WO2004096975A2 - Apparatus and methods for amplification of blood stem cell numbers - Google Patents

Apparatus and methods for amplification of blood stem cell numbers Download PDF

Info

Publication number
WO2004096975A2
WO2004096975A2 PCT/IB2004/001724 IB2004001724W WO2004096975A2 WO 2004096975 A2 WO2004096975 A2 WO 2004096975A2 IB 2004001724 W IB2004001724 W IB 2004001724W WO 2004096975 A2 WO2004096975 A2 WO 2004096975A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
hematopoietic cells
undifferentiated
cell
culture
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2004/001724
Other languages
English (en)
French (fr)
Other versions
WO2004096975A3 (en
Inventor
Gerard Madlambayan
Peter Zandstra
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Insception Biosciences Inc
Original Assignee
Insception Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Insception Biosciences Inc filed Critical Insception Biosciences Inc
Priority to CA2565581A priority Critical patent/CA2565581C/en
Priority to JP2006506626A priority patent/JP2006525013A/ja
Priority to AU2004234627A priority patent/AU2004234627A1/en
Priority to EP04730899A priority patent/EP1641911A2/en
Priority to US10/555,604 priority patent/US7795024B2/en
Publication of WO2004096975A2 publication Critical patent/WO2004096975A2/en
Publication of WO2004096975A3 publication Critical patent/WO2004096975A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0647Haematopoietic stem cells; Uncommitted or multipotent progenitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M23/00Constructional details, e.g. recesses, hinges
    • C12M23/02Form or structure of the vessel
    • C12M23/14Bags
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M23/00Constructional details, e.g. recesses, hinges
    • C12M23/24Gas permeable parts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12MAPPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M23/00Constructional details, e.g. recesses, hinges
    • C12M23/58Reaction vessels connected in series or in parallel
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/124Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10TTECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00Chemistry: analytical and immunological testing
    • Y10T436/25Chemistry: analytical and immunological testing including sample preparation
    • Y10T436/25125Digestion or removing interfering materials
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10TTECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00Chemistry: analytical and immunological testing
    • Y10T436/25Chemistry: analytical and immunological testing including sample preparation
    • Y10T436/25375Liberation or purification of sample or separation of material from a sample [e.g., filtering, centrifuging, etc.]
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10TTECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00Chemistry: analytical and immunological testing
    • Y10T436/25Chemistry: analytical and immunological testing including sample preparation
    • Y10T436/25375Liberation or purification of sample or separation of material from a sample [e.g., filtering, centrifuging, etc.]
    • Y10T436/255Liberation or purification of sample or separation of material from a sample [e.g., filtering, centrifuging, etc.] including use of a solid sorbent, semipermeable membrane, or liquid extraction

Definitions

  • the present invention relates to an apparatus and methods for expanding stem or progenitor cells in a controllable bioprocess system, providing for expansion of the stem or progenitor cells, controlling endogenous factor production, and providing cell populations (mixtures of stem, progenitor, and mature cells) that are useful for transplantation (hematopoietic rescue) and other therapeutic treatments.
  • Hematopoietic stem cells are rare cells that have been identified in fetal bone marrow, umbilical cord blood, adult bone marrow, and peripheral blood, which are capable of differentiating into each of the myeloerythroid (red blood cells, granulocytes, monocytes), megakaryocyte (platelets) and lymphoid (T-cells, B-cells, and natural killer cells) lineages.
  • myeloerythroid red blood cells, granulocytes, monocytes
  • megakaryocyte platelets
  • lymphoid T-cells, B-cells, and natural killer cells
  • Stem cells initially undergo commitment to lineage restricted progenitor cells, which can be assayed by their ability to form colonies in semisolid media.
  • Progenitor cells are restricted in their ability to undergo multi-lineage differentiation and have lost their ability to self-renew. Progenitor cells eventually differentiate and mature into each of the functional elements of the blood. The lifelong maintenance of mature blood cells results from the proliferative activity of a small number of pluripotent hematopoietic stem cells that have a high, but perhaps limited, capacity for self- renewal. In culture, hematopoietic stem cells rapidly commit to differentiated cell types, which irreversibly predominate in the culture. This property, along with their relative scarcity in blood, presents challenges to the creation of long term, stable cultures of pluripotent hematopoietic stem cells. SUMMARY OF THE INVENTION
  • the present invention provides for an apparatus and methods for expanding undifferentiated pluripotent cells of the hematopoietic lineage in culture, whereby the cells proliferate in culture with little to no lineage commitment, and differentiation.
  • the undifferentiated hematopoietic cells generally have the phenotypes of CD34+, CD34+Lin-, CD133+, NOD/SCID repopulating cells, and rapid NOD/SCID repopulating cells.
  • This bioprocess includes in one aspect, a bioprocess device having a first cell culture chamber, a second cell culture chamber, and a conduit in regulatable fluid communication with the first chamber and the second chamber.
  • the interior surfaces of the first cell culture chamber, the second cell culture chamber and the conduit are substantially closed to the environment.
  • one or more of the interior surfaces of the first cell culture chamber, the second cell culture chamber and the conduit are substantially open to the environment.
  • the device includes embodiments wherein the first cell culture chamber or the second cell culture chamber is semipermeable to oxygen gas and carbon dioxide gas, but substantially impermeable to liquids.
  • at least one of the first cell culture chamber or the second cell culture chamber is adapted to a pump device.
  • the bioprocess system is modular, and the first chamber, the second chamber, or the conduit are detachable.
  • the conduit has a selection element.
  • the selection element is used to segregate differentiated cells from undifferentiated cells, and in one embodiment has affinity for one or more antigens expressed by differentiated hematopoietic cells, for example but not limited to antigens selected from the group consisting of: lin + antigens, CD2, CD3, CD4, CD8, CD13, CD14, CD16, CD19, CD24, CD38, CD45, CD56, CD66b and glycophorin A.
  • the conduit further includes a magnet or a magnetizable element, to facilitate segregation of the cell subpopulations.
  • a sample of hematopoietic cells is obtained, further including a subset of undifferentiated hematopoietic cells.
  • the sample of hematopoietic cells are cultured in culture media and under conditions appropriate to cause proliferation of the undifferentiated hematopoietic cells.
  • the undifferentiated hematopoietic cells are segregated from differentiated hematopoietic cells or growth factors, and the segregated undifferentiated hematopoietic cells are further cultured thereby causing proliferation of the segregated undifferentiated hematopoietic cells. This method can be carried out in either closed or open culture conditions.
  • the growth factors are segregated from the undifferentiated hematopoietic cells, by exchange of the culture media, by dilution, or by perfusion of the culture.
  • the differentiated hematopoietic cells are segregated from the undifferentiated hematopoietic cells by affinity separation, immunoaffinity separation, and the immunoaffinity separation is performed using a selection element having an antibody or fragment thereof, for example but not limited to anti-CD2, anti-CD3, anti-CD4, anti-CD8, anti-CD13, anti-CD14, anti-CD16, anti-CD19, anti-CD24, anti- CD38, anti-CD45, anti-CD56, anti-CD66b, and an anti-glycophorin A antibody.
  • the invention also provides methods of preserving cells.
  • a sample of hematopoietic cells is obtained further including a subset of undifferentiated hematopoietic cells.
  • the cells hematopoietic cells are cultured in culture media and under conditions appropriate to cause proliferation of the subpopulation of undifferentiated hematopoietic cells; the undifferentiated hematopoietic cells are segregated from the differentiated hematopoietic cells and undesired growth factors; and the cells are cultured further, thereby causing proliferation of the segregated undifferentiated hematopoietic cells.
  • the segregated undifferentiated hematopoietic cells are then frozen, e.g., in DMSO, in glycerin, or another suitable cryopreservative. These methods can be performed in closed system and open system embodiments.
  • the growth factors are segregated from the undifferentiated hematopoietic cells, by exchange of the culture media, by dilution, or by perfusion of the culture.
  • the differentiated hematopoietic cells are segregated from the undifferentiated hematopoietic cells by affinity separation, itnrnunoaffinity separation, and the immunoaffjxiity separation is performed using a selection element having an antibody or fragment thereof, for example but not limited to anti-CD2, anti-CD3, anti-CD4, anti-CD8, anti-CD13, anti- CD14, anti-CD16, anti-CD19, anti-CD24, anti-CD38, anti-CD45, anti-CD56, anti- CD66b, and an anti-glycophorin A antibody.
  • a selection element having an antibody or fragment thereof, for example but not limited to anti-CD2, anti-CD3, anti-CD4, anti-CD8, anti-CD13, anti- CD14, anti-CD16, anti-CD19, anti-CD24, anti-CD38, anti-CD45, anti-CD56, anti- CD66b, and an anti-glycophorin A antibody.
  • the invention includes methods of treating a mammal.
  • a mammal is first identified, having a disorder characterized by an insufficient number of hematopoietic cells; a sample of hematopoietic cells is obtained, e.g., from a donor for an allograft transplant, or from the mammal for an autologous transplant, the sample further including a subset of undifferentiated hematopoietic cells; the sample of hematopoietic cells is cultured in culture media and under conditions appropriate to cause proliferation of the undifferentiated hematopoietic cells; the undifferentiated hematopoietic cells are segregated from differentiated hematopoietic cells or growth factors; and the segregated undifferentiated hematopoietic cells are cultured further, thereby causing further proliferation of the segregated undifferentiated hematopoietic cells.
  • the mammal is providing with a suitable quantity of the cultured undifferentiated hematopoietic cells, and the cultured undifferentiated hematopoietic cells increase the number of hematopoietic cells in the mammal, thereby treating the disorder.
  • Embodiments of the invention include open and closed systems. Disorders suitable for treatment include, for example but not limited to a cytopenia or an anemia such as those induced by cancer treatments, or a genetic defect resulting in aberrant levels of blood cells, or cancer, for example a graft versus tumor approach.
  • cultures of undifferentiated hematopoietic cells with long-term repopulating potential are expanded at least a four-fold prior to transplantation in the mammal.
  • the invention includes a method for providing a cell population of undifferentiated human hematopoietic cells; wherein the number of undifferentiated human hematopoietic cells increases by at least 20-fold to form the cell population.
  • the invention also includes in one aspect, a method of providing a therapeutic protein to a mammal.
  • a mammal in need of a therapeutic protein is identified; a sample of hematopoietic cells is obtained further including a subset of undifferentiated hematopoietic cells; a gene encoding the therapeutic protein is introduced into at least one undifferentiated hematopoietic cell; the undifferentiated hematopoietic cell having the gene is cultured in culture media and under conditions appropriate to cause proliferation of the undifferentiated hematopoietic cell; the undifferentiated hematopoietic cells having the gene are segregated from differentiated hematopoietic cells or growth factors; and the segregated undifferentiated hematopoietic cells having the gene are cultured thereby causing further proliferation of the hematopoietic cells having the gene; and a suitable quantity of the cultured undifferentiated hematopoietic cells having the gene encoding the therapeutic
  • the mammal does not demonstrate a pathological immune response to the transplant after transplantation.
  • mammal does not demonstrate a pathological immune response to the transgene, or its expression products.
  • the invention provides a method of providing blood to a mammal.
  • a mammal is identified having an insufficient number of hematopoietic cells; a sample of hematopoietic cells is obtained further comprising a subset of undifferentiated hematopoietic cells; the sample of hematopoietic cells is cultured in culture media and under conditions appropriate to cause proliferation of the undifferentiated hematopoietic cells; the undifferentiated hematopoietic cells are segregated from differentiated hematopoietic cells or growth factors; the segregated undifferentiated hematopoietic cells are cultured further thereby causing proliferation of the segregated undifferentiated hematopoietic cells; and the mammal is provided with a suitable quantity of the cultured undifferentiated hematopoietic cells as a transplant, wherein the cultured undifferentiated hematopoietic cells increase the number of hematopoietic
  • cultures of undifferentiated hematopoietic cells with long-term repopulating potential are expanded at least a four-fold prior to transplantation in the mammal.
  • the invention includes a method for providing a cell population of undifferentiated human hematopoietic cells; wherein the number of undifferentiated human hematopoietic cells increases by at least 20- fold to form the cell population.
  • Culture of cells is performed using either closed systems or open systems.
  • the undifferentiated hematopoietic stem cells do not cause graft versus host disease in the mammal following transplantation.
  • the invention also provides in various aspects, method of controlling cell proliferation.
  • Levels of one or more growth factors in a cell culture having a subpopulation of undifferentiated hematopoietic cells are reduced, wherein reduction of the growth factor levels allows the undifferentiated hematopoietic cells to expand in number in the culture without substantial lineage commitment of the cells.
  • the growth factors reduced are, for example but not limited to hematopoietins, TGF-beta or MIP-1 -alpha.
  • growth factor levels are reduced by subpopulation segregation, or by media exchange or media dilution, or by perfusion of the culture.
  • Cell cultures may be closed systems or open systems.
  • the invention provides a method of banking blood for a mammal.
  • a sample of hematopoietic cells further comprising a subset of undifferentiated hematopoietic cells is obtained from a mammal; the sample of hematopoietic cells are cultured in culture media and under conditions appropriate to cause proliferation of the undifferentiated hematopoietic cells; the undifferentiated hematopoietic cells are segregated from differentiated hematopoietic cells or growth factors; the segregated undifferentiated hematopoietic cells are cultured further thereby causing further proliferation of the segregated undifferentiated hematopoietic cells; and the mammal is provided with a transplant, including a suitable quantity of the cultured undifferentiated hematopoietic cells, wherein the cultured undifferentiated hematopoietic cells increase the number of hematopoietic cells in the mammal following the transplant.
  • the invention includes commercial processes for collecting, expanding, and banking for a patient, a sample of cultured undifferentiated hematopoietic cells suitable for transplant into the patient.
  • the sample is provided by a donor and used in an allograft, or the patient provides the initial sample, and the cultured undifferentiated hematopoietic cells are used in an autologous transplant.
  • the invention provides for a transplant kit.
  • the kit includes a population of undifferentiated hematopoietic cells, that have been expanded at least four-fold in culture, and are suitable for transplant into a mammal, particularly a human.
  • Cells provided in the kit are cultured in either closed systems or open systems.
  • Also included in the kit are instructions for using the cells in a transplant procedure.
  • Figure 1 is a picture of the apparatus used for the bioprocess.
  • the cell culture chamber shown in this illustration employs culture bags semipermeable to gases.
  • the conduit as shown includes an enrichment element, which separates the CD34+ cells from differentiated and committed lin + hematopoietic cells.
  • Figure 2 shows graphical representations comparing the kinetic growth of total cells (A), CD34 + cells (B), CD34 + CD38" cells (C) and CFCs (C) using either traditional culture dishes or using the present invention.
  • Figure 3 is a graphical representation showing the extent of expansion of total cells, CD34 + cells, CD34 + CD38" cells and CFCs, expanded by using either traditional culture dishes or using the present invention.
  • Figure 4A depicts RT-PCR analysis of cultured hematopoietic cells showing expression levels of various inhibitory factors. Beta-actin was used as a control.
  • Figure 4B is a graphical representation of ELISA analysis showing the secretion of inhibitory factors in culture. The detection of TGF-betal and MIP-1 alpha is illustrated.
  • Figure 5A is a graphical representation of ELISA analysis showing changes in TGF-betal secretion rates in response to cell selection and enrichment.
  • Figure 5B depicts RT-PCR analysis showing that column isolated and FACS sorted lin + cells express TGF-betal. Beta-actin was used as a control.
  • Figure 6A is a graphical representation of ELISA analysis showing changes in MIP-1 alpha secretion rates in response to media exchange.
  • Figure 6B depicts semi- quantitative RT-PCR analysis showing that MIP-1 alpha expression is decreased in response to fresh media. Beta-actin was used as a control.
  • FIG 7A is a schematic of the closed-system bioprocess.
  • the bioprocess consists of two cell culture bags (3 or 7 ml) which are joined through a conduit having a subpopulation selection element.
  • the subpopulation selection element is used to remove contaminating lin+ cells from culture.
  • Figure 7B illustrates the effect of the subpopulation selection element. Representative flow cytometric plots showing the amount of lin+ cells present pre- (7Bii) and post-selection (7Biii). A negative control is also shown that was not labeled with the lin+ antibody cocktail (7Bi). Comparisons were made to the commercially available StemSepTM column (7B iv, ii, iii).
  • FIG. 8 shows the absolute numbers of hematopoietic cells generated in the bioprocess.
  • Purified UCB lin" cells (1 x 10 5 cells/ml) were cultured for 8-days in the bioprocess with subpopulation selection and media dilution/exchange occurring at day 4.
  • Figure 10 illustrates human cell engraftment in NOD/SCID mice following intravenous injection.
  • A Representative flow cytometric plots showing the presence of human CD45 ⁇ LA-abc + cells in NOD/SCID mice (Aiii). A control NOD/SCID mouse that did not receive cells is also shown (An) along with a representative isotype control (At).
  • Figure 11 A shows a bioprocess configuration that allows for flow rate control.
  • a peristaltic pump is used to 'push' cells through the conduit having a subpopulation selection element.
  • Figure 11B shows the effect of increasing flow rate on the recovery and purity of lin" cells exiting the subpopulation selection element.
  • Figure 12. is a schematic of the experimental protocol. The experimental design of all 4 test conditions is shown. Subpopulation selection and/or media dilution were performed on day 4 with all cultures allowed to incubate for a total of 8-days. Cultures were established with fresh UCB lin" cells in media containing TPO, SCF and FL. S: subpopulation selection; E: media dilution/exchange; NS: no selection; NE: no media dilution/exchange.
  • Figure 13 shows the effects of subpopulation selection and media dilution on the expansion of hematopoietic progenitor cell populations.
  • Purified UCB lin" cells (1 x 10 5 cells/ml) were cultured for 8-days using the four culture conditions indicated in Figure 1. At the end of the 8-day culture period, total cell (A) and progenitor cell (A, B, C) expansion was analyzed using phenotypic and in vitro functional assays. The fold expansion values shown are in comparison to fresh UCB lin" cells.
  • (*) Represents significant difference (p ⁇ 0.05) in comparison to unmanipulated control cultures (NS/NE).
  • Figure 14 illustrates human cell engraftment in NOD/SCID mice following intrafemoral injection. These are so-call rapid repopulating stem cells. May have enhanced clinical utility by allowing for "rapid engraftment" following transplantation.
  • A A total of 3 x 10 5 cells, grown using the four culture conditions indicated, were injected intrafemorally into NOD/SCID mice. Examination of human cell engraftment in both the right and left femurs was assessed after 2-weeks.
  • (B) A representative mouse, transplanted with cells from the S/E condition, showing engraftment in both the right femur (Bv) and left femur (Buz) is represented along with a corresponding isotype control (Br ⁇ ). Also shown is a non-engrafted control mouse that did not receive a transplant (isotype, Bz; right femur, B ⁇ ; left femur, Bin).
  • C Limiting dilution analysis was performed to determine the frequency of migrating R-SRCs in fresh UCB lin" cells and cultured cells using the intrafemoral NOD/SCID assay.
  • Engraftment frequencies for fresh UCB lin" (Ci) and expanded (Cz ⁇ ) cells are shown for each cell dose.
  • the frequency of migrating R-SRCs was calculated using the maximum likelihood estimator with the overlayed curves representing results from these analyses.
  • the calculated frequencies of R-SRCs are shown on the plots. Isotype controls were established for each sample.
  • Figure 15. illustrates human cell engraftment in NOD/SCID mice following intravenous injection.
  • A A typical flow cytometry plot showing the presence of human CD45 ⁇ LA-abc + cells in intravenously injected NOD/SCID mice (Aiz ⁇ ). A control NOD/SCID mouse that did not receive cells is also shown (Aii) along with a representative isotype control (Ai).
  • B Limiting dilution analysis was performed to determine the frequency of LT-SRCs present in fresh UCB lin" cells and expanded cells. The resultant engraftment frequencies for fresh lin" cells (Bi) and cultured cells (Bz ⁇ ) are shown for each cell dose and overlayed with curves representing results from the maximum likelihood estimator. Isotype controls were established for each sample.
  • Figure 16 shows multilineage differentiation of cells engrafted into NOD/SCID mice.
  • Mice that were found to show human cell engraftment (CD45 + ) were analyzed using flow cytometry for their ability to differentiate into cells of both lymphoid and myeloid lineages.
  • (Aii, Bz ⁇ ) Representative FACS analysis dot plots showing CD19 expression on engrafted cells from mice injected intrafemorally (Aii) or intravenously (Bz ⁇ ). Positive staining indicated that cells were capable of lymphoid differentiation.
  • Figure 17 illustrates the endogenous secretion of inhibitory factors is modulated by subpopulation selection and media dilution.
  • A ELISA analysis showing changes in TGF- ⁇ l secretion rates in response to subpopulation selection and/or media dilution. Conditions undergoing subpopulation selection resulted in significantly lower TGF- ⁇ l production levels.
  • B RT-PCR analysis showing that column isolated and FACS sorted lin + cells express TGF- ⁇ l.
  • C ELISA analysis showing changes in MlP-l ⁇ secretion rates in response to subpopulation selection and/or media dilution. Media dilution significantly decreased the secretion of MIP- l ⁇ .
  • HSCs hematopoietic stem cells
  • Immunophenotyping is a method that can be used to characterize hematopoietic cells based on the expression of cell surface antigens. These markers are expressed on distinct sub-populations of cells and in combination with systematic functional analysis of cells expressing particular cell surface antigens has led to their categorization based on lineage relationships.
  • the terms "undifferentiated hematopoietic cell”, “undifferentiated cell”, “hematopoietic stem cell (HSC)”, and “primitive cell” are used interchangeably to describe a pluripotential hematopoietic stem cell that is capable of long term in vivo expansion and repopulation when transplanted into a mammal. It has been established that the most primitive cell types express the cell surface antigen CD34, which is a transmembrane glycophosphoprotein thought to play an important role in stem and progenitor cell adhesion in BM 72 . Cell populations expressing CD34 and lacking the CD38 antigen (i.e. CD34 + CD38" cells) have been shown to display primitive cell potentials.
  • the majority of SRCs can be found in the CD34 + CD38" cell fractions and not in the CD34 + CD38 + populations, which are thought to contain more differentiated cell types 7 .
  • the CD34 + CD38" phenotype has also been associated with an enrichment of cells having LTC-IC characteristics 73 .
  • the existence of murine and human CD34" HSCs that are capable of long-term multilineage repopulation illustrates that the CD34 antigen may itself be regulated independently of HSC potential and that CD34 expression itself is not a requisite HSC marker 14 - 74 - 77 .
  • Primitive cells have also been identified based on the expression of Thy-1, a T-cell related marker 78 .
  • Thy-1 expression allows for the recovery of LTC-ICs from UCB, BM and human fetal liver mononuclear cells (MNCs) 79 and accounts for all repopulating cells (Thy-1. Ho) present in mouse BM 80 .
  • CD133 a transmembrane receptor glycoprotein
  • AC133 a transmembrane receptor glycoprotein
  • CD34 + CD133 + cell fractions isolated from UCB are highly enriched in primitive progenitors 82 and SRCs that additionally have the capacity to engraft secondary recipients 83 - 84 .
  • vascular growth factor receptor 2 KDR
  • KDR vascular growth factor receptor 2
  • the absence of specific antigens can also be used to characterize and isolate primitive hematopoietic stem cell populations.
  • human CD34 + cells lacking HLA-DR 86 or CD45RA/CD71 87 identify primitive multipotential hematopoietic cells capable of self-renewal and differentiation into multiple hematopoietic lineages.
  • isolating cells that lack markers associated with mature myeloid and lymphoid cells represents a method of enriching for primitive cell types.
  • the term "differentiated hematopoietic cell” refers to a lineage committed hematopoietic cell. These cells typically express one or more of the antigens CD2, CD3, CD14, CD16, CD19, CD24, CD56, CD66b, and glycophorin A, and are termed lineage markers (lin + ). The detection of lin + antigens indicates the loss of pluripotential properties and that the cell has become differentiated, or lineage committed. Accordingly, these lin + antigens also provide the appropriate antigens for targeted separation of differentiated cells as described herein, and antibodies to these antigens are widely available for irnrnunoseparation procedures.
  • monocytes are known to secrete transforming growth factor (TGF)- ⁇ l and macrophage inflammatory protein (M ⁇ P)-l ⁇ 21 ' 28 .
  • TGF transforming growth factor
  • M ⁇ P macrophage inflammatory protein
  • Neutrophils have been associated with the secretion of TGF- ⁇ l, MlP-l ⁇ and tumor necrosis factor (TNF)- ⁇ 21 - 25 while megakaryocytes secrete interleukin (IL)-3 23 .
  • TGF tumor necrosis factor
  • IL interleukin
  • IL-12, TNF- ⁇ , IL-1, or IL- 10 can stimulate lymphocytes to produce MlP-l ⁇ 29 - 30 .
  • These inhibitory factors are known to prevent HSC expansion in vitro by causing them to remain quiescent, undergo apoptosis, and/or differentiate into mature cell types 31 " 35 .
  • cytokine receptors are not specific to HSCs but instead can also be found on cells at different stages of blood development. It has been shown that c-kit, flk2/flt3, c-mpl, IL-6R and GM-CSFR (the receptors for SCF, FL, TPO, IL-6 and GM-CSF respectively), can be differentially expressed not only on cells from the stem cell compartment but also on progenitor and mature cell populations 36 " 43 . The presence of these receptors throughout the hematopoietic hierarchy implies that the actions of supplemented cytokines are not specific to HSCs but also target more differentiated cells.
  • cytokines have been shown to stimulate the terminal differentiation and proliferation of megakaryocyte 44 ' 45 , granulocyte 46 and macrophage 47 progenitors. Because of the cellular heterogeneity of HSC expansion cultures, cytokine supplementation would stimulate the simultaneous proliferation and/or differentiation of stem cells (and progenitor cells) which would ultimately result in the formation of large numbers of progenitor and terminally differentiated mature cell populations. In this context, these generated cell populations may then prevent HSC expansion in vitro through the secretion of inhibitory factors.
  • One model for stem cell expansion involves a negative feedback control mechanism whereby differentiated blood cells, generated in cytokine supplemented cultures, produce soluble factors that, directly or indirectly, prevent HSC expansion.
  • This mechanism implies that the removal of these cells or the endogenous factors generated by these cells would remove the block to HSC expansion by shifting the balance of signals presented to the stem cells (i.e. from supplemented cytokines and secreted cytokines) from those preventing expansion to those favoring expansion.
  • the removal of these cells may also provide a mechanism to enrich for cells that may secrete stimulatory factors.
  • Usable methods that control and modulate the endogenous production of stimulatory and inhibitory factors thus overcome limitations of current HSC expansion systems.
  • the invention disclosed herein describes an apparatus and processes for expanding HSCs ex vivo in part by controlling the global effects of endogenously produced inhibitory and stimulatory factors.
  • the HSCs generated as described herein can be used for a variety of clinical applications.
  • the expanded HSCs can be transplanted for amelioration of cytopenia and anemia induced by radiotherapy or chemotherapy using anticancer drugs, in order to enhance or accelerate immune and hematopoietic recovery following intensive treatment.
  • the invention can be used for prevention and treatment of infectious diseases associated with lymphopenia, such as the CD4+ T cell depletion seen with chronic HIV infection.
  • the HSCs can be cultured with differentiating factors to produce specific blood cell types.
  • HSCs produced using this invention can be induced to differentiate into cells of a desired population and function using known biological agents.
  • the invention can generate "designer transplants" with a plurality of functions established to provide the greatest patient care.
  • the HSCs can also be used in gene therapy, to express a fransgene in a recipient subject, taking advantage of their reduced immunogenicity and pluripotential properties.
  • the present invention provides for expanding stem or progenitor cells, particularly of the hematopoietic lineage.
  • the process generally includes obtaining hematopoietic cells that are enriched for hematopoietic stem and progenitor cells; for example lin- cells, and introducing them into a suitable growth medium.
  • the cells are maintained in culture and allowed to proliferate.
  • Differentiated cells and endogenous growth factors are removed, either continuously during culture or intermittently during the culture process, for example, through performing media exchange on the cells remaining in culture, and by targeted separation and removal of differentiated cells.
  • the remaining undifferentiated stem cells are cultured and allowed to proliferate further. Multiple cycles of culture and selection/media exchange are performed to expand the cells.
  • differentiated cells in various phases of lineage commitment can be selected and propagated further in accordance with the invention.
  • one or more hematopoietins can be added to the culture to force differentiation or lineage commitment. It is preferred that cell expansion and selection be performed in a completely controllable, environmentally closed-system, in accordance with FDA and other regulations governing the handling and processing of blood products, and to maintain sterility. These methods and a representative apparatus for performing this bioprocess, are discussed in detail below.
  • the bioprocess disclosed herein can be practiced as an open system or as a closed system as is illustrated in the Examples. Closed systems are generally sealed from the environment, and provide a more regulatable sterile microenvironment for the culture. Additional benefits to closed systems include increased safety for researchers and medical professionals in the handling of biological fluids. Current FDA and other administrative guidelines require closed systems for the handling and processing of blood cells and products designed to be used in humans, and are accordingly preferred.
  • the invention consists of one or more cell culture chambers, capable of receiving and containing a sample of cells.
  • the cell culture chambers may be substantially rigid, for example, as in the case of a cell culture flask or dish, or may be semi-rigid, for example, as in the case of a cell culture bag.
  • cell culture containers there are many types and kinds of cell culture containers (chambers) that are commercially available, such as those produced by Corning Costar. Suitable materials are ones that can withstand a variety of sterilization techniques including autoclaving and gamma irradiation and, for those components which directly contact cells, should also be biologically inert. Selection of an appropriate cell culture chamber is made in view of these and such other factors as the volume desired, transparency, gas diffusion, open or closed design, and the particular selection of the type and kind of chamber would be apparent to one of skill in the art in view of the teachings provided.
  • a currently preferred embodiment employs cell culture bags that are semi-permeable to oxygen gas and carbon dioxide gas, but substantially impermeable to water vapor and liquids such as cell culture media, thus ensuring no or little loss of growth medium during culture.
  • Fluorinated ethylene polymers exemplify material suitable for this purpose.
  • Other materials that are not gas permeable but meet the appropriate criteria include polypropylene, stainless steel and other medical grade materials, particularly polymers.
  • the cell culture chambers may include one or more ports, replaceable caps or covers, self-sealing septa such as rubber stoppers, valves, or similar means that allow the user to add or remove materials from the chamber without substantial exposure of the interior of the bioprocess to the external environment.
  • these mechanisms permit the cells, media and other components, such as antibodies and growth factors, to be introduced into the chamber, and permit removal of media, cells, endogenous soluble growth factors and the like, from the chamber, while maintaining an environmentally closed system.
  • Vents, regulators or other ports for attaching external gas (e.g., oxygen or air) or liquid (e.g., culture media) sources, or for attaching pumps or pressure devices, may be provided.
  • a first cell culture chamber is used for initial culture and expansion of cells.
  • a second cell culture chamber is used for subsequent expansion of the desired cells.
  • this embodiment includes a conduit, which provides a means for achieving fluid communication between the first cell culture chamber and the second cell culture chamber. Fluid transfer between the cell culture chambers, through the conduit, can be regulated by flow regulators, ports or valves, pumps or similar devices, as described above.
  • the conduit may include a selection element, which may be positioned within the lumen of the conduit, or which may be external.
  • a selection element may take the form of for example an enrichment matrix, such as microbeads contained inside the conduit, which have a specific affinity for a ligand, or have a specific charge, for example Affi-Gel beads with covalently bound anti-CD34 monoclonal antibody, or the like.
  • the selection element targets and selects cells having particular phenotypes , for example, those characteristic of differentiated cells.
  • One role of the selection element is to immobilize the differentiated cells to the selection surface, thereby reducing the number of differentiated cells in culture, and segregating them from undifferentiated cells.
  • a selection element may include beads having antibodies immunospecific to pan-differentiated hematopoietic cells, such as those manufactured by StemCell Technologies. Antibodies provide an excellent means for affinity separation of differentiated cells, because many antigenic markers for differentiated cells exist, and antibodies to these antigens are commercially available.
  • antibodies provide one means for targeted immunoseparation, and F(ab) or F(ab)2 fragments, Fv fragments, and bispecific antibodies (or fragments) can also be used, and the descriptions herein of cellular segregation with whole immunoglobulins is intended to be exemplary and non-limiting.
  • Cells can be separated by numerous other methods, such as FACS, lectin affinity, and other methods know in the art.
  • the selection element targets and selects cells having antigenic markers characteristic of undifferentiated hematopoietic stem cells, providing for their . removal from the heterogeneous culture. For example, a CD34 + expressing cell may be contacted with, and immobilized to an enrichment element having CD34 affinity.
  • the designations positive selection and negative selection will apply with respect to the particular cells targeted, the selection element used, and whether the selection element targets differentiated cells or undifferentiated cells, e.g., if the target cell is CD34 + and the selection element has affinity for CD34, then isolation of CD34 + cells is an example of positive selection; but if the target cell is CD34 + and the selection element has affinity for pan-differentiated hematopoietic cells, isolation of CD34 + cells by binding to the matrix and removal from the culture of differentiated cells provides an example of negative selection.
  • Segregation of differentiated cells from undifferentiated cells can be accomplished by many methods. Positive or negative selection methods are preferred. Selection can be accomplished in a particular location within the apparatus, such as within the conduit using a selection element, and cells can be segregated in one step, such as during passage through the conduit. Alternatively, segregation may take several steps. For example, bispecific antibodies are added to the cell culture along with a magnetic colloid, the bispecific antibodies having affinity for the magnetic colloid and for a lin+ antigen. This process effectively attaches a magnetic colloid to a lin+ cell. The magnetically labeled cells are passed through the conduit, which is itself placed in a magnetic field. Other modifications are described herein and will be apparent to those of skill in the art in view of the teachings provided. The segregation of undifferentiated cells and differentiated cells is thus believed to be routine.
  • the bioprocess described herein may employ a continuous process of growth and selection, or a discontinuous process of growth an selection.
  • a continuous process cells are cultured and selection of target cells (either positive selection or negative selection) is effectuated without removing the cells from media or otherwise interrupting the cell culture process.
  • a discontinuous process culture and selection proceed in a stepwise manner.
  • a modular closed system apparatus it may be more convenient to employ a discontinuous bioprocess since the chambers can be removed from the conduit and placed in an incubator . without having to keep the apparatus assembled.
  • Colony forming cells are progenitor cells that can be detected by the formation of erythroid, myeloid or mixed (i.e. both erythroid and myeloid) cell containing colonies after 2-3 weeks of culture in semi-solid media (meth cellulose).
  • Long-term culture-initiating cells are more primitive than CFCs and can be enumerated by their ability to give rise to CFCs after greater than 5-weeks of culture with stromal cells 57 ' 58 .
  • the stromal cell elements which are composed of mesenchymal cells including fibroblasts, endothelial cells, adipocytes and osteogenic cells, produce a variety of soluble factors that support the long-term proliferation and maintenance of LTC-ICs.
  • the sensitivity of this assay can be increased through the use of genetically engineered murine fibroblast (M2-10B4) cell lines that secrete factors known to enhance the detection and maintenance of LTC-ICs 59 ' 60 .
  • In vivo functional assays offer the best indication of the developmental potential of a hematopoietic cell population. This is because they directly test the potential for a stem cell population to contribute to the development or redevelopment of a particular organ, tissue or system following intravenous injection.
  • murine HSCs have been identified based on their ability to reconstitute hematopoiesis after transplantation into an im-tnunocompromised and hematologically compromised host.
  • Till and McCuUoch 61 first reported the existence of such a cell type when they injected syngeneic BM cells into irradiated mouse recipients and observed the formation of multi-lineage colonies in the spleen. Interestingly, these colonies contained cells that could form additional colonies upon transplantation into secondary hosts.
  • NOD/SCID mice 66 ' 67 While many animal models have been developed to detect the presence of human HSCs 62_65 , the most widely-used involves non-obese diabetic/severe combined immunodeficient (NOD/SCID) mice 66 ' 67 .
  • Cells capable of engrafting these recipients have been termed NOD/SCID-repopulating cells (SRCs) 68 and are considered to be human HSCs that home to and engraft the murine BM, where they subsequently proliferate and differentiate into multiple blood cell lineages 69 ' 70 .
  • SRCs NOD/SCID-repopulating cells
  • This assay has been successfully used with standard limiting dilution analysis (LD A) as a means to quantify HSC content in a given cell sample 1 .
  • LD A standard limiting dilution analysis
  • the present invention provides an apparatus and methods for the expansion of hematopoietic stem and progenitor cells used, for example in a therapeutic transplant to repopulate the blood of a mammal. Since these cells are relatively rare, a starting cell population is first obtained using methods known in the art. Blood, such as mobilized peripheral blood (PB) and bone marrow (BM) are suitable sources, but umbilical cord blood (UCB) provides an enriched source of these undifferentiated cells. Further enrichment of the hematopoietic stem or progenitor cell content from these sources can also be performed prior to culture, for example by purifying mononuclear cell (MNC) fractions.
  • MNC mononuclear cell
  • Isolation of more enriched populations of hematopoietic stem and progenitor cells can be accomplished using fluorescence-activated cell sorting, immobilization to glass wool, column separation or bead separation techniques, or other known methods of enrichment. Many suitable types are known in the art.
  • HSCs in culture are separated from inhibitory hematopoietins (through subpopulation selection and/or media exchange procedures) to prevent their differentiation and commitment to particular lineages.
  • Hematopoietins are a generic name given to hematopoietic growth factors (HGF) or hematopoietic cytokines, which act on cells of the hematopoietic system. These factors are active at all stages of development, and accordingly these hematopoietins will be removed from the bioprocess to prevent HSC differentiation.
  • HGF hematopoietic growth factors
  • cytokines hematopoietic cytokines
  • Hematopoietic growth factors are produced by many different cell types including those not belonging to the hematopoietic system. These factors are either secreted or they exist in membrane-bound or matrix-associated forms. They may have different modes of action also, such as autocrine, paracrine, or juxtacrine growth control. Production of hematopoietic factors is regulated strictly, i. e., they are synthesized by activated cells under certain conditions rather than being produced constitutively all the time. Many observations point to the existence of an ordered hierarchy and a concerted action of factors involved in the development of the hematopoietic system.
  • Cytokines interact with HSCs via three classes of transmembrane receptors; 1) those with intrinsic tyrosine kinase activity, 2) those that interact with the gpl30 subunit and 3) those that interact with Janus kinases (JAKs) 88 ' 89 .
  • JNKs Janus kinases
  • FL flk2/flt3 ligand
  • SCF stem cell factor
  • IL interleukin
  • SIL-6R IL-6/soluble IL-6-receptor
  • TPO thrombopoietin
  • IL-3 IL-1, IL-12, granulocyte- colony stimulating factor (G-CSF) and granulocyte- macrophage- colony stimulating factor (GM-CSF) 90 " 101 .
  • stroma-free cytokine supplemented cultures which contained IL-1, IL-3, IL-6, G-CSF, GM-CSF and SCF, supported a significant expansion (66-fold) of colony forming unit- granulocyte- macrophage (CFU-GM) progenitor cells 102 . Accordingly these hematopoietins can be introduced to the bioprocess to modulate differentiation of HSCs, or can be removed.
  • Some factors negatively regulate processes of hematopoiesis. For example, they may selectively inhibit the proliferation of some types of hematopoietic cells and may even induce cell death. For example, it has been shown that the addition of TGF- ⁇ to hematopoietic cell cultures directly inhibits the expansion of repopulating stem cells 103 , LTC-ICs 48 and primitive CFCs 104 55 but has no effect on more mature progenitors 105 . Similar is the finding that TGF- ⁇ preferentially inhibits the growth of CD34 + CD38" cells whereas more mature CD34 + CD38 + cells are poorly affected 106 .
  • TGF- ⁇ The functional effects of TGF- ⁇ have been attributed to its ability to prevent cells from progressing through the cell cycle. It has been shown that in the presence of TGF- ⁇ primitive cell populations (including CD34 + cells) are unable to transition from either Go to Gi or Gi to S phase presumably due to the up-regulation of the cyclin dependent kinase (cdk) inhibitors pl5, p27 and p21 31 ' 107 . Finally, TGF- ⁇ may also elicit some of its actions by down-regulating the expression of receptor types whose signaling is important for the in vitro growth of HSCs including c-kit 108 - 109 , c-mpl 10 ° and flt3/flk2 107 ' 110 . MlP-l ⁇ has been shown to inhibit the proliferation of primitive hematopoietic cells including CFU-GEMM and
  • MlP-l ⁇ has little effect, or even stimulatory effects, on more mature progenitors 116 suggesting that MlP-l ⁇ may be a pleiotropic factor.
  • IL-3 is another cytokine thought to have inhibitory functions.
  • IL-3 has been linked to the growth of primitive cells including LTC-ICs and CFCs, and is often found in cytokine combinations reported to be effective in expansion cultures 117 . Conversely, several studies have indicated that IL-3 can abrogate the expansion and self -renewal of primitive stem cells in a concentration dependent manner 118 and, in both human and murine models, IL-3 has been shown to impair the reconstituting ability of HSCs 35 ' 119 .
  • IL-3 may prevent HSCs from homing to the BM by impairing their chemotactic response to stromal derived factor-1 (SDF-1) through the CXCR4 receptor 120 , thereby resulting in the in vivo clearance and destruction of potential engrafting cells in non-hematopoietic tissues.
  • SDF-1 stromal derived factor-1
  • the presence of TNF- in cultures supplemented with stimulatory cytokines including SCF 121 and FL 34 ' 122 can potently inhibit the proliferation of progenitor cells, likely by promoting apoptosis 123 through Fas (a member of the TNF receptor family) signaling 124 .
  • stimulatory cytokines include monocyte chemoattractant protein (MCP)-l 52 and SDF-1 125 ' 126 .
  • MCP monocyte chemoattractant protein
  • hematopoietins generally need to be removed to prevent lineage commitment. Alternatively, they may be added to specific cultures to force lineage commitment. In contrast, certain hematopoetins can preserve the na ⁇ ve and undifferentiated state of CD34+ cells, and their addition to or enrichment in the bioprocess may improve yield. Modulation of hematopoietins in the bioprocess is thus considered within the abilities of one skilled in the art of the teachings provided herein.
  • Exemplary culture conditions for growing HSCs are given in the Examples, but generally in accordance with the invention, a sample of cells containing a subset of HSCs is first obtained then cultured. The cultured cells are then maintained for a growth period suitable for allowing proliferation to occur, which may include media exchanges to remove soluble growth factors, after which time the HSCs are segregated from the other differentiated cells. The HSCs are then allowed to proliferate again as described. The segregation of differentiated cells can be performed again if necessary. At the end of the culture period the expanded HSCs can be preserved by freezing after addition of, for example glycerin, DMSO or a suitable cryopreservative, or used directly in a therapeutic procedure. It is important to note that the above steps can be performed with the entire bioprocess apparatus assembled or in separate parts in which cell culture is carried out independent of cell segregation.
  • Clinical uses for HSCs include, for example, the therapeutic treatment of blood cancers treatment of anemia, treatment of hereditary blood disorders, replenishment of blood cells following high dose radiation and chemotherapy in the treatment of cancer, graft-versus-tumor treatment of cancer, treatment of autoimmune disorders, and in gene therapy approaches.
  • hematopoietic cells are first destroyed by high dose radiation and chemotherapy.
  • a matched donor (having similar HLA profiles) provides the source of transplantable HSCs, which are isolated and expanded according to the methods provided herein.
  • the transplant of undifferentiated cells provides for long term repopulation of the blood of the recipient.
  • Non-cancerous blood disorders amenable to treatment by HSC therapy include aplastic and other types of anemia.
  • the minimum cell dose for UCB transplants be 3.7 x 10 7 MNC/kg 127. Because typical UCB collections contain an average of approximately 1.4 x 10 9 MNC (Cairo, Blood, 1997, 90:4665), it was calculated that an average cord blood sample would be sufficient to transplant a patient weighing a maximum of approximately 37 kg ( ⁇ 81 lbs). Using similar calculations, it was reported that 75% of the greater than 4000-banked samples at the Toronto Umbilical Cord Blood Bank contain only enough cells to be useful for pediatric bone marrow transplantations (i.e. patients weighing ⁇ 24 kg or ⁇ 53 lbs) 130 .
  • HSCs in order for these, and other banked samples to be a useful source of HSCs for single or multiple adult transplants, or for multiple tissue regeneration therapies, their HSC content must be increased.
  • the ex vivo expansion of HSCs described herein provides such a provides a solution.
  • the bioprocess can also be used to expand undifferentiated cells from adult sources, for example a donor provides his or her own bone marrow or peripheral blood, thus eliminating immune mismatch in the event of a transplant of these cells back to the donor.
  • the bioprocess can be used to expand pluripotential hematopoietic cells that are allogeneic but not immunogenic, and thus suitable for transplant purposes.
  • the bioprocess may be used to express a therapeutic protein from the undifferentiated cells, which have been genetically modified ex vivo to incorporate a fransgene encoding the therapeutic protein.
  • the hematopoietic cells are obtained, transfected with the fransgene, and expanded in culture as described. Differentiated cells are removed from culture, and the undifferentiated cells are assayed for expression of the fransgene. Cells positively expressing the fransgene are transplanted into a mammal. The low immunogenicity of stem cells makes this cell type well-suited for gene therapy.
  • the bioprocess can be used by commercial and non-profit blood banking organizations, to expand a subpopulation of undifferentiated cells, e.g., lin-, CD133+, CD34+, long-term repopulating NOD/SCID and other undifferentiated cells, that can later be frozen and stored, or used in a transplant procedure.
  • a donor may provide the sample of cells, or a patient about to undergo a medical procedure may provide the source of cells that will be expanded. In the latter case, the cells are a perfect immunological match for the recipient.
  • Commercial methods of storing, processing and providing undifferentiated are thus included within the scope of this invention.
  • UCB samples were collected from consenting donors according to the procedures accepted by the ethics board of Mt. Sinai Hospital (Toronto, ON, Canada) and centrifuged over 10% pentastarch (Bristol-Myers Squibb Canada, Montreal, QC, Canada) to obtain the mononuclear cell (MNC) fraction.
  • MNC mononuclear cell
  • Lineage depleted (lin-) cells were isolated from the MNC fraction using the StemSepTM system according to the manufacturers protocol (Stem Cell Technologies, Vancouver,
  • MNCs were collected in Hanks Buffered Saline Solution (HBSS; Gibco, Rockville, MD) containing 2% human serum (HS) at a concentration of 50 x 10 6 cells/ml.
  • the selection antibody cocktail was then added at a concentration of 100 ⁇ l/ml cell suspension.
  • the antibody cocktail used removes cells expressing CD2, CD3, CD14, CD16, CD19, CD24, CD56, CD66b, and glycophorin A.
  • the cells were then incubated for 15 min at room temperature (RT) after which time a magnetic colloid was added at a concentration of 60 ⁇ l/ml cell suspension. The cells were then allowed to incubate an additional 15 min at RT.
  • the bioprocess apparatus was assembled using the following procedure:
  • the enrichment beads (Stem Cell Technologies) were then placed in the tubing until they filled a lengtn or approximately 1" after which the second screen was inserted into the tubing to hold the beads in place. These beads aid in the magnetic separation of cells as described above. 1/8" male luer fittings (Cole-Parmer) were then placed into each end of the tubing to which were attached two threaded lock cannulas (American Fluoroseal Corporation). The cannula mates with the self-sealing rubber septums for sterile filling, sampling or emptying of culture bags. This selection element is also referred to as the 'enrichment element'.
  • bioprocess The entire assembled product in its entirety is now called the "bioprocess apparatus" or “bioprocess”.
  • bioprocess can be used entirely assembled or in discontinuous sections, thus permitting cell culture to be performed separately from cell segregation.
  • the use of the bioprocess as a single assembled product would require that a three-way stopcock (Cole-Parmer) be placed between one of the culture bags and the tubing.
  • the stopcock would facilitate filling of the culture bag with cells and growth medium.
  • the sterile septum would be attached to the stopcock inlet port.
  • Lin" cells were seeded at 1 x 10 5 cells/ml in StemSpanTM media (Stem Cell Technologies) containing Iscove's MDM, 1% BSA, 10 ⁇ g/ml rh insulin, 200 ⁇ g/ml human transferring, 10" 4 M 2-mercaptoethanol and 2 mM L-glutamine.
  • the media was supplemented with 100 ng/ml SCF (Amgen, Thousand Oaks, CA), 100 ng/ml FL (Amgen) and 50 ng/ml TPO (R&D Systems, Minneapolis, MN).
  • Lin- cells were seeded at 1 x 10 5 cells/ml in StemSpanTM media (Stem Cell Technologies) containing Iscove's MDM, 1% BSA, 10 micrograms/ml rh insulin, 200 micrograms/ml human transferrin, 10" 4 M 2-mercaptoethanol and 2 mM L- glutamine.
  • the media was further supplemented with 100 ng/ml SCF (Amgen), 100 ng/ml FL (Amgen) and 50 ng/ml TPO (R&D Systems).
  • Approximately 2-3 ml of the cell suspension was then injected into a 3 ml culture bag (through the septum) using a sterile syringe attached to a threaded cannula.
  • the culture bag and cell contents were then maintained at 37°C in a humidified atmosphere of 5% CO2 in air. Re- selection after 4-days in culture (i.e. to remove lin+ cells generated during culture) was performed as described.
  • Lin cell selection in the bioprocess was performed. Incubation of the cells with antibody cocktail and magnetic colloid was carried out inside the culture bag with the cells remaniing in growth medium. The antibody cocktail and magnetic colloid were used at half the amounts suggested by the manufacturer. Following these steps, the cells were then allowed to flow through the enrichment element (either by directing flow via the stopcock or by attaching the bag to the enrichment element via septum/cannula mating). For flow rate experiments, a peristaltic pump was adapted to the primary cell culture container. Similar to the StemSepTM system, the conduit having an enrichment element was placed in an external magnetic field prior to separation. Upon passing through the conduit, and thus the enrichment element, the now purified lin" cells flow into the second culture chamber and were collected for further processing.
  • Media exchange can be performed on enriched lin" cells in the culture bags. Briefly, the cells are centrifuged by placing the culture bag into a 15 or 50 ml conical centrifuge tube (tissue paper can be used to stabilize the bag and prevent the bag from collapsing). The tube is then centrifuged for 5 min at approximately 1000 rpm after which time a cell pellet is visible at the bottom of the culture bag. The media is then carefully removed through the self-sealing septum using a sterile syringe. Care must be taken to prevent cells from being removed. Fresh media is then added through the same septum. This process can be adapted for automated media exchange.
  • Phenotypic analysis was performed using flow cytometry.
  • CD34, CD38, CD19 and CD33 expression was analyzed by first collecting and washing cells in ice cold HBSS containing 2% HSA (HBSS-HS). 5 x 10 4 to 100 x 10 5 cells were then resuspended in 100 ⁇ l HBSS-HS containing saturating amounts of the appropriate antibodies or isotype controls for 30 min on ice. Stained cells were then washed using HBSS-HS and resuspended in a 10% formalin solution (Fisher, Nepean, ON, Canada). Fixed cells were then analyzed immediately using flow cytometry or placed at 4°C for later analysis. CD45 and HLA-abc expression was assessed as described below.
  • Flow cytometric analysis was performed using a Coulter EPICS XL with 4-Color Expo software or a Coulter EPICS Elite with Elite software (Beckman Coulter, Miami, FL).
  • CD34, CD38, CD19, CD33, CD45 and HLA-abc expression was assessed using anti-CD34-PE, anti-CD38-FITC, anti-CD19-PE, anti-CD33-PE, anti- CD45-PE/FITC and anti-HLA-abc-FITC (Beckman Coulter).
  • Isotype controls were tested using anti-IgGi-PE, anti-IgGi-FITC and anti-IgG2a-FITC (Beckman Coulter).
  • Non-cultured or post-cultured cells were assayed for CFC content by plating 500 cells into methylcellulose media (MethoCultTM, Stem Cell Technologies) containing 1% methylcellulose in Iscove's MDM, 30% FBS, 1% BSA, 10"4 M 2- mercaptoethanol, 2 mM L-glutamine, 50 ng/ml rhSCF, 10 ng/ml rhGM-CSF, 10 ng/ml rhIL-3 and 3 units/ml rhEPO. After 14 days of incubation, duplicate or triplicate cultures were scored for CFC content and frequency.
  • LTC-IC assays were performed by initially seeding 2000 cells on to irradiated human stromal cells (M2-10B4) in 6-well plates. Cell were allowed to incubate for 5 weeks at 37°C with weekly half media exchanges using MyeloCultTM media (Stem Cell Technologies) containing alpha-MEM, 12.5% HS, 12.5% FBS, 0.2 mM inositol, 20 micromolar folic acid, 10" 4 M 2-mercaptoethanol, 2 mM L-glutamine, and 10" 6 M freshly dissolved hydrocortisone. After 5-weeks, the entire contents of each well were harvested by trypsinization and plated into methycellulose media (see above). LTC-IC content and frequency was then determined by analysis of CFCs present after 14-days.
  • Either fresh lin" cells or the progeny of lin" cells grown using the culture conditions described were transplanted into sublethally irradiated (3.6 Gy) 8-10 week old NOD/SCID mice using either intravenous (to test for LT-SRCs) or intrafemoral (to test for R-SRCs) injection.
  • NOD/SCID mice received transplants of either fresh lin" cells or the progeny of lin” cells grown using the bioprocess (see above).
  • intravenous studies cells were introduced via a standardized tail vein injection method as previously reported 71 .
  • the mice were first anesthetized using a 2.5 % avertin solution. The right knee was then bent and 25 ⁇ l of the cell sample was injected through the knee joint directly into the BM cavity of the right femur 131 .
  • mice were sacrificed and the bone marrow from the right and left femurs were collected and analyzed for human cell engraftment.
  • the bone marrow from mice receiving cells IV were pooled prior to analysis, while the bone marrow samples from mice undergoing IF transplants were analyzed separately.
  • Erythrocytes were removed using ammonium chloride lysis (Stem Cell Technologies) and human engraftment was determined by suspending cells in 100 microliters of HBSS-HS and incubating with saturating amounts of CD45/HLA-abc antibodies or isotype controls for 30 min on ice.
  • TGF-beta and MlP-l ⁇ mRNA expression was determined using RT-PCR. Briefly, total cellular mRNA was collected by lysing cells in 500 ⁇ l Trizol Reagent (Invitrogen, Groningen, The Netherlands) for 5 min followed by addition of 100 ⁇ l chloroform. After centrifugation at 12,000 g for 15 min, the aqueous phase was collected and mixed with isopropanol to precipitate the mRNA. The mRNA pellet was then obtained by centrifugation at 12,000 g for 10 min, washed in 70% ethanol and re-suspended in sterile water. mRNA concentration was then determined using a microQuant plate reader (Biotek Instruments, Winooski, VT).
  • Synthesis of mRNA into cDNA was performed by mixing 1-5 ⁇ g of total mRNA with 1 microliter oligo-dT and sterile water to a final volume of 12 microliters in a microcentrifuge tube. The mixture was then heated to 70°C for 10 min and quickly chilled on ice.
  • a lOmM dNTP mix 10 mM each dATP, dGTP, dCTP and dTTP
  • PCR was performed by mixing 2 microliters of the cDNA solution with 23 microliters of a solution containing 10 microliters lOx PCR buffer, 2-3 microliters 50 mM MgC >, 1 microliter 10 mM dNTP mix, 1 microliter sense primer (25 micromolar), 1 microliter anti-sense primer (25 micromolar), 1 microliter Tac j polymerase (5U/ml) and 80 ml autoclaved water (Invitrogen).
  • the PCR reaction was carried out using optimized reagent concentrations and temperatures that were specific to the primer of choice.
  • the primers used were as follows:
  • TGF-beta/sense GCGACTCGCCAGAGTGGTTAT, SEQ ID NO:l
  • TGF-beta/anti-sense ATAGTTGGTGTCCAGGGCTCG, SEQ ID NO:2
  • MIP-1 alpha/anti-sense ATCATGTTTGAGACCTTCAA, SEQ ID NO:4.
  • PCR products were then analyzed by running samples on a 1% agarose gel, staining with an ethydium bromide solution and visualizing bands under a UV source.
  • TGF-beta and MIP-1 alpha were measured using Quantikine ELISA Kits (R&D Systems, Minneapolis, MN). Both were done according to the manufacturer's protocols. The amount of protein in each sample was determined by comparison to a standard curve. Data acquisition and analysis was done using a VERSAmax microplate reader (Molecular Devices, Sunnyvale, CA). 12. STATISTICAL ANALYSIS
  • the cells were then allowed to grow for 4-days after which time they were subjected to subpopulation selection (to remove any lin + cells generated during the first 4 days of culture).
  • the cells cultured in the 24-well plate were enriched using the standard StemSepTM column and protocol. After selection, the cells were then allowed to grow undisturbed for an additional 4-days.
  • Figures 2 and 3 show the kinetic growth profiles for the various cell types, normalized to a starting cell sample of 150,000 (i.e. the number of input cells in 1 well of a 24-well plate), and the overall expansion of the cells compared to input numbers, respectively.
  • the results of these studies have shown that the bioprocess can be used to grow total cells, CD34 + cells, CD34 + CD38" cells and CFCs with expansions equivalent to, if not greater than, those obtained using standard culture dishes. Cells grown using the bioprocess also maintain similar functional and phenotypic characteristics as those cells grown in standard culture dishes.
  • the data also shows that expansion of total and progenitor cell types can be maintained in the bioprocess over at least an 8-day culture period with minimal cell death (assayed using trypan blue dye exclusion).
  • these results demonstrate that the selection element and overall selection process (i.e. cells exiting and entering culture bags, flow through tubing, etc.) do not have a negative affect on overall cellular growth.
  • TGF- ⁇ l The production of TGF- ⁇ l was found to be significantly affected by subpopulation selection. Analysis of TGF- ⁇ l secretion rates (on a per cell basis) demonstrated that subpopulation selection resulted in a significantly lower secretion rate regardless of whether or not media exchange was performed or not (Fig. 5A). This implies that the selection process removes a population(s) of cells which generate and secrete TGF- ⁇ l in vitro. In order to confirm this finding, lin+ cells were specifically analyzed for their ability to express and secrete TGF- ⁇ l. In these studies lin + cells were collected either from the selection column (i.e. cells which were retained in column) or by FACS sorting.
  • umbilical cord blood has been established as an important source of hematopoietic stem cells (HSCs) for use in bone marrow transplantation (BMT) therapies to reconstitute hematopoiesis in patients with hematological and non-hematological disorders 134 ' 135 .
  • HSCs hematopoietic stem cells
  • BMT bone marrow transplantation
  • the advantages of using UCB include low incidences of graft- versus-host disease (GvHD), lack of risk to the donor, lack of donor attrition, and low viral transmission from donor to patient 137 .
  • UCB cells can be cryopreserved and selected without loss of HSC number and proliferative capacity, thus providing the potential for cord blood banking as a means to augment the donor pool 138 .
  • a suitable process for production of undifferentiated cells for transplant must carefully consider both the efficacy and safety of the cellular product to be administered to the patient.
  • these processes should also meet the standards outlined by the Food and Drug Administration (FDA) which include the requirement for the system to be closed (i.e. no exposure to the environment or environmental contaminants), that the process be designed with biocompatible materials and that the process be sterile, sterilizable and pyrogen free (FDA, 2003).
  • FDA Food and Drug Administration
  • Single-use bioprocesses ensure low incidences of cell contamination as they avoid repeated use. Closed-system culture configurations that meet these requirements for expanding HSCs for transplant include culture chambers of gas permeable bags 148 , stirred/spinner flasks 149 ' 150 and flat bed perfusion bioreactors 151
  • the bioprocess is capable of expanding UCB derived hematopoietic stem and progenitor cells including CFCs, LTC-ICs and long-term non-obese diabetic/severe combined immunodeficient (NOD/SCID) repopulating stem cells (LT-SRCs).
  • UCB derived hematopoietic stem and progenitor cells including CFCs, LTC-ICs and long-term non-obese diabetic/severe combined immunodeficient (NOD/SCID) repopulating stem cells (LT-SRCs).
  • NOD/SCID non-obese diabetic/severe combined immunodeficient repopulating stem cells
  • the bioprocess described consists of two cell culture chambers, more particularly culture bags and a subpopulation selective element, which is responsible for removing mature blood cells (lin+) from culture.
  • the selection element comprises a conduit having a tube containing stainless steel beads and connects the two culture chamber bags to form the system ( Figure 7A).
  • the bioprocess design is modular such that each component can be separated without exposing cell contacting areas (i.e. within the selection element and cell culture bags) to outside environmental contaminants.
  • the bioprocess is a single-use system, which makes it attractive for clinical applications as the risk of cell contamination due to repeated use is removed.
  • the application of the bioprocess involves first introducing UCB derived lineage depleted (lin-) undifferentiated cells into the primary cell culture bag through a sterile self -sealing rubber septum. The cells are then maintained in culture and after a specified time lin+ undifferentiated cells, which are generated during culture, are removed. This is accomplished by linking lin+ undifferentiated cells to dextran coated iron particles and subsequently allowing them to flow through the selection element. The selection element is placed in an external magnetic field, which allows the particle labeled cells to be retained in the selection element. Flow rates are established using gravity.
  • the enriched lin- cell population that flows through the selection element is then channeled into the secondary culture bag where media dilution/exchange is performed by centrifuging the container, removing spent media through a sterile self -sealing rubber septum and re- introducing fresh media through the same septum.
  • the cells are then allowed to proliferate. Additional segregation and media exchange may be performed.
  • Other methods of lin+ cell depletion can be envisioned including chemical targeting of lin+ cells, centrifugal elutriation, electromagnetic separation, or other methods described in the literature.
  • the input cell numbers ranged from 1.1 x 10 6 - 3.5 x 10 6 for the bioprocess and 1.7 x 10 6 - 3.5 x 10 6 for the StemSepTM column. Cells were stained for the presence of lin+ markers both pre- and post- selection.
  • UCB lin- cells were subjected to 8-day cultures in which cells were exposed to the subpopulation selection and media dilution/exchange processes at day 4.
  • Phenotypic as well as in vitro functional assays were used to quantify the expansion of total cells and progenitor cells including CD34+ cells, CD34+CD38- cells, CFCs and LTC-ICs at input as well as on days 4 and
  • Table 1 Experiments showing the extent of non-specific cell loss occurring though the subpopulation selection element.
  • Percent cell loss is calculated by first taking the difference between the theoretical number of cells that should pass through the selection element [i.e. total input cell number - (total input cell number * % lin + cells)] and the actual number of cells exiting the selection element, dividing this value by the theoretical number of cells and multiplying by 100.
  • Table 2 Effects of flow rate on yield and purity of lin- cells exposed to the subpopulation selection process.
  • HSC HSC in vitro
  • subpopulation selection i.e. removal of lin+ cells from culture
  • media exchange strategies to reduce the concentration of inhibitory factors in culture
  • the results of studies with the closed-system bioprocess show that the bioprocess supports the expansion of UCB derived stem and progenitor cells including CD34+ cells, CD34+CD38- cells, CFCs, LTC-ICs and LT-SRCs.
  • the subpopulation selection element was shown to efficiently remove contaminating lin+ cells from culture.
  • the selection element While the main function of the selection element is to remove differentiated lin+ cells from culture, it is also general in its use such that any cell type with a characteristic phenotype can be removed. This characteristic makes the bioprocess versatile for use in a variety of alternative applications.
  • donor T cells are responsible for the onset of graft-versus-host disease (GvHD) (Ho et al., 2001). It has been suggested that the removal of subsets of donor T cells including those expressing CD8 can reduced the incidence of acute GvHD in patients undergoing allogeneic stem cell transplantation (Baron et al., 2002).
  • the bioprocess incorporates simple cell selection processing based on cell surface phenotype, it is possible to generate a culture strategy whereby contaminating T cells are concomitantly removed during culture. In this manner, the resulting cell graft generated using the bioprocess would not only be enriched for repopulating stem cells but also devoid of cells responsible for GvHD, increasing the probability for successful long-term engraftment.
  • CD34+ obtained from different UCB and bone marrow samples is highly variable (De Bruyn et al., 1997; Koller et al., 1996). Therefore, the bioprocess is able to conform to samples that may have high proliferative potentials, in which case it may be necessary to transfer cells into larger volume bags. The ability to control the flow of cells in the bioprocess from one bag to another (i.e. through the selection element) under closed conditions would make this possible. The versatility of the bioprocess regarding these issues allows the culture of cord blood samples with highly variable cell numbers and growth potentials to be cultured in a standardized process.
  • the closed-system bioprocess described herein is capable of efficiently and robustly expanding hematopoietic stem and progenitor cells. As such, it should prove to be a valuable tool for the development, implementation and success of clinical transplantation therapies requiring these types of cells.
  • samples are collected, e.g., in a 250 ml Baxter collection bag by gravity flow. Collection is initiated within 15 minutes of delivery (or on an undelivered placenta). Samples are collected and stored temporarily at 25°C with no drop off in viability, for example, samples are stored for up to 72 hours before processing, and decrease in total cell viability, as assessed by FACS, is negligible.
  • processing stage samples are mixed with pentastarch by methods known in the art for cell enrichment. Processing stage samples can also be spun without addition of starch or Ficoll (12 min. spin) and may be processed directly in bags. Sample are frozen with DMSO. The NYBC thawing process is also useful. It is not necessary to culture the cells overnight. RBCs are lysed by ammonium chloride. Cells are run through a StepSep column with all washes in HANKS buffer or PBS buffer and at a temperature from about 4 degrees Celsius to about 37 degrees Celsius.
  • Cells are cultured for 2 to 7 days (preferably 4 days) in serum-free medium plus growth factors, for example SCF [about lOOng/ml], TPO [about 50ng/ml], Flt-3L [about 100ng/ml].
  • Cells are run through a StepSep column with all washes in HANKS buffer or PBS buffer from about 4 degrees Celsius to about 37 degrees Celsius.
  • Cells are cultured from about 2 to about 7 days (preferably 4 days) fresh serum-free medium plus growth factors: SCF (about lOOng/ml), TPO (about 50ng/ml), Flt-3L (about lOOng/ml).
  • Phenotypic analysis is performed, for example FACS detection of CD34 or CD38 expressing target cells or other such markers.
  • In vitro detection and activity assays include CFC or LTC-IC.
  • hi vivo detection and activity assays are mouse NOD-SCID or IF.
  • RBC depletion is typically performed before freezing. Growth periods are preferably 4 day cycles plus media exchange. A rest period is not typically required.
  • the claimed bioprocess apparatus and methods provide a methodology to expand hematopoietic stem or progenitor cells, based on cell enrichment and media exchange, in a controllable, closed-system.
  • the bioprocess performs in an equivalent, if not better, manner when compared to standard systems known in the art (i.e. culture dishes).
  • standard systems known in the art i.e. culture dishes.
  • the built-in cell enrichment process has been shown to be as efficient as commercially available columns in removing lin + cells from culture, and media exchange can easily be performed without cell loss.
  • Umbilical cord blood (UCB) derived hematopoietic stem cells (HSCs) provide a therapeutically efficacious source of cells to treat a variety of hematological disorders 134 ' 135 .
  • UMB umbilical cord blood
  • HSCs hematopoietic stem cells
  • Effective HSC expansion represents an attractive solution, however this goal has remained elusive despite >20 years of experimentation in animal models and human clinical trials 147 .
  • Even the seemingly attainable goal of using culture - generated progenitors to shorten neutrophil and platelet recovery times in patients following myeloablative chemotherapy 143 45 has been generally ineffective 147 .
  • Hematopoietic progenitor and mature blood cell populations secrete regulatory proteins whose actions are known to inhibit HSC proliferation and/or induce stem cell differentiation 21 , 22 , 2 4,27,158 ⁇ h US/ i 1S likely that the generation of these cells due to induced or "background" differentiation, which typically occurs during all stem cell culture, and their secreted products limits HSC expansion in vitro.
  • stem cell differentiation 21 , 22 , 2 4,27,158 ⁇ h US/ i 1S likely that the generation of these cells due to induced or "background” differentiation, which typically occurs during all stem cell culture, and their secreted products limits HSC expansion in vitro.
  • the effects of these endogenously secreted negative regulators are currently under investigated.
  • the secretion of such factors represents a feedback control mechanism through which differentiated blood cells can significantly affect the proliferative status of HSCs.
  • the global control of negative regulator production represents a simple means to overcome the block to HSC expansion observed in vitro.
  • GCM global culture manipulation
  • lin" UCB cells were subjected to 8-day cultures under four different conditions. In the first condition cells remained unmanipulated during the 8-day culture period ( Figure 12, NS/NE). For the second and third conditions, lin" cells were initially grown for 4-days and then subjected to either subpopulation selection ( Figure 12, S/NE) or media dilution ( Figure 12, NS/E) respectively. Subpopulation selection removed lin + cells (mature blood cells) generated during the first 4-days of culture.
  • the fourth condition underwent both subpopulation selection and media dilution at day 4 ( Figure 12, S/E).
  • phenotypic and functional assays were performed to test the impact of GCM on the expansion of total cells, CD34 + cells, CD34 + CD38" cells, CFCs and LTC-ICs. All cultures were grown in the same medium supplemented with the same growth factors (SCF, FL and TPO) in order to isolate the effects of the individual manipulation.
  • the calculated frequencies of migrating R-SRCs in fresh lin" cells and in the S/E expanded progeny were 1/89700 (95% confidence interval, 1/43500 - 1/217000) and 1/291900 (1/198200 - 1/452400) respectively.
  • subpopulation selection and media dilution supported a 12.1-fold expansion of migrating R-SRCs above input values.
  • TGF- ⁇ l and MlP-l ⁇ were expressed and secreted by cells during culture.
  • Other inhibitory factors including tumor necrosis factor (TNF)- ⁇ , interleukin (IL)-3 and stromal derived factor (SDF)-l were below the sensitivity of detection.
  • the secretion rate (on a per cell basis) of TGF- ⁇ l was found to be significantly lower in conditions that underwent subpopulation selection, regardless of whether media dilution was performed or not, resulting in an overall decrease in the concentration of TGF- ⁇ l in culture supernatants (Figure 17a).
  • Control cultures produced TGF- ⁇ l at a rate of 21.8 x 10" 6 ⁇ 1.1 x 10" 6 pg/cell/hr (bulk concentration: 2297 ⁇ 426 pg/ml) while cultures undergoing subpopulation selection alone (S/NE) or subpopulation selection and media dilution (S/E) resulted in values of 13.0 x 10" 6 ⁇ 1.4 x lO" 6 (bulk concentration: 1528 ⁇ 167 pg/ml) and 13.0 x 10" 6 ⁇ 1.7 x 10" 6 (bulk concentration: 1002 ⁇ 281 pg/ml) pg/cell/hr respectively.
  • MlP-l ⁇ production was unaffected by subpopulation selection but was significantly impacted by media dilution.
  • N/E media dilution alone
  • S/E media dilution plus subpopulation selection
  • MlP-l ⁇ was secreted at a rate of 3.3 x 10" 6 ⁇ 0.8 x 10- 6 (bulk concentration: 206 ⁇ 36 pg/ml), 0.5 x 10" 6 ⁇ 0.2 x 10" 6 (bulk concentration: 70 ⁇ 30 pg/ml) and 0.5 x 10 "6 ⁇ 0.2 x 10" 6 (bulk concentration: 53 ⁇ 13 pg/ml) pg/cell/hr respectively (Figure 17c).
  • Endogenous production of negative regulators acts as a feedback control mechanism that limits HSC proliferation in vitro.
  • these negative regulators can be produced: 1) secretion by differentiating cells (e.g., TGF- ⁇ l) and 2) stimulation of cells by culture conditioned media (e.g., MlP-l ⁇ ).
  • the GCM strategies i.e. subpopulation selection and medium dilution
  • these migrating cells may represent a more primitive cell population than those cells that are only capable of engrafting the transplant site. To our knowledge, this is the first reported use of this assay to quantify the expansion of stem cells that have this unique migratory ability.
  • TGF-(beta)l maintains hematopoietic immaturity by a reversible negative control of cell cycle and induces CD34 antigen up-modulation. J Cell Sci 113, 383-90 (2000).
  • Cashman, J. D., Eaves, C. J., Sarris, A. H. & Eaves, A. C. MCP-1, not MlP-lalpha, is the endogenous chemokine that cooperates with TGF-beta to inhibit the cycling of primitive normal but not leukemic (CML) progenitors in long-term human marrow cultures. Blood 92, 2338-44. (1998).
  • CD34+AC133+ cells isolated from cord blood are highly enriched in long-term culture-initiating cells, NOD/SCID-repopulating cells and dendritic cell progenitors. Stem Cells 16, 387-96 (1998).
  • TGF-beta transforming growth factor beta
  • CD34high cells can be separated into KIThigh cells in which transforming growth factor-beta (TGF-beta) downmodulates c-kit and KITlow cells in which anti-TGF-beta upmodulates c-kit.
  • TGF-beta transforming growth factor-beta
  • Tumor necrosis factor-alpha inhibits stem cell factor- induced proliferation of human bone marrow progenitor cells in vitro. Role of p55 and p75 tumor necrosis factor receptors. J Clin Invest 94, 165-72. (1994).
  • TGF-beta transforming growth factor beta
  • PDGF platelet-derived growth factor

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Sustainable Development (AREA)
  • Clinical Laboratory Science (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/IB2004/001724 2003-05-02 2004-05-03 Apparatus and methods for amplification of blood stem cell numbers Ceased WO2004096975A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA2565581A CA2565581C (en) 2003-05-02 2004-05-03 Apparatus and methods for amplification of blood stem cell numbers
JP2006506626A JP2006525013A (ja) 2003-05-02 2004-05-03 血液幹細胞の数の増幅のための装置および方法
AU2004234627A AU2004234627A1 (en) 2003-05-02 2004-05-03 Apparatus and methods for amplification of blood stem cell numbers
EP04730899A EP1641911A2 (en) 2003-05-02 2004-05-03 Apparatus and methods for amplification of blood stem cell numbers
US10/555,604 US7795024B2 (en) 2003-05-02 2004-05-03 Apparatus and methods for amplification of blood stem cell numbers

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US46758903P 2003-05-02 2003-05-02
US60/467,589 2003-05-02
US55483304P 2004-03-19 2004-03-19
US60/554,833 2004-03-19
US55742604P 2004-03-29 2004-03-29
US60/557,426 2004-03-29

Publications (2)

Publication Number Publication Date
WO2004096975A2 true WO2004096975A2 (en) 2004-11-11
WO2004096975A3 WO2004096975A3 (en) 2005-03-10

Family

ID=33425192

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2004/001724 Ceased WO2004096975A2 (en) 2003-05-02 2004-05-03 Apparatus and methods for amplification of blood stem cell numbers

Country Status (7)

Country Link
US (1) US7795024B2 (enExample)
EP (1) EP1641911A2 (enExample)
JP (1) JP2006525013A (enExample)
AU (1) AU2004234627A1 (enExample)
CA (1) CA2565581C (enExample)
SG (1) SG150387A1 (enExample)
WO (1) WO2004096975A2 (enExample)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120258538A1 (en) * 2009-09-10 2012-10-11 Keio University Culture method for hematopoietic stem cells
US11248238B2 (en) 2015-10-22 2022-02-15 Juno Therapeutics Gmbh Methods, kits, agents and apparatuses for transduction
US11274278B2 (en) 2014-04-16 2022-03-15 Juno Therapeutics Gmbh Methods, kits and apparatus for expanding a population of cells
US11400115B2 (en) 2014-04-23 2022-08-02 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
US11608486B2 (en) 2015-07-02 2023-03-21 Terumo Bct, Inc. Cell growth with mechanical stimuli
US11613727B2 (en) 2010-10-08 2023-03-28 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11624046B2 (en) 2017-03-31 2023-04-11 Terumo Bct, Inc. Cell expansion
US11629332B2 (en) 2017-03-31 2023-04-18 Terumo Bct, Inc. Cell expansion
US11634677B2 (en) 2016-06-07 2023-04-25 Terumo Bct, Inc. Coating a bioreactor in a cell expansion system
US11667876B2 (en) 2013-11-16 2023-06-06 Terumo Bct, Inc. Expanding cells in a bioreactor
US11667881B2 (en) 2014-09-26 2023-06-06 Terumo Bct, Inc. Scheduled feed
US11685883B2 (en) 2016-06-07 2023-06-27 Terumo Bct, Inc. Methods and systems for coating a cell growth surface
US11795432B2 (en) 2014-03-25 2023-10-24 Terumo Bct, Inc. Passive replacement of media
US11851678B2 (en) 2017-08-09 2023-12-26 Juno Therapeutics, Inc. Methods for producing genetically engineered cell compositions and related compositions
US11866465B2 (en) 2017-04-27 2024-01-09 Juno Therapeutics Gmbh Oligomeric particle reagents and methods of use thereof
US11913024B2 (en) 2015-10-22 2024-02-27 Juno Therapeutics Gmbh Methods for culturing cells and kits and apparatus for same
US11965175B2 (en) 2016-05-25 2024-04-23 Terumo Bct, Inc. Cell expansion
US12043823B2 (en) 2021-03-23 2024-07-23 Terumo Bct, Inc. Cell capture and expansion
US12066365B2 (en) 2012-02-23 2024-08-20 Juno Therapeutics Gmbh Chromatographic isolation of cells and other complex biological materials
US12152699B2 (en) 2022-02-28 2024-11-26 Terumo Bct, Inc. Multiple-tube pinch valve assembly
US12234441B2 (en) 2017-03-31 2025-02-25 Terumo Bct, Inc. Cell expansion
US12258580B2 (en) 2017-11-01 2025-03-25 Juno Therapeutics, Inc. Process for generating therapeutic compositions of engineered cells
USD1099116S1 (en) 2022-09-01 2025-10-21 Terumo Bct, Inc. Display screen or portion thereof with a graphical user interface for displaying cell culture process steps and measurements of an associated bioreactor device
US12516099B2 (en) 2018-08-09 2026-01-06 Juno Therapeutics, Inc. Processes for generating engineered cells and compositions thereof
US12522660B2 (en) 2018-10-31 2026-01-13 C3S2 Gmbh Methods for selection and stimulation of cells and apparatus for same
US12577285B2 (en) 2017-12-08 2026-03-17 Juno Therapeutics, Inc. Process for producing a composition of engineered T cells

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7314759B2 (en) * 2001-12-14 2008-01-01 Darrell Lee Bigalke Continuous fluid sampler and method
US20110158955A1 (en) * 2008-03-11 2011-06-30 Yoshimoto Katsura Method for producing cells having characteristic of hematopoietic stem cells/progenitor cells
JP6043934B2 (ja) * 2008-10-31 2016-12-14 国立大学法人名古屋大学 抗原特異的細胞傷害性t細胞の調製キット
US20100112696A1 (en) * 2008-11-03 2010-05-06 Baxter International Inc. Apparatus And Methods For Processing Tissue To Release Cells
US8309343B2 (en) * 2008-12-01 2012-11-13 Baxter International Inc. Apparatus and method for processing biological material
WO2011047289A1 (en) 2009-10-16 2011-04-21 University Of Medicine And Dentistry Of New Jersey Closed system separation of adherent bone marrow stem cells for regenerative medicine applications
RS59002B1 (sr) 2012-01-27 2019-08-30 Univ Montreal Pirimido[4,5-b]indol derivati i njihova primena u ekspanziji hematopoetskih matičnih ćelija
AU2015209434A1 (en) 2014-01-22 2016-08-04 Zpredicta, Inc. Method and apparatus for isolating invasive and metastatic cells for evaluating therapeutics and prediction of metastatic capacity
US10384207B2 (en) 2015-07-21 2019-08-20 Neuro Probe Incorporated Assay apparatus and methods
US20210292696A1 (en) * 2016-09-22 2021-09-23 Corning Incorporated Gravity flow cell culture devices, systems, and methods of use thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5409813A (en) * 1993-09-30 1995-04-25 Systemix, Inc. Method for mammalian cell separation from a mixture of cell populations
US5925567A (en) * 1995-05-19 1999-07-20 T. Breeders, Inc. Selective expansion of target cell populations
US5837444A (en) * 1996-07-16 1998-11-17 Shah; Kumarpal A. Islet cell transplantation machine for diabetes cure

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120258538A1 (en) * 2009-09-10 2012-10-11 Keio University Culture method for hematopoietic stem cells
US11746319B2 (en) 2010-10-08 2023-09-05 Terumo Bct, Inc. Customizable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11773363B2 (en) 2010-10-08 2023-10-03 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11613727B2 (en) 2010-10-08 2023-03-28 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US12135265B2 (en) 2012-02-23 2024-11-05 Juno Therapeutics Gmbh Chromatographic isolation of cells and other complex biological materials
US12066365B2 (en) 2012-02-23 2024-08-20 Juno Therapeutics Gmbh Chromatographic isolation of cells and other complex biological materials
US11667876B2 (en) 2013-11-16 2023-06-06 Terumo Bct, Inc. Expanding cells in a bioreactor
US11708554B2 (en) 2013-11-16 2023-07-25 Terumo Bct, Inc. Expanding cells in a bioreactor
US11795432B2 (en) 2014-03-25 2023-10-24 Terumo Bct, Inc. Passive replacement of media
US11274278B2 (en) 2014-04-16 2022-03-15 Juno Therapeutics Gmbh Methods, kits and apparatus for expanding a population of cells
US12208137B2 (en) 2014-04-23 2025-01-28 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
US11400115B2 (en) 2014-04-23 2022-08-02 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
US12296010B2 (en) 2014-04-23 2025-05-13 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
US11667881B2 (en) 2014-09-26 2023-06-06 Terumo Bct, Inc. Scheduled feed
US12065637B2 (en) 2014-09-26 2024-08-20 Terumo Bct, Inc. Scheduled feed
US11608486B2 (en) 2015-07-02 2023-03-21 Terumo Bct, Inc. Cell growth with mechanical stimuli
US11913024B2 (en) 2015-10-22 2024-02-27 Juno Therapeutics Gmbh Methods for culturing cells and kits and apparatus for same
US11248238B2 (en) 2015-10-22 2022-02-15 Juno Therapeutics Gmbh Methods, kits, agents and apparatuses for transduction
US12129477B2 (en) 2015-10-22 2024-10-29 Juno Therapeutics Gmbh Methods, kits, agents and apparatuses for transduction
US11965175B2 (en) 2016-05-25 2024-04-23 Terumo Bct, Inc. Cell expansion
US11634677B2 (en) 2016-06-07 2023-04-25 Terumo Bct, Inc. Coating a bioreactor in a cell expansion system
US12077739B2 (en) 2016-06-07 2024-09-03 Terumo Bct, Inc. Coating a bioreactor in a cell expansion system
US11685883B2 (en) 2016-06-07 2023-06-27 Terumo Bct, Inc. Methods and systems for coating a cell growth surface
US11999929B2 (en) 2016-06-07 2024-06-04 Terumo Bct, Inc. Methods and systems for coating a cell growth surface
US12234441B2 (en) 2017-03-31 2025-02-25 Terumo Bct, Inc. Cell expansion
US12570960B2 (en) 2017-03-31 2026-03-10 Terumo Bct, Inc. Expanding cells in a bioreactor
US11629332B2 (en) 2017-03-31 2023-04-18 Terumo Bct, Inc. Cell expansion
US12359170B2 (en) 2017-03-31 2025-07-15 Terumo Bct, Inc. Expanding cells in a bioreactor
US11624046B2 (en) 2017-03-31 2023-04-11 Terumo Bct, Inc. Cell expansion
US11702634B2 (en) 2017-03-31 2023-07-18 Terumo Bct, Inc. Expanding cells in a bioreactor
US11866465B2 (en) 2017-04-27 2024-01-09 Juno Therapeutics Gmbh Oligomeric particle reagents and methods of use thereof
US12215348B2 (en) 2017-08-09 2025-02-04 Juno Therapeutics, Inc. Methods for producing genetically engineered cell compositions and related compositions
US11851678B2 (en) 2017-08-09 2023-12-26 Juno Therapeutics, Inc. Methods for producing genetically engineered cell compositions and related compositions
US12258580B2 (en) 2017-11-01 2025-03-25 Juno Therapeutics, Inc. Process for generating therapeutic compositions of engineered cells
US12577285B2 (en) 2017-12-08 2026-03-17 Juno Therapeutics, Inc. Process for producing a composition of engineered T cells
US12516099B2 (en) 2018-08-09 2026-01-06 Juno Therapeutics, Inc. Processes for generating engineered cells and compositions thereof
US12522660B2 (en) 2018-10-31 2026-01-13 C3S2 Gmbh Methods for selection and stimulation of cells and apparatus for same
US12043823B2 (en) 2021-03-23 2024-07-23 Terumo Bct, Inc. Cell capture and expansion
US12209689B2 (en) 2022-02-28 2025-01-28 Terumo Kabushiki Kaisha Multiple-tube pinch valve assembly
US12152699B2 (en) 2022-02-28 2024-11-26 Terumo Bct, Inc. Multiple-tube pinch valve assembly
USD1099116S1 (en) 2022-09-01 2025-10-21 Terumo Bct, Inc. Display screen or portion thereof with a graphical user interface for displaying cell culture process steps and measurements of an associated bioreactor device

Also Published As

Publication number Publication date
WO2004096975A3 (en) 2005-03-10
AU2004234627A1 (en) 2004-11-11
SG150387A1 (en) 2009-03-30
CA2565581C (en) 2014-07-08
US20070160582A1 (en) 2007-07-12
US7795024B2 (en) 2010-09-14
EP1641911A2 (en) 2006-04-05
JP2006525013A (ja) 2006-11-09
CA2565581A1 (en) 2004-11-11

Similar Documents

Publication Publication Date Title
US7795024B2 (en) Apparatus and methods for amplification of blood stem cell numbers
Koller et al. Clinical-scale human umbilical cord blood cell expansion in a novel automated perfusion culture system
US7790458B2 (en) Material and methods for the growth of hematopoietic stem cells
Donnelly et al. Functional activity of murine CD34+ and CD34− hematopoietic stem cell populations
Piacibello et al. Engraftment in nonobese diabetic severe combined immunodeficient mice of human CD34+ cord blood cells after ex vivo expansion: evidence for the amplification and self-renewal of repopulating stem cells
Madlambayan et al. Dynamic changes in cellular and microenvironmental composition can be controlled to elicit in vitro human hematopoietic stem cell expansion
EP4314244B1 (en) Cell capture and expansion
Madlambayan et al. Clinically relevant expansion of hematopoietic stem cells with conserved function in a single-use, closed-system bioprocess
JPH10295369A (ja) 造血幹細胞の製造方法
Hoffman Progress in the development of systems for in vitro expansion of human hematopoietic stem cells
Golfier et al. Mid-trimester fetal livers are a rich source of CD34+/++ cells for transplantation
Kim et al. Ex Vivo Expansion of Human Umbilical Cord Blood CD34+ Cells in a Collagen Bead—Containing 3-Dimensional Culture System
EP4301846A1 (en) Highly potent m-cenk cells and methods
CA2219869A1 (en) Human cd-34 hematopoietic stem cells
WO2004096972A2 (en) Apparatus and methods for amplification of blood stem cell numbers
Watanabe et al. Autologous and allogeneic transplantation with peripheral blood CD34+ cells: a pediatric experience
JP2005527223A (ja) サイトカインフリーでの前駆細胞の増殖および維持
US20120065620A1 (en) Bone marrow extracellular matrix extract and therapeutic use thereof
Haylock et al. Ex vivo hematopoietic progenitor cell expansion
Chabannon et al. Production of ex vivo expanded hematopoietic cells and progenitors in a closed bioreactor, starting with a small volume marrow collection: A feasibility study in patients with poor-risk breast cancer and receiving high-doses of cyclophosphamide.
Kawano et al. Clinically applicable bulk isolation of blood CD34+ cells for autografting in children
Chabannon et al. Ex vivo expansion of human hematopoietic progenitors and cells to support high–dose chemoradiation therapy: Five years of clinical experience
WO2005109199A2 (en) Method for selectively expanding, selecting and enriching stem/progenitor cell populations
Roberts et al. Impact of cell culture technology on transfusion medicine
Gulati et al. Marrow Contamination: Pharmacological Treatment

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 171725

Country of ref document: IL

Ref document number: 2006506626

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2004730899

Country of ref document: EP

Ref document number: 2004234627

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2004234627

Country of ref document: AU

Date of ref document: 20040503

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004234627

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004730899

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2565581

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007160582

Country of ref document: US

Ref document number: 10555604

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10555604

Country of ref document: US