WO2004099407A1

WO2004099407A1 - Method of testing sensitivity to anticancer drug

Info

Publication number: WO2004099407A1
Application number: PCT/JP2004/006511
Authority: WO
Inventors: Jin-Ichi Inokuchi; Kazuya Kabayama; Yasuyuki Igarashi
Original assignee: Chemical Biology Institute
Priority date: 2003-05-09
Filing date: 2004-05-07
Publication date: 2004-11-18
Also published as: JPWO2004099407A1

Abstract

A marker for the sensitivity of cancerous cells to anticancer drugs; and a method of predicting the sensitivity of cancerous cells to anticancer drugs. mRNA or polypeptide expressed by ganglioside GM3 synthetase (SAT-1) gene of cancerous cells can be a marker for the sensitivity of cancerous cells to anticancer drugs. The sensitivity of cancerous cells to anticancer drugs can be determined by measuring expressed mRNA or polypeptide.

Description

Description Anticancer drug susceptibility test method Technical field

The present invention relates to a method for testing the sensitivity of cancer cells to anticancer agents. More specifically, the present invention relates to a test for the sensitivity of cancer cells to anticancer drugs, using the expression level of the gangliosio GM3 synthase gene as an index. Background art

Many anticancer drugs have been developed for various cancers. The effects of anticancer drugs vary depending on the characteristics of the tumor of the patient and the individual, so they are currently used by trial and error while observing the therapeutic effects. As a result, the administration of ineffective anticancer drugs results in unnecessary treatment, and in some cases, the pain of patients due to the side effects of the drugs. Being able to identify whether cancer cells are susceptible to the drug before starting chemotherapy would be very useful in developing a treatment strategy.

Recently, lung cancer deaths in Japan have overtaken stomach cancer and are the first place (lung cancer mortality rate by site cancer mortality rate in 1980: 17.9%). In the future, this lung cancer mortality rate is expected to continue increasing, and it is predicted that the number of deaths in 2000 will be about twice that in 2000. The challenge of reducing medical costs related to lung cancer is important.

Diagnosis of lung cancer is based on symptoms and medical examination, chest X-ray, CT, contrast-enhanced radiography, CT (computer tomography) MR I, endoscopy, bronchial fiberscope, biopsy tissue examination, cytology, customer sputum cytology And so on. With this, it is determined how much the lung cancer is, and if it is, how much progress is made.

Specifically, the lung spreads tumors (T), Rinno. Nodal metastasis (N), distant metastasis

Scores are assigned to each of (N), and the stage from stage I to stage IV is determined based on the score a. Generally, surgery is performed for stages I to part of stage III, but in later stages, chemotherapy using radiation and anticancer drugs is mainly used. Anticancer drugs include cisplatin, vinorelbine, mitomycin, paclitax Cell, docetaxel, gemcitabine, etc. are used in some combinations. As mentioned above, if it is possible to discriminate whether or not cancer cells are susceptible to the drug in order to avoid the administration of ineffective anticancer drugs, only to give the patient pain due to side effects, it is very important to formulate a treatment policy It is beneficial. In order to determine whether an anticancer drug is effective against cancer cells, it is very useful to have a marker substance. '

Ganglioside is a generic name for the sialic acid-containing glycosphingolipid (GSL) family, and GM3, the first ganglioside molecule in its biosynthetic pathway, is widely expressed in various cells of mammals including humans. Therefore, its physiological functions and pathophysiological significance have been attracting attention.

The association of gandarioside expression with cancer malignancy and function has been the focus of more researchers than before. Cell membranes have been shown to play a very important role in the metastatic potential of cancer, because the fusion of membrane vesicles of highly metastatic cells to the membrane of low metastatic cells transforms the metastatic potential. (Poste, G. and Nicolson, GL .: Proc. Nat. Acad. Sci. USA, 77, 399-403, 1980).

Numerous reports have also been made regarding the canceration and tumorigenicity of gandariosides and cells. Of particular interest is the change in the expression pattern of gandhaloside by cell transformation due to viral infection (Hakomori, S., Murakami, WT .: Proc. Nat. Acad. Sci. USA, 59, 254). -261, 1968; Yogeeswaran, G., Sheinin, R., Wherrett, JR. And Murray, RK .: J. Biol. Chem., 247, 5146-5148, 1972). Transformation by the tumorigenic DNA virus SV40 or poliovirus generally increases short-chain gangliosides such as GM3. This is understood as a simplification in which a sugar chain is deficient due to a change in sugar transfer activity.

On the other hand, in naturally transformed cells or hepatoma cells, the sugar chains are scattered and are rare (Dnistrian, AM., Skipski, VP., Barclay, M., Essner, ES. and Stock, CC .: Biochem. Biophys. Res. Comraun., 64, 367-375, 1975). Thus, no unified opinion has been found regarding the metastasis, invasion, and cancer potential of gangliosides and cancer cells. The relationship between the expression of gandariosides and the malignancy and function of cancer is of greater interest than ever before, but there is a unified view of metastasis, invasion, and cancer potential of gangliosides and cancer cells. Not found. Disclosure of the invention

In view of the above, a gene that is effective and generally applicable as a diagnostic marker for the sensitivity of cancer cells to anticancer drugs is required, and the development of highly accurate anticancer drug sensitivity testing methods using such markers is urgently needed. Have been.

The present inventors have found that the expression level of a specific gene changes depending on the degree of sensitivity of a cancer cell to an anticancer agent, and have reached the present invention. This test method makes it easy to determine whether or not a patient's cells are sensitive to an anticancer drug, finds the possibility of selecting the type of anticancer drug to be administered to the patient, and reduces side effects by selecting an anticancer drug that is appropriate for the patient Therefore, we conducted intensive research.

The present inventors aimed at examining the relationship between ganglioside expression and malignancy of cancer from a new viewpoint, and the ganlioside GM3 synthase (SAT-I) gene (Ishii, A., Ohta) cloned in 1998. , M., Watanabe, Y., Matsuda, Κ., Ishiyaraa, K., Sakoe, K., Nakamura, M., Inokuchi, J., Sanai, Y. and Saito, M .: J. Biol. Chem. , 27, 31652-31655, 1998) (SEQ ID NO: 1) was examined for various human cancer cells. As a result, they found that the level of expression of the SAT-I gene varied greatly between individual cancer cells. The enzyme gene used in the present invention is the gene of the enzyme (SEQ ID NO: 2) that synthesizes ratatosylceramide (LacCer) into ganglioside GM3 (GM3 synthase (SAT-I) gene). Furthermore, the present inventors have found that the expression level of the GM3 synthase gene (SAT-I gene) shows a clear correlation with the sensitivity of cancer cells to anticancer drugs, and based on these findings! Thus, the present invention has been completed.

That is, the present invention relates to SAT-ImRNA, which is expressed from a gandarioside GM3 synthase (SAT-I) gene having the nucleotide sequence of SEQ ID NO: 1 and is used as an anticancer drug sensitivity marker for cancer cells.

The present invention also relates to a gandarioside GM3 synthase (SAT-I) polypeptide having the amino acid sequence of SEQ ID NO: 2 used as a marker for cancer cell sensitivity to anticancer drugs.

The present invention also provides a method for testing the sensitivity of a cancer cell to an anticancer drug, comprising the steps of: The present invention relates to a method comprising measuring the expression level of a gliocid GM3 synthase (SAT-I) gene. Since the sensitivity of cancer cells to anticancer drugs is correlated with the expression level of ganglioside GM3 synthase (SAT-I) gene in cancer cells, the sensitivity of cancer cells to anticancer drugs can be measured by measuring the expression level of SAT-I gene . Cancer cells can be obtained from the Depositary Center for Biological Sciences or the Medical Cell Repository.

The present invention also provides

(1) The correlation between the sensitivity of cancer cells to anticancer drugs and the ganglioside GM3 synthase (SAT-I) gene expression level in cancer cells was determined,

(2) measuring the SAT-I gene expression level of the patient's cancer cells in vitro,

(3) determining the sensitivity of the patient's cancer cells to the anticancer drug from the correlation in (1) and the expression level in (2);

And a method for selecting an anticancer agent. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows an electrophoretogram (top) and a bar graph (bottom) showing a comparison of the SAT_I gene expression levels in five types of human non-small cell lung cancer.

FIG. 2 is a bar graph showing the test results of the survival rate of lung cancer cells by anticancer drug treatment. FIG. 3 is a correlation diagram showing the correlation between the SAT-I gene expression level in human lung cancer and the survival rate of cancer cells by anticancer drug treatment.

BEST MODE FOR CARRYING OUT THE INVENTION

The target cancer types are lung cancer (non-small cell lung cancer and small cell lung cancer), esophageal cancer, breast cancer, stomach cancer, liver cancer, head and neck cancer, colorectal cancer, knee cancer, prostate cancer, cervical cancer, ovarian cancer, encephaloma Tumors and testicular tumors.

When obtaining cancer cells from a patient, aspiration biopsy, pinch biopsy, biopsy biopsy, biopsy for cytology, endoscopic biopsy, fine needle aspiration biopsy, needle biopsy, transbronchial lung biopsy It can be obtained by biopsy (biopsy), from the sputum discharged by the patient, or during surgery.

The expression level of the SAT-I gene is expressed by the SAT-I mR This can be done by measuring NA or SAT-I protein. The detection method is not particularly limited as long as it can detect mRNA or protein of SAT-I and can be sensitive to anticancer drugs. The expression level of the ganglioside GM3 synthetic gene can be measured by measuring SAT-I mRNA, typically by Northern blotting.

Northern plotting is a technique well known to those skilled in the art. In the Northern plot method, RNA (mRNA) is extracted from cells, the RNA (mRNA) is electrophoresed, the pattern is transferred to a filter, and a specific labeled probe labeled with an isotope or the like is used for hybridization. By analyzing the presence and amount of mRNA in the sample,

As a probe for detection in hybridization, double-stranded DNA, single-stranded DNA or RNA is used. When the mRNA is to be specifically detected by the Northern blot method, a single-stranded DNA or RNA having a sequence complementary to the mRNA itself is used as a probe. The chain length of the probe used is relatively arbitrary, and a synthetic oligonucleotide ゃ of about 20 to 40 bases, and a DNA or RNA probe having a length of several hundred to 1 kbp can be used. When the DNA sequence to be synthesized is a relatively short DNA probe, a specific sequence portion of the gene to be detected is used. Tools for checking gene homology

(http://www.ncbi.nlm.nih.gov/Blast), it is possible to search for a sequence specific to the gene to be detected.

Probe labeling methods used for hybridization can be broadly classified into two types: radioactive labels and non-radioactive labels. The production of radiolabeled oligonucleotides can be synthesized mainly by the PCR method based on 32 P-labeled nucleotides. However, this method is not convenient because of the problem of radioactive waste disposal. Non-radioactive labeling uses a probe molecule with a special modifying group added to it, and detects the added modifying group by fluorescence, chemiluminescence, or coloring. Since there is no big difference between the detection sensitivity of the nucleic acid detection method using this non-radioactive labeling method and the sensitivity of the radioactive labeling method, it is relatively safe to use this method. Is desirable. Examples of non-radioactive labels include digoxigenin (DIG) labeling and G) Biotin labeling using avidin and FITC (fluorescene

Isothiocyanate) can also be applied to a method in which a molecule or the like is covalently bound to DNA and labeled. In addition, as a simple method for preparing a non-radioactively labeled probe, a method of adding a labeled nucleotide to the 5 'end during PCR operation can also be used. Examples of the labeling substance include biotin-digoxigenation. Oligonucleotide probes have the advantage of producing relatively large quantities of homogenous ones, but have problems in terms of sensitivity. When a label is added to a portion other than the end of the prop, a method for synthesizing the labeled DNA by the ec translation method can be used.

When detecting RNA molecules such as mRNA by the Northern blot method, the detection probe must be single-stranded. The production of single-stranded DNA probes includes the use of oligonucleotides and random PCR, but the use of RNA probes as single-stranded probes is preferred because of high sensitivity. An RNA probe synthesizes an antisense RNA using a DNA sequence cloned upstream of a promoter sequence of an RNA polymerase such as T7 or S6 as a type III. At this time, a labeled RNA probe can be prepared by using the labeled nucleotide as a substrate.

The culture medium (RPMI-1640 or DMEM, Sigma) for culturing cancer cells contains 10% calf serum and antibiotics such as penicillin and streptomycin. Cells normally cultured in 10 cm dishes at the 5 ° / ₀ hundred ₂ base Inkyu the presence Ta. The culture temperature is usually 37 ° C.

Culture the cells in a 10 cm dish until confluent, and wash three times with PBS (phosphate-buffered saline). Tr i z o 1

Add 1 ml of a phenolic reagent for RNA extraction (manufactured by Gizogo), leave at room temperature for 2 minutes, scrape, and collect in a 1.5 ml tube. After complete lysis of the cells by pipetting, incubate at room temperature for 10 minutes. Add 200 µl of chloroform, suspend for 30 seconds, allow to stand for 2 minutes, centrifuge at 12,000 rpm for 15 minutes at 4 ° C, and separate phases. Transfer the upper layer to a new 1.5 ml tube, add an equal volume (500 μl) of cold isopropanol, suspend for 10 seconds, then stand still for 10 minutes, and incubate at 4 ° C and 12,000 rpm. Centrifuge for 10 min to precipitate RNA Let it. Decant the supernatant, add 1 ml of 70% ethanol-DEPC (getyl pyrocarbonate) -treated water, lightly suspend and wash, centrifuge at 12,000 rpm for 5 minutes at 4 ° C, and decant. And remove the salt. After drying the tube with a desiccator to completely remove water, the RNA is dissolved in 0-treated water 201. Store at 1 80 ° C.

It is desirable to purify total RNA to mRNA, but it is possible to analyze total RNA as it is. Denature at 55 ° C in a solution of formamide and formalin, and run on an agarose gel containing formalin. The gel is then transferred to a nitrocellulose or nylon filter with a high salt solution of 15-20 X SSC. After total RNA has been filtered, 8 for nitrocellulose

Treat in a vacuum oven at 0 ° C for about 2 hours to immobilize total RNA. In the case of a nylon membrane, it is fixed by exposing it to ultraviolet light for a while to form a crosslink. Next, a probe derived from SAT-I cDNA is prepared to identify the SAT-I mRNA on this filter. When a single-stranded probe and a filter are brought into contact under specific conditions, those with complementarity will bind. Here, if the probe is labeled with a radioactive substance, only the bound SAT-ImRNA can be detected. The conditions for hybridization are 5-6 X SSC and a temperature of 65 ° C (42 ° C in the presence of formamide).

mRNA can also be measured by the RT_PCR method. In RT-PCR, RNA is first reverse transcribed into cDNA using reverse transcriptase, and then PCR is performed using this cDNA as a starting material with a specific primer set and a thermostable DNA polymerase. This method detects and quantifies the presence of the target RNA in the form of amplification of its cDNA.

The expression level of the gandarioside GM3 synthetic gene can be measured by measuring the protein expressed from the gene, typically using a Western plot method.

Cells are cultured in a 6-well dish, and a protein extraction buffer (1 OmM Tris-HCl, 15 OmM sodium chloride, 5 mM sodium ethylenediamine tetraacetate (EDTA)) containing a surfactant (1% TritonX-100) ) And extract on ice Perform sonication for 0 minutes, and collect the supernatant by centrifugation at 15,00 rpm for 30 minutes.

Western blotting is a method in which proteins are fractionated by SDS-containing polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a nitrocellulose filter, and detected using an antibody. The protein is transferred from the polyacrylamide gel to a suitable filter such as a nitrocellulose thin film. The protein attached to the filter can be identified by using the SAT-I protein antibody as a probe. For example, use a peroxidase-conjugated secondary antibody method Transfer from the gel to the filter is often performed by electroplating, that is, the gel in which the protein has been developed by electrophoresis is brought into close contact with the filter, and the filter is placed on the anode side. A current is applied for a certain period of time, with the cathode as the cathode, which transfers the protein from the gel to the filter.After a few hours, the membrane is removed and the antibody that specifically binds to the SAT-I protein is reacted. Dye out the antibody.

Methods for making antibodies are well known. The SAT-I protein or a fragment thereof is used to induce antibodies. Animals such as Egrets, rats, and mice are immunized, for example, by intraperitoneal and Z or intradermal injection of an emulsion containing 100 μg of protein and Freund's adjuvant. For example, antibodies can be detected by ELISA assays using proteins adsorbed on solid surfaces. Several booster injections are required, eg, at intervals of about two weeks, to obtain high titers. Antibodies addition monochrome one Nanore antibody polyclonal antibodies by the method described above (Harlow, E and Lane, D. (1988), Antibodies: A LABORATORY MANUAL, Cold Spring Harbor Laboratory) also used be <o this and force ^s.

In addition, as a method for detecting a protein, observation and image processing using a fluorescence microscope or a laser microscope, measurement using flow cytometry, and a detection method using evanescent light can be performed without disrupting cells.

A fluorescence-activated cell sorter (fluorescene-activated cell sorter, FACS) is a device that labels cells with antibodies and sorts cells based on the fluorescence intensity.The experimental method using this device is called flow cytometry. . For example, anti-GM3 synthetic yeast Then, FITC (Fluorescein isothiocyanate) -labeled antibody which reacts with anti-GM3 synthase is reacted. By subjecting these cells to FACS and measuring the intensity of fluorescence intensity, it is possible to determine whether or not GM3 synthase is highly expressed.

The anticancer drug is not limited at all. In the case of lung cancer, new anticancer drugs including etoposide (etoposide), adriamycin (Adriamycin), cisplatin (Cis1 atin), vincristin, and paclitaxel have been developed. Then, it can be applied to the anticancer drug.

This diagnostic system is expected to provide a system for tailor-made cancer treatment strategies for individual cancer patients that can predict the maximum therapeutic effect while minimizing the side effects of anticancer drugs.

Hereinafter, the present invention will be described specifically with reference to examples, but the present invention is not limited to these examples. Example 1

Measurement of SAT-I gene expression in lung cancer cells (1)

In order to compare the expression levels of the GM3 synthase (SAT-I) gene in human non-small cell lung cancer, five types of human non-small cell lung cancer (LCSC # 1, LCSC # 2, Lu99B, LK1-2, A549 (Center for Medical Cell Resources, Institute of Aging Medicine, Tohoku University

(obtained from http: //www.idac. tohoku. ac.jp/dep/ccr/))) Cells were used. Cells were cultured at 37 ° C in an incubator with 5% C 存在₂ using RPMI-1640 culture containing 10% calf serum. RNA was extracted as follows. The cells were cultured in a 10 cm dish until confluent, and cultured three times in PBS (phosphate-buffered saline). Lml of Trizo 1 (phenolic reagent for RNA extraction, manufactured by Gibgo) was added, left at room temperature for 2 minutes, scraped, and collected in a 1.5 ml tube. After complete lysis of the cells by pipetting, they were incubated for 10 minutes at room temperature. Add 200 / X 1 of black-mouthed form, suspend for 30 seconds, and stand still for 2 minutes. After centrifugation for 5 minutes, phase separation was performed. Transfer the upper layer to a new 1.5 ml tube, add an equal volume (500 / z 1) of cold isopropanol, suspend for 10 seconds, then stand for 10 minutes, and at 4 ° C, 12, OO rpm. The RNA was precipitated by centrifugation for 10 minutes. Decant the supernatant, add 1 ml of 70% ethanol-DEPC (getyl pyrocarbonate) -treated water, lightly suspend and wash, centrifuge at 4 ° C, 12, OOO rpm for 5 minutes, and then decant. To remove the salt. The tube was dried in a desiccator to completely remove water, and then the RNA was dissolved in 20% of treated water. The expression level of the SAT-I gene was confirmed for the RNA extracted using this method by Northern blotting.

After 6 μg of RNA per cell is electrophoresed on formaldehyde-denatured agarose gel, it is transcribed to a membrane and hybridized with digoxigenin-labeled RNA probe of human SAT-I gene. Was confirmed.

The probe was produced as follows. Extract RNA from human leukemia cell HL60, primers with the following sequence:

Forward direction CAGGTATAGCGTGGACTTACTC (SEQ ID NO: 3)

Reverse TTCACGATCMTGCCTCCACTG (SEQ ID NO: 4)

Was used to perform RT-PCR to amplify the SAT-I gene fragment for probe. It was ligated to pGEM-Teasy (produced by Promega), transformed into Escherichia coli XL-1 blue), and purified. The SAT-I gene fragment-inserted plasmid for the probe is digested with the restriction enzyme Ecoθ109I, and a mixed solution of T7 RNA polymerase (Roche) and DIG-labeled mononucleotide (Roche) is prepared. ) To produce an RNA probe (SEQ ID NO: 5).

As a result, one SAT-I gene high-expressing strain A549 and two mid-expressing strains LCS

C # 1, LCSC # 2, and two low-expressing strains Lu 99B and LK-12 (Fig. 1). The amount of the migrated RNA was confirmed by methylene blue staining of 28 S and 18 S ribosomal RNA. A549 (adenocarcinoma) showed the highest expression of SAT-I gene and LCSC # 1 (glandular carcinoma). Cancer) and LCSC # 2 (adenocarcinoma) had a moderate expression level, while Lu 99B (large cell carcinoma) and LK-12 (squamous cell carcinoma) had low expression levels.

Example 2

Anticancer drug sensitivity test (1)

Next, these cells were examined for anticancer drug sensitivity (resistance). Survival rates of various lung cancer cells after 24 hours in the presence of etoposide, a topoisomerase II inhibitor, adriamicin, an RNA polymerase inhibitor, vincristine, a microtubule function inhibitor, and cisbratin, a DNA biosynthesis inhibitor When measured using Cell Counting Kit-8 (manufactured by Dojindo Laboratories), a cytotoxicity measurement reagent, all of the measured drugs exhibited drug resistance dependent on the SAT-I gene expression level (Fig. 50% survival rate of lung cancer cells by each drug treatment 2 showed (IC _5. value)).

Five types of human non-small cell lung cancer were seeded on a 96-well plastic plate at 10,000 cells per well at 100 μl and cultured for 24 hours. After culturing for 24 hours, etoposide (1, 10, 100, 500 / Μ), adriamycin ( 0.1, 1, 10, 50, 100 / ζ ζ), Vincristine (1, 10, 100, 500, 1000 μΜ) and Cisplatin (1, 10, 100, 500, Ι Ο ΟμΜ) The dose was administered in a concentration series. After further incubation for 24 hours, 10 μl of Cell Counting Kit-8 (manufactured by Dojindo Laboratories) was added to each well, and the absorbance (450 nm) of the medium was measured 3 hours later. . The results are shown in Fig. 2. A549 (adenocarcinoma), which overexpresses the SAT-I gene, shows high resistance to the anticancer drugs etoposide, adriamycin, vininkristin, and cisbratin, and LCSC # 1 (adenocarcinoma), LCSC # 2 (adenocarcinoma) was moderately resistant, and Lu 99B (large cell carcinoma) and LK-2 (squamous cell carcinoma) were highly susceptible. There is a positive correlation between the expression level of the SAT-I gene and the resistance to the anticancer drugs etoposide, adriamycin, vincristine, and cisplatin. Example 3

Measurement of SAT-I gene expression in lung cancer cells (2)

The SAT-I gene expression levels of the following 16 human lung cancer cell lines were measured by the RT-PCR method. EBC—l (A), LCSC # 1 (B), LCSC # 2 (B), Lu 65 (C), Lu 99 B (C), LK-2 (A), A549 (B), OBA-LK- 1 (C), ABC-1 (B), Lu 99 (C), QG90 (D), PC 3 (B), PC 6 (D), NC I-H 226 (A), L c 1 sq (A ), NC I-H23 (B) (The parentheses at the end of the cell name indicate the pathological a tissue classification: (A) Squamous cell carcinoma,

(B) adenocarcinoma, (C) large cell carcinoma, (D) small cell carcinoma). QG90, PC3, and PC6 strains were provided by Associate Professor Katsuichi Inoue, Hokkaido University, and the other strains were the Medical Cell Resource Center, Institute of Aging Medicine, Tohoku University.

(http: // ww. iaac. tohoku. ac. jp / dep / ccr /)

—Single-stranded cDNA was synthesized using an RNA sample extracted from each cell, using a single-stranded cDNA synthesis kit Rev eSeRaAc e (registered trademark) (Toyobo). For the synthesis of single-stranded cDNA, a random primer or an oligo dT primer was used. Prepare a reaction solution according to the method attached to the kit.If a random primer is used, perform the reaction at 30 ° C for 10 minutes, 42 ° C for 50 minutes, and 95 ° C for 5 minutes.If the Oligo dT primer is used, Reactions were performed at 42 ° C for 50 minutes and at 95 ° C for 5 minutes using a thermal cycler (Gene Amp® PCR System 9700, manufactured by Applied Biosystems). After the reaction was completed, the reverse transcript was stored at -30 ° C.

The PCR reaction was carried out using 400 nM (final concentration) of SAT-I gene expression in both forward and reverse primers and ExTaq (Takara Shuzo) at a volume of 10 / i1. The parameters of the thermal cycler are as follows: In all reactions, the cycle of 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, pairing at 55 ° C for 30 seconds, and elongation cycle at 72 ° C for 1 minute is 30- This was repeated 35 times, and the extension reaction was further continued at 72 ° C for 5 minutes, and then left at 4 ° C. A part of the final reaction product of the PCR product was developed by 1.5% agarose gel electrophoresis and assayed by ethidium dipromide staining. Table 1 shows the results.

Example 4

Anticancer drug sensitivity test (2)

The sensitivity of various human lung cancer cells used in Example 3 to the anticancer drug paclitaxel was measured. Various human lung cancer cells were raised from a frozen state and cultured in a 10 cm dish, and passaged at least twice to stabilize the cell growth state. The cells were detached using 0.25 ° / o Tripsin-EDTA solution (Sigma), and the number of cells was measured by a hemocytometer. Adjust the concentration of the medium to 5 X 10 ⁴ ce 11 s Zm 1 and inoculate 9 Ο Ο μΙ each in 96 we 1 1 plate (5 X 10 ³ cells per well) . One day later, the medium was replaced with a medium containing various anticancer agents at a concentration of 0, 0.1, 1, 10, 100 μΜ, and incubated. After 2 2 hours, C el 1 countingkit - 8 (Dojin Kagaku) was 1 0 / x 1 / we 1 1 was added and reacted between 2:00 co ₂ incubator. The absorbance at 450 nm was measured using a microplate reader. Cell Counting Kit ~ 8 is a kit for measuring cell number in cell proliferation or cytotoxicity tests of chemicals. It is a novel tetrazolium salt WST-8 (2- (2-me Toxic 4-12-Trofeninole) 1-3- (4-12-Trofeninole) 15- (2,4-disulfophenol) 1H-tetrazolium 'monosodium salt) is used as a coloring substrate. WST-8 is reduced by intracellular dehydrogenase to produce water-soluble formazan. Since the number of cells and the amount of formazan produced are linearly proportional, the number of viable cells can be measured by measuring the absorbance of this formazan at 450 nm. Table 1 shows the results. Cell name IC ₅₀ (μ Μ) SAT-I gene expression level *

PC 3 1 0 0 or more 1

AB C—1 1 0 0 or more 0.01936596

NC I -H2 3 1 0 0 or more 0.04561019

PC-6 100 or more 0.06380957

A5 4 9 0.1 1 3.08977118

LC S C # 2 1 0 0 or more 0.06127037

L u 9 9 B 1 0 0 or more 0.09848174

QG- 9 0 1 4.2 2 0.49637419

EB C—1 1 00 or more 0

NC I H2 2 6 3 1.8 1.94239058

L c 1 s q 1 0 0 or more 0.05484168

Lu 9 9 5 9. 3 0.16564023

OB A— LK 1 1 5.5.0 0.53830659

LC SC # 1 1 0 0 or more 0.05859819 Lu 65 5.42 0.050608466

LK2 8.33 0.06593591

* Relative ratio when PC3 expression level is set to 1 Figure 3 shows the correlation between the SAT-I gene expression level in human lung cancer and the survival rate of cancer cells treated with the anticancer drug paclitaxel. There is a negative correlation between SAT-I gene expression and resistance to the anticancer drug paclitaxel.

The above results indicate that the expression level of the SAT-I gene in cancer cells is closely related to anticancer drug resistance (sensitivity). It was found that anticancer drug resistance (sensitivity) can be predicted. This discovery is expected to make a significant contribution to cancer diagnosis and treatment in the future.

Claims

The scope of the claims

1. SAT-I mRNA that is expressed from the ganglioside GM3 synthase (SAT-I) gene having the nucleotide sequence of SEQ ID NO: 1 and is used as an anticancer drug sensitivity marker for cancer cells.

2. A ganglioside GM3 synthase having the amino acid sequence of SEQ ID NO: 2 to be used as an anticancer drug sensitivity marker for cancer cells.

3. A method for testing the susceptibility of a cancer cell to a cancer agent, the method comprising measuring the expression level of the ganglioside GM3 synthase (SAT-I) gene in the cancer cell.

4. (1) The correlation between the sensitivity of cancer cells to anticancer drugs and the amount of gandarioside GM3 synthase (SAT-I) gene in cancer cells was determined.

(2) measuring the SAT-I expression level of the patient's cancer cells in vitro,

(3) From the correlation in (1) and the expression level in (2), the sensitivity of the patient's cancer cells to the anticancer drug is determined.

And a method for selecting an anticancer agent.

5. The method according to claim 3, wherein the cancer is lung cancer.

6. The method according to claim 5, wherein the lung cancer is a non-small cell lung cancer.

7. The method according to claim 3, wherein the expression level of the ganglioside GM3 synthase gene is measured by measuring the amount of mRNA expressed from the gene.

8. The method according to claim 7, wherein the mRNA expression level is measured by Northern blotting.

9. A probe comprising a DNA having the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof, or an RNA corresponding thereto, which is used for measuring the mRNA expression level according to claim 7 or 8.

10. The method according to claim 3 or 4, wherein the expression level of the ganglioside GM3 synthase gene is measured by measuring a protein expressed from the gene.

1 1. The method according to claim 10, wherein the expression level is measured by Western blotting.

12. An antibody against a protein having the amino acid sequence of SEQ ID NO: 2 or a fragment thereof, which is used for measuring the expression level of the protein according to claim 10 or 11.

13. The method according to claim 3, wherein the anticancer agent is selected from the group consisting of etoposide, adriamycin, cisplatin, vincristin, and paclitaxel.