WO2004065593A1 - Recombinant bovine pepsin and pepsinogen produced in prokaryotic and eukaryotic cells - Google Patents

Recombinant bovine pepsin and pepsinogen produced in prokaryotic and eukaryotic cells Download PDF

Info

Publication number
WO2004065593A1
WO2004065593A1 PCT/ES2004/070002 ES2004070002W WO2004065593A1 WO 2004065593 A1 WO2004065593 A1 WO 2004065593A1 ES 2004070002 W ES2004070002 W ES 2004070002W WO 2004065593 A1 WO2004065593 A1 WO 2004065593A1
Authority
WO
WIPO (PCT)
Prior art keywords
pepsinogen
bovine
plasmid
sequence
recombinant
Prior art date
Application number
PCT/ES2004/070002
Other languages
Spanish (es)
French (fr)
Other versions
WO2004065593B1 (en
Inventor
Ramón GONZALEZ GARCIA
Rosario MUÑOZ MORENO
José Luis GARCÍA LÓPEZ
Original Assignee
Consejo Superior De Investigaciones Científicas
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Consejo Superior De Investigaciones Científicas filed Critical Consejo Superior De Investigaciones Científicas
Publication of WO2004065593A1 publication Critical patent/WO2004065593A1/en
Publication of WO2004065593B1 publication Critical patent/WO2004065593B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6478—Aspartic endopeptidases (3.4.23)
    • C12N9/6481—Pepsins (3.4.23.1; 3.4.23.2; 3.4.23.3)

Definitions

  • the present invention falls within the Agrifood Area, in the Dairy Industry Sector, and may affect the subsectors of production of cheeses and bioactive peptides.
  • the proteolytic activity of the pepsin obtained makes it interesting for any application in which an extremely pure aspartic protease is needed.
  • the decrease in pH produced during fermentation can itself cause the coagulation of the milk, but in most cases the objective is to achieve a mixed, acidic and enzymatic coagulation, in which, in addition to the decrease in pH, the proteolytic enzyme action [Cheese: chemistry, physics and microbiology. Ed P.F. Fox. Elsevier Applied Science. London, 1987].
  • proteolytic enzyme used in cheese making is chymosin, which is the most abundant enzyme in lactating calf rennet. This protease specifically hydrolyzes the F105-M106 bond of K-casein, which is found on the surface of casein micelles and is an essential factor for its stability [Fox, PF (1993) Exogenous enzymes in dairy technology- A review. J. Food. Biochem 17: 173-199].
  • the curd thus obtained is then subjected to the cutting and desuerado processes, and subsequently to the salting and molding processes.
  • the result of all this is fresh cheese, which can be marketed as such or undergo the curing process, during which a series of physical-chemical changes occur that influence the characteristics of the final product.
  • Most of these changes are a consequence of the metabolic activity of bacteria and, in some cheeses, of filamentous fungi, with notable influence of the proteolytic activities of milk, residuals of rennet or those produced by the microorganisms present [Izco, JM , Torre, P., Barcina, Y. (1999) Accelerated cheese maturation. Revision. Food. June 99: 135-144].
  • proteolysis in cheeses are the modification of texture and aroma.
  • the contribution to aroma is due to the release of peptides and amino acids, which in turn can be a substrate for other reactions that produce compounds that influence taste and aroma, by deamination, decarboxylation or desulfurization thereof.
  • the desirable extent of proteolysis in a cheese depends on the type in question, and different methodologies have been developed in order to accelerate it, thereby reducing cure times, and consequently production costs.
  • Pepsin like chymosin, is secreted in the abomasum of ruminants in the form of an inactive zymogen (pepsinogen and prochymosin, respectively).
  • pepsinogen and prochymosin respectively.
  • These zymogens have an N-terminal extension that prevents enzymatic activity, but as a result of the low pH of the environment in which they are secreted, autocatalytic proteolytic processing that releases the mature protease occurs [Richter ,, C, Tanaka, T., Yada , RY (1998)
  • the sequence of the first 110 amino acids of the amino terminal end of bovine pepsinogen has been determined experimentally from purified bovine abomasum protein [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1) and the sequence overlapping the activation fragment.
  • Bobine Pepsin the sequence of the first 65 amino acid residues (completing the sequence of the first 110 residues of bovine pepsinogen).
  • FEBS Lett. 35: 133-136 The sequence of the first 110 amino acids of the amino terminal end of bovine pepsinogen has been determined experimentally from purified bovine abomasum protein [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1) and the sequence overlapping the activation
  • pepsin is an enzyme with similar but different properties than chymosin. These properties make it suitable to accelerate the ripening of cheeses if used in combination with pepsin in certain proportions.
  • the use of a pepsin preparation with a richness of 97% does not seem to imply
  • HAS DE TIT CI ⁇ N RULE 26 Recombinant enzymes also have the advantage, over those of animal origin, of guaranteeing compliance with religious protocols such as Halal or Kosher and of satisfying the demand of vegetarian consumers [Vegetarian Society information sheet. http://www.veqsoc.org].
  • Bioactive peptides are a series of molecules that have been identified in recent years for their beneficial properties for human health through a series of mechanisms that include antihypertensive, antihypercholesterolemic, antimicrobial or prebiotic activities. Many of these peptides are found in food or are obtained from them, as a result of the activity of certain proteases on precursor proteins. At present there is a tendency to try to produce and isolate these bioactive peptides as a way to revalue products or by-products of the food industry.
  • Bovine pepsin is an interesting enzyme for its biotechnological production because it is part of the natural rennet used traditionally in cheese making. This enzyme also contributes to the coagulation of milk by its action on the same bond (F105-M106) of the ⁇ -casein on which chymosin acts, although the proteolytic activity of this enzyme is greater and more nonspecific than that of the chymosin [Fox, PF (1993) Exogenous enzymes in dairy technology- A review. J. Food. Biochem 17: 173-199].
  • rennet containing pepsin as well as in cheeses made with recombinant rennet to which natural bovine pepsin has been added, a greater residual proteolytic activity is observed, which results in maturation rates
  • Whey proteins that originate bioactive peptides after digestion include ⁇ -lactobglobulin, alpha-lactalbumin, lactoferrin, bovine seralbumin and the macropeptide casein.
  • the macropeptide casein is hydrolyzed by the action of bovine pepsin [Shameet, KM, Brown, RJ, McMahon, DJ (1992) Proteolitic activity of proteinases on macropeptide isolated from K-casein. J. Dairy Sci. 75: 1380-1388]. Therefore, it is a great advantage to have pure recombinant bovine pepsin, since its use would allow the selective generation of specific bioactive sequences from milk and cheesemaking sera. Similarly, recombinant bovine pepsin can be used on any other protein substrate to obtain bioactive peptides, such as
  • E SUBSTITUTION RULE 26 from royal jelly [Matsui, T., Yuliyoshi, A., Doi, S., Sugimoto, H., Yamada, H., Matsumoto, K. (2002) Gastrointestinal enzyme production of bioactive peptides from royal jelly protein and their anthypertensive ability in SHR. J. Nutritional Biochem. 13: 80-86].
  • the present invention consists in the design and implementation of a method for producing recombinant bovine pepsinogen in microorganisms such as for example in Escher ⁇ chia coli bacteria and in Saccharomyces cerevisi33 yeast.
  • This invention allows pepsinogen and pepsin to be obtained without the need to use materials of animal origin, thus avoiding suspicions about the healthiness of products obtained from mammal viscera or about their adaptation to certain religious rituals, which affect large groups of the population .
  • Possible applications of the recombinant pepsinogen and pepsin obtained include cheese making and obtaining bioactive peptides.
  • a 148 bp DNA fragment containing the region coding for the N-terminal amino acids that are absent in pBP4B was synthesized from pBPUO, in addition to the sequence corresponding to the 5 'position region of the deletion and part of the region corresponding to said deletion. This fragment served to restore the sequence obtained
  • plasmid pBP05 was constructed to produce bovine pepsinogen in Saccharomyces cerevisise, strain BY4741 ( Figure 4). This plasmid has been designed to allow the secretion of bovine pepsinogen by yeast cells. The producing strain transformed with this plasmid is deposited in the Spanish Type Culture Collection (CECT) with the identification number CECT11778, and protected in accordance with the provisions of the Budapest Treaty.
  • CECT Spanish Type Culture Collection
  • plasmids pBP4B (clone 1Abo04B07 of a bovine abomasum cDNA library from the University of Alberta, Canada) [MAGPIE Automated Genomics Project Investigation Environment; http://magpie.ucalgary.ca/magpie/cattle_ests/private/] and pBPMO (clone 103110 of MARC 3BOV cDNA library, in vector pCMV SPORT6, from the Children's Hospital Oakland Research Institute MI) [Smith, TPL, Grosse, WM, Freking, BA, Roberts, AJ, Stone, RT, Casas, E., Way, JE, White, J., Cho, J., Fahrenkrug, SC, Bennett, GL, Heaton, MP, Laegreid, WW, Rohrer, GA, Chitko-McKown, CG, Pertea, G., Holt, I., Kara
  • the cDNA-PBP3 primer contained the following elements: sequences identical to the multiple cloning site (MCS) of plasmid pBlueScript SK-, which flank the 5' end of the partial cDNA of the pepsinogen that It is found in plasmid pBPHO; a synthetic sequence encoding the four amino acids of the N-terminal end of the pepsinogen absent in the pBP4B construct [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1) and the sequence overlapping the activation fragment. FEBS Lett.
  • the cDNA-PB2 primer contained sequences complementary to the 5' flank of the internal deletion of the pepsinogen cDNA which It is in the pBPUO construction (see Table 1)
  • the reaction mixture contained the following components in a final volume of 50 ⁇ l: template plasmid (pBPMO) 0.5 ⁇ g, Pfu TURBO (Stratagene) 2.5
  • This product was used as a primer for a polymerization reaction in a thermocycler with plasmid pBP4B as a template.
  • the reaction mixture contained the following components in a final volume of 50 ⁇ l: 0.5 ⁇ g template plasmid, Pfu TURBO (Stratagene) 2.5 units, Pfu TURBO (Stratagene) 1X buffer, 0.1 mM dATP, dTTP 0 , 1 mM, 0.1 mM dGTP, 0.1 mM dCTP, 1/5 of the product recovered from the previous PCR and csp water
  • This reaction mixture was introduced into the programmed thermal cycler as follows: '"an initial stage a 95 ° C for 1 minute and a half, 30 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 10 minutes, and a final stage of 15 minutes at 68 ° C.
  • the insert present in this plasmid was completely sequenced to verify that the synthetic cDNA encoding methionyl pepsinogen was complete and had no mutations.
  • the strain transformed with this plasmid is deposited in the CECT with the identification number CECT5722, and protected in accordance with the provisions of the Budapest Treaty.
  • the Xba-PB primer was used (see Table 1), which contains an X ⁇ bal restriction target that contains part of the ribosome binding site and facilitates subsequent ligation with the plN-lll vector (lpp p -5) -A3, followed by the pepsinogen sequence but changing some nucleotides of the first 5 amino acids according to the use of codons most used in E. coli, and the Hind-PB primer (see Table 1), which contains sequences complementary to the last codons of the pepsinogen cDNA in addition to several additional termination codons in each of the reading phases and a Hind ⁇ restriction target (see Table 1).
  • the reaction mixture contained the following components in a final volume of 50 ⁇ l: 0.5 ⁇ g mold plasmid, Pfu TURBO (Stratagene) 2.5 units, Pfu TURBO buffer (stratagene) 1X, dAT s 0.1 mM P, 0.1 mM dTTP, 0.1 mM dGTP, 0.1 mM dCTP, 400 nM primers each and csp water
  • This reaction mixture was introduced into the programmed thermal cycler as follows: an initial stage at 95 ° C for 1 minute and a half, 20 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 3.5 minutes, and a final stage of 15 minutes at 68 ° C.
  • the 1.15 kb cDNA insert of pBP01 containing the bovine pepsinogen coding sequence was cloned into Saccharomyces cerevisiae using the 5.9 kb expression vector pYES2 (Invitrogen).
  • both plasmid pBP01 and vector pYES2 were digested with the restriction enzymes Xho ⁇ and Sac ⁇ and purified from an agarose gel, using a commercial QUIAGEN kit the bands corresponding to the digested vector and the insert of 1 , 3 kb of pBP01. These DNA fragments were ligated and the ligation mixture was used to transform competent E. coli DH5 ⁇ cells.
  • plasmid pBP04 A recombinant clone containing plasmid pBP04 was selected ( Figure 4).
  • the bovine pepsinogen cDNA is under the control of a yeast promoter that is induced by galactose and repressed by glucose, in a vector that replicates and contains a selection marker for S. cerevisi ⁇ .
  • plasmid pBP04 was used as the basis for constructing plasmid pBP05, which contains a transcriptional fusion in which the pepsinogen is preceded by a signal peptide for the secretion of the alpha factor of S cerevisiae First, S.
  • BP05A contains, in the 5'-3 ⁇ sense sequences identical to the multiple cloning site (MCS) of plasmid pYES2, which flank the 5 'end of the pepsinogen cDNA found in plasmid pBP04, a synthetic sequence with restriction targets Sac ⁇ and EcoRI and sequences identical to the 5 'end of the gene that encodes the S. cerevisise pheromone alpha.
  • MCS multiple cloning site
  • SUBSTITUTE SHEET (RULE 26) BP05B also contains, in the 5'-3 'sense, sequences complementary to the N-terminal end of the reconstructed bovine pepsinogen cDNA, in fusion with sequences complementary to the C-terminal end of the alpha factor signal peptide (see Table 1).
  • the reaction mixture contained the following components in a final volume of 50 ⁇ l: 1 ⁇ g genomic DNA, Pfu TURBO (Stratagene) 2.5 units, buffer for Pfu TURBO (Stratagene) 1X, 0.1 mM dATP, 0.1 dTTP mM, 0.1 mM dGTP, 0.1 mM dCTP, 400 nM primers each and csp water
  • This reaction mixture was introduced into the programmed thermal cycler as follows: an initial stage at 95 ° C for 1 minute and a half, 25 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 1 minute, and a final stage of 15 minutes at 68 ° C.
  • This product was used as a primer for a polymerization reaction with plasmid pBP04 as a template.
  • the reaction mixture contained the following components in a final volume of 50 ⁇ l: 0.5 ⁇ g template plasmid, Pfu TURBO (Stratagene) 2.5 units, Pfu TURBO buffer (stratagene) 1X, 0.1 mM dATP, dTTP 0 , 1mM, 0.1mM dGTP, 0.1mM dCTP, 1/5 of the product recovered from the previous PCR and csp water
  • This reaction mixture was introduced into the programmed thermal cycler as follows: an initial stage at 95 ° C for 1 and a half minutes, 30 three-stage cycles: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 25 minutes, and a final stage of 15 minutes at 68 ° C.
  • Plasmid pBP05 was purified from E. coli strain DH5 ⁇ (pBP05) by a commercial PROMEGA kit (Wizard miniprep) and used to transform S. cerevisise BY4741 cells by the lithium acetate method [The LiAc TRAFO Method Page http://www.umanitoba.ca/faculties/medicine/biochem/gietz/method.html].
  • the Transforming strain expressing the translational fusion of bovine pepsinogen with the alpha factor signal peptide under the control of the GAL1 gene promoter is deposited in the CECT with the identification number CECT11778, and protected according to the provisions of the Budapest Treaty .
  • Example 1 Production of recombinant bovine pepsinoqen in E. coli E. coli DH5 ⁇ cells transformed with plasmid pBP03 (strain CECT5723), which contains the Met-cDNA of bovine pepsinogen under the control of an IPTG inducible promoter, were incubated in LB medium supplemented with 50 ⁇ g / ml ampicillin, at 37 ° C and 220 rpm. As a control, cells transformed with the plN-lll-A3 vector were used. These cultures were used to inoculate the same fresh medium medium and incubate it under the same conditions.
  • plasmid pBP03 strain CECT5723
  • IPTG isopropyl- ⁇ -D-thiogalactoside
  • Each assay contained 350 ⁇ l of extract diluted 1/10 in buffer 1 (0.01 M HCl, 0.1 M NaCl, pH 2.0) and 350 ⁇ l of hemoglobin, plus the amount of 0.3 M HCl calculated above.
  • the reactions were incubated for 24 hours at 37 ° C and stopped by adding 700 ⁇ l of 5% TCA. After incubating 10 minutes on ice, centrifuged at 13,000 rpm for 10 minutes in a table microcentrifuge and the OD was measured at 280 nm of the supernatants, in order to estimate the amount of hydrolyzed hemoglobin during the test time.
  • the OD controls at 280 nm of the pre-hydrolysis reaction mixtures were prepared by reversing the order of addition of the substrate and the TCA, so that there was no time for hydrolysis. To calculate the activity, the difference of OD at 280 nm between the test at time 0 and 24 hours was taken into account.
  • Table 2 shows the activity of the total and soluble extracts of strain CECT5723, expressed as equivalent in weight of commercial swine pepsin under the same test conditions. As can be seen, the production of recombinant bovine pepsinogen by E. coli DH5 ⁇ has been achieved.
  • Example 2 Production of recombinant bovine pepsinoqen in S. cerevisiee S. cerevisiae BY4741 cells transformed with plasmid pBP05 (strain CECT11778), which contains the bovine pepsinogen Met-cDNA under the control of a galactose-inducible promoter, were incubated during overnight at least half without uridine or uracil, with glucose as a source of carbon at 30 ° C and 200 rpm. As ⁇ control cells transformed with the vector pYES2 were used. These cultures were used to inoculate minimal medium without uridine or uracil, with galactose as a carbon source to a D.O.
  • SUBSTITUTE SHEET RULE 26 0.5 g of glass beads were added and stirred on a tube shaker for 5 minutes to obtain the total cell extract. These samples were used to carry out a proteolytic activity test against hemoglobin in the same way as in the example. First, the amount of 0.3M HCl needed to bring each sample to pH 2.0 was calculated. Each assay contained 350 ⁇ l supernatant, or extract diluted 1/10 in buffer 1 (0.01 M HCl, 0.1 M NaCl, pH 2.0), and 350 ⁇ l hemoglobin, plus the amount of HCl 0, 3 M calculated above. The reactions were incubated for 24 hours at 37 ° C and stopped by adding 700 ⁇ l of 5% TCA.
  • Fig. 1 Alignment of the amino terminal sequence of the pepsinogen, determined experimentally, with the conceptual translation of the inserts contained in plasmids pBP4B and pBPHO. In the second case it has been necessary to change the reading phase to obtain a sequence identical to pepsinogen from the 3 'flank of the 118 bp deletion.
  • Fig. 2. Scheme of the construction of plasmid pBPOL The sequences corresponding to the vectors pCMV-SPORT6 and pBlueScript SK- appear in gray and black colors respectively.
  • the cDNA sequence of the bovine pepsin gene appears white or striped, depending on the original clone from which it was obtained.
  • the cDNA deletion of the pBPHO clone is represented by a dotted line.
  • Fig. 3 Scheme of the construction of plasmid pBP03.
  • the sequences corresponding to the vectors piN-lll (lppp-5) A3 and pBlueScript SK- appear in gray and black colors respectively.
  • the arrowhead indicates the direction of transcription from the promoter in plasmid plN-lll (lppp-5) A3.
  • the synthetic cDNA sequence encoding methionyl pepsinogen appears as a white arrow.
  • Fig. 4. Scheme of the construction of plasmids pBP04 and pBP05.
  • the sequences corresponding to the vectors pYES2 and pBlueScript SK- appear in gray and black colors respectively.
  • the arrowhead indicates the direction of transcription from the GAL1 promoter in plasmid pYES2.
  • the synthetic cDNA sequence encoding methionyl pepsinogen appears as a white arrow.
  • the sequence encoding the alpha factor signal peptide appears as a striped rectangle.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a system for the production of recombinant bovine pepsin, comprising the construction, using different cDNAs and synthetic sequences, of a cDNA which can be expressed in microbial, prokaryotic or eukaryotic cells, and the conditions for the production of said pepsin in micro-organisms. Said enzyme can be used for the same applications as the native bovine enzyme, but without the sanitary risk associated with the use of animal tissues.

Description

TítuloTitle
PEPSINA Y PEPSINÓGENO BOVINOS RECOMBINANTES PRODUCIDOSPEPSINA AND PEPSINÓGENO RECOMBINANT BOVINE PRODUCED
EN CÉLULAS PROCARIOTAS Y EUCARIOTASIN PROCEDURAL AND EUCHARIOT CELLS
Sector de la TécnicaTechnical Sector
La presente invención se encuadra dentro del Área Agroalimentaria, en el Sector de Industrias Lácteas, pudiendo afectar a los subsectores de producción de quesos y de péptidos bioactivos. La actividad proteolítica de la pepsina obtenida hace que pueda ser interesante para cualquier aplicación en la que se necesite una proteasa aspártica extremadamente pura.The present invention falls within the Agrifood Area, in the Dairy Industry Sector, and may affect the subsectors of production of cheeses and bioactive peptides. The proteolytic activity of the pepsin obtained makes it interesting for any application in which an extremely pure aspartic protease is needed.
Estado de la TécnicaState of the Art
Elaboración de quesos curadosPreparation of cured cheeses
La producción de la mayor parte de los quesos, tanto artesanales como industriales, consta de dos etapas principales, la elaboración y el curado. En las primeras fases de la elaboración se persigue la deshidratación de la leche, de tal manera que la grasa y las caseínas se concentran entre 6 y 12 veces, según la variedad de que se trate. Esto se consigue en tres etapas, acidificación, coagulación y desuerado. La acidificación consiste en la fermentación de la lactosa por parte de bacterias lácticas, produciéndose ácido láctico. Estas bacterias pueden ser inoculadas o encontrarse naturalmente en la leche. El descenso de pH producido durante la fermentación puede por sí mismo provocar la coagulación de la leche, pero en la mayor parte de las ocasiones el objetivo es conseguir una coagulación mixta, acida y enzimática, en la cual, además del descenso de pH interviene la acción de enzimas proteolíticas [Cheese: chemistry, physics and microbiology. Ed. P.F. Fox. Elsevier Applied Science. London, 1987].The production of most cheeses, both artisanal and industrial, consists of two main stages, processing and curing. Dehydration of milk is pursued in the early stages of processing, so that fat and caseins are concentrated between 6 and 12 times, depending on the variety in question. This is achieved in three stages, acidification, coagulation and desuerado. Acidification consists in the fermentation of lactose by lactic bacteria, producing lactic acid. These bacteria can be inoculated or found naturally in milk. The decrease in pH produced during fermentation can itself cause the coagulation of the milk, but in most cases the objective is to achieve a mixed, acidic and enzymatic coagulation, in which, in addition to the decrease in pH, the proteolytic enzyme action [Cheese: chemistry, physics and microbiology. Ed P.F. Fox. Elsevier Applied Science. London, 1987].
La enzima proteolítica más importante utilizada en la elaboración del queso es la quimosina, que es la enzima más abundante del cuajo de ternero lactante. Esta proteasa hidroliza específicamente el enlace F105-M106 de la K- caseína, que se encuentra en la superficie de las micelas de caseína y es un factor esencial para su estabilidad [Fox, P.F. (1993) Exogenous enzymes in dairy technology- A review. J. Food. Biochem. 17: 173-199]. Como consecuencia de esta hidrólisis, y de la liberación del extremo C-terminal del caseín macropéptido, la p-K-caseína restante sufre una desestabilización hidrofóbica que provoca la agregación de las micelas y la coagulación de la leche cuando se dan las condiciones adecuadas de pH (debido a la fermentación de la lactosa), temperatura y concentración de calcio.The most important proteolytic enzyme used in cheese making is chymosin, which is the most abundant enzyme in lactating calf rennet. This protease specifically hydrolyzes the F105-M106 bond of K-casein, which is found on the surface of casein micelles and is an essential factor for its stability [Fox, PF (1993) Exogenous enzymes in dairy technology- A review. J. Food. Biochem 17: 173-199]. How As a result of this hydrolysis, and the release of the C-terminal end of the macropeptide casein, the remaining pK-casein undergoes a hydrophobic destabilization that causes the aggregation of the micelles and the coagulation of the milk when adequate pH conditions occur (due to to lactose fermentation), temperature and calcium concentration.
La cuajada así obtenida se somete a continuación a los procesos de corte y desuerado, y posteriormente a las de salado y moldeado. El resultado de todo ello es el queso fresco, que puede ser comercializado como tal o bien someterse al proceso de curado, durante el cual se producen una serie de cambios físico-químicos que influyen sobre las características del producto final. La mayor parte de estos cambios son consecuencia de la actividad metabólica de bacterias y, en algunos quesos, de hongos filamentosos, con notable influencia de las actividades proteolíticas de la leche, las residuales del cuajo o las producidas por los microorganismos presentes [Izco, J.M., Torre, P., Barcina, Y. (1999) Maduración acelerada de los quesos. Revisión. Alimentaria. Junio 99: 135-144].The curd thus obtained is then subjected to the cutting and desuerado processes, and subsequently to the salting and molding processes. The result of all this is fresh cheese, which can be marketed as such or undergo the curing process, during which a series of physical-chemical changes occur that influence the characteristics of the final product. Most of these changes are a consequence of the metabolic activity of bacteria and, in some cheeses, of filamentous fungi, with notable influence of the proteolytic activities of milk, residuals of rennet or those produced by the microorganisms present [Izco, JM , Torre, P., Barcina, Y. (1999) Accelerated cheese maturation. Revision. Food. June 99: 135-144].
Las principales consecuencias de la proteolisis en los quesos son la modificación de la textura y del aroma. La contribución al aroma se debe a la liberación de péptidos y aminoácidos, que a su vez pueden ser sustrato para otras reacciones que producen compuestos que influyen sobre el sabor y el aroma, mediante desaminación, descarboxilación o desulfuración de los mismos. La extensión deseable de la proteolisis en un queso depende del tipo del que se trate, y se han puesto a punto diferentes metodologías con el fin de acelerarla, consiguiendo de esta manera reducir los tiempos de curado, y consecuentemente los costes de producción.The main consequences of proteolysis in cheeses are the modification of texture and aroma. The contribution to aroma is due to the release of peptides and amino acids, which in turn can be a substrate for other reactions that produce compounds that influence taste and aroma, by deamination, decarboxylation or desulfurization thereof. The desirable extent of proteolysis in a cheese depends on the type in question, and different methodologies have been developed in order to accelerate it, thereby reducing cure times, and consequently production costs.
El pepsinógeno bovinoBovine Pepsinogen
La pepsina, al igual que la quimosina, se secreta en el abomaso de los rumiantes en forma de un zimógeno inactivo (pepsinógeno y proquimosina, respectivamente). Estos zimógenos tienen una extensión N-terminal que impide la actividad enzimática, pero como consecuencia del bajo pH del ambiente en el que se secretan se produce el procesamiento proteolítico autocatalítico que libera la proteasa madura [Richter,, C, Tanaka, T., Yada, R.Y. (1998)Pepsin, like chymosin, is secreted in the abomasum of ruminants in the form of an inactive zymogen (pepsinogen and prochymosin, respectively). These zymogens have an N-terminal extension that prevents enzymatic activity, but as a result of the low pH of the environment in which they are secreted, autocatalytic proteolytic processing that releases the mature protease occurs [Richter ,, C, Tanaka, T., Yada , RY (1998)
HOJA DE SUSTITUCI N RE LA 26 Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem. J. 335: 481-490]. En la producción comercial de cuajos se suele proceder a una fase de activación, mediante la modificación del pH con el fin de convertir todos los zimógenos presentes en las proteasas activas correspondientes.SUBSTITUTE SHEET RE LA 26 Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 335: 481-490]. In the commercial production of rennet, an activation phase is usually carried out, by modifying the pH in order to convert all the zymogens present in the corresponding active proteases.
La secuencia de los 110 primeros aminoácidos del extremo amino terminal del pepsinógeno bovino ha sido determinada experimentalmente a partir de la proteína purificada de abomaso bovino [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1 ) and the sequence overlapping the activation fragment. FEBS Lett. 34: 311-314; Harboe, M., Foltmann, B., (1975) Bobine pepsin: the sequence of the first 65 amino acid residues (completing the sequence of the first 110 residues of bovine pepsinogen). FEBS Lett. 35: 133-136]. Además, se han publicado en revistas científicas o en bases de datos varias secuencias de fragmentos genómicos o de cDNA cuyo análisis sugiere que se trata de fragmentos del gen del pepsinógeno bovino [Lu, Q., Wolfe, K.H., McConnel, D.J. (1988) Molecular cloning of múltiple bovine aspartyl portease genes. Gene, 71 :135-146; MAGPIE Automated Genomics Project Investigation Environment; http://magpie.ucalgary.ca/magpie/cattle_ests/private/; Smith, T.P.L., Grosse, W.M., Freking, B.A., Roberts, A.J., Stone, R.T., Casas, E., Way, J.E., White, J., Cho, J., Fahrenkrug, S.C., Bennett, G.L., Heaton, M.P., Laegreid, W.W.,Rohrer, G.A., Chitko-McKown, C.G., Pertea, G., Holt, I., Karamycheva, S., Liang, F., Quackenbush, J., Keele, J.W. (2001 ) Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a geneindex for cattle. Genome Research 11 :626-630.], pero en ningún caso se ha publicado la secuencia completa ni se ha demostrado la actividad del producto génico.The sequence of the first 110 amino acids of the amino terminal end of bovine pepsinogen has been determined experimentally from purified bovine abomasum protein [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1) and the sequence overlapping the activation fragment. FEBS Lett. 34: 311-314; Harboe, M., Foltmann, B., (1975) Bobine Pepsin: the sequence of the first 65 amino acid residues (completing the sequence of the first 110 residues of bovine pepsinogen). FEBS Lett. 35: 133-136]. In addition, several sequences of genomic or cDNA fragments have been published in scientific journals or in databases whose analysis suggests that these are fragments of the bovine pepsinogen gene [Lu, Q., Wolfe, K.H., McConnel, D.J. (1988) Molecular cloning of multiple bovine aspartyl portease genes. Gene, 71: 135-146; MAGPIE Automated Genomics Project Investigation Environment; http://magpie.ucalgary.ca/magpie/cattle_ests/private/; Smith, TPL, Grosse, WM, Freking, BA, Roberts, AJ, Stone, RT, Casas, E., Way, JE, White, J., Cho, J., Fahrenkrug, SC, Bennett, GL, Heaton, MP , Laegreid, WW, Rohrer, GA, Chitko-McKown, CG, Pertea, G., Holt, I., Karamycheva, S., Liang, F., Quackenbush, J., Keele, JW (2001) Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a geneindex for cattle. Genome Research 11: 626-630.], But in no case has the complete sequence been published nor has the activity of the gene product been demonstrated.
Enzimas recombinantes para la elaboración de quesos Como ya hemos comentado, la pepsina es una enzima con propiedades similares pero distintas que la quimosina. Estas propiedades la hacen adecuada para acelerar la maduración de los quesos si se utiliza en combinación con la pepsina en determinadas proporciones. El uso de una preparación de pepsina con una riqueza del 97% no parece suponer unRecombinant enzymes for cheese making As we have already mentioned, pepsin is an enzyme with similar but different properties than chymosin. These properties make it suitable to accelerate the ripening of cheeses if used in combination with pepsin in certain proportions. The use of a pepsin preparation with a richness of 97% does not seem to imply
HOJA DE SUSTITUCIÓN RE L problema para la elaboración de queso [Birkkjaer, H., Johnk, P. (1985) Technological suitability of calf rennet substitutes. International Dairy Federation Bulletin 194:8-13]. Si bien ambas enzimas se encuentran en el estómago de los rumiantes, sus proporciones son claramente distintas entre adultos y lechales, siendo estos últimos, hasta hace poco, la única fuente de quimosina disponible. La creciente demanda de coagulantes para la industria quesera llevó hace ya varios años a una situación en la que la disponibilidad de cuajos de ternero lactante, ricos en quimosina, era claramente insuficiente para satisfacer las necesidades del mercado.; Entre las diferentes alternativas que se han puesto en práctica para solucionar esta carencia están algunas fuentes tradicionales de enzimas proteolíticas como son los cuajos vegetales, y otras no tradicionales, como la utilización de enzimas microbianas y la utilización de quimosina recombinante.RE L SUBSTITUTE SHEET problem for cheese making [Birkkjaer, H., Johnk, P. (1985) Technological suitability of calf rennet substitutes. International Dairy Federation Bulletin 194: 8-13]. Although both enzymes are found in the stomach of ruminants, their proportions are clearly different between adults and milkmen, the latter being, until recently, the only source of chymosin available. The growing demand for coagulants for the cheese industry led several years ago to a situation in which the availability of lactating calves, rich in chymosin, was clearly insufficient to meet the needs of the market .; Among the different alternatives that have been put in place to solve this deficiency are some traditional sources of proteolytic enzymes such as vegetable rennet, and other non-traditional ones, such as the use of microbial enzymes and the use of recombinant chymosin.
A pesar de algunas reticencias iniciales, la utilización de quimosina recombinante ha ganado una gran cuota del mercado de coagulantes en muy poco tiempo, habiéndose demostrado que es sustancialmente equivalente a la quimosina obtenida a partir de cuajo de ternera [Ortiz de Apodaca, M.J., Amigo, L., Ramos, M. (1994) Study of the milk-clotting and proteolytic activity of calf rennet, fermentation-produced chymosin, vegetable and microbial coagulants. Milchwissenschaft 49:13-16]. La producción de quimosina recombinante comercial se ha llevado a cabo mediante la expresión del cDNA del gen de la proquimosina bovina en tres microorganismos diferentes: Escherichia coli, Aspegillus nigery Kluyveromyces lactis (estas enzimas recombinantes han sido comercializadas con los nombres de Chy-Max, Chymogen y Maxiren respectivamente). Antes de su comercialización estos preparados de proquimosina se purifican y se activan para dar lugar a la quimosina madura.Despite some initial reluctance, the use of recombinant chymosin has gained a large share of the coagulant market in a very short time, having been shown to be substantially equivalent to the chymosin obtained from rennet [Ortiz de Apodaca, MJ, Amigo , L., Ramos, M. (1994) Study of the milk-clotting and proteolytic activity of calf rennet, fermentation-produced chymosin, vegetable and microbial coagulants. Milchwissenschaft 49: 13-16]. Commercial recombinant chymosin production has been carried out by expressing the cDNA of the bovine prochymosin gene in three different microorganisms: Escherichia coli, Aspegillus nigery Kluyveromyces lactis (these recombinant enzymes have been marketed under the names of Chy-Max, Chymogen and Maxiren respectively). Before marketing, these prochymosin preparations are purified and activated to give rise to mature chymosin.
La introducción en el mercado de estos cuajos recombinantes tuvo como principal consecuencia la eliminación de la dependencia de la industria quesera respecto de la disponibilidad de cuajos naturales de lechales. Pero además, en el contexto de una creciente demanda de seguridad alimentaria, y a consecuencia de crisis de confianza como la ocasionada por la epidemia de la encefalitis espongiforme bovina (BSE), la obtención de enzimas recombinantes equivalentes a los coagulantes animales es aún una alternativa más atractiva.The introduction in the market of these recombinant rennet had as main consequence the elimination of the dependency of the cheese industry with respect to the availability of natural rennet of piglets. But also, in the context of a growing demand for food safety, and as a result of a crisis of confidence such as that caused by the epidemic of bovine spongiform encephalitis (BSE), obtaining recombinant enzymes equivalent to animal coagulants is still another alternative. attractive
H A DE TIT CIÓN REGLA 26 Las enzimas recombinantes tienen además la ventaja, sobre los de origen animal, de garantizar el cumplimiento de protocolos religiosos como Halal o Kosher y de satisfacer la demanda de consumidores vegetarianos [Vegetarían Society information sheet. http://www.veqsoc.org].HAS DE TIT CIÓN RULE 26 Recombinant enzymes also have the advantage, over those of animal origin, of guaranteeing compliance with religious protocols such as Halal or Kosher and of satisfying the demand of vegetarian consumers [Vegetarian Society information sheet. http://www.veqsoc.org].
Péptidos bioactivosBioactive peptides
Los péptidos bioactivos son una serie de moléculas que se han identificado en los últimos años por sus propiedades beneficiosas para la salud humana a través de una serie de mecanismos que incluyen actividades antihipertensiva, antihipercolesterémica, antimicrobiana o prebiótica. Muchos de estos péptidos se encuentran en los alimentos o son obtenidos a partir de ellos, como consecuencia de la actividad de determinadas proteasas sobre proteínas precursoras. En la actualidad hay una tendencia a tratar de producir y aislar estos péptidos bioactivos como una forma de revalorizar productos o subproductos de la industria alimentaria. Una de las fuentes de péptidos bioactivos que más se ha estudiado es precisamente el caseín macropéptido de los sueros de quesería, un sustrato a partir del que la pepsina bovina es capaz de liberar péptidos en las condiciones apropiadas [Shameet, K.M., Brown, R.J., McMahon, D.J. (1992) Proteolitic activity of proteinases on macropeptide isolated from κ-casein. J. Dairy Sci. 75: 1380-1388].Bioactive peptides are a series of molecules that have been identified in recent years for their beneficial properties for human health through a series of mechanisms that include antihypertensive, antihypercholesterolemic, antimicrobial or prebiotic activities. Many of these peptides are found in food or are obtained from them, as a result of the activity of certain proteases on precursor proteins. At present there is a tendency to try to produce and isolate these bioactive peptides as a way to revalue products or by-products of the food industry. One of the most studied bioactive peptide sources is precisely the macropeptide casein of cheese sera, a substrate from which bovine pepsin is capable of releasing peptides under the appropriate conditions [Shameet, KM, Brown, RJ, McMahon, DJ (1992) Proteolitic activity of proteinases on macropeptide isolated from κ-casein. J. Dairy Sci. 75: 1380-1388].
Posibles aplicaciones del pepsinógeno recombinantePossible applications of recombinant pepsinogen
La pepsina bovina resulta una enzima interesante para su producción biotecnológica porque forma parte de los cuajos naturales utilizados tradícionalmente en la elaboración de queso. Esta enzima también contribuye a la coagulación de la leche por su acción sobre el mismo enlace (F105-M106) de la κ-caseína sobre el que actúa la quimosina, aunque la actividad proteolítica de esta enzima es mayor y más inespecífica que la de la quimosina [Fox, P.F. (1993) Exogenous enzymes in dairy technology- A review. J. Food. Biochem. 17: 173-199]. De este modo, en los quesos elaborados con cuajos que contienen pepsina, así como en quesos elaborados con cuajo recombinante al que se ha añadido pepsina bovina natural, se observa una mayor actividad proteolítica residual, que se traduce en índices de maduraciónBovine pepsin is an interesting enzyme for its biotechnological production because it is part of the natural rennet used traditionally in cheese making. This enzyme also contributes to the coagulation of milk by its action on the same bond (F105-M106) of the κ-casein on which chymosin acts, although the proteolytic activity of this enzyme is greater and more nonspecific than that of the chymosin [Fox, PF (1993) Exogenous enzymes in dairy technology- A review. J. Food. Biochem 17: 173-199]. Thus, in cheeses made with rennet containing pepsin, as well as in cheeses made with recombinant rennet to which natural bovine pepsin has been added, a greater residual proteolytic activity is observed, which results in maturation rates
HOJA DE SUSTITUCIÓN REGLA 26 más altos cuando se someten estos quesos al proceso de curado [Zapparoli, G.A., Zanazzi, M., Bertezzolo, C, Fantuzzi, U., Bianchi, P.G., Forini, M., Melani, D., Negrini, A., de Battisti, A. (1992) Grana cheesemaking triáis using Chymogen coagulant. Lattel 7:214-221]. La sustitución en estas últimas mezclas de la pepsina natural por pepsina recombinante permitiría elaborar quesos destinados a maduración con combinaciones enzimáticas idénticas a las naturales, pero sin necesidad de recurrir a extractos de origen animal, que puedan plantear dudas en cuanto a su salubridad o su adecuación a las exigencias de amplios grupos de consumidores. Otra posible aplicación de la pepsina bovina recombinante sería la obtención de péptidos bioactivos a partir de caseín macropéptido de sueros de quesería o de algún otro sustrato proteico. Estudios recientes han demostrado los posibles efectos beneficiosos para la salud de los péptidos bioactivos derivados de la leche y del suero de quesería. Estos efectos son múltiples e incluyen: protección frente a la hipertensión, actividad antiinflamatoria, disminución de los niveles de colesterol, inmunomodulación, actividad antimicrobiana, actividad antiviral, actividad anticancerígena, actividad antitrombótica, actividad antioxidante, efectos opiáceos y otras [Clare, D.A., Sweisgood, H.E. (2000) Bioactive milk peptides: a prospectus. J. Dairy Sci. 83:1187-1195; Shah, N.P. (2000) Effects of milk-derived bioactives: an overview: British J. Nutr. 84:S3-210; Smacchi, E., Bobbetti, M. (2000) Bioactive peptides in dairy producís: síntesis and interaction with proteolytic encimes. Food Microbiol. 17:129-141]. Las proteínas del suero que originan péptidos bioactivos después de su digestión incluyen la β-lactobglobulina, alfa- lactalbúmina, lactoferrina, seralbúmina bovina y el caseín macropéptido. De hecho, el caseín macropéptido resulta hidrolizado por la acción de la pepsina bovina [Shameet, K.M., Brown, R.J., McMahon, D.J. (1992) Proteolitic activity of proteinases on macropeptide isolated from K-casein. J. Dairy Sci. 75: 1380- 1388]. Por ello es una gran ventaja disponer de la pepsina bovina recombinante pura, puesto que su utilización permitiría la generación selectiva de secuencias bioactivas específicas a partir de la leche y de sueros de quesería. De igual manera, la pepsina bovina recombinante se puede utilizar sobre cualquier otro sustrato proteico para la obtención de péptidos bioactivos, como por ejemplo aSUBSTITUTE SHEET RULE 26 higher when these cheeses are subjected to the curing process [Zapparoli, GA, Zanazzi, M., Bertezzolo, C, Fantuzzi, U., Bianchi, PG, Forini, M., Melani, D., Negrini, A., de Battisti, A. (1992) Grana cheesemaking triáis using Chymogen coagulant. Lattel 7: 214-221]. The substitution in these last mixtures of the natural pepsin with recombinant pepsin would allow to elaborate cheeses destined for maturation with enzymatic combinations identical to the natural ones, but without the need to resort to extracts of animal origin, which may raise doubts as to their health or suitability to the demands of large groups of consumers. Another possible application of the recombinant bovine pepsin would be the obtaining of bioactive peptides from macropeptide casein from cheese sera or from some other protein substrate. Recent studies have shown the possible beneficial health effects of bioactive peptides derived from milk and whey. These effects are multiple and include: protection against hypertension, anti-inflammatory activity, decreased cholesterol levels, immunomodulation, antimicrobial activity, antiviral activity, anticancer activity, antithrombotic activity, antioxidant activity, opioid effects and others [Clare, DA, Sweisgood , HE (2000) Bioactive milk peptides: a prospectus. J. Dairy Sci. 83: 1187-1195; Shah, NP (2000) Effects of milk-derived bioactives: an overview: British J. Nutr. 84: S3-210; Smacchi, E., Bobbetti, M. (2000) Bioactive peptides in dairy producís: synthesis and interaction with proteolytic encimes. Food Microbiol 17: 129-141]. Whey proteins that originate bioactive peptides after digestion include β-lactobglobulin, alpha-lactalbumin, lactoferrin, bovine seralbumin and the macropeptide casein. In fact, the macropeptide casein is hydrolyzed by the action of bovine pepsin [Shameet, KM, Brown, RJ, McMahon, DJ (1992) Proteolitic activity of proteinases on macropeptide isolated from K-casein. J. Dairy Sci. 75: 1380-1388]. Therefore, it is a great advantage to have pure recombinant bovine pepsin, since its use would allow the selective generation of specific bioactive sequences from milk and cheesemaking sera. Similarly, recombinant bovine pepsin can be used on any other protein substrate to obtain bioactive peptides, such as
E SUSTITUCIÓN REGLA 26 partir de jalea real [Matsui, T., Yuliyoshi, A., Doi, S., Sugimoto, H., Yamada, H., Matsumoto, K. (2002) Gastrointestinal enzyme production of bioactive peptides from royal jelly protein and their anthypertensive ability in SHR. J. Nutricional Biochem. 13:80-86].E SUBSTITUTION RULE 26 from royal jelly [Matsui, T., Yuliyoshi, A., Doi, S., Sugimoto, H., Yamada, H., Matsumoto, K. (2002) Gastrointestinal enzyme production of bioactive peptides from royal jelly protein and their anthypertensive ability in SHR. J. Nutritional Biochem. 13: 80-86].
Descripción de la invenciónDescription of the invention
Breve descripción de la invenciónBrief Description of the Invention
La presente invención consiste en el diseño y realización de un procedimiento para producir pepsinógeno bovino recombinante en microorganismos como por ejemplo en la bacteria Escheríchia coli y en la levadura Saccharomyces cerevisi33. Esta invención permite la obtención de pepsinógeno y pepsina sin necesidad de utilizar materiales de origen animal, soslayando así sospechas sobre la salubridad de productos obtenidos a partir de visceras de mamíferos o sobre su adecuación a determinados rituales religiosos, que afectan a grandes grupos de la población. Las posibles aplicaciones del pepsinógeno y de la pepsina recombinantes obtenidos incluyen la elaboración de quesos y la obtención de péptidos bioactivos.The present invention consists in the design and implementation of a method for producing recombinant bovine pepsinogen in microorganisms such as for example in Escheríchia coli bacteria and in Saccharomyces cerevisi33 yeast. This invention allows pepsinogen and pepsin to be obtained without the need to use materials of animal origin, thus avoiding suspicions about the healthiness of products obtained from mammal viscera or about their adaptation to certain religious rituals, which affect large groups of the population . Possible applications of the recombinant pepsinogen and pepsin obtained include cheese making and obtaining bioactive peptides.
Descripción detallada de la invención Para la construcción de un cDNA sintético que codifica una versión completa del pepsinógeno bovino se utilizaron los plásmidos pBP4B (clon 1Abo04B07 de una genoteca de cDNA de abomaso bovino de la Universidad de Alberta, Canadá) y pBPMO (clon 103110 de la genoteca MARC 3BOV cDNA del Children's Hospital Oakland Research Institute, MI). El primero carece de la secuencia correspondiente a los 37 aminoácidos del extremo amino terminal del pepsinógeno, mientras que el segundo carece de la secuencia correspondiente a loss cuatro aminoácidos del extremo amino terminal (SVVK), y además contiene una deleción interna de 118 pb (Figura 1 ). Mediante PCR se sintetizó, a partir de pBPUO un fragmento de DNA de 148 pb que contenía la región que codifica para los aminoácidos del extremo N-terminal que se hallan ausentes en pBP4B, además de la secuencia correspondiente a la región en posición 5' respecto de la deleción y parte de la región correspondiente a dicha deleción. Este fragmento sirvió para restaurar la secuencia obtenidaDETAILED DESCRIPTION OF THE INVENTION For the construction of a synthetic cDNA encoding a complete version of bovine pepsinogen, plasmids pBP4B (clone 1Abo04B07 of a bovine abomasum cDNA library from the University of Alberta, Canada) and pBPMO (clone 103110 of MARC 3BOV cDNA library of Children's Hospital Oakland Research Institute, MI). The former lacks the sequence corresponding to the 37 amino acids of the amino terminus of pepsinogen, while the second lacks the sequence corresponding to s four amino acids of the amino terminus (SVVK), and contains an internal deletion of 118 bp ( Figure 1 ). By PCR, a 148 bp DNA fragment containing the region coding for the N-terminal amino acids that are absent in pBP4B was synthesized from pBPUO, in addition to the sequence corresponding to the 5 'position region of the deletion and part of the region corresponding to said deletion. This fragment served to restore the sequence obtained
HOJA DE SUSTITUCIÓN REGLA experimentalmente obteniéndose finalmente el plásmido pBP01 (FiguraSUBSTITUTE SHEET RULE experimentally finally obtaining plasmid pBP01 (Figure
2). La cepa transformada con este plásmido se encuentra depositada en la Colección Española de Cultivos Tipo (CECT) con el número de identificación CECT5722, y protegida de acuerdo con lo estipulado en el Tratado de Budapest.two). The strain transformed with this plasmid is deposited in the Spanish Type Culture Collection (CECT) with the identification number CECT5722, and protected in accordance with the provisions of the Budapest Treaty.
A continuación se realizó la construcción de los plásmido pBP03 (Figura 3) para producir el pepsinógeno bovino en Escherichia coli DH5α. La cepa productora transformada con este plásmido pBP03 se encuentra depositada en la Colección Española de Cultivos Tipo (CECT) con el número de identificación CECT5723, y protegida de acuerdo con lo estipulado en el Tratado de Budapest.The construction of plasmids pBP03 (Figure 3) was then carried out to produce bovine pepsinogen in Escherichia coli DH5α. The producing strain transformed with this plasmid pBP03 is deposited in the Spanish Type Culture Collection (CECT) with the identification number CECT5723, and protected in accordance with the provisions of the Budapest Treaty.
Finalmente se construyó el plásmido pBP05 para producir el pepsinógeno bovino en Saccharomyces cerevisise, cepa BY4741 (Figura 4). Este plásmido ha sido diseñado para permitir la secreción del pepsinógeno bovino por parte de las células de levadura. La cepa productora transformada con este plásmido se encuentra depositada en la Colección Española de Cultivos Tipo (CECT) con el número de identificación CECT11778, y protegida de acuerdo con lo estipulado en el Tratado de Budapest.Finally, plasmid pBP05 was constructed to produce bovine pepsinogen in Saccharomyces cerevisise, strain BY4741 (Figure 4). This plasmid has been designed to allow the secretion of bovine pepsinogen by yeast cells. The producing strain transformed with this plasmid is deposited in the Spanish Type Culture Collection (CECT) with the identification number CECT11778, and protected in accordance with the provisions of the Budapest Treaty.
Para demostrar la producción de pepsinógeno en estos dos microorganismos recombinantes se procedió a su cultivo en condiciones de inducción de la producción, con IPTG o galactosa según el caso, determinándose la cantidad de pepsinógeno obtenido mediante un ensayo de actividad proteolítica.To demonstrate the production of pepsinogen in these two recombinant microorganisms, it was cultivated under conditions of induction of production, with IPTG or galactose, as appropriate, determining the amount of pepsinogen obtained by means of a proteolytic activity test.
A continuación se describen con más detalle las diferentes etapas necesarias y los métodos empleados en el desarrollo de la invención.The different necessary steps and methods used in the development of the invention are described in more detail below.
Obtención y secuencia de un cDNA que codifica una versión completa del pepsinóqeno bovinoObtaining and sequencing a cDNA that encodes a complete version of bovine pepsinoqen
Para la construcción de un cDNA sintético que codifica una versión completa del pepsinógeno bovino se utilizaron los plásmidos pBP4B (clon 1Abo04B07 de una genoteca de cDNA de abomaso bovino de la Universidad de Alberta, Canadá) [MAGPIE Automated Genomics Project Investigation Environment; http://magpie.ucalgary.ca/magpie/cattle_ests/private/] y pBPMO (clon 103110 de la genoteca MARC 3BOV cDNA, en el vector pCMV SPORT6, del Children's Hospital Oakland Research Institute MI) [Smith, T.P.L., Grosse, W.M., Freking, B.A., Roberts, A.J., Stone, R.T., Casas, E., Way, J.E., White, J., Cho, J., Fahrenkrug, S.C., Bennett, G.L., Heaton, M.P., Laegreid, W.W., Rohrer, G.A., Chitko-McKown, C.G., Pertea, G., Holt, I., Karamycheva, S., Liang, F., Quackenbush, J., Keele, J.W. (2001) Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a geneindex for cattle. Genome Research 11 :626-630.] (Figura 2). El primero carece de la secuencia correspondiente a los 37 aminoácidos del extremo amino terminal del pepsinógeno, mientras que el segundo carece de la secuencia correspondiente a los cuatro aminoácidos del extremo N-terminal (SWK), y además contiene una deleción interna de 118 pb.For the construction of a synthetic cDNA encoding a complete version of bovine pepsinogen, plasmids pBP4B (clone 1Abo04B07 of a bovine abomasum cDNA library from the University of Alberta, Canada) [MAGPIE Automated Genomics Project Investigation Environment; http://magpie.ucalgary.ca/magpie/cattle_ests/private/] and pBPMO (clone 103110 of MARC 3BOV cDNA library, in vector pCMV SPORT6, from the Children's Hospital Oakland Research Institute MI) [Smith, TPL, Grosse, WM, Freking, BA, Roberts, AJ, Stone, RT, Casas, E., Way, JE, White, J., Cho, J., Fahrenkrug, SC, Bennett, GL, Heaton, MP, Laegreid, WW, Rohrer, GA, Chitko-McKown, CG, Pertea, G., Holt, I., Karamycheva, S. , Liang, F., Quackenbush, J., Keele, JW (2001) Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a geneindex for cattle. Genome Research 11: 626-630.] (Figure 2). The first one lacks the sequence corresponding to the 37 amino acids of the amino terminal end of the pepsinogen, while the second one lacks the sequence corresponding to the four amino acids of the N-terminal end (SWK), and also contains an internal deletion of 118 bp.
En primer lugar, utilizando como molde el plásmido pBPHO se sintetizó, mediante PCR, un fragmento de DNA que contenía todos los elementos necesarios para obtener un cDNA completo del pepsinógeno que estaban ausentes en el plásmido pBP4B. En sentido 5'-3' el cebador cDNA-PBP3 (ver Tabla 1 ) contenía los siguientes elementos: secuencias idénticas al sitio múltiple de clonación (MCS) del plásmido pBlueScript SK-, que flanquean el extremo 5' del cDNA parcial del pepsinógeno que se encuentra en el plásmido pBPHO; una secuencia sintética que codifica los cuatro aminoácidos del extremo N-terminal del pepsinógeno ausentes en la construcción pBP4B [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1 ) and the sequence overlapping the activation fragment. FEBS Lett. 34: 311-314; Harboe, M., Foltmann, B., (1975) Bobine pepsin: the sequence of the first 65 amino acid residues (completing the sequence of the first 110 residues of pepsinógeno.bovine pepsinogen] además de un codón ATG (metionina) que sirve como inicio de traducción; y para terminar secuencias idénticas del extremo 5' del cDNA parcial del pepsinógeno presente en dicha construcción. El cebador cDNA-PB2 (ver Tabla 1 ) contenía secuencias complementarias al flanco 5' de la deleción interna del cDNA del pepsinógeno que se encuentra en la construcción pBPUO (ver Tabla 1 ). La mezcla de reacción contenía los siguientes componentes en un volumen final de 50 μl: plásmido molde (pBPMO) 0,5 μg, Pfu TURBO (Stratagene) 2,5First, using the pBPHO plasmid as a template, a DNA fragment containing all the elements necessary to obtain a complete cDNA of the pepsinogen that were absent in the plasmid pBP4B was synthesized by PCR. In the 5'-3 'sense, the cDNA-PBP3 primer (see Table 1) contained the following elements: sequences identical to the multiple cloning site (MCS) of plasmid pBlueScript SK-, which flank the 5' end of the partial cDNA of the pepsinogen that It is found in plasmid pBPHO; a synthetic sequence encoding the four amino acids of the N-terminal end of the pepsinogen absent in the pBP4B construct [Harboe, M., Foltmann, B., (1973) The N-terminal amino acid sequence of bovine pepsin (EC 3.4.4.1) and the sequence overlapping the activation fragment. FEBS Lett. 34: 311-314; Harboe, M., Foltmann, B., (1975) Bobine pepsin: the sequence of the first 65 amino acid residues (completing the sequence of the first 110 residues of pepsinogeno.bovine pepsinogen] in addition to an ATG codon (methionine) that serves as a translation start; and to terminate identical sequences of the 5 'end of the partial cDNA of the pepsinogen present in said construct, the cDNA-PB2 primer (see Table 1) contained sequences complementary to the 5' flank of the internal deletion of the pepsinogen cDNA which It is in the pBPUO construction (see Table 1) The reaction mixture contained the following components in a final volume of 50 μl: template plasmid (pBPMO) 0.5 μg, Pfu TURBO (Stratagene) 2.5
HOJA DE SUSTITUCIÓN R unidades, tampón para Pfu TURBO (Stratagene) 1X, dATP 0,1 mM, dTTP 0,1 mM, dGTP 0,1 mM, dCTP 0,1 mM, cebadores 400 nM cada uno y agua c.s.p. Esta mezcla de reacción se introdujo en el termociclador programado de la siguiente manera: una etapa inicial a 95 °C durante 1 minuto y medio, 20 ciclos de tres etapas: 95 °C 30 segundos, 55 °C 1 minuto y 68 °C 1 minuto, y una etapa final de 15 minutos a 68 °C. Seguidamente se añadieron 10 unidades de Dpnl y se incubó la mezcla a 37 °C durante 3 horas. Después de inactivar la enzima a 80 °C durante 20 minutos se purificó el producto de 148 pb de un gel de agarosa al 2% mediante el uso de un kit comercial de QUIAGEN.SUBSTITUTE SHEET R units, buffer for Pfu TURBO (Stratagene) 1X, 0.1 mM dATP, 0.1 mM dTTP, 0.1 mM dGTP, 0.1 mM dCTP each, 400 nM primers each and csp water This reaction mixture was introduced in the thermal cycler programmed as follows: an initial stage at 95 ° C for 1 minute and a half, 20 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 1 minute, and a final stage of 15 minutes at 68 ° C. Then 10 units of Dpnl were added and the mixture was incubated at 37 ° C for 3 hours. After inactivating the enzyme at 80 ° C for 20 minutes, the 148 bp product was purified from a 2% agarose gel by using a commercial QUIAGEN kit.
Tabla 1. Secuencia de los oligonucleótidos utilizados en este trabajo.Table 1. Sequence of the oligonucleotides used in this work.
CDNA-PB3 5 ' -CCCGGGCTGCAGAATTC-ATGTCTGTTGTCAAG-ATCCCACTCGTCΛAAAΑGAAGTCC- 3 ' CS de PBS SK" M S V V K pBPUOCDNA-PB3 5 '-CCCGGGCTGCAGAATTC-ATGTCTGTTGTCAAG-ATCCCACTCGTCΛAAAΑGAAGTCC- 3' CS of PBS SK " MSVVK pBPUO
CDNA-PB2 5 - -GTGGCGGCCTCCCGGATG- 3 ' pBPI10/pBP4BCDNA-PB2 5 - -GTGGCGGCCTCCCGGATG- 3 'pBPI10 / pBP4B
Xba-PB 5 -GCTCTAGAGGGTATTAATAATGAGCGTCGTCAAAATCCCACτCG- 3 ' Xbal RBS M S V V K I P LXba-PB 5 -GCTCTAGAGGGTATTAATAATGAGCGTCGTCAAAATCCCACτCG- 3 'Xbal RBS M S V V K I P L
Hind-PB 5 -GCGAAGCTTAGTTAGCTATTAGGCCACGGGAGCCAGGCCG- 3 ' Hindlll SxStop A V P A L GHind-PB 5 -GCGAAGCTTAGTTAGCTATTAGGCCACGGGAGCCAGGCCG- 3 'Hindlll SxStop A V P A L G
BP05A 5 ' - GGAATATTAAGCTTGGTACC - GAGCTCGAATTC - ATGAGATTTCCTTCAATTTTTACTGC - 3 ' CS de pYES2' Sinténtica Nt péptido señal factor alfaBP05A 5 '- GGAATATTAAGCTTGGTACC - GAGCTCGAATTC - ATGAGATTTCCTTCAATTTTTACTGC - 3' CS of pYES2 ' Synthetic Nt peptide signal factor alpha
BP05B 5 ' -GATCTTGACAACAGACAT-AGCTTCAGCCTCTCTTTTATCC-3 N-t pepsinógeπo " C-t péptido señal factor alfaBP05B 5 '-GATCTTGACAACAGACAT-AGCTTCAGCCTCTCTTTTATCC-3 Nt pepsinogeπo " Ct peptide signal factor alpha
Este producto se utilizó como cebador para una reacción de polimerización en un termociclador con el plásmido pBP4B como molde. La mezcla de reacción contenía los siguientes componentes en un volumen final de 50 μl: plásmido molde 0,5 μg, Pfu TURBO (Stratagene) 2,5 unidades, tampón para Pfu TURBO (Stratagene) 1X, dATP 0,1 mM, dTTP 0,1 mM, dGTP 0,1 mM, dCTP 0,1 mM, 1/5 del producto recuperado de la PCR anterior y agua c.s.p. Esta mezcla de reacción se introdujo en el termociclador programado de la siguiente manera: '"una etapa inicial a 95 °C durante 1 minuto y medio, 30 ciclos de tres etapas: 95 °C 30 segundos, 55 °C 1 minuto y 68 °C 10 minutos, y una etapa final de 15 minutos a 68 °C. Seguidamente se añadieron 10 unidades de Dpnl y se incubó la mezcla a 37 °C durante 3 horas, antes de utilizar 10 μl de la mezcla para transformar células competentes de E. coli DH5α [Sambrook, J., Fritsch, E.F., Maniatis, T. (1989) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor]. De esta manera se recuperó una cepa de E. coli que contenía el plásmido pBP01 , que contiene una copia completa del cDNA que codifica el pepsinógeno bovino precedida de un codón ATG, clonada en el vector pBlueScript SK-. El inserto presente en este plásmido se secuenció completamente para verificar que el cDNA sintético que codifica el metionil-pepsinógeno estaba completo y que no tenía mutaciones. La cepa transformada con este plásmido se encuentra depositada en la CECT con el número de identificación CECT5722, y protegida de acuerdo con lo estipulado en el Tratado de Budapest.This product was used as a primer for a polymerization reaction in a thermocycler with plasmid pBP4B as a template. The reaction mixture contained the following components in a final volume of 50 μl: 0.5 μg template plasmid, Pfu TURBO (Stratagene) 2.5 units, Pfu TURBO (Stratagene) 1X buffer, 0.1 mM dATP, dTTP 0 , 1 mM, 0.1 mM dGTP, 0.1 mM dCTP, 1/5 of the product recovered from the previous PCR and csp water This reaction mixture was introduced into the programmed thermal cycler as follows: '"an initial stage a 95 ° C for 1 minute and a half, 30 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 10 minutes, and a final stage of 15 minutes at 68 ° C. Then 10 units were added of Dpnl and the mixture was incubated at 37 ° C for 3 hours, before using 10 μl of the mixture to transform competent E. coli DH5α cells [Sambrook, J., Fritsch, EF, Maniatis, T. (1989) Molecular cloning A laboratory manual Cold Spring Harbor Laboratory Press Cold Spring Harbor]. In this way, an E. coli strain containing plasmid pBP01 was recovered, containing a complete copy of the cDNA encoding the bovine pepsinogen preceded by an ATG codon, cloned into the pBlueScript SK- vector. The insert present in this plasmid was completely sequenced to verify that the synthetic cDNA encoding methionyl pepsinogen was complete and had no mutations. The strain transformed with this plasmid is deposited in the CECT with the identification number CECT5722, and protected in accordance with the provisions of the Budapest Treaty.
Construcción de plásmidos para expresar el pepsinóqeno bovino en E. coli bajo el control de promotores que se inducen por lactosa o IPTG El inserto de cDNA de 1 ,15 kb de pBP01 que contiene la secuencia codificante del pepsinógeno bovino se clonó en E. coli utilizando el vector de expresión plN-lll(lppp-5)-A3 de 7,4 kb, con el fin de proporcionar al cDNA del pepsinógeno bovino los elementos necesarios para su expresión controlada en E. coli. Para amplificar el inserto a partir de pBP01 se utilizó el cebador Xba-PB (ver Tabla 1 ), que contiene una diana de restricción X¿bal que contiene parte del sitio de unión a ribosomas y facilita la ligación posterior con el vector plN-lll(lppp-5)-A3, seguida de la secuencia del pepsinógeno pero cambiando algunos nucleótidos de los 5 primeros aminoácidos según el uso de codones más utilizado en E. coli, y el cebador Hind-PB (ver Tabla 1 ), que contiene secuencias complementarias a los últimos codones del cDNA del pepsinógeno además de varios codones adicionales de terminación en cada una de las fases de lectura y de una diana de restricción Hind\\\ (ver Tabla 1 ). La mezcla de reacción contenía los siguientes componentes en un volumen final de 50 μl: plásmido molde 0,5 μg, Pfu TURBO (Stratagene) 2,5 unidades, tampón para Pfu TURBO (stratagene) 1X, dATsP 0,1 mM, dTTP 0,1 mM, dGTP 0,1 mM, dCTP 0,1 mM, cebadores 400 nM cada uno y agua c.s.p. Esta mezcla de reacción se introdujo en el termociclador programado de la siguiente manera: una etapa inicial a 95 °C durante 1 minuto y medio, 20 ciclos de tres etapas: 95 °C 30 segundos, 55 °C 1 minuto y 68 °C 3,5 minutos, y una etapa final de 15 minutos a 68 °C. El producto amplificado se cortó con H/ndIII y X al, al igual que el vector pIN- lll(lppp-5)-A3. Se purificaron ambos fragmentos, se ligaron y la mezcla de ligación se utilizó para transformar células competentes de E. coli DH5α. Se seleccionó un clon recombinante que contiene el plásmido pBP03 (Figura 3). La figura 5 muestra la secuencia completa del inserto presente en pBP03 (SEQ ID 1), junto con su traducción conceptual (SEQ ID 2). La cepa productora transformada con este plásmido se encuentra depositada en la CECT con el número de identificación CECT5723, y protegida de acuerdo con lo estipulado en el Tratado de Budapest.Construction of plasmids to express bovine pepsinoqen in E. coli under the control of promoters that are induced by lactose or IPTG The 1.15 kb cDNA insert of pBP01 containing the bovine pepsinogen coding sequence was cloned into E. coli using the expression vector plN-lll (lpp p -5) -A3 7.4 kb, in order to provide the bovine pepsinogen cDNA with the elements necessary for its controlled expression in E. coli. To amplify the insert from pBP01, the Xba-PB primer was used (see Table 1), which contains an X¿bal restriction target that contains part of the ribosome binding site and facilitates subsequent ligation with the plN-lll vector (lpp p -5) -A3, followed by the pepsinogen sequence but changing some nucleotides of the first 5 amino acids according to the use of codons most used in E. coli, and the Hind-PB primer (see Table 1), which contains sequences complementary to the last codons of the pepsinogen cDNA in addition to several additional termination codons in each of the reading phases and a Hind \\\ restriction target (see Table 1). The reaction mixture contained the following components in a final volume of 50 μl: 0.5 μg mold plasmid, Pfu TURBO (Stratagene) 2.5 units, Pfu TURBO buffer (stratagene) 1X, dAT s 0.1 mM P, 0.1 mM dTTP, 0.1 mM dGTP, 0.1 mM dCTP, 400 nM primers each and csp water This reaction mixture was introduced into the programmed thermal cycler as follows: an initial stage at 95 ° C for 1 minute and a half, 20 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 3.5 minutes, and a final stage of 15 minutes at 68 ° C. The amplified product was cut with H / ndIII and X al, as was the vector p-lll (lpp p -5) -A3. Both fragments were purified, ligated and the mixture of Ligation was used to transform competent E. coli DH5α cells. A recombinant clone containing plasmid pBP03 was selected (Figure 3). Figure 5 shows the complete sequence of the insert present in pBP03 (SEQ ID 1), together with its conceptual translation (SEQ ID 2). The producing strain transformed with this plasmid is deposited in the CECT with the identification number CECT5723, and protected in accordance with the provisions of the Budapest Treaty.
Construcción de plásmidos para expresar el pepsinóqeno bovino en S. cerevisiae bajo el control de un promotor que se induce por galactosaConstruction of plasmids to express bovine pepsinoqen in S. cerevisiae under the control of a galactose-induced promoter
El inserto de cDNA de 1 ,15 kb de pBP01 que contiene la secuencia codificante del pepsinógeno bovino se clonó en Saccharomyces cerevisiae utilizando el vector de expresión pYES2 (Invitrogen) de 5,9 kb. Para ello se digirieron tanto el plásmido pBP01 como el vector pYES2 con las enzimas de restricción Xho\ y Sac\ y se purificaron a partir de un gel de agarosa, utilizando un kit comercial de QUIAGEN las bandas correspondientes al vector digerido y al inserto de 1 ,3 kb de pBP01. Estos fragmentos de DNA se ligaron y la mezcla de ligación se utilizó para transformar células competentes de E. coli DH5α. Se seleccionó un clon recombinante que contiene el plásmido pBP04 (Figura 4). De esta manera el cDNA del pepsinógeno bovino está bajo el control de un promotor de levadura que se induce por galactosa y se reprime por glucosa, en un vector que se replica y contiene un marcador de selección para S. cerevisiω. Con el fin de asegurar la expresión del pepsinógeno en la levadura, el plásmido pBP04 se utilizó como base para construir el plásmido pBP05, que contiene una fusión transcripcional en la que el pepsinógeno está precedido de un péptido señal para la secreción del factor alfa de S. cerevisiae. En primer lugar se utilizó DNA genómico de S. cereyisiee BY4741 como molde para obtener un producto de PCR que codifica un péptido señal, utilizando los cebadores BP05A y BP05B (ver Tabla 1 ). BP05A contiene, en sentido 5'-3\ secuencias idénticas al sitio múltiple de clonación (MCS) del plásmido pYES2, que flanquean el extremo 5' del cDNA del pepsinógeno que se encuentra en el plásmido pBP04, una secuencia sintética con las dianas de restricción Sac\ y EcoRI y secuencias idénticas al extremo 5' del gen que codifica la feromona alfa de S. cerevisise.The 1.15 kb cDNA insert of pBP01 containing the bovine pepsinogen coding sequence was cloned into Saccharomyces cerevisiae using the 5.9 kb expression vector pYES2 (Invitrogen). For this, both plasmid pBP01 and vector pYES2 were digested with the restriction enzymes Xho \ and Sac \ and purified from an agarose gel, using a commercial QUIAGEN kit the bands corresponding to the digested vector and the insert of 1 , 3 kb of pBP01. These DNA fragments were ligated and the ligation mixture was used to transform competent E. coli DH5α cells. A recombinant clone containing plasmid pBP04 was selected (Figure 4). In this way the bovine pepsinogen cDNA is under the control of a yeast promoter that is induced by galactose and repressed by glucose, in a vector that replicates and contains a selection marker for S. cerevisiω. In order to ensure the expression of pepsinogen in yeast, plasmid pBP04 was used as the basis for constructing plasmid pBP05, which contains a transcriptional fusion in which the pepsinogen is preceded by a signal peptide for the secretion of the alpha factor of S cerevisiae First, S. cereyisiee BY4741 genomic DNA was used as a template to obtain a PCR product that encodes a signal peptide, using primers BP05A and BP05B (see Table 1). BP05A contains, in the 5'-3 \ sense sequences identical to the multiple cloning site (MCS) of plasmid pYES2, which flank the 5 'end of the pepsinogen cDNA found in plasmid pBP04, a synthetic sequence with restriction targets Sac \ and EcoRI and sequences identical to the 5 'end of the gene that encodes the S. cerevisise pheromone alpha.
HOJA DE SUSTITUCIÓN (REGLA 26) BP05B contiene, también en sentido 5'-3', secuencias complementarias al extremo N-terminal del cDNA reconstruido del pepsinógeno bovino, en fusión con secuencias complementarias al extremo C-terminal del péptido señal del factor alfa (ver Tabla 1 ). La mezcla de reacción contenía los siguientes componentes en un volumen final de 50 μl: DNA genómico 1 μg, Pfu TURBO (Stratagene) 2,5 unidades, tampón para Pfu TURBO (Stratagene) 1X, dATP 0,1 mM, dTTP 0,1 mM, dGTP 0,1 mM, dCTP 0,1 mM, cebadores 400 nM cada uno y agua c.s.p. Esta mezcla de reacción se introdujo en el termociclador programado de la siguiente manera: una etapa inicial a 95 °C durante 1 minuto y medio, 25 ciclos de tres etapas: 95 °C 30 segundos, 55 °C 1 minuto y 68 °C 1 minuto, y una etapa final de 15 minutos a 68 °C. Seguidamente se añadieron 10 unidades de Dpnl y se incubó la mezcla a 37 °C durante 3 horas. Después de inactivar la enzima a 80 °C durante 20 minutos se purificó el producto de 320 pb de un gel de agarosa al 1% mediante el uso de una kit comercial de QUIAGEN.SUBSTITUTE SHEET (RULE 26) BP05B also contains, in the 5'-3 'sense, sequences complementary to the N-terminal end of the reconstructed bovine pepsinogen cDNA, in fusion with sequences complementary to the C-terminal end of the alpha factor signal peptide (see Table 1). The reaction mixture contained the following components in a final volume of 50 μl: 1 μg genomic DNA, Pfu TURBO (Stratagene) 2.5 units, buffer for Pfu TURBO (Stratagene) 1X, 0.1 mM dATP, 0.1 dTTP mM, 0.1 mM dGTP, 0.1 mM dCTP, 400 nM primers each and csp water This reaction mixture was introduced into the programmed thermal cycler as follows: an initial stage at 95 ° C for 1 minute and a half, 25 cycles of three stages: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 1 minute, and a final stage of 15 minutes at 68 ° C. Then 10 units of Dpnl were added and the mixture was incubated at 37 ° C for 3 hours. After inactivating the enzyme at 80 ° C for 20 minutes, the 320 bp product was purified from a 1% agarose gel using a commercial QUIAGEN kit.
Este producto se utilizó como cebador para una reacción polimerización con el plásmido pBP04 como molde. La mezcla de reacción contenía los siguientes componentes en un volumen final de 50 μl: plásmido molde 0,5 μg, Pfu TURBO (Stratagene) 2,5 unidades, tampón para Pfu TURBO (stratagene) 1X, dATP 0,1 mM, dTTP 0,1mM, dGTP 0,1mM, dCTP 0,1 mM, 1/5 del producto recuperado de la PCR anterior y agua c.s.p. Esta mezcla de reacción se introdujo en el termociclador programado de la siguiente manera: una etapa inicial a 95 °C durante 1 minuto y medio, 30 ciclos de tres etapas: 95 °C 30 segundos, 55 °C 1 minuto y 68 °C 25 minutos, y una etapa final de 15 minutos a 68 °C. Seguidamente se añadieron 10 unidades de Dpnl y se incubó la mezcla a 37 °C durante 3 horas, antes de utilizar 10 μl de la mezcla para transformar células competentes de E. coli DH5α. De esta manera se recuperó una cepa de E. coli que contenía el plásmido pBP05 (Figura 4).This product was used as a primer for a polymerization reaction with plasmid pBP04 as a template. The reaction mixture contained the following components in a final volume of 50 μl: 0.5 μg template plasmid, Pfu TURBO (Stratagene) 2.5 units, Pfu TURBO buffer (stratagene) 1X, 0.1 mM dATP, dTTP 0 , 1mM, 0.1mM dGTP, 0.1mM dCTP, 1/5 of the product recovered from the previous PCR and csp water This reaction mixture was introduced into the programmed thermal cycler as follows: an initial stage at 95 ° C for 1 and a half minutes, 30 three-stage cycles: 95 ° C 30 seconds, 55 ° C 1 minute and 68 ° C 25 minutes, and a final stage of 15 minutes at 68 ° C. Then 10 units of Dpnl were added and the mixture was incubated at 37 ° C for 3 hours, before using 10 µl of the mixture to transform competent E. coli DH5α cells. In this way, an E. coli strain containing plasmid pBP05 was recovered (Figure 4).
El plásmido pBP05 se purificó a partir de la cepa de E. coli DH5α (pBP05) mediante un kit comercial de PROMEGA (Wizard miniprep) y se utilizó para transformar células de S. cerevisise BY4741 mediante el método de acetato de litio [The LiAc TRAFO Method Page. http://www.umanitoba.ca/faculties/medicine/biochem/gietz/method.html]. La cepa transformante que expresa la fusión traduccional del pepsinógeno bovino con el péptido señal del factor alfa bajo el control del promotor del gen GAL1 se encuentra depositada en la CECT con el número de identificación CECT11778, y protegida de acueido con lo estipulado en el Tratado de Budapest.Plasmid pBP05 was purified from E. coli strain DH5α (pBP05) by a commercial PROMEGA kit (Wizard miniprep) and used to transform S. cerevisise BY4741 cells by the lithium acetate method [The LiAc TRAFO Method Page http://www.umanitoba.ca/faculties/medicine/biochem/gietz/method.html]. The Transforming strain expressing the translational fusion of bovine pepsinogen with the alpha factor signal peptide under the control of the GAL1 gene promoter is deposited in the CECT with the identification number CECT11778, and protected according to the provisions of the Budapest Treaty .
Ejemplos de realización de la invenciónExamples of embodiment of the invention
Ejemplo 1. Producción de pepsinóqeno bovino recombinante en E. coli Células de E. coli DH5α transformadas con el plámido pBP03 (cepa CECT5723), que contiene el Met-cDNA del pepsinógeno bovino bajo el control de un promotor ¡nducible por IPTG, se incubaron en medio LB suplementado con ampicilina 50 μg/ml, a 37 °C y 220 rpm. Como control se utilizaron células transformadas con el vector plN-lll-A3. Estos cultivos se utilizaron para inocular medio el mismo medio fresco e incubarlo en las mismas condiciones. Cuando los cultivos alcanzaron una D.O. 600 nm de 0,7-1 ,0 se repartieron en dos matraces y a uno de ellos se le añadió isopropil-β-D-thiogalactosido (IPTG) a una concentración final de 400 μM para inducir la expresión. Los cultivos se incubaron entonces a 30°C durante 4 horas. Pasado este tiempo las células se centrifugaron, se lavaron en solución salina (NaCI 0,9%) se resuspendieron en 1/5 del volumen inicial en 50 mM de Tris-fosfato, pH 7,0 a 4°C. A continuación se sonicaron 3 x 6 seg a 4°C, dando lugar al "extracto total", o bien se centrifugaron a 13.000rpm x 10 min, en una microcentrífuga de mesa y el sobrenadante da lugar al "extracto soluble" que contiene el pepsinógeno bovino. La actividad proteolítica frente a hemoglobina del pepsinógeno presente en los extractos obtenidos tal como se describe anteriormente se determinó siguiendo el procedimiento descrito por [Kassell, B., Meitner, P.A. (1970) Bovine pepsiηogen and pepsin. Methods Enzymol. 19:337-347], con algunas modificaciones. En primer lugar se calculó la cantidad de HCl 0,3M necesaria para llevar cada muestra a pH 2,0. Cada ensayo contenía 350 μl de extracto diluido 1/10 en tampón 1 (HCl 0,01 M, NaCI 0,1 M, pH 2,0) y 350 μl de hemoglobina, más la cantidad de HCl 0,3 M calculada anteriormente. Las reacciones se incubaron durante 24 horas a 37°C y se pararon mediante la adición de 700 μl de TCA 5%. Después de incubar 10 minutos en hielo se centrifugaron a 13.000 rpm durante 10 minutos en una microcentrífuga de mesa y se midió la D.O. a 280 nm de los sobrenadantes, con el fin de estimar la cantidad de hemoglobina hidrolizada durante el tiempo del ensayo. Los controles de la D.O. a 280 nm de las mezclas de reacción previa a la hidrólisis se prepararon invirtiendo el orden de adición del sustrato y el TCA, de modo que no hubiese tiempo para la hidrólisis. Para calcular la actividad se tuvo en cuenta la diferencia de D.O. a 280 nm entre el ensayo a tiempo 0 y a 24 horas. La tabla 2 muestra la actividad de los extractos total y soluble de la cepa CECT5723, expresada como equivalentes en peso de pepsina porcina comercial en las mismas condiciones de ensayo. Como se puede apreciar se ha conseguido la producción de pepsinógeno bovino recombinante por parte de E. coli DH5α.Example 1. Production of recombinant bovine pepsinoqen in E. coli E. coli DH5α cells transformed with plasmid pBP03 (strain CECT5723), which contains the Met-cDNA of bovine pepsinogen under the control of an IPTG inducible promoter, were incubated in LB medium supplemented with 50 μg / ml ampicillin, at 37 ° C and 220 rpm. As a control, cells transformed with the plN-lll-A3 vector were used. These cultures were used to inoculate the same fresh medium medium and incubate it under the same conditions. When the cultures reached an OD 600 nm of 0.7-1, 0 were distributed in two flasks and one of them was added isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 400 μM to induce expression. The cultures were then incubated at 30 ° C for 4 hours. After this time, the cells were centrifuged, washed in saline solution (0.9% NaCl) and resuspended in 1/5 of the initial volume in 50 mM Tris-phosphate, pH 7.0 at 4 ° C. They were then sonicated 3 x 6 sec at 4 ° C, giving rise to the "total extract", or centrifuged at 13,000rpm x 10 min, in a table microcentrifuge and the supernatant gives rise to the "soluble extract" containing the bovine pepsinogen. The proteolytic activity against hemoglobin of pepsinogen present in the extracts obtained as described above was determined following the procedure described by [Kassell, B., Meitner, PA (1970) Bovine pepsiηogen and pepsin. Methods Enzymol. 19: 337-347], with some modifications. First, the amount of 0.3M HCl needed to bring each sample to pH 2.0 was calculated. Each assay contained 350 μl of extract diluted 1/10 in buffer 1 (0.01 M HCl, 0.1 M NaCl, pH 2.0) and 350 μl of hemoglobin, plus the amount of 0.3 M HCl calculated above. The reactions were incubated for 24 hours at 37 ° C and stopped by adding 700 µl of 5% TCA. After incubating 10 minutes on ice, centrifuged at 13,000 rpm for 10 minutes in a table microcentrifuge and the OD was measured at 280 nm of the supernatants, in order to estimate the amount of hydrolyzed hemoglobin during the test time. The OD controls at 280 nm of the pre-hydrolysis reaction mixtures were prepared by reversing the order of addition of the substrate and the TCA, so that there was no time for hydrolysis. To calculate the activity, the difference of OD at 280 nm between the test at time 0 and 24 hours was taken into account. Table 2 shows the activity of the total and soluble extracts of strain CECT5723, expressed as equivalent in weight of commercial swine pepsin under the same test conditions. As can be seen, the production of recombinant bovine pepsinogen by E. coli DH5α has been achieved.
Tabla 2. Actividad proteolítica de los extractos total y soluble de cepas recombinantes de E. coli en condiciones de inducción o sin inducir.Table 2. Proteolytic activity of the total and soluble extracts of recombinant strains of E. coli under conditions of induction or without induction.
Figure imgf000016_0001
Figure imgf000016_0001
Ejemplo 2. Producción de pepsinóqeno bovino recombinante en S. cerevisiee Células de S. cerevisiae BY4741 transformadas con el plámido pBP05 (cepa CECT11778), que contiene el Met-cDNA del pepsinógeno bovino bajo el control de un promotor inducible por galactosa, se incubaron durante toda la noche en medio mínimo sin uridina ni uracilo, con glucosa como fuente de carbono a 30 °C y 200 rpm. Como\control se utilizaron células transformadas con el vector pYES2. Estos cultivos se utilizaron para inocular medio mínimo sin uridina ni uracilo, con galactosa como fuente de carbono a una D.O. 600 nm de 0,4 y se incubaron durante 24 horas en las condiciones anteriores. Los cultivos se centrifugaron, utilizándose el sobrenadante para medir la actividad del pepsinógeno extracelular. Las células se lavaron en solución salina y se resuspendieron en 1/10 del volumen inicial en 50 mM de Tris-fosfato, pH 7,0.Example 2. Production of recombinant bovine pepsinoqen in S. cerevisiee S. cerevisiae BY4741 cells transformed with plasmid pBP05 (strain CECT11778), which contains the bovine pepsinogen Met-cDNA under the control of a galactose-inducible promoter, were incubated during overnight at least half without uridine or uracil, with glucose as a source of carbon at 30 ° C and 200 rpm. As \ control cells transformed with the vector pYES2 were used. These cultures were used to inoculate minimal medium without uridine or uracil, with galactose as a carbon source to a D.O. 600 nm of 0.4 and were incubated for 24 hours under the above conditions. The cultures were centrifuged, using the supernatant to measure the activity of the extracellular pepsinogen. The cells were washed in saline and resuspended in 1/10 of the initial volume in 50 mM Tris-phosphate, pH 7.0.
HOJA DE SUSTITUCIÓN REGLA 26 Se añadieron 0,5 g de perlas de vidrio y se agitaron en un agitador de tubos durante 5 minutos para obtener el extracto celular total. Estas muestras se utilizaron para llevar a cabo un ensayo de actividad proteolítica frente a hemoglobina del mismo modo que en el ejemplol . En primer lugar se calculó la cantidad de HCl 0,3M necesaria para llevar cada muestra a pH 2,0. Cada ensayo contenía 350 μl sobrenadante, o bien de extracto diluido 1/10 en tampón 1 (HCl 0,01 M, NaCI 0,1 M, pH 2,0), y 350 μl de hemoglobina, más la cantidad de HCl 0,3 M calculada anteriormente. Las reacciones se incubaron durante 24 horas a 37°C y se pararon mediante la adición de 700 μl de TCA 5%. Después de incubar 10 minutos en hielo se centrifugaron a 13.000 rpm durante 10 minutos en una microcentrífuga de mesa y se midió la D.O. a 280 nm de los sobrenadantes, con el fin de estimar la cantidad de hemoglobina hidrolizada durante el tiempo del ensayo. Los controles de la D.O. a 280 nm de las mezclas de reacción previa a la hidrólisis se prepararon invirtiendo el orden de adición del sustrato y el TCA, de modo que no hubiese tiempo para la hidrólisis. Para calcular la actividad se tuvo en cuenta la diferencia de D.O. a 280 nm entre el ensayo a tiempo 0 y a 24 horas. La tabla 3 muestra la actividad de los extractos total y soluble de la cepa CECT11778, expresada como equivalentes en peso de pepsina porcina comercial en las mismas condiciones de ensayo. Como se puede apreciar se ha conseguido la producción y secreción parcial de pepsinógeno bovino recombinante por parte de S. cerevisiae BY4741.SUBSTITUTE SHEET RULE 26 0.5 g of glass beads were added and stirred on a tube shaker for 5 minutes to obtain the total cell extract. These samples were used to carry out a proteolytic activity test against hemoglobin in the same way as in the example. First, the amount of 0.3M HCl needed to bring each sample to pH 2.0 was calculated. Each assay contained 350 μl supernatant, or extract diluted 1/10 in buffer 1 (0.01 M HCl, 0.1 M NaCl, pH 2.0), and 350 μl hemoglobin, plus the amount of HCl 0, 3 M calculated above. The reactions were incubated for 24 hours at 37 ° C and stopped by adding 700 µl of 5% TCA. After incubating 10 minutes on ice, they were centrifuged at 13,000 rpm for 10 minutes in a table microcentrifuge and the OD was measured at 280 nm of the supernatants, in order to estimate the amount of hydrolyzed hemoglobin during the test time. The OD controls at 280 nm of the pre-hydrolysis reaction mixtures were prepared by reversing the order of addition of the substrate and the TCA, so that there was no time for hydrolysis. To calculate the activity, the OD difference at 280 nm between the test at time 0 and 24 hours was taken into account. Table 3 shows the activity of the total and soluble extracts of strain CECT11778, expressed as equivalent in weight of commercial swine pepsin under the same test conditions. As can be seen, the production and partial secretion of recombinant bovine pepsinogen by S. cerevisiae BY4741 has been achieved.
Tabla 3. Actividad proteolítica del extracto celular y del medio de cultivo de cepas recombinantes de S. cerevisiee en condiciones de inducción.Table 3. Proteolytic activity of the cell extract and culture medium of recombinant strains of S. cerevisiee under induction conditions.
Figure imgf000017_0001
Figure imgf000017_0001
H Descripción de las figurasH Description of the figures
Fig. 1. Alineamiento de la secuencia amino terminal del pepsinógeno, determinada experimentalmente, con la traducción conceptual de los insertos contenidos en los plásmidos pBP4B y pBPHO. En el segundo caso ha sido necesario cambiar de fase de lectura para obtener una secuencia idéntica al pepsinógeno a partir del flanco 3' de la deleción de 118 pb. Fig. 2. Esquema de la construcción del plásmido pBPOL Las secuencias correspondientes a los vectores pCMV-SPORT6 y pBlueScript SK- aparecen en colores gris y negro respectivamente. La secuencia de cDNA del gen de la pepsina bovina aparece en blanco o a rayas, dependiendo del clon original del que se haya obtenido. La deleción en el cDNA del clon pBPHO se representa por una línea de puntos.Fig. 1. Alignment of the amino terminal sequence of the pepsinogen, determined experimentally, with the conceptual translation of the inserts contained in plasmids pBP4B and pBPHO. In the second case it has been necessary to change the reading phase to obtain a sequence identical to pepsinogen from the 3 'flank of the 118 bp deletion. Fig. 2. Scheme of the construction of plasmid pBPOL The sequences corresponding to the vectors pCMV-SPORT6 and pBlueScript SK- appear in gray and black colors respectively. The cDNA sequence of the bovine pepsin gene appears white or striped, depending on the original clone from which it was obtained. The cDNA deletion of the pBPHO clone is represented by a dotted line.
Fig. 3. Esquema de la construcción del plásmido pBP03. Las secuencias correspondientes a los vectores piN-lll(lppp-5)A3 y pBlueScript SK- aparecen en colores gris y negro respectivamente. La punta de flecha indica el sentido de transcripción a partir del promotor en el plásmido plN-lll(lppp-5)A3. La secuencia de cDNA sintético que codifica el metionil-pepsinógeno aparece como una flecha blanca. Fig. 4. Esquema de la construcción de los plásmidos pBP04y pBP05. Las secuencias correspondientes a los vectores pYES2 y pBlueScript SK- aparecen en colores gris y negro respectivamente. La punta de flecha indica el sentido de transcripción a partir del promotor GAL1 en el plásmido pYES2. La secuencia de cDNA sintético que codifica el metionil-pepsinógeno aparece como una flecha blanca. La secuencia que codifica el péptido señal del factor alfa aparece como un rectángulo rayado. Fig. 3. Scheme of the construction of plasmid pBP03. The sequences corresponding to the vectors piN-lll (lppp-5) A3 and pBlueScript SK- appear in gray and black colors respectively. The arrowhead indicates the direction of transcription from the promoter in plasmid plN-lll (lppp-5) A3. The synthetic cDNA sequence encoding methionyl pepsinogen appears as a white arrow. Fig. 4. Scheme of the construction of plasmids pBP04 and pBP05. The sequences corresponding to the vectors pYES2 and pBlueScript SK- appear in gray and black colors respectively. The arrowhead indicates the direction of transcription from the GAL1 promoter in plasmid pYES2. The synthetic cDNA sequence encoding methionyl pepsinogen appears as a white arrow. The sequence encoding the alpha factor signal peptide appears as a striped rectangle.

Claims

Reivindicaciones Claims
1. Pepsinógeno bovino recombinante, caracterizado por: a) su secuencia de aminoácidos es la que se muestra en SEQ ID 2 y en la figura 5, y b) se obtiene mediante técnicas de DNA recombinante a partir de la secuencia de DNA SEQ ID 11. Recombinant bovine pepsinogen, characterized by: a) its amino acid sequence is that shown in SEQ ID 2 and in Figure 5, and b) is obtained by recombinant DNA techniques from the DNA sequence SEQ ID 1
2. Pepsinógeno bovino recombinante caracterizado porque su secuencia de DNA contenga al menos la secuencia codificante de la pepsina madura SEQ ID 1 (residuos 139-1119) o cambios conservativos de la misma debido a la realización de mutaciones o inserciones que conserven su funcionalidad.2. Recombinant bovine pepsinogen characterized in that its DNA sequence contains at least the mature pepsin coding sequence SEQ ID 1 (residues 139-1119) or conservative changes thereof due to the performance of mutations or insertions that retain its functionality.
3. Pépsinógeno bovino recombinante caracterizado porque su secuencia de aminoácidos contenga al menos la secuencia codificante de la pepsina madurar SEQ ID 2 (residuos 1-326) o cambios conservativos de la misma debido a la realización de mutaciones, inserciones o deleciones en la secuencia SEQ ID 1 que conserven su funcionalidad.3. Recombinant bovine pepsinogen characterized in that its amino acid sequence contains at least the coding sequence of the mature pepsin SEQ ID 2 (residues 1-326) or conservative changes thereof due to the making of mutations, insertions or deletions in the SEQ sequence ID 1 that retain its functionality.
4. Pepsina bovina recombinante, caracterizada porque se obtiene a partir de pepsinógeno bovino recombinante según la reivindicación 1 a 3, mediante: a) acidificación de una solución que contiene pepsinógeno, o b) cualquier otro procedimiento que dé lugar a la formación de una proteasa activa a partir de pepsinógeno recombinante.4. Recombinant bovine pepsin, characterized in that it is obtained from recombinant bovine pepsinogen according to claim 1 to 3, by: a) acidification of a solution containing pepsinogen, or b) any other procedure that leads to the formation of an active protease from recombinant pepsinogen.
5. Un procedimiento para producir pepsinógeno o pepsina bovinos recombinantes según cualquiera de las reivindicaciones 1 a la 4, caracterizado por las siguientes operaciones: a) creación del fragmento de cDNA que codifica el pepsinógeno bovino, cuya secuencia de nucleótidos de este fragmento debe contener la secuencia indicada en la reivindicación 2 b) construcción de un vector de expresión conteniendo esta secuencia como por ejemplo plásmidos de expresión, c) transformación de células con dichos vectores, d) utilización de dichas células para producir pepsinógeno bovino5. A method for producing recombinant bovine pepsinogen or pepsin according to any one of claims 1 to 4, characterized by the following operations: a) creation of the cDNA fragment encoding the bovine pepsinogen, whose nucleotide sequence of this fragment must contain the sequence indicated in claim 2 b) construction of an expression vector containing this sequence such as expression plasmids, c) transformation of cells with said vectors, d) use of said cells to produce bovine pepsinogen
6.- Un procedimiento según la reivindicación 5 caracterizado porque el vector es un plásmido: a) el plásmido construido es pBP03, b) la trasformación con dicho plásmido de células de E. coli DH5 se corresponde con la célula CECT57236. A method according to claim 5 characterized in that the vector is a plasmid: a) the constructed plasmid is pBP03, b) the transformation with said plasmid of E. coli DH5 cells corresponds to the CECT5723 cell
7.- Un procedimiento según la reivindicación 5 caracterizado porque: a) el plásmido construido es pBP05, b) la trasformación con dicho plásmido de células de S. cerevisiae BY4741 se corresponde con la célula CECT11778 7. A method according to claim 5 characterized in that: a) the plasmid constructed is pBP05, b) the transformation with said plasmid of S. cerevisiae BY4741 cells corresponds to the CECT11778 cell
PCT/ES2004/070002 2003-01-24 2004-01-21 Recombinant bovine pepsin and pepsinogen produced in prokaryotic and eukaryotic cells WO2004065593A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES200300179A ES2247872B1 (en) 2003-01-24 2003-01-24 PEPSINA AND PEPSINOGENO RECOMBINANT BOVES PRODUCED IN PROCEDURAL AND EUCHARIOT CELLS.
ESP200300179 2003-01-24

Publications (2)

Publication Number Publication Date
WO2004065593A1 true WO2004065593A1 (en) 2004-08-05
WO2004065593B1 WO2004065593B1 (en) 2004-09-16

Family

ID=32749102

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2004/070002 WO2004065593A1 (en) 2003-01-24 2004-01-21 Recombinant bovine pepsin and pepsinogen produced in prokaryotic and eukaryotic cells

Country Status (2)

Country Link
ES (1) ES2247872B1 (en)
WO (1) WO2004065593A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10927360B1 (en) 2019-08-07 2021-02-23 Clara Foods Co. Compositions comprising digestive enzymes
US11160299B2 (en) 2019-07-11 2021-11-02 Clara Foods Co. Protein compositions and consumable products thereof
US11279748B2 (en) 2014-11-11 2022-03-22 Clara Foods Co. Recombinant animal-free food compositions and methods of making them

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CHOW R.B. ET AL.: "Bovine pepsinogen and pepsin", J. BIOL. CHEM., vol. 243, no. 8, 1968, pages 1718 - 1724 *
EMTAGE J.S. ET AL.: "Synthesis of calf prochymosin (prorennin) in Escherichia coli", PROC. NATL. ACAD. SCI. USA, vol. 80, no. 12, 1983, pages 3671 - 3675, XP001318429 *
HARBOE M.K. ET AL.: "Bovine pepsin:the sequence of the first 65 amino acid residues ( completing the sequence of the first 110 residues of bovine pepsinogen)", FESB LETT., vol. 60, no. 1, 1975, pages 133 - 136, XP025597803, DOI: doi:10.1016/0014-5793(75)80435-2 *
LANG H.M. ET AL.: "Bovine pepsinogens and pepsins.III.Composition and specificity of the pepsins", BIOCHEMISTRY, vol. 10, no. 12, 1971, pages 2296 - 2301 *
LIPOLDOVA M. ET AL.: "Isolation, partial characterization and translation of mRNA for chymosin and pepsin, the two main aspartyl proteinases of bovine stomach", FOLIA BIOL., vol. 31, no. 2, 1985, PRAHA, pages 71 - 80 *
LU Q. ET AL.: "Molecular cloning of multiple bovine aspartyl protease genes", GENE, vol. 71, no. 1, 1988, pages 135 - 146, XP023543725, DOI: doi:10.1016/0378-1119(88)90085-6 *
NEVALDINE B. ET AL.: "Bovine pepsinogen and pepsin.IV.A new method of purification of the pepsin", BIOCHEM. BIOPHYS. ACTA., vol. 250, no. 1, 1971, pages 207 - 209, XP023510103, DOI: doi:10.1016/0005-2744(71)90135-5 *
TSUKAGOSHI N. ET AL.: "Nucleotide sequence and expression in Escherichia coli of swine pepsinogen : involvement of the amino-terminal portion of the activation peptide segment in restoration of the functional protein", GENE, vol. 65, no. 2, 1988, pages 285 - 292 *
YOO J.-O. ET AL.: "Molecular cloning of a cDNA sequence for bovine pepsinogen", KOREAN BIOCHEM. J., vol. 18, no. 3, 1985, pages 240 - 244 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11279748B2 (en) 2014-11-11 2022-03-22 Clara Foods Co. Recombinant animal-free food compositions and methods of making them
US11160299B2 (en) 2019-07-11 2021-11-02 Clara Foods Co. Protein compositions and consumable products thereof
US11800887B2 (en) 2019-07-11 2023-10-31 Clara Foods Co. Protein compositions and consumable products thereof
US11974592B1 (en) 2019-07-11 2024-05-07 Clara Foods Co. Protein compositions and consumable products thereof
US10927360B1 (en) 2019-08-07 2021-02-23 Clara Foods Co. Compositions comprising digestive enzymes
US11142754B2 (en) 2019-08-07 2021-10-12 Clara Foods Co. Compositions comprising digestive enzymes
US11649445B2 (en) 2019-08-07 2023-05-16 Clara Foods Co. Compositions comprising digestive enzymes

Also Published As

Publication number Publication date
WO2004065593B1 (en) 2004-09-16
ES2247872A1 (en) 2006-03-01
ES2247872B1 (en) 2007-05-01

Similar Documents

Publication Publication Date Title
Hafeez et al. Strategies of producing bioactive peptides from milk proteins to functionalize fermented milk products
Hayes et al. Putting microbes to work: dairy fermentation, cell factories and bioactive peptides. Part II: bioactive peptide functions
ES2248819T3 (en) ANTI-LONG PEPTIDES OF MARINE FISH AS ADDITIVES FOR FOOD PRODUCTS.
Mohanty et al. Bovine chymosin: Production by rDNA technology and application in cheese manufacture
Kappeler et al. Characterization of recombinant camel chymosin reveals superior properties for the coagulation of bovine and camel milk
ES2669299T3 (en) Method of production of non-bovine chymosin and its use
Uniacke-Lowe et al. Chymosin, pepsins and other aspartyl proteinases: Structures, functions, catalytic mechanism and milk-clotting properties
Feng et al. Codon optimization of the calf prochymosin gene and its expression in Kluyveromyces lactis
Ersöz et al. Large-scale production of yak (Bos grunniens) chymosin A in Pichia pastoris
ES2143545T5 (en) CHEESE PRODUCTION WITH RECOMBINANT ASPARTIC PROTEASE.
Gagnaire et al. Uncommonly thorough hydrolysis of peptides during ripening of Ragusano cheese revealed by tandem mass spectrometry
Claverie-MartÌn et al. Aspartic proteases used in cheese making
ES2718071T3 (en) Endoprotease specific for proline and its use
JPH05505523A (en) Cheese production method
Fox Exogenous enzymes in dairy technology—A review 1
ES2247872B1 (en) PEPSINA AND PEPSINOGENO RECOMBINANT BOVES PRODUCED IN PROCEDURAL AND EUCHARIOT CELLS.
KR20170020706A (en) Milk clotting aspartic protease enzyme composition
US7741438B2 (en) Methods and compositions involving endopeptidases PepO2 and PepO3
ES2763650T3 (en) Aspartic proteases
Ogel Microbial production of recombinant rennet: recent developments
Kim et al. Amino acid sequence analysis of bitter peptides from a soybean proglycinin subunit synthesized in Escherichia coli
JP5757555B2 (en) Novel acidic protease and its use
ES2246175B1 (en) "PROCEDURE TO PRODUCE RECOMBINANT CAPRINE CHEMOSINE FOR COAGULATION OF GOAT MILK IN CHEESE MANUFACTURE".
JP4592387B2 (en) Inulin-degrading enzyme and its gene
EP4328240A1 (en) Recombinant protein production

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

B Later publication of amended claims

Effective date: 20040812

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)