WO2004063322A2

WO2004063322A2 - Dna size markers and method for preparing them

Info

Publication number: WO2004063322A2
Application number: PCT/KR2004/000046
Authority: WO
Inventors: Jong-Yoon Chun
Original assignee: Seegene, Inc.
Priority date: 2003-01-13
Filing date: 2004-01-13
Publication date: 2004-07-29
Also published as: WO2004063322A3; AU2003201778A1; WO2004063373A1

Abstract

The present invention relates to a method for preparing a plasmid set used in producing a DNA size marker set, a method for preparing a DNA size marker set, a plasmid set for producing a DNA size marker set, a kit for preparing a DNA size marker set, and a DNA size marker set. According to the present invention, a DNA size marker set can be permanently provided and personalized (customized) in conformance with the intention of users. Furthermore, a multiplex PCR as well as PCR is very much applicable to the present invention.

Description

DNA SIZE MARKERS AND METHOD FOR PREPARING THEM

BACKGROUND OF THE INVENTION FIELD OF THE INVENTION

The present invention relates to a method for preparing a DNA size marker set, a method for preparing a plasmid set used in producing a DNA size marker set, a plasmid set for producing a DNA size marker set, a kit for preparing a DNA size marker set, and a DNA size marker set.

DESCRIPTION OFTHERELATEDART

The DNA molecular weight markers are necessary to determine the molecular weight or the base pair length of nucleic acids. A large number of DNA marker fragments are available from numerous suppliers. These marker fragments are obtained either by restriction digests of several bacteriophage or plasmid DNAs, or polymerase chain reaction (PCR) amplification.

However, there is a limitation in obtaining desired marker fragments from the methods of restriction digests (Carlson et al., U.S. Pat. No. 5,316,908). Thus, PCR amplification has been applied to obtain the desired DNA marker fragments (Amills et al., Genet. Anal, 13:147- 149(1996); and Dawson, U.S. Pat. No. 5,714,326). According to the above method, each marker ladder is amplified by each separate PCR reaction and then the PCR products are combined to use as DNA marker ladders because the multiple PCR approach rendered a discontinuous ladder with many gaps and unspecific bands (Amills et al., Genet. Anal, 13:147-149 (1996); and Dawson, U.S. Pat. No. 5,714,326).

However, such approach is in fact time consuming when compared with the multiplex PCR approach. No technique has been described, permitting the use of multiplex PCR for the amplification of DNA marker ladders in which the DNA marker ladders are amplified in a single PCR reaction instead of multi PCR reactions. Furthermore, the conventional DNA ladders have been consumable and therefore, customers are continuously forced to purchase DNA ladders. In addition to this, any existing DNA ladder cannot be personalized (customized) in conformance with the intention of users.

Throughout this application, various patents and publications are referenced and citations are provided in parentheses. The disclosure of these patents and publications in their entities are hereby incorporated by references into this application in order to more fully describe this invention and the state of the art to which this invention pertains.

SUMMARY OF THE INVENTION

Under such circumstances, the present inventor has made intensive studies to develop a novel approach for preparing DNA size markers, in particular, providing a semi-permanent DNA size markers and as a result have found a novel method for providing DNA size markers by either PCR or multiplex PCR in customizable and non-consumable manner. Accordingly, it is an object of this invention to provide a method for preparing a DNA size marker set.

It is another object of this invention to provide a method for preparing a plasmid set used in producing a DNA size marker set.

It is still another object of this invention to provide a plasmid set for producing a DNA size marker set.

It is further object of this invention to provide a kit for preparing a DNA size marker set.

It is still further object of this invention to provide a DNA size marker set.

Other objects and advantages of the present invention will become apparent from the detailed description to follow taken in conjunction with the appended claims and drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the 100 bp ladder products of this invention amplified by a polymerase chain reaction. Lanes 1-12 represent the ladders with indicated lengths of this invention and lane denoted 100 bp ladders represents 100 bp DNA ladders purchased from New England BioLabs, Inc.

FIG. 2 shows the 100 bp ladder products of this invention amplified by multiplex polymerase chain reaction. Lane 1 represents 100 bp DNA ladders purchased from New England BioLabs, Inc. Lane 2 represents 100 bp ladders of this invention.

FIG. 3 A shows the photograph of 100 bp DNA ladder fragments synthesized by PCR reaction using each ladder plasmid as a template. Lane 1 : lOObp DNA ladder with high intensity at 500 and lOOObp. Lane 2: lOObp DNA ladder with same intensity. Lanes 3 to 14 are shown each PCR product as a differently sized marker.

FIG. 3B shows examples of 100 bp personalized DNA ladder on agarose gel. Lane 1 : 100 bp DNA ladder (100-1500 bp). Lane 2 : 200, 400, 600, 800, 1000 and 1500 bp. Lane 3 : 100, 300, 500, 700, 900, and 1200 bp. Lane 4 : 100, 200, 300, 400, and 500 bp. Lane 5 : 500, 600, 700, 8Q0, 900, 1000, 1200, and 1500 bp.

FIG. 4A shows the photograph of 50 bp DNA ladder fragments synthesized by PCR reaction using each 100 bp ladder plasmid as a template. Lane 1: lOObp DNA ladder with high intensity at 500 and 1000 bp. Lane 2: 100 bp DNA ladder with same intensity. Lane 3: 50 bp DNA ladder with same intensity ranging in size from 150 bp to 1550 bp. Lanes 4 to 15 show each 50 bp PCR product as a differently sized marker from 150 bp to 1550 bp. Lane 16: the mixture of 50 bp and 100 bp DNA ladders with high intensity at 500 and 1000 bp.

FIG. 4B shows examples of 50 bp and 100 bp personalized DNA ladders on agarose gel. Lane 1: 50 bp DNA ladder (150-1550 bp). Lane 2: 150, 350, 550, 750, 950 and 1550 bp. Lane 3: 250, 450, 650, 850, 1050, and 1250 bp. Lane 4: 150, 250, 350, 450, and 500 bp. Lane 5: 550, 650, 750, 850, 950, 1050, 1250, and 1550 bp. Lane 6: 100, 150, 200, 250, 300, 350, 400, 450, and 500 bp. Lane 7: 500, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1200, 1250, 1500, and 1550 bp. Lane 8: 100, 150, 200, 250, 300, 350, 400, 500, 800, and 1000 bp.

DETAILED DESCRIPTION OF THIS INVETNION In one aspect of this invention, there is provided a method for preparing a DNA size marker set, which comprises the steps of: (a) selecting a plurality of specific regions on target DNA molecule(s) to be amplified so that each amplified product has a definite and desired length; (b) preparing a plurality of first primer pairs for amplifying the specific regions in which a 5 '-end portion of each forward primer of the first primer pairs has a common nucleotide sequence, a 5 '-end portion of each reverse primer of the first primer pairs has a common nucleotide sequence and a 3 '-end portion of the first primer pairs has an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto; (c) performing a polymerase chain reaction of the specific regions using the first primer pairs so that DNA molecules with definite and desired lengths are amplified; (d) cloning each amplified product with a definite and desired length into a plasmid; and (e) amplifying the amplified product by a polymerase chain reaction with one type of a third primer pair using the cloned plasmid(s) as template(s) to generate the DNA size marker set; wherein a forward primer of the third primer pair has a nucleotide sequence substantially corresponding to the common nucleotide sequence of the forward primers of the first primer pairs and a reverse primer of the third primer pair has a nucleotide sequence substantially corresponding to the common nucleotide sequence of the reverse primers of the first primer pairs, whereby each primer of the third primer pair is hybridized with a nucleotide sequence of each end portion of the amplified products of the step (d).

The present method is directed to a method for obtaining a DNA size marker set by either PCR or a multiplex PCR, permitting to provide a DNA size marker set with cost and time effectiveness. The success of this invention is ascribed mainly to the employment of the first primer pair

(forward and reverse primers) with a common nucleotide sequence at its 5 '-end portion. That is to say, a 5 '-end portion of each forward primer of the first primer pairs has one common nucleotide sequence and a 5 '-end portion of each reverse primer of the first primer pairs has one common nucleotide sequence. Therefore, all the amplified products using the first primer pairs have the identical nucleotide sequences at their 5'- or 3 '-end portions. The common sequences at 5 '-end portions of the forward and reverse primers may be the same or different, preferably, different. The 5 '-end portions of the forward and reverse primers may comprise other nucleotide sequence as well as the common sequence. Preferably, the 5 '-end portion consists of the common sequence. The first primer used in the present method comprises 5'- and 3 '-end portions with reference to a middle position of the primer. The term "5 '-end portion" used herein in conjunction with the first primer refers to a nucleotide sequence at the 5 '-end of the primer, preferably, having a pre-selected arbitrary nucleotide sequence substantially not complementary to any site on the target DNAmolecule(s). The term "3 '-end portion" used herein in conjunction with the first primer refers to a nucleotide sequence at the 3 '-end of the primer, having an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto.

Therefore, it is preferred that each of the first primer pair comprises: (i) the 3 '-end portion having an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto; and (ii) the 5 '-end portion having as a common nucleotide sequence a pre-selected arbitrary nucleotide sequence substantially not complementary to any site on the target DNA molecule(s). The site on the specific region to anneal is located at a terminal portion of the specific region to be amplified.

The term "primer" as used herein refers to an oligonucleotide, whether occurring naturally or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of the primer extension product which is complementary to a nucleic acid strand (template) is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact length of the primers will depend on many factors, including temperature, application and source of the primer. The term "annealing" or "priming" as used herein refers to the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, whereby the apposition enables the polymerase to polymerize nucleotides into a nucleic acid molecule which is complementary to the template nucleic acid or a portion thereof. The 3 '-end portion of the first primer has a nucleotide sequence substantially complementary to a site on a template DNA molecule. The term "substantially complementary" in reference to primer is used herein to mean that the primer is sufficiently complementary to hybridize selectively to a template nucleic acid sequence under the designated annealing conditions, such that the annealed primer can be extended by polymerase to form a complementary copy of the template. Therefore, it can be understood that this term has a different meaning from "perfectly complementary" or related terms thereof. It is appreciated that the 3 '-end portion can have one or more mismatches to a template to an extent that the ACP can serve as primer. Most preferably, the 3 '-end portion has a nucleotide sequence perfectly complementary to a site on a template, i.e., no mismatches. According to a preferred embodiment, each of the first primer pair further comprises (iii) a regulator portion positioned between the 3 '-end portion and the 5 '-end portion comprising at least one universal base or non-discriminatory base analog, whereby the regulator portion is capable of enhancing an annealing specificity of the 3 '-end portion of the first primer to the site to anneal thereto. Therefore, the preferred first primer has three portions: (i) the 3 '-end portion having an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto; (ii) the 5 '-end portion having as a common nucleotide sequence a pre-selected arbitrary nucleotide sequence substantially not complementary to any site on the target DNA molecule(s); and (iii) a regulator portion positioned between the 3'-end portion and the 5'-end portion comprising at least one universal base or non-discriminatory base analog. The preferred first primer described above (called "annealing control primer") has been developed by the present inventor and disclosed in PCT/KR02/01781. The preferred first primer allows improving dramatically its annealing specificity to the site of interest, so that the amplified products having a definite and desired length can be obtained.

It is preferable that the regulator portion comprises contiguous nucleotides consisting of universal bases or non-discriminatory base analogs. The term "universal base or non- discriminatory base analog" used herein refers to one capable of forming base pairs with each of the natural DNA/RNA bases with little discrimination between them. The universal base or non- discriminatory base analog in the regulator portion includes deoxyinosine, inosine, 7-deaza-2'- deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3 -nitropyrrole, 3- nitropyrrole, 2'-OMe 3 -nitropyrrole, 2'-F 3 -nitropyrrole, l-(2'-deoxy-beta-D-ribofuranosyl)-3- nitropyrrole, deoxy 5-nitroindole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4- aminobenzimidazole, deoxy nebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5- introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3 -nitropyrrole, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, morpholino-4- nitrobenzimidazole, morpholino-3 -nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate-4- nitrobenzimidazole, phosphoramidate-3 -nitropyrrole, 2'-0-methoxyethyl inosine, 2'0- methoxyethyl nebularine, 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitrobenzimidazole, 2'-0-methoxyethyl 3 -nitropyrrole and combinations thereof, but not limited to. More preferably, the universal base or non-discriminatory base analog is deoxyinosine, l-(2'- deoxy-beta-D-ribofuranosyl)-3-nitropyrrole or 5-nitroindole, most preferably, deoxyinosine.

In a preferred embodiment, the first primer having a regulator portion contains at least 2 universal base or non-discriminatory base analog residues, more preferably, at least 3 universal bases or non-discriminatory base analogs. Advantageously, the universal base residues between the 3'- and 5 '-end portion sequences can be up to 15 residues in length. According to one embodiment, the first primer contains 2-15 universal base or non-discriminatory base analog residues. Most preferably, the universal bases between the 3'- and 5 '-end portion sequences are about 5 residues in length.

The lengths of the 3'- and 5 '-end portion sequences of the first primer may vary, hi a preferred embodiment, the 3 '-end portion is at least 6 nucleotides in length, which is considered a minimal requirement of length for primer annealing. More preferably, the 3 '-end portion sequence is from 10 to 25 nucleotides and can be up to 60 nucleotides in length.

In another preferred embodiment, the 5 '-end portion of the first primer contains at least 15 nucleotides in length, which is considered a minimal requirement of length for annealing under high stringent conditions. Preferably, the 5 '-end portion sequence can be up to 60 nucleotides in length. More preferably, the 5 '-end portion sequence is from 6 to 50 nucleotides, most preferably, from 20 to 25 nucleotides in length.

The 5 '-end portion has a pre-selected arbitrary nucleotide sequence substantially not complementary to any site on the template nucleic acid and this nucleotide sequence can serve as a priming site for subsequent amplification. The term "pre-selected arbitrary" nucleotide sequence used herein refers to any defined or pre-selected deoxyribonucleotide, ribonucleotide, or mixed deoxyribonucleotide sequence which contains a particular sequence of natural or modified nucleotides. In some embodiment, the pre-selected arbitrary nucleotide sequence of the 5 '-end portion can be composed of a universal primer sequence such as T3 promoter sequence, T7 promoter sequence, SP6 promoter sequence, and Ml 3 forward or reverse universal sequence. Using a longer arbitrary sequence (about 25 to 60 bases) at the 5 '-end portion reduces the efficiency of the first primer, but shorter sequences (about 15 to 17 bases) reduce the efficiency of annealing at high stringent conditions of the first primer. It is also a key feature of the present invention to use a pre-selected arbitrary nucleotide sequence at the 5 '-end portion of the first primer as a priming site for subsequent multiplex amplification.

According to the present method, the nucleotide sequences of the 5 '-end portions of the forward primers of the first primer pairs may be identical to or different from those of the 5 '-end portions of the reverse primers.

In the present method, the target DNA molecule used may be derived from a wide variety of biological sources, including bacteriophages such as λ and 0X174, plasmids such as pBR322 and pUC18 and eucaryotic genomic DNAs obtained from yeast or mouse, the nucleotide sequences of which are known in the art. The specific regions to be amplified are present on different or same target DNA molecule(s). For example, where λ DNA is used as target DNA molecule, the specific regions are present on the same molecule whereas where genomic DNA from mouse is used, the specific regions are preferably present on different target DNA molecules.

The amplification of the specific regions is performed by PCR including cycles of denaturation, annealing and extension, more preferably, hot start PCR method known in the art. Methods known to denaturate double stranded DNA includes, but not limited to, heating, alkali, formamide, urea and glycoxal treatment, enzymatic methods (e.g., helicase action) and binding proteins. For instance, the denaturation can be achieved by heating at a temperature ranging from 80°C to 105°C. General methods for accomplishing this treatment are provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001). Conditions of nucleic acid hybridization suitable for forming such double stranded DNA are described by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y(2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). A variety of DNA polymerases can be used in the amplification step of the present methods, which includes "Klenow" fragment of E. coli DNA polymerase I, a thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase such as obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Ηiermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Many of these polymerases may be isolated from bacterium itself or obtained commercially. Polymerase to be used with the subject invention can also be obtained from cells which express high levels of the cloned genes encoding the polymerase. When a polymerization reaction, is being conducted, it is preferable to provide the components required for such reaction in excess in the reaction vessel. Excess in reference to components of the amplification reaction refers to an amount of each component such that the ability to achieve the desired amplification is not substantially limited by the concentration of that component. It is desirable to provide to the reaction mixture an amount of required cofactors such as Mg²⁺, and dATP, dCTP, dGTP and dTTP in sufficient quantity to support the degree of amplification desired. All of the enzymes used in this amplification reaction may be active under the same reaction conditions. Indeed, buffers exist in which all enzymes are near their optimal reaction conditions. Therefore, the amplification process of the present invention can be done in a single reaction volume without any change of conditions such as addition of reactants.

While the amplification of the specific regions can be performed according to conventional

PCR process, it can be also performed according to a two-stage PCR process for enhancing

PCR specificity to target sequences, i.e., specific regions of interest. The two-stage PCR process has been suggested by the present inventor and disclosed in PCT/KR02/01781, accomplishing successfully the exclusion of non-specific PCR products.

Therefore, where the amplification is carried out according to a two-stage PCR process, the step (c) is followed by the step (c)' of a second-stage polymerase chain reaction using a second primer pair in which each second primer comprises a nucleotide sequence to be hybridized with a nucleotide sequence at each end portion of the amplified products in the step (c). hi two-stage

PCR process, the steps of (c) and (c)' are referred to as a first and second-stage PCR, respectively. The term "second primer" used herein refers to primer used in the second-stage PCR.

According to a preferred embodiment, the second primer pair consists of one primer having a substantially corresponding sequence to the common nucleotide sequence at the 5 '-end portion of the forward primer of the first primer and the other primer having a substantially corresponding sequence to the common nucleotide sequence at the 5 '-end portion of the reverse primer of the first primer. Thus, the first primer pair per se may be used as the second primer pair. More preferably, the second primer consists of a substantially corresponding sequence to the 5 '-end portion of the first primer.

The term "substantially corresponding" in reference to primer is used herein to mean that the primer comprises a completely or incompletely identical sequence to its compared sequence. Where the primer comprises an incompletely identical sequence, it may have one or more non- identical bases to an extent that it can serve as primer. For example, the second primer comprises completely or incompletely identical sequence to its compared sequence, i.e., the 5'- end portion of the first primer. Where the second primer comprises an incompletely identical sequence to the 5 '-end portion of the first primer, it may have one or more non-identical bases to an extent that it can serve as primer in the second-stage amplification.

It would be understood that if the nucleotide sequences of 5 '-end portions of the first primers are identical, one type of primer substantially corresponding to the sequence of 5 '-end portion will be used in the step of the second-stage amplification, whereas if they are different, two types of primer each substantially corresponding to the sequence of each 5 '-end portion of the first primer will be used in the step of the second-stage amplification.

Two amplification steps in the present methods are separated only in time. The first-stage amplification should be followed by the second-stage amplification. It would be understood that the first-stage amplification reaction mixture could include the second primers corresponding to the 5 '-end portion which will be used to anneal to the sequences of the 5 '-end portions of the first primer in the second-stage amplification, which means that the second primers corresponding to the 5 '-end portion can be added to the reaction mixture at the time of or after the first-stage amplification step.

As an alternative process, in the second-stage amplification step, the complete sequences of the first primer used in the first-stage amplification step, instead of the primers substantially corresponding to the 5 '-end portions of the first primer, can be used as primers under the high stringent conditions for re-amplifying the product generated from the first-stage amplification step, wherein the 3'- and 5'- ends of the product from the first amplification step which is generated from annealing and extension of the 3 '-end portion sequence of the first primer to the template nucleic acid under the low stringent conditions comprise the sequence or complementary sequence of the first primer and also serve as perfect paring sites to the first primer.

In this view, this alternative process is preferred because the process need not further add the primers substantially corresponding to the 5 '-end portions of the first primers to the reaction mixture at the time of or after the first-stage amplification step.

Annealing or hybridization in the amplification steps is performed under stringent conditions that allow for specific binding between a nucleotide sequence and primer. Such stringent conditions for annealing will be sequence-dependent and varied depending on environmental parameters. In the present methods, the second-stage amplification is generally performed under higher stringent conditions than the first-stage amplification. In a preferred embodiment, the first annealing temperature ranges from about 30°C to 68°C for the first-stage amplification step, more preferably, 40°C to 65°C. It is preferred that the second annealing temperature ranges from about 50°C to 72°C for the second-stage amplification. According to a more preferred embodiment, the first annealing temperature is equal to or lower than the second annealing temperature.

According to the present methods, the first-stage amplification under low stringent conditions is carried out for at least 2 cycles of annealing, extending and denaturing to improve the specificity of primer annealing during the first-stage amplification, and through the subsequent cycles, the second-stage amplification is processed more effectively under high stringent conditions.

The first-stage amplification can be carried out up to 30 cycles. I a preferred embodiment, the first-stage amplification is carried out for 2 cycles. In another embodiment, the second-stage amplification under high stringent conditions is carried out for at least one cycle (preferably, at least 5 cycles) and up to 45 cycles to amplify the first-stage product. In a more preferred embodiment, the second-stage amplification is carried out for 25-35 cycles.

The cloning process may be carried out by a conventional method known in the art such as disclosed by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001). The plasmid suitable in the cloning process includes a wide variety of cloning vectors commercially available such as pGEM-T

Easy, pSClOl, ColEl, pBR322, pUC8/9, pHC79 and pUC19.

One of striking features of the instant method is to require only one type of a third primer pair in amplifying different insert sequences in the cloned plasmids for generating a DNA size marker set. Such excellence becomes true owing to the fact that all the inserts in the cloned plasmids have the identical nucleotide sequences at their 5'- or 3 '-end portions.

The plasmids used in the step (d) may be different from or identical to each other. In the case that the plasmids are identical to each other, the present method may further comprise the step of (e') amplifying the amplified product plus a partial sequence of the plasmid by a polymerase chain reaction with one type of a fourth primer pair using the cloned plasmid(s) as template(s) to. generate the DNA size marker set; in which a forward primer of the fourth primer pair has a nucleotide sequence to anneal to a nucleotide sequence of the plasmid being away from the 5 '-end of the amplified product and a reverse primer of the fourth primer pair has a nucleotide sequence to anneal to a nucleotide sequence of the plasmid being away from the 3'- end of the amplified product.

Through performing the step (e'), other size marker pattern can be conveniently yielded. It is preferred that two annealing positions of the fourth primer pair are located at the identical interval from both ends of the amplified products. Most preferably, the interval is 25 bp in length. For instance, where the forward primer of the fourth primer pair is designed to anneal to a nucleotide sequence of the cloned plasmid being 25 bp away from the 5 '-end of the amplified product, the reverse primer is designed to anneal to a nucleotide sequence of the cloned plasmid being 25 bp away from the 3 '-end of the amplified product and the inserts amplified cover 100- 1500 bp with the increase by 100 bp, a DNA size marker set to display 150-1550 bp discrete bands with the increase by 50 bp can be obtained.

The amplification in the step (e) or (e') can be carried out by each polymerase chain reaction using each cloned plasmid as a template. Alternatively, the amplification can be performed by a multiplex PCR in the same reaction using a mixture of the cloned plasmids as templates and the third primer pair to generate the DNA size marker set. The successful multiplex PCR in this invention occurs due predominantly to the employment of one primer pair type that is ascribed originally to the common nucleotide sequence at 5 '-end portion of the first primer. In general, it is extremely difficult to set up PCR conditions to amplify more than 10 targets in parallel because an optimal PCR amplification is required to amplify even one specific locus without any unspecifϊc by-products. Therefore, DNA size markers prepared by multiplex PCR have not been commercialized. However, the present invention readily provides DNA size markers by multiplex PCR. The multiplex PCR in the present method may be performed in a similar manner to PCR described previously. It is preferred that the annealing temperature ranges from about 50°C to 72°C for the multiplex PCR.

According to a preferred embodiment, the amplification in the step (e) or (e') is followed by the step of (f) combining the amplified products with definite and desired lengths in a single tube to generate a DNA size marker set. The final product is a mixture of DNA fragments covering base pair lengths of interest, giving DNA size markers ranging 20-1000 bp, 100-1500 bp, 200-6000 bp, 500-8000 bp, 1000- 15000 bp, 2500-35000 bp, 50-10000 bp, etc. When the final products are visualized, a series of DNA segments can be found without a discontinuous marker and several gaps mainly corresponding to the smaller fragments. Preferably, the amplified products are of different and definite lengths ranging from 100 to 1,500 base pairs. More preferably, the final amplified products are visualized as a series of ladder with definite and desired lengths such as 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200 and 1500 bps. In addition, it is preferred that the final amplified products are of different and definite lengths ranging from 0.5 to 10.0 kilobase pairs. More preferably, the final amplified products are visualized as a series of ladder with definite and desired lengths such as 500, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 8000 and

10000 bps. Where the present method is executed to generate a 50 bp ladder through the step (e')₅ it is preferred that the final amplified products are of different and definite lengths ranging from 50 to 1,550 base pairs. More preferably, the final amplified products are visualized as a series of ladder with definite and desired lengths covering 50 to 1,550 base pairs with the increase by 50 bps.

In addition, the final amplified products can comprise at least one nucleotide with a label for detection. Suitable labels include, but not limited to, fluorophores, chromophores, chemiluminescers, magnetic particles, radioisotopes, mass labels, electron dense particles, enzymes, cofactors, substrates for enzymes and haptens having specific binding partners, e.g., an antibody, streptavidin, biotin, digoxigenin and chelating group.

The present invention can provide a method for DNA size markers by means of PCR or multiplex PCR. According to the present method, the DNA size markers each of which has a definite and desired length are obtained with significant cost and time effectiveness. The DNA size markers prepared by the present method show neither discontinuous marker nor gaps corresponding to smaller fragments because PCR or multiplex PCR in this method is performed under optimal conditions using one type of primer pair common to all the templates, hi addition, the DNA fragments are prepared at nearly equal level by the present method, thus showing very similar band intensities on electrophoresis gel.

In another aspect of this invention, there is provided a method for preparing a plasmid set used in producing a DNA size marker set, which comprises the steps of: (a) selecting a plurality of specific regions on target DNA molecule(s) to be amplified so that each amplified product has a definite and desired length; (b) preparing a plurality of first primer pairs for amplifying the specific regions in which a 5 '-end portion of each forward primer of the first primer pairs has a common nucleotide sequence, a 5 '-end portion of each reverse primer of the first primer pairs has a common nucleotide sequence, and a 3 '-end portion of the first primer pairs has an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto; (c) performing a polymerase chain reaction of the specific regions using the first primer pairs so that DNA molecules with definite and desired lengths are amplified; and (d) cloning each amplified product with a definite and desired length into a plasmid, whereby the amplified products into the plasmids can be amplified with one type of the third primer pair to generate the DNA size marker set.

This method is aimed at providing a plasmid set used in producing DNA size markers. Each plasmid in the plasmid set carries an insert sequence corresponding to each DNA size marker with definite length.

Since the method of this invention is performed in the same manner as the method for preparing DNA size markers described above, except that the final PCR is not carried out, the common descriptions between them are omitted in order to avoid the redundancy of this specification leading to undue multiplicity.

This method can provide a plurality of cloned plasmids used in producing DNA size markers. The cloned plasmids are useful as a template in PCR or multiplex PCR. If the cloned plasmids are transformed to cells, the transformants can serve as a semi-permanent source for DNA size markers. Therefore, according to a preferred embodiment, the steps of transforming the cloned plasmids into host cells such as E. coli and Bacillus sp. and culturing the transformed host cells are performed after the step (d).

Afterwards, when producing DNA size markers, only one type of a third primer pair in PCR using the final cloned plasmids as templates is required, because all the inserts in the cloned plasmids have the identical nucleotide sequences at their 5'- or 3 '-end portions.

In still another aspect of this invention, there is provided a plasmid set prepared by the method for preparing a plasmid set used in producing a DNA size marker set, in which the plasmids comprise insert sequences each having different and definite length and spanning the desired range of base pair lengths; in which when the insert sequences in the plasmids are amplified, a DNA size marker set having different and definite lengths and spanning the desired range of base pair lengths is produced.

In further aspect of this invention, there is provided a kit for preparing a DNA size marker set, which comprises (i) the plasmid set of this invention and (ii) the third primer pair and/or the fourth primer pair described above. The present kit may optionally include the reagents required for performing PCR reactions such as buffers, DNA polymerase, DNA polymerase cofactors, and deoxyribonucleotide-5'-triphosphates. Optimal amounts of reagents to be used in a given reaction can be readily determined by the skilled artisan having the benefit of the current disclosure. The kits, typically, are adapted to contain in separate packaging or compartments the constituents afore-described.

In still further aspect of this invention, there is provided a DNA size marker set prepared by the present method described above, wherein the DNA size markers are of different and definite lengths and span the desired range of base pair lengths.

According to the present invention, a DNA size marker set can be permanently provided and personalized (customized) in conformance with the intention of users. Furthermore, a multiplex PCR as well as PCR is very much applicable to the present invention.

The following specific examples are intended to be illustrative of the invention and should not be construed as limiting the scope of the invention as defined by appended claims.

EXAMPLES

In the experimental disclosure which follows, the following abbreviations apply: M

(molar), mM (millimolar), μM (micromolar), g (gram), μg (micrograms), ng (nanograms), 1

(liters), ml (milliliters), μl (microliters), °C (degree Centigrade), Promega (Promega Co.,

Madison, USA), Stratagene (La Jolla, CA, USA), QIAGEN (QIAGEN GmbH, Hilden, Germany), and Applied Biosystems (Foster City, CA, USA).

The oligonucleotide sequences used in the Examples are shown in Sequencing List.

EXAMPLE 1: Genomic DNA Preparation

The liver tissues were excised from mouse (ICR) immediately, and then frozen quickly in liquid nitrogen. Two hundred micrograms of grinded tissues were added to a 15 ml tube containing 1.2 ml of digestion buffer (100 M NaCl, 10 mM Tris-Cl pH 8.0, 25 mM EDTA pH

8.0, and 0.5% SDS) and 6 μl of 20 mg/ml proteinase K. The tube was heated at 50°C for 12 hr.

The genomic DNA was extracted twice with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) and once with chloroform/isoamyl alcohol (24:1).

EXAMPLE 2: Cloning of Each 100 bp Ladder Fragment

In order to construct 100 bp DNA ladders, twelve different useful genes were used as templates for each fragment of the 100 bp ladder ranging in size from 100 bp to 1.5 kb, respectively. The mouse genomic DNA was used as a template for the amplification of each gene fragment.

A. Primer design A pair of annealing control primers (ACPs), which has been developed by the present inventor and disclosed in PCT/KR02/01781, for each gene was designed as follows:

1) 100 bp for Nitric oxide synthase (Nos-1) gene (Genbank Accession NO. L23806)

100-5 'primer: 5 ' -GTCTACCAGGCATTCGCTTCATπiIIGGACTGAGCTGTTAGAGAC-3 ' (SEQ ID NO: 1),

100-3 'primer: 5 ' -CTGTGAATGCTGCGACTACGATfflIIGACCCAAGCGTGAGGAG-3 ' (SEQ ID NO :2);

2) 200 bp for CD4 antigen (cd4) gene (Genbank Accession NO. AF088189) 200-5 'primer: 5'-GTCTACCAGGCATTCGCTTCATiπiICTCACGACCAGGCTTCC-3'

(SEQ ID NO:3),

200-3 'primer: 5 '-CTGTGAATGCTGCGACTACGATimiGCCAGTCCTTCCTTCAC-3 ' (SEQ ID NO:4);

3) 300 bp for p53 tumor suppressor gene (Genbank Accession NO. AF287146)

300-5'primer: 5'-GTCTACCAGGCATTCGCTTCATimiCAGTCTACTTCCCGCCAT-3' (SEQ ID NO:5),

300-3'primer: 5'-CTGTGAATGCTGCGACTACGATππiAGACCTGACAACTATCAACC-3' (SEQ E) NO:6);

4) 400 bp for Tumor necrosis factor (TNF) gene (Genbank Accession NO . M20155)

400-5 'primer: 5 '-GTCTACCAGGCATTCGCTTCATπiπCAACGGCATGGATCTCAA-3 ' (SEQ ID NO:7),

400-3 'primer: 5 '-CTGTGAATGCTGCGACTACGATIIIIIGACTCCAAAGTAGACCTGC-3 ' (SEQ ID NO: 8),

5) 500 bp for Glyceraldehyde-3 -phosphate dehydrogenase (GAPD) gene (Genbank Accession NO. NM_008084)

500-5 'primer: 5 '-GTCTACCAGGCATTCGCTTCATiπiICGTGGAGTCTACTGGTGTCT-3 ' (SEQ ID NO:9),

500-3 'primer: 5 ' -CTGTGAATGCTGCGACTACGATπiIICCACGACGGACACATTG-3 ' (SEQ ID NO: 10), 6) 600 bp for Plasmacytoma ABPC45 (12;15) translocated c-myc oncogene (Genbank Accession NO. K03229)

600-5'primer: 5'-GTCTACCAGGCATTCGCTTCATIiπiCCTCCTGCCTCCTGAAG-3' (SEQ ID NO: 11),

600-3 'primer: 5 '-CTGTGAATGCTGCGACTACGATimiAAAGAACACAGGGAAAGACC-3 ' (SEQ ID NO: 12);

7) 700 bp for Interferon alpha 1 (MulFN- alpha 1) gene (Genbank Accession NO. X01974) 700-5'primer: 5'-GTCTACCAGGCATTCGCTTCATIiπiCTGTGCTTTCCTGATGGT-3'

(SEQ ID NO: 13),

700-3 'primer: 5 '-CTGTGAATGCTGCGACTACGATIiπiTGAATGACAGTTTTGAGATG-3 ' (SEQ ID NO: 14);

8) 800 bp for MHC class 1 Q4 beta-2-microglobulin (Qb-1) gene (Genbank Accession NO.

M18837)

800-5 'primer: 5 '-GTCTACCAGGCATTCGCTTCATimiCTCACTTTGTACACCAGGC-3 '

(SEQ ID NO: 15),

800-3 'primer: 5 ' -CTGTGAATGCTGCGACTACGATIIIIITACAGACAGTAGCAATGTGG-3 ' (SEQ ID NO: 16);

9) 900 bp for Stem cell inhibitor/macrophage inflammatory protein la gene (Genbank Accession NO. X53372)

900-5 'primer: 5 ' -GTCTACCAGGCATTCGCTTCATπiIIGTGTCCTACCCTGCTCAA-3 ' (SEQ ID NO: 17),

900-3 'primer: 5 '-CTGTGAATGCTGCGACTACGATmiITCTCTGGTATAAACAAAGCAT-3 ' (SEQ ID NO: 18);

10) 1000 bp for Interleukin-1 alpha gene (Genbank Accession NO. AF010237) 1000-5 'primer: 5 '-GTCTACCAGGCATTCGCTTCATπiIITTTAGGACATTCAGGTATCA-3 '

(SEQ ID NO: 19),

1000-3 'primer: 5'-CTGTGAATGCTGCGACTACGATIiπiTGAGGTAGGAAAGATGTAGC-3' (SEQ ID NO:20);

11) 1200 bp for Granulocyte-macrophage colony stimulating factor gene (Genbank Accession NO. X03020) 1200-5 'primer: 5 '-GTCTACCAGGCATTCGCTTCATIIIIITAACATGTGTGCAGACCC-3 '

(SEQ ID NO-21),

1200-3 'primer: 5 '-CTGTGAATGCTGCGACTACGATIimTGTCTTCCGCTGTCCAA-3 ' (SEQ ID NO:22);

12) 1500 bp for c-fos oncogene (Genbank Accession NO. V00727)

1500-5 'primer: 5 '-GTCTACCAGGCATTCGCTTCATIiπiTACTGACTGCACTTCCTGAC-3 ' (SEQ ID NO:23), and

1500-3 'primer: 5'-CTGTGAATGCTGCGACTACGATIIIIIACTAGGAACAACACACTCCA-3' (SEQ ID NO:24).

The Primers described previously were synthesized by means of a DNA synthesizer (Expedite 8900 Nucleic Acid Synthesis System, Applied Biosystems (ABI)) according to a standard protocol. The deoxyinosine in the primers was incorporated using deoxyinosine CE phosphoramidite (ABI). The primers were purified by means of an OPC cartridge (ABI), and their concentrations were determined by UV spectrophotometry at 260nm. In the primers described above, "I" symbolizes deoxyinosine.

The universal primers, JYC4 and JYC5, which correspond to the 5 '-end portion sequences (common sequences) of the 5' and 3' ACPs, respectively, are as follows: JYC4 5 '- GTCTACCAGGCATTCGCTTCAT -3 ' (SEQ ID NO:25), and JYC5 5 '- CTGTGAATGCTGCGACTACGAT -3 ' (SEQ ID NO:26).

B. PCR amplification

Each fragment of the 100 bp ladder, ranging in size from 100 bp to 1.5 kb, was amplified by a two-stage PCR amplification using the above ACP set. The first-stage PCR amplification was performed by hot start PCR method in which the procedure is to set up the complete reactions without the DNA polymerase and incubate the tubes in the thermal cycler to complete the initial denaturation step at >90°C (D'Aquila et al., Nucleic Acids Res., 19:3749 (1991)). Then, while holding the tubes at a temperature above 70°C, the appropriate amount of DNA polymerase can be pipetted into the reaction.

The first-stage PCR amplification was conducted by two cycles of PCR consisting of annealing, extending and denaturing reaction; the reaction mixture in a final volume of 49.5 μl containing 50 ng of the mouse genomic DNA, 5 μl of 10 x PCR reaction buffer (Promega), 5 μl of 25 mM MgCl₂, 5 μl of dNTP (2 mM each dATP, dCTP, dGTP, dTTP), 1 μl of 5' ACP (10 μM) and 1 μl of 3' ACP (10 μM) was pre-heated at 94°C, while holding the tube containing the reaction mixture at the 94°C, 0.5 μl of Taq polymerase (5units/ul; Promega) was added into the reaction mixture; the PCR reactions comprise two cycles of 94°C for 40 sec, 55-60°C for 40 sec, and 72°C for 80 sec; followed by denaturing the amplification product at 94°C.

After the completion of the first-stage PCR amplification, each 1 μl of the universal primers, JYC4 (10 μM) and JYC5 (10 μM) which correspond to the 5 '-end portion sequences of the 5' and 3' ACPs, was added into the reaction mixture obtained from the first-stage PCR amplification, under denaturing temperature such as at 94°C. The second stage-PCR reaction was as follows: 35 cycles of 94°C for 40 sec, 68°C for 40 sec, and 72°C for 80 sec; followed by a 5 min final extension at 72°C.

C. Gel extraction and cloning

The amplified products were analyzed by electrophoresis on a 2% agarose gel and detected by staining with ethidium bromide. The resulting PCR products can be also detected on a denaturing polyacrylamide gel by autoradiography or non-radioactive detection methods such as silver staining (Gottschlich et al., Res. Commun. Mol. Path. Pharm. 97:237-240(1997); and Kociok, N. et al., Mol. Biotechnol. 9, 25-33(1998)), the use of fluoresenscent-labelled oligonucleotides (Bauer et al. Nucleic Acids Res. 21:4272-4280(1993); Ito, T., et al., FEBS Lett. 351:231-236(1994); Luehrsen, K.R. et al., BioTechniques 22:168-174(1997); and Smith, N.R. et al., BioTechniques 23:274-279(1997)), and the use of biotinylated primers (Korn et al., Hum. Mol. Genet. 1:235-242(1992); Tagle, D.A. et al., Nature 361:751-753(1993); and Rosok, O. et al., BioTechniques 21:114-121(1996)). After electrophoresis on agarose gel stained with EtBr, each PCR product was extracted using GENECLEA II Kit (Q-BIOgene, USA) and cloned into the pGEM-T Easy vector (Promega, USA) as described by the manufacturer. The plasmid was transformed to the XL 1 -blue competent cell. The transformed cells were plated on LB/ampicillin agar plate. The plasmid was isolated from single and white colony. The insert was confirmed by digestion with EcoRλ restriction enzyme. The plasmid with the insert was sequenced using ABI PRISM 310 genetic analyzer (Applied Biosystems, USA).

EXAMPLE 3: Amplification of 100 bp Ladders by Multiplex PCR

A. Mixture of each 100 bp clone

The isolated 100 bp ladder clones ranging in size from 100 bp to 1500 bp were mixed in a single tube by using 0.1-1 ng of each 100 bp ladder plasmid. The concentration of each 100 bp ladder plasmid was adjusted depending on the purpose; if the 500 bp and 1000 bp ladders are to be more amplified than others, more concentration of these two plasmids is added into the plasmid mixture. The mixture was diluted to 100-1000 fold with 1 X TE buffer. The diluted mixture was used as a template in the following multiplex PCR amplification.

B. Multiplex PCR Multiplex PCR amplification was performed in 50 μl of reaction mixture containing 1 μl of the above diluted 100 bp ladder mixture, 5 μl of 10 x PCR reaction buffer (Promega), 5μl of 25 mM MgCl₂, 5 μl of dNTP (2 mM each dATP, dCTP, dGTP, dTTP), 1 μl of 10 μM 5' universal primer (JYC4), 1 μl of 10 μM 3' universal primer (JYC5), and 0.5 μl of Taq polymerase (5 units/μl; Promega, USA). The amplification reaction was carried out in a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems, USA) with denaturation for 3 min at 94°C, followed by 35 cycles of denaturation at 94°C for 40 sec, annealing at 68°C for 40 sec, and extension at 72°C for 40 sec, and a final extension at 72°C for 5 min. Two μl of the PCR reaction was detected on EtBr stained 2% agarose gel.

Figs. 1 and 2 show the amplified 100 bp ladder products by PCR (Fig. 1) and multiplex

PCR (Fig. 2), respectively. For the PCR, each 100 bp ladder plasmid was used as a template for the amplification of the corresponding fragment by using the universal primers, JYC4 and JYC5, as described in the above multiplex PCR. The results indicate that the universal primers can generate each 100 bp ladder fragment from the corresponding 100 bp ladder plasmid. For the multiplex PCR, the mixture of each 100 bp ladder plasmid was used as templates for amplification of the multiplex 100 bp ladders as described above. The amplified 100 bp ladders were detected by staining with ethidium bromide (Fig. 2, lane 2). These results indicate that the • method using ACPs for amplification of 100 bp ladder fragments ranging from 100 bp to 1500 bp by multiplex PCR approaches produces desired molecular weight markers such as 100 bp ladders without a discontinuous marker having several gaps mainly corresponding to the smaller fragment of the ladder, which was a major problem in the current multiplex PCR approaches for molecular weight markers (Amills et al., Genet. Anal, 13 : 147-149 (1996)).

EXAMPLE 4: Cloning of Each 100 bp Ladder Fragment into pUC19

In order to construct 100 bp DNA ladders into a pUC19 vector, the isolated twelve different ladder clones were used as templates for amplifying each fragment of the 100 bp ladder ranging in size from 100 bp to 1.5 kb, respectively.

A. PCR amplification

Each 100 bp DNA ladder fragment was amplified by an individual PCR amplification by using each 100 bp ladder clone ranging in size from 100 bp to 1500 bp as a template. To generate blunt ends, pfu DNA polymerase was used in PCR reaction. Each PCR amplification was performed in 50 μl of reaction mixture containing 10-30 ng of each 100 bp ladder plasmid, 5 μl of 10 x cloned pfu buffer (Stratagene), 5 μl of dNTP (2 mM each dATP, dCTP, dGTP and dTTP), 1-3 μl of 10 μM 5' universal primer (JYC4), 1-3 μl of 10 μM 3' universal primer (JYC5), and 1 μl of pfu polymerase (2.5 units/μl; Stratagene, USA). The amplification reaction was carried out in a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems, USA) with denaturation for 3 min at 94°C, followed by 35 cycles of denaturation at 94°C for 40 sec, annealing at 68°C for 40 sec, and extension at 72°C for 120 se , and a final extension at 72°C for 5 min.

B. Gel extraction and cloning

The successfully amplified products were analyzed by electrophoresis on a 2% agarose gel and detected by staining with ethidium bromide. After electrophoresis on agarose gel stained with EtBr, each successfully amplified PCR product for each 100 bp ladder was extracted using GENECLEAN II Kit (Q-BIOgene, USA) and cloned into the EcoICK I site of pUC19 vector. The plasmid was transformed to the XLl-blue competent cell. The transformed cells were plated on LB/ampicillin agar plate. The plasmid was isolated from single and white colony. The insert was confirmed by a double digestion analysis with EcoBI and BamBI restriction enzymes. The plasmid with the insert was sequenced using ABI PRISM 310 genetic analyzer (Applied Biosystems, USA).

EXAMPLE 5: Generation of 50 bp/100 bp DNA Ladders by Individual PCR Amplification

A. Amplification of each 100 bp DNA ladder fragment to generate 100 bp DNA ladder Each 100 bp DNA ladder fragment was amplified by an individual PCR amplification by using each 100 bp ladder clone ranging in size from 100 bp to 1500 bp as a template. Each PCR amplification was performed in 50 μl of reaction mixture containing 10-30 ng of each 100 bp ladder plasmid, 5 μl of 10 x PCR reaction buffer (Promega), 5μl of 25 mM MgCl₂, 5 μl of dNTP (2 mM each dATP, dCTP, dGTP, dTTP), 1-3 μl of 10 μM 5' universal primer (JYC4), 1- 3 μl of 10 μM 3' universal primer (JYC5), and 0.5 μl of Taq polymerase (5 units/μl; Promega, USA). The amplification reaction was carried out in a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems, USA) with denaturation for 3 min at 94°C, followed by 35 cycles of denaturation at 94°C for 40 sec, annealing at 68°C for 40 sec, and extension at 72°C for 40 sec, and a final extension at 72°C for 5 min. The successfully amplified products for each 100 bp ladder were mixed to generate the 100 bp DNA ladder. Figure 3 A shows photograph of the 100 bp DNA ladder fragments synthesized by PCR reaction using each ladder plasmid as a template (lanes 3-14).

B. Generation of 100 bp personalized DNA ladder

To create a personalized ladder, the desired plasmid templates each having differentially sized insert were chosen and the desired 100 bp ladder products were amplified using the chosen plasmids as templates and two universal primers, and mixed together, as described in the above step A. Figure 3B shows examples of the 100 bp DNA personalized ladder.

C. Amplification of each 50 bp DNA ladder fragment to generate 50 bp DNA ladder Each 50 bp DNA ladder fragment was amplified by an individual PCR amplification by using the same each 100 bp ladder clone ranging in size from 100 bp to 1500 bp as a template. The plasmid sequence was used to design the 50 bp universal primer sequences.

The 50 bp universal primers, puc-25F and puc-25R, which correspond to the forward and reverse sequences of the pUC19 vector from the insert sequence, respectively, are as follows: PUC-25F 5'-TAAAACGACGGCCAGTGAATTC-3' (SEQ ID NO:27), and

PUC-25R 5 '-CTCTAGAGGATCCCCGGGTACC-3 ' (SEQ ID NO:28).

Each PCR amplification was performed in 50 μl of reaction mixture by using each 100 bp ladder plasmid as a template, as described in the above step A, except the universal primers. The

50 bp universal primers, puc-25F and puc-25R, were used to amplify each 50 bp ladder fragment ranging in size from 150 bp to 1550 bp. For example, a 150 bp ladder fragment can be generated by using the 100 bp plasmid as a template. The successfully amplified products for each 50 bp ladder were mixed to generate the 50 bp DNA ladder. Figure 4A shows photograph of the 50 bp DNA ladder fragments synthesized by PCR reaction using each 100 bp ladder plasmid as a template (lanes 4-15).

D. Generation of 50 bp personalized DNA ladder

To create a personalized ladder, the desired plasmid templates each having differentially sized insert were chosen and the desired 50 bp ladder products were amplified using the chosen plasmids as templates and the two 50 bp universal primers and mixed together, as described in the above step B. Figure 4B shows examples of the 50 bp DNA personalized ladder.

Having described a preferred embodiment of the present invention, it is to be understood that variants and modifications thereof falling within the spirit of the invention may become apparent to those skilled in this art, and the scope of this invention is to be determined by appended claims and their equivalents.

Claims

What is claimed is:

1. A method for preparing a DNA size marker set, which comprises the steps of:

(a) selecting a plurality of specific regions on target DNA molecule(s) to be amplified so that each amplified product has a definite and desired length; (b) preparing a plurality of first primer pairs for amplifying the specific regions in which a 5 '-end portion of each forward primer of the first primer pairs has a common nucleotide sequence, a 5 '-end portion of each reverse primer of the first primer pairs has a common nucleotide sequence and a 3 '-end portion of the first primer pairs has an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto;

(c) performing a polymerase chain reaction of the specific regions using the first primer pairs so that DNA molecules with definite and desired lengths are amplified;

(d) cloning each amplified product with a definite and desired length into a plasmid; and

(e) amplifying the amplified product by a polymerase chain reaction with one type of a third primer pair using the cloned plasmid(s) as template(s) to generate the DNA size marker set; wherein a forward primer of the third primer pair has a nucleotide sequence^' substantially corresponding to the common nucleotide sequence of the forward primers of the first primer pairs and a reverse primer of the third primer pair has a nucleotide sequence substantially corresponding to the common nucleotide sequence of the reverse primers of the first primer pairs, whereby each primer of the third primer pair is hybridized with a nucleotide sequence of each end portion of the amplified products of the step (d).

2. The method according to claim 1, wherein the plasmids used in the step (d) are identical to each other.

3. The method according to claim 2, wherein said method further comprises the step of (e') amplifying the amplified product plus a partial sequence of the plasmid by a polymerase chain reaction with one type of a fourth primer pair using the cloned plasmid(s) as template(s) to generate the DNA size marker set; in which a forward primer of the fourth primer pair has a nucleotide sequence to anneal to a nucleotide sequence of the plasmid being away from the 5'- end of the amplified product and a reverse primer of the fourth primer pair has a nucleotide sequence to anneal to a nucleotide sequence of the plasmid being away from the 3 '-end of the amplified product.

4 The method according to claim 1 or 3, wherein the amplification in the step (e) or (e') is carried out by a multiplex polymerase chain reaction in the same reaction using a mixture of the cloned plasmids as templates to generate the DNA size marker set.

5. The method according to claim 4, wherein the multiplex polymerase chain reaction is carried out with an annealing temperature of 50-72°C.

6. The method according to claim 1 or 3, wherein the amplification in the step (e) or (e') is carried out by each polymerase chain reaction using each cloned plasmid as a template.

7. The method according to claim 6, wherein the amplification in the step (e) or (e') is followed by the step of (f) combining the amplified products with definite and desired lengths in a single tube to generate a DNA size marker set.

8. The method according to claim 1, wherein the specific regions to be amplified are present on same or different target DNAmolecule(s).

9. The method according to claim 1, wherein each of the first primer pairs comprises: (i) the

3 '-end portion having an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto; and (ii) the 5 '-end portion having as a common nucleotide sequence a pre-selected arbitrary nucleotide sequence substantially not complementary to any site on the target DNA molecule(s).

10. The method according to claim 9, wherein each of the first primer pair further comprises (iii) a regulator portion positioned between the 3'-end portion and the 5'-end portion comprising at least one universal base or non-discriminatory base analog, whereby the regulator portion is capable of enhancing an annealing specificity of the 3 '-end portion of the first primer to the site to anneal thereto.

11. The method according to claim 10, wherein the regulator portion comprises contiguous nucleotides consisting of universal bases or non-discriminatory base analogs.

12. The method according to claim 11, wherein the universal base or non-discriminatory base analog is deoxyinosine, 1 -(2 '-deoxy-beta-D-ribofuranosyl)-3 -nitropyrrole or 5-nitroindole.

13. The method according to claim 10, wherein the regulator portion comprises at least two universal bases or non-discriminatory base analogs.

14. The method according to claim 1, wherein the nucleotide sequences of the 5 '-end portions of the forward primers of the first primer pairs are identical to or different from those of the 5'- end portions of the reverse primers.

15. The method according to claim 1, wherein the step (c) is followed by the step (c)' of a second-stage polymerase chain reaction using the second primer pair; in which each second primer comprises a nucleotide sequence to be hybridized with a nucleotide sequence of each end portion of the amplified products in the step (c).

16. The method according to claim 15, wherein the second primer pair consists of one primer having a substantially corresponding sequence to the common nucleotide sequence at the 5 '-end portion of the forward primer of the first primer and the other primer having a substantially corresponding sequence to the common nucleotide sequence at the 5 '-end portion of the reverse primer of the first primer.

17. The method according to claim 16, wherein the second primer consists of a substantially corresponding sequence to the 5 '-end portion of the first primer.

18. The method according to claim 15, wherein the second-stage polymerase chain reaction is carried out with an annealing temperature of 50-72°C.

19. The method according to claim 1, wherein the amplified products from polymerase chain reactions are of different and definite lengths ranging from 100 to 1,500 base pairs.

20. The method according to claim 3, wherein the amplified products from polymerase chain reactions are of different and definite lengths ranging from 50 to 1,550 base pairs.

21. The method according to claim 1 or 3, wherein the amplified products from polymerase chain reactions are of different and definite lengths ranging from 0.5 to 15.0 kilobase pairs.

22. A method for preparing a plasmid set used in producing a DNA size marker set, which comprises the steps of:

(a) selecting a plurality of specific regions on target DNA molecule(s) to be amplified so that each amplified product has a definite and desired length;

(b) preparing a plurality of first primer pairs for amplifying the specific regions in which a 5 '-end portion of each forward primer of the first primer pairs has a common nucleotide sequence, a 5 '-end portion of each reverse primer of the first primer pairs has a common nucleotide sequence, and a 3 '-end portion of the first primer pairs has an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto;

(c) performing a polymerase chain reaction of the specific regions using the first primer pairs so that DNA molecules with definite and desired lengths are amplified; and

(d) cloning each amplified product with a definite and desired length into a plasmid, whereby the amplified products in the plasmids can be amplified with one type of the third primer pair to generate the DNA size marker set.

23. The method according to claim 22, wherein the specific regions to be amplified are present on same or different target DNA molecule(s).

24. The method according to claim 22, wherein each of the first primer pairs comprises: (i) the 3 '-end portion having an annealing nucleotide sequence substantially complementary to a site on the specific region to anneal thereto; and (ii) the 5 '-end portion having as a common nucleotide sequence a pre-selected arbitrary nucleotide sequence substantially not complementary to any site on the target DNA molecule(s).

25. The method according to claim 24, wherein each of the first primer pair further comprises (iii) a regulator portion positioned between the 3 '-end portion and the 5 '-end portion comprising at least one universal base or non-discriminatory base analog, whereby the regulator portion is capable of enhancing an annealing specificity of the 3 '-end portion of the first primer to the site to anneal thereto.

26. The method according to claim 25, wherein the regulator portion comprises contiguous nucleotides consisting of universal bases or non-discriminatory base analogs.

27. The method according to claim 25, wherein the universal base or non-discriminatory base analog is deoxyinosine, l-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole.or 5-nitroindole.

28. The method according to claim 25, wherein the regulator portion comprises at least two universal bases or non-discriminatory base analogs.

29. The method according to claim 22, wherein the nucleotide sequences of the 5 '-end portions of the forward primers of the first primer pairs are identical to or different from those of the 5'- end portions of the reverse primers.

30. The method according to claim 22, wherein the step (c) is followed by the step (c)' of a second-stage polymerase chain reaction using a second primer pair in which each second primer comprises a nucleotide sequence to be hybridized with a nucleotide sequence of each end portion of the amplified products in the step (c).

31. The method according to claim 30, wherein the second primer pair consists of one primer having a substantially corresponding sequence to the common nucleotide sequence at the 5 '-end portion of the forward primer of the first primer and the other primer having a substantially corresponding sequence to the common nucleotide sequence at the 5 '-end portion of the reverse primer of the first primer.

32. The method according to claim 31, wherein the second primer consists of a substantially corresponding sequence to the 5 '-end portion of the first primer.

33. The method according to claim 30, wherein the second-stage polymerase chain reaction is carried out with an annealing temperature of 50-72°C.

34. The method according to claim 22, wherein the cloned plasmids comprise insert sequences having different and definite lengths ranging from 100 to 1,500 base pairs.

35. The method according to claim 22, wherein the cloned plasmids comprise insert sequences having different and definite lengths ranging from 0.5 to 10.0 kilobase pairs.

36. A plasmid set prepared by the method of any one of claims 22-35 for producing a DNA size marker set, wherein the plasmids comprise insert sequences being of different and definite lengths and spanning the desired range of base pair lengths; in vvhich when the insert sequences in the plasmids are amplified, a DNA size marker set having different and definite lengths and spanning the desired range of base pair lengths is produced.

37. A kit for preparing a DNA size marker set, which comprises (i) the plasmid set of claim 36 and (ii) the third primer pair of claim 1 and/or the fourth primer pair of claim 3.

38. A DNA size marker set prepared by the method of claim 1 or 3, wherein the DNA size markers are of different and definite lengths and span the desired range of base pair lengths.