WO2004104043A1 - A synthetic bioelastomer - Google Patents
A synthetic bioelastomer Download PDFInfo
- Publication number
- WO2004104043A1 WO2004104043A1 PCT/AU2004/000683 AU2004000683W WO2004104043A1 WO 2004104043 A1 WO2004104043 A1 WO 2004104043A1 AU 2004000683 W AU2004000683 W AU 2004000683W WO 2004104043 A1 WO2004104043 A1 WO 2004104043A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bioelastomer
- resilin
- amino acid
- polypeptide
- cross
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43577—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
- C07K14/43581—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies from Drosophila
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention is concerned with a synthetic bioelastomer and, more particularly, a polypeptide bioelastomer whose amino acid sequence is derived from the repeat sequences of resilin.
- the present invention is also concerned with nanomachines, biosensors and like apparatus, in particular, those in which the polypeptide is, for example, a part of, a spring mechanism, or "nanospring” .
- the invention also provides the use of the bioelastomer in macroscopic applications. Fusion proteins with other polypeptides also form a part of the invention and may be used in various of these applications, as can hybrid molecules formed in other ways.
- Resilin is a rubber-like protein which occurs in specialised regions of the insect cuticle and is the most efficient elastic material known.
- the elastic efficiency of the material is purported to be 97%; only 3% of stored energy is lost as heat. It confers long range elasticity to the cuticle and functions as both an energy store and as a damper of vibrations in insect flight systems. It is also used in the jumping mechanisms of fleas and grasshoppers .
- Resilin has been found in the jumping mechanism of fleas (Bennet-Clark and Lucey, 1967) and in a number of other insect structures and in some crustaceans (Andersen and Weis-Fogh, 1964) . It has been found in all insects investigated and also in crustaceans (cray-fish) , but appears to be absent from arachnids .
- resilin has elasticity and its insolubility. It is insoluble in water below 140°C. In many solvents, resilin swells considerably, especially in protein solvents such as, phenol, formamide, formic acid. Resilin also swells without going into solution in concentrated solutions of lithium thiocyanate and cupric ethylenediamine, solvents which are able to dissolve silk fibroins and cellulose. When resilin is placed in methanol, ethanol or acetone, it shrinks to a hard glassy substance as when dried in air. When placed back in water, it swells to its original size with no noticeable change in its elastic properties (Weis- Fogh, 1960) .
- the elastic properties of resilin are consistent with the requirements of polymer elasticity: the cross- linked molecules must be flexible and conformationally free.
- rubber theory which attributes rubber-like properties to a decrease in conformational entropy on deforming a network of kinetically free, random polymer molecules.
- Urry and co-workers (Urry, 1988; Urry et al . 1995) , which proposes that the elastic mechanism arises from the beta-spiral structure. Resilin and abductin behave as entropic elastomers, returning almost all of the energy stored in deformation.
- abductin has low proline content with no predicted ⁇ -turns and hence no ⁇ - spiral.
- the amino acid composition of resilin is more like that of elastin, with high proline, glycine and alanine content. Nevertheless, the sequences do not show similarities in alignment however and appear to be unrelated on an evolutionary basis.
- resilin An important property of resilin is the cross- linked nature of the insoluble resilin. This has been shown to be due to tyrosine cross-linking resulting in the formation of dityrosine moieties (Andersen, 1964; 1966) .
- the precursors of resilin are probably soluble, non-cross- linked peptide chains, which are secreted from the apical surface of the epidermal cells into the subcuticular space, where they are rapidly cross-linked to form a three dimensional easily deformable protein network.
- a polypeptide that comprises at least three beta- turn structures is described in International Publication No. WO 98/05685.
- the repeat sequence disclosed is based on human elastin. Elastin typically cross-links through the oxidisation and condensation of lysine side chains to produce hydrolysates which contain desmosine and isodesmosine . There is no suggestion of dityrosine crosslink formation to link the beta-turns.
- WO 02/00686 describes a nanomachine comprising a bioelastomer having repeating peptide monomeric units which form a series of beta- turns separated by dynamic bridging segments suspended between said beta-turns.
- the bioelasto ers described are poor in tyrosine, and there is no suggestion of tyrosine cross-linking between the chains comprising beta-turns.
- the fundamental functional unit at the nanoscale dimension is the twisted filament, formed through coupling a plurality of individual chains to a multi-functional cap - adipic acid for the double- stranded filament, the Kemp tri-acid for the triple- stranded filament and EDTA for a quadruple-stranded filament.
- the present invention is based on the discovery that a recombinant polypeptide expressed from exon 1 of the resilin gene from Drosophilxa melanogaster may be cross-linked by dityrosine formation and form a bioelastomer, despite only amino acids 19-322 of a 620 amino acid polypeptide being present.
- a consensus sequence was derived from this observation and from observations in other species, and polypeptides with repeat sequences based on same were prepared.
- a polypeptide having an amino acid sequence in accordance with the invention comprises a series of beta- turns which together form a beta-spiral, which can act as a readily deformed spring (a "nanospring”) in nanomachines and/or be cross-linked by dityrosine bond formation to form a novel bioelastomer .
- a bioelastomer which is a polypeptide comprising a plurality of repeat units with the consensus sequence SXXYGXP, where S is serine, X is an amino acid, Y is tyrosine, G is glycine and P is proline, and which is cross-linked through dityrosine bond formation, with the proviso that the bioelastomer is not resilin.
- repeat units comprise the consensus sequence: X ⁇ X 2 X 3 XSX5Xg GX 7 PX8X9X ⁇ oX ⁇ wherein:
- Xi is absent or any amino acid
- X 2 is absent or any amino acid
- X 3 is absent or any amino acid
- X 4 is P or S
- X 5 is a charged or polar amino acid
- X 6 is a charged or polar amino acid
- X 7 is A or P
- X 8 is G or A
- X 9 is absent, G or a polar amino acid
- Xio is absent, G or a polar amino acid
- Xii is absent or any amino acid.
- X l7 if present, is G, Y, A or
- N most preferably G.
- X 2 if present, is a basic amino acid or G, more preferably, G, L or Q and most preferably G.
- X 3 if present, is a basic amino acid T or P, more preferably R, K, T or P.
- X 4 is typically P.
- X 5 is preferably D, T or S .
- X 6 is preferably S, Q or T.
- X 7 is typically A.
- X 8 is typically G.
- X g is preferably G, Q or S, most preferably G.
- X 10 if present, is preferably G, S or N, most preferably G.
- Xi is preferably G, Q, P, S or N.
- At least one of X 8 , X 9 and X i0 is G, most preferably X 8 .
- the repeat sequences may be the same or different, and at least some may include variations from the above sequence .
- the repeat sequences may be joined by linker sequences which typically comprise 1 to 20 amino acids, more typically 1 to 10 amino acids and generally 1 to 4 amino acids.
- Linker sequences may be absent, with the repeats abutting, or there may even be overlap of repeat units in accordance with the above sequence.
- the length ,of the repeat sequences may vary, and it will be appreciated this will result in different spacing between the tyrosine residues. Therefore, there will be greater or lesser spacing between the dityrosine cross-links and, while not wishing to bound by theory, it is proposed that this will affect the "tightness" of coiling in the nanospring material.
- the tyrosine residues are separated by 8 to 34 amino acid residues, more often 9 to 24, and most often 10 to 14 residues, given the usual length of the repeat sequences and linker sequences .
- repeat sequences there may be additional tyrosine residues within the repeat sequences, within the linker sequences or within other regions of the cross-linked polypeptide.
- the polypeptide comprises repeat units with the sequence GGRPSDSYGAPGGGN or GGRPSDTYGAPGGGN, for example, the polypeptide RPSDTYGAPGGGNGGRPSDTYGAPG.
- the polypeptide may comprise the amino acids shown in italics in Fig. 6, which are from exon 1 of the resilin gene (SEQ ID NO:l) .
- the region amplified in this embodiment is not the entire exon 1.
- Exon 1 extends from base 54752-55771, but the region expressed in this embodiment comprises bases 54805-55714.
- the polypeptide may be a fragment of SEQ ID NO:l, or could have the amino acid sequence set forth in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 14 or SEQ ID NO:27.
- the polypeptide may be encoded, for example, by a portion of SEQ ID NO:2, by SEQ ID NO: 26 or by any sequence which codes for the polypeptides, and may also be prepared by chemical synthesis.
- the polypeptide comprises repeat units with the sequence PSSQYGAPAQT. This shorter repeat sequence may comprise a fragment from SEQ ID NO: 4 containing the repeat units or any of SEQ ID Nos: 15, 17, 25, 29 or 31, or the polypeptide encoded by the DNA sequences set forth in SEQ ID Nos: 17 -24.
- the polypeptide comprises repeat units with the sequence SSSYGAP or SSTYGAP or STTYGAP .
- the term "consensus sequence” refers to an amino acid (or nucleotide) sequence comprising the amino acids most commonly found at each portion in the sequence but may leave the nature or identity of some amino acids unstated in which case the symbol "X" is used in place of the conventional 1 letter amino acid codes.
- the conventional 1 letter amino acid codes are used throughout the specification, and will be well understood by the person skilled in the art. It will be appreciated that not all repeat units will conform in their entirety to the consensus sequence and yet the beta- spiral structure of the polypeptides of the invention is not disrupted, but most or all repeat units will have the specific sequences set forth above.
- an isolated polypeptide comprising a plurality of repeat units with the consensus sequence SXXYGXP, where S is serine, X is an amino acid, Y is tyrosine, G is glycine and P is proline, with the proviso that the polypeptide is not pro-resilin.
- S serine
- X amino acid
- Y tyrosine
- G glycine
- P proline
- polypeptide has the amino acid sequence set forth in SEQ ID Nos: 25, 27, 29 or 31.
- an isolated nucleic acid which encodes a polypeptide according to the second aspect.
- the nucleic acid has the nucleotide sequence set forth in any one of SEQ ID Nos : 17- 24, 26, 28 or 30.
- a method of preparing a bioelastomer comprising the steps of:
- a hybrid molecule comprising a polypeptide according to the second aspect and a second polymeric molecule.
- hybrid polymers will display new properties including resilience with high tensile strength, adhesion properties and cell interaction and adhesion.
- spider dragline silk protein A recombinant form of spider dragline silk protein has been successfully expressed in transformed mammalian cells in culture (Lazaris et al . 2002) .
- HMW-GS high molecule weight glutenin subunits
- the mussel adhesive proteins Mefp-1,2 and 3 have also been expressed in E. coli and also synthesised chemically. (Deming, 1999)
- Elastin has been produced as a recombinant form (Meyer and Chilkoti (2002) .
- the isolated polypeptide is a his-tagged polypeptide.
- polypeptides of the invention may be synthesized chemically using methods well known to the person skilled in the art. They may also be prepared by expression of a modified resilin.
- a strategy for the synthesis of genes encoding repetitive, protein-based polymers of specific sequence, chain length and architecture is described by Meyer and Chilkoti (2002) .
- One might also synthesise a gene with hybrid sequences added to the resilin gene repeats.
- These additional genes might encode the Byssus plaque protein (Mefp) sequence or the elastin sequence or the fibronectin cell adhesion sequence motif (Arg-Gly-Asp-Ser/Val) or dragline spider silk protein sequence or collagen sequence.
- Mefp Byssus plaque protein
- elastin sequence or the elastin sequence or the fibronectin cell adhesion sequence motif (Arg-Gly-Asp-Ser/Val) or dragline spider silk protein sequence or collagen sequence.
- hybrid genes could then be cloned into a bacterial expression vector such as that described in the present invention for production of the novel recombinant protei (s) .
- Another modification includes the production of hybrid hydrogel systems assembled from water-soluble synthetic polymers and a well-defined protein- folding motif, in this case the resilin polypeptide unit. These hydrogels undergo temperature-induced collapse owing to the cooperative conformational transition of the coiled- coil protein domain. This system shows that well- characterized water-soluble synthetic polymers can be combined with well-defined folding motifs of proteins in hydrogels with engineered volume-change properties. This technology has been described by Wang et al (1999) .
- polypeptide comprising a first polypeptide as described above and a second polypeptide fused to the first polypeptide.
- the fusion protein may be cross-linked through dityrosine cross-links, but need not necessarily be cross- linked.
- the first polypeptide comprising a series of beta- turns in sufficient number to form a beta- spiral may be fused to a second peptide without cross- linking to form a spring mechanism in a nanomachine although, the first polypeptide may be cross-linked.
- the second polypeptide may be an enzyme, in order to allow the introduction of functionality to a bioelastomer, an immunoglobulin, a structural protein such as silk fibroin which can then be woven into an extremely light, resilient and durable thread or filament, or any other polypeptide.
- a nanomachine comprising a polypeptide according to the second aspect acting as a spring mechanism and a device upon which said spring mechanism acts.
- a biosensor comprising a polypeptide according to the second aspect or a bioelastomer according to the first aspect or a hybrid molecule according to the third aspect.
- a manufactured article consisting or comprising of a bioelastomer according to the first aspect or a hybrid molecule according to the fourth aspect.
- Fig. 1 is a schematic illustration of how elastomeric polypeptides work
- Fig. 2 shows the beta-spiral structure in UDP-N- acetylglucosamine acyltransferase
- Fig. 3 is an alternative representation of the beta-spiral elastic protein structure using a space filling model
- Fig. 4 shows the nature of the dityrosine crosslink in proteins
- Fig. 5 is a schematic illustration of cross- linking in a bioelastomer such as is created by the formation of tyrosine cross-links
- Fig. 6 shows the amino acid sequence of the resilin gene from Drosophilia melangogaster
- Fig. 7 shows the DNA sequence from the coding region of the resilin gene from Drosophilia melanogaster
- Fig. 8 shows the PCR reaction products using primers RESF3 and RESPEPRl which shows that expression and purification of soluble Drosophilia pro-resilin in E. coli has been achieved;
- Fig. 9 shows a partial Ndel/EcoRl digest of a resilin clone;
- Fig. 10 is a gel showing expression and purification of soluble Drosophilia pro-resilin in E. coli ;
- Fig. 11 is a gel illustrating the cross -linking of soluble pro-resilin with peroxidase enzymes has taken place;
- Fig. 12 is a photograph of a sample of uncrossed- linked pro-resilin in test A and cross-linked resilin in test tube B;
- Fig. 13 shows graphically the fluorescence spectrum of cross- linked resilin
- Fig. 14 gives the amino acid sequence for cloned recombinant resilin in accordance with the present invention.
- Fig. 15 shows the sedimentation equilibrium analysis of resilin which gives a molecular weight estimate of soluble resilin
- Fig. 16 is a gel demonstrating resilin production in the method of Example 4.
- Fig. 17 is a gel showing pro-resilin production under different induction conditions
- Fig. 18 is a gel showing the fractions emerging from a nickel column and demonstrating purification of recombinant pro-resilin
- Fig. 19 is a gel demonstrating resilin production in an auto-induetion method
- Fig. 20 is a gel demonstrating resilin production under a variety of growth conditions in the auto-induction method
- Fig. 21 is a gel showing that cross-linking takes place after one (1) hour of irradiation of a resilin solution with gamma radiation;
- Fig. 22 is a gel showing that cross-linking of a resilin solution takes place after exposure to UVB radiation
- Fig. 23 is a gel showing cross-linking of resilin with UV radiation in the presence of riboflavin
- Fig. 24 is a gel showing fluorescein cross- linking of resilin with white light
- Fig. 25 shows the results of a further experiment with fluorescein cross-linking
- Fig. 26 shows the results of coumarin cross- linking with an ultraviolet mercury lamp as described in Example 14;
- Fig. 27 plots percentage dityrosine cross-link formation from tyrosine residues in resilin against exposure time (in minutes) to white light when fluorescein is added to the resilin;
- Fig. 28 is a gel showing photo-induced cross- linking of resilin exon 1 recombinant protein as described in Example 16. Irradiation was for ten (10) seconds. Lane 1: molecular weight standard; Lane 2: resilin only; Lane 3: resilin plus S 2 0 8 ; Lane 4: resilin plus ((Ru)II) (pby 3 ) 2+ ; Lane 5: resilin plus S 2 0 8 ; plus ( (Ru) II) (PBY 3 ) 2+ ; and
- Fig. 29 shows the effect of ( (Ru (II) (bpy) 3 ) 2+ dilution on degree of soluble resilin (lmg/ml in PBS) crosslinking.
- Lane 1 resilin + S 2 0 8 + ((Ru(II) (bpy) 3 ) 2+ (no light);
- lane 2 resilin + S 2 0 8 ;
- lane 4 resilin + (Ru ( II) (bpy) lane 5 : resilin + S 2 0 8 + 200 ⁇ M (Ru (II) (bpy)
- Lane 6 : resilin + S 2 0 8 + lOO ⁇ M (Ru ( II ) (bpy) lane 7 : resilin + S 2 0 8 + 50uM (Ru (II ) (bpy)
- Lane 8 : resilin + S 2 0 8 + 25 ⁇ M (Ru (II) (bpy) Lane 9
- Fig. 31 is a mass spectrum of a peptide in accordance with the invention.
- Fig. 32 is a graph comparing dityrosine fluorescence produced by various peroxidases.
- the resilin gene (CG15920) was tentatively identified from the genome sequence of Drosophila melanogaster (Ardell, DH and Andersen, SO (2001) , through analysis of the Drosophila genome database.
- the protein comprises short repeat sequences characteristic of other elastic proteins such as elastin and spider flagelliform silk, which are dominated by the VPGVG and GPGGX units, respectively. For these sequences it was suggested that they form beta- turns, and that the resulting series of beta turns forms a beta spiral (Ardell and Andersen, 2001) , which can act as a readily deformed spring (a "nanospring” ) .
- FIG. 1 shows schematically how a beta-spiral structure as in the present invention may revert from an extended position back to a rest position. This is an entropy-driven process to which the rubbery properties of elastomeric polypeptides is frequently attributed.
- Figs. 2 and 3 show a typical beta-spiral structure (in this case from UDP-N-a ⁇ etylglucosamine acyltransferase) which may extend and revert to a rest position in the manner illustrated in Fig. 1.
- the beta strands in Fig. 2 are represented by arrow structures. These are connected by a beta-turn motif, and these are generally initiated by a 2 amino acid sequence of PG or GG.
- beta-turn motifs allows the beta-strands to form a beta-spiral of the type shown in Fig. 2 and, with a space filling model of a peptide from the HMW protein, in Fig. 3 (from: Parchment et al . (2001) .
- Tyrosine is able to form dityrosine through a free radical mechanism, as illustrated in Fig. 4.
- the present inventors have been able to prepare a bioelastomer from resilin through formation of dityrosine cross-links between monomer units. Uncrossed-linked monomeric units are also useful in certain applications such as in nanomachines.
- the polypeptides are cross-linked to form an insoluble gel from a solution, preferably one with a relatively high concentration of protein, more preferably a protein concentration greater than 10% w/v.
- a solution preferably one with a relatively high concentration of protein, more preferably a protein concentration greater than 10% w/v.
- any means of cross-linking may be employed provided that the dityrosine bonds are formed. These methods are well known to the person skilled in the art and are discussed by Malencik and Anderson (1996) , the contents of which are incorporated herein by reference.
- enzyme-mediated cross-linking may be employed. Although peroxidases such as horseradish peroxidase and lactoperoxidase can form dityrosine crosslinks between proteins, their specific activity towards tyrosine residues is only about 1% of the activity displayed by the Arthromyces peroxidase. This unique property of the fungal enzyme was identified and used by Malencik and Anderson (1996) to cross-link calmodulin (which contains only two Tyr residues) into a very large MW polymer.
- Duox peroxidase from Caenorhabdi tis elegans which is responsible for the cross-linking of tyrosine residues in the cuticle. This enzyme has been shown to cause formation of dityrosine in worm cuticle proteins (Edens et al . 2001) .
- the PICUP photo- induced-cross-linking of unmodified proteins
- a Ru(III) ion is formed, which serves as an electron abstraction agent to produce a carbon radical within the polypeptide, preferentially at a tyrosine residue, and thus allows dityrosine link formation.
- This method of induction allows quantitative conversion of soluble resilin or pro-resilin fragments to a very high molecular weight aggregate.
- this method allows for convenient shaping of the bioelastomer by introducing recombinant resilin into a glass tube of the desired shape and irradiating the recombinant resilin contained therein.
- gamma-irradiation may be employed for cross-linking resilin monomers, although care must be taken not to damage the protein through exposure to this radiation.
- UVB radiation cross-linking may also be undertaken in the presence of absence of riboflavin. In the absence of riboflavin a substantial amount of cross-linking takes place within one hour of exposure, but this time is substantially reduced if riboflavin is present.
- cross-linking may be effected with ultra-violet light in the presence of coumarin or by white light in the presence of fluorescein.
- An analysis of the dityrosine may be performed using conventional methods such as high performance liquid chromatography measurements in order to ascertain the extent of dityrosine cross-link formation.
- the resilience of a cross-linked polymer can be measured using methods known in the art.
- the level of cross-linking can vary provided that the resulting resilin repeat polymer displays the requisite resilient properties.
- the degree of cross-linking is a function of the time and energy of the irradiation.
- the time required to achieve a desired level of cross-linking may readily be computed by exposing non-cross-linked polymer to the source of radiation for different time intervals and determining the degree of resilience (elastic modulus) of the resulting cross-linked material for each time interval.
- the resilin repeat polymers are preferably lightly cross-linked.
- the extent of cross- linking is at least about one cross-link for every five or ten to one hundred monomer units, e.g., one cross-link for every twenty to fifty monomer units. Indeed, we have found that about 18% of the available tyrosine in the pro- resilin monomer is converted to dityrosine following enzymatic oxidation of proresilin.
- the extent of cross-linking may be monitored during the reaction or pre-determined by using a measured amount of reactants. For example, since the dityrosine cross-link is fluorescent, the fluorescence spectrum of the reactant mixture may be monitored during the course of a reaction to determine the extent of cross-linking at any particular time. This is illustrated in Fig. 14, and allows for control of the reaction and the properties of the bioelastomer which results. Once the desired level of cross-linking is achieved (indicated by reaching a predetermined fluorescence intensity) a peroxidase- catalysed reaction may be quenched in a manner known to the person skilled in the art.
- glutathione can be added or the gel can be soaked in a solution of glutathione and glutathione peroxidase as described in Malencik and Anderson (1996) .
- Fusion proteins may be produced through cloning techniques known to the person skilled in the art.
- other means of linking molecules may be employed including covalent bonds, ionic bonds and hydrogen bonds or electrostatic interactions such as ion- dipole and dipole-dipole interactions.
- the linkage may be formed, for example, by the methods described above for cross-linking of the resilient component. It may be necessary to provide appropriate chemical moieties in the second component to allow cross-linking with the first, resilient component. Such moieties are well known to the person skilled in the art and include, for example, amino, and carboxylic groups.
- the second component is a protein, the association between the components can be effected by recombinant nucleic acid technology.
- a hybrid resilin molecule can contain various numbers of both components. For example they can contain (a) one molecule of each component, (b) one molecule of the first component and a plurality of molecules (e.g., two to five hundred or ten to one hundred) of the second component, (c) a plurality of molecules of the first component and one molecule of the second component, or (d) a plurality of molecules of both components. Optimal numbers and positioning of inserted sequences can be determined by the person skilled in the art. The degree of linkage between the two components and the relative number of each component in the final hybrid resilin molecule can be varied so as to provide the desired level of the function of both components.
- the hybrid resilin molecules include those in which the fragments of the second component are inserted within the sequence of the resilin polypeptide.
- resilin repeat sequences can be inserted in the second component molecules.
- the inserted sequences can be inserted tandemly or alternately.
- a first component can be combined with a load-bearing second component.
- load-bearing polymers are collagen and silk or silk-like proteins, e.g., insect (or spider) - derived silk proteins.
- Other suitable types of polymers that could used as second components to endow strength include polyamides, polyesters, polyvinyls, polyethylenes, polyurethanes, polyethers, and polyimides.
- Hybrid resilin molecules that include such polymers have a variety of uses including, for example, artificial joint ligaments with increased resilience where the second component is collagen or a functional fragment thereof.
- Functional fragments of collagen include those with the following sequence: Gly-Pro-Hyp, where Hyp is hydroxyproline.
- an insect or spider silk protein e.g., fibroin
- a functional fragment thereof e.g., fibroin
- Such fabrics are useful in the manufacture, for example, of military clothing.
- Fragments of fibroin include those with the following sequences: Gly-Ala-Gly-Ala-Gly-Ser, Ala-Ser- Ala-Ala-Ala-Ala-Ala, Ser-Ser-Al -Ala-Ala-Ala-Ala-Ala- Ala-Ala, and Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala-Ala.
- the materials of the invention i.e., resilin repeat polymers, or hybrid resilin molecules, can be manufactured in various useful physical forms, e.g., woven or non-woven sheets, gels, foams, powders, or solutions. Furthermore, where desired, the materials, during manufacture, can be molded into appropriate shapes as, for example, in the case of medical prostheses such as vascular prostheses or joint prostheses.
- biocompatible material When used in vivo, and in particular inside the body of a subject, e.g., a human patient, it is important that the material be biocompatible.
- a "biocompatible" material is not substantially mutagenic, antigenic, inflammatory, pyrogenic, or hemolytic . Furthermore, it must neither exhibit substantial cytotoxicity, acute systemic toxicity, or intracutaneous toxicity, nor significantly decrease clotting time. In vivo and in vitro tests for these undesirable biological activities are well known in the art; examples of such assays are given, for example, in U.S. Pat. No. 5,527,610, the contents of which are incorporated by reference. Also, when used in vivo, the materials may be biogradable.
- the resilin polypeptides and hybrid molecules used for in vivo applications are likely to be substantially biocompatible.
- methods for modulating these undesirable effects are known in the art. For example, "tanning" of the material by treating it with chemicals such as aldehydes
- the materials used to make devices for in vivo use are also sterilizable.
- Resilin may be used to produce nanomachines and biosensors .
- the entropy-driven extension and resilience of resilin can be used in a number of nanomachine applications, including: (A) MEMS applications of nanomachines. Significant improvements in micro-electro-mechanical device functions. Response times of such devices can be as short as milliseconds. (B) Biosensor applications such as sensing the binding of drugs, xenobiotics and toxic chemical compounds.
- the nanomachine envisaged comprises an elastomer, such as resilin, coupled in series to a hydrophobi ⁇ ally folded globular receptor protein.
- Polypeptides of the present invention such as that derived from the first exon of the resilin gene, whose sequence is given in Fig. 15, can be prepared in any suitable manner. While chemical synthesis of such polypeptides is envisaged, it is preferred to transform an appropriate host cell with an expression vector which expresses the polypeptide. The design of a host- expression vector system is entirely within the capability of the person skilled in the art.
- the expression systems that can be used for purposes of the invention include, but are not limited to, microorganisms such as bacteria (for example, E. coli including but not limited to E. coli strains BL21 (DE3) plysS, BL21 (DE3)RP and BL21* and B .
- microorganisms such as bacteria (for example, E. coli including but not limited to E. coli strains BL21 (DE3) plysS, BL21 (DE3)RP and BL21* and B .
- subtilis transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the nucleotide sequences; yeast transformed with recombinant yeast expression vectors; insect cells infected with recombinant viral expression vectors (baculovirus) ; plant cell systems infected with recombinant viral expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors; or mammalian cells (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses.
- yeast transformed with recombinant yeast expression vectors insect cells infected with recombinant viral expression vectors (baculovirus) ; plant cell systems infected with recombinant viral expression
- a number of expression vectors may be advantageously selected depending upon the use intended for the gene product being expressed. For example, when a large quantity of such a protein is to be produced vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
- vectors include, but are not limited to, the E. coli expression vector pETMCSl (Miles et al, 1997), pUR278 (Ruther et al .
- telomere sequence may be ligated individually into the vector in frame with the lacZ coding region so that a fusion protein is produced;
- pIN vectors Inouye & Inouye, Nucleic Acids Res., 13:3101, 1985; Van Heeke & Schuster, J. Biol. Chem., 264:5503, 1989; and the like.
- pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S- transferase (GST) .
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
- a number of viral-based expression systems can be utilized.
- the nucleotide sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
- This chimeric gene can then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non- essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the gene product in infected hosts (e.g., See Logan & Shenk, Proc. Natl. Acad.
- Specific initiation signals may also be required for efficient translation of inserted nucleotide sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire gene or cDNA, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (Bittner et al . , Methods in Enzymol . , 153:516, 1987).
- a host cell strain can be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation and generation of Hyp and DOPA residues) and processing
- Mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, and WI38.
- stable expression is preferred.
- cell lines which stably express the sequences described above can be engineered.
- host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
- appropriate expression control elements e.g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.
- engineered cells can be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
- This method can advantageously be used to engineer cell lines which express the gene product.
- Such engineered cell lines can be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the gene product.
- a fusion protein can be readily purified by utilizing an antibody or a ligand that specifically binds to the fusion protein being expressed.
- an antibody or a ligand that specifically binds to the fusion protein being expressed.
- a system described by Janknecht et al . , Proc. Natl . Acad. Sci. USA, 88:8972, 1991 allows for the ready purification of non-denatured fusion proteins expressed in human cell lines.
- the gene of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading frame is translationally fused to an a ino- terminal tag consisting of six histidine residues.
- Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni 2+ nitriloacetic acid-agarose columns and histidine- tagged proteins are selectively eluted with imidazole-containing buffers. If desired, the histidine tag can be selectively cleaved with an appropriate enzyme.
- large quantities of recombinant polypeptides can advantageously be obtained using genetically modified organisms (e.g., plants or mammals), wherein the organisms harbor exogenously derived transgenes encoding the polypeptide of interest (Wright et al . , Bio/technology, 5:830, 1991; Ebert et al . , Bio/technology, 9:835, 1991; Velander et al . , Proc. Natl. Acad. Sci. USA, 89:12003, 1993; Paleyanda et al . , Nature Biotechnology, 15:971, 1997; Hennighausen, Nature Biotechnology, 15:945, 1997; Gibbs, Scientific American, 277:44, 1997).
- genetically modified organisms e.g., plants or mammals
- the polypeptide of interest is expressed in a bodily tissue and then is purified from relevant tissues or body fluids of the appropriate organism. For example, by directing expression of the transgene to the mammary gland, the protein is secreted in large amounts into the milk of the mammal from which it can be conveniently purified (e.g., Wright et al . , cited supra, Paleyanda et al . , cited supra; Hennighausen, cited supra).
- EXAMPLE 1 Cloning of the resilin gene from Drosophila melanogaster
- the first exon of the resilin gene ( Figure 6) was amplified from Drosophila melanogaster genomic DNA via PCR using two primers designed from the known DNA sequence of the Drosophila gene.
- the forward primer contained a (His) 6 coding sequence and an Ndel site while the reverse primer contained an EcoRI site. These restriction sites were included to facilitate cloning of the PCR product into the Ndel/EcoRI site of the E. coli expression vector pETMCSl (Miles et al . 1997).
- the PCR product shown in Figure 8, lane 3 was purified from the agarose gel using a commercial kit (MN) and cloned into the cloning vector pCR-Blunt (Invitrogen) .
- the sequence of the insert was determined using dye-terminator nucleotide mixes (Big Dye - ABI) . The sequence was found to be identical to that reported for the CG15920 sequence from Drosophila .
- An internal Ndel site was found at base 55596 (underlined in Figure 7) .
- PCR primers were (forward) ResF3 and (reverse) RespepRl .
- the sequences of the primers were: ResF3 : 5 ' ...CCCATATGCACCATCACCATCACCATCCGGAGCCACCAGTTAACTCGTAT CTACC...3'
- EXAMPLE 2 Expression and purification of the first exon of the resilin gene from Drosophila melanogaster The sequence obtained above was obtained by partial digestion of the resilin/pCRBlunt clone with EcoRI /Ndel . The upper band (see Figure 9) was excised from the gel and purified using a commercially available kit (Machery-Nagel) and ligated into the Ecol/Ndel site of the expression vector pETMCSl, using standard ligation conditions with T4 DNA ligase. About 200ng of insert was ligated to 50ng of vector at 12 °C overnight. The ligated recombinant plasmid mix was used to transform competent cells of the E.
- coli strain ToplO Invitrogen
- LB Luria Broth
- Colonies were selected and recombinant plasmids carried were prepared using a commercial kit (Machery-Nagel) .
- the sequence of the expected recombinant plasmid insert was confirmed by DNA sequence analysis and matched the published sequence of CG15920.
- the correct recombinant plasmid containing the Drosophila melanogaster resilin exon I sequence cloned into the Ndel/EcoRl site of expression vector pETMCSl was isolated from a 2ml overnight culture of the E. coli ToplO strain carrying this plasmid. This purified plasmid was then used to transform the E. coli strains BL21 (DE3)plysS or the ⁇ . coli me (BL21*) strain, with selection for resistance to both ampicillin (lOO ⁇ g/ml) and chloramphenicol (34 ⁇ g/ml) .
- coli ribonuclease E mutant strain BL21 Star TM, (DE3)pLysS: F - ompT hsdS B (rB - mB - ) gal dcm rnel31 (DE3) pLysS (Cam R ) contained more soluble recombinant resilin than the BL21 (DE3)plysS strain (data not shown) .
- A600 of 0.1 The cells were grown with vigorous aeration (200 cycles per minute) on a rotary shaker at 37°C until the A600 reached 0.8. At this point, IPTG (isopropyl- ⁇ -D- thiogalactopyranoside) was added to ImM final concentration and the culture was grown for a further 4.5h at 37°C with vigorous aeration. The cells were harvested by centrifugation (10,000xg 20 min at 4°C) . The cell pellets were resuspended at 4°C in 80ml of 50mM NaH 2 P0 4 / Na 2 HP0 buffer containing 150mM NaCl and IX protease inhibitor cocktail (EDTA-free) (Roche - Cat. No . 1 873
- the cells were disrupted with a sonicator (4X15sec bursts) following addition of Triton X-100 (to 0.5% final cone) .
- Membrane and soluble fractions were separated by centrifugation of the disrupted cells at 100,000xg for lh at 4°C.
- the soluble fraction was bound to a 10ml packed column of Ni-NTA affinity resin (Qiagen - Ni-NTA Superflow (25 ml) 25 ml nickel-charged resin (max. pressure: 140 psi) (cat # 30410) for 1.5h at 4°C.
- the resin was packed into a column which was washed (at lml/min) with loading buffer (50mM NaH 2 P0 4 / Na 2 HP0 4 buffer containing 150mM NaCl) until the A 280 fell to near baseline and stabilised. In order to remove E.
- the results of this affinity column purification of soluble resilin is shown in Figure 10.
- the molecular weight of the soluble recombinant resilin was shown by SDS-PAGE to be ca. 46,000 Da, which suggested that the recombinant protein might be produced in E.
- a single colony of the recombinant E. coli strain is added to 400 ml broth with 0.4ml Ampicillin (100 mg/ml) and 0.4 ml Chloramphenicol (34 mg/ml) in a laminar flow cabinet to ensure sterile conditions.
- the broth is shaken at 220rpm overnight at 37°C.
- the OD 60 o of the overnight culture is measured. An aliquot of the overnight culture is added to the 6 litres of broth to give a final OD 60 o of 0.15. 1 ml of both Ampicillin and Chloramphenicol (same concentrations as above) is added to each 1 litre of broth along with 1 drop (ca. 50 ⁇ l) of Antifoam 289 (Sigma) . The broth is shaken at 220rpm for 2 hours until the OD SO o is around 1.0. At this time, 0.5 ml of 1M IPTG is added to each litre of broth followed by shaking for another 3 hours . The cells from the culture are collected by centrifugation at 6000 rpm at 4°C for 20 minutes.
- Three 40 ml broths were autoclaved as per usual recipe. Each was induced at different times and OD 600 values according to the conditions below:
- the cultures were induced with 20 ⁇ l of 1M IPTG.
- EXAMPLE 5 Alternative strain of E.coli
- the E. coli BL21 (DE3)plysS strain was compared to BL21 (DE3) RP strain of E.coli to determine if we could improve our production of resilin.
- This strain contains plasmid-encoded copies of tRNA genes which can overcome rare Arg and Pro codons .
- the resilin expression clone (resilin 5) DNA was transformed into another strain of E.coli, the BL21 (DE3) RP strain (Stratagene) . This strain is expected to give better production due to the ability to produce rare codons.
- three 40 ml LB broths were autoclaved. One broth contained the Resilin 5 strain, one with Resilin RP strain and the other with the vector alone. The vector was included because it would not produce resilin and hence would help ensure that the results were valid.
- EXAMPLE 6 Alternative Procedure for production of recombinant resilin in E. coli
- the medium used for autoinduction of the recombinant resilin gene was the Overnight Express Autoinduction SystemTM (Novagen) .
- Procedure 1 Add 1 ml of overnight culture (OD e0 o approximately 6.0) to the culture medium and shake for 4 hours at 37°C at 220rpm. Shake for a further 26 hours at room temperature. Spin as per usual method.
- the final OD 60 o is approximately 12.0 rather than the usual 4.0 obtained on LB medium.
- a 40 ml sample was spun and processed to compare with resilin produced from LB broth. The results are shown in Fig 19. Since the pellet from the 40 ml spin was 3.6 times greater in weight than the usual resilin pellet, it was resuspended in 3.6 ml rather than the 1 ml used for the usual 40 ml pellet. The resuspended pellets were sonicated and spun. 1 ml of the resulting supernatant was processed through a Nickel column and the elution was run on a gel . The gel shows that the production of resilin is equivalent to that from the LB broth method. Since we are achieving approximately 4 times the number of cells per litre of broth, we are effectively increasing our productivity 4-fold.
- Procedure 2 As per Procedure 1 however add overnight culture to broth at approximately 3.30pm and shake overnight at 37°C. Cells were collected by centrifugation the following morning after 18 hours growth. Variation of Growth Conditions
- the cultures were spun, and processed through a Ni-NTA spin column.
- the elutions, with 1M Imidazole, were loaded onto an SDS PAGE gel. The results are shown in Fig 20.
- pellets were lysed in the same volume of lysis buffer and sonicated for the same amount of time. They were spun for 30 minutes at 14,000 rpm and 1 mL of the supernatant was loaded onto the Ni-NTA columns. The resilin was eluted with 100 ⁇ L 1 M Imidazole. 5 ⁇ l of each eluate was loaded onto the gel .
- Immobilized metal affinity chromatography Assemble the Nickel column in a fume hood and equilibrate with wash buffer 1, ( ⁇ 200 ml for a 50mm dia x 60mm column) . Flow rate ⁇ 10ml per minute.
- wash buffer 1 to rinse the bottom of the Q-sepharose breakthrough container and load this onto the column. Continue washing the column with wash buffer 1 until the A280 has returned to baseline ( ⁇ 100ml) . At this point, all the resilin should be bound to the nickel column and almost all other protein washed out and collected as Nickel column breakthrough.
- ImM Benzamidine HC1 0.5% Triton X-100 (TX-100) lOmM ⁇ -ME (750 ⁇ l per litre of solution) make up to 1 litre with distilled water, pH to 7.2 (with cone HC1) .
- Wash Buffer 1 lOOmM NaH 2 P0 4 lOmM
- 1% Tx- 100 lOmM 2ME (add 750 ⁇ l to 1 litre of solution just before using)
- a search of the genbank insect genomes database comprising completed genomes from Drosophila melanogaster, Anopheles gambiae and Apis mellifera
- PCR' s were set up to determine the optimal conditions for amplification of specific products from the primer pairs designed (see table of primer pairs above) .
- the standard PCR was set up as follows by adding all components listed below in to a microcentrifuge PCR tube to a total volume of 50 ⁇ l: (note that QIAGEN Taq Polymerase kit was used) lOx QIAGEN reaction buffer 5 ⁇ l, 5 x Q buffer lO ⁇ l, 25mM MgCl 2 (variable component ranging from 0.2 ⁇ l - 2 ⁇ l) , dNTP mix (0.5 ⁇ M each) 0.5 ⁇ l, primer F' 0.5 ⁇ l, primer
- an optional step can be performed by discarding the flowthrough and placing the column back into the collecting tube and adding 500 ⁇ l buffer NT2. centrifuge for 1 minute at full speed. Discard flowthrough and place back into collecting tube. Add 600 ⁇ l of buffer NT3 and centrifuge for 1 minute at full speed. Discard flowthrough and place back into collecting tube. Then add 200 ⁇ l buffer NT3. Centrifuge for 2 minutes at full speed to remove NT3 quantitatively. Finally place column into a clean 1.5ml microcentrifuge tube and add 25-50 ⁇ l elution buffer NE and leave at room temperature for 1 minute. Centrifuge for 1 minute at full speed. Ligate excised PCR fragment into pGEM-Teasy
- An optional step after this is to wash the column by adding 0.5ml buffer PB and centrifuge 30 to 60 seconds. Discard the flow through from this and wash the column by adding 0.75ml buffer PE and centrifuge for 30 to 60 seconds. Discard the flow-through from this and centrifuge an additional 1 minute to remove residual wash buffer. Place the column in clean 1.5ml microcentrifuge tube. To elute the DNA, add 50 ⁇ l buffer EB to the centre of the column and let stand for 1 minute. Then centrifuge for 1 minute.
- DNA (plasmid) 5 ⁇ l double distilled water
- primer (M13 F' , M13 R' or T7) l ⁇ l
- Big Dye 3.1 2 ⁇ l total volume 12 ⁇ l
- sequencing buffer 3 ⁇ l total volume 12 ⁇ l
- use program 4 35 cycles When complete, add 1.3 ⁇ l 3M NaOAc pH5.2 and 30 ⁇ l absolute ethanol. Incubate at —20°C for 15 minutes. Spin 15 minutes at 4°C and remove solution carefully by pipetting. Then wash with lOO ⁇ l 80% ethanol and spin at max speed for 5 minutes at 4°C. Then remove solution carefully and dry with no heat in vacuum centrifuge for 3 minutes. Make sure that the sequencing cleanup is performed in 1.5ml microcentrifuge tubes. Also better
- RNA extraction with QIAGEN Rneasy Mini kit following protocol described in "Rneasy mini protocol for isolation of total RNA from animal tissue" Tissues and samples need to be disrupted first up. To do this the samples are first places in a sterile RNase free 2ml screw cap microcentrifuge tube with 3 to 4 sterile glass beads. This is then taken through the BIO- 101 (Savant) FastPrep FP120 disruptor. A speed of 5.0 and time of 3 x 6 seconds is used. The a quick spin for 15 seconds at 2000rpm is performed to allow settling of debris. The supernatant is then transferred onto a QIA shredder column in a 2ml collection tube and then centrifuged for 15 seconds at 10,000rpm.
- the cleared lysate is then transferred into a fresh 1.5ml microcentrifuge tube and further centrifuge for an extra 3 minutes at max speed. This is then transferred into another fresh microcentrifuge tube. Then 1 volume (approximately 350-600 ⁇ l) of 70% ethanol is added to the cleared lysate and mixed immediately by pipetting (do not centrifuge) . Up to 700 ⁇ l of the sample can then be added to the Rneasy column, placed in a 2ml collection tube. Centrifuge for 15 seconds at 8000 x g (10,000rpm). Discard the flow through and pipette 350 ⁇ l buffer RW1 onto the column and centrifuge 15 seconds at 8000 x g (10,000rpm).
- the next stage involved extracting RNA and making ds cDNA from flea and buffalo fly this was then used in degenerate PCR. Also at this stage, two new degenerate primers were designed, primers 6 and 7. This primers were used in conjunction with the earlier primers. PCR was then performed using all the primer pair's 1+7, 2+7, 3+7 and the earlier primer sets of 1+5, 2+5, 1+4 and 3+4 on both flea and buffalo fly cDNA. Of these bands were obtained for buffalo fly for primer pair's 1+7 (approx. 500bp) , 2+7 (300, 500bp and lkb) , 3+7 (lkb) , 1+4 (approx.
- Annealing was carried out by an incremental decrease in temperature from 50 to 10 °C over minutes (0.5°C/min) on a MJ Research PTC-200 Peltier Thermal cycler.
- Biolabs was added to each tube, and ligation performed at 16 °C for 1-18 hrs. Samples were heated at 65 °C for 10 minutes to inactivate Ligase, and samples purified using Qiaquick DNA purification columns (Qiagen) .
- Clone 1 comprises SEQ ID NO: 17 which is well expressed except that it is eaten at 5' end , and therefore has only 10 repeats: AACCCCGTCTAGCCAGTATGGTGCACCG
- Clone 9 comprises SEQ ID NO: 18 includes an inserted C near the start and is not preferred: GCGCCAAACCCCGTCTAGCCAGTATGGTGCACCG GCGC AAACCCCGTCTAGCCAGTATGGTGCACCG GCGC AAACCCCGTCTAGCCAGTATGGTGCACCG GCGC AAACCCCGTCTAGCCAGTATGGTGCACCG GCGC AAACCCCGTCTAGCCAGTATGGTGCACCG GCGC AAACCCCGTCTAGCCAGTATGGTGCACCG GCACCG
- Clone 18 comprises SEQ ID NO: 22 which is well expressed except that it is eaten at 5' end , and therefore has only 7 repeats :
- Clone 22 comprises SEQ ID NO: 23 has an inserted A and is not preferred: GCGCAAACCCCGTCTAGCCAGTATGGTGCACCG
- This clone is being re-amplified with specific primers and cloned into the expression vector as discussed below.
- Re-amplification for cloning into expression vector pET Primers were designed for the re-amplification of selected inserts such that a Nde I restriction enzyme site and 6-HIS expression tag were added to the 5' end of the concatamer, while a battery of stop codons and EcoRI restriction enzyme site were added at the 3' end. These were designed such that the amplified product could be cloned into the expression vector pET using the EcoRI and Nde I restriction enzymes such that the product when expressed would contain an N- terminal 6-histidine tag for easy purification of the expressed protein.
- PCR reactions were run on a 1% agarose gel and products were purified from gel using a QIA quick gel extraction kit (QIAGEN) .
- QIAGEN QIA quick gel extraction kit
- Products were cloned using the pCR-Blunt cloning vector (Invitrogen) , with transformation into chemically competent Stbl3 cells (Invitrogen) . Selection of recombinants was based upon growth on LB agar plates containing Kanamycin at 50 ug/ml, followed by PCR screening of selected colonies using M13for and Mlrev primers to amplify inserts within the plasmids.
- the T2A and R5E inserts have been cut out of the pCR-Blunt vector in the following manner. 5 ul Plasmid
- the reactions were run on a 1% agarose gel and digested T2A and R5E products were purified from gel using a QIA quick gel extraction kit (QIAGEN) .
- QIAGEN QIA quick gel extraction kit
- the pET expression vector containing a 500 bp DHFR insert (RSC722+DHFR) was obtained from Dr Nick Dixon - (RSC, ANU; Neylon et al . 2000). This was cloned into competent DH5D cells. Colonies were selected and grown up at 37 °C overnight, following which plasmids were isolated using a plasmid purification kit (QIAGEN) . The insert was cut out by the following protocol.
- the reaction was incubated at 37oC for 2 hours, then 1 ul (10U) EcoRI enzyme (New England Biolabs) was added. The reaction was incubated overnight.
- Ligations into expression vector Ligations were carried out as follows: 10 ul plasmid 7 ul insert •
- Integrity of sequence will be confirmed by sequence analysis, after which these plasmids will be transformed into appropriate cells for expression.
- EXAMPLE 10 A peptide was synthesised ' using standard FMOC synthesis techniques.
- the peptide has the following amino acid sequence (SEQ ID NO: 32) : RPSDTYGAPGGGNGGRPSDTYGAPGG (26mer)
- the peptide includes a 15-residue repeat sequence and spans two tyrosine residues.
- Pro-resilin was purified from E. coli cells as described above and was cross-linked into an insoluble polymer in a process which may also be applied to the synthetic resilins of Examples 9 & 10.
- the formation of the insoluble gel depended on the concentration of the resilin protein solution.
- soluble resilin monomer was concentrated to 80mg/ml, 150mg/ml and 250mg/ml in 0.25M Borate buffer pH 8.2, as described above .
- Lanes 2, 3 and 4 show the peroxidase enzymes used in the experiment while lanes 5, 6 and 7 show, respectively, the effects of lactoperoxidase, horseradish peroxidase and Arthromyces peroxidase on the soluble resilin.
- Lactoperoxidase was the least effective peroxidase at causing cross-linking of soluble resilin as only a small percentage of the monomer was converted to a dimer.
- Horseradish peroxidase was more effective as a ladder of higher molecular weight oligomers was apparent by Coomassie blue staining of the gel.
- the Arthromyces peroxidase converted all of the monomer to very large protein polymers which barely entered the 10% polyacrylamide separating gel .
- the protein concentration was increased by passage of the soluble resilin through a CentriconTM (lOkDa) filtration device.
- the protein concentration was increased from
- reaction conditions were: soluble resilin (40 ⁇ l) , H 2 0 2 (lOmM) , peroxidase (5 ⁇ l of lOmg/ml) in 0.25M Borate buffer pH 8.2. reaction was initiated by addition of hydrogen peroxide. An instantaneous gel formation was observed in all three reactions, with the 25% protein solution yielding the firmest gel and the 8% resilin solution gave a very low density gel, which was not completely solid.
- the gel which formed was brightly fluorescent upon irradiation with long-wave (300nm) UV light (tube B) , in comparison with an equivalent quantity of soluble resilin before cross-linking (tube B) , as shown in Figure 12, was insoluble in buffer and water.
- Authentic dityrosine shows maximum sensitivity for excitation at 301nm and emission at 377nm in borate buffer. These wavelengths represent the isosbestic and isoemissive points found in the absorption and fluorescence emission spectra of dityrosine in the presence of varying amounts of boric acid-sodium borate buffer (Malencik et al . 1996).
- Figure 32 shows a comparison of dityrosine fluorescence produced by various peroxidases and measured using a microtitre plate fluorescence reader (BMG Polarstar) with excitation at 300nm and emission at 420nm. Peroxidases were made up in PBS to lmg/ml . Resilin concentration was 5mg/ml .
- EXAMPLE 12 Purified soluble recombinant resilin was crosslinked by preparing a 20% solution of resilin protein in lOOmM borate buffer pH 8.5 and treating with Arthromyces ramosus peroxidase in the presence of lOmM H 2 0 2 at room temperature.
- the conditions for rubber formation were:
- This material was washed in 0.1M tris buffer pH 8.0 and tested for ⁇ omparitive resilience using Atomic Force Microscopy (AFM) .
- the samples were dried and then either resuspended in water or maintained at 70% relative humidity for AFM testing. Where humidity control was required this was achieved by enclosing both the sample and the lower portion of the SPM scanner tube with a small Perspex chamber and flushing the system with nitrogen gas of the desired humidity, obtained by bubbling the gas through reverse osmosis water.
- a Honeywell monolithic integrated humidity sensor and a "K" type thermocouple sensor were inserted through small holes in the end wall of the chamber in order to monitor humidity and temperature.
- the Butadiene and Butyl rubber were supplied as sheets by Empire Rubber, Australia.
- the samples had been vulcanised using standard curative systems and contained no fillers.
- SPM Digital Instruments Dimension 3000 Scanning Probe Microscope
- Measurements made in air were obtained with the SPM operating in TappmgMode TM using silicon "Pointprobes” while Measurements made in water were obtained with the SPM operating in ContactModeTM using "Nanoprobe” Silicon Nitride Probes.
- Relative triggers of 20-100 nm of deflection were used to limit the cantilever deflection and thus the total force applied to the samples during force-distance measurements.
- the resilience of the sample was defined as the area under the contact region of the retract curve expressed as a percentage of the area under the contact region of the approach curve.
- Exposure times were for 1, 2, 4, 8, 16, 32 and 64 hours.
- the exposed resilin was diluted 40:1 with lOmM phosphate buffer pH 8.0. 1 ⁇ l of this solution was mixed with 14 ⁇ l of loading dye and loaded into each gel well. Note that after 32 and 64 hours of exposure, the resilin could not be pipetted hence a small amount was picked up at the end of a tip and mechanically mixed with the loading dye.
- a protein standard was used in lane 1. The gel was run at 160V and, once finished, was stained with Coomassie Blue. The resulting gel is shown in Fig. 21.
- Resilin monomer runs at around 50kDa on an SDS- PAGE gel and can be clearly seen as the dominant band in lanes 2-6.
- Crosslinking between two resilin monomers to create a dimer will double the size of the protein and hence will run at around lOOkDa. Trimers will run at around 150kDa and so on. Fully crosslinked resilin should remain at the bottom of the well i.e. the very top of the lane.
- the gel shows that crosslinking is taking place afterl hour irradiation with a faint band at around lOOkDa. However, comparing the relative concentrations of the monomer and dimer shows that not a lot of crosslinking has occurred at this point.
- the degree of crosslinking ie the proportion of dimers
- the proportion of uncrosslinked resilin increases such that after 16 hours irradiation, the proportion of uncrosslinked resilin is around the same as crosslinked resilin.
- the resilin does not easily progress through the gel indicating that little monomer remains and the resilin contains many crosslinks. A slight band of monomer can be seen in the 32 hour sample.
- EXAMPLE 14 UVB Radiation Crosslinking of Resilin 100 ⁇ l of concentrated resilin (230mg/ml) was diluted in 900 ⁇ l PBS (Phosphate Buffer Solution) to give a final concentration of 23mg/ml. This was aloquoted into 7 x 100 ⁇ l samples in quartz glass cups of 5mm internal diameter. The cups were sealed with sticky labels, ensuring that this did not hinder the exposure of the resilin solution to the UVB radiation.
- PBS Phosphate Buffer Solution
- the samples were exposed to UVB radiation using UVB tubes designed for a QUV Weatherometer . Samples were located 10 mm from the edge of the UVB tube. This was performed at ambient air temperatures for 1, 2, 4, 8, 16, 32 and 64 hours. All exposures were continuous except for the 16 hour (2 x 8 hour exposures on consecutive days) and 64 hour (56 hours followed by 8 hours exposure 2 days later) exposures. After exposure, the samples were transferred to eppendorf tubes to minimise loss of water from evaporation.
- Fig. 23 show that a substantial amount of resilin has crosslinked after just 30 minutes with all resilin monomer being crosslinked after 4 hours exposure. This shows a large improvement in crosslinking time compared with resilin exposed to UVB without riboflavin. A small amount of resilin dimer and trimer exists after 4 hours exposure.
- Fluorescein Crosslinking of Resilin with White Light lOOmM fluorescein solution was produced using 0. ImM NaOH in water. 1 ⁇ l of the fluorescein solution was mixed with 1 ml of lOmg/ml resilin. 190 ⁇ l of the resilin was aloquoted into 5 wells and kept on ice. The resilin was exposed to 2 x 300W globes positioned 10cm from the top of the wells for 30, 60, 90, 120 and 150 seconds. 1 ⁇ l of the resulting solution was mixed with 14 ⁇ l of loading dye and run on an SDS-PAGE gel. The results (not shown here) showed that more time was needed to complete the crosslinking.
- Concentrated resilin was diluted to 10 mg/ml with 50 mM TRIS and 50 mM NaCl. The solution was divided into three parts. The first part was mixed with 100 ⁇ M 7- hydroxycoumarin-3-carboxylic acid and 90 ⁇ l aliquots were placed into small tubes with a black cap. The second part was mixed with 10 ⁇ M 7-hydroxycoumarin-3-carboxylic acid and 90 ⁇ l aliquots were placed into small tubes with a blue cap. The third part contained no 7-hydroxycoumarin-3- carboxylic acid, and the tubes had red caps.
- the dityrosine was determine using the following equation: (volume * HPLC / weight) and results in a figure for the amount of dityrosine per weight of protein.
- the amount of tyrosine crosslinking is larger for the enzyme catalysed reaction than for 15 minutes exposure to white light with the addition of fluorescein. In fact, there are at least 3 times as many crosslinks formed.
- the PICUP (photo-induced cross-linking of unmodified proteins) reaction is induced by very rapid, visible light photolysis of a tris-bipyridyl Ru(II) complex in the presence of an electron acceptor.
- a Ru(III) ion is formed, which serves as an electron abstraction agent to produce a carbon radical within the polypeptide (backbone or side chain) , preferentially at positions where stabilization of the radical by hyperco jugation or resonance is favored - tyrosine and tryptophan residues.
- the radical reacts very rapidly with a susceptible group in its immediate proximity to form a new C-C bond (Fancy and Kodadek, 1999 and Fancy, 2000)
- This method preferentially crosslinks associated or self-assembled proteins following brief photolysis.
- the reaction has been proposed to proceed through a Ru(III) intermediate formed by photoinitiated oxidation of the metal centre by APS.
- the Ru(III) complex is a potent one-electron oxidant and can oxidise tyrosine (or tryptophan - although there are no trp residues in the resilin-5 sequence) side chains, creating a radical that can couple to appropriate nearby residues by a variety of pathways.
- One possible crosslinking reaction that can occur is the formation of an arene coupling reaction. If the neighbouring amino acid is tyrosine, a dityrosine bond is formed (Fancy and Kodadek, 1999) .
- Fancy DA (2000) Curr Opin Chem Biol. 4(1) :28- 33. Elucidation of protein-protein interactions using chemical cross-linking or label transfer techniques. Fancy DA, Denison C, Kim K, Xie Y, Holdeman T,
- Peroxidasin a novel enzyme-matrix protein of Drosophila development. EMBO J. 13: 3438-3447. Neylon, C, Brown, SE, Kralicek, AV, Miles, CS
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2006529446A JP2007531506A (en) | 2003-05-21 | 2004-05-21 | Synthetic bioelastomer |
| US10/557,445 US20070275408A1 (en) | 2003-05-21 | 2004-05-21 | Synthetic Bioelastomer |
| AU2004240695A AU2004240695A1 (en) | 2003-05-21 | 2004-05-21 | A synthetic bioelastomer |
| EP04734182A EP1625161A4 (en) | 2003-05-21 | 2004-05-21 | SYNTHETIC BIOELASTOMER |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2003902483 | 2003-05-21 | ||
| AU2003902483A AU2003902483A0 (en) | 2003-05-21 | 2003-05-21 | A bioelastomer ii |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2004104043A1 true WO2004104043A1 (en) | 2004-12-02 |
Family
ID=31501349
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2004/000683 Ceased WO2004104043A1 (en) | 2003-05-21 | 2004-05-21 | A synthetic bioelastomer |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20070275408A1 (en) |
| EP (1) | EP1625161A4 (en) |
| JP (1) | JP2007531506A (en) |
| AU (1) | AU2003902483A0 (en) |
| WO (1) | WO2004104043A1 (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008055931A1 (en) * | 2006-11-08 | 2008-05-15 | Basf Se | Use of natural, recombinant and synthetic resilins in cosmetics |
| WO2008155304A1 (en) * | 2007-06-20 | 2008-12-24 | Basf Se | Synthetic repetitive proteins, the production and use thereof |
| US8101717B2 (en) | 2006-11-13 | 2012-01-24 | The University Of Sydney | Use of tropoelastin for repair or restoration of tissue |
| US8906651B2 (en) | 2007-11-26 | 2014-12-09 | Collplant Ltd. | Compositions comprising fibrous polypeptides and polysaccharides |
| US9687583B2 (en) | 2011-09-01 | 2017-06-27 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Adhesive biopolymers and uses thereof |
| KR20170113209A (en) * | 2016-03-23 | 2017-10-12 | 한양대학교 에리카산학협력단 | Self-assembled nanostructures of elastin and resilin-based block copolypeptides with stimuli responsiveness and resilience for drug delivery system, tissue engineering, and regenerative medicine and methods of preparing thereof |
| WO2019116342A1 (en) * | 2017-12-15 | 2019-06-20 | Politecnico Di Milano | Elastomeric peptide |
| US10799616B2 (en) | 2013-11-05 | 2020-10-13 | Collplant Ltd. | Cross-linked resilin-containing materials |
| US12268275B2 (en) | 2018-07-18 | 2025-04-08 | Bolt Threads, Inc. | Cross-linked elastomeric proteins in polar nonaqueous solvents and uses thereof |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2696255C (en) | 2007-08-14 | 2016-11-29 | Commonwealth Scientific And Industrial Research Organisation | Photoactivated crosslinking of a protein or peptide |
| KR101135158B1 (en) * | 2009-10-01 | 2012-04-16 | 이동익 | Heteroarm star polymer by using dityrosine |
| US10988515B2 (en) | 2017-01-13 | 2021-04-27 | Bolt Threads, Inc. | Elastomeric proteins |
| CN112442491A (en) * | 2020-12-03 | 2021-03-05 | 湖北省农业科学院经济作物研究所 | Clone expression and purification method of silkworm chorion peroxidase gene and application thereof |
| CN114507364B (en) * | 2022-02-15 | 2022-07-26 | 浙江大学 | Preparation method of photo-curing casein hydrogel and application of photo-curing casein hydrogel in hemostasis and skin repair |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4589882A (en) * | 1983-09-19 | 1986-05-20 | Urry Dan W | Enzymatically crosslinked bioelastomers |
| JP3581155B2 (en) * | 1995-04-14 | 2004-10-27 | バイオイラスティックス リサーチ,リミティド | Bioelastomer suitable as food additive |
| AU728480B2 (en) * | 1996-08-07 | 2001-01-11 | Hospital For Sick Children, The | Self-aligning peptides derived from elastin and other fibrous proteins |
| AU3867400A (en) * | 1999-03-19 | 2000-10-09 | Duke University | Methods of using bioelastomers |
-
2003
- 2003-05-21 AU AU2003902483A patent/AU2003902483A0/en not_active Abandoned
-
2004
- 2004-05-21 US US10/557,445 patent/US20070275408A1/en not_active Abandoned
- 2004-05-21 WO PCT/AU2004/000683 patent/WO2004104043A1/en not_active Ceased
- 2004-05-21 EP EP04734182A patent/EP1625161A4/en not_active Withdrawn
- 2004-05-21 JP JP2006529446A patent/JP2007531506A/en active Pending
Non-Patent Citations (13)
| Title |
|---|
| ADAMS,M.D ET AL.: "The genome sequence of Drosophila melanogaster", SCIENCE, vol. 287, no. 5461, 2000, pages 2185 - 2195 |
| ALI FE ET AL.: "Metal catalyzed oxidation of tyrosine residues by different oxidation systems of copper/hydrogen peroxide", J INORG BIOCHEM., vol. 98, no. 1, January 2004 (2004-01-01), pages 173 - 84 |
| AMINI F ET AL.: "Using oxidative crosslinking and proximity labeling to quantitatively characterize protein-protein and protein-Peptide complexes", CHEM BIOL., vol. 10, 2003, pages 1115 - 27 |
| ANDERSEN, SO; WEIS-FOGH, T: "Resilin: a rubber-like protein in arthropod cuticle.", ADV INSECT PHYSIOL, vol. 2, 1964, pages 1 - 65 |
| ANDERSON SO: "Covalent cross-links in a structural protein, resilin.", ACTA PHYSIOL SCAND, vol. 263, 1966, pages 1 - 81 |
| ANDREEV OA; RESHETNYAK YK; GOLDFARB RH.: "Evidence of inter- and intra-molecular crosslinking of tyrosine residues of calmodulin induced by photoactivation of ruthenium(II)", PHOTOCHEM PHOTOBIOL SCI., vol. 1, no. 10, October 2002 (2002-10-01), pages 834 - 6 |
| ARDELL D.H. ET AL.: "Tetntative identification of a resilin gene in Drosophila melanogaster", INSECT BIOCHEM. MOL. BIOL., vol. 31, no. 10, September 2001 (2001-09-01), pages 965 - 970, XP002998361 * |
| ARDELL, DH; ANDERSEN, SO: "Tentative identification of a resilin gene in Drosophila melanogaster", INSECT BIOCHEM MOLECULAR BIOL, vol. 31, 2001, pages 965 - 970 |
| BARRO F ET AL.: "Transformation of wheat with high molecular weight subunit genes results in improved functional properties", NAT BIOTECHNOL., vol. 15, 1997, pages 1295 - 1299 |
| BENNET-CLARK, HC; LUCEY, ECA: "The jump of the flea", J EXP BIOL, vol. 47, 1967, pages 59 - 76 |
| DATABASE GENBANK [online] June 2002 (2002-06-01), CERDA J. ET AL.: "Molecular characterization of Calymmin, a novel notochord sheath-associated extracellular matrix protein in the zebrafish embryo", XP002998359, accession no. NCBI Database accession no. (AAF06358), (NP_571089) * |
| LOMBARDI E.C. ET AL.: "Preliminary characterization of resilin isolated from the cockroach, Periplaneta americana", MAT. RES. SOC. SYMP. PROC., vol. 292, 1993, pages 3 - 7, XP002999007 * |
| See also references of EP1625161A4 |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008055931A1 (en) * | 2006-11-08 | 2008-05-15 | Basf Se | Use of natural, recombinant and synthetic resilins in cosmetics |
| US8101717B2 (en) | 2006-11-13 | 2012-01-24 | The University Of Sydney | Use of tropoelastin for repair or restoration of tissue |
| WO2008155304A1 (en) * | 2007-06-20 | 2008-12-24 | Basf Se | Synthetic repetitive proteins, the production and use thereof |
| JP2010530231A (en) * | 2007-06-20 | 2010-09-09 | ビーエーエスエフ ソシエタス・ヨーロピア | Synthetic repeat proteins, their production and use |
| US8367803B2 (en) | 2007-06-20 | 2013-02-05 | Basf Se | Synthetic repetitive proteins, the production and use thereof |
| CN101855239B (en) * | 2007-06-20 | 2013-11-06 | 巴斯夫欧洲公司 | Synthetic repeat proteins and their production and use |
| AU2008265231B2 (en) * | 2007-06-20 | 2014-05-01 | Basf Se | Synthetic repetitive proteins, the production and use thereof |
| US9145463B2 (en) | 2007-11-26 | 2015-09-29 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions comprising fibrous polypeptides and polysaccharides |
| US8906651B2 (en) | 2007-11-26 | 2014-12-09 | Collplant Ltd. | Compositions comprising fibrous polypeptides and polysaccharides |
| US9273152B2 (en) | 2007-11-26 | 2016-03-01 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions comprising fibrous polypeptides and polysaccharides |
| US9815874B2 (en) | 2007-11-26 | 2017-11-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Compositions comprising fibrous polypeptides and polysaccharides |
| US9687583B2 (en) | 2011-09-01 | 2017-06-27 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Adhesive biopolymers and uses thereof |
| US10799616B2 (en) | 2013-11-05 | 2020-10-13 | Collplant Ltd. | Cross-linked resilin-containing materials |
| KR20170113209A (en) * | 2016-03-23 | 2017-10-12 | 한양대학교 에리카산학협력단 | Self-assembled nanostructures of elastin and resilin-based block copolypeptides with stimuli responsiveness and resilience for drug delivery system, tissue engineering, and regenerative medicine and methods of preparing thereof |
| KR101952835B1 (en) | 2016-03-23 | 2019-03-04 | 한양대학교 에리카산학협력단 | Self-assembled nanostructures of elastin and resilin-based block copolypeptides with stimuli responsiveness and resilience for drug delivery system, tissue engineering, and regenerative medicine and methods of preparing thereof |
| WO2019116342A1 (en) * | 2017-12-15 | 2019-06-20 | Politecnico Di Milano | Elastomeric peptide |
| IL275278B1 (en) * | 2017-12-15 | 2024-10-01 | Milano Politecnico | Elastomeric peptide |
| IL275278B2 (en) * | 2017-12-15 | 2025-02-01 | Milano Politecnico | Elastomeric peptide |
| US12268275B2 (en) | 2018-07-18 | 2025-04-08 | Bolt Threads, Inc. | Cross-linked elastomeric proteins in polar nonaqueous solvents and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2003902483A0 (en) | 2003-06-05 |
| US20070275408A1 (en) | 2007-11-29 |
| JP2007531506A (en) | 2007-11-08 |
| EP1625161A4 (en) | 2006-07-12 |
| EP1625161A1 (en) | 2006-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1625161A1 (en) | A synthetic bioelastomer | |
| KR101932771B1 (en) | Processes for producing silk dope | |
| Ding et al. | Biomimetic production of silk-like recombinant squid sucker ring teeth proteins | |
| Kaplan et al. | Silk: biology, structure, properties, and genetics | |
| JP5128943B2 (en) | Recombinant spider silk protein | |
| EP1931702B1 (en) | Silk proteins | |
| CN108218972B (en) | Protein from the web of the Nephilengys Cruentata spider | |
| US20070099231A1 (en) | Bioelastomer | |
| Riley et al. | Bioproduction and characterization of a pH responsive self‐assembling peptide | |
| Wen et al. | The novel aciniform silk protein (AcSp2-v2) reveals the unique repetitive domain with high acid and thermal stability and self-assembly capability | |
| JPWO1995001432A1 (en) | Novel polypeptide and DNA encoding same | |
| AU2012339619A1 (en) | Collagen-like silk genes | |
| AU2004240695A1 (en) | A synthetic bioelastomer | |
| AU2004240694A1 (en) | A bioelastomer | |
| WO2024116130A1 (en) | Recombinant polypeptide | |
| CN107849100B (en) | Polar solvent solution and method for producing same | |
| Winkler | Triggered assembly of spider-silk like proteins | |
| Jansson | Strategies for functionalization of recombinant spider silk | |
| Grant | Biomimetic Production Techniques for Mechanical and Chemical Characterization of Sucker Ring Teeth Isoform-12 From the Dosidicus Gigas Squid | |
| HK1257458B (en) | Proteins from the webs of nephilengys cruentata spiders | |
| HK1171774B (en) | Processes for producing silk dope | |
| HK1171774A (en) | Processes for producing silk dope | |
| HK1164897A (en) | Silk proteins | |
| HK1119718B (en) | Silk proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2004240695 Country of ref document: AU Ref document number: 2006529446 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004734182 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2004240695 Country of ref document: AU Date of ref document: 20040521 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004240695 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004734182 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10557445 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 10557445 Country of ref document: US |





