WO2004101800A1

WO2004101800A1 - Dna constructs and vectors for the inducible expression of nucleotide sequences

Info

Publication number: WO2004101800A1
Application number: PCT/EP2004/005207
Authority: WO
Inventors: Thomas Henkel; Martin Funk; Volker RÖNICKE; Kay Brinkmann
Original assignee: Medigene Ag
Priority date: 2003-05-15
Filing date: 2004-05-14
Publication date: 2004-11-25

Abstract

The present invention relates to a DNA construct comprising a viral vector backbone, at least one recombination cassette, and at least one inducible promoter as well as to vectors wherein a heterologous nucleic acid is inserted into the recombination cassette of the DNA construct of the invention.

Description

DNA constructs and vectors for the inducible expression of nucleotide sequences

The present invention relates to DNA constructs or vectors for the inducible gene expression as well as to methods for the expression of nucleotide sequences.

Human gene therapy by administration of viral vectors was recently challenged by safety issues. One important possibility to reduce side effects is to control the expression level of the recombinant proteins encoded by the viral vectors. Furthermore, inducible gene expression is also of pivotal importance in the field of target validation as it offers the unique opportunity to analyze harmful proteins, because the expression of a cDNA coding for such a protein and packaged in viral particles in combination with a constitutive promoter would result in the destruction of cells before the protein could be tested.

Initial attempts for inducible gene expression were based on endogenous promoters responsive to heat shock, heavy metals or hormones. These systems hampered from pleiotrophic effects and were not appropriate for gene therapy approaches. Consequently, the cuiτent generation of inducible systems is based on chimeric transactivators (for review see Harvey and Caskey, 1998).

The general requirements for inducible systems are a lack of interference with endogenous processes, low basal activity and dose responsiveness. Inducers have to be physiologically inert and should have a high rate of clearance from the organism. Finally, transactivators have to be characterized by low immunogenicity. Several different systems exist in the art (for reviews see Mills, 2001 and Burcin et al., 1998). However, these systems have either the disadvantage that an unacceptable high basic activity of the promoter is observed or that the system is only active in selected cells.

A well-known example in the art is the tetracycline-regulated system, which is derived from the bacterial transposon TN10. The original version is based on a fusion protein of the tet-repressor and the HSN-NP16 transactivation domain (tTA). The inducible promoter is composed out of several tet-operators upstream of a minimal promoter. The system is tet repressible as tTA only binds to the tet- operator in the absence of tetracycline. The reversible system is based on a mutant tet-repressor (rtTA), which allows induction of gene expression due to tetracycline or doxicycline administration. The system shows a high level of inducibility, but also a strong basal activity. Another disadvantage is that tetracycline is deposited in bones, which clearly affects the reversibility of the inducible expression in vivo.

The antiprogestin-regulated GeneSwitch-System is composed out of a recombinant transcription factor, which is highly specific for the antiprogestin R.U486, and an inducible promoter containing several GAL4-binding sites upstream of a minimal promoter. RU486 has a well characterized pharmacokinetic as it is a therapeutic for human beings. The recombinant transcription factor is usually a fusion protein out of either HSN-NP16 or the ΝFKB transactivation domain, a mutated progesterone receptor ligand binding domain and a GAL4 DΝA-binding domain. In its original version, it had a 100-fold higher selectivity for RU486 than for progesterone and needed only 0.1 to 1.0 percent of the antiprogestin action of RU486 (Wang, O'Malley, Tsai, O'Malley, 1994; Brogden, Goa, Faulds, 1993). The improved version is characterized by a recombinant transcription factor, which is ten times more potent than the previous one and shows full activity at very low RU486 concentrations (0.01 nM) (Wang, Xu, Pierson, O'Malley, Tsai, 1997). No anti-progestin or anti-glucocorticoid action of RU486 could be observed at these concentrations.

Several attempts were undertaken to analyze the suitability of this inducible expression system for the in vivo administration. One analysis used a HSN vector in combination with the GeneSwitch-System (Oligino et al., 1998). Neuronal cells were infected in vivo and revealed only low background activity in combination with clear inducibility. Unfortunately, HSNs are well suited for the infection of neuronal but not most other tissues. In another experimental setting gutless recombinant adenoviruses were used to infect liver cells in vivo (Burcin et al., 1999). The results , were encouraging in terms of transduction efficiency and inducibility, but were also characterized by high background activity of the inducible promoter. Amelioration was achieved by modification of the recombinant transcription factor - a ΝFKB transactivation domain was used instead of the NP16 part, but basal activity was still too high. The same holds true for the experiments shown in Molin et al., 1998, Molin et al., 2000 and Edholm and Molin, 2001, where also a GeneS witch expression system was tested.

In summary, all systems used in the art for the inducible expression of heterologous nucleic acids have either the disadvantage that they work only in selected cells or that an unacceptable high basal activity is observerd.

Therefore, the problem underlying the present invention resides in providing agents for the inducible expression of heterologous nucleic acids with an acceptable low basal activity.

In the context of the present invention, the inventors could surprisingly demonstrate that expression systems based on a viral backbone with inducible promoters exhibit a very low basal activity if these promoters are combined with recombination cassettes suited for the introduction of heterologous nucleotide sequences. Consequently, in one aspect of the present invention, the problem is solved by a DNA construct comprising a viral vector backbone, at least one recombination cassette from the Gateway® cloning system, which is available under the registered trademark "Gateway" (Gateway® Technology, Version D, 2003), and at least one inducible promoter from the anti-progestine-regulated system.

As demonstrated in, the examples, this DNA-construct is very well suited for the introduction of heterologous DNA and the resulting vector demonstrates extremely low basal activity when used for the expression of the heterologous DNA in mammalian cells.

In the context of the present invention, the term "recombination cassette" means a DNA sequence in which nucleotide sequences can be introduced via homologous recombination. A recombination cassette comprises usually two recombination sites, which are reverse complementary DNA-binding sites and are located on both borders of the recombination cassette. The recombination cassette of the DNA construct of the present invention allows insertion of a heterologous DNA sequence which is comprised in a cognate recombination cassette on another DNA molecule. The exchange of the DNA sequences between the recombination cassettes is mediated by recombination enzymes which act on the recombination sites which are located on both borders of each recombination cassette. The mechanism of recombination, in particular of recombinational cloning using a recombination cassette has been described in Gopaul and Duyne 1999, and in Hallet and Sheratt 1997.

In a preferred embodiment, the recombination sites at the borders of the recombination cassette of the DNA construct of the present invention are selected from the group consisting of the types attL, attR, attB, and attP, and are of the same type at both borders. In a particularly preferred embodiment, the recombination sites on both borders of the recombination cassette are of the same type, but comprise mutations that hinder recombination between the recombination sites at both borders of the recombination cassette.

The recombination sites attL, attR, attB, and attP are known from the bacteriophage lambda site-specific recombination system which facilitates the integration of lambda into the E. coli chromosome (Hartley et al., 2000). In a particularly preferred embodiment, the DNA construct of the present invention comprises a recombination cassette that is available under the registered trademark "Gateway®" (Gateway® Technology, Version D, 2003). The Gateway technology (Invitrogen) allows the efficient transfer of DNA segments in parallel into multiple vector backbones for optimization of protein expression and functional analysis of genes (Hartley et al, 2000; Phizicky et al. 2003). Consequently, a fast and efficient transfer into mammalian cells of not only a single cDNA, but of whole cDNA libraries is possible.

The recombination cassette of the DNA molecule of the invention allows for recombination cloning of a heterologous DNA, which can be verified by assaying for the phenotypic function encoded by the heterologous DNA or by the well- known methods of restriction enzyme analysis or sequence analysis of DNA molecules.

It is an advantage of the DNA construct of the present invention, that it allows for packaging of heterologous DNA molecules, in particular for the generation of cDNA libraries, and that it allows for the controlled expression of heterologous DNA sequences in mammalian cells as a vehicle for gene therapy.

In the context of the present invention, the term "inducible promoter" means a DNA sequence which regulates the expression of another nucleotide sequence and which activity is induced by at least one factor which binds to the promoter. In the context of the present invention, the term promoter means the DNA sequence upstream or downstream to the coding sequence, required for basal and/or regulated transcription of a gene.

1 One especially suited inducible promoter in the context of the present invention is a promoter from the anti-progestine-regulated system. This system has already been described above.

In the context of the present invention, the term "viral backbone" denotes that the DNA construct used is derived from the genome of a virus which has been modified for several purposes, e.g. having an inducible promoter and a recombination cassette as defined above.

According to a preferred embodiment of the invention, the promoter is localized 5' from the recombination cassette.

According to a preferred embodiment of the invention, the viral backbone is derived from an adenovirus, an adeno-associated virus, a lentivirus or a baculovirus.

According to a preferred embodiment of the invention, the DNA construct further comprises at least one nucleotide sequence coding for a marker or reporter protein.

According to a more preferred embodiment of the invention, the marker or reporter protein is selected from the group consisting of blue fluorescent protein (BFP), cyan fluorescent protein (CFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), His3, CAT, GUS, LacZ, and Luciferase. According to a preferred embodiment of the invention, the viral backbone carries an origin of replication , a selection marker and centromere from the genome of Saccharomyces cerevisiae for replication and segregation of the DNA construct in Saccharomyces cerevisiae.

According to a preferred embodiment of the invention, the selection marker is selected from the group consisting of ADE2, LYS2, HIS3, TRP1, LEU2, URA3, MET3, Kan, and Zeo.

According to a preferred embodiment of the invention, transformation and homologous recombination with the DNA construct in Saccharomyces cerevisiae can be used for modification of the DNA backbone without the need of classical cloning techniques. Following the modification of the DNA backbone the DNA construct can be reintroduced and propagated in E. coli:

According to a preferred embodiment of the irivention, modification of the DNA construct includes modification or insertion of the promoter, marker or recombination cassette or integration of additional promoters, markers or recombination cassettes.

According to a preferred embodiment of the invention, multiple recombination cassettes from the MultiSite Gateway system could be introduced into the DNA backbone.

In the context of the present invention, the inventors have demonstrated for the first time that viral vectors demonstrate a surprisingly and extremely low basal activity if inducible promoters are combined with recombination cassettes.

Consequently, in another aspect of the present invention, the problem is solved by a DNA construct comprising a viral vector backbone, at least one recombination cassette, and at least one inducible promoter. Numerous recombination systems from various organisms have been described and are suited in the context of the present invention. See, e.g., Hoess et al., Nucleic Acids Research 14(6):2287 (1986); Abremski et al., J. Biol. Chem. 261(1):391 (1986); Campbell, J. Bacteriol. 174(34):7495 (1992); Qian et al, J. Biol. Chem. 267(11):7794 (1992); Araki et al., J. Mol. Biol. 225(1):25 (1992); Maeser and Kahnmann; Mol. Gen. Genet. 230:170-176 (1991)).

Another advantage of the present invention is that the DNA construct of the present invention allows fast and efficient transfer into mammalian cells of not only single cDNAs but of whole cDNA libraries.

The DNA constructs of the present invention enable efficient and specific recombination of DNA segments using recombination proteins. They are optimally suited for the representative packaging of cDNA libraries, due to the ease of recombination and packaging of potential harmful proteins, which is of pivotal importance for expression cloning approaches in mammalian cells. In addition, the DNA constructs of the invention are suited as a vehicle for gene therapy.

According to preferred embodiments, this DNA construct of the invention has further features as defined above with respect to the promoter, the viral backbone and the marker or reporter proteins.

In an especially preferred embodiment, the recombination cassette is from the cloning system provided under the registered trademark Gateway® and/or said inducible promoter is from the anti-progestine-regulated system. These two systems are especially favourable since they have been characterized well in the art (Brogden et al. 1993; Phizicky et al. 2003; Gopaul and Duyne 1999; Hallet and Sheratt 1997). The invention further relates to a vector, wherein a heterologous nucleotide sequence is inserted into the recombination cassette of the DNA construct.

This vector comprising heterologous nucleotide sequences is extremely suited for the transfection of mammalian cells and for the expression of the heterologous nucleotide sequences in these cells. These heterologous nucleotide sequences may include genes coding for proteins of interest, but may also be sequences of which the specific function is unknown to date and which can be analyzed with the help of the vector of the invention. The vector of the present invention is of particular advantage in gene therapy for the expression of genes in a patient who suffers from missing function of said genes. A further advantage of the vector of the present invention is that it allows for the analysis of gene function by the expression of a gene and the comparing of relevant parameters during expression and in the absence of expression of said gene.

In an especially preferred embodiment, the present invention provides a new combination of an adenoviral vector, fluorescence markers, an inducible expression system like the anti-progestine-regulated system and a recombination system like the Gateway system. Unexpectedly, this new system is characterized by virtually no leakiness in the absence of any insulator sequence (see below) in combination with an at least 1000-fold inducibility. This system has the following advantages:

- Inducible promoter without any detectable leakiness

- Fluorescence marker proteins to monitor packaging, amplification and infection of target tissue

- Recombination system for inclusion of whole cDNA libraries

- Expression system optionally composed out of two independent viruses allows optimal fine tuning of expression level.

The invention further relates to a method of producing a DNA construct of the invention, wherein the at least one inducible promoter and the at least one recombination cassette and optionally the at least one nucleotide sequence coding for a marker or reporter protein are introduced together or separately into a viral vector backbone. Techniques for the introduction of DNA sequences into the viral vector backbone are known in the art. In preferred embodiments of the invention, the viral backbone is derived from an adenovirus, an adeno-associated virus, a lentvirus or a baculovirus. Preferably, the viral backbone comprises a genome of an adenovirus (Maniatis). In a particularly preferred embodiment of the invention, the viral backbone comprises at least nucleotides 1 to 341 of the adenovirus genome (Steinwaerder, 2000).

In a preferred embodiment of the present invention, the viral vector backbone comprises an adenovirus-derived vector backbone which is available under the trademark AdEasy™ (AdEasy™, Application Manual, Qbiogene Version 1.4; He et al. 1998; Sambrook et al. 1989).

Furthermore, the invention relates to a method of producing a vector according to the invention, wherein a heterologous nucleotide sequence is inserted into the recombination cassette of the DNA construct of the invention. Techniques for the introduction of DNA sequences into the viral vector backbone are known in the art (see above).

As explained above in detail, many inducible promoters described in the art are activated by recombinant transcription factors provided by the expression of nucleic acids encoding the transcription factors (Salucci et al. 2002; Xu et al. 2001; Steinwaerder and Lieber 2000). Consequently, in such systems, it is necessary to provide besides from the vector with the inducible promoter and the heterologous nucleic acid to be expressed also a vector encoding the transcription factor.

Therefore, the invention also relates to an expression system comprising a) at least one vector of the invention, and b) at least one vector comprising a nucleotide sequence coding for at least one transcription factor specific for the inducible promoter of the vector of section a).

Within the invention it is also included that the nucleotide sequence encoding the transcription factor is localized on the same vector as the promoter and the heterologous nucleic acid.

In a preferred embodiment, also the vector encoding for the transcription factor is of viral origin, preferably from an adenovirus, an adeno-associated virus, a lentivirus or a baculovirus.

The invention provides further a method for the expression of a heterologous nucleotide sequence, wherein an expression system of the invention is introduced into a suitable mammalian cell and the mammalian cell is cultivated under conditions suitable for the expression of the heterologous nucleotide sequence, wherein the expression of the heterologous nucleotide sequence is induced by the addition of a factor activating the inducible promoter.

Furthermore, the invention relates to a method for the expression of a heterologous nucleotide sequence, wherein a vector of the invention is introduced into a suitable mammalian cell and the mammalian cell is cultivated under conditions suitable for the expression of the heterologous nucleotide sequence, wherein the expression of the heterologous nucleotide sequence is induced by addition of a factor activating the inducible promoter. The suitable mammalian cells of the present invention and the methods of their treatment, in particular of their culture are known to the skilled person in the art (Catalogue 2003 of the American Type Culture Collection (ATCC)). As mentioned above, the DNA constructs of the invention are very useful for the preparation of cDNA libraries, e.g. for testing a multiplicity of DNA sequences for a given purpose.

Therefore, the invention relates also to a cDNA library, comprising a multiplicity of nucleic acid sequences, wherein the each sequence is inserted into the recombination cassette of a DNA construct of the invention.

The present invention realtes in addition to a method of screening of a cDNA library of the invention. As described above, the present invention allows for the expression of genes of unknown functions, a multitude of which lead to phenotypic changes of the cell representing a cDNA clone, and which can be examined visually or experimentally, in particular by assaying for morphological changes using fluorescent markers, enzymatic analyses, Western-blot analyses etc.

In a preferred embodiment of the method of screening according to the present invention the desired phenotype is a phenotypic trait of the cells transformed with a DNA construct of the cDNA library, which can be detected using a fluorescent probe which detects the phenotypic trait, an enzymatic assay which detects the phenotypic trait and/or a western blot analysis using an antiserum, polyclonal or monoclonal antibody or antibody fragment which detects the phenotypic trait.

In the art it became evident that adeno viral sequences spanning nucleotides 1-341, which occur in all recombinant adenoviral vectors, contain cryptic enhancer sequences which influence heterologous expression interfering with heterologous promoters (Steinwaerder, 2000, Steinwaerder and Lieher, 2000). Consequently, all tested adenoviral, inducible expression systems were characterized by leakiness in the absence of insulator sequences, which led to low titers in combination with cDNAs coding for harmful proteins (Rubinchik, Ding, Qin, Zhank, Don, 2000, Gene Terh. 7:875-885). To inliibit said interference and the resulting leakiness insulators (or cl romatin boundary elements) have been required. The mechanism of action of said insulators is not yet known, but several hypotheses exist, which are described in Cai and Shen 2001.

In the context of the present invention;! it could be shown that the use of recombination sites, such as for example the att-sites of the Gateway recombination system, block the cryptic enhancer effects of the adenoviral backbone resulting in virtually no leakiness of the inducible expression of the transgene. In addition, silencer effects of the adenoviral backbone, which have occasionally been observed to influence heterologous expression by interfering with heterologous promoters are effectively blocked in the DNA construct and vector of the present invention which comprise recombination sites.

Therefore, an insertion of insulator sequences is no longer essential for the tight control of transgene expression in adenoviral vectors. An exact and reliable control of gene expression is required in inducible as well as in constitutive systems and/or in systems comprising tissue-specific promoters. Any interference by further parts of the DNA sequence have to be avoided in order to obtain a controllable and in particular a predictable expression of the heterologous gene. Interactions of vector systems with endogenous factors has led to uncontrollable influencing of the expression of a heterologous gene in the prior art, which is avoided by the present invention (Salucci et al, 2002; Hawley 2001; Pannell and Ellis 2001; Xu et al 2001; Ehrhardt et al. 2003; Ramezani et al. 2003; Haberman and McCown 2002; Paterna and Bueler 2002; Schnieder et al. 2002; Lund et al. 1996; Van der Velden et al. 2001; Steinwaerder and Liebermann 2000; Walther and Stein 2000; Sandhu et al. 1997).

Consequently, the invention also relates to the use of recombination sites for the inhibition of enhancer-promoter interactions and of silencer-promoter interactions, preferably in viral, epecially preferred in adenoviral systems. In a preferred embodiment, said recombination sites are selected from the group consisting of attL-attR, attB-attP, Cre-loxP, FLP-FRT, R-Rs, XerCD.

The DNA constructs or vectors or expression systems of the invention are extremely suitable as pharmaceutical compositions, since they enable the production of a polypeptide starting from its nucleotide sequence by the use of a system which has very little or no basal activity. Consequently, the present invention also relates to a pharmaceutical composition comprising a DNA construct, a vector or an expression system of the invention, optionally in combination with pharmaceutically acceptable carriers.

Furthermore, the invention also relates to the use of a DNA construct, a vector or an expression system of the invention for the preparation of a pharmaceutical composition. In addition, the invention also relates to a method of treating a patient, wherein sufficient amounts of a DNA construct of the invention or a vector of the invention or an expression system of the invention are administered to a patient.

The present invention in addition refers to pharmaceutical compositions. In a first embodiment, the pharmaceutical compositions of the invention comprise the DNA construct, the vector or the expression system of the invention. A further embodiment of the pharmaceutical compositions of the invention comprises the vector which is not packaged into a virus. A further embodiment of the pharmaceutical compositions of the invention comprises the inductor of the vector or of the DNA construct of the invention, in particular the inductor RU 486. Still a further embodiment of the pharmaceutical compositions of the invention comprises the transcription factor for the vector of the invention, which, according to the invention, can be expressed separately and can be administered separately from the vector of the invention. The pharmaceutical compositions of the invention preferably are suitably formulated for oral or systemic, in particular parenteral, administration, for subcutaneous or intramuscular administration or for administration via the mucuous membrane. Preferably, the pharmaceutical compositions of the invention are suitable for systemic, parenteral, subcutaneous or intramuscular injections. The pharmaceutical compositions of the invention are preferably solutions or suspensions and comprise the vector of the invention in a pharmaceutically suitable buffer. The pharmaceutical compositions of the invention preferably comprise additive agents and auxiliary agents, preferably auxiliary agents for stabilization. The pharmaceutical compositions of the invention can preferably be administered as a solution or as a suspension, as an elixir or in the form of capsules, preferably as an injection or infusion solution.

Preferably the pharmaceutical compositions of the invention comprise additive agents and auxiliary agents which are selected from the group comprising: detergents, in particular such as Triton-X-100 or sodiumdesoxycholate; polyols, in particular such as in particular polyethyleneglycole, glycerine, sugars, in particular such as saccharose and/or glucose; ampholyte compounds, in particular such as amino acids such as e.g. glycine or in particular taurine or betaine and/or proteins, in particular such as bovine or human serum albumin. Preferred embodiments comprise detergents, polyols and/or ampholytic compounds. Further embodiments of additive agents and auxiliary agents are proteinase inhibitors, in particular aprotinin, epsilon-aminohexanoic acid or pepstatin A.

Another subject of the invention is the use of a DNA construct according to the present invention or a vector according to the invention or an expression system according to the invention for the preparation of a pharmaceutical composition.

The DNA constructs, viral vectors, expression systems, cDNAs, pharmaceutical compositions, methods and uses of the present invention comprise heterologous nucleic acids or refer to heterologous nucleic acids which are preferably any gene which is relevant for any disease, or which is relevant for substitution for a defect in any gene.

The purpose of the present invention was to generate a viral vector for the recombinant gene expression in mammalian cells, whereby the expression level should be under tight control in order to allow dose dependent analysis of the action of for example even harmful or toxic proteins at distinct time points in the cellular context. Moreover, efficient transfer of cDNAs or whole cDNA-libraries should be feasible independent of any specific restriction sites as the prerequisite to perform expression cloning approaches.

These objects are met by the present invention. As it is shown in the examples the expression system underlying the present invention was capable to produce rAVs for the expression of exactly the same splice factor as in the above described system developed by Molin et al. (see above). Though they used also GeneSwitch expression system in an adenoviral vector, their approach showed substantial leakiness and therefore a crucial reduction in yield and moreover does not allow the recombination of cDNAs, whereas with the present invention it is feasible to express said splice factor without any reduction in yield.

The invention is more closely explained in the following examples with reference to the figures 1 to 17. The figures show:

Figure 1 : DNA-sections for modular construction of the vectors pKS 3 and pKS 4 as well as the adenoviral vectors pKA 3 und pKA 4. The

DNA-sections of the promoter and the expression cassettes were inserted in pShuttle-Vectors (Qbiogene).

CMV: constitutive Cytomegalovirus-Promoter

PA: Polyadenylation signal UAS: Upstream Activator Sequence, binding sites of Gal4-transcription activator

Pro: Adenovirus Elb TATA-Sequence

K: Kozak-Sequence att: Attachment-Site, recombination sequence of Bakteriophage λ

Gateway: Recombination cassette of the Gateway

System (Invitrogen)

Stop : Codon for termination of transkription

CFP: Cyan Fluorescent Protein Bglll, BamHI, Xhol, Xbal, Kpnl, Pvul: recognition sequences of restriction endonucleases

Figure 2: ^' Construction of the plasmid pKS 2 for the constitutive, bicistronic protein expression. Two cassettes for the constitutive expression of recombinant proteins and the constitutive expression of CFP were inserted in vector pKS.

Figure 3: Construction of plasmid pKS 3 for the inducible expression of recombinant proteins and the constitutive expression of CFP. The constitutive promoter of plasmid pKS 2 was replaced with the inducible promoter (Gene Switch, Invitrogen).

Figure 4: Construction of plasmid pKS 1 for the constitutive expression of recombinant fusion proteins. The cassette for the constitutive expression of recombinant CFP-fusion proteins was inserted in vector pKS. Figure 5: Construction of plasmid pKS 4 for the inducible expression of recombinant fusion proteins. The constitutive promoter of plasmid pKS 1 was replaced with the inducible promoter (Gene Switch, Invitrogen).

Figure 6: Construction of the adenoviral plasmids pKA 3 and pKA 4. The expression cassettes of plasmids pKS 3 (with inducible expression cassette) and pKS 4 (cassette for constitutive expression of CFP- fusion proteins) were inserted in the genome of a modified, recombinant adenovirus (pAV-dummy). The resulting viral vectors were named pKA 3 and pKA 4, respectively.

ORI Origin of Replication

Res Ampiciline resistence

LITR / RITR Left / Right Inverted Terminal Repeat Ad5 ΔE1/ΔE3 recombinant adenovirus, Serotype 5, deletion in El and E3 genes

Pad: recognition sequence of restriction endonuclease

Figure 7: DNA-sections for modular construction of the adenoviral plasmid pKA-Switch. The DNA-sections for the expression of the transcription factor and YFP were introduced in pShuttle-Vectors (Qbiogene).

Pro: Herpes Simplex Virus Thymidinkinase- minimal promoter

YFP: Yellow Fluorescent Protein

DBD: DNA binding domaine PRB: Antiprogesterone binding domaine

TAD: Trans-activation domaine

Figure 8: Construction of the adenoviral plasmid pKA-Switch for the bicistronic expression of transcription factors and YFPs. The cassette for the expression of the transcription factor and YFP were inserted in the vector pShuttle (Qbiogen). The viral vector pKA- Switch was constructed by recombination of the resulting plasmid pShuttle-S witch and recombinant adenovirus genome (Serotype 5, deletion in El and E3 genes, pAdEasyl).

Ad5 Homology: sections of vektor pKS for the homologous recombination with the adenovirus genome, Serotype 5

Res Kanamycine resistence

Figure 9: Gene card of adenoviral plasmid pKA 3. The vector is suited for the inducible expression of recombinant proteins with simultaneous constitutive CFP expression. Depicted is the circular plasmid for the replication in bacteria. For packaging of the viruses the vector was linearized with Pad and transfected in HEK cells. All gene sections with the exception of the deleted adenoviral genome are drawn to scale. The overall size of the vector is approximatly 34 Kb.

Amp^r Ampiciline resistence

Figure 10: Schema displaying components and mechanism of the GeneSwitch system. Due to basal expression activity of the pSwitch gene, low amounts of the inactive transcription factor are expressed. After activation of the transcriptin factor by RU486 (Mifepristone), the expression of the transgene and the transcription factor itself is induced. High transcription levels of the transgene are achieved due to the autoregulative mechanism of the system.

Figure 11 : Gateway recombination reaction, BP reaction. DNA sequences from PCR or cDNA library are transferred into an universal entry vector by using the site specific recombination properties of bacteriphage lambda. After recombination and selection the entry vector can be used as a transfer vehicle to shift the DNA sequence into different expression systems.

Figure 12: Gateway recombination reaction, LR reaction. The transgene of the entry vector is transferred into the expression vector of choice by using the site specific recombination properties of bacteriphage lambda. After recombination and selection the expression vector can be used for expression and analysis of the transgene in biological assays

Figure 13: Generation of recombinant adenovirus using AdEasy system. The construction of a recombinant adenovirus is a two-step process in which the desired expression cassette is first assembled into the transfer vector pShuttle. Subsequently the casette is transferred into the adenoviral genome by homologous recombination of pShuttle and p AdEasy 1. Finally the linearized recombinant adenovirus vector can be packaged into infectious virus particles in HEK293 cells. Figure 14: Inducibility of recombinant gene expression can be controlled by application of individual viruses. Viruses for the recombinant transcription factor (AV-Sw) and the inducible reporter gene LacZ (AV-lac) were administered to pCMs in different MOIs. Expression was switched on by adding of RU486 at 10^"8 M. Cells were harvested 60 hrs later. The β-galactosidase activity of cell extracts were standardized against the value which was obtained by infecting cells with AV-Sw at an MOI of one and AV-lac at an MOI of eight. Error bars indicate standard deviation.

Figure 15: Dose response relationsliip between RU486 administration and inducible gene expression. Primary cardiomyocytes from neonatal rats were stimulated with phenylephrine and infected with viruses coding for the recombinant transcription factor (MOI 1) and the LacZ reporter gene (MOI 8) controlled by the inducible promoter, respectively. RU486 was administered at different concentrations. Cells were harvested 60 hrs after induction of expression. Amount of β-galactosidase in cell extracts was determined.

Figure 16: Time dependent induction of recombinant gene expression in primary cardiomyocytes. Primary cardiomyocytes from neonatal rats were infected with the inducible expression system (AV-Sw MOI 1, AV-lac MOI 8). Cells were harvested at different time points after administration of RU486 at a final concentration of 10^"8 M. Levels of β-galactosidase activity were measured in cell extracts and standardized against the 60 hrs value. PE: Phenylephrine 100 μM. Figure 17: Amplification of an rAV for the regulated expression of ASF demonstrated tightness of the new system. Recombinant adenoviruses bearing cDNAs coding for different proteins under control of the inducible (GeneSwitch) or CMV promoter were amplified in 293 cells. Titers of resulting viral suspensions were determined by end-point dilution based on fluorescence signal from the second cistron. 1: CMV- YFP, 2: GeneSwitch- YFP, 3: GeneSwitch-ASF, 4: GeneSwitch-RNase-tox

Example 1 : Construction of plasmids #11 and #29

The pCI vector (Promega) (SEQ ID NO:4) was modified in the following way. It was cut with BsrG I, blunted with Klenow-fragment in the presence of dNTPs and religated to eliminate the BsrG I site. The new vector was cut with Nhe I and Not I and gel purified. A PCR fragment containing the coding region for the yellow variant of the green fluorescent protein (YFP) and the following restriction sites was inserted into the Nhe I and Not I sites: Spe I-Xba I-EcoR I-Xho I- YFP coding region (2. codon until end)-STOP-Not I. The pEYFP plasmid (Clontech) served as a template for the PCR amplification. This vector was named #11. The new vector was cut with Xba I and EcoR I and gel purified. To derive plasmid #29 a Kozak- sequence was inserted into the Xba I and EcoR I sites of vector #11. The Kozak sequence was derived from oligo annealing. Kozak oligo 5': CTA GAA CTA GTT CCA CCA TGG (SEQ ID NO:8). Kozak oligo 3': AAT TCC ATG GTG GAA CTA GTT (SEQ ID NO:9). (The first ATG of the coding region is indicated in bold)

Example 2: Construction of plasmid #148, #149, #232

In the first step the pShuttle plasmid (He et al, 1998) (SEQ ID NO:6) was cut with Sal I and Kpn I, gel purified, blunted with T4-polymerase and religated to eliminate the multiple cloning site. The vector, which was named plasmid #148, was digested with EcoR I, blunted with T4-polymerase and religated to get rid of the single EcoR I site in the vector backbone. This vector was named #149. Next the vector was linearized with Bgl II and desphosphorylated. A whole expression cassette for a Flag-CFP (cyano variant of GFP) fusion protein derived from a modified pCI vector was inserted into the Bgl II site. The new construct was named plasmid #151.

The pCI vector (Promega) (SEQ ID NO:4) was modified in the following way: It was cut with BsrG I, blunted with Klenow-fragment in the presence of dNTPs and religated to eliminate the BsrG I site. The new vector was cut with Nhe I and Not I and gel purified. A PCR fragment containing the coding region for the CFP (SEQ ID NO:l) and the following restriction sites was inserted into the Nhe I and Not I sites: Spe I-Xba I-EcoR I-Xho I-CFP coding region (2. codon until end)- STOP-Not I. The pECFP-Cl plasmid (Clontech) served as a template for the PCR amplification. The new vector was cut with Xba I and EcoR I and gel purified. The coding region for the Flag epitope was constructed by oligo annealing and inserted into the Xba I and EcoR I sites.

Flag oligo 5': CTA GAT CCA CCA TGG ATT AC A AGG ATG ACG ACG ATA AGG (SEQ ID NO: 10)

Flag oligo 3': AAT TCC TTA TCG TCG TCA TCC TTG TAA TCC ATG GTG GAT (SEQ ID NO: 11)

(The first ATG of the coding region is indicated in bold)

Next the whole CFP-expression cassette (Fig. 1) was isolated by digestion of this vector with Bgl II and BamH I and gel purification of the smaller band. The resulting fragment was inserted into the Bgl II site of the vector described above to get plasmid #151. To get plasmid #232, plasmid #151 was cut with EcoR I and Xho I and gel purified. A PCR fragment containing the entire coding region of VDAC-3 (voltage dependent anion channel protein mRNA accession number: AF038962) without stop codon was inserted into the EcoR I and Xho I sites. To do this the EcoR I site was added in frame to the 5' end of the coding region and the Xho I site in frame to the 3' end by the PCR primers EcoRI-VDAC and NDAC-XhoI. A human heart cDΝA library served as template for the PCR amplification.

EcoRI-NDAC: CCG GAA TTC TGT AAC ACA CCAACG TAC TGT

(SEQ IDNO:12)

NDAC-XhoI: CCG CTC GAG ATC TTC CAG TTC AAA TCC CAA (SEQ ID NO: 13)

Example 3 : Construction of pKA 3

Plasmid #11 was digested with restrictionendonucleases Xho I and Not I and gel purified to get rid of the YFP coding sequence. A linker (Xho I-Spe I-Not I, Sequence: 5' TCGAGACTAGTGCGGCC 3'; SEQ ID NO:14) was inserted to get plasmid #11-1. In parallel, plasmid #232 was cut with restrictionendonucleases EcoR I and Xho I and gel purified in order to delete the NDAC-3 coding region. A Mfe I-Mfe I-Sal I linker (Sequence: 5' AATTGCAATTGGTCGA 3'; SEQ ID NO: 15) was inserted, which destroyed EcoR I and Xho I recognition sites. The resulting construct was named plasmid #232-1. The next step was the isolation of the expression cassette from plasmid #11-1. The construct was digested with restrictionendonucleases Bgl II and BamH I and the smaller fragment containing the entire expression cassette was gel purified. Plasmid #232-1 was linearized with Bgl II and the isolated expression cassette was inserted into the Bgl II site. The resulting construct, which contained the expression cassette in head to tail organization, was named plasmid #232/ 11. Plasmid #232/ 11 was linearized with Xba I and Spe I and gel purified. Finally, the gateway module was amplified by PCR for all reading frames. By addition of Xba I and Spe I restriction sites by primers GA and GB, the gateway cloning module (Gateway cloning system cassette, reading frame C, h vitrogen; see Fig. 1: "recombination cassette" (SEQ ID NO:2)) could be inserted into the plasmid #232/ 11 to get the final constructs named pKS 2-1; pKS 2-2; pKS 2-3 (see Fig. 2).

Sequen'ce primer GA-1 (no frameshift): 5'GCTCTAGAGCAGGGGTACCCCTCCACCATGGGACAATTGGATCAAA CAAGTTTGTACAAAAAAG3' (SEQIDNO:16)

Sequence primer GA-2 (frameshift +1):

5 ' GCTCTAGAGCAGGGGTACCCCTCC ACC ATGGGACAATTGGTATC AAA CAAGTTTGTACAAAAAAG3' ' (SEQ ID NO: 17) Sequence primer GA-3 (frameshift +2):

5 ' GCTCTAGAGC AGGGGTACCCCTCC ACCATGGGAC AATTGGCTATCAA ACAAGTTTGTACAAAAAAG3 ' ^• (SEQ ID NO: 18)

The primers GA-1, GA-2 or GA-3, respectively, added Xba I, Kpn I, Mfe I restriction sites and a Kozak sequence upstream of the gateway module. Sequence primer GB:

5'GTTCCGACTAGTATCATCTAATTAATATCGAACCACTTTGTACAAGAA3'

(SEQ ID NO:19)

The primer GB added "stop" codons for three reading frames and restriction sites for Spe I and Xho I downstream of the gateway module.

The next step was the integration of an inducible promoter (Fig. 1 (SEQ ID NO:3)). The promoter sequence was amplified by a standard PCR with the primers PA and PB and pGene/ N5-His (Invitrogen) as a template to add new recognition sites for restrictionendonucleases (5'-Bgl II-promoter-Kpn 1-3'). Sequence primer PA: 5 ' AAGCGAAGATCTTCAAGCGGAGTACTGTCCTCC3 '

(SEQ ID ΝO:20) Sequence primer PB: 5'GGGGTACCCCGTGGCCTGTGAAGAGAAAAAA3'

(SEQ ID NO:21)

The resulting product was inserted into the TOPO TA vector (Invitrogen), sequenced and isolated by cutting with Bgl II and Kpn I and gel purification. The fragment was inserted into the Bgl II and Kpn I sites of plasmid #148. The modified fragments were excised by digestion with Bgl II and Kpn I after deletion of two internal restriction sites by sequential linearization, blunting and religation for Xba I and Pac I, gel purified and inserted into the Bgl II and Kpn I sites of the three plasmids pKS 2-1, pKS 2-2, pKS 2-3. The resulting constructs were named pKS 3-1, pKS 3-2 and pKS 3-3 (see Fig. 3).

Another necessary modification was the insertion of a linker (Bgl II-Pac I-Bgl II, sequence: 5' GATCTTTAATTAAAGATC 3'; SEQ ID NO:22) into plasmid #232. Plasmid #232 was linearized with Bgl II and the linker was inserted into the Bgl II site to get plasmid #232-dummy ("AN- vector"). Plasmid #232-dummy was linearized with Pme I and combined with p AdEasy- 1 by homologous recombination in E. coli to receive plasmid pAN-dummy (Fig. 6).

A Bgl II-Pvu I-Bgl II linker (sequence: 5' GATCTCGATCGAGATC 3'; SEQ ID ΝO:23) was inserted into the Bgl II site of plasmids pKS3-l, 2, 3. The resulting constructs pKS3-lm, pKS3-2m and pKS3-3m were linearized with Pvu I and partially digested with Pac I to avoid deletion of the origin of replication and the kanamycin resistance gene flanked by two Pac I sites. The resulting fragments were independently inserted into the Pac I site of pAN-dummy to get the plasmids pKA 3-1, pKA 3-2 and pKA 3-3 (Fig. 6). In a final step the kanamycin resistance gene had to be exchanged to the ampicillin selection marker. For this purpose plasmids pKA 3-1, pKA 3-2 and pKA 3-3 were digested with Pac I to separate the kanamycin marker. In parallel, a DNA fragment containing the ampicillin resistance gene, the bacterial origin of replication, the yeast centromere sequence and the histidine selection marker was amplified with the primers YA.and YB and the plasmid pRS413 (SEQ ID NO:5) (NCBI accession number U03447) as template by PCR.

Sequence primer YA: 5' CCTTAATTAAGGGGCGCTCTTCCGCTT CTT 3'

(SEQ ID NO:24)

Sequence primer YB: 5' CCTTAATTAAGGACCGCATAGATCCGTCGA 3'

(SEQ ID NO:25)

The primers added Pac I restriction sites to the flanking ends of the PCR fragment. The fragment was inserted into the Pac I sites to receive the final AN vectors pKA 3-1, pKA 3-2 and pKA 3-3 (Fig. 6). Figure 9 shows a gene card of adenoviral plasmid pKA 3.

Example 4: Construction of pKA 3-lacZ, pKA 3-YFP, pKA 3-ASF and pKA 3- RΝase

LacZ was cloned from pGene/N5-His/lacZ using standard PCR methods. YFP was cloned from pEYFP using standard PCR methods. The splice factor ASF (Wu and Maniatis, Cell 1993 Dec 17;75(6):1061-70; Molin and Alcusjarvi, J Nirol 2000 Oct;74(19):9002-9; accession number BC0102640) was cloned from a cDΝA library of the human heart using standard methods.

To construct a fusion RΝase the unmodified RΝase Tl-gene of Aspergillus oryzae was amplified by PCR from the plasmid ρRTΝ3 (Ikehara et al. PNAS 1986; 83:4695-4699). Afterwards the amino acid ⁵⁹tryptophan was replaced by ⁵⁹tyrosin by site-specific PCR-mutagenesis (Ito et al.; Gene 1991 Jun 15; 102(l):67-70) in order to increase the activity of said RNase (Schubert et al.; Eur J Biochem 1994; 220, 527). The so mutated gene was named TIM. Further, the RNaselll of E. coli was amplified and cloned directly from self prepared genomic DNA and was named RIII. The effect of said RNase on S. cerevisae is described in Pines et al.; J Bacteriology 1988; 170: 2989-2993. Using standard PCR methods Xhol restriction sites were added to the 3' end of TIM and the 5' end of RIII. After Xhol restriction digestion both RNases were ligated to get the final fusion RNase. All PCR products were verified via sequencing.

According to example 10 the DNA-sequences coding for lacZ, YFP, ASF and the fusion RNase, respectively, were inserted into the AV vector pKA 3 by in vitro recombination.

Example 5 : Construction of pKA 4

Plasmid #151 was digested with restrictionendonucleases Xba I and Xho I and gel purified. In parallel the Gateway module (Gateway cloning system cassette, reading frame C, Invitrogen (SEQ ID NO:2)) was amplified by PCR using the primer GA-F and GB-X. The primer GA-F added the Xba I and Kpn I restriction sites and the coding region for the Flag epitope upstream of the Gateway module. The primer GB-X added the Xho I restriction site downstream of the of the Gateway module. The PCR product was digested with restrictionsendonucleases Xba I and Xho I and gel purified. The resulting recombination cassette for fusion proteins (Fig. 1) was inserted into the linearized plasmid #151. The resulting construct for expression of fusion-proteins with N-terminal Flag-tag and C- terminal CFP under control of the CMV promoter was named pKSl (Fig. 4). Sequence primer GA-F:

5' CTAGAGCGGGGTACCCCTCCACCATGGATTACAAGGATGACGACGA TAAGGATCAAACAAGTTTGTAC 3' (SEQ IDNO:26)

Sequence primer GB-X: 5' TCGAGCGGATATCGAACCACTTTGTACAAGAA 3' (SEQ ID NO:27)

The next step was the exchange of the constitutive CMV promoter for an inducible promoter (Fig. 1 (SEQ ID NO:3)). The sequence for the inducible promoter was amplified by a standard PCR with the primers PA^' and PB and pGene/ V5-His (Invitrogen) as a template to add new recognition sites for restrictionendonucleases (5'-Bgl II-promoter-Kpn 1-3').

Sequence primer PA: 5' AAGCGAAGATCTTCAAGCGGAGTACTGTCCTCC 3'

(SEQ ID NO:20) Sequence primer PB: 5' GGGGTACCCCGTGGCCTGTGAAGAGAAAAAA 3'

(SEQ ID O:21)

The resulting product was inserted into the TOPO TA vector (Invitrogen), sequenced and isolated by cutting with Bgl II and Kpn I and gel purification. The fragment was inserted into the Bgl II and Kpn I sites of plasmid #148. The modified fragments were excised by digestion with Bgl II and Kpn I after deletion of two internal restriction sites by sequential linearization, blunting and religation for Xba I and Pac I and gel purified. The plasmid pKSl was digested with the restrictionendonucleases Bgl II and Kpn I to get rid of the CMV promoter. After gel purification of the linearized plasmid pKSl, the modified fragment of the inducible promoter was inserted into the Bgl II and Kpn I sites of the plasmid (Fig. 5). The resulting construct was named pKS4.

Another necessary step was the construction of a plasmid called #232-dummy. For this procedure a linker (Bgl Il-Pac I-Bgl II, sequence: 5' GATCTTTAATTAAAGATC 3'; SEQ ID NO: 22) was inserted into plasmid #232. Plasmid #232 was linearized with Bgl II and the linker was inserted into the Bgl II site to get plasmid #232-dummy ("AV-vector"). Plasmid #232-dummy was linearized with Pme I and combined with pAdEasy-1 (SEQ ID NO:7) by homologous recombination in E. coli to receive plasmid pAV-dummy (Fig. 6).

A Bgl II-Pvu I-Bgl II linker (sequence: 5' GATCTCGATCGAGATC 3'; SEQ ID NO: 23) was inserted into the Bgl II site of plasmids pKS4. The resulting construct pKS4-m was linearized with Pvu I and partially digested with Pac I to avoid deletion of the origin of replication and the kanamycin resistance gene flanked by two Pac I sites. The resulting fragment was inserted into the Pac I site of pAV-dummy to get the plasmid pKA 4. In a final step the kanamycin resistance gene had to be exchanged to the ampicillin selection marker. For this purpose plasmid pKA 4 was digested with Pac I to separate the kanamycin marker.

In parallel, a DNA fragment containing the ampicillin resistance gene, the bacterial origin of replication, the yeast centromere sequence and the histidine selection marker was amplified with the primers YA and YB and the plasmid pRS413 (SEQ ID NO:5) (NCBI accession number U03447) as template by PCR.

Sequence primer YA: 5' CCTTAATTAAGGGGCGCTCTTCCGCTT CTT 3'

(SEQ ID NO:24)

Sequence primer YB: 5' CCTTAATTAAGGACCGCATAGATCCGTCGA 3' (SEQ ID NO:25)

The primers added Pac I restriction sites to the flanking ends of the PCR fragment. The fragment was inserted into the Pac I sites to receive the final AV vector pKA 4 (Fig. 6). Example 6: Construction of pKA-Switch

A PCR-fragment coding for an inducible transactivator was derived by standard PCR amplification with primers SA and SB and pSwitch (Invitrogen) as a template (Fig. 7; "inducible transcription factor"). Sequence primer S A: 5 ' GAAGATCTTCTGC AGGTCGAAGCGGAGTA 3 '

(SEQ ID NO:28)

Sequence primer SB: 5' CGGGATCCCGCCATAGAGCCCACCGCAT 3'

(SEQ ID NO:29)

The primers added a Bgl II restriction site upstream and BamH I restriction site downstream of the flanking regions of the PCR fragment.

The fragment was inserted into the TopoTA vector (Invitrogen) and sequenced. Recognition sites for restrictionendonucleases Pac I and Bgl II located between promoter and transactivator coding sequence were deleted by blunting and religation. After excision of the coding region for the inducible transactivator by Bgl II and BamH I restrictionendonucleases, the fragment was inserted into plasmid #149 to derive plasmid pShuttle (Fig. 8). The construct was linearized with Bgl II and gel purified. In parallel plasmid #29 was digested with Bgl II and BamH I and the resulting shorter fragment containing the YFP expression cassette was isolated by gel purification (Fig. 7; "YFP expression cassette"). The fragment was inserted into the Bgl II site of pShuttle in order to construct pShuttle-Switch. The latter was linearized with Pme I and combined with p AdEasy- 1 (SEQ ID NO:7) by homologous recombination in E. coli resulting in AV vector pKA- Switch (Fig. 8). Example 7: Generation of recombinant adenovirus plasmids (generation of "AV dummy"and "AV pKA-Switch")

Recombinant adenoviruses were produced according to the simplified system developed by He et al. (He TC, Zhou S, da Costa LT, Yu J, Kinzler KW and Vogelstein B (1998): A simplified system for generating recombinant adeno- viruses. Proc. Natl. Acad. Sci. USA. 95: 2509-2514). To generate a recombinant adenovirus genome the relevant AV-vector (pShuttle-Switch or #232-dummy) was combined with the p AdEasy- 1 plasmid by homologous recombination. Briefly, 5 μg of relevant AV-vector (pShuttle-Switch or #232-dummy) were linearized with the restriction enzyme Pme I and gel-purified. Approximately 100 ng of the linearized vector were combined with 100 ng of the pAdEasy-1 plasmid and aqua bidest was added to a final volume of 7 μl. This solution was, combined with 20 μl of electro-competent bacteria (BJ5183) and transferred to an electroporation cuvette (2.0 mm). The electroporation was performed using the Bio-Rad Gene Pulser (2.500 V, 200 Ohms, 25 μFD). Then 500 μl LB-medium were added. The bacterial culture was incubated at 37°C for 20 minutes in a bacterial shaker and afterwards plated on two LB-agar plates (1/10, 9/10) containing 50 μg/ml kanamycin. After overnight incubation at 37°C twelve of the smallest colonies were picked and grown for at least 12 hours in 2 ml LB-medium (50 μg kanamycin) at 37°C in a bacterial shaker. Plasmid DNA from these overnight cultures was purified by alkaline lysis and digested with the restriction enzyme Pac I. One of the positive clones which showed two fragments after cleavage (30 kb and 4.0 kb) was transformed into the bacterial strain DH5α by electroporation (2.500 V, 200 Ohms, 25 μFD). A single colony was picked and transferred into 500 ml LB-medium (50 μg/ml kanamycin) and grown for 12 to 16 hours in a bacterial shaker. Plasmid DNA was prepared by the Tip-500 column (Qiagen, Hilden, Germany) according to the manufacturers instructions. Then 10 μg DNA were digested with Pac I, ethanol precipitated and resuspended in 40 μl H₂O (cell culture grade). Finally the packaging of the recombinant Adenovirus was performed according to Example 8. Example 8: Packaging of recombinant adenoviruses (generation of "AV pKA- Switch", "AV pKA 3", "AV pKA 4", "AV pKA 3-lacZ"

The packaging was performed in HEK 293 cells (ATCC: CRL-1573) by lipofection. The day before transfection cells were seeded into two T-25 flask (2 x 10⁶ cells each) in DMEM (10% fetal calf serum). For each flask 20 μl of the Pac I digested adenovirus genome was mixed with 20 μl of Lipofectamine (GIBCO BRL) in 500 μl OptiMem I medium and incubated for 15 minutes at room temperature. Meanwhile cells were washed twice with 4 ml serum-free DMEM. Then 2.5 ml OptiMem I was added to each flask followed by the DNA Lipofectamine solution. After incubation for 6 hrs at 37°C and 5% CO₂ medium was changed to DMEM (10% fetal calf serum). Packaging was monitored by GFP expression of transfected cells. Cells were harvested after 7 to 14 days, depending on the efficiency of the packaging.

To harvest the cells they were detached by pipetting. Cells were sedimented by centrifugation at 100 x g for 5 minutes and the pellet was resuspended in 1 ml of (20 mM Tris pH 8.0, 2 mM MgCl₂, 140 mM NaCl, 3 mM KCl). After three freeze-thaw cycles in liquid nitrogen and a 37°C waterbath the cell lysate was centrifuged at 150 x g. For the amplification of the recombinant adenovirus 80% of the supernatant were used. The rest was stored at -80°C after adding glycerol to a final concentration of 25%.

The first amplification was performed in one T-25 flask with HEK 293 cells at a density of 70 to 80%. Cells were harvested and lysed as described above. The virus titer was determined after two to four rounds of further amplification in T-75 flasks. The titer of infectious particles was determined by end-point-dilution with HEK 293 cells based on the TCID 50 method (Mahy and Kangro, Virology Methods Manual, New York, NY: Harcourt Brace; 1996:25-46).

Example 9: Gateway recombination of DNA sequences into entry vector

The integration of cDNA sequences was performed by an in vitro recombination using the site specific recombination properties of bacteriphage lambda (Gateway Cloning Technology, Invitrogen).

In a first step the nucleotides of the Gateway-recombination sites (attBl and attB2) were added to the DNA sequences by PCR methods. Subsequently the recombination reaction between one (e.g. PCR product) or more (e.g. cDNA library) DNA sequences and the Gateway module of the donor vector was mediated by a cocktail of recombination proteins (BP clonase enzyme mix).

Briefly, 10-100 ng of the PCR product or cDNA, 300 ng of the donor vector, 4 μl BP clonase reaction buffer and 2 μl BP clonase enzyme mix were combined in a 20 μl reaction assay and incubated at 25°C for 12h. The recombination reaction was stopped by adding 4 μg Proteinase K and incubation for 10 min at 37°C. 2 μl of the reaction mix were transformed into library efficient DH10B competent cells (Invitrogen) by electroporation according to the manufactors manual. The cells were incubated in 1 ml LB media for 1,5 h at 37°C. 200 μl of the cell suspension were plated onto an agar plate containing 50 μg/ml kanamycin. After incubation over night at 37°C one E.coli colony was picked. After plasmid midi preparation, the vector was checked for the correct insert by PCR methods and was used for integration of the transgene into AV- vectors by the LR-Gateway recombination (see Example 10). Primer for adding the attBl site:

5' GGGGACAAGTTTGTACAAAAAAGCAGGCTNN-(template specific site)-3' 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTNN-3' (SEQ ID NO:30)

Primer for adding the attB2 site: 5 ' GGGGACCACTTTGTAC AAGAAAGCTGGGTN-(template specific site)-3 ' 5' GGGGACCACTTTGTACAAGAAAGCTGGGTN-3' (SEQ ID NO:31)

Example 10: Gateway recombination of cDNAs into AV-vector

The integration of cDNAs into the AV vector (pKA 3 or pKA 4) was mediated by an in vitro recombination making use of the bacteriophage λ excision reaction (Gateway Cloning Technology, Invitrogen). This so called LR reaction is a recombination reaction between a cDNA flanked by attachment sites in an entry vector and the Gateway module of the AV vector pKA 3 mediated by a cocktail of recombination proteins (LR clonase enzyme mix).

Briefly 150 ng of the entry vector, 500 ng of AV pKA 3, 4 μl LR clonase reaction buffer and 2 μl LR clonase enzyme mix were combined in a 20 μl reaction assay and incubated at 25 °C for 12h. The recombination reaction was stopped by adding 4 μg Proteinase K and incubation for 10 min at 37°C. 2 μl of the reaction mix were transformed into library efficient DH10B competent cells (Invitrogen) by electroporation according to the manufactors manual. The cells were incubated in 1 ml LB media for 1,5 h at 37°C. 200 μl of the cell suspension were plated onto an agar plate containing 100 μg/ml ampicillin. After incubation over night at 37°C one E.coli colony was picked. After plasmid midi preparation, the vector was checked for the correct insert by PCR methods and was used for packaging in HEK 293 cells. Example 11 : Isolation of primary cardiomyocytes from neonatal rats

Neonatal rats (P2-P7) were sacrificed by cervical dislocation. The ventricles of the beating hearts were removed and cardiomyocytes were isolated with the "Neonatal Cardiomyocyte Isolation System" (Worthington Biochemicals Corporation, Lakewood, New Jersey) according to the protocol. Briefly, the ventricles were washed twice with ice cold Hank's Balanced Salt Solution without Potassium and Magnesium (CMF-HBBS) and minced with a scalpel to an average volume of one cubic millimeter. The heart tissue was further digested over night with trypsin at 10°C. Next morning trypsin inhibitor and collagenase were added. After incubation at 37°C and mild agitation for 45 minutes the cells were dispersed by pipetting. The solution was further purified by 70 μm mesh (Cell Strainer) and centrifuged twice for 5 minutes at 60 x g. The cell pellet was resuspended in plating medium and counted. Cells were seeded with a density of 2 x 10⁴/cm² on gelatine (Sigma, Deisenhofen) coated dishes. The next morning cells were washed twice with DMEM and maintenance medium was added.

Plating medium: DMEM/M-199 (4/1); 10% Horse serum, 5% Fetal calf serum; 1 mM Sodiumpyruvate; Antibiotics and antimycotics

Maintenance medium: DMEM/M-199 (4/1); 1 mM Sodiumpyruvate

Example 12: Stimulation of isolated cardiomyocytes from neonatal rats

Stimulation of primary cardiomyocytes from neonatal rats (pCMs) with the hypertrophic agent phenylephrine (100 μM) was started two to six hours after medium was changed to maintenance medium. Directly after stimulation pCMs were infected with recombinant adenoviruses at a MOI of five. Recombinant expression was induced by addition of RU486 directly into the medium at the indicated concentration. Example 13: Reportergene Assays

Cardiomyocytes from neonatal rats (pCMs) were infected with virus for the recombinant transcription factor (AV pKA-Switch) and virus for the inducible reporter gene LacZ (AV pKA 3-lacZ). The multiplicity of infection (MOI) was used as indicated below. 18 h after infection recombinant expression of lacZ protein was induced by addition of RU486 at the indicated concentration. After 60 h the cells were harvested. Therefore, the cells were washed three times with pre- cooled PBS (4°C). Cells were incubated with 200μl cell lysis reagent (β-Gal Reporter Gene Assay, Roche) per 3.5 cm culture at room temperature on an orbital shaker. After 30 min cells were detached using a rubber scraper. The cell extract was centrifuged for 2 min at 20000 x g at 4°C to precipitate cellular debris. The supernatant was transferred into a clean microfuge tube and could be stored at - 80°C intermediately.

The chemiluminescent β-Gal Reporter Gene Assay for quantification of recombinant lacZ protein was performed according to the manufactors manual (Roche).

In principle the recombinant β-galactosidase from the lacZ gene cleaves its artificial substrate and releases dioxetane. A pH shift to a value higher than 12 initiates deprotonation of dioxetane and leads to emission of light (475 mn).

Therefore, 50 μl cell extract and 100 μl substrate reagent were incubated for 45 min in a plastic tube. After adding 50μl of initiation reagent for pH shift the tube was transferred to a luminometer. Light production was integrated for 5 s. Quantification was standardized against internal controls. Example 14: Dependence of expression level on multiplicity of infection (MOI) of individual viruses

Cardiomyocytes from neonatal rats (pCMs) were infected with different MOIs of individual viruses to analyze, if there is a correlation between virus load and inducibility of the system. Interestingly, there was good fit between increasing viral liters and LacZ expression. Virtually no leakiness was observed in the absence of the recombinant transcription factor (AV pKA-Switch 0), whereas adding of AV pKA-Switch resulted in a dose dependent activation of the target promoter. The inducibility was also controllable by the amount of target promoter (AV pKA 3-lacZ) in a dose dependent fashion. These series of experiments revealed the high level of control of recombinant gene expression on top of RU486 dependent induction based on the exact titration of individual viruses. The new system clearly benefited from the split character into AV pKA-Switch and AV pKA 3-lacZ in contrast to most other systems which rely on bicistronic expression of target gene and transcription factor.

Example 15: RU486 dependent induction of recombinant gene expression

Cells were infected with rAVs bearing the recombinant transcription factor (AV pKA-Switch, MOI 1) and the inducible reporter gene LacZ (AV pKA 3-lacZ, MOI 8), in order to investigate RU486 dependence of inducible expression level. Administration of increasing amounts of RU486 resulted in rising expression levels up to 10^"8'⁵ M. At this concentration a plateau was reached. Further increase of the RU486 concentration above 10^"7'⁵ M resulted even in a reduction of LacZ expression. These experiments nicely revealed the possibility of tight regulation of the inducibility by controlling the RU486 concentration. Furthermore, the optimal dose (10^"85 M) of RU486 could be identified. Example 16: Time course of inducible gene expression

The activity of the new expression system was analyzed at different intervals after induction as a further level of characterization. Recombinant gene expression peaked at 60 hrs after induction of gene expression independent of the stimulation with the hypertrophic agent phenylephrine.

Example 17: Determination of tightness of the inducible expression system

Different combinations of cDNAs and promoters in rAV vectors were amplified in 293 cells, in order to evaluate potential leakiness of the new system. The combinations analyzed were:

1 : CMV-promoter plus YFP-reporter gene 2: AV pKA 3 -YFP; inducible promoter plus YFP reporter gene 3: AV pKA 3-ASF; inducible promoter plus ASF-splicing factor 4: AV pKA 3 -RNase; inducible promoter plus toxic Rnase

No difference in amplification efficiency between individual virus constructs could be observed. This was in particular surprising as the splice factor ASF was known to hamper viral production in 293 cells. Molin et al. 1998 and Edholm et al. 2001 used a similar inducible promoter also in a adenoviral context and were only able to get 95 percent reduced yields, when they amplified ASF coding viruses. This was in strong contrast to our results and indicated the high level of tightness of our new system in comparison to their system. References

Abremski K. et al. (1986): Bacteriophage PI Cre-loxP site-specific recombination. Site-specific DNA topoisomerase activity of the Cre recombination protein. J. Biol. Chem. 261(1):391

AdEasy™, Adenovirus Technologies, Application manual, Qbiogene Version 1.4

ATCC Catalogue 2003 of the American Type Culture Collection (ATCC)

Araki et al. (1992): Site-specific recombinase, R, encoded by yeast plasmid pSRl. J. Mol. Biol. 225(1):25 Brogden RN et al. (1993): Mifepristone. Drugs 45 (3): 384-409

Burcin MM et al. (1998): A regulatory system for target gene expression. Front Biosci l998 Jan l;3:cl-7

Burcin MM et al. (1999): Adenovirus-mediated regulable target gene expression in vivo. Proc Natl Acad Sci USA Jan 19;96(2):355-60 Cai and Shen (2001): Effects of cis Arrangement of Chromatin Insulators on Enhancer-Blocking Activity. Science Vol 291:493-495

Campbell (1992): Chromosomal insertion sites for phages and plasmids. J Bacteriol. 174(23):7495

Edholm D. et al (2001): Adenovirus vector designed for expression of toxic proteins. J Virol Oct; 75(20):9579-84

Ehrhardt A. et al. (2003): Optimization of cis-acting elements for gene expression from nonviral vectors in vivo. Hum Gene Ther Feb 10;14(3):215-25

Gateway® Technology, A universal technology to clone DANN sequences for functional analysis and expression in multiple systems, Version D, April 23, 2003, 25-0522, Invitrogen

Gopaul DN. And Duyne GD. (1999): Structure and mechanism in site-specific recombination. Curr Opin Struct Biol Feb;9(l): 14-20 Haberman RP. and McCown TJ. (2002): Regulation of gene expression in adeno- associated virus vectors in brain. Methods Oct;28(2):219-26

Hallet B. and .Sheratt DJ. (1997): Transposition and site-specific recombination: adapting DNA cut-and-past mechanisms to a variety of genetic rearrangements. FEMS Microbiol Rev 1997 Sep;21(2):157-78

Hartley et al. (2000) : DNA Cloning Using In Nitro Site-Specific Recombination. Genome Research 10 : 1788- 1795 by Cold Spring Harbor Laboratory Press ISSN 1088-9051/00

Harvey DM and Caskey CT (1998): Inducible control of gene expression: prospects for gene therapy. Curr Opin Chem Biol, Aug;2(4):512-8

Hawley RG (2001): Progress toward vector design for hematopoietic stem cell gene therapy. Curr Gene Ther ; 1(1):1-17

He TC, Zhou S, da Costa LT, Yu J, Kinzler KW and Vogelstein B (1998): A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA. 95: 2509-2514.

Hoess et al. (1986): The role of the loxP spacer region in PI site-specific recombination. Nucleic Acids Research 14(6):2287

Ikehara M et al. (1986): Inquiries into the structure-function relationship of ribonuclease Tl using chemically synthesized coding sequences. Proc Natl Acad Sci U S A 83(13):4695-9

Ito W (1991): A general method for introducing a series of mutations into cloned DNA using the polymerase chain reaction. Gene 15;102(l):67-70

Lund A.H. et al. (1996): Transcriptional silencing of retroviral vectors. J Biomed Sci Nov-Dec;3(6):365-378 Maeser and Kahnmann (1991): The Gin recombinase of phage Mu can catalyse site-specific recombination in plant protoplasts. Mol. Gen. Genet. 230:170-176

Mahy and Kangro, Virology Methods Manual, New York, NY: Harcourt Brace; 1996:25-46 Mills A (2001): Changing colors in mice: an inducible system that delivers. Genes & Development 15: 1461-1467 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/01

Molin M et al. (1998): Two novel adenovirus vector systems permitting regulated protein expression in gene transfer experiments. J Virol Oct;72(10):8358-61

Molin M and Akusjarvi G. (2000): Overexpression of essential splicing factor ASF/SF2 blocks the temporal shift in adenovirus pre-mRNA splicing and reduces virus progeny formation. J Virol Oct;74(19):9002-9

Oligino et al. (1998): Drug inducible transgene expression in brain using a herpes simplex virus vector. Gene Ther Apr;5(4):491-6

Pannell D. and Ellis J. (2001): Silencing gene expression: implications for design of retro virus vectors. Rev Med Virol Jul-Aug;ll(4):205-17

Paterna JC. and Bueler H. (2002): Recombinant adeno-associated virus vector design and gene expression in the mammalian brain. Methods Oct;28(2):208-18 Pliizicky E. et al. (2003): Protein analysis on a proteomic scale. Nature 422:208- 215

Pines O. et al (1988): Expression of double-stranded-RNA-specific RNase III of Escherichia coli is lethal to Saccharomyces cerevisiae. J Bacteriol;170(7):2989-93

Qian et al. (1992): Reactions between half- and full-FLP recombination target sites. A model system for analyzing early steps in FLP protein-mediated site- specific recombination. J. Biol. Chem. 267(11):7794

Ramezani A. et al. (2003): Performance- and safety-enhanced lentiviral vectors containing the human interferon-{beta} scaffold attachment region and the chicken {beta}-globin insulator. Blood Feb 13; [epub ahead of print - copy of May 12, 2003]

Rubinchik S. et al. (2000): Adenoviral vector which delivers FasL-GFP fusion protein regulated by the tet-inducible expression system. Gene Ther. 7: 875-885 Salucci V et al. (2002): Tight control of gene expression by a helper-dependent adenovirus vector carrying the rTA2(s)-M2 tetracycline transactivator and repressor system. Gene Ther Nov;9(21): 1415-21

Sambrook, J., Fritsch, E.F., and Maniatis, T., in Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, Vol. 1, 2, 3 (1989)

Sandhu JS. Et al. (1997): Human gene therapy. Crit Rev Biotechnol;17(4):307-26

Schnieder G. et al. (2002): Variables affecting in vivo performance of high- capacity adenovirus vectors. J Virol Feb;76(4): 1600-9

Schubert W.D. et al (1994): X-ray crystallographic and calorimetric studies of the effects of the mutation Trp59-->Tyr in ribonuclease Tl. Eur J Biochem;

Steinwaerder DS and Lieber A (2000): Insulation from viral transcriptional regulatory elements improves inducible transgene expression from adenovirus vectors in vitro and in vivo. Gene Ther Apr;7(7):556-67 Van der Velden AW. Et al. (2001): Vector design for optimal protein expression. Biotechniques Sep;31(3):572, 574, 576-80, passim ι

Walther W. and Stein U. (2000): Viral vectors for gene transfer: a review of their use in the treatment of human diseases. Drugs Aug;60(2):249-71

Wang Y et al. (1994): A regulatory system for use in gene transfer. Proc Natl Acad Sci USA Aug 16;91(17):8180-4

Wang, Y et al. (1997): Positive and negative regulation of gene expression in eukaryotic cells with an inducible transcriptional regulator. Gene Ther May; 4(5):432-41

Wu JY and Maniatis T. (1993): Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell 17;75(6): 1061-70

XU ZL. et al. (2001): Optimization of transcriptional regulatory elements for constructing plasmid vectors. Gene Jul ll;272(l-2): 149-56

Claims

1. A DNA construct comprising a) a viral vector backbone, b) at least one recombination cassette from the gateway cloning system, and c) at least one inducible promoter from the anti-progestine-regulated system.

2. The DNA construct according to claim 1, wherein the promoter is localized 5' from the recombination cassette.

3. The DNA construct of any of claims 1 or 2, wherein the viral backbone is derived from an adenovirus, and adeno-associated virus, a lentivirus or a baculovirus, especially an adenovirus.

4. The DNA construct of any of claims 1 to 3, further comprising at least one nucleotide sequence coding for a marker or reporter protein. . ;

5. The DNA constructs of claim 4, wherein the marker or reporter protein is selected from the group consisting of blue fluorescent protein (BFP), cyan fluorescent protein (CFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), His3, CAT, GUS, LacZ, and Luciferase.

6. A DNA construct comprising , a) a viral vector backbone, b) at least one recombination cassette, and c) at least one inducible promoter.

7. The DNA construct of claim 6, further having the features as defined in claims 2 to 5.

8. The DNA construct of any of claims 6 or 7, wherein said recombination cassette is from the gateway cloning system and/or wherein said inducible promoter is from the anti-progestine-regulated system.

9. A vector, wherein a heterologous nucleotide sequence is inserted into the recombination cassette of the DNA construct of any of claims 1 to 8.

10. A method of producing a DNA construct of any of claims 1 to 3 or 6 to 8, wherein the at least one inducible promoter and the at least one recombination cassette are introduced together or separately into a viral vector backbone.

11. A method of producing a DNA construct of any of claims 4 or 5, wherein the at least one inducible promoter, the at least one recombination cassette and the at least one nucleotide sequence coding for a marker or reporter protein are introduced together or separately into a viral vector backbone.

12. A method of producing a vector according to claim 9, wherein a heterologous nucleotide sequence is inserted into the recombination cassette of the DNA construct of any of claims 1 to 8.

13. An expression system comprising a) at least one vector according to claim 9, and b) at least one vector comprising a nucleotide sequence coding for at least one transcription factor specific for the inducible promoter of the vector of section a).

14. A metliod for the expression of a heterologous nucleotide sequence, wherein an expression system according to claim 13 is introduced into a suitable mammalian cell and the mammalian cell is cultivated under conditions suitable for the expression of the heterologous nucleotide sequence, wherein the expression of the heterologous nucleotide sequence is induced by the addition of a factor activating the inducible promoter.

15. A method for the expression of a heterologous nucleotide sequence, wherein a vector according to claim 9 is introduced into a suitable mammalian cell and the mammalian cell is cultivated under conditions suitable for the expression of the heterologous nucleotide sequence, wherein the expression of the heterologous nucleotide sequence is induced by addition of a factor activating the inducible promoter.

16. A cDNA library, comprising a multiplicity of nucleic acid sequences, wherein each sequence is inserted into the recombination cassette of a DNA construct of any of claims 1 to 8.

17. Method of screening a cDNA library for a clone which expresses a desired phenotype, wherein a multiplicity of DNA sequences which are comprised in the cDNA library of claim 16 are assayed for said phenotype.

18. Method of claim 17, wherein said desired phenotype is a phenotypic trait of the cells transformed with a DNA construct of said cDNA library, which can be detected using a fluorescent probe which detects said phenotypic trait, an enzymatic assay which detects said phenotypic trait and/or a western blot analysis using an antiserum, polyclonal or monoclonal antibody or antibody fragment which detects said phenotypic trait.

19. Use of recombination sites for the inhibition of enhancer-promoter interactions or silencer-promoter interactions.

20. The use according to claim 19, wherein said recombination sites are selected from the group consisting of attL-attR, attB-attP, Cre-loxP, FLP-

FRT, R-Rs, XerCD.

21. A pharmaceutical composition comprising a DNA construct according to any of claims 1 to 8 or a vector according to claim 9 or an expression system according to claim 13, optionally in combination with at least one pharmaceutically acceptable carrier.

22. Use of a DNA construct according to any of claims 1 to 8 or a vector according to claim 9 or an expression system according to claim 13 for the preparation of a pharmaceutical composition.