WO2004088573A1 - Determining cell cycle phase data - Google Patents

Determining cell cycle phase data Download PDF

Info

Publication number
WO2004088573A1
WO2004088573A1 PCT/GB2003/003876 GB0303876W WO2004088573A1 WO 2004088573 A1 WO2004088573 A1 WO 2004088573A1 GB 0303876 W GB0303876 W GB 0303876W WO 2004088573 A1 WO2004088573 A1 WO 2004088573A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
cell cycle
image data
object area
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2003/003876
Other languages
English (en)
French (fr)
Inventor
Nicholas Solvatore Arini
Ian David Goodyer
Alla Borisovna Zaltsman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GE Healthcare UK Ltd
Original Assignee
Amersham Biosciences UK Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amersham Biosciences UK Ltd filed Critical Amersham Biosciences UK Ltd
Priority to CA002520982A priority Critical patent/CA2520982A1/en
Priority to US10/550,362 priority patent/US20060247862A1/en
Priority to EP03816506A priority patent/EP1609111A1/en
Priority to AU2003260795A priority patent/AU2003260795B2/en
Priority to JP2004570045A priority patent/JP2006521785A/ja
Publication of WO2004088573A1 publication Critical patent/WO2004088573A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/645Specially adapted constructive features of fluorimeters
    • G01N21/6452Individual samples arranged in a regular 2D-array, e.g. multiwell plates
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10Investigating individual particles
    • G01N15/14Optical investigation techniques, e.g. flow cytometry
    • G01N15/1468Optical investigation techniques, e.g. flow cytometry with spatial resolution of the texture or inner structure of the particle
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/6428Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/645Specially adapted constructive features of fluorimeters
    • G01N21/6456Spatial resolved fluorescence measurements; Imaging
    • G01N21/6458Fluorescence microscopy
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06VIMAGE OR VIDEO RECOGNITION OR UNDERSTANDING
    • G06V20/00Scenes; Scene-specific elements
    • G06V20/60Type of objects
    • G06V20/69Microscopic objects, e.g. biological cells or cellular parts
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10Investigating individual particles
    • G01N15/14Optical investigation techniques, e.g. flow cytometry
    • G01N2015/1477Multiparameters
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10Investigating individual particles
    • G01N15/14Optical investigation techniques, e.g. flow cytometry
    • G01N2015/1493Particle size

Definitions

  • the present invention relates to methods of determining cell cycle phase data for cells, the cells comprising a luminescent reporter which is capable of being indicative of at least one cell cycle phase.
  • the invention further relates to apparatus and computer software adapted to carry out such a method.
  • chemical compound is intended to be interpreted broadly so as to include, but not be limited to, simple organic and inorganic molecules, proteins, peptides, nucleic acids and oligonucleotides, carbohydrates, lipids, or any chemical structure of biological interest.
  • cell-based assays are run on populations of cells. The measured response is usually an average over the cell population.
  • a popular instrument used for ion channel assays is disclosed in U.S. Patent No. 5,355,215.
  • a typical assay consists of measuring the time-dependence of the fluorescence of an ion-sensitive dye, the fluorescence being a measure of the intra-cellular concentration of the ion of interest which changes as a consequence of the addition of a chemical compound.
  • the dye is loaded into the population of cells disposed on the bottom of the well of a multiwell plate at a time prior to the measurement.
  • the response of the cells is heterogeneous in both magnitude and time. This variability may obscure or prevent the observation of biological activity important to compound screening.
  • the heterogeneity may arise from experimental sources, but more importantly, heterogeneity is fundamental in any population of cells.
  • the origin of the variability may be a consequence of the life-cycle divergence among the population, or the result of the evolutionary divergence of the number of active target molecules.
  • a method that mitigates, compensates for, or even utilizes the variations would enhance the value of cell-based assays in the characterization of the pharmacological activity of chemical compounds.
  • Quantification of the response of individual cells circumvents the problems posed by the non-uniformity of that response of a population of cells.
  • a device that measures the average response will have less sensitivity than one determining individual cellular response.
  • the latter method generates a statistical characterization of the response profile permitting one to select the subset of active cells. Additional characterization of the population will enhance the interpretation of the response profile.
  • the cell cycle is of key importance to many areas of drug discovery. On the one hand this fundamental process provides the opportunity to discover new targets for anticancer agents and improved chemotherapeutics, but on the other hand drugs and targets in other therapeutic areas must be tested for undesirable effects on the cell cycle. Historically, a wide range of techniques have been developed to study the cell cycle both as a global biochemical process and at the molecular level.
  • Known methods include those that produce data describing the proliferative activity of a cell population. Measuring the incorporation of [ 14 C]- or [ 3 H]-thymidine (Regan, J.D. and Chu, E.H. (1966) "A convenient method for assay of DNA synthesis in synchronized human cell cultures” J. Cell Biol. 28, 139-143) by scintillation counting was one of the earliest methods of determining cell proliferation, and is still widely used today. More recent developments (Graves, R. et al. (1997) “Noninvasive, real-time method for the examination of thymidine uptake events-application of the method to V-79 cell synchrony studies" Anal. Biochem. 248, 251-257) have allowed thymidine incorporation to be measured in a homogeneous microplate assay format.
  • a combination of DNA staining with pulsed BrdU incorporation can be used to resolve the cell cycle position further.
  • Dual-parameter analysis of DNA staining and/or BrdU incorporation can also be used with antibodies to cell-surface markers to profile cell cycle distribution in a defined sub-population of cells (Mehta, B.A. and Maino, V.C.
  • cells are loaded with a fluorescent dye such as carboxy-fluorescein diacetate succinimidyl ester (CFSE), which is partitioned between daughter cells at each successive round of cell division with a twofold reduction in fluorescence.
  • CFSE carboxy-fluorescein diacetate succinimidyl ester
  • Subsequent analysis of cell fluorescence by flow cytometry reveals the number of cell divisions undergone by each cell in the population.
  • This technique has also been used in multi-parameter analyses combined with BrdU and proliferation-marker staining (Hasbold, J. and Hodgkin, P.D. (2000) "Flow cytometric cell division tracking using nuclei" Cytometry 40, 230-237).
  • a method of determining cell cycle phase data for cells comprising at least one luminescent reporter capable of emitting radiation, the at least one luminescent reporter comprising a first luminescent reporter which is capable of being indicative of at least one cell cycle phase, said method comprising: storing classification information for classifying individual cells into different cell cycle phases using an automated classification process; receiving image data created by detecting radiation emitted by said at least one luminescent reporter; analyzing said image data to identify object areas in the image data which correspond to individual cells; analyzing said image data, on the basis of said identified object areas, to determine, for a selected cell, one or more measurements including a measurement of a parameter relating to at least a cytoplasmic component of the cell; and applying said classification information to said measurements to classify the selected cell into a selected one of a plurality of sub-populations of cells, each sub-population having cells in a different cell cycle phase.
  • the invention provides methods of analysis of luminescent imaging on cell populations in a manner that
  • Figure 1 is a schematic view of a first embodiment of a line-scan confocal microscope used to image samples according to the present invention.
  • Figures 2A and 2B are, respectively, a top view and a side view of the ray path of a multicolour embodiment of the present invention, without a scanning mirror.
  • Figure 2C is a top view of the ray path of a single beam autofocus.
  • Figures 3 A and 3B are, respectively, a top view and a side view of the ray path of the multicolour embodiment of the present invention with the scanning mirror.
  • Figure 3C is a top view of the ray path of the single beam autofocus.
  • Figure 4 is a side view of the two beam autofocus system.
  • Figures 5A, 5B and 5C illustrate a rectangular CCD camera and readout register.
  • Figure 6 is a schematic illustration showing data processing components in an imaging a data processing system arranged in accordance with an embodiment of the invention.
  • Figure 7 is a schematic diagram illustrating cell cycle position nucleic acid reporter constructs used in an embodiment of the present invention.
  • Figure 8 shows a DNA construct for determining the G2/M phase of the cell cycle.
  • Figure 9 is a schematic diagram illustrating cyclin Bl regulation during cell cycle progression. The cell cycle proceeds in the direction of the arrow with cyclin Bl expression driven by a cell cycle phase-specific promoter which initiates expression at the end of the S phase and peaks during G2 (A). At the start of mitosis (B) cyclin Bl translocates from the cytoplasm to the nucleus and from metaphase onwards (C) the protein is specifically degraded.
  • Figure 10 is a schematic illustration showing typical intensity and distribution of signals in a cell including a fluorescent reporter in accordance with an embodiment of the invention, in each of the G0/G1, S, G2 and Mitotic (M) cell cycle phases.
  • Figure 11 shows a set of pie graphs illustrating the relative sizes of the sub-populations of cells in each of the G0/G1/S, G2, Prophase and Mitotic cell cycle phases, as determined using an automated analysis in accordance with the invention, in each of an unsynchronized cell population, acolchicine treated cell population and a mimosine treated cell population.
  • Figure 12 shows a graph illustrating the locations of different cell cycle phases relative to thresholds set in a third embodiment of the invention.
  • Figure 13 is a schematic illustration showing typical intensity and distribution of signals in a cell including a fluorescent reporter in accordance with an embodiment of the invention, in each of the metaphase, anaphase, telophase, and cytokinesis cell cycle phases.
  • the present invention is useful for identifying pharmacological agents for the treatment of disease. It provides a high throughput method for conducting a wide variety of biological assays where one or more luminescent markers are employed to measure a biological response. Such assays can be conducted on chemical compounds or any molecule of biological interest, included but not limited to drug candidates, such as those found in combinatorial libraries will allow the high throughput screening of chemical compounds of biological interest, including but not limited to drug candidates, such as those found in combinatorial libraries.
  • the techniques of the present invention may be used in assays in which data are acquired on individual cells, on a cellular or sub-cellular level, sufficiently rapidly so as to permit the acquisition of such data on a sufficient number of cells to constitute a statistically meaningful sample of the cell population.
  • assays may make use of any known fluorophore or fluorescent label including but not limited to fluorescein, rhodamine, Texas Red, Amersham
  • Figure 1 shows a first embodiment of the present invention.
  • the microscope comprises a source 100 or 110 of electromagnetic radiation for example, in the optical range, 350-750nm, a cylindrical lens 120, a first slit mask 130, a first relay lens 140, a dichroic mirror 150, an objective lens 170, a microtiter plate 180 containing a two-dimensional array of sample wells 182, a tube lens 190, a filter 200, a second slit mask 210 and a detector 220.
  • These elements are arranged along optical axis OA with slit apertures 132, 212 in masks 130, 210 extending perpendicular to the plane of Figure 1.
  • the focal lengths of lenses 140, 170 and 190 and the spacings between these lenses as well as the spacings between mask 130 and lens 140, between objective lens 170 and microtiter plate 180 and between lens 190 and mask 210 are such as to provide a confocal microscope.
  • electromagnetic radiation from a lamp 100 or a laser 110 is focused to a line using a cylindrical lens 120.
  • the shape of the line is optimized by a first slit mask 130.
  • the slit mask 130 is depicted in an image plane of the optical system, that is in a plane conjugate to the object plane.
  • microtiter plate 180 which contains a two-dimensional array of sample wells 182.
  • the optical elements of Figure 1 are depicted in cross-section and the well plate in perspective.
  • the projection of the line of illumination onto well plate 180 is depicted by line 184 and is also understood to be perpendicular to the plane of Figure 1.
  • well plate 180 may be moved in two dimensions (X, Y) parallel to the dimensions of the array by means not shown.
  • the slit mask 130 resides in a Fourier plane of the optical system, that is in a plane conjugate to the objective back focal plane (BFP) 160.
  • the aperture 132 lies in the plane of the figure
  • the lens 140 relays the illumination stripe formed by the aperture 132 onto the back focal plane 160 of the objective 170 which transforms it into a line 184 in the object plane perpendicular to the plane of Figure 1.
  • the slit mask 130 is removed entirely.
  • the illumination source is the laser 110, the light from which is focused into the back focal plane 160 of the objective 170. This can be accomplished by the combination of the cylindrical lens 120 and the spherical lens 140 as shown in Figure 1, or the illumination can be focused directly into the plane 160 by the cylindrical lens 120.
  • An image of the sample area for example a sample in a sample well 182, is obtained by projecting the line of illumination onto a plane within the sample, imaging the fluorescence emission therefrom onto a detector 220 and moving the plate 180 in a direction perpendicular to the line of illumination, synchronously with the reading of the detector 220.
  • the fluorescence emission is collected by the objective lens 170, projected through the dichroic beamsplitter 150, and imaged by lens 190 through filters 200 and a second slit mask 210 onto a detector 220, such as is appropriate to a confocal imaging system having an infinity-corrected objective lens 170.
  • the dichroic beamsplitter 150 and filter 200 preferentially block light at the illumination wavelength.
  • the detector 220 illustratively is a camera and may be either one dimensional or two dimensional. If a one dimensional detector is used, slit mask 210 is not needed.
  • the illumination, detection and translation procedures are continued until the prescribed area has been imaged. Mechanical motion is simplified if the sample is translated at a continuous rate.
  • Continuous motion is most useful if the camera read-time is small compared to the exposure-time.
  • the camera is read continuously.
  • the displacement d of the sample during the combined exposure-time and read- time may be greater than or less than the width of the illumination line W, exemplarily 0.5 W ⁇ d 5W. All of the wells of a multiwell plate can be imaged in a similar manner.
  • the microscope can be configured to focus a line of illumination across a number of adjacent wells, limited primarily by the field-of- view of the optical system.
  • more than one microscope can be used simultaneously.
  • the size and shape of the illumination stripe 184 is determined by the width and length of the Fourier transform stripe in the objective lens back focal plane 160.
  • the length of the line 184 is determined by the width of the line in 160 and conversely the width in 184 is determined by the length in 1 0.
  • the length of the illumination stripe at 160 is chosen to overfill the objective back aperture. It will be evident to one skilled in the art that the size and shape of the illumination stripe 184 can be controlled by the combination of the focal length of the cylindrical lens 120 and the beam size at 120, that is by the effective numerical aperture in each dimension, within the restrictions imposed by aberrations in the objective, and the objective field of view.
  • the dimensions of the line of illumination 184 are chosen to optimize the signal to noise ratio. Consequently, they are sample dependent. Depending on the assay, the resolution may be varied between diffraction-limited, i.e., less than 0.5 ⁇ m, and approximately 5 ⁇ m.
  • the beam length is preferably determined by the objective field of view, exemplarily between 0.5 and 1.5 mm.
  • a Nikon ELWD, 0.6 NA, 10X objective, for example, has a field of view of approximately 0.75 mm.
  • the diffraction-limited resolution for 633 nm radiation with this objective is approximately 0.6 ⁇ m or approximately 1100 resolution elements.
  • the effective depth resolution is determined principally by the width of aperture 212 in slit mask 210 or the width of the one dimensional detector and the image magnification created by the combination of the objective lens 170 and lens 190.
  • the best depth resolution of a confocal microscope approaches 1 ⁇ m. In the present application, a depth resolution of 5-10 ⁇ m may be sufficient or even advantageous.
  • the sample of interest such as a live cell
  • a similar situation prevails in the case of video-rate kinetics studies of transient events such as ion-channel openings. Practically, this is accomplished by underfilling the back aperture of the objective lens, which is equivalent to increasing the diameter of the illumination aperture.
  • the effective numerical aperture ("NA") of the illumination is less than the NA of the objective.
  • the fluorescence emission is, however, collected with the full NA of the objective lens.
  • the width of aperture 212 must be increased so as to detect emission from the larger illumination volume. At an aperture width a few times larger than the diffraction limit, geometrical optics provides an adequate approximation for the size of the detection-volume element:
  • Axial Width: z d where M is the magnification, da is the width of aperture 212 and a is the half- angle subtended by the objective 170. It is an important part of the present invention that the illumination aperture 132 or its equivalent in the embodiment having no aperture and the detection aperture 212 be independently controllable.
  • Multi- Wavelength Configuration An embodiment enabling multi-wavelength fluorescence imaging is preferred for certain types of assays. In this way, image data can be generated for the same area being imaged in each of a plurality of different colour channels simultaneously.
  • Figs. 2A and 2B depict the ray paths in a three-colour line-scan confocal imaging system, from a top view and a side view respectively.
  • the system comprises several sources S n of electromagnetic radiation, collimating lenses JU, and mirrors M n for producing a collimated beam that is focused by cylindrical lines CL into an elongated beam at first spatial filter SFi, a confocal microscope between first spatial filter SFi, and second spatial filter SF 2 and an imaging lens EL, beamsplitters DMi and DM and detectors D n for separating and detecting the different wavelength components of fluorescent radiation from the sample.
  • Spatial filters SF, and SFi and SF 2 preferably are slit masks.
  • Figure 2A depicts sources, Si, S 2 and S 3 , for colours ⁇ i, ⁇ 2 and ⁇ 3 , and lenses L l5 " and L 3 that collimate the light from the respective sources.
  • Lenses Li, L 2 and L 3 preferably are adjusted to compensate for any chromaticity of the other lenses in the system.
  • Mirrors Mi, M 2 and M 3 are used to combine the illumination colours from sources S n .
  • the mirrors M 2 and Mi are partially transmitting, partially reflecting and preferentially dichroic.
  • M 2 for example, should preferentially transmit ⁇ 3 , and preferentially reflect ⁇ 2 . It is thus preferential that ⁇ 3 be greater than ⁇ 2 .
  • the combined excitation beams from sources S Bi be focused to a "line", or an highly eccentric ellipse, in the object plane OP.
  • a variety of configurations may be used to accomplish this.
  • the combined illumination beams are focused by cylindrical lens CL into an elongated ellipse that is coincident with the slit in the spatial filter SFi.
  • the slit mask resides in an image plane of the system, aligned perpendicular to the propagation of the illumination light and with its long axis in the plane of the page of Figure 2A.
  • the lenses TL and OL relay the illumination line from the plane containing SFi to the object plane OP.
  • a tirrning mirror, TM is for convenience.
  • DM 3 is between TL and OL and CL focuses the illumination light directly into the BFP.
  • Other embodiments will be evident to one skilled in the art.
  • the light emitted by the sample and collected by the objective lens, OL is imaged by the tube lens, TL, onto the spatial filter, SF 2 .
  • SF 2 is preferentially a slit aligned so as to extend perpendicular to the plane of the page.
  • the light passed by filter SF 2 is substantially a line of illumination.
  • SF 2 may be placed in the primary image plane or any plane conjugate thereto.
  • DM 3 is partially reflecting, partially transmitting and preferably "multichroic". Multi-wavelength "dichroic" mirrors, or “multichroic” mirrors can be obtained that preferentially reflect certain wavelength bands and preferentially transmit others.
  • ⁇ ! will be defined to be the fluorescence emission excited by ⁇ i. This will, in general, be a distribution of wavelengths somewhat longer than ⁇ ⁇ .
  • ⁇ 2 and ⁇ 3 are defined analogously.
  • the light transmitted by SF 2 is imaged onto the detection devices, which reside in planes conjugate to the primary image plane.
  • an image of the spatial filter SF 2 is created by lens IL on all three detectors, D BIOS.
  • individual lenses EL are associated with the detection devices, the lens pairs LL and I n serving to relay the image of the spatial filter SF 2 onto the respective detectors Dminister.
  • the light is split among the detectors by mirrors DM] and DM 2 .
  • the mirrors are partially transmitting, partially reflecting, and preferentially dichroic.
  • DM ⁇ preferentially reflects ⁇ and preferentially transmits ⁇ 2 and ⁇ 3 .
  • the blocking filter, BFi preferentially transmits ⁇ i effectively blocking all other wavelengths present.
  • DM 2 preferentially reflects ⁇ 2 and preferentially transmits ⁇ 3 .
  • the blocking filters, BF 2 and BF 3 preferentially transmit ⁇ 2 and ⁇ 3 respectively, effectively blocking all other wavelengths present.
  • rapid data acquisition is provided by framing images at video rates.
  • Video-rate imaging allows up to 30 or even 60 frames per second. In the present use, it is intended to connote frame rates with an order-of-magnitude of 30 Hz.
  • video- rate imaging is achieved by illuminating along one dimension of the sample plane and scanning the illumination beam in the direction perpendicular thereto so as to effect a relative translation of the illumination and sample.
  • the scanning stage is generally massive. Consequently, it cannot be moved sufficiently rapidly.
  • Figure 3 depicts an embodiment of the invention utilizing a scanning mirror, SM.
  • the mirror is advantageously placed in a plane conjugate to the objective back focal plane (BFP):
  • BFP objective back focal plane
  • a rotation in the BFP (or a plane conjugate thereto) effects a translation in the object plane (OP) and its conjugate planes.
  • the full scan range of SM need only be a few degrees for typical values of the focal lengths of the lenses RLi and RL 2 .
  • this lens pair images the BFP onto the SM at a magnification of one, but a variety of magnifications can be advantageously used.
  • the limiting factors to the image acquisition rate are the camera read-rate and the signal strength. In the imaging mode described above, data can be acquired continuously at the camera read- rate, exemplarily 1 MHz.
  • the sample lies in the object plane of an imaging system. Accordingly, an autofocus mechanism is used that maintains the portion of the sample in the field-of-view of the imaging system within the object plane of that system.
  • the precision of planarity is determined by the depth-of-field of the system. In a preferred embodiment, the depth-of-field is approximately 10 ⁇ m and the field-of-view is approximately 1 mm 2 .
  • the autofocus system operates with negligible delay, that is, the response time is short relative to the image acquisition-time, exemplarily 0.01- 0.1 s.
  • the autofocus light source is independent of the illumination light sources and the sample properties.
  • this configuration permits the position of the sample carrier along the optical axis of the imaging system to be determined independent of the position of the object plane.
  • Embodiments of single-beam autofocus are shown in Figs. 2C and 3C, where a separate light source, S of wavelength ⁇ 4, and detector D are shown.
  • the wavelength ⁇ j is necessarily distinct from the sample fluorescence, and preferentially a wavelength that cannot excite appreciable fluorescence in the sample.
  • ⁇ t is preferentially in the near infrared, exemplarily 800-1000 nm.
  • Optically-based autofocus mechanisms suitable for the present application are known.
  • an astigmatic-lens-based system for the generation of a position error signal suitable for servo control is disclosed in Applied Optics 23 565-570 (1984).
  • a focus error detection system utilizing a "skew beam” is disclosed in SPIE 200 73-78 (1979). The latter approach is readily implemented according to Figs. 2C and 3C, where D is a split detector.
  • the servo loop For use with a microtiter plate having a sample residing on the well bottom, the servo loop must, however, be broken to move between wells. This can result in substantial time delays because of the need to refocus each time the illumination is moved to another well.
  • Continuous closed-loop control of the relative position of the sample plane and the object plane is provided in a preferred embodiment of the present invention, depicted in Figure 4.
  • This system utilizes two independent beams of electromagnetic radiation.
  • One, originating from S 5 is focused on the continuous surface, exemplarily the bottom of a microtiter plate.
  • the other, originating from S 4 is focused on the discontinuous surface, exemplarily the well bottom of a microtiter plate.
  • the beams originating from S and S 5 have wavelengths and ⁇ 5 , respectively, ⁇ is collimated by L 4 , apertured by iris Li, and focused onto the discontinuous surface by the objective lens OL.
  • ⁇ 5 is collimated by L 5 , apertured by iris I 5 , and focused onto the continuous surface by the lens CFL in conjunction with the objective lens OL.
  • the reflected light is focused onto the detectors D 4 and D 5 by the lenses IL 4 and IL 5 , respectively.
  • the mirrors, t , M 5 and M 6 are partially transmitting, partially reflecting. In the case that ⁇ t and ⁇ s are distinct, M 6 is preferentially dichroic.
  • ⁇ j is focused onto the well bottom.
  • the object plane can be offset from the well bottom by a variable distance. This is accomplished by adjusting L 4 or alternatively by an offset adjustment in the servo control loop. For convenience of description, it will be assumed that ⁇ j focuses in the object plane.
  • the operation of the autofocus system is as follows. If the bottom of the sample well is not in the focal plane of objective lens OL, detector D generates an error signal that is supplied through switch SW to the Z control.
  • the Z control controls a motor (not shown) for moving the microtiter plate toward or away from the objective lens. Alternatively, the Z control could move the objective lens. If the bottom PB of the microtiter plate is not at the focal plane of the combination of the lens CFL and the objective lens OL, detector D 5 generates an error signal that is applied through switch SW to the Z control.
  • An XY control controls a motor (not shown) for moving the microtiter plate in the object plane OP of lens OL.
  • the entire scan is under computer control.
  • An exemplary scan follows: At the completion of an image in a particular well, the computer operates SW to switch control of the servo mechanism from the error signal generated by D 4 to that generated by D5; the computer then directs the XY control to move the plate to the next well, after which the servo is switched back to D 4 .
  • the "coarse" focusing mechanism utilizing the signal from the bottom of the plate is used to maintain the position of the sample plane to within the well- to-well variations in the thickness of the plate bottom, so that the range over which the "fine" mechanism is required to search is minimized.
  • the image size on the detector will be ⁇ 100 ⁇ m.
  • the diameter of the iris I is 0.5 mm and LL is 100 mm, then the image size on the detector will be ⁇ 400 ⁇ m. The latter is chosen to be less sensitive so as to function as a "coarse" focus.
  • the wavelengths ⁇ and ⁇ s are necessarily distinct from the sample fluorescence, and preferentially wavelengths that cannot excite appreciable fluorescence in the sample.
  • ⁇ t and ⁇ 5 are preferentially in the near infrared, such as 800-1000 nm.
  • the two beams are polarized perpendicular to one another and M 6 is a polarizing beamsplitter.
  • Pseudo-closed loop control is provided in the preferred embodiment of single-beam autofocus which operates as follows. At the end of a scan the computer operates SW to switch control to a sample-and-hold device which maintains the Z control output at a constant level while the plate is moved on to the next well after which SW is switched back to D 4 .
  • a detection device is used having manifold, independent detection elements in a plane conjugate to the object plane.
  • line illumination is advantageous principally in applications requiring rapid imaging.
  • the potential speed increase inherent in the parallelism of line illumination as compared to point illumination is, however, only realized if the imaging system is capable of detecting the light emitted from each point of the sample along the illumination line, simultaneously.
  • CCD charge-coupled device
  • CCD charge-coupled device
  • a continuous-read line-camera is used and in a preferred embodiment a rectangular CCD is used as a line-camera. Both embodiments have no dead-time between lines within an image or between images.
  • An additional advantage is that a larger effective field-of-view is achievable in the stage-scanning embodiment, discussed below.
  • the properties required of the detection device can be further clarified by considering the following preferred embodiment.
  • the resolution limit of the objective lens is ⁇ 1 ⁇ m, typically -0.5 ⁇ m, and the detector comprises an array of -1000 independent elements.
  • Resolution, field-of-view (FOV) and image acquisition-rate are not independent variables, necessitating compromise among these performance parameters.
  • the magnification of the optical system is set so as to image as large a FOV as possible without sacrificing resolution. For example, a -1 mm field-of-view could be imaged onto a 1000- element array at 1- ⁇ m pixelation. If the detection elements are 20- ⁇ m square, then the system magnification would be set to 20X. Note that this will not result in 1- ⁇ m resolution.
  • Pixelation is not equivalent to resolution. If, for example, the inherent resolution limit of the objective lens is 0.5 ⁇ m and each 0.5 ⁇ m X 0.5 ⁇ m region in the object plane is mapped onto a pixel, the true resolution of the resulting digital image is not 0.5 ⁇ m. To achieve true 0.5- ⁇ m resolution, the pixelation would need to correspond to a region -0.2 ⁇ m X 0.2 ⁇ m in the object plane. In one preferred embodiment, the magnification of the imaging system is set to achieve the true resolution of the optics.
  • the highest detection efficiency, lowest noise detection devices having sufficient read-out speed for the present applications are CCD cameras.
  • a rectangular CCD camera is depicted having an m x n array of detector elements where m is substantially less than n.
  • the image of the fluorescence emission covers one row that is preferably proximate to the read register. This minimizes transfer time and avoids accumulating spurious counts into the signal from the rows between the illuminated row and the read- register.
  • each disposed in a plane conjugate to the object plane is elucidated by the following.
  • the detection spatial filter is omitted and a line-camera is used as a combined detection spatial filter and detection device.
  • a variable-width detection spatial filter permits the optimization of the detection volume so as to optimize the sample-dependent signal-to-noise ratio.
  • the following preferred embodiment retains the advantage of a line-camera, namely speed, and the flexibility of a variable detection volume.
  • the magnification is set so as to image a diffraction-limited line of height h onto one row of the camera.
  • the width of the detection spatial filter d is preferably variable h ⁇ d ⁇ lOh.
  • the detectors in the illuminated columns of the camera are binned, prior to reading, which is an operation that requires a negligible time compared to the exposure- and read-times.
  • the cameras are Princeton Instruments NTE/CCD-1340/100-EMD.
  • the read-rate in a preferred embodiment is 1 MHz at a few electrons of read-noise.
  • the pixel format is 1340x100, and the camera can be wired to shift the majority of the rows (80%) away from the region of interest, making the camera effectively 1340x20.
  • an additional advantage is that it permits the acquisition of rectangular images having a length limited only by the extent of the sample.
  • the length is determined by the lesser of the camera width and the extent of the line illumination.
  • the sample is disposed on the bottom of a well in a 96-well microtiter plate, the diameter of which is 7 mm.
  • a strip 1 ⁇ m X 1 mm is illuminated and the radiation emitted from the illuminated area is imaged onto the detection device.
  • the optical train is designed such that the field-of-view is ⁇ lmm 2 .
  • an image of the well-bottom can be generated at 1- ⁇ m pixelation over a 1 X 7-rnm field.
  • assays are performed on live cells. Live-cell assays frequently require a reasonable approximation to physiological conditions to run properly. Among the important parameters is temperature. It is desirable to incorporate a means to raise and lower the temperature, in particular, to maintain the temperature of the sample at 37°C. In another embodiment, control over relative humidity, and/or CO 2 and/or O 2 is necessary to maintain the viability of live cells. In addition, controlling humidity to minimize evaporation is important for small sample volumes.
  • Three embodiments providing a microtiter plate at an elevated temperature, preferably 37°C, compatible with the LCI system follow. The imaging system preferably resides within a light-proof enclosure. In a first embodiment, the sample plate is maintained at the desired temperature by maintaining the entire interior of the enclosure at that temperature. At 37°C, however, unless elevated humidity is purposefully maintained, evaporation cooling will reduce the sample volume limiting the assay duration.
  • a second embodiment provides a heated cover for the microwell plate which allows the plate to move under the stationary cover.
  • the cover has a single opening above the well aligned with the optical axis of the microscope. This opening permits dispensing into the active well while mamtaining heating and hmited circulation to the remainder of the plate.
  • a space between the heated cover plate and microwell plate of approximately 0.5 mm allows free movement of the microwell plate and minimizes evaporation. As the contents of the interrogated well are exposed to ambient conditions though the dispenser opening for at most a few seconds, said contents suffer no significant temperature change during the measurement.
  • a thin, heated sapphire window is used as a plate bottom enclosure.
  • a pattern of resistive heaters along the well separators maintain the window temperature at the desired level.
  • the three disclosed methods can be variously combined.
  • the imaging system is integrated with plate- handling robots, such as the Zymark Twister.
  • FIG. 6 shows a schematic illustration of data processing components of a system arranged in accordance with the invention.
  • the system based on the Amersham Biosciences IN Cell AnalyzerTM system, includes a confocal microscope 400 as described above, which includes the detectors D l5 D 2 , D 3 , D , D 5 , the switch SW, a control unit 401, an image data store 402 and an Input/Output (I/O) device 404.
  • a confocal microscope 400 as described above, which includes the detectors D l5 D 2 , D 3 , D , D 5 , the switch SW, a control unit 401, an image data store 402 and an Input/Output (I/O) device 404.
  • I/O Input/Output
  • An associated computer terminal 405 includes a central processing unit (CPU) 408, memory 410, a data storage device such as a hard disc drive 412 and I/O devices 406 which facilitate interconnection of the computer with the MDPU and the computer with a display element 432 of a screen 428 via a screen I/O device 430, respectively.
  • Operating system programs 414 are stored on the hard disc drive 412, and control, in a known manner, low level operation of the computer terminal 405.
  • Program files and data 420 are also stored on the hard disc drive 412, and control, in a known manner, outputs to an operator via associated devices and output data stored on the hard disc drive.
  • the associated devices include a display 432 as an element of the screen 428, a pointing device (not shown) and keyboard (not shown), which receive input from, and output information to, the operator via further I/O devices (not shown).
  • Included in the program files 420 stored on the hard drive 412 are an image processing and analysis application 416, an assay control application 418, and a database 422 for storing image data received from the microscope 400 and output files produced during data processing.
  • the image processing and analysis application 418 may be a customized version of known image processing and analysis software packages, such as Jmage-ProTM from Media Cybernetics.
  • the performance of an assay using the confocal microscope 400 is controlled using control application 418, and the image data are acquired. After the end of acquisition of image data for at least one well in a microtiter plate by at least one detector Di, D 2 , D 3) the image data are transmitted to the computer 405 and stored in the database 422 on the computer terminal hard drive 412, at which point the image data can be processed using the image processing and analysis application 416, as will be described in greater detail below.
  • luminescence is observed from an essentially planar surface using a line-scan confocal microscope as described above.
  • luminescent reporters are provided in a manner as described in our previous International patent application PCT/ GB02/004258.
  • the position in the cell cycle of a population of cells is determined by: a) expressing in the cells a nucleic acid reporter construct, preferably a DNA construct, comprising a nucleic acid sequence encoding a detectable live-cell reporter molecule operably linked to and under the control of: i) at least one cell cycle phase-specific expression control element, and ii) a destruction control element; wherein said reporter construct is expressed in a cell at a predetermined point in the cell cycle; and b) determining the position of cells in the cell cycle by monitoring luminescent signals emitted by the reporter molecule.
  • a nucleic acid reporter construct preferably a DNA construct, comprising a nucleic acid sequence encoding a detectable live-cell reporter molecule operably linked to and under the control of: i) at least one cell cycle phase-specific expression control element, and ii) a destruction control element; wherein said reporter construct is expressed in a cell at a predetermined point in the cell cycle; and b) determining the position
  • the nucleic acid reporter construct is also preferably linked to and under the control of a cell cycle phase-specific spatial localisation control element.
  • the cell cycle phase-specific expression control element is typically a DNA sequence that controls transcription and/or translation of one or more nucleic acid sequences and permits the cell cycle specific control of expression. Any expression control element that is specifically active in one or more phases of the cell cycle may suitably be used for construction of the cycle position reporter construct.
  • the cell cycle phase specific expression control element may be selected from cell cycle specific promoters and other elements that influence the control of transcription or translation in a cell cycle specific manner.
  • the expression control element is a promoter
  • the choice of promoter will depend on the phase of the cell cycle selected for study.
  • Suitable promoters include: cyclin Bl promoter (Cogswell et al, Mol. Cell Biol., (1995), 15(5), 2782-90, Hwang et al, LBiol.Chem., (1995), 270(47).
  • Cdc25B promoter (Korner et al, J.Biol.Chem., (2001), 276(13), 9662-9); cyclin A2 promoter (Henglein et al, Proc.Nat.Acad.Sci.USA, (1994), 91(12), 5490-4, Zwicker et al, Embo J., (1995), 14(18), 4514-22); Cdc2 promoter (Tommasi and Pfeifer, Mol.
  • the cell cycle phase specific expression control element may be selected from cell cycle specific IRES elements and other elements that influence the control of translation in a cell cycle specific manner.
  • An IRES element is an internal ribosomal entry site that allows the binding of a ribosome and the initiation of translation to occur at a region of mRNA which is not the 5'-capped region.
  • a cell cycle-specific IRES element restricts cap-independent initiation of translation to a specific stage of the cell cycle (Sachs, A.B., Cell, (2000), 101, 243-5).
  • the expression control element is selected to be an IRES, suitably its selection will depend on the cell cycle phase under study. In this case, a constitutively expressed (e.g.
  • CMV or SV40 CMV or SV40
  • inducible promoter may be used to control the transcription of the bicistronic mRNA (Sachs, A.B., Cell, (2000), 101, 243-5).
  • a non cell cycle phase-dependent IRES element e.g. the EMCV IRES found in pIRES vectors, BD Clontech
  • more precise control of expression of the reporter may be obtained by using a cell cycle phase specific promoter in conjunction with a cell cycle phase specific IRES element.
  • IRES elements suitable for use in the invention include: G2-IRES
  • Table 1 fists some preferred expression control elements that may be used in accordance with the invention, and indicates the cell cycle phase in which each element is activated.
  • the destruction control element is a DNA sequence encoding a protein motif that controls the destruction of proteins containing that sequence.
  • the destruction control element may be cell cycle mediated, for example: Cyclin Bl D-box (Glotzer et al, Nature, (1991), 349, 132-138, Yamano et al, EMBO J., (1998), 17(19), 5670-8, Clute and Pines, Nature Cell Biology, (1999), 1, 82 - 87); cyclin A N-terminus (den Elzen and Pines, J. Cell Biol., (2001), 153(1), 121-36, Geley et al, J.
  • the destruction control element may be non cell-cycle mediated, such as PEST sequences as described by Rogers et al, Science, (1986), 234, 364-8.
  • non cell-cycle mediated destruction control elements include sequences derived from casein, ornithine decarboxylase and proteins that reduce protein half-life. Use of such non cell-cycle mediated destruction control sequences in the method of the invention provides means for determining the persistence time of the cell cycle reporter following induction of expression by a cell cycle specific promoter.
  • the live-cell reporter molecule encoded by the nucleic acid sequence may be selected from the group consisting of fluorescent proteins and enzymes.
  • Preferred fluorescent proteins include Green Fluorescent Protein (GFP) from Aequorea victoria and derivatives of GFP such as functional GFP analogues in which the amino acid sequence of wild type GFP has been altered by amino acid deletion, addition, or substitution.
  • Suitable GFP analogues for use in the present invention include EGFP (Cormack, B.P. et al, Gene, (1996), 173, 33-38); EYFP and ECFP (US 6066476, Tsien, R. et al); F64L-GFP (US 6172188, Thastrup, O.
  • Suitable enzyme reporters are those which are capable of generating a detectable (e.g. a fluorescent or a luminescent) signal in a substrate for that enzyme.
  • Particularly suitable enzyme/substrates include: nitroreductase/Cy-Q (as disclosed in WO 01/57237) and ⁇ - lactamase/CCF4.
  • the nucleic acid reporter construct may optionally include a cell cycle phase-specific spatial localisation control element comprising a DNA sequence encoding a protein motif that is capable of controlling the sub-cellular localisation of the protein in a cell cycle specific manner.
  • a localisation control element may be used advantageously according to the invention where: i) a specific . sub-cellular localisation of the reporter is desirable; and or ii) more precise determination of the cell cycle position is required.
  • Suitable spatial localisation control elements include those that regulate localisation of a cell cycle control protein, for example the cyclin Bl CRS.
  • Figure 7 illustrates the general construction of a DNA construct according to the invention, in which Figure 7A shows a construct utilising a cell cycle phase-specific promoter and no internal ribosome entry site (IRES) element, Figure 7B shows a construct utilising an IRES element to facilitate mammalian selection, and Figure 7C shows a construct utilising a constituitive or inducible mammalian promoter and a cell cycle phase-specific IRES as the expression control element.
  • IRES internal ribosome entry site
  • A represents a cell cycle phase-specific expression control (promoter)
  • B represents a cell cycle phase specific destruction control element
  • C represents a cell cycle phase specific localisation control element
  • D represents a reporter gene
  • E represents a non-cell cycle specific LRES element
  • F represents a mammalian selectable marker
  • G represents a mammalian constitutive promoter
  • H represents a cell cycle specific IRES element
  • the construct comprises a cyclin Bl promoter, a cyclin Bl destruction box (D-box), a cyclin Bl cytoplasmic retention sequence (CRS) and a green fluorescent protein (GFP).
  • the nucleic acid reporter construct comprises an expression vector comprising the following elements: a) a vector backbone comprising: i) a bacterial origin of replication; and ii) a bacterial drug resistance gene; b) a cell cycle phase specific expression control element; c) a destruction control element; and d) a nucleic acid sequence encoding a reporter molecule.
  • the nucleic acid reporter construct additionally contains a cell cycle phase-specific spatial localisation control element and/or a eukaryotic drug resistance gene, preferably a mammalian drug resistance gene.
  • Expression vectors may also contain other nucleic acid sequences, such as polyadenylation signals, splice donor/splice acceptor signals, intervening sequences, transcriptional enhancer sequences, translational enhancer sequences and the like.
  • the drug resistance gene and the reporter gene may be operably linked by an internal ribosome entry site (IRES), which is either cell cycle specific (Sachs, et al, Cell, (2000), 101, 243-245) or cell cycle independent (Jang et al, J. Virology, (1988), 62, 2636-2643 and Pelletier and Sonenberg, Nature, (1988), 334, 320-325), rather than the two genes being driven from separate promoters.
  • IRS internal ribosome entry site
  • the nucleic acid reporter construct is assembled from a DNA sequence encoding the cyclin Bl promoter operably linked to DNA sequences encoding 171 amino acids of the amino terminus of cyclin Bl and a DNA sequence encoding a green fluorescent protein (GFP) (Figure 8).
  • the construct illustrated in Figure 8 contains a cyclin Bl promoter (A), cyclin Bl destruction box (D-box) (B), cyclin Bl CRS (C) and a GFP reporter (D).
  • cyclin Bl This is necessary to target cyclin Bl to the ubiquitination machinery and, in conjunction with at least one C-terminal lysine residue, this is also required for its cell-cycle specific degradation; ii) an approximately ten amino acid nuclear export signal (NES).
  • NES nuclear export signal
  • This motif is recognised, either directly or indirectly, by exportin 1 and is sufficient to maintain the bulk of cyclin Bl in the cytoplasm throughout interphase; iii) approximately four mitosis-specific phosphorylation sites that are located in and adjacent to the NES and confer rapid nuclear import and a reduced nuclear export at mitosis.
  • the construct When expressed in a eukaryotic cell, the construct will exhibit cell cycle specific expression and destruction of the GFP reporter which parallels the expression and degradation of endogenous cyclin Bl.
  • nucleic acid reporter construct according to the first aspect may be constructed by selecting suitable alternative cell cycle control elements, for example from those shown in Tables 1 and 2, to design cell cycle phase reporters which report a desired section of the cell cycle.
  • Suitable vector backbones which include bacterial and mammalian drug resistance genes and a bacterial origin of replication include, but are not limited to: pCI-neo (Promega), pcDNA (Invitrogen) and pTriExl (Novagen).
  • Suitable bacterial drug resistance genes include genes encoding for proteins that confer resistance to antibiotics including, but not restricted to: ampicillin, kanamycin, tetracyclin and chloramphenicol.
  • Eurkaryotic drug selection markers include agents such as: neomycin, hygromycin, puromycin, zeocin, mycophenolic acid, histidinol, gentamycin and methotrexate.
  • the DNA construct may be prepared by the standard recombinant molecular biology techniques of restriction digestion, ligation, transformation and plasmid purification by methods familiar to those skilled in the art and are as described in Sambrook, J. et al (1989), Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press.
  • the construct can be prepared synthetically by established methods, e.g. the phosphoramidite method described by Beaucage and Carufhers, (Tetrahedron Letters, (1981), 22, 1859-1869) or the method described by Matthes et al (EMBO J., (1984), 3, 801- 805).
  • oligonucleotides are synthesised, e.g.
  • the DNA construct may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance, as described in US4683202 or by Saiki et al (Science, (1988), 239, 487-491). A review of PCR methods may be found in PCR protocols, (1990), Academic Press, San Diego, California, U.S.A.
  • PCR polymerase chain reaction
  • the gene sequence encoding the reporter must be joined in frame with the cell cycle phase specific destruction control element and optionally the spatial localisation control element.
  • the resultant DNA construct should then be placed under the control of one or more suitable cell cycle phase specific expression control elements.
  • the host cell into which the construct or the expression vector containing such a construct is introduced may be any cell which is capable of expressing the construct and may be selected from eukaryotic cells for example, from the group consisting of a mammalian cell, a fungal cell, a nematode cell, a fish cell, an amphibian cell, a plant cell and an insect cell.
  • the prepared DNA reporter construct may be transfected into a host cell using techniques well known to the skilled person. One approach is to temporarily permeabilise the cells using either chemical or physical procedures. These techniques may include: electroporation (Tur-Kaspa et al, Mol. Cell Biol.
  • cationic lipid based methods may be used to introduce DNA into cells (Stewart et al, Human Gene Therapy, (1992), 3, 267; Torchilin et al, FASEB J, (1992), 6, 2716; Zhu et al, Science, (1993), 261, 209-211; Ledley et al, J. Pediatrics, (1987), 110, 1; Nicolau et al, Proc.Nat. Acad.Sci.,USA, (1983), 80, 1068; Nicolau and Sene, Biochem.Biophys.Acta, (1982), 721, 185-190).
  • Superfect Qiagen
  • Fugene ⁇ Fugene ⁇
  • Jiao et al, Biotechnology, (1993), H, 497-502) describe the use of bombardment mediated gene transfer protocols for transferring and expressing genes in brain tissues which may also be used to transfer the DNA into host cells.
  • a further alternative method for transfecting the DNA construct into cells utilises the natural ability of viruses to enter cells.
  • Such methods include vectors and transfection protocols based on, for example, Herpes simplex virus (U.S. Pat 5288641), cytomegalovirus (Miller, Curr. Top. Microbiol. Jmmunol., (1992), 158, 1), vaccinia virus (Baichwal and Sugden, 1986, in Gene Transfer, ed. R.
  • suitable recombinant host cells include HeLa cells, Vero cells, Chinese Hamster ovary (CHO), U2OS, COS, BHK, HepG2, NTH 3T3 MDCK, RUN, HEK293 and other mammalian cell lines that are grown in vitro. Such cell lines are available from the American Tissue Culture Collection (ATCC), Bethesda, Maryland, U.S.A. Cells from primary cell lines that have been established after removing cells from a mammal followed by culturing the cells for a limited period of time are also intended to be included in the present invention.
  • ATCC American Tissue Culture Collection
  • Cell lines which exhibit stable expression of a cell cycle position reporter may also be used in establishing xenografts of engineered cells in host animals using standard methods. (Krasagakis, K.J et al, Cell Physiol., (2001), 187(3), 386-91; Paris, S. et al, Clin.Exp.Metastasis, (1999), 17(10), 817-22). Xenografts of tumour cell lines engineered to express cell cycle position reporters will enable establishment of model systems to study tumour cell division, stasis and metastasis and to screen new anticancer drugs.
  • cells transfected with the DNA reporter construct may be cultured under conditions and for a period of time sufficient to allow expression of the reporter molecule at a specific stage of the cell cycle.
  • reporter molecule typically, expression of the reporter molecule will occur between 16 and 72 hours post transfection, but may vary depending on the culture conditions. If the reporter molecule is based on a green fluorescent protein sequence the reporter may take a defined time to fold into a conformation that is fluorescent. This time is dependent upon the primary sequence of the green fluorescent protein derivative being used. The fluorescent reporter protein may also change colour with time (see for example, Terskikh, Science, (2000), 290, 1585-8) in which case imaging is required at specified time intervals following transfection.
  • the nucleic acid reporter construct comprises a drug resistance gene
  • cells expressing the modified reporter gene may be selected by growing the cells in the presence of an antibiotic for which transfected cells are resistant due, to the presence of a selectable marker gene.
  • the purpose of adding the antibiotic is to select for cells that express the reporter gene and that have, in some cases, integrated the reporter gene, with its associated promoter, IRES elements, enhancer and termination sequences into the genome of the cell line.
  • a clonal cell line expressing the construct can be isolated using standard techniques. The clonal cell line may then be grown under standard conditions and will express reporter molecule and produce a detectable signal at a specific point in the cell cycle.
  • Example 1 Preparation of DNA construct i) The N-terminal third of the cyclin Bl mRNA (amino acids 1- 171), encoding the cyclin Bl destruction box and the NES was amplified with Hind ⁇ i and BamHI ends using standard PCR techniques and the following primers: GGGAAGCTTAGGATGGCGCTCCGAGTCACCAGGAAC
  • the gene for wtGFP was amplified with primers designed to introduce restriction sites that would facilitate construction of fusion proteins.
  • the PCR product was cloned into pTARGET (Promega) according to manufacturer's instructions and mutations (F64L/S175G/E222G) were introduced using the QuikChange site-directed mutagenesis kit (Stratagene). Constructs were verified by automated DNA sequencing. DNA encoding the mutant GFP was then cloned downstream of the cyclin Bl N-terminal region using BamHI and Sail restriction sites.
  • iii) The cell cycle dependent region of the cyclin Bl promoter (-150 -> +182) was amplified with SacII and HindL ⁇ sites and cloned upstream of the Cyclin Bl N-terminal region and the GFP fusion protein. iv) The promoter and recombinant protein encoding DNA was excised and cloned in place of the CMV promoter in a Bglll/Nhel cut pCI-Neo derived vector.
  • Example 2 Effect of cell cycle blocking agents on GFP fluorescence from cell cycle phase marker using transiently transfected cells
  • U2OS cells ATCC HTB-96
  • Cells were transfected with a cell cycle reporter construct prepared according to Example 1, comprising a cyclin Bl promoter operably linked to sequences encoding the cyclin Bl D-box, the cyclin Bl CRS, and GFP in a pCORON4004 vector (Amersham Biosciences) using Fugene 6 (Roche) as the transfection agent.
  • HeLa cells were micro-injected with the construct prepared according to Example 1 and examined by time lapse microscopy.
  • Differential interference contrast (DIC) images were made along with the corresponding fluorescence images.
  • a cell in metaphase showed bright fluorescence in the nucleus.
  • the same cell was imaged similarly at later times in anaphase and late anaphase.
  • the DIC images showed the division of the cell into two daughter cells, the corresponding fluorescence images showed the loss of fluorescence accompanying destruction of the fluorescent construct as the cell cycle progresses.
  • Example 4 - Stable cell line production U2-OS cells (ATCC HTB-96) were transfected with the construct described in Example 1 and grown for several months in culture media containing 1 mg/ml geneticin to select for cells stably expressing the construct. A number of clones were picked by standard methods (e.g. described in Freshney, Chapter 11 in Culture of Animal Cells, (1994) Wiley-Liss Inc) and a clone containing fluorescent cells was isolated. This cell line was maintained at 37°C in culture media containing 25 mM HEPES.
  • the green fluorescent protein reporter sequence in the vector described in example 1 was replaced with enhanced GFP (EGFP; Cormack, B.P. et al,
  • the EGFP gene is a brighter form of GFP containing the mutations F64L and S65T.
  • EGFP contains codons that have been altered to optimise expression in mammalian cells. This new construct was transfected into U2-OS cells and a number of colonies were isolated by selection with geneticin followed by sorting of single cells using a fluorescence activated cell sorter. These clones showed brighter fluorescence than those generated in example 4 and as expected fluorescence intensity and location appeared to vary according to the cell cycle phase of the cell.
  • screening assays are conducted using libraries of chemical compounds.
  • One or more multiwell plates are prepared using a cell line as described above. Whilst in the following embodiments a cell line including a cell cycle reporter construct as described in Example 1 above is used, it should be appreciated that any other of the described embodiments of cell line can be used in alternative embodiments.
  • a controlled amount of cells, referred to herein as a population is placed in a carrier solution in each of the wells of the plate and allowed to establish for a predetermined period, for example 24 hours.
  • a different one of the library of chemical compounds is added in a controlled concentration and amount to each of the wells and allowed to stand for a predetermined period, for example 24 hours.
  • a nuclear stain is added before imaging is conducted. In other embodiments of the invention, no nuclear stain is added before imaging is conducted.
  • imaging is conducted for each well of the plate in turn, using a confocal microscope as described above. A small area in the centre of each well, at the bottom of the well, is imaged to acquire image data in one or more channels of the selected area. The fluorescence detected in the confocal microscope is converted into one or more digital images in which the digital values are proportional to the intensity of the fluorescent radiation incident on each pixel of the detection device.
  • the processing and analysis of the image data in accordance with the invention comprises a number of discrete steps.
  • the image data are analyzed to identify areas of image data corresponding to individual cells.
  • Such object areas may be sub-cellular components of individual cells, such as the cell nuclei.
  • a binary mask is generated from one of the digital images in which all values meeting one or more criteria are replaced by one, all values failing to meet the criteria are replaced by zero.
  • the one or more criteria include a threshold value determined from an image taken in a set-up procedure for the assay.
  • the mask is searched for groups of contiguous value-one pixels to identify the object areas corresponding to individual cells. Next, measurements are made on the individual cells using the identified object areas.
  • Classification rules are applied to the measurements to classify individual cells into a selected one of a plurality of sub-populations of cells in different cell cycle phases. For each identified object area, values of the corresponding pixels in the same image or in another image are analysed. Measurements relating to the identified object areas are calculated from the positions of pixels in the image and the intensities of pixels in the image. The classification rules are applied to the calculated measurements to classify each identified cell in an analysed part of the image in turn, and the classification data are written to an output data file for the assay. In this way, it is possible to determine, in a high throughput automated process, cell cycle phase data indicative of the relative sizes of the plurality of sub-populations in the population of cells. The process is repeated in quick succession for each of the one or more images acquired in each of the wells of the plate in turn.
  • the cell cycle phase marker used has a fluorescence signal that varies according to the phase of the cell cycle of the cell in a manner which is illustrated in Figure 10.
  • Four different patterns can be distinguished in this embodiment of the invention: 1. G0/G1/S phase cells have relatively low expression of the cell cycle phase marker, both in the nucleus and the cytoplasm;
  • G2 cells have relatively low nuclear, and relatively high cytoplasmic, expression of the cell cycle phase marker 3.
  • M cells have relatively high nuclear expression, with substantially no cytoplasmic expression of the cell cycle phase marker;
  • P cells have relatively high nuclear, and relatively high cytoplasmic, expression of the cell cycle phase marker.
  • a nuclear marker producing fluorescence at a wavelength different to that of the cell cycle phase marker, is used in this embodiment to identify nuclear areas for each cell under analysis in the image data.
  • the nuclear marker may be one of the toxic intercalating nuclear dyes (such as DRAQ5TM or a HoechstTM dye, for example Hoechst 33342).
  • a non-toxic nuclear marked may be used in assays in which the same cell population is imaged and analysed to determine its relative cell cycle sub-populations a number of times during a time course study.
  • a non-toxic marker may be used in the form of an NLS-fluorescent protein fusion.
  • the ClontechTM pHcRedl-Nuc vector when transfected into a cell line in accordance with the present invention, produces a red fluorescence signal in the nucleus.
  • image acquisition an image of the cell nuclei is acquired in a first channel corresponding to the nuclear marker, a cell cycle phase analysis image is acquired in a second channel corresponding to the cell phase marker, and the two images are coregistered such that the pixels of each image are aligned.
  • the cell nuclei image is analysed first to identify nuclear areas in the image data.
  • the operator sets a nuclear signal threshold in the cell nuclei image by visually inspecting the image and the corresponding thresholded image to ensure that the threshold accurately differentiates the edges of the nuclear areas.
  • a segmentation algorithm for example a watershed segmentation algorithm (S. Beucher, F. Meyer, “Morphological Segmentation”, Journal of Visual Communication and Image Representation, 1:21-46, 1990 and Vincent, Soille, JEEE Transactions on Pattern Analysis and Machine Intelligence, 13:583-598, 1991) is applied to the thresholded image to uniquely identify the area of the nucleus of each individual cell being analysed.
  • two binary masks defining object areas in which the cell measurements are to be taken, are generated - an eroded nuclear mask (to sample the cell cycle phase marker intensity signal in the central part of nucleus) and a thin cytoplasmic ring (to sample the cell cycle phase marker intensity signal in the cytoplasm near the nucleus).
  • the nuclear object area is eroded from the edge of the nuclear object by a predetermined number of pixels, for example three pixels, to generate the eroded nuclear mask.
  • the nuclear object is dilated from its edge by a predetermined number of pixels, for example two pixels.
  • the two masks, generated for each individual cell as described above are then applied to the cell cycle phase analysis image.
  • the fluorescence signal intensities in each pixel in the eroded nuclear mask area are averaged to produce an average nuclear signal intensity (I n ) which represents the average intensity over the nuclear area.
  • the fluorescence signal intensities in each pixel in the thin cytoplasmic ring are averaged to produce an average cytoplasmic signal intensity (I c ) representing the average intensity within cytoplasmic sampling ring.
  • I c average cytoplasmic signal intensity
  • Three further thresholds are set by the operator, by inspecting the cell cycle phase analysis image and the measurements output for selected objects in the image, to enable the automatic classification process.
  • the operator manually selects cells corresponding to each of the different cell cycle phases and sets the thresholds to accurately differentiate between them.
  • the nuclear threshold (T n ) is set to separate G0/G1/S and G2 phase cells from M and P phase cells.
  • the value is selected to be approximately midway between that of typical M and P phase cells, which have relatively high average nuclear signal intensity, and that of typical G0/G1/S and G2 phase cells, which have relatively low average nuclear signal intensity.
  • the cytoplasmic threshold (7 ⁇ .) is set to separate G0/G1/S phase cells from G2 and P phase cells.
  • the value is selected to be approximately midway between that of typical G2 and P cells, which have relatively high average cytoplasmic signal intensity and that of typical G0/G1/S cells, which have relatively low average cytoplasmic intensity signal.
  • the nuclear/cytoplasmic intensity threshold (T nlc ) is set to separate M phase cells from P phase cells.
  • the value is selected to be approximately midway between the nuclear/cytoplasmic ratio for typical M phase cells, which is relatively low, and that of typical P cells, which is relatively high.
  • These thresholds are set by the operator selecting individual cell objects (for example by right-clicking a mouse when pointing at the relevant nucleus on screen). The comparison is repeated in a number of different wells of a plate, to ensure consistency of the settings across the whole assay.
  • a threshold selection can alternatively be made based on automatically- generated histograms or scatter-plots of the corresponding parameters in each well.
  • the thresholds themselves may also be determined automatically by the image processing application, based on measuring signals in a control well and adjusting the threshold to ensure that there is an expected proportion of cells seen in each cell cycle phase.
  • automated threshold selection can be performed by pattern recognition in the scatter plots or other data representation.
  • the image processing application may be adapted to learn to select thresholds based on the manual selections performed by the user in past assays. Once the threshold values are selected, the automated classification process can be conducted on all image data acquired in the assay.
  • the classification rules used to identify cell phases with the reference to the thresholds are in this embodiment as follows:
  • the results of the classification for each well, or at least some wells, of each plate in the assay is output as a data file including, against each well identifier, cell cycle phase population data output in the form of a percentage of the population (the sub-population) in each of the G0/G1/S, G2, M and P phases of the cell cycle.
  • cell cycle phase data may be output on a per-cell basis, once the cell cycle phase of the cell has been identified.
  • FIG. 11 shows the results obtained in one assay performed in accordance with the invention.
  • Stably transfected U2OS cells were treated with either colchicine (an M phase blocking drug) or mimosine (an agent known to cause a block in GO/Gl/S cell phase).
  • Cells, including unsynchronised cells as a control were analysed using the method of the present invention. Similar results were obtained when the cells were analysed by Fluorescence Activated Cell Sorter (FACS) analysis, indicating that the method of the invention reliably distinguished the cell cycle phases.
  • FACS Fluorescence Activated Cell Sorter
  • This embodiment is based upon the first embodiment, using a procedure as described above and with an adapted cell classification process.
  • An additional measurement parameter based on those described above, is calculated for each cell.
  • the cell classification rules can be based upon a reduced number of thresholds. This has the advantage of straightforward visualisation and therefore is more intuitive and accessible, and only two classification thresholds need to be defined.
  • This parameter is an absolute value (magnitude), and its value is used to differentiate between differences of the cell phases in combination with the average nuclear intensity signal I n .
  • the operator sets classification thresholds in a manner similar to that described above, however in this embodiment there are only two to be set.
  • the nuclear threshold ( T n ) is set to separate GO/Gl/S and G2 phase cells from M and
  • P phase cells The value is selected to be approximately midway between that of typical M and P phase cells, which have relatively high average nuclear signal intensity, and that of typical GO/Gl/S and G2 phase cells, which have relatively low average nuclear signal intensity.
  • a second threshold (T p ) is set to separate GO/Gl/S and P phase cells from G2 and M phase cells.
  • the value is selected to be approximately midway between that of typical GO/Gl/S and P phase cells, which have a relatively high value of the parameter p and that of typical G2 and M phase cells, which have a relatively low value of the parameter p.
  • the method of this embodiment provides a process for automatically classifying cells in different phases of the cell cycle based only on the cell cycle phase marker signal, and obviates the need for the use of a nuclear marker.
  • An image is acquired in only the channel corresponding to the fluorescence of the cell phase marker fluorescence.
  • a cell segmentation algorithm is applied once the image is thresholded to produce a binary cell mask for each cell.
  • the whole cell mask is generated using a signal threshold set by the operator by selecting typical G1S cells in the image and setting the threshold higher than the average nuclear signal intensity in these cells.
  • Cell cycle phase analysis is then based on combination of intensity, signal texture, size and shape parameters, specific for each of the phases of cell cycle. Cells from different cell cycle phases are identified via the setting of corresponding classification thresholds, as described in further detail below.
  • Exemplary measurement parameters calculated by the image processing and analysis software application in this embodiment include: /- Average intensity of signal within the cell;
  • H- Heterogeneity the area of the holes (groups of pixels with intensity below the threshold) inside the object
  • the phases to be identified preferably include each of GO/Gl/S, G2, M and P phase cells.
  • the mitotic cells can be distinguished into MP (metaphase) cells.
  • Early Gl phase cells can also be distinguished in this embodiment
  • margination parameter Mis used in the above example set of classification rules, it can be used in an alternative set.
  • the term "luminescence” as used herein is intended to include the phenomena of fluorescence and other types of luminescence such as chemiluminescence and phosphorescence.
  • the cell cycle position of the cells may be determined in various alternative embodiments of the invention by monitoring the expression of the reporter molecule and detecting luminescence signals emitted by the reporter using an appropriate detection device. If the reporter molecule produces a fluorescent signal, then, either a conventional fluorescence microscope, or a confocal based fluorescence microscope may be used. If the reporter molecule produces luminous light, then a suitable device such as a luminometer may be used.
  • the proportion of cells expressing the reporter molecule may be determined. If the DNA construct contains franslocation control elements and the cells are examined using a microscope, the location of the reporter may also be determined.
  • the fluorescence of cells transformed or transfected with the DNA construct may suitably be measured by optical means in for example; a spectrophotometer, a fluorimeter, a fluorescence microscope, a cooled charge-coupled device (CCD) imager (such as a scanning imager or an area imager), a fluorescence activated cell sorter, a confocal microscope or a scanning confocal device, where the spectral properties of the cells in culture may be determined as scans of light excitation and emission.
  • CCD charge-coupled device
  • a processing method which uses pre-stored classification rules to classify a selected cell into a selected one of a plurality of sub-populations of cells in different cell cycle phases
  • other classification methods may be implemented, such as the use of a neural network.
  • any feature described in relation to any one embodiment may be used alone, or in combination with other features described, and may also be used in combination with one or more features of any other of the embodiments, or any combination of any other of the embodiments.
  • equivalents and modifications not described above may also be employed without departing from the scope of the invention, which is defined in the accompanying claims.

Landscapes

  • Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Dispersion Chemistry (AREA)
  • Optics & Photonics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Multimedia (AREA)
  • Theoretical Computer Science (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/GB2003/003876 2003-04-02 2003-09-08 Determining cell cycle phase data Ceased WO2004088573A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA002520982A CA2520982A1 (en) 2003-04-02 2003-09-08 Determining cell cycle phase data
US10/550,362 US20060247862A1 (en) 2003-09-08 2003-09-08 Determining cell cycle phase data
EP03816506A EP1609111A1 (en) 2003-04-02 2003-09-08 Determining cell cycle phase data
AU2003260795A AU2003260795B2 (en) 2003-04-02 2003-09-08 Determining cell cycle phase data
JP2004570045A JP2006521785A (ja) 2003-04-02 2003-09-08 細胞周期相データの決定

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0307684.1A GB0307684D0 (en) 2003-04-02 2003-04-02 Determining cell cycle phase data
GB0307684.1 2003-04-02

Publications (1)

Publication Number Publication Date
WO2004088573A1 true WO2004088573A1 (en) 2004-10-14

Family

ID=9956096

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/003876 Ceased WO2004088573A1 (en) 2003-04-02 2003-09-08 Determining cell cycle phase data

Country Status (6)

Country Link
EP (1) EP1609111A1 (https=)
JP (1) JP2006521785A (https=)
AU (1) AU2003260795B2 (https=)
CA (1) CA2520982A1 (https=)
GB (2) GB0307684D0 (https=)
WO (1) WO2004088573A1 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007167057A (ja) * 2005-11-22 2007-07-05 Olympus Corp 微弱光多検体検査方法および装置ならびに検査システム
WO2007097816A2 (en) 2005-11-12 2007-08-30 General Electric Company Time-lapse cell cycle analysis of unstained nuclei
JP2007309776A (ja) * 2006-05-18 2007-11-29 Olympus Corp 顕微鏡装置および細胞観察方法
US8045782B2 (en) * 2004-12-07 2011-10-25 Ge Healthcare Niagara, Inc. Method of, and apparatus and computer software for, implementing image analysis protocols
JP2016194438A (ja) * 2015-03-31 2016-11-17 シスメックス株式会社 細胞撮像装置及び細胞撮像方法
EP2210081B1 (en) * 2007-10-29 2021-04-21 Menarini Silicon Biosystems S.p.A. Method for the identification and handling of particles
EP4549949A4 (en) * 2022-07-01 2025-12-31 Toppan Holdings Inc DETECTION DEVICE

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5408839B2 (ja) * 2006-10-20 2014-02-05 オリンパス株式会社 細胞周期解析方法
JP2008164551A (ja) * 2006-12-29 2008-07-17 Osaka Univ 細胞の評価方法、細胞測定用システム、及び細胞測定用プログラム
JP6953632B2 (ja) * 2018-07-09 2021-10-27 オリンパス株式会社 光分析装置、光分析方法および学習済みモデル

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4812394A (en) * 1983-10-18 1989-03-14 University Of California Flow cytomeric measurement of DNA and incorporated nucleoside analogs
US5856665A (en) * 1991-07-12 1999-01-05 Jeffrey H. Price Arc lamp stabilization and intensity control for imaging microscopy
WO2001011341A2 (en) * 1999-08-05 2001-02-15 Cellomics, Inc. A system for cell-based screening
US20010041347A1 (en) * 1999-12-09 2001-11-15 Paul Sammak System for cell-based screening
WO2003031612A2 (en) * 2001-10-05 2003-04-17 Amersham Biosciences Uk Limited Method for determining cell cycle position

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4812394A (en) * 1983-10-18 1989-03-14 University Of California Flow cytomeric measurement of DNA and incorporated nucleoside analogs
US5856665A (en) * 1991-07-12 1999-01-05 Jeffrey H. Price Arc lamp stabilization and intensity control for imaging microscopy
WO2001011341A2 (en) * 1999-08-05 2001-02-15 Cellomics, Inc. A system for cell-based screening
US20010041347A1 (en) * 1999-12-09 2001-11-15 Paul Sammak System for cell-based screening
WO2003031612A2 (en) * 2001-10-05 2003-04-17 Amersham Biosciences Uk Limited Method for determining cell cycle position

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8045782B2 (en) * 2004-12-07 2011-10-25 Ge Healthcare Niagara, Inc. Method of, and apparatus and computer software for, implementing image analysis protocols
US8885911B2 (en) * 2004-12-07 2014-11-11 Ge Healthcare Niagara, Inc. Method of, and apparatus and computer software for, implementing image analysis protocols
US20120057752A1 (en) * 2004-12-07 2012-03-08 Ge Healthcare Niagara, Inc. Method of, and apparatus and computer software for, implementing image analysis protocols
JP2009515533A (ja) * 2005-11-12 2009-04-16 ゼネラル・エレクトリック・カンパニイ 非染色核の微速度細胞周期解析
US7817841B2 (en) 2005-11-12 2010-10-19 General Electric Company Time-lapse cell cycle analysis of unstained nuclei
EP1946270B1 (en) * 2005-11-12 2011-11-02 General Electric Company Time-lapse cell cycle analysis of unstained nuclei
AU2006338566B2 (en) * 2005-11-12 2011-12-15 General Electric Company Time-lapse cell cycle analysis of unstained nuclei
WO2007097816A2 (en) 2005-11-12 2007-08-30 General Electric Company Time-lapse cell cycle analysis of unstained nuclei
JP2007167057A (ja) * 2005-11-22 2007-07-05 Olympus Corp 微弱光多検体検査方法および装置ならびに検査システム
JP2007309776A (ja) * 2006-05-18 2007-11-29 Olympus Corp 顕微鏡装置および細胞観察方法
EP2210081B1 (en) * 2007-10-29 2021-04-21 Menarini Silicon Biosystems S.p.A. Method for the identification and handling of particles
JP2016194438A (ja) * 2015-03-31 2016-11-17 シスメックス株式会社 細胞撮像装置及び細胞撮像方法
EP3076158A3 (en) * 2015-03-31 2016-12-21 Sysmex Corporation Cell imaging apparatus and cell imaging method
US10591709B2 (en) 2015-03-31 2020-03-17 Sysmex Corporation Cell imaging apparatus and cell imaging method
EP4549949A4 (en) * 2022-07-01 2025-12-31 Toppan Holdings Inc DETECTION DEVICE

Also Published As

Publication number Publication date
AU2003260795A1 (en) 2004-10-25
JP2006521785A (ja) 2006-09-28
EP1609111A1 (en) 2005-12-28
CA2520982A1 (en) 2004-10-14
AU2003260795B2 (en) 2008-11-06
GB0307684D0 (en) 2003-05-07
GB0327651D0 (en) 2003-12-31

Similar Documents

Publication Publication Date Title
US7369696B2 (en) Classification of cells into subpopulations using cell classifying data
JP4011936B2 (ja) 細胞に基づくスクリーニングシステム
DE69903337T2 (de) Ein screeningsystem auf zellbasis
US5117466A (en) Integrated fluorescence analysis system
DE69905049T2 (de) Auf zellen basiertes screening-system
DK2350617T3 (en) Fluorescence imaging apparatus and method
US7420674B2 (en) Method and arrangement for analyzing samples
US10180398B2 (en) Trajectory-based triggering system for hyperspectral imaging flow cytometer
US20210164883A1 (en) Cell analysis method, cell analysis device, and cell analysis system
US20030151741A1 (en) Method for investigating a sample
US20040063162A1 (en) System for cell-based screening
CN1829907A (zh) 生物实体的分析
AU2003260795B2 (en) Determining cell cycle phase data
US6005256A (en) Method and apparatus for performing cell analysis based on simultaneous multiple marker emissions from neoplasia (CASMMEN)
Sands et al. Measuring and sorting cell populations expressing isospectral fluorescent proteins with different fluorescence lifetimes
US20060247862A1 (en) Determining cell cycle phase data
EP3438644B1 (en) Cell analysis system
Kraus et al. Linear fluorescence unmixing in cell biological research
US20240346839A1 (en) Light microscopy method, device and computer program product
EP1439384B1 (en) A system for screening biological cells
US20230221178A1 (en) Apparatus and a method for fluorescence imaging
WO2018215624A1 (en) Method for image-based flow cytometry and cell sorting using subcellular co-localization of proteins inside cells as a sorting parameter
Sinclair et al. Hyperspectral imaging flow cytometer
EP1147400B1 (en) Imaging system for detecting fluorescent organic substances in a sample
JP2023137105A (ja) 品質評価方法及び品質評価プログラム

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 171037

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2003260795

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003816506

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2004570045

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2520982

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 2003816506

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006247862

Country of ref document: US

Ref document number: 10550362

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10550362

Country of ref document: US