ylmA gene potentially encodes an unknown ATP-binding protein that could function as one of the components of an ABC transporter. Consequently, overexpression of this protein either individually or in combination with engineered pan and/or ilv biosynthetic genes could result in higher pantothenate production. In addition, suppressor host mutations of the Spo" Pan" phenotype, which restore pantothenate production, could result in a strain with higher pantothenate production.
Table 5. The effect of sporulation-deficient mutations on pantothenate production and spore formation of β. subtilis.
Strain (relevant Total pantothenate Number of spores characteristic) production (mg/l) (cfu/ml)
1A747 0.7 2.4x106
1A747_spoOΛ (spoOAr.kan) 0.4 0
1A747_s/gH (spoOHAHind\\\- 0.4 0
EcoR\::cat)
1A747_s/g£ (spollG A: aphA-3) 0.7 0
1 A747_s/gF (spollAABCv.caf) 0.6 1.3
1A747 sigG (spoil IGv.ermC ) 0.8 0
PA12 170 1.5x106
PA12_spoOA (spoOAr.kan) 50 0
PA12_s/gH (spoOHAHindW- 60 0
EcoR\::cat)
PA12_s g£ (spollGA::aphA-3) 150 0
PA12_s;gF (spoil AABC: : cat) 160 13.8
PA12_s gG (spolllGv.ermC) 0.7 0
EXAMPLE III
This example describes the fermentation of β. subtilis pantothenate-overproducing strains containing sporulation-deficient mutations spoOA or spollG (sigE).
The sigE mutant (PA12_s/gE), the spoOA mutant (PA12_spoOA), and their parent, PA12, were grown in standard fed-batch fermentations using 2-liter lab scale fermentors for 48 hours. Both pantothenate levels and spore formation frequency of bacteria were measured during the course of the fermentation. As shown in Table 6, pantothenate production was similar in both the parent and the sigE mutant, but was reduced approximately 85% in the spoOA mutant. The yield of pantothenate on glucose was again similar between the sigE mutant and the parent strain. Spores were detected in the parent, but not in either mutant. Table 6. Sporulation and pantothenate production of β. subtilis strains PA12, PA12_spoOA, and PA12_s/g£ grown in 2-liter bench scale fermentation for 48 hours.
Strain (relevant Total pantothenate Number of spores characteristic) production (g/l) (cfu/ml)
PA12 9.7 4 x 108
PA12_spoOA (spoOAr.kan) 1.4 0
PA12_s/g£ (spollG A: aphA-3) 12.9 0
The present invention has been illustrated through the examples, which are only showing specific embodiments thereof. This should not be construed as limiting the invention thereto, since many embodiments will be obvious to the skilled person upon reading it.
EXAMPLE IV
This example describes the construction and testing of B. subtilis pantothenate overproducing strains containing null-mutations in spoOA and abrB.
Single and double abrB and spoOA mutations were introduced into PA49, a pantothenate- overproducing strain by transformation of chromosomal DNA from strains SWV215 (spoOAr.kan) and SWV119 (abrBrtet). Transformants were selected on TBAB agar medium containing 10 μg/ml of Km for kan gene; and 10 μg/ml of tetracycline (Tc) for tet gene. The transformation efficiency was 2x103 transformants/μg DNA for spoOAr.kan, 4x102 transformants/μg DNA for abrBr.tet and 4 transformants/μg DNA for double spoOAr.kan and abrBrtet mutant. The resulting strains were:
(i) Kmr transformant from SWV215 DNA was named PA1030;
(ii) Tetracycline-resistant (Tcr) transformant from SWV119 DNA was named PA1037;
(iii) Kmr and Tcr transformants from SWV215 and SWV119 DNAs was named PA1051.
Four colonies of each mutant were analysed for pantothenate production and spore formation in shake flask cultures. Single colonies grown on TBAB plates supplemented with the appropriate antibiotics were used to inoculate 10 ml of VY medium supplemented with the appropriate antibiotics. The bacteria were grown overnight (-17 h) at 37°C with an agitation of 250 rpm. Overnight cultures were diluted (1 :100) in 20 ml of VFB MMGT and grown to middle exponential growth (OD6o0=0.6-0.8). Using these cultures 30 ml of VFB MMGT were inoculated with a starting turbidity of OD6oo=0.03 and the bacteria were grown at 37°C with an agitation of 250 rpm in a 250-ml Erlenmeyer flask with baffles. After 18 h growth, cell turbidity was measured at 600 nm (OD6oo) and the number of 'heat-resistant' cfu was determined using sporulation assay. The cells were then removed by filtration through a 0.45 μm pore-size filter and the pantothenate content in the spent medium was assayed using HPLC assay method. Results showed that the cell biomass of all mutants, as determined by OD6oo measurements of the cultures, was similar to that of the parental control. The total pantothenate production of PA1030 (spoOAr.kan) and PA1037 (abrBr.tet) decreased 3 to 4 fold compared to the parent PA49 strain (Table 7), indicating that the lack of SpoOA (as it was also shown in Example II) and AbrB functions negatively affected the pantothenate production. However, the double-mutant PA1051 (spoOAr.kan abrBr.tet) produced 40% more pantothenate than the PA49 control, and produced no spores. Based on these results, pantothenate production can be enhanced above the wild-type expression level in a double abrB and spo0A-uu\\ mutant.
Table 7. Sporulation and pantothenate production of B. subtilis strains PA49, PA1030, PA1037 and PA1051 grown in shake flask culture.
Strain (relevant Total pantothenate Number of spores characteristic) production (mg/l) (cfu/ml)
PA49 430 3.6x102
PA1030 (spoOArkan) 160 0
PA1037(aorB::tet) 110 0
PA1051 (spoOAr.kan abrBr.tet) 600 0
EXAMPLE V
This example describes the construction and testing of B. subtilis pantothenate overproducing strain that overexpresses spoOA and contains a sporulation-deficient mutation (spollGA).
Construction of B. subtilis strains carrying Psp3tC-spo0A and a s/g£-null mutation.
In Example II it was shown that the lack of SpoOA decreased pantothenate production 2 to 3 fold compared to the parent strains. To investigate the effect of overexpression of the spoOA gene on pantothenate production, an IPTG-inducible Pspac-spoOA fusion was introduced into amyE gene of PA49 by transformation of chromosomal DNA from strain AH 1763 (amyEr.Pspac spoOA[caf\). Transformants were selected on TBAB agar medium containing 6 μg/ml of Cm and the resulted Cmr strain was named PA1025. Then a sporulation-deficient mutation in spollGA was introduced into PA1025 by transformation of chromosomal DNA from strain 901 (spollGA::aphA-3). Transformants were selected on TBAB agar medium containing 6 μg/ml of Cm for cat gene and 10 μg/ml of Km for aphA-3 gene and the resulted Cmr and Kmr strain was named PA1064.
The effect of overexpression of spoOA on the pantothenate production in B. subtilis.
Single colonies of PA49, PA1025 and PA1064 were used to inoculate 10 ml of VY medium supplemented with the appropriate antibiotics. The bacteria were grown overnight (-17 h) at 37°C with an agitation of 250 rpm. Overnight cultures were diluted (1 :100) in 20 ml of VFB MMGT and grown to middle exponential growth (OD60o=0.6-0.8). Using these cultures 30 ml of VFB MMGT and 30 ml of VFB MMGT containing 10 mM IPTG were inoculated with a starting turbidity of OD6oo=0.03 and the bacteria were grown at 37°C with an agitation of 250 rpm in a 250-ml Erlenmeyer flask with baffles. After 18 h growth, cell turbidity was measured at 600 nm (OD60o) and the number of 'heat-resistant' cfu was determined using sporulation assay. The cells were then removed by filtration through a 0.45 μm pore-size filter and the pantothenate content in the spent medium was assayed using HPLC assay method. Results showed that the cell biomass of all mutants, as determined by OD60o measurements of the cultures, was similar to that of the parental control. In the absence of the IPTG inducer the total pantothenate production of PA1025 (Pspacspo0A) and PA1064 (Ps acSpoOA spollG A: aphA-3) was similar to the parent PA49 strain (Table 8). When the expression of spoOA was induced from the Pspac promoter using 10 mM IPTG, PA1025 produced 70% more pantothenate and 10-fold more spores than the parent control, while PA1064 also produced 70% more pantothenate than the PA49 control and it was deficient in sporulation. Table 8. Sporulation and pantothenate production of B. subtilis strains PA49, PA1025 and PA1064 grown in shake flask culture.
Strain (relevant characteristic) IPTG Total pantothenate Number of spores
(mM) production (mg/l) (cfu/ml)
PA49 0 410 3.6x102
PA49 10 400 7.5x102
PA1025 (PspacspoOA) 0 400 2.5x102
PA1025 (Pspacspo0A) 10 670 3.7x103
PA1064 0 390 0
(Pspac poOA spollGA::aphA-3)
PA1064 10 680 0
(PspacSpoOA spollGA::aphA-3)
REFERENCES CITED IN THE SPECIFICATION
Branda, S. S., J. E. Gonzalez-Pastor, S. Ben-Yehuda, R. Losick, and R. Kolter. 2001.
Fruiting body formation by Bacillus subtilis. Proc. Natl. Acad. Sci. USA 98: 11621-11626.
Britton, R. A., P. Eichenberger, J. E. Gonzalez-Pastor, P. Fawcett, R. Monson, R. Losick, and A. D. Grossman. 2002. Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J. Bacteriol. 184: 4881-4890.
Bron, S. 1990. Plasmids, p. 75-174. In C. R. Harwood and S. M. Cutting (ed.), Molecular Biological Methods for Bacillus. John Wiley & Sons, Ltd., Chichester, United Kingdom.
Cutting, S. M. and R. B. Vander Horn. 1990. Genetic analysis, p. 27-74. In C. R. Harwood and S. M. Cutting (ed.), Molecular Biological Methods for Bacillus. John Wiley & Sons, Ltd., Chichester, United Kingdom.
Driks, A. and R. Losick. 1991. Compartmentalized expression of a gene under the control of sporulation transcription factor sigma E in Bacillus subtilis. Proc. Natl Acad. Sci. USA 88: 9934-9938.
Fawcett, P., P. Eichenberger, R. Losick, and P. Youngman. 2000. The transcriptional profile of early to middle sporulation in Bacillus subtilis. Proc. Natl Acad. Sci. USA 97: 8063-8068.
Guerout-Fleury, A. M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic- resistance cassettes for Bacillus subtilis. Gene 167: 335-336.
Harwood, C. R. and S.M. Cutting. 1992. Molecular Methods for Bacillus. John Wiley and Sons, New York, NY.
Healy, J., J. Weir, I. Smith, and R. Losick. 1991. Post-transcriptional control of a sporulation regulatory gene encoding transcription factor σH in Bacillus subtilis. Mol. Microbiol. 5: 477- 487.
Hecker, M. and U. Vόlker. 1998. Non-specific, general and multiple stress resistance of growth-restricted Bacillus subtilis cells by the expression of the σB regulon. Mol. Microbiol. 29: 1129-1136. Helman, J. D. and C. P. Moran, Jr. 2002. RNA polymerase and sigma factors, p. 289-312. In A. L. Sonenshein, J. A. Hoch and R. Losick (ed.), Bacillus subtilis and its Closest Relatives: From Genes to Cells. American Society for Microbiology Press, Washington, D. C.
Hofmeister, A. E., A. Londono-Vallejo, E. Harry, P. Stragier, and R. Losick. 1995. Extracellular signal protein triggering the proteolytic activation of a developmental transcription factor in B. subtilis. Cell 83: 219-226.
Jonas, R. M., E. A. Weaver, T. J. Kenney, C. P. Moran, Jr. and W. G. Haldenwang. 1988. The Bacillus subtilis spollG operon encodes both sigma E and a gene necessary for sigma E activation. J. Bacteriol. 170: 507-511.
Karow, M. L., P. Glaser, and P. J. Piggot. 1995. Identification of a gene, spollR, that links the activation of sigma E to the transcriptional activity of sigma F during sporulation in Bacillus subtilis. Proc. Nat. Acad. Sci. USA 92: 2012-2016.
Klier, A. F. and G. Rapoport, 1988. Genetics and regulation of carbohydrate catabolism in Bacillus. Annu. Rev. Microbiol. 42: 65-95.
LaBell, T. L., J. E. Trempy, and W. G. Haldenwang 1987. Sporulation-specific sigma factor sigma 29 of Bacillus subtilis is synthesized from a precursor protein, p31. Proc. Natl Acad. Sci. USA 84: 1784-1788.
Lee, G., C. Talkington, and J. Pero. 1980. Nucleotide sequence of a promoter recognized by Bacillus subtilis RNA polymerase. Mol. Gen. Genet. 180: 57-65.
Li, Z. and P. J. Piggot. 2001. Development of a two-part transcription probe to determine the completeness of temporal and spatial compartmentalization of gene expression during bacterial development. Proc. Natl Acad. Sci. USA 98: 12538-12543.
Londono-Vallejo, J. A. and P. Stragier. 1995. Cell-cell signaling pathway activating a developmental transcription factor in Bacillus subtilis. Genes Dev. 9: 503-508. Losick, R. and P. Stragier. 1992. Crisscross regulation of cell-type-specific gene expression during development in B. subtilis. Nature 355: 601-604.
Margoiis, P., A. Driks, and R. Losick. 1991. Establishment of cell type by compartmentalized activation of a transcription factor. Science 254: 562-565.
Moran, C. P., Jr., N. Lang, S. F. LeGrice, G. Lee, M. Stephens, A. L. Sonenshein, J. Pero, and R. Losick. 1982. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet. 181: 2373-2378.
Osbourne, M. S., R. J. Craig, and D. M. Rothstein. 1985. Thermoinducible transcription system for Bacillus subtilis that utilizes control elements from temperate phage ^105. J. Bacteriol. 163: 1101-1108.
Partridge, S. R. and J. Errington. 1993. The importance of morphological events and intercellular interactions in the regulation of prespore-specific gene expression during sporulation in Bacillus subtilis. Mol. Microbiol. 8: 945-955.
Perego, M. 1993. Integrational vectors for genetic manipulation in Bacillus subtilis, p. 615- 624. In A. L. Sonenshein, J. A. Hoch and R. Losick (ed.), Bacillus subtilis and other Gram- positive bacteria. American Society for Microbiology Press, Washington, D. C.
Peters, H. K., Ill and W. G. Haldenwang. 1994. Isolation of a Bacillus subtilis spollGA allele that suppresses processing-negative mutations in the pro-sigma E gene (sigE). J. Bacteriol. 176: 7763-7766.
Petit, M. A., C. Bruand, L. Janniere, and S. D. Ehrlich. 1990. Tn70-derived transposons active in Bacillus subtilis. J. Bacteriol. 172: 6736-6740.
Phillips, Z. E. V. and M. A. Strauch. 2002. Bacillus subtilis sporulation and stationary phase gene expression. Cell. Mol. Life Sci. 59: 392-402.
Piggot, P. J. and R. Losick. 2002. Sporulation genes and intercompartmental regulation, p. 483-518. In A. L. Sonenshein, J. A. Hoch and R. Losick (ed.), Bacillus subtilis and its Closest Relatives: From Genes to Cells. American Society for Microbiology Press, Washington, D. C.
Pragai, Z., N. E. E. Allenby, N. O'Connor, S. Dubrac, G. Rapoport, T. Msadek, and C. R. Harwood. 2004. Transcriptional regulation of the phoPR operon in Bacillus subtilis. J. Bacteriol. 186: 1182-1190.
Satola, S. W., J. M. Baldus, and C. P. Moran, Jr. 1992. Binding of SpoOA stimulates spollG promoter activity in Bacillus subtilis. J. Bacteriol. 174: 1448-1453.
Stragier, P., C. Bonamy, and C. Karmazyn-Campelli. 1988. Processing of a sporulation sigma factor in Bacillus subtilis: how morphological structure could control gene expression. Cell 52: 697-704.
Wu, L. J. and J. Errington. 1994. Bacillus subtilis SpoIIIE protein required for DNA segregation during asymmetric cell division. Science 264: 572-575.
Xu, K. and M. A. Strauch. 1996. Identification, sequence, and expression of the gene encoding γ-glutamyltranspeptidase in Bacillus subtilis. J. Bacteriol. 178: 4319-4322.
Yansura, D. G. and D. J. Henner. 1984. Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 81 : 439- 443.
Youngman, P. 1990. Use of Transposons and integrational vectors for mutagenesis and construction of gene fusions in Bacillus species,' p. 221-266. In C. R. Harwood and S. M. Cutting (ed.), Molecular Biological Methods for Bacillus. John Wiley & Sons, Ltd., Chichester, United Kingdom.
Vagner, V., E. Dervyn, and S. D. Ehrlich, 1998. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144: 3097-3104.

Claims

1. A sporulation-deficient microorganism being capable of overproducing a pantothenate compound.
2. A microorganism according to claim 1 wherein the microorganism has been modified such that it exhibits a reduced SigE activity.
3. A microorganism according to claim 1 or 2 wherein the microorganism has at least one mutation which affects at least one gene selected from the group consisting of spollGA, spollGB, spollR and spollAC.
4. A microorganism according to any one of claims 1 to 3, wherein the microorganism overexpresses the spoOA gene.
5. A microorganism according to claim 1 wherein the microorganism has been modified such that it exhibits a reduced SpoOA activity and a reduced AbrB activity.
6. A microorganism according to claim 5 wherein the microorganism has at least one mutation which affects the spoOA gene and at least one mutation which affects the abrB gene.
7. A microorganism according to any one of claims 1 to 6 wherein the microorganism belongs to the genus Bacillus.
8. A microorganism according to any one of claims 1 to 7 wherein the microorganism belongs to the species Bacillus subtilis.
9. A microorganism according to any one of claims 1 to 8 wherein the pantothenate compound is pantothenate.
10. A microorganism according to any one of claims 1 to 9 wherein a population of said microorganisms is capable of producing at least 100 mg pantothenate/liter culture medium in shake-flask cultures containing minimal medium.
11. A microorganism according to any one of claims 1 to 10 wherein a population of said microorganisms is capable of producing at least 5 g pantothenate/liter culture medium in fed-batch fermentation.
12. A microorganism according to any one of claims 1 to 1 1 wherein the amount of pantothenate compound produced by the microorganism is greater than 50% of the amount of said pantothenate compound produced by the corresponding microorganism not being sporulation-deficient.
13. A microorganism according to any one of claims 1 to 12 wherein the microorganism overexpresses one or more genes selected from the group consisting of panB, panC, panD, panE, ilvB, HvN, ilvC, ilvD, glyA, serA, ylmA, and the gcv genes.
14. A method for producing a pantothenate compound comprising
(a) culturing a microorganism according to any one of claims 1 to 13 under conditions such that the pantothenate compound is produced; and
(b) optionally recovering the pantothenate compound from the cell culture medium.
15. A method according to claim 14 wherein a population of the microorganisms is cultured in fed-batch fermentation.
16. A method for the preparation of a sporulation-deficient microorganism capable of overproducing a pantothenate compound, comprising
(a) providing a microorganism that is capable of overproducing the pantothenate compound, and
(b) introducing in the microorganism of step (a) a mutation that causes reduced SigE activity or introducing in the microorganism of step (a) mutations that cause reduced SpoOA activity and reduced AbrB activity such that a sporulation-deficient microorganism, is obtained; or
(a) providing a microorganism that is incapable of overproducing the pantothenate compound,
(b) introducing in the microorganism of step (a) a mutation that causes reduced SigE activity or introducing in the microorganism of step (a) mutations that cause reduced SpoOA activity and reduced AbrB activity such that a sporulation-deficient microorganism is obtained, and
(c) modifying the sporulation-deficient microorganism obtained in step (b) such that it is capable of overproducing the pantothenate compound.
17. A method according to claim 16 wherein the mutation which causes reduced SigE activity affects at least one gene selected from the group consisting of spollGA, spollGB, spollR and spollAC.
18. A method according to claim 16 or 17, further comprising the step of introducing in the microorganism a DNA sequence or a mutation that causes spoOA overexpression.
19. A method according to claim 16 wherein the mutations which cause reduced SpoOA activity and reduced AbrB activity affect the spoOA gene and the abrB gene.
20. A method according to any one of claims 16 to 19 wherein the microorganism belongs to the genus Bacillus.
21. A method according to claim 20 wherein the microorganism belongs to the species Bacillus subtilis.
22. A method according to any one of claims 16 to 21 wherein the pantothenate compound is pantothenate.
23. The use of a microorganism according to any one of claims 1 to 13 for the preparation of a pantothenate compound.
PCT/EP2004/006619 2003-06-18 2004-06-18 Production of pantothenate using microorganisms incapable of sporulation Ceased WO2004113510A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2006515998A JP4713469B2 (en) 2003-06-18 2004-06-18 Production of pantothenate using microorganisms that cannot sporulate
CN2004800171442A CN1809631B (en) 2003-06-18 2004-06-18 Method for producing pantothenate using a microorganism incapable of sporulation
KR1020057024232A KR101185656B1 (en) 2003-06-18 2004-06-18 Production of pantothenate using microorganisms incapable of sporulation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP03013844 2003-06-18
EP03013844.0 2003-06-18

Publications (2)

Publication Number Publication Date
WO2004113510A2 true WO2004113510A2 (en) 2004-12-29
WO2004113510A3 WO2004113510A3 (en) 2005-05-26

Family

ID=33522254

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/006619 Ceased WO2004113510A2 (en) 2003-06-18 2004-06-18 Production of pantothenate using microorganisms incapable of sporulation

Country Status (4)

Country Link
JP (1) JP4713469B2 (en)
KR (1) KR101185656B1 (en)
CN (1) CN1809631B (en)
WO (1) WO2004113510A2 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005028659A3 (en) * 2003-09-22 2005-06-23 Basf Ag Method for producing an animal food supplement containing d-pantothenic acid and/or salts thereof
JP2006345860A (en) * 2005-05-20 2006-12-28 Shinshu Univ Recombinant Bacillus bacteria
EP2157174A1 (en) 2008-08-12 2010-02-24 DSM IP Assets B.V. Increased production of pantothenate (vitamin B5)
EP2186880A1 (en) 2008-11-07 2010-05-19 DSM IP Assets B.V. Improved production of riboflavin
WO2010075960A2 (en) 2008-12-15 2010-07-08 Dsm Ip Assets B.V. Method for producing riboflavin
WO2012175574A1 (en) 2011-06-21 2012-12-27 Dsm Ip Assets B.V. Increased pantothenate (vitamin b5) production
WO2012175575A2 (en) 2011-06-21 2012-12-27 Dsm Ip Assets B.V. Increased vitamin b5 production
US10184106B2 (en) 2012-06-20 2019-01-22 Genentech, Inc. Methods for viral inactivation and other adventitious agents
WO2020099303A1 (en) 2018-11-15 2020-05-22 Dsm Ip Assets B.V. Improved production of riboflavin
US10731186B2 (en) 2014-07-23 2020-08-04 Purac Biochem Bv Genetically modified (R)-lactic acid producing thermophilic bacteria
WO2021260057A2 (en) 2020-06-23 2021-12-30 Dsm Ip Assets B.V. Fermentation process

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0820262D0 (en) * 2008-11-05 2008-12-10 Tmo Renewables Ltd Microorganisms
JP5512177B2 (en) * 2009-07-06 2014-06-04 旭松食品株式会社 Natto strain with reduced spore-forming ability and natto with few spores produced using the strain
CN108949785B (en) * 2018-08-06 2020-03-06 齐鲁工业大学 Application of sporulation-related gene spo0A in enzyme production
CN109554321B (en) * 2018-12-03 2021-12-31 清华大学 Genetically engineered bacterium for high-yield lipopeptide and application thereof
KR102389327B1 (en) * 2020-07-01 2022-04-20 씨제이제일제당 (주) Microorganism having inhanced activity of 3-methyl-2-oxobutanoate hydroxymethyltransferase and uses thereof
CN112195143B (en) * 2020-09-24 2022-10-14 浙江工业大学 Strain for producing D-pantothenic acid by fermentation method and method for producing D-pantothenic acid by fermentation method
KR102879057B1 (en) * 2023-01-27 2025-10-30 씨제이제일제당 (주) Microorganism having enhanced activity of pantoate-beta-alanine ligase from Arcanobacterium phocisimile and uses thereof
CN119859602B (en) * 2025-01-23 2025-10-31 浙江工业大学 Engineering bacterium for stably and highly producing D-pantothenic acid as well as construction method and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1190434A (en) * 1995-07-07 1998-08-12 诺沃挪第克公司 Production of proteins using bacillus incapable of sporulation
US6489542B1 (en) * 1998-11-04 2002-12-03 Monsanto Technology Llc Methods for transforming plants to express Cry2Ab δ-endotoxins targeted to the plastids
EP2163629B1 (en) * 1999-09-21 2017-03-08 Basf Se Methods and microorganisms for production of panto-compounds
KR20040004496A (en) * 2001-01-19 2004-01-13 바스프 악티엔게젤샤프트 Processes for enhanced production of pantothenate
CN100529068C (en) * 2001-01-19 2009-08-19 巴斯福股份公司 Microorganisms and processes for enhanced production of pantothenate
DE10147960A1 (en) * 2001-09-28 2003-04-10 Degussa Process for the fermentative production of D-pantothenic acid and / or its salts
FI112666B (en) * 2001-11-06 2003-12-31 Ipsat Therapies Oy Non-spore-forming Bacillus subtilis, its preparation and use

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005028659A3 (en) * 2003-09-22 2005-06-23 Basf Ag Method for producing an animal food supplement containing d-pantothenic acid and/or salts thereof
JP2006345860A (en) * 2005-05-20 2006-12-28 Shinshu Univ Recombinant Bacillus bacteria
EP2157174A1 (en) 2008-08-12 2010-02-24 DSM IP Assets B.V. Increased production of pantothenate (vitamin B5)
EP2186880A1 (en) 2008-11-07 2010-05-19 DSM IP Assets B.V. Improved production of riboflavin
WO2010075960A2 (en) 2008-12-15 2010-07-08 Dsm Ip Assets B.V. Method for producing riboflavin
WO2012175575A2 (en) 2011-06-21 2012-12-27 Dsm Ip Assets B.V. Increased vitamin b5 production
WO2012175574A1 (en) 2011-06-21 2012-12-27 Dsm Ip Assets B.V. Increased pantothenate (vitamin b5) production
WO2012175575A3 (en) * 2011-06-21 2013-05-02 Dsm Ip Assets B.V. Vitamin b5 production
US10184106B2 (en) 2012-06-20 2019-01-22 Genentech, Inc. Methods for viral inactivation and other adventitious agents
US10731186B2 (en) 2014-07-23 2020-08-04 Purac Biochem Bv Genetically modified (R)-lactic acid producing thermophilic bacteria
WO2020099303A1 (en) 2018-11-15 2020-05-22 Dsm Ip Assets B.V. Improved production of riboflavin
US12365885B2 (en) 2018-11-15 2025-07-22 Dsm Ip Assets B.V. Production of riboflavin
WO2021260057A2 (en) 2020-06-23 2021-12-30 Dsm Ip Assets B.V. Fermentation process

Also Published As

Publication number Publication date
CN1809631B (en) 2010-05-26
KR101185656B1 (en) 2012-09-24
CN1809631A (en) 2006-07-26
JP2006527589A (en) 2006-12-07
KR20060023159A (en) 2006-03-13
JP4713469B2 (en) 2011-06-29
WO2004113510A3 (en) 2005-05-26

Similar Documents

Publication Publication Date Title
WO2004113510A2 (en) Production of pantothenate using microorganisms incapable of sporulation
JP5392957B2 (en) Methods and microorganisms for producing punt-compounds
Hohmann et al. Host organisms: Bacillus subtilis
US20020110860A1 (en) Twin-arginine translocation in Bacillus
EP1186664B1 (en) Process for producing a fermentation product
US20090233296A1 (en) Thiamin production by fermentation
WO2004005525A2 (en) Microorganisms and processes for enhanced production of pantothenate
KR20040004496A (en) Processes for enhanced production of pantothenate
US20250270603A1 (en) Genetically modified bacteria resistant to mass cell lysis
US8232081B2 (en) Methods and microorganisms for production of panto-compounds
JP2018536423A (en) Microbial strains and methods for fermentation production without low molecular weight substances and protein antibiotics
KR101376848B1 (en) MNA stabilization method
Shi et al. Polyphosphate kinase of Lysinibacillus sphaericus and its effects on accumulation of polyphosphate and bacterial growth
Garrity et al. Mutations in the gene for a tRNA that functions as a regulator of a transcriptional attenuator in Bacillus subtilis.
Liu et al. Identification of BagI as a positive transcriptional regulator of bagremycin biosynthesis in engineered Streptomyces sp. Tü 4128
US20240052297A1 (en) Mesophilic, methylotrophic bacteria for the ph-independent production of biochemicals
US20230272442A1 (en) 5-methylfolate producing microorganism
Bednarz et al. The gamma-butyrolactone receptors ScbR and AtrA form a quorum sensing switch between coelimycin and actinorhodin synthesis in Streptomyces coelicolor A3 (2)
Wang et al. Dynamic regulation of ppGpp under a quorum sensing-based promoter to improve the toyocamycin production
Zhang et al. High-level prodigiosin production in Pseudomonas putida enabled by combinatorial metabolic engineering
Yeşilirmak et al. Comparative proteomic analysis of Bacillus thuringiensis wild-type and two mutant strains disturbed in polyphosphate homeostasis
ÖZTÜRK DETECTION OF YvfI-SinR CO-REGULATED GENES AND THE EFFECT OF DegU TRANSCRIPTIONAL FACTOR ON THE EXPRESSION OF YvfI GENE in Bacillus subtilis
US20240110211A1 (en) Transformed cell having ability to produce 2,5-pyridine dicarboxylic acid
Ababneh et al. CodY regulates SigD levels and activity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1020057024232

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2006515998

Country of ref document: JP

Ref document number: 20048171442

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 1020057024232

Country of ref document: KR

122 Ep: pct application non-entry in european phase