WO2004083368A2

WO2004083368A2 - Molecular markers for the baking quality of wheat

Info

Publication number: WO2004083368A2
Application number: PCT/FR2004/000598
Authority: WO
Inventors: Arnaud Messager; Elisabeth Bervas; Laurent Linossier; Gilles Charmet; Marie-Reine Perretant; Cyril Groos
Original assignee: Genoplante-Valor
Priority date: 2003-03-14
Filing date: 2004-03-11
Publication date: 2004-09-30
Also published as: FR2852328A1; WO2004083368A3

Abstract

The invention relates to molecular markers for a region of wheat chromosome 3A, which can be used to asses the baking quality of a plant, a line or a variety of wheat, through the detection of one or more baking ability QTLs present in said region.

Description

MOLECULAR MARKERS OF THE BAKING QUALITY OF A WHEAT.

The present invention relates to new markers of the baking quality of a wheat, and to their use for improving it. The quality of wheat is a fundamental factor in international trade. However, each wheat sector having specific requirements, the definition of the quality of a wheat will depend considerably on the intended use. The “baking quality” of a wheat (we also speak of its “bread-making value”) defines its ability to make good bread.

Due to the large number of stages involved in the process of making a bread (or bread-making), the characteristics of a wheat to be taken into account to establish its bread-making value are multiple.

In France, the bread-making value is determined by the BIPEA test (Bureau Interprofessionnel d'Etudes Analytiques, AFNOR standard NF V03-716). This test is based on a standardized bread-making procedure and on a scoring grid of the evolution of the properties of the dough during kneading, shaping, finishing and baking. The quality of the finished product (volume of the bread, appearance of the crumb, of the crust) is also studied. The results of the BIPEA test are given in a scoring grid on 300 points, with intermediate ratings of dough, crumb and bread on 100 points.

However, these “life-size” tests for making a bread are costly both in time, in means and in quantity of flour (2.5 to 3 kg of grain, or 1.5 kg of flour for a test) . It is only possible to carry out such a test at the final stages of selection, when a large quantity of wheat grains is available.

Other tests, qualified as indirect, have been developed for use during the first stages of selection where the number of lines to be tested is high and the quantity of grains available for each line is very low. Among these tests, mention will be made in particular of the Chopin alveograph.

Chopin's alveograph consists in subjecting a dough piece to a constant flow of air and measuring the pressure inside the dough "bubble" thus formed. This extension reproduces the deformation of the dough under the influence of gas evolution. This test provides information on the toughness (P = maximum pressure at deformation), the extensibility (L = length of the curve) and the strength of the dough (W = energy supplied for the formation of a bubble up to rupture, proportional to the area under the curve). It is carried out at constant hydration and therefore does not take into account the differences in water absorption of the flour linked to the "hardness" of a wheat. However, all of these tests require, as for the BIPEA test, to have beforehand mature wheat plants to collect a sufficient quantity of grains (and therefore flour). In addition, these tests only study part of the stresses undergone by the flour during its transformation into bread and therefore only inform the breeders about certain characteristics of the dough.

Other indirect tests, usable on a small quantity of grain and from the first stages of selection, have been developed. These tests make it possible to estimate certain characteristics of wheat more specifically involved in the bread-making value of a wheat: the hardness of the grain and its protein content.

The hardness of a grain corresponds to its capacity to resist crushing and depends on the bonding strength between the components of the albumen. The hardness analysis methods focus on two aspects of the character: the grain's resistance to crushing itself and the condition of the flour particles. A frequently used method for the evaluation of this last parameter is near infrared reflection spectrometry, which is based on the principle according to which the near infrared reflection spectrum is sensitive to variations in size and distribution. particles from a sample ground (ROBERT and BERTRAND, Sci. Aliment., 5: 501-517, 1985). The infrared radiation penetrates less in a sample the smaller the particles in the sample, which leads to a decrease in the values of the absorbances. “Soft” wheats having a finer grain size than “hard” wheats (with identical milling method), the absorbance values of a standardized flour subjected to near infrared radiation will be all the lower as the wheat will be "soft" (WILLIAM, Cereal. Chem., 56: 169-172, 1979). It is therefore a method of indirect estimation of the “Particle Size Index”, AACC standard.

The protein content of the grain generally varies between 9 and 16% depending on the variety and the agro-environmental conditions. The use of near infrared spectroscopy allows rapid measurement of the protein level (WILLIAMS. 1979, cited above). This non-destructive method is carried out on whole grains.

Since bread-making is one of the main outlets for French wheat, the bread-making value of wheat is a major issue for breeders. However, because of the complexity of the characteristics associated with the baking quality of a wheat, the implementation of conventional methods of varietal selection to obtain plants having the desired properties can prove to be long and tedious. The identification and use of molecular markers linked to genes determining the bread-making value would speed up the selection process of wheat varieties with better bread-making value. Currently, an approach increasingly used to facilitate the obtaining of plants having a quantitative character of agronomic interest consists in locating chromosomal regions intervening in the variability of this character. These regions, called QTL (for “Quantitative Trait Locus”), are marked by molecular markers whose polymorphism explains a significant part of the variation of the character of interest. Basically, a QTL is a statistical object that we can define by (at least) two parameters: its position and its effect (additive).

When a QTL associated with the desired trait has been identified, it can then be used in various ways to obtain plants exhibiting this trait. For example, molecular markers of a QTL can be used to select plants carrying this QTL. This is in order to use these plants as a source of genetic material for the purpose of improving this trait of interest in other plants. The allele associated with this favorable QTL can then be introduced (for example by conventional introgression methods) into plants in which it is desired to improve this characteristic of interest; the effectiveness of this introgression can be controlled by the use of molecular markers associated with the QTL concerned, according to the usual procedures of selection assisted by markers (SAM) (Hospital and Charcosset, Genetics _r 147: 1469-1485, 1997).

As regards the bread-making value of a wheat, various QTLs of interest have already been identified.

Thus, SYMES (Aust. J. Agr. Res., 16: 113-123, 1965) has shown that the difference in hardness between varieties of wheat is essentially linked to a single gene, "Ha", positioned on the short arm chromosome 5D (MATTERN et al., Proc 4th Int. Wheat Genêt. Symp. Coloumbus, Missouri, 703-707, 1973; LAW et al., Heredi ty, 40: 133-151, 1978,). However, SOURDILLE et al. (Theor. Appl. Genêt., 93: 580-586, 1996) have shown by a QTL approach that this Ha gene explains 63% of the phenotypic variation in hardness. Other hardness studies, using a genetic analysis approach, have highlighted minor effects associated with chromosomes 2A, 4A, 4B, 7A (MATTERN et al. 1973, supra), 5A, 5B (MORRISON et al. , J. Cereal. Sci., 2: 145-152, 1989), 2A, 2D, 5B and 6D (SOURDILLE et al. 1996, cited above).

The study of substitution lines or monosomal lines made it possible to detect genetic factors controlling the amount of protein on the long and short arms of chromosome 5D (MORRIS et al., Proc 4th Int. Wheat Genêt. Sy p. Coloumbus, Missouri, 715-718, 1973; LAW et al., Seed Protein Improvment by Nuclear Techniques (ed) IAEA, 483-502, 1978), chromosome 5A (MORRIS et al. 1973, cited above), chromosomes 1A, 1B, 5B and 7A (STEIN IRA et al., Crop. Sci., 32: 581 -584, 1992). More recently, two QTL intervening at the level of 66% and 20% in the variation of this characteristic have been detected on chromosome 6B (JOPPA et al., Crop. Sci., 37: 1586-1589, 1997) and on chromosome 2D (PRASAD et al., Theor. Appl. Genêt., 99: 341-345, 1999) respectively.

Finally, some QTL studies concerning various components of bread-making value have made it possible to identify different genetic regions involved in the baking quality of a wheat (PERRETANT et al., Theor. Appl. Genêt., 100: 1167-1175, 2000 ; ZANETTI et al., Plant. Breed., 120: 13-19, 2001).

The inventors undertook to identify other QTLs associated with the bread-making value of a wheat. For this purpose, they analyzed the progeny of a cross between two varieties of wheat of good agronomic and baking value: the variety "Renan" and the variety "Récital". They thus detected a region, carried by chromosome 3A, which controls various characters influencing the baking quality of a bread: the strength of the dough, the protein level of the grain, the hardness of the grain, the volume of the bread and the value in bread making (bread note, dough note and total BIPEA test score). They identified in this region stable QTLs of bread-making capacity, as well as several molecular markers of these QTLs.

The subject of the present invention is the use of one or more molecular markers of the region of chromosome 3A bordered by the markers cfd079b and gwmδδb for the evaluation of the baking quality of plants, lines, or varieties of wheat.

We define here as "molecular marker" of the region of chromosome 3A mentioned above, any polynucleotide sequence included in this region and having a polymorphism correlated with the aptitude of a wheat for bread-making. These markers can be of different categories: as nonlimiting examples, they can be RFLPs (Restriction Fragment Length Polymorphism), AFLPs (amplification fragment length polymorphisms), RAPDs (random amplified polymorphic DNA), microsatellites, SNPs (Single Nucleotide Polymorphisms), STS (Sequence Tagged Sites) and in particular ESTs (Expressed Sequence Tags) or genes.

The present invention relates in particular to a method for evaluating the baking quality of a wheat, characterized in that it comprises the detection of the presence or absence in biological material originating from said wheat, of an allele of 'At least one molecular marker of the region of chromosome 3A defined above, said allele being associated with a high baking quality.

According to a preferred embodiment of the present invention, said molecular marker (s) are one or more microsatellite markers. According to a preferred arrangement of this embodiment, the said microsatellite marker (s) is (are) chosen from the markers gwm5, gwm068b, g m.369 and cfd79b. These four markers cover the entire region of chromosome 3A defined above.

Preferably, a combination of at least 2, advantageously at least 3, will be used, and very preferably a combination of the 4 markers.

These markers are known in themselves: g m.5 (also called WMS5), gwm068 (also called WMS68), g m369 (also called WMS369) have been described by RÔDER et al. {Genetics, 149: 2007-2023, 1998); cfd79 has been described by GUYOMARC'H et al. (Theor. Appl. Gen., 104: 1164-1172, 2002) and SOURDILLE et al. (Improvement of the genetic maps of wheat using new microsatellite markers. In: Proc. Plant and Animal Génome 'IX Conf. San Diego, CA, USA, 425: 167, 2001). Their characteristics are indicated below: gwm5: left primer: GAAAGGGCCAGGCTAGTAGT (SEQ ID N ° 1) right primer: CCAGCTACCTCGATACAACTC (SEQ ID N ° 2) Tm: 50 ° C

This marker is linked to a grain protein QTL, a dough strength QTL, a grain hardness QTL, a bread volume QTL (BIPEA test), a bread note QTL ( BIPEA test), and a dough note QTL (BIPEA test).

The size of the product of amplification of the favorable allele provided by the Renan variety is 168 bp. gwm68: left primer: AGGCCAGAATCTGGGAATG (SEQ ID N ° 3) right primer: CTCCCTAGATGGGAGAAGGG (SEQ ID N ° 4) Tm: 60 ° C

This marker is linked to a dough strength QTL, a bread volume QTL (BIPEA test), a bread note QTL (BIPEA test), a dough note QTL (BIPEA test), and a total score QTL (BIPEA test).

The size of the favorable allele amplification product provided by the Renan variety is 126 bp. gwm369: left primer: ACCGTGGGTGTTGTGAGC (SEQ ID N ° 5) right primer: CTGCAGGCCATGATGATG (SEQ ID N ° 6) Tm: 60 ° C

This marker is linked to a grain protein QTL, to a grain hardness QTL, and to a bread volume QTL (BIPEA test). The size of the product of amplification of the favorable allele provided by the Renan variety is 184 bp. cfd079: left primer: TCTGGTTCTTGGGAGGAAGA (SEQ ID N ° 7) right primer: CATCCAACAATTTGCCCAT (SEQ ID N ° 8) Tm: 60 ° C

This marker is linked to a grain hardness QTL.

The size of the favorable allele amplification product provided by the Renan variety is 284 bp. In the case in particular of the markers gwm5 and gwm369, the allele provided by the variety Renan appears moreover typical of this variety, which makes these markers particularly interesting for following the QTL in numerous intervarietal crosses involving the variety Renan.

From the information provided by the present invention on the chromosome region 3A defined above and the QTL located in ^this' region you, those skilled in the art can readily identify other molecular markers in this region and these QTL , by conventional methods, known in themselves. For example, it is possible, from a BAC library covering the area of interest of chromosome 3A, to define which are the positive clones, that is to say those for which the markers gwm.5 , g m068b, gwm369 and cfd79b hybridize. Each end of BAC clones can then be sequenced, thus generating new microsatellite or SNP markers if their polymorphism is correlated with the aptitude of a wheat for bread-making.

The molecular markers of the region of chromosome 3A defined above, and in particular the markers gwm.5, gwm068b, gwm369 and cfd79b, can be used to assess the potential for bread-making value of a plant, a line or a variety of wheat, by detection of one or more of the QTL associated with the bread-making value present in this region.

Plants, lines, or varieties with at least one QTL improved breadmaking value thus detected can be used ^'as a source of genetic material for improving the baking value of low or medium baking quality plants, for example by introgression of said QTL in said plants. The monitoring of this introgression can then be ensured using the molecular markers in accordance with the invention.

In the context of the implementation of the present invention, it is possible to use, according to the techniques known per se for selection assisted by markers, one or more several molecular markers of the region of chromosome 3A defined above and of the QTLs located in this region, at different stages of obtaining wheats having a good baking quality. The combination of markers covering this entire region of chromosome 3A, such as the markers gwm5, gwm068b, gwm369 and cfd79b, makes it possible to follow the introgression of several characteristics at the same time.

For example, the markers gwm5 and gwm.369, can be used, singly or, more advantageously, in combination, to follow the introgression of QTL in the crosses between Renan and many varieties, among which we can cite, from non-limiting examples, the Alloy, Altria, Apache, Aztec, Balthazar, Baltimor, Efal, Forby, Isengrain, Lorraine, Oracle, Ornicar, Qualital, Récital, Soisson, Sponsor varieties, for which the markers gwm5 and gwm369 are both polymorphs.

The present invention can be used in particular in Tri ticum aestivum, which is the main species used in baking. However, the microsatellite markers gwm5, gwm068b, gwm369 and cfd79b, being specific for the Triticaceae genome, they can also be transferred to diploid wheat Tri ticum monococcum, or tetraploid wheat Tri ticum durum. In particular, the marker gwm5 can be used in the context of improving the protein content of the grain which is a characteristic sought in these species.

The present invention also encompasses the use of polynucleotide probes or primers allowing the detection of the molecular markers defined above, and in particular the markers gwm5, gwm068b, gwm369 and cfd79b, in the context of the uses of said markers defined above.

The present invention also relates to a detection kit which can be used to evaluate the bread-making value of a wheat, characterized in that it comprises at least two pairs of primers allowing the amplification of two different markers chosen from gwm5, gwm068b, gwm369 and cfd79b. Preferably, the kits conform to the invention comprise three pairs of primers for amplification of three of ^'markers above, and particularly preferably, they contain four pairs of primers for amplification of four such markers.

The present invention will be better understood with the aid of the additional description which follows, which refers to a non-limiting example illustrating the demonstration of QTL of value in breadmaking. EXAMPLE: I- MATERIAL AND METHODS:

Population used:

For the mapping, a population made up of 194 recombinant F7 inbred lines (RIL for:

"Recombinant inbred ones") was used. This population was obtained from the cross between two varieties of European winter wheat: "Renan" and "Récital".

The first is characterized by a very good baking value, associated with a high protein content. The second is characterized by good baking quality despite a relatively low protein content. They also both have significant grain hardness.

The RILs were sown in France in 1999 in 6 different environments, namely Châlons en Champagne

(CHAL), Clermont-Ferrand (CF), Chartainvilliers (CVIL), Le

Moulon (LM), Mons (MO) and Rennes (RN).

Construction of the genetic map of the Récital x Renan population The genetic linkage map is constructed using RFLP, AFLP and microsatellite markers.

The RFLP analysis was carried out by non-radioactive labeling (cold probe) according to the protocol described by LU et al. {Agronomy, 14: 33-39, 1994). The technique for revealing microsatellite markers and AFLPs used is a non-radioactive silver nitrate method, described by TIXIER et al. [Journal of Genetics and Breeding, 51: 175-177, 1997).

The Renan x Récital (ReR) genetic map currently includes 525 loci distributed over 38 linkage groups covering a total of 2722.3 centiMorgans (cM) in genetic distance.

The analysis of the links is carried out using the Mapmaker / exp 3.06 software (LANDER et al., Genomics., 121: 185-199, 1987). The recombination frequencies are converted into distances in centiMorgans (cM) using the KOSAMBI mapping function (KOSAMBI, Ann. Eugen., 12: 172-175, 1944). The linking groups are assigned to chromosomes, using microsatellite loci, by comparison with the reference maps of Courtot X Chinese Spring and Synthetic X Opata described respectively by CADALEN et al. {Theo. Appl. Broom. , 94: 367-377, 1997) and RÔDER et al. (Genetics, 149: 2007-2023, 1998). QTL analysis

In a first step, an analysis of variance (ANOVA) is performed for each marker taken individually. The markers declared significant are then subjected to a multiple regression step to determine the subset of markers which remain significant together. The subset of markers thus defined is used as a source of covariates in the next step. The list of chromosomes carrying putative QTLs is established according to the marker ANOVA. The part of the trait explained by these markers is determined by the R ² of the multiple regression model. For each chromosome carrying a putative QTL, the location and the effect of this QTL are calculated by the “marker regression” method (HYNE V. and KEARSEY M., Theor. Appl Genêt., 91: 471-476, 1995). This method consists in performing a least squares adjustment between the values of the effects observed at the markers and the predicted values taking into account the frequency of recombination between the markers and the QTL. Statistical analysis :

All statistical character analyzes were performed using the SAS program (SAS Institute Inc., 1991). Pearson correlation coefficients between phenotypic data were estimated using the software program Splus (Splus guide to statistical and mathematical analyzes, Mathsoft, Seattle, Wash, 1993).

Parameters of bread-making capacity: Measurement of the rheological quality of the dough:

The rheological characteristics of the pastes are tested using the Chopin alveograph (ISO standard 5530-4).

Grain hardness measurement: Two different methods were used:

The hardness was evaluated on flour by analysis in the near infrared (NIR) using an Infra atic 8100. This method is standardized by the AACC (American Association of Cereal Chemists) under the reference 39-70A. The device is calibrated according to data from the ITCF laboratory (Technical Institute of Cereals and Fourrages) which is used as a reference in France.

The grain hardness was also measured according to AACC protocol 55-31, using the SKCS 4100 device (SKCS: Singel-Kernel Characterization System, GAINES et al., Cereal. Chem., 73: 278-283, 1996) sold by the company PERTEN INSTRUMENTS. This device measures the energy required to grind a grain; an average over a sample of 300 grains is established. Grain protein level measurement:

The method chosen for measuring the protein level in the grain is the method by infrared analysis of the whole grain standardized by the AACC (method 39-25).

Measurement of the bread-making value: The final bread-making test used in this method is the standardized test called "BIPEA" (NF V03-716). Four samples are processed simultaneously, at the same time as a control which is taken up for each analysis and which serves as a reference. II- RESULTS:

A set of QTLs associated with bread-making ability has been detected on chromosome 3A.

Figure 1 in the appendix represents the position of these QTLs on the chromosome, and their characteristics.

Figure 1 legend:

The vertical lines represent the confidence interval of the QTL (when it has been detected in several environments, only the shortest interval is represented). The numbers in parentheses next to these traits represent, for the first of them the number of environments where the QTL has been detected and for the second the highest value of R for this character. GPC: grain H protein levels _NIR '• grain hardness W: dough strength ol _pa i _n: bread volume (test BIPEA) Note _pa in: bread note (test BIPEA) Note _P ATE: note paste (BIPEA test) Note _to tai _e : total score (BIPEA test) QTL detection of grain protein content:

Table I below summarizes the grain protein content results obtained for the RILs and the parental lines in each environment.

Table I

The results obtained show that the two parental lines have very different grain protein content values. The fact that the bloodlines recombinant show average values close to those of the parental lines suggests the existence of weak epistatic effects. On the other hand, the variation in terms of protein content of the grain is greater in the RILs than in the parental lines. Thus, the difference between the lines with the highest grain protein contents and those with the lowest content is about double that between the Renan and Récital varieties. These results suggest that favorable alleles are carried by both parents.

Analysis of grain protein QTLs detected 4 stable QTLs (i.e. detected in at least 4 out of 6 environments). These QTLs are present on chromosomes 2A, 3A, 4D and 7D. Each of these QTLs explains about 10% of the phenotypic variation associated with the protein content of the grain. The grain protein QTL associated with chromosome 3A is detected in the 6 environments, and the favorable allele of this QTL is provided by the Renan line. The value of R ² varies from 4.1 to 8.3 depending on the environment tested.

Grain hardness QTL detection:

The differences in hardness between "hard" and "soft" wheats are mainly controlled by the Ha gene (SYMES, 1965, cited above). However, this gene does not explain all of the phenotypic variation associated with the hardness of the grain. In this study, the two cultivars used have the same allele of the Ha gene. Any variation in hardness is therefore independent of this gene, and is associated with genes potentially associated with minor variations in the hardness of the grain.

The hardness, determined according to the two different methodologies (NIR and SKCS) described in the examples, was analyzed in three environments (CF, CH and RN). Whichever method is used, the Renan cultivar has the highest hardness values. These analyzes each highlight 7 QTLs associated with the hardness of the grain. Five of them are detected by both methods, both by the NIR method and by SKCS, and account for approximately 29 to 37% of the phenotypic variation in hardness. The results for the hardness evaluated by NIR and SKCS are presented in Table II. Figure 1 illustrates the results for the hardness evaluated by NIR.

Detection of QTL associated with the strength of the dough (W):

This character was analyzed in three environments (CF, CH and RN). 11 markers linked to the strength of the paste were identified.

These markers together explain around 24 to 46% of the phenotypic variation associated with the strength of the dough.

Only a QTL, located on chromosome 3A, appears in the 3 environments studied with a maximum R ² of 10.8.

In this crossover, a significant relationship could be demonstrated between GPC and W. The QTL located on chromosome 3A for GPC colocalizes with that associated with W. This correlation between W and GPC may result from the effect of a gene influencing these two traits, or that of several closely related genes.

Detection of QTL associated with bread volume ( _Bread vol):

This character was analyzed in the three environments CF, CH and R. A QTL, located on chromosome 3A is detected in these 3 environments with a maximum R ² of 4.6.

Detection of QTL associated with the bread note (Note _pa i _n ):

This character was analyzed in the three environments CF, CH and RN.

The bread note shows a very wide range of variations within the descendants. For this note, Renan and Récital are relatively contrasting, Renan having more favorable characteristics than Récital. The population presents many transgressive lines on the part and others values of both parents. This note presents a bimodal aspect distribution, which could suggest the existence of a major gene explaining a large part of the variability of this note. A QTL was detected on chromosome 3A in 2 separate environments, with a maximum R ² of 7.9. Detection of QTL associated with the dough note ( _Dough note):

This character was analyzed in the three environments CF, CH and RN. A QTL was detected on chromosome 3A in one of these environments, with a maximum R ² of 5.3.

Detection of QTL associated with the total score (Note _to pillowcase):

This character has been analyzed in the CF, CH and RN environments. A QTL was detected on chromosome 3A in the 3 environments, with a maximum R ² of 9.3.

Claims

1) Method for evaluating the baking quality of a wheat, characterized in that it comprises the detection of the presence or absence in biological material originating from said wheat, of an allele, of at least one molecular marker of the region of chromosome 3A bordered by the markers cfd079b and gwm68b, said allele being associated with a high baking quality.

2) Method according to claim 1, characterized in that the (s) said (s) marker (s) molecular (s) comprise one or more marker (s) microsatellite (s).

3) Method according to claim 2, characterized in that the (s) said (s) marker (s) microsatellite (s) is (are) chosen (s) from the markers gwm5, gwm068b, gwm369 and cfd79b.

4) Method according to claim 3, characterized in that a combination of at least 2 of the markers gwm5, gwm068b, gwm369 and cfd79b is used.

5) Method according to claim 4, characterized in that a combination of the 4 markers gwm.5, gwm068b, gwm369 and cfd79b is used.

6) Use of one or more molecular markers of the region of chromosome 3A bordered by the markers cfd079b and gwmδδb, for the evaluation of the baking quality of plants, lines, or varieties of wheat.

7) Use of one or more molecular markers of the region of chromosome 3A bordered by the markers cfd079b and gwm68b, for monitoring the introgression of at least one QTL of value in bread-making carried by said chromosomal region in a line or variety of wheat.

8) Detection kit which can be used to evaluate the bread-making value of a wheat, characterized in that it comprises at least two pairs of primers allowing the amplification of two different markers chosen from gwm5, gwm068b, gwm369 and cfd79b.