WO2004052313A2 - Anti-infectives - Google Patents

Anti-infectives Download PDF

Info

Publication number
WO2004052313A2
WO2004052313A2 PCT/US2003/039983 US0339983W WO2004052313A2 WO 2004052313 A2 WO2004052313 A2 WO 2004052313A2 US 0339983 W US0339983 W US 0339983W WO 2004052313 A2 WO2004052313 A2 WO 2004052313A2
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
heteroaryl
heterocycloalkyl
aryl
och
Prior art date
Application number
PCT/US2003/039983
Other languages
French (fr)
Other versions
WO2004052313A3 (en
Inventor
Deping Chai
Kevin J. Duffy
Duke M. Fitch
Antony N. Shaw
Rosanna Tedesco
Kenneth J. Wiggall
Michael N. Zimmerman
Original Assignee
Smithkline Beecham Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation filed Critical Smithkline Beecham Corporation
Priority to AU2003300957A priority Critical patent/AU2003300957A1/en
Publication of WO2004052313A2 publication Critical patent/WO2004052313A2/en
Publication of WO2004052313A3 publication Critical patent/WO2004052313A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond

Definitions

  • the present invention relates to compounds that inhibit an RNA-containing virus and methods of making and using the same. Specifically, the present invention relates to inhibitors of hepatitis C virus (HCV).
  • HCV hepatitis C virus
  • HCV infection is responsible for 40-60% of all chronic liver disease and 30% of all liver transplants. The CDC estimates that the number of deaths due to HCV will minimally increase to 38,000/yr. by the year 2010.
  • Alpha-interferon (alone or in combination with ribavirin) has been widely used since its approval for treatment of chronic HCV infection.
  • adverse side effects are commonly associated with this treatment: flulike symptoms, leukopenia, thrombocytopenia, and depression from interferon, as well as hemolytic anemia induced by ribavirin (Lindsay, K.L. (1997) Hepatology 26 (Suppl. 1):71S-77S).
  • HCV post- transfusion non A, non-B hepatitis
  • HCV is an enveloped virus containing a single strand RNA molecule of positive polarity.
  • the HCV genome is approximately 9.6 kilobases (kb) with a long, highly conserved, noncapped 5' nontranslated region (NTR) of approximately 340 bases which functions as an internal ribosome entry site (IRES) (Wang, C.Y., Le, S.Y., Ali, N., Siddiqui, A., Rna-A Publication of the Rna Society. 1(5): 526-537, 1995 Jul). This element is followed by a region which encodes a single long open reading frame (ORF) encoding a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins.
  • ORF long open reading frame
  • the HCV-RNA Upon entry into the cytoplasm of the cell, the HCV-RNA is directly translated into a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins. This large polypeptide is subsequently processed into the individual structural and nonstructural proteins by a combination of host and virally-encoded proteinases (Rice, CM. (1996) in B.N. Fields, D.M.Knipe and P.M. Howley (Eds.) Virology, 2nd Edition, p931- 960, Raven Press, NY).
  • 3 'NTR which roughly consists of three regions: an - 40 base region which is poorly conserved among various genotypes, a variable length poly(U)/polypyrimidine tract, and a highly conserved 98 base element also called the "3'X-tail" (Kolykhalov, A. et al, (1996) J. Virology 70:3363-3371; Tanaka, T. et al, (1995) Biochem Biophys. Res. Commun. 215:744-749; Tanaka, T. et al, (1996) J. Virology 70:3307-3312; Yamada, N. et al, (1996) Virology 223:255-261).
  • the 3' NTR is predicted to form a stable secondary structure that is essential for HCV growth in chimps and is believed to function in the initiation and regulation of viral RNA replication.
  • the NS5B protein (591 amino acids, 65 kDa) of HCV (Behrens, S.E., et al, (1996) EMBO J. 15:12-22), encodes an RNA-dependent RNA polymerase (RdRp) activity and contains canonical motifs present in other RNA viral polymerases.
  • RdRp RNA-dependent RNA polymerase
  • the NS5B protein is fairly well conserved both intra-typically (-95-98% amino acid (aa) identity across lb isolates) and inter-typically (-85% aa identity between genotype la and lb isolates).
  • HCV NS5B RdRp activity for the generation of infectious progeny virions has been formally proven in chimpanzees (Kolykhalov, A.A., et al, (2000) J. Virology 74:2046-2051).
  • inhibition of NS5B RdRp activity is predicted to cure HCV infection.
  • Positive strand hepatitis C viral RNA is the nucleic acid strand that is translated and initially copied upon entry of the HCV-RNA into the cell. Once in the cell, positive strand viral RNA generates a negative strand replicative intermediate.
  • Negative strand RNA is the template used to generate the positive strand message that is generally packaged into productive virions.
  • HCV inhibitor compounds are only evaluated for their ability to inhibit positive strand HCV-RNA. However, it would be desirable to develop inhibitor compounds having the ability to inhibit both positive and negative strand replication to obtain complete clearance of the HCV virus.
  • R 1 is hydrogen, halogen, C C 4 alkyl, -OR 11 , -SR 11 , -NR 10 R ⁇ , aryl, -C(0)OH, -C(0)NHR ⁇ , cyano, nitro, amino, -0(C C 4 alkyl)C(0)NH 2)
  • R 5 is selected from the group consisting of hydrogen, halogen, cyano, Ci-C ⁇ alkyl, -OH, and -OC C 4 alkyl;
  • R 7 is -0-C 3 -C 3 cycloalkyl, -O-heterocycloalkyl, -O-heteroaryl, -O-Ci-Q alkyl-C 3 -C 8 cycloalkyl, -0-C ⁇ -C 6 alkyl-heterocycloalkyl, -O-C C ⁇ alkyl-heteroaryl, where any of said cycloalkyl, heterocycloalkyl, or heteroaryl (including the cycloalkyl, heterocycloalkyl, or heteroaryl moieties of said -Ci-C ⁇ alkyl-C 3 -C 8 cycloalkyl
  • R 8 is hydrogen, halogen, hydroxyl, C C 4 alkyl, -C(0)OR 9 , -C(0)R 9 , -C(0)NR 9 R 10 , -OR 14 , -NR 9 R 10 , -N(R 10 )C(O)R 9 , -OC(0)NR 9 R 10 , -N(R 10 )C(O)NR 9 R 10 or -N(R 10 )SO 2 R 12 ; or R 1 and R 2 or R 5 and R 6 or R 6 and R 7 or R 7 and R 8 taken together are alkylenedioxy; W is hydrogen, -C(0)OR ⁇ , C C 10 alkyl, C 2 -C 10 alkenyl, C 2 -C ⁇ 0 alkynyl,
  • X is O or S
  • Y is -OH or -SH
  • Z is hydrogen or C C alkyl; wherein each R 9 is independently selected from the group consisting of hydrogen, d-C 3 alkyl, C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, C 3 -C 8 cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-C 3 -C 8 cycloalkyl, -d-Q alkyl-heterocycloalkyl, -d-Q alkyl-aryl, and -C ⁇ -C 6 alkyl-heteroaryl, -C 2 -Q alkenyl-C 3 -C 8 cycloalkyl, -C 2 -C 6 alkenyl-heterocycloalkyl, -C 2 -Q alkenyl-aryl, -C 2 -C 6 alkenyl-heterocycloalkyl, -C 2 -Q alkenyl-aryl
  • each R 12 is independently selected from the group consisting of Ci-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, and
  • R 1 is amino, -0(C,-Q alkyl)C(0)NH 2 , -0(C r Q alkyl)C(0)NH(d-Q alkyl), -0(Q-C 4 alkyl)C(0)N(d-C 4 alkyl)(Q-C 4 alkyl), -0(d-Q alkyl)C0 2 H, or -0(Q-Q alkyl) C0 2 (d-Q alkyl);
  • R 4 is Q-Q haloalkyl, nitro or amino;
  • R 6 is Q-Q haloalkyl, nitro or amino
  • R 8 is -C(0)OR 9 , -C(0)R 9 , -C(0)NR 9 R 10 , -OR 14 , -NR 9 R 10 , -N(R 10 )C(O)R 9 , -OC(0)NR 9 R 10 , -N(R 10 )C(O)NR 9 R 10 or -N(R 10 )SO 2 R 12 ;
  • W is Ci-Cio alkyl substituted with -C(0)d-Q alkyl or -C(0)N(Q-C 4 alkyl) 2 ; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • This invention is also directed to a prodrug of a compound according to Formula I, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • this invention is directed to pharmaceutical compositions comprising a compound according to Formula I, or a tautomer thereof, or a prodrug thereof, or salts or solvates thereof.
  • this invention is directed to a method of inhibiting an RNA- containing virus comprising contacting the virus with an effective amount of a compound of Formula I.
  • this invention is directed to a method of treating infection or disease caused by an RNA-containing virus which comprises administering to a subject in need thereof, an effective amount of a compound according to Formula I.
  • This invention is particularly directed to methods of inhibiting hepatitis C virus.
  • This invention is also directed to a method for inhibiting replication of hepatitis C virus which comprises inhibiting replication of both positive and negative strand HCV-RNA.
  • alkyl represents a straight-or branched-chain saturated hydrocarbon, which may be unsubstituted or substituted by one, or more of the substituents defined herein.
  • exemplary alkyls include, but are not limited to methyl (Me), ethyl (Et), propyl, isopropyl, butyl, isobutyl, t-butyl and pentyl.
  • lower alkyl refers to an alkyl containing from 1 to 4 carbon atoms.
  • alkyl (or alkenyl or alkynyl) is used in combination with other substituent groups, such as "haloalkyl” or “arylalkyl", the term “alkyl” is intended to encompass a divalent straight or branched-chain hydrocarbon radical.
  • cycloalkylalkyl is intended to mean the radical -alkyl-cycloalkyl, wherein the alkyl moiety thereof is a divalent straight or branched-chain hydrocarbon radical and the cycloalkyl moiety thereof is as defined herein, and is represented by the bonding arrangement present in the groups -CH 2 -cyclopropyl, -CH 2 -cyclohexyl, or -CH 2 (CH 3 )CHCH 2 -cyclopentenyl.
  • Arylalkyl is intended to mean the radical -alkylaryl, wherein the alkyl moiety thereof is a divalent straight or branched-chain carbon radical and the aryl moiety thereof is as defined herein, and is represented by the bonding arrangement present in a benzyl group (-CH 2 -phenyl).
  • alkenyl represents a straight-or branched-chain hydrocarbon containing one or more carbon-carbon double bonds.
  • An alkenyl may be unsubstituted or substituted by one or more of the substituents defined herein.
  • Exemplary alkenyls include, but are not limited ethenyl, propenyl, butenyl, isobutenyl and pentenyl.
  • alkynyl represents a straight-or branched-chain hydrocarbon containing one or more carbon-carbon triple bonds and, optionally, one or more carbon-carbon double bonds.
  • An alkynyl may be unsubstituted or substituted by one or more of the substituents defined herein.
  • Exemplary alkynyls include, but are not limited ethynyl, butynyl, propynyl (propargyl, isopropynyl), pentynyl and hexynyl.
  • Cycloalkyl represents a group or moiety comprising a non-aromatic monocyclic, bicyclic, or tricyclic hydrocarbon containing from 3 to 14 carbon atoms which may be unsubstituted or substituted by one or more of the substituents defined herein and may be saturated or partially unsaturated.
  • exemplary cycloalkyls include monocyclic rings having from 3-7, preferably 3-6, carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclopentadienyl, cyclohexyl, cyclohexenyl and cycloheptyl.
  • Heterocycloalkyl represents a group or moiety comprising a non-aromatic, monovalent monocyclic, bicyclic, or tricyclic radical, which is saturated or partially unsaturated, containing 3 to 18 ring atoms, which includes 1 to 5 heteroatoms selected from nitrogen, oxygen and sulfur, and which may be unsubstituted or substituted by one or more of the substituents defined herein.
  • heterocycloalkyls include, but are not limited to, azetidinyl, pyrrolidyl (or pyrrolidinyl), piperidinyl, piperazinyl, morpholinyl, tetrahydro-2H-l,4-thiazinyl, tetrahydrofuryl (or tetrahydrofuranyl), dihydrofuryl, oxazolinyl, thiazolinyl, pyrazolinyl, tetrahydropyranyl, dihydropyranyl, 1,3- dioxolanyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-oxathiolanyl, 1,3-oxathianyl, 1,3-dithianyl, azabicylo[3.2.1]octyl, azabicylo[3.3.1]nonyl, azabicylo[4.3.0
  • heterocycloalkyl is a monocyclic heterocycloalkyl, such as azetidinyl, pyrrolidyl (or pyrrolidinyl), piperidyl (or piperidinyl), piperazinyl, morpholinyl, tetrahydro-2H-l,4- thiazinyl, tetrahydrofuryl (or tetrahydrofuranyl), tetrahydrothienyl, dihydrofuryl, tetrahydropyranyl, dihydropyranyl, 1,3-dioxolanyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-oxathianyl, 1,3-dithianyl, oxazolinyl, thiazolinyl and pyrazolinyl.
  • azetidinyl such as azetidinyl, pyrrolidyl (or pyrrol
  • Aryl represents a group or moiety comprising an aromatic, monovalent monocyclic or bicyclic hydrocarbon radical containing from 6 to 10 carbon ring atoms, which may be unsubstituted or substituted by one or more of the substituents defined herein, and to which may be fused one or more cycloalkyl rings, which may be unsubstituted or substituted by one or more substituents defined herein.
  • aryl is phenyl.
  • Heteroaryl represents a group or moiety comprising an aromatic monovalent monocyclic, bicyclic, or tricyclic radical, containing 5 to 18 ring atoms, including 1 to 5 heteroatoms selected from nitrogen, oxygen and sulfur, which may be unsubstituted or substituted by one or more of the substituents defined herein.
  • This term also encompasses bicyclic or tricyclic heterocyclic-aryl compounds containing an aryl ring moiety fused to a heterocycloalkyl ring moiety, containing 5 to 16 ring atoms, including 1 to 5 heteroatoms , selected from nitrogen, oxygen and sulfur, which may be unsubstituted or substituted by one or more of the substituents defined herein.
  • heteroaryls include, but are not limited to, thienyl, pyrrolyl, imidazolyl, pyrazolyl, furyl (or furanyl), isothiazolyl, furazanyl, isoxazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyridyl (or pyridinyl), pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, tetrazinyl, triazolyl, tetrazolyl, benzo[b]thienyl, naphtho[2,3-b]thianthrenyl, isobenzofuryl, 2,3-dihydrobenzofuryl, chromenyl, chromanyl, xanthenyl, phenoxathienyl, indolizinyl, isoindolyl, indolyl, indazolyl
  • heteroaryl is a monocyclic heteroaryl, such as thienyl, pyrrolyl, imidazolyl, pyrazolyl, furyl, isothiazolyl, furazanyl, isoxazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, tetrazinyl, triazolyl and tetrazolyl.
  • halogen and “halo” represent chloro, fluoro, bromo or iodo substituents.
  • Halroxy is intended to mean the radical -OH.
  • Alkoxy is intended to mean the radical -OR a , where R a is an optionally substituted alkyl group. Exemplary alkoxy include methoxy, ethoxy, propoxy, and the like.
  • Lower alkoxy groups have optionally substituted alkyl moieties from 1 to 4 carbons.
  • Alkylenedioxy is intended to mean the divalent radical -OR a O- which is bonded to adjacent atoms (e.g., adjacent atoms on a phenyl or naphthyl ring), wherein R a is a d-Q alkyl group.
  • alkylenedioxy-substituted phenyls include benzo[l,3]dioxyl and 2,3-dihydro-benzo[l,4]dioxyl.
  • R 1 is amino, -0(C Q alkyl)C(0)NH 2 , -0(Q-Q alkyl)C(0)NH(Q-Q alkyl), -0(C ⁇ -Q alkyl)C(0)N(d-Q alkyl)(d-C 4 alkyl), -0(C Q alkyl)C0 2 H, or -0(d-Q alkyl)C0 2 (Ci-C 4 alkyl).
  • R 4 is nitro.
  • R 6 is -CF 3 .
  • this invention is directed to compounds wherein R 8 is -0(Q-Q alkyl) or -0(Q-C 4 alkenyl), where the Q-Q alkyl or C 2 -Q alkenyl- group is unsubstituted or substituted with a substituent selected from -CON(C ⁇ -Q alkyl)(C ⁇ -Q alkyl), -CONH(C Q alkyl), -CONH 2 .
  • W is -Q-Q alkyl-C(0)d-C 4 alkyl or -Q-Q alkyl-C(0)N(d-C 4 alkyl) 2 ; specifically, W is -CH 2 C(0)C(CH 3 ) 3 or -CH 2 C(0)N(CH 3 ) 2 .
  • R 1 , R 2 , R 4 , R 6 R 7 , R 8 or W when at least one of R 1 , R 2 , R 4 , R 6 R 7 , R 8 or W is defined as above, R 3 and R 5 , or the other of R 1 , R 2 , R 4 , R 6 R 7 , R 8 and W may be any substituent defined herein.
  • R 1 is hydrogen, halogen, Q-C 4 alkyl, aryl, -OR a , -C(0)OH, -C(0)NHR a , cyano, nitro, amino, -0(C Q alkyl)C(0)NR a R a or -0(d-Q alkyl)C0 2 R a .
  • R 1 is H, phenyl, -CH 3 , -OCH 3 , -N0 2 , -NH 2 , F, Cl, Br, -OH, -C(0)OH, -C(0)NHCH 3 , -OCH 2 C(0)NH 2 or -0CH 2 C0 2 CH 2 CH 3 .
  • R 1 is H, F, Cl, phenyl, -CH 3 , -OCH 3 , -N0 2 , -NH 2 , -OH, -C(0)NHCH 3 , -OCH 2 C(0)NH 2 or -OCH 2 C0 2 CH 2 CH 3 .
  • R 1 is H, -NH 2 , -OCH 2 C(0)NH 2 or -OCH 2 C0 2 CH 2 CH 3 .
  • C C 6 alkyl or Q-Q alkenyl is optionally unsubstituted or substituted by one or more substituents independently selected from the group consisting of cyano, -OQ-Q alkyl, -OH, -N(C Q alkylXd-Q alkyl), -NH(d-Q alkyl), -NH 2 , -C0 2 H, -C(0)OQ-C 4 alkyl, -CON(Q-C 4 alkyl)(C r C 4 alkyl), -CONH(d-Q alkyl), and -CONH 2 , and where
  • R 1 and R 2 taken together are methylenedioxy.
  • R 3 is H, halogen, -OH or -C(0)OH, preferably H or F. In the specific embodiments of the compounds described herein, R 3 is H. In a further embodiment, R 4 is H, halogen, C r Q alkyl or nitro. In specific embodiments, R 4 is H, Br, F or nitro. In the specific embodiments of the compounds described herein, R 4 is H or nitro.
  • R 5 is H, halogen, d-Q alkyl, or -OR .
  • R 5 is H, Br, Cl, methyl, methoxy, or hydroxyl.
  • R 5 is H or Cl.
  • R 6 is H, halogen, Q-Q alkyl, Q-Q haloalkyl or -OR a .
  • R 6 is H, hydroxyl, methoxy, Br, Cl or CF 3 .
  • R 6 is H or CF 3 .
  • R is H
  • R s is hydrogen, -OR b8 or -NHR b8 , where R bs is H or Q-Q alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C0 2 H, -CONH 2 , -C(0)OC C 2 alkyl, -CONH(Q-C 2 alkyl), and -CON(Q-Q alkyl) 2 , or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C0 2 H, -CONH 2 , -C(0)OC Q alkyl, ⁇ CONH(Q-C 2 alkyl) and -CON(Q-Q alkyl) 2 .
  • R 8 is H, -OCH 3 , -OCH 2 CONH 2 , or
  • W is hydrogen, -C(0)OR a , C 3 -C 8 alkyl, Q-Q alkenyl, Q-Q alkynyl,-C ⁇ -Q alkyl-C(0)Q-Q alkyl, -Q-C 2 alkyl-C(0)N(C r C 4 alkyl) 2 , -(C 1 -C 4 alkyl)-(C 3 -C 5 cycloalkyl), -(C C 4 alkyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, or -(C 1 -C 4 alkyl)-heteroaryl, where the Q-Q alkyl, Q-Q alkenyl or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, cyano, -0R ⁇ -SR a , -S(0)d-Q alkyl, -S(0) 2 C C 4
  • W is Q-Q alkyl, Q alkenyl, Q alkynyl, -(Q-Q alkyl)-(Q-Q cycloalkyl), -(Ci alkyl)-heterocycloalkyl, -(Q alkyl)-aryl, or -(Q alkyl)-heteroaryl, where the Q-Q alkyl, Q alkenyl or Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -OCH , -SCH 3 , and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of the
  • -(d-Q alkyl)-(C 3 -Q cycloalkyl), -(d-Q alkyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, or -(Q-Q alkyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from -CH 3 , halogen, nitro, cyano, -OR a , -NR a R a .
  • W is H, -(CH 2 ) ⁇ - 3 -phenyl, -CH 2 -(2-CN-phenyl), -(CH ⁇ cyclopropyl, -CH 2 (2-CH 3 -cycloprop-l-yl), -(CH 2 )-cyclobutyl, -(CH 2 )-cyclopentyl, -(CH 2 )-cyclohexyl, -CH 2 -(2-tetrahydrofuryl), -CH 2 -(3 -tetrahydrofuryl), -CH 2 -(3-pyridyl), -CH 2 -(6-NH 2 -3-pyridyl), -CH 2 -(4-pyridyl), -CH 2 -(2-NH 2 -4-pyridyl), -CH 2 -(2-CH 3 -4- pyridyl), -CH 2 -(4-bromophenyl), -CHCH 2 -
  • W is -(CH 2 ) 2 CH(CH 3 ) 2 , -CH 2 C(0)C(CH 3 ) 3 , -CH 2 C(0)N(CH 3 ) 2 , or -(CH 2 ) 2 (cyclopropyl).
  • X is O
  • Y is OH
  • Z is H or methyl.
  • Z is H. It is to be understood that the present invention covers all combinations of specific and preferred groups described herein.
  • one embodiment of this invention comprises compounds wherein:
  • R 1 is hydrogen, halogen, C r Q alkyl, aryl, -OR a , -C(0)OH, -C(0)NHR a , cyano, nitro, amino, -0(Q-Q alkyl)C(0)NR a R a or -0(Q-Q alkyl)C0 2 R a ;
  • R 3 is H, halogen or -C(0)OH
  • R 4 is H, halogen, Q-Q alkyl or nitro
  • R 5 is H, halogen, C Q alkyl, or -OR a
  • R 6 is H, halogen, Q-Q alkyl, Q-Q haloalkyl or -OR a ;
  • R' is hydrogen, halogen, -Q-Q alkyl, -Q alkenyl, -C(0)OR a , -C(0)R a , -OR b"" , -NR a R d' , -C(0)NR a R d' ,
  • R 8 is hydrogen, -OR b8 , -NHR b8 , where R b8 is H or Q-Q alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C0 2 H, -CONH 2 , -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl), or -CON(Q-Q alkyl) 2 , or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C0 2 H, -CONH 2 , -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl) or -CON(Q-C 4 alkyl) 2 ; W is Q-Q alkyl, Q alkenyl, Q alkynyl, W is -Q-Q
  • R 1 is amino, -0(Q-Q alkyl)C(0)NH 2 , -0(Q-Q alkyi)C(0)NH(Q-Q alkyl), -0(C r Q alkyl)C(0)N(Q-Q alkyl)(Q-C 4 alkyl), -0(Q-Q alkyl)C0 2 H, or -0(C r Q alkyl)C0 2 (Q-C 4 alkyl).
  • R 4 is nitro
  • R 6 is C r C 4 haloalkyl
  • R 8 is, -OR b8 , -NHR b8 , where R b8 is C C 4 alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C0 2 H, -CONH 2 , -C(0)OQ-Q alkyl, -CONH(d ⁇ Q alkyl), or -CON(C Q alkyl) 2 , or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C0 2 H, -CONH 2 , -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl) or -CON(Q-Q alkyl) 2 .; or W is -Q-Q alkyl-C(0)Q-Q alkyl or -Q-Q alkyl-C(0)N
  • Another embodiment of this invention comprises compounds of Formula I, wherein
  • R 1 is H, phenyl, -CH 3 , -OCH 3 , -N0 2 , -NH 2 , F, Cl, Br, -OH, -C(0)OH, -C(0)NHCH 3 , -OCH 2 C(0)NH 2 or -OCH 2 C0 2 CH 2 CH 3 ;
  • R 2 is H F, Cl, -OH, -NH 2 , N0 2 , -CH 3 , -OCH 3 , -NHCH 3 , -0(CH 2 ) 2 OH,
  • R 3 is H or halogen
  • R 4 is H or nitro
  • R is H, halogen or -OH;
  • R 6 is H or CF 3 ;
  • X is O; Y is OH; Z is H; provided that at least one of R 1 , R 2 , R 4 , R ⁇ R 7 , R 8 or W is defined as follows, wherein:
  • R 1 is -NH 2 , -OCH 2 C(0)NH 2 or -OCH 2 C0 2 CH 2 CH 3 ;
  • R 4 is nitro
  • R 6 is -CF 3 ;
  • W is -CH 2 C(0)C(CH 3 ) 3 or -CH 2 C(0)N(CH 3 ) 2 . tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • Yet another embodiment of this invention comprises compounds of Formula I wherein:
  • R 1 is H, -NH 2 , -0CH 2 C(0)NH 2 or -OCH 2 C0 2 CH 2 CH 3 ;
  • R 3 is H
  • R 4 is H or nitro;
  • R 5 is H or Cl;
  • R 6 is H or CF 3 ;
  • W is -(CH 2 ) 2 CH(CH 3 ) 2 , -CH 2 C(0)C(CH 3 ) 3 , -CH 2 C(0)N(CH 3 ) 2 , or -(CH 2 ) 2 (cyclopropyl);
  • X is O;
  • Y is OH;
  • Z is H; provided that at least one of R 1 , R 2 , R 4 , R 6 R 7 , R 8 or W is defined as follows, wherein: R 1 is -NH 2 , -OCH 2 C(0)NH 2 or -OCH 2 C0 2 CH 2 CH 3 ;
  • R 4 is nitro
  • R 6 is -CF 3 ;
  • W is -CH 2 C(0)C(CH 3 ) 3 or -CH 2 C(0)N(CH 3 ) 2 . or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • R 2 , R 7 , R 8 and W are as defined herein.
  • R 2 , R 7 , R 8 and W are as defined herein.
  • at least one of R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 or R 8 is not H.
  • at least one of R 1 , R 2 , R 6 , R 7 or R 8 is not H.
  • at least one of R 2 or R 7 or at least one of R 2 or R 8 is not H.
  • a substituent described herein is not compatible with the synthetic methods of this invention, the substituent may be protected with a suitable protecting group that is stable to the reaction conditions used in these methods.
  • the protecting group may be removed at a suitable point in the reaction sequence of the method to provide a desired intermediate or target compound.
  • suitable protecting groups and the methods for protecting and de- protecting different substituents using such suitable protecting groups are well known to those skilled in the art; examples of which may be found in T. Greene and P. Wuts, Protecting Groups in Chemical Synthesis (3rd ed.), John Wiley & Sons, NY (1999), which is incorporated herein by reference in its entirety.
  • a substituent may be specifically selected to be reactive under the reaction conditions used in the methods of this invention. Under these circumstances, the reaction conditions convert the selected substituent into another substituent that is either useful as an intermediate compound in the methods of this invention or is a desired substituent in a target compound.
  • various substituents may be a "protected -OH" group.
  • This term refers to a substituent represented as -OR p , where R p refers to a suitable protecting group for an -OH moiety.
  • Hydroxyl protecting groups are well known in the art and any hydroxyl protecting group that is useful in the methods of preparing the compounds of this invention may be used.
  • Exemplary hydroxyl protecting groups include benzyl, tetrahydropyranyl, silyl (trialkyl-silyl, diaryl-alkyl-silyl, etc.) and various carbonyl-containing protecting groups, as disclosed in T. Greene and P. Wuts, supra.
  • R 2 may be the protected hydroxyl moiety -OSi(tert-butyl)(CH 3 ) 2 .
  • the compounds of this invention may contain at least one chiral center and may exist as single stereoisomers (e.g., single enantiomers), mixtures of stereoisomers (e.g. any mixture or enantiomers or diastereomers) or racemic mixtures thereof. All such single stereoisomers, mixtures and racemates are intended to be encompassed within the broad scope of the present invention.
  • Compounds identified herein as single stereoisomers are meant to describe compounds that are present in a form that are at least 90% enantiomerically pure. Where the stereochemistry of the chiral carbons present in the chemical structures illustrated herein is not specified, the chemical structure is intended to encompass compounds containing either stereoisomer of each chiral center present in the compound.
  • Such compounds may be obtained synthetically, according to the procedures described herein using optically pure (enantiomerically pure) or substantially optically pure materials. Alternatively, these compounds may be obtained by resolution/separation of a mixture of stereoisomers, including racemic mixtures, using conventional procedures. Exemplary methods that may be useful for the resolution/separation of mixtures of stereoisomers include chromatography and crystallization/re-crystallization. Other useful methods may be found in "Enantiomers, Racemates, and Resolutions, " J. Jacques et al., 1981, John Wiley and Sons, New York, NY, the disclosure of which is incorporated herein by reference. The compounds of this invention may possess one or more unsaturated carbon- carbon double bonds. All double bond isomers, both the cis (Z) and trans (E) isomers, and mixtures thereof are intended to be encompassed within the scope of the present invention.
  • pharmaceutically acceptable salt is intended to describe a salt that retains the biological effectiveness of the free acid or base of a specified compound and is not biologically or otherwise undesirable.
  • a desired salt may be prepared by any suitable method known in the art, including treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or with an organic acid, such as acetic acid, trifluoroacetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acid, such as glucuronic acid or galacturonic acid, alpha-hydroxy acid, such as citric acid or tartaric acid, amino acid, such as aspartic acid or glutamic acid, aromatic acid, such as benzoic acid or cinnamic acid, sulfonic acid, such as p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid or the like.
  • an inorganic acid such
  • Examples of pharmaceutically acceptable salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates succinates, suberates, sebacates, fumarates, maleates, butyne-l,4-dioates, hexyne- 1,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, phenylacetates, phenylpropionates, phenylbutrates, citrates, lactates, ⁇ -hydroxybutyrates, glycollates, tartrates mandelates,
  • an inventive compound is an acid
  • a desired salt may be prepared by any suitable method known to the art, including treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary, or tertiary), an alkali metal or alkaline earth metal hydroxide, or the like.
  • an inorganic or organic base such as an amine (primary, secondary, or tertiary), an alkali metal or alkaline earth metal hydroxide, or the like.
  • suitable salts include organic salts derived from amino acids such as glycine and arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as ethylene diamine, dicyclohexylamine, ethanolamine, piperidine, morpholine, and piperazine, as well as inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium.
  • Particular pharmaceutically acceptable salts of a compound of Formulas I, II, III or IV include the sodium salt and the potassium salt.
  • pharmaceutically acceptable salts may be prepared by treating these compounds with an alkaline reagent or an acid reagent, respectively. Accordingly, this invention also provides for the conversion of one pharmaceutically acceptable salt of a compound of this invention, e.g., a hydrochloride salt, into another pharmaceutically acceptable salt of a compound of this invention, e.g., a sodium salt.
  • solvate is intended to mean a pharmaceutically acceptable solvate form of a specified compound that retains the biological effectiveness of such compound.
  • solvates include compounds of the invention in combination with water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine.
  • inventive compounds, salts, or solvates may exist in different crystal forms, all of which are intended to be within the scope of the present invention and specified formulas.
  • prodrugs of the compounds of this invention are also included within the scope of this invention.
  • prodrug is intended to mean a compound that is converted under physiological conditions, e.g., by solvolysis or metabolically, to a compound of Formulas I, II, III or IV, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • a prodrug may be a derivative of one of the compounds of this invention that contains, for example, a carboxylic acid ester or amide moiety or an enol-ester moiety that may be cleaved under physiological conditions.
  • a prodrug containing such a moiety may be prepared according to conventional procedures, for example, by treatment of a compound of Formula I, containing an amino, amido or hydroxyl moiety with a suitable derivatizing agent, for example, a carboxylic acid halide or acid anhydride, or by converting a compound of Formula I, containing a carboxyl moiety to an ester or amide or by converting a compound of Formula I, containing a carboxylic acid ester moiety to an enol-ester.
  • a suitable derivatizing agent for example, a carboxylic acid halide or acid anhydride
  • Prodrugs of the compounds of this invention may be determined using techniques known in the art, for example, through metabolic studies. See, e.g., "Design of Prodrugs," (H. Bundgaard, Ed.) 1985, Elsevier Publishers B.V., Amsterdam, The Netherlands.
  • the present invention is directed to a method of inhibiting an RNA-containing virus which comprises contacting the virus with an effective amount of a compound of Formulas I, II, III or IV.
  • This invention is also directed to a method of treating infection or disease caused by an RNA-containing virus comprising administering to a subject in need thereof, an effective amount of the compound of Formulas I, II, III or IV.
  • this invention is directed to a method of inhibiting HCV activity, comprising contacting the virus with an effective amount of a compound of Formulas I, II, III or IV, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • HCV activity may be inhibited in mammalian tissue by administering to a subject in need thereof a compound of Formula I or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • a therapeutically "effective amount” is intended to mean that amount of a compound that, when administered to a mammal in need of such treatment, is sufficient to effect treatment, as defined herein.
  • a therapeutically effective amount of a compound of Formula I or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof is a quantity of an inventive agent that, when administered to a mammal in need thereof, is sufficient to modulate or inhibit the activity of HCV such that a disease condition which is mediated by that activity is reduced, alleviated or prevented.
  • the amount of a given compound that will correspond to such an amount will vary depending upon factors such as the particular compound (e.g., the potency (IQ 0 ), efficacy (EQ 0 ), and the biological half-life of the particular compound), disease condition and its severity, the identity (e.g., age, size and weight) of the mammal in need of treatment, but can nevertheless be routinely determined by one skilled in the art.
  • the particular compound e.g., the potency (IQ 0 ), efficacy (EQ 0 ), and the biological half-life of the particular compound
  • disease condition and its severity e.g., the identity of the mammal in need of treatment, but can nevertheless be routinely determined by one skilled in the art.
  • duration of treatment and the time period of administration (time period between dosages and the timing of the dosages, e.g., before/with/after meals) of the compound will vary according to the identity of the mammal in need of treatment (e.g., weight), the particular compound and its properties (e.g., pharmaceutical characteristics), disease or condition and its severity and the specific composition and method being used, but can nevertheless be determined by one of skill in the art.
  • this invention is directed to a method for inhibiting replication of hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises contacting a cell infected with said virus with an effective amount of a compound of Formulas I, II, III or IV.
  • This invention is also directed to a method of treating infection or disease caused by hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises administering to a subject in need thereof, an effective amount of a compound of Formulas I, II, HI or IV.
  • this invention is directed to a method of inhibiting replication of both positive and negative strand HCV-RNA with a compound of Formulas I, II, III or IV, wherein the compounds demonstrate substantially equal inhibition of positive strand HCV-RNA replication and negative strand HCV-RNA replication. That is, for a given compound of this invention, the IQ 0 for inhibition of positive strand HCV-RNA replication is not statistically different (less than a 2-fold difference) from the IQ 0 for inhibition of negative strand HCV-RNA replication. Generally, the compounds of this invention demonstrate an IQ 0 for inhibition of positive strand HCV-RNA replication that is +30% the IQo for inhibition of negative strand HCV-RNA replication.
  • Treating is intended to mean at least the mitigation of a disease condition (acute, chronic, latent, etc.) in a subject (a mammal, such as a human), where the disease condition is caused by an infectious RNA-containing virus.
  • the methods of treatment for mitigation of a disease condition include the use of the compounds in this invention in any conventionally acceptable manner, for example for prevention, retardation, prophylaxis, therapy or cure of a disease.
  • the compounds of Formula I, Formula II and Formula Ul of this invention are particularly useful for the treatment of acute, chronic or latent HCV diseases, such as acute and chronic hepatitis infection, hepatocellular carcinoma, liver fibrosis, or other HCV-related diseases.
  • the compounds of Formula I, Formula II and Formula HI of this invention may also be useful for treatment of diseases caused by infectious RNA-containing viruses other than HCV, including, but not limited to, Dengue, HIV or picornaviruses.
  • Chronic fatigue syndrome is another disease that may be treatable using the compounds of this invention.
  • An inventive compound of Formulas I, II, III or IV, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof may be administered to a subject as a pharmaceutical composition in any pharmaceutical form that is recognizable to the skilled artisan as being suitable. Suitable pharmaceutical forms include solid, semisolid, liquid, or lyophilized formulations, such as tablets, powders, capsules, suppositories, suspensions, liposomes, and aerosols.
  • compositions of the invention may also include suitable excipients, diluents, vehicles, and carriers, as well as other pharmaceutically active agents, depending upon the intended use or mode of administration.
  • Administration of a compound of the Formulas I, II, III or IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof may be performed according to any of the generally accepted modes of administration available to those skilled in the art.
  • the compounds of this invention may be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, topical, transdermal, or transmucosal administration. For systemic administration, oral administration is preferred.
  • the compounds can be formulated into conventional oral dosage forms such as capsules, tablets and liquid preparations such as syrups, elixirs and concentrated drops.
  • injection e.g., parenteral administration
  • the compounds of the invention are formulated in liquid solutions, preferably, in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution.
  • the compounds of the invention may also be formulated in liposome-containing preparations, particularly liposome-containing preparations useful for delivery of the compounds of this invention to the liver or potentially to nonhepatic reservoirs of infection.
  • the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms can also be produced.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration for example, may be through nasal sprays, rectal suppositories, or vaginal suppositories.
  • the compounds of the invention can be formulated into ointments, salves, gels, or creams, as is generally known in the art.
  • compositions containing a compound of Formulas I, II, IE or IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which are active when given orally can be formulated as syrups, tablets, capsules and lozenges.
  • a syrup formulation will generally consist of a suspension or solution of the compound or salt in a liquid carrier for example, ethanol, peanut oil, olive oil, glycerine or water with a flavoring or coloring agent.
  • a liquid carrier for example, ethanol, peanut oil, olive oil, glycerine or water with a flavoring or coloring agent.
  • any pharmaceutical carrier routinely used for preparing solid formulations may be used.
  • any pharmaceutical carrier routinely used for preparing dispersions or suspensions may be considered, for example aqueous gums, celluloses, silicates or oils, and may be incorporated in a soft gelatin capsule shell.
  • Typical parenteral compositions consist of a solution or suspension of a compound or salt in a sterile aqueous or non-aqueous carrier optionally containing a parenterally acceptable oil, for example polyethylene glycol, polyvinylpyrrolidone, lecithin, arachis oil or sesame oil.
  • a parenterally acceptable oil for example polyethylene glycol, polyvinylpyrrolidone, lecithin, arachis oil or sesame oil.
  • compositions for inhalation are in the form of a solution, suspension or emulsion that may be administered as a dry powder or in the form of an aerosol using a conventional propellant such as dichlorodifluoromethane or trichlorofluoromethane.
  • a typical suppository formulation comprises a compound of Formulas I, II, III or
  • Typical dermal and transdermal formulations comprise a conventional aqueous or non-aqueous vehicle, for example a cream, ointment, lotion or paste or are in the form of a medicated plaster, patch or membrane.
  • the composition is formulated and administered in a unit dosage form.
  • a metered aerosol dose may be administered, for transdermal application, a topical formulation or patch may be administered and for transmucosal delivery, a buccal patch may be administered.
  • a dose of the pharmaceutical composition contains at least a therapeutically effective amount of the active compound (i.e., a compound of Formulas I, II, Ul or IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof).
  • the selected dose may be administered to a mammal, for example, a human patient, in need of treatment mediated by inhibition of HCV activity by any known or suitable method of administering the dose, including: topically, for example, as an ointment, or cream, orally, rectally, for example, as a suppository, parenterally by injection, or continuously by intravaginal, intranasal, intrabronchial, intraaural, or intraocular infusion.
  • Treatment of all forms of infection or disease (acute, chronic, latent etc) or as prophylaxis with these compounds (or their salts etc.) may be achieved using the compounds of this invention as a monotherapy, in dual or multiple combination therapy, such as in combination with other antivirals, in combination with an interferon, in combination with an interferon and ribavirin or levovirin, or in combination with one or more agents which include but are not limited to: immunomodulatory agents (such as cytokines, suppressors of cytokines and/or cytokine signalling, or immune modifiers, adjuvants and the like), immunomodulatory agents that enhance the body's immune system (such as vitamins, nutritional supplements, antioxidant compositions, vaccines or immunostimulating complexes, such as vaccines comprising a multimeric presentation of an antigen and adjuvant), other direct antiviral agents, indirect antiviral agents or agents which target viral RNA and impair translation or replication or modulate signalling or cellular host factors, or host- viral interface, immunoglobul
  • an interferon is intended to mean any form of interferon, which includes, but is not limited to, natural or recombinant forms of alpha, beta or gamma interferons, albumin-linked interferons, or pegylated interferons.
  • Representative compounds of this invention include the compounds of the Examples described herein, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • Representative of preferred compounds of this invention comprise the following: (Z)-2-acetylamino-3- ⁇ 3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-
  • This invention is also directed to methods for the synthesis of the compounds of Formula I and tautomers thereof.
  • 2-aminobenzoic acid (a) such as 2-amino-5- fluorobenzoic acid, 2-amino-5-tert-butyldimethylsilyloxybenzoic acid or 2-amino-5- methylbenzoic acid can be treated with phosgene or a phosgene equivalent such as triphosgene or ethyl chloroformate in an appropriate solvent such as tetrahydrofuran to afford the benzo[J][l,3]oxazines (b).
  • phosgene or a phosgene equivalent such as triphosgene or ethyl chloroformate
  • an indole-2,3-dione (c) such as 4- bromoindole-2,3-dione may be oxidised with a peracid such as peracetic acid to afford the benzo[J
  • the benzo[J][l,3]oxazines (b) such as 1H- benzo[J
  • an appropriate alkylating agent such as 3-methyl-l-bro
  • compounds (d) can be prepared by the alkylation of benzo[J
  • an appropriate alcohol such as 2-cyclopropylethanol, 3,3-dimethylbutanol, 2-furancarbinol or 4-pyridinylcarbinol
  • a phosphine such as triphenylphosphine
  • an azodicarboxylate such as diethyl azodicarboxylate or diisopropyl azodicarboxy
  • Compounds of Formula I may be prepared by the coupling of N-alkylated benzo[ ⁇ fj[l,3]oxazines (d) with an appropriate thiadiazine such as ethyl l,l-dioxo-2H-benzo-l,2,4-thiadiazinyl-3-acetate, methyl (7- bromo-l,l-dioxo-l,2-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate or ethyl (l,l-dioxo-7- hydroxy-l,2-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate in the presence of a base such as sodium hydride or DBU (l,8-diazabicyclo[5.4.0]undec-7-ene) in an appropriate solvent such as dimethylformamide, dimethylacetamide or tetrahydrofuran followed by acidification with an acid such as acetic acid or ace
  • a benzo[d][l,3]oxazine-2,4-dione (f) such as l-(3-methylbutyl)-lH- benzo[d][l,3]oxazine-2,4-dione can be treated with a cyanoacetate such as methyl cyanoacetate or ethyl cyanoacetate in the presence of an appropriate base such as sodium hydride in an appropriate solvent such as tetrahydrofuran or dimethylformamide then acidified with an acid such as acetic acid to afford the 3-cyanoquinolines (g).
  • a cyanoacetate such as methyl cyanoacetate or ethyl cyanoacetate
  • an appropriate base such as sodium hydride
  • an appropriate solvent such as tetrahydrofuran or dimethylformamide
  • cyano compounds (g) may be then condensed with an appropriate 2-aminobenzenesulfonamide such as 2-aminobenzenesulfonamide, 2-amino-5-chlorobenzenesulfonamide or 2-amino-4- bromobenzenesulfonamide in the presence of trimethylaluminum in an appropriate solvent such as dioxane, toluene or tetrahydrofuran to afford the compounds of Formula I.
  • 2-aminobenzenesulfonamide such as 2-aminobenzenesulfonamide, 2-amino-5-chlorobenzenesulfonamide or 2-amino-4- bromobenzenesulfonamide
  • compounds (g) may be treated with ammonium chloride and triethylaluminum in an appropriate solvent such as toluene or dioxane to give amidines (h) which may then be coupled with an appropriate 2-chlorobenzenesulfonyl chloride such as 5- nitro-2-chlorobenzenesulfonyl chloride in the presence of a base preferably sodium hydride to give compounds of Formula I.
  • an appropriate 2-chlorobenzenesulfonyl chloride such as 5- nitro-2-chlorobenzenesulfonyl chloride in the presence of a base preferably sodium hydride to give compounds of Formula I.
  • An aniline (j) such as 4-methoxyaniline or 2-methylaniline can be treated with chlorosulfonylisocyanate in an appropriate solvent such as nitroethane then treated with a acid such as aluminum trichloride to give the cyclized compound (k).
  • Compound (k) can be hydrolysed with an aqueous acid such as aqueous sulfuric acid to afford the 2- aminobenzenesulfonamides (1).
  • Amides (m) can be formed by treating amines (1) with ethyl chloromalonate in the presence of a base such as pyridine, triethylamine or pyridine in a solvent such as tetrahydrofuran or dichloromethane.
  • Cyclisation of amides (m) to afford thiadiazines (n) may occur on treatment with a dehydrating agent, such as phosphorus oxychloride, either neat or in a solvent, such as toluene, or with a base, such as sodium carbonate, cesium carbonate or sodium bicarbonate, in a solvent, such as water or aqueous ethanol.
  • a dehydrating agent such as phosphorus oxychloride
  • a base such as sodium carbonate, cesium carbonate or sodium bicarbonate
  • a solvent such as water or aqueous ethanol
  • 7-Methoxythiadiazines (p) can be treated with a demethylation reagent, such as boron tribromide or hydrobromic acid, in an appropriate solvent, such as dichloromethane or acetic acid, and any ester hydrolysis product may then be re-esterified by treatment with an alcohol, such as ethanol in the presence of an acid, such as sulfuric acid, to give the 7- hydroxy compounds (q).
  • a demethylation reagent such as boron tribromide or hydrobromic acid
  • an appropriate solvent such as dichloromethane or acetic acid
  • any ester hydrolysis product may then be re-esterified by treatment with an alcohol, such as ethanol in the presence of an acid, such as sulfuric acid, to give the 7- hydroxy compounds (q).
  • Compounds (q) may be coupled with benzo[J][l,3]oxazines as described in Scheme 1 to gives hydroxy compounds of Formula I.
  • the free hydroxyl group may then be optionally treated with an alkylating agent, such as bromoacetamide or bromoacetonitrile, in the presence of a base such as sodium hydride or potassium carbonate to give alkylated compounds of Formula I.
  • an alkylating agent such as bromoacetamide or bromoacetonitrile
  • [l,3]oxazine-2,4-dione (d), shown in Scheme 5, comprises treating the 2-aminobenzoic acid (a) under reductive amination conditions by treating the 2- aminobenzoic acid with an appropriate aldehyde (W-C ⁇ O) in the presence of an appropriate reducing agent, such as sodium borohydride, sodium cyanoborohydride or diborane, in a suitable solvent such as tetrahydrofuran or dichloromethane, to form the N-akylated 2- aminobenzoic acid (r).
  • an appropriate reducing agent such as sodium borohydride, sodium cyanoborohydride or diborane
  • N-akylated 2-aminobenzoic acid (r) Treatment of the N-akylated 2-aminobenzoic acid (r) with phosgene or a phosgene equivalent such as triphosgene or ethyl chloroformate in an appropriate solvent such as tetrahydrofuran, as described above, provides the N-alkylated 1H- benzo[J
  • Scheme 6 illustrates an alternate method for the preparation of the intermediate N-akylated 2-aminobenzoic acid (r) by coupling of a 2-halobenzoic acid (s), such as a 2-bromobenzoic acid or a 2-chlorobenzoic acid, with an N-substituted amine (W-NH 2 ) in the presence of an appropriate copper catalyst, for example copper (II) bromide, in the presence of a suitable base, such as potassiuim carbonate or triethylamine, in an appropriate solvent such as tetrahydrofuran or dimethylformamide.
  • [l,3]oxazine-2,4-dione (d). may be accomplished as described above.
  • a salt of a compound of Formula I may be prepared by treating the compound with an appropriate base, such as sodium hydroxide or potassium hydroxide, in an appropriate solvent, such as water or water and methanol.
  • an appropriate base such as sodium hydroxide or potassium hydroxide
  • an appropriate solvent such as water or water and methanol.
  • intermediate compounds that are useful for the preparation of the compounds of Formulas I, II, Ul and/or IV.
  • Such useful intermediate compounds include: 3- [(7-(2-bromoethanoyl)- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl] -6- fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one, 3-[(7-(2-bromoethanoyl)-l,l- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl] - 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy- lH-quinolin-2-one, N-(sulfamoyl-4-trifluoromethylphenyl)-2-malonamic acid ethyl ester, (l,l-
  • the activity of the inventive compounds as inhibitors of ⁇ CV activity may be measured by any of the suitable methods known to those skilled in the art, including in vivo and in vitro assays.
  • the ⁇ CV NS5B inhibitory activity of the compounds of Formulas I, ⁇ , HI and IV was determined using standard assay procedures described in Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001).
  • the compounds of this invention have demonstrated in vitro HCV NS5B inhibitory activity in such standard assays and have IQ 0 's in the range of 0.0001 ⁇ M to 100 ⁇ M.
  • Representative compounds of Formula I, Examples 10-20, 60-75, 110-120, 130-139, and 141-160 have all demonstrated in vitro HCV NS5B inhibitory activity and have IQ 0 's in the range of
  • Inhibition of recombinant purified HCV polymerase with compounds in in vitro biochemical assays may be validated using the replicon system whereby the polymerase exists within a replicase complex, associated with other viral and cellular polypeptides in appropriate stoichiometry. Demonstration of cell-based inhibition of HCV replication may be more predictive of in vivo function than demonstration of HCV NS5B inhibitory activity in in vitro biochemical assays.
  • the compounds of this invention inhibit both positive and negative strand HCV-RNA replication.
  • the following methods have been developed and used for determining the positive and negative strand HCV-RNA replication inhibition activity of the compounds of this invention.
  • Test Method 1 Method for positive strand replicon HCV-RNA detection in replicon cells Replicon cells were plated at 3 X 10 3 cells per well in a 96-well plate plates at 37° and
  • DMEM Dulbecco's Minimal Essential Medium
  • FCS fetal calf serum
  • NEAA nonessential amino acids
  • G418 neomycin 1 mg/ml Geneticin
  • Buffer RLT (Qiagen, Valencia, California, US) was added to each well and RNA purified according to manufacturer's recommendations (Qiagen RNAeasy) and were eluted twice in 45 ⁇ l dH 2 0 prior to RT-PCR.
  • Primers and probes specific for the positive strand RNA detection of neomycin gene were: neo-forward: 5'CCGGCTACCTGCCCATTC3' (SEQ ID NO 1); neo-reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 2); neo-probe: 5'FAM- ACATCGCATCGAGCGAGCACGTAC-TAMRA3' (SEQ ID NO 3).
  • the cDNA primer used was 5 ACA TGC GCG GCA TCT AGA CCG GCT ACC TGC CCA TTC3' (SEQ ID NO 4) whereby the first 18 bases represent SEQ ID NO 5 linked to neo sequences; neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 6); neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ ID NO 3). Additionally, the PDAR control reagent human cyclophilin was used for normalization.
  • a primer containing HCV RNA (or replicon RNA sequences such as neomycin gene) and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction, 5 ⁇ CATGCGCGGCATCTAGACCGGCTACCTGCCCATTC3' (SEQ ID NO 4).
  • Thermoscript-RT-PCR system (Invitrogen) was used for the RT reaction according to the manufacturer's protocol, with approximately 9 ⁇ l of the cell-harvested RNA and 1 ⁇ l of primer (10 ⁇ M) incubated with RT at 60°C for 1 h. Following that incubation, 2 ⁇ l of cDNA product containing the 5' tag was amplified for TaqMan quantification using the 48 ⁇ l of TaqMan Universal Master Mix (Applied Biosystems) as well as primers, neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse:
  • Example 8 N-(4- ⁇ 3-[6-Fluoro-4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yl ⁇ thiazol-2-yl)acetamide a) 6-Fluoro-4-hydroxy-3-(7-iodo- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3- yl)- l-(3-methylbutyl)-lH-quinolin-2-one: Sodium hydride (1.01 g.
  • Example 12 l-(2-Cyclopropylethyl)-3-[ 1 , l-dioxo-7-(5-oxo-4,5-dihydro-isoxazol-3-yl)- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one a) 3- ⁇ 3-[ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl ⁇ -3-ethoxyacrylic acid ethyl ester : Following the procedure of example 2c), the product obtained in example 9a), l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo
  • Example 13 2- ⁇ 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1- dioxo- 1 ,4-dihydrobenzo[ l,2,4]thiadiazin-8-yloxy ⁇ acetamide a) l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(8-hydroxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: A mixture of 3-(5-chloro-8- hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)- l-(2-cyclopropylethyl)-6- fluoro-4-hydroxy-lH-quinol
  • the system was degassed and then purged two times with carbon monoxide.
  • the reaction mixture was stirred at 88°C for 6h, and then at 75°C for 40 h. Thin layer chromatographic analysis showed residual starting material. Additional 1,3- bis(diphenylphosphino)propane (48.5 mg) and palladium(II) acetate (27 mg) were then added.
  • the system was evacuated and refilled with carbon monoxide. After addition of triethylamine (0.5 mL), the reaction mixture was stirred at 90°C for 6h, cooled to room temperature and partitioned between chloroform and IM aqueous hydrochloric acid.
  • Example 15 2- ⁇ [l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-7-yloxy ⁇ -H-dimethylcarbamoylmethylacetamide a) 7-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-one: A solution of 4- anisidine (20 g, 162 mmol) in nitroethane (100 mL) was added dropwise to a solution of chlorosulfonyl isocyanate (17 mL, 195 mmol) in nitroethane (150 mL) strirred at -40°C.
  • N-(4-Methoxy-2-sulfamoylphenyl)malonamic acid ethyl ester A mixture of 2- amino-5-methoxybenzenesulfonamide (9.1 g, 45 mmol) and diethyl malonate (14 mL, 92 mmol) were heated together at 160 °C for 1 h. The mixture was cooled and diluted with diethyl ether to give the title compound as a solid (8.5 g, 60%).
  • Example 16 2- [3-( 1 , 1 -Dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4] thiadiazin-3-yl)-6-fluoro-4-hydroxy-2-oxo-2H- quinolin- 1 -yl] -N,N-dimethylacetamide a) 3-( 1 , 1 -Dioxo-1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy- 1H- quinolin-2-one: l-[3-(Dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride (0.200 g, 1.04 mmol) was added to a solution of 5-fluoro-2-aminobenzoic acid (0.155 g, 1.00 mmol), (l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-
  • Example 17 1 -(3,3-Dimethyl-2-oxobutyl)-3-( 1 , 1-dioxo-l ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-6- fluoro-4-hydroxy-lH-quinolin-2-one
  • Example 18 2- ⁇ 3- [ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yloxy ⁇ acetamidine a) 2- ⁇ 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]fhiadiazin-7-yloxy ⁇ acetonitrile : Powdered potassium carbonate (0.278 g, 2.01 mmol) was added to a stirred solution of l-(2-cyclopropylethyl)-6- fluoro-4-hydroxy-3-(7-
  • Example 20 4- ⁇ 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl ⁇ -2,4-dioxobutyric acid, methyl ester
  • Example 9b The product of Example 9b) (325 mg, 0.693 mmol) and dimethyl oxalate (122 mg, 1.04 mmol) in N,N-dimethylformamide (5.0 mL) was treated with sodium hydride (55 mg, 1.38 mmol, 60%). The reaction mixture was stirred at room temperature for lh and at 50 °C for 4h. After cooling to room temperature, 3M aqueous hydrochloric acid (10 mL) was added and the resulting solution was extracted with chloroform (3 x 30 mL). The organic layers were combined, dried over magnesium sulfate, and the solvent removed en vacuo.
  • the compond of this invention 5-amino-3-(l,l-dioxo-l,4-dihydro- benzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3-methyl-butyl)-lH-quinolin-2-one, may be prepared by reduction of 3-(l, 1-dioxo- l,4-dihydro-l-benzo[l, 2, 4]fhiadizain-3-yl)-4- hydroxy-l-(3-methylbutyl)-5-nitro-lH-quinolin-2-one, which may be prepared by the following procederie.
  • HCV NS5B inhibitory activity of the compounds of Formulas I, II, III and IV was determined using standard procedures well known to those skilled in the art and described in, for example Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001).

Abstract

Compounds useful as HCV anti-infectives having the formula (I) wherein the formula variables are as defined herein, are disclosed. Also disclosed are methods of making and using the same.

Description

ANTI-INFECTΓVES
FIELD OF THE INVENTION
The present invention relates to compounds that inhibit an RNA-containing virus and methods of making and using the same. Specifically, the present invention relates to inhibitors of hepatitis C virus (HCV).
BACKGROUND OF THE INVENTION In the U.S., an estimated 4.5 million Americans are chronically infected with HCV. Although only 30% of acute infections are symptomatic, greater than 85% of infected individuals develop chronic, persistent infection. Treatment costs for HCV infection have been estimated at $5.46 billion for the U.S. in 1997. Worldwide, over 200 million people are estimated to be infected chronically. HCV infection is responsible for 40-60% of all chronic liver disease and 30% of all liver transplants. The CDC estimates that the number of deaths due to HCV will minimally increase to 38,000/yr. by the year 2010.
Due to the high degree of variability in the viral surface antigens, existence of multiple viral genotypes, and demonstrated specificity of immunity, the development of a successful vaccine in the near future is unlikely. Alpha-interferon (alone or in combination with ribavirin) has been widely used since its approval for treatment of chronic HCV infection. However, adverse side effects are commonly associated with this treatment: flulike symptoms, leukopenia, thrombocytopenia, and depression from interferon, as well as hemolytic anemia induced by ribavirin (Lindsay, K.L. (1997) Hepatology 26 (Suppl. 1):71S-77S). This therapy remains less effective against infections caused by HCV genotype 1 (which constitutes -75% of all HCV infections in the developed markets) compared to infections caused by the other 5 major HCV genotypes. Unfortunately, only -50-80% of the patients respond to this treatment (measured by a reduction in serum HCV RNA levels and normalization of liver enzymes) and, of those treated, 50-70% relapse within 6 months of cessation of treatment. Recently with the introduction of pegylated interferon (Peg-IFN), both initial and sustained response rates have improved substantially, and combination treatment of Peg-IFN with ribavirin constitutes the gold standard for therapy. However, the side effects associated with combination therapy and the impaired response in patients with genotype 1 present opportunities for improvement in the management of this disease.
First identified by molecular cloning in 1989 (Choo, Q-L. et ah, (1989) Science 244:359-362), HCV is now widely accepted as the most common causative agent of post- transfusion non A, non-B hepatitis (NANBH) (Kuo,G. et al, (1989) Science 244:362-364). Due to its genome structure and sequence homology, this virus was assigned as a new genus in the Flaviviridae family. Like the other members of the Flaviviridae (such as flaviviruses (e.g., yellow fever virus and Dengue virus types 1-4) and pestiviruses (e.g., bovine viral diarrhea virus, border disease virus, and classic swine fever virus (Choo et al, 1989; Miller, R.H. and R.H. Purcell (1990) Proc. Natl. Acad. Sci. USA 87:2057-2061)), HCV is an enveloped virus containing a single strand RNA molecule of positive polarity. The HCV genome is approximately 9.6 kilobases (kb) with a long, highly conserved, noncapped 5' nontranslated region (NTR) of approximately 340 bases which functions as an internal ribosome entry site (IRES) (Wang, C.Y., Le, S.Y., Ali, N., Siddiqui, A., Rna-A Publication of the Rna Society. 1(5): 526-537, 1995 Jul). This element is followed by a region which encodes a single long open reading frame (ORF) encoding a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins.
Upon entry into the cytoplasm of the cell, the HCV-RNA is directly translated into a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins. This large polypeptide is subsequently processed into the individual structural and nonstructural proteins by a combination of host and virally-encoded proteinases (Rice, CM. (1996) in B.N. Fields, D.M.Knipe and P.M. Howley (Eds.) Virology, 2nd Edition, p931- 960, Raven Press, NY). Following the termination codon at the end of the long ORF, there is a 3 'NTR which roughly consists of three regions: an - 40 base region which is poorly conserved among various genotypes, a variable length poly(U)/polypyrimidine tract, and a highly conserved 98 base element also called the "3'X-tail" (Kolykhalov, A. et al, (1996) J. Virology 70:3363-3371; Tanaka, T. et al, (1995) Biochem Biophys. Res. Commun. 215:744-749; Tanaka, T. et al, (1996) J. Virology 70:3307-3312; Yamada, N. et al, (1996) Virology 223:255-261). The 3' NTR is predicted to form a stable secondary structure that is essential for HCV growth in chimps and is believed to function in the initiation and regulation of viral RNA replication.
The NS5B protein (591 amino acids, 65 kDa) of HCV (Behrens, S.E., et al, (1996) EMBO J. 15:12-22), encodes an RNA-dependent RNA polymerase (RdRp) activity and contains canonical motifs present in other RNA viral polymerases. The NS5B protein is fairly well conserved both intra-typically (-95-98% amino acid (aa) identity across lb isolates) and inter-typically (-85% aa identity between genotype la and lb isolates). The essentiality of the HCV NS5B RdRp activity for the generation of infectious progeny virions has been formally proven in chimpanzees (Kolykhalov, A.A., et al, (2000) J. Virology 74:2046-2051). Thus, inhibition of NS5B RdRp activity (inhibition of RNA replication) is predicted to cure HCV infection. Positive strand hepatitis C viral RNA is the nucleic acid strand that is translated and initially copied upon entry of the HCV-RNA into the cell. Once in the cell, positive strand viral RNA generates a negative strand replicative intermediate. Negative strand RNA is the template used to generate the positive strand message that is generally packaged into productive virions. Presently, HCV inhibitor compounds are only evaluated for their ability to inhibit positive strand HCV-RNA. However, it would be desirable to develop inhibitor compounds having the ability to inhibit both positive and negative strand replication to obtain complete clearance of the HCV virus.
Accordingly, there exists a significant need to identify synthetic or biological compounds for their ability to inhibit HCV. Preferably, such synthetic or biological compounds inhibit both positive and negative strand replication of the hepatitis C virus.
SUMMARY OF THE INVENTION This invention is directed to compounds having Formula I, as follows:
Figure imgf000004_0001
wherein:
R1 is hydrogen, halogen, C C4 alkyl, -OR11, -SR11, -NR10Rπ, aryl, -C(0)OH, -C(0)NHRπ, cyano, nitro, amino, -0(C C4 alkyl)C(0)NH2)
-0( -C4 alkyl)C(0)NH(C1-C4 alkyl), -0(C C4 alkyl)C(0)N(C C4 alkyl)(C C4 alkyl), -0(C C4 alkyl)C02H, or -0(C C4 alkyl)C02(C C4 alkyl);
R2 is hydrogen, CrC8 alkyl, C2-C3 alkenyl, C2-C8 alkynyl, C3-C6 cycloalkyl, heterocycloalkyl, aryl, heteroaryl, nitro, cyano, halogen, -C(0)OR9, -C(0)R9, -C(0)NR9R10, -OR9, -SR9, -S(0)R12, -S(0)2R12, -NR9R10, protected -OH, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10, -P(0)(0R9)2, -S02N 9R10, -S03H, -N(R10)SO2R12, -N=CH-NH2, -N=CH-NH(C C4 alkyl), or -N=CH-N(C C4 alkyl)2, where said -Cg alkyl, C2-C8 alkenyl or Cr-Cg alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -SH, -OC,-C4 alkyl, -SC C4 alkyl, -NR10Rπ, cyano, nitro, -C02R10, -C(0)OC C4 alkyl, -CONR10Rn, -CONH2, aryl, and heteroaryl, and where said cycloalkyl, heterocycloalkyl, aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from -Cs alkyl, CrC6 haloalkyl, halogen, -OH, -SH, -NH2, -OC C4 alkyl, -SC,-C4 alkyl, -N(C C4 alkyl)(C C4 alkyl), -NH(C C4 alkyl), cyano, nitro, -C02H, -C(0)OC C4 alkyl, -CON(C C4 alkyl)(CrC4 alkyl), -C0NH(CrC4 alkyl) and -CONH2; R3 is hydrogen, halogen, cyano, Cι-C6 alkyl, -OH, or -C02H; R4 and R6 are each independently selected from the group consisting of hydrogen, halogen, cyano, Cι-C6 alkyl, -OH, -OC1-C4 alkyl, Cι-C4 haloalkyl, nitro and amino;
R5 is selected from the group consisting of hydrogen, halogen, cyano, Ci-Cβ alkyl, -OH, and -OC C4 alkyl;
R7 is hydrogen, C C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, C3-Ce cycloalkyl, heterocycloalkyl, aryl, heteroaryl, nitro, cyano, halogen, -C(0)OR9, -C(0)R9, -C(0)NR9R10, -OR9, -SR9, -S(0)R12, -S(0)2R12, -NR9R10, protected -OH, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10, -P(0)(OR9)2, -S02NR9R10, -S03H, -N(R10)SO2R12, -C(Od-C4 alkyl)=C(H)(C02C1-C4 alkyl), -C(H)=C(C02CrC4 alkyl)(NHCO(C C4 alkyl)), -0-d-C4 alkyl-C(0)NH-C1-C3 alkyl-C(0)NH2, -O-C1-C4 a kyl-C(0)NH-C C3 alkyl-C(0)NHC C4 alkyl, -0-C C4 alkyl-C(0)NH-CrC3 alkyl-C(0)N(C,-C4 alkyl)2, -0-d-C4 alkyl-C(0)N(C C4 alkyPj-d-d alkyl-C(0)NH2, -O-Q-C4 alkyl-C(0)N(C1-C4 alkyl)-C,-C3 alkyl-C(0)NHCrC4 alkyl, -O-d-Q alkyl-C(0)N(C C4 alkyl)-C C3 alkyl-C(0)N(CrC4 alkyl)2, -0-C C4 alkyl-C(=NH)NH2, -0-C C4 alkyl-C(=NH)NH(d-C4 alkyl), -O-C Q. alkyl-C(=NH)N(CrC4 alkyl)2, -0-d-C4 alkyl-C(=N(d-C4 alkyl))NH(C,-C4 alkyl), -0-C C4 alkyl-C(=N(CrC4 alkyl))N(C C4 alkyl)2, -C(=NH)NH2, -C(=NH)NH(C C4 alkyl), -C(=NH)N(d-C4 alkyl)2, -C(=N(C C4 alkyl))NH(CrC4 alkyl), -C(=N(d-C4 alkyl))N(C C4 alkyl)2, or -C(0)-C C4 alkyl-C(0)C02(C C4 alkyl), where said Cι-C8 alkyl, C2-C8 alkenyl or C2-C3 alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -SH, -OC,-C4 alkyl, -SC C4 alkyl, -NR10RU, cyano, nitro, -C02H, -C(0)OC C4 alkyl, -CONR10Rn, -CONH2, -0-C(0)NH2, -0-C(0)NHC C4 alkyl, -0-C(0)N(C C4 alkyl)2, aryl, heteroaryl, heterocycloalkyl, -C(0)aryl, -C(0)heterocycloalkyl, and -C(0)heteroaryl, where said aryl, heteroaryl, heterocycloalkyl, aryl, -C(0)aryl, -C(0)heterocycloalkyl, or -C(0)heteroaryl is unsubstituted or substituted with one or more substituents independently selected from C1-C4 alkyl, CrC4 haloalkyl, halogen, -OH, -SH, -NH2, -OCrC4 alkyl, -Sd-C4 alkyl, -N(C,-C4 alkyl)(CrC4 alkyl), -NH(C C4 alkyl), cyano and nitro, and where said cycloalkyl, heterocycloalkyl, aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from d- alkyl, d-C6 haloalkyl, halogen, -OH, -SH, -NH2, -OC C4 alkyl, -SCrC4 alkyl, -N(C C4 alkyl)(C C alkyl), -NH(CrC alkyl), cyano, nitro, oxo(as a substituent for cycloalkyl, heterocycloalkyl, or heteroaryl), -C02H, -C(0)OC C4 alkyl,
-CON(C C4 alkyl)(C C4 alkyl), -CONH(C C4 alkyl), -CONH2, -NHC(0)CrC4 alkyl, and -N(Cι-C4 alkyl)C(0)Ci-C4 alkyl; or R7 is -0-C3-C3 cycloalkyl, -O-heterocycloalkyl, -O-heteroaryl, -O-Ci-Q alkyl-C3-C8 cycloalkyl, -0-Cι-C6 alkyl-heterocycloalkyl, -O-C Cδ alkyl-heteroaryl, where any of said cycloalkyl, heterocycloalkyl, or heteroaryl (including the cycloalkyl, heterocycloalkyl, or heteroaryl moieties of said -Ci-Cβ alkyl-C3-C8 cycloalkyl, -C C6 alkyl-heterocycloalkyl, or -d-C6 alkyl-heteroaryl) is substituted by oxo and is optionally substituted with one or more substituents independently selected from C,-C alkyl, CrC4 haloalkyl, halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rn, -CONR10Rn, -NR10CONR10Rπ, -OCONR10RU, -SO2NR10Rπ, and -COR11;
R8 is hydrogen, halogen, hydroxyl, C C4 alkyl, -C(0)OR9, -C(0)R9, -C(0)NR9R10, -OR14, -NR9R10, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10 or -N(R10)SO2R12; or R1 and R2 or R5 and R6 or R6 and R7 or R7 and R8 taken together are alkylenedioxy; W is hydrogen, -C(0)ORπ, C C10 alkyl, C2-C10 alkenyl, C2-Cι0 alkynyl,
C3-C6 cycloalkyl, -(CrC6 alkyl)-(C3-C6 cycloalkyl), -(C2-C6 alkenyl)-(C3-C6 cycloalkyl), -(C2-C6 alkynyl)-(C3-C6 cycloalkyl), -(C C6 alkyl)-heterocycloalkyl, -(C2-C6 alkenyl)-heterocycloalkyl, -(C2-C6 alkynyl)-heterocycloalkyl, -(Cj-Cβ alkyl)-aryl, (C2-Cό alkenyl)-aryl, -(C2-C6 alkynyl)-aryl, -(Cι-C6 alkyl)-heteroaryl, -(C2-C6 alkenyl)-heteroaryl, or -(d-Cβ alkynyl)-heteroaryl, where said Ci-Cio alkyl, C2-Cι0 alkenyl, C2-Cι0 alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, cyano, -OH, -OC C4 alkyl, -SH, -SC C4 alkyl, -S(0)(d-C4 alkyl), -S03H, -S(0)2(CrC4 alkyl), -C(0)C C4 alkyl, or -C(0)N(CrC4 alkyl)2, said C -C6 cycloalkyl is unsubstituted or substituted with one or more substituents independently selected from halogen, cyano, C C4 alkyl, -OH, -OCι-C alkyl, -SH, -SC1-C4 alkyl, -S(0)(CrC4 alkyl), -S03H, and -S(0)2(d-C4 alkyl), and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of said -(d-C6 alkyl)-(C C6 cycloalkyl), -(C2-C6 alkenyl)-(C3-C6 cycloalkyl), -(C2-C6 alkynyl)-(C3-C6 cycloalkyl), -(Cι-C6 alkyl)-heterocycloalkyl, -(C2-C6 alkenyl)-heterocycloalkyl, -(C2-C6 alkynyl)-heterocycloalkyl, -(CrQ alkyl)-aryl, (C2-C6 alkenyl)-aryl, -(C2-Q alkynyl)-aryl, -(Ci-Q alkyl)-heteroaryl, -(C2-C6 alkenyl)-heteroaryl, or -(C2-Q alkynyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from d-Q; alkyl, C Q haloalkyl, halogen, cyano, nitro, -OH, -NH , -OC C4 alkyl, -N(C C4 alkyl)(C C4 alkyl), and -NH(d-C4 alkyl);
X is O or S;
Y is -OH or -SH;
Z is hydrogen or C C alkyl; wherein each R9 is independently selected from the group consisting of hydrogen, d-C3 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, C3-C8 cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-C3-C8 cycloalkyl, -d-Q alkyl-heterocycloalkyl, -d-Q alkyl-aryl, and -Cι-C6 alkyl-heteroaryl, -C2-Q alkenyl-C3-C8 cycloalkyl, -C2-C6 alkenyl-heterocycloalkyl, -C2-Q alkenyl-aryl, -C2-C6 alkenyl-heteroaryl, -C2-C6 alkynyl-C3-C8 cycloalkyl, -C2-C6 alkynyl-heterocycloalkyl, -C2-C6 alkynyl-aryl, and -C2-Q alkynyl-heteroaryl, where said d-Cg alkyl, C2-C8 alkenyl, or C2-Cg alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rn, -OCONR10Rπ, -SO2NR10Ru, and -COR11, and where any of said cycloalkyl, heterocycloalkyl, aryl or heteroaryl (including the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moieties of said -d-Q alkyl-C3-C8 cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -d-C6 alkyl-aryl, or -Cι-C6 alkyl-heteroaryl) is unsubstituted or substituted with one or more substituents independently selected from C C alkyl, C1-C4 haloalkyl, halogen, -OR11, -NR10Rπ, cyano, nitro, -CO2R11, -CONR10Rπ, -NR10CONR10Rn, -OCONR10Rπ, -Sθ2NR10Rn, and -COR11; each R10 is independently selected from hydrogen and C Q alkyl; each R11 is independently selected from the group consisting of hydrogen, d-Q alkyl, C3-C6 cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C1-C4 alkyl-C3-C3 cycloalkyl, -CrC4 alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, or -Cι-C4 alkyl-heteroaryl where said cycloalkyl, heterocycloalkyl, aryl , heteroaryl, -alkylcycloalkyl, -alkylheterocycloalkyl, -alkylaryl or -alkylheteroaryl is unsubstituted or substituted with one or more substituents independently selected from CrQ alkyl, d-Q; haloalkyl, halogen -Od-Q alkyl, -OC C6 haloalkyl, cyano, -N(C C6 alkyl)(C Q alkyl), -NH(CrC6 alkyl), -NH2, -CO2C1-Q alkyl, -C02H, -CON(C,-C6 alkyl)(d-C6 alkyl), -CONH(C Q alkyl), and -CONH2; or, when present in any NR9R10 or NR10Rπ, each R9 and R10 or each R10 and R11, independently, taken together with the nitrogen to which they are attached represent a 3-6-membered saturated ring optionally containing one other heteroatom selected from oxygen and nitrogen, where said 3-6-membered ring is unsubstituted or substituted with one or more substituents independently selected from hydrogen, Q-Q alkyl, halogen, cyano, -OQ-Q alkyl, -OH, -N(C Q alkyl)(C Q alkyl), -NH(CrQ alkyl), -NH2, -C02H, -C(0)OC Q alkyl, -C(0)d-Q alkyl, -CON(CrQ alkyl)(CrC6 alkyl), -CONH(Cι-Q alkyl), -CONH2, C3-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, Q-Q cycloalkyl-Q-Q alkyl-, heterocycloalkyl-Ci-Q alkyl-, aryl-Q-Q alkyl- and heteroaryl-C1-C6 alkyl-, and where said cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylalkyl-, heterocycloalkylalkyl-, arylalkyl- or heteroarylalkyl- is unsubstituted or substituted with one or more substituents independently selected from d-Q alkyl, d-Q haloalkyl, halogen -OC Q alkyl, -OQ-Q haloalkyl, cyano,
-N(Q-Q alkyl)(d-Q alkyl), -NH(C Q alkyl), -NH2, -C02CrC6 alkyl, -C02H, -CON(C,-C6 alkylXd-Q alkyl), -CONH(CrC6 alkyl), and -CONH2; each R12 is independently selected from the group consisting of Ci-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, and
-Q-Q alkyl-heteroaryl, -Q-Q alkenyl-Q-Q cycloalkyl, -Q-Q alkenyl-heterocycloalkyl, -Q-Q alkenyl-aryl, -Q-Q alkenyl-heteroaryl, -Q-Q alkynyl-Q-Q cycloalkyl, -Q-Q alkynyl-heterocycloalkyl, -Q-Q alkynyl-aryl, and -Q-Q alkynyl-heteroaryl, where said Cι-C8 alkyl, Q-Q alkenyl, or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OR13, -NR10R13, cyano, nitro, -C02R13, -CONR10R13, -NR10CONR10R13, -OCONR10R13, -SO2NR10R13, and -COR13, and where any of said cycloalkyl, heterocycloalkyl, aryl or heteroaryl (including the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moieties of said -Q-Q alkyl-Q~Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, or -Q-Q alkyl-heteroaryl) is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, d-Q haloalkyl, halogen, -OR13, -NR10R13, cyano, nitro, -C02R13, -CONR10R13, -NR10CONR10R13, -OCONR10R13, -SO2NR10R13, and -COR13; each R13 is independently selected from the group consisting of hydrogen, d-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Ci-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, and -Q-Q alkyl-heteroaryl; and and R14 is selected from the group consisting of substituted Q-Q alkyl and substituted or unsubstituted Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl,
-Q-Q alkyl-heterocycloalkyl, -Ci-Q alkyl-aryl, -d-Q alkyl-heteroaryl, -Q-Q alkenyl-Q-Q cycloalkyl, -Q-Q alkenyl-heterocycloalkyl, -Q-Q alkenyl-aryl, -Q-Q alkenyl-heteroaryl, -Q-Q alkynyl-Q-Q cycloalkyl, -Q-Q alkynyl-heterocycloalkyl, -Q-Q alkynyl-aryl or -Q-Q alkynyl-heteroaryl, where said substituted Q-Q alkyl, Q-Q alkenyl, or Q-Q alkynyl is substituted with one or more substituents independently selected from halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rn, -CONR10Rπ, -NR10CONR10Rπ, -OCONR10Rπ, -SO2NR10Rn, and -COR11, and where any of said cycloalkyl, heterocycloalkyl, aryl or heteroaryl (including the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moieties of said -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -d-Q alkyl-aryl, or -Q-Q alkyl-heteroaryl) is unsubstituted or substituted with one or more substituents independently selected from d-Q alkyl, d-Q haloalkyl, halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rπ, -CONR10Rn, -NR10CONR10Rπ, -OCONR10Rπ, -SO2NR10Rπ, and -COR11; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows: wherein:
R1 is amino, -0(C,-Q alkyl)C(0)NH2, -0(CrQ alkyl)C(0)NH(d-Q alkyl), -0(Q-C4 alkyl)C(0)N(d-C4 alkyl)(Q-C4 alkyl), -0(d-Q alkyl)C02H, or -0(Q-Q alkyl) C02(d-Q alkyl);
R2 is -N=CH-NH2, -N=CH-NH(C,-Q alkyl), or -N=CH-N(Q-Q alkyl)2; R4 is Q-Q haloalkyl, nitro or amino;
R6 is Q-Q haloalkyl, nitro or amino;
R7 is -C(Od-Q
Figure imgf000009_0001
alkyl), -C(H)=C(C02C C4 alkyl)(NHCO(d-C4 alkyl)), -O-C1-C4 alkyl-C(0)NH-Cι-C3 alkyl-C(0)NH2, -O-C1-C4 alkyl-C(0)NH-Ci-C3 alkyl-C(0)NHQ-C4 alkyl, -0-C C4 alkyl-C(0)NH-C Q alkyl-C(0)N(d-Q alkyl)2, -0-CrC4 alkyl-C(0)N(C,-C4 alkyl)-d-Q alkyl-C(0)NH2) -0-C C4 alkyl-C(0)N(Q-C4 alkyl)-CrC3 alkyl-C(0)NHC C4 alkyl, -O-C1-C4 alkyl-C(0)N(CrC4 alkyl)-d-Q alkyl-C(0)N(CrQ alkyl)2, -0-Q-C4 alkyl-C(=NH)NH2, -0-C Q alkyl-C(=NH)NH(C C4 alkyl), -O-d-Q alkyl-C(=NH)N(C C4 alkyl)2, -O-d-Q alkyl-C(=N(d-Q alkyl))NH(CrC4 alkyl), -O-d-Q alkyl-C(=N(C,-Q alkyl))N(Q-C4 alkyl)2, -C(=NH)NH2, -C(=NH)NH(d-Q alkyl), -C(=NH)N(C Q alkyl)2, -C(=N(CrC4 alkyl))NH(CrQ alkyl), -C(=N(CrC4 alkyl))N(C C4 alkyl)2, -C(0)-CrC4 alkyl-C(0)C02(C C4 alkyl), a d-Q alkyl, Q-Q alkenyl or Q-Q alkynyl group substituted with -0-C(0)NH2, -0-C(0)NHQ-Q alkyl or -0-C(0)N(CrC4 alkyl)2, a cycloalkyl, heterocycloalkyl, aryl or heteroaryl substituted with at least one substituent independently selected from oxo(as a substituent for cycloalkyl, heterocycloalkyl, or heteroaryl), -NHC(0)CrC4 alkyl, and -N(Q-C4 alkyl)C(0)CrC4 alkyl, or a -O-Q-Cg cycloalkyl, -O-heterocycloalkyl, -O-heteroaryl, -O-Q-Q alkyl-C3-C8 cycloalkyl, -O-Q-Q alkyl-heterocycloalkyl, -O-Q-Q alkyl-heteroaryl group substituted by oxo, and optionally substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rn, -OCONR10Rπ, -SO2NR10R1I, and -COR11;
R8 is -C(0)OR9, -C(0)R9, -C(0)NR9R10, -OR14, -NR9R10, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10 or -N(R10)SO2R12;
W is Ci-Cio alkyl substituted with -C(0)d-Q alkyl or -C(0)N(Q-C4 alkyl)2; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
This invention is also directed to a prodrug of a compound according to Formula I, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. In addition, this invention is directed to pharmaceutical compositions comprising a compound according to Formula I, or a tautomer thereof, or a prodrug thereof, or salts or solvates thereof. In another embodiment, this invention is directed to a method of inhibiting an RNA- containing virus comprising contacting the virus with an effective amount of a compound of Formula I. In yet another embodiment, this invention is directed to a method of treating infection or disease caused by an RNA-containing virus which comprises administering to a subject in need thereof, an effective amount of a compound according to Formula I. This invention is particularly directed to methods of inhibiting hepatitis C virus. This invention is also directed to a method for inhibiting replication of hepatitis C virus which comprises inhibiting replication of both positive and negative strand HCV-RNA.
DETAILED DESCRIPTION OF THE INVENTION It will be appreciated by those skilled in the art that the compounds of this invention, represented by generic Formula I, above, exist in tautomeric forms having Formula I-A and Formula I-B, as follows:
Figure imgf000011_0001
I-A I-B
In addition, it will be appreciated by those skilled in the art, that the compounds of this invention may exist in several other tautomeric forms. All tautomeric forms of the compounds described herein are intended to be encompassed within the scope of the present invention. Examples of some of the other possible tautomeric forms of the compounds of this invention include, but are not limited to:
Figure imgf000011_0002
I-C I-D
Figure imgf000011_0003
I-E I-F
As a convention, the compounds exemplified herein have been assigned names based on the structure of the tautomer of Formula I-A. It is to be understood that any reference to named compounds of this invention is intended to encompass all tautomers of the named compounds and any mixtures of tautomers of the named compounds.
As used herein, the term "alkyl" represents a straight-or branched-chain saturated hydrocarbon, which may be unsubstituted or substituted by one, or more of the substituents defined herein. Exemplary alkyls include, but are not limited to methyl (Me), ethyl (Et), propyl, isopropyl, butyl, isobutyl, t-butyl and pentyl. The term "lower alkyl" refers to an alkyl containing from 1 to 4 carbon atoms.
When the term "alkyl" (or alkenyl or alkynyl) is used in combination with other substituent groups, such as "haloalkyl" or "arylalkyl", the term "alkyl" is intended to encompass a divalent straight or branched-chain hydrocarbon radical. For example, "cycloalkylalkyl" is intended to mean the radical -alkyl-cycloalkyl, wherein the alkyl moiety thereof is a divalent straight or branched-chain hydrocarbon radical and the cycloalkyl moiety thereof is as defined herein, and is represented by the bonding arrangement present in the groups -CH2-cyclopropyl, -CH2-cyclohexyl, or -CH2(CH3)CHCH2-cyclopentenyl.
"Arylalkyl" is intended to mean the radical -alkylaryl, wherein the alkyl moiety thereof is a divalent straight or branched-chain carbon radical and the aryl moiety thereof is as defined herein, and is represented by the bonding arrangement present in a benzyl group (-CH2-phenyl). As used herein, the term "alkenyl" represents a straight-or branched-chain hydrocarbon containing one or more carbon-carbon double bonds. An alkenyl may be unsubstituted or substituted by one or more of the substituents defined herein. Exemplary alkenyls include, but are not limited ethenyl, propenyl, butenyl, isobutenyl and pentenyl. As used herein, the term "alkynyl" represents a straight-or branched-chain hydrocarbon containing one or more carbon-carbon triple bonds and, optionally, one or more carbon-carbon double bonds. An alkynyl may be unsubstituted or substituted by one or more of the substituents defined herein. Exemplary alkynyls include, but are not limited ethynyl, butynyl, propynyl (propargyl, isopropynyl), pentynyl and hexynyl.
"Cycloalkyl" represents a group or moiety comprising a non-aromatic monocyclic, bicyclic, or tricyclic hydrocarbon containing from 3 to 14 carbon atoms which may be unsubstituted or substituted by one or more of the substituents defined herein and may be saturated or partially unsaturated. Exemplary cycloalkyls include monocyclic rings having from 3-7, preferably 3-6, carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclopentadienyl, cyclohexyl, cyclohexenyl and cycloheptyl. "Heterocycloalkyl" represents a group or moiety comprising a non-aromatic, monovalent monocyclic, bicyclic, or tricyclic radical, which is saturated or partially unsaturated, containing 3 to 18 ring atoms, which includes 1 to 5 heteroatoms selected from nitrogen, oxygen and sulfur, and which may be unsubstituted or substituted by one or more of the substituents defined herein. Illustrative examples of heterocycloalkyls include, but are not limited to, azetidinyl, pyrrolidyl (or pyrrolidinyl), piperidinyl, piperazinyl, morpholinyl, tetrahydro-2H-l,4-thiazinyl, tetrahydrofuryl (or tetrahydrofuranyl), dihydrofuryl, oxazolinyl, thiazolinyl, pyrazolinyl, tetrahydropyranyl, dihydropyranyl, 1,3- dioxolanyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-oxathiolanyl, 1,3-oxathianyl, 1,3-dithianyl, azabicylo[3.2.1]octyl, azabicylo[3.3.1]nonyl, azabicylo[4.3.0]nonyl, oxabicylo[2.2.1]heptyl and 1,5,9-triazacyclododecyl. Generally, in the compounds of this invention, heterocycloalkyl is a monocyclic heterocycloalkyl, such as azetidinyl, pyrrolidyl (or pyrrolidinyl), piperidyl (or piperidinyl), piperazinyl, morpholinyl, tetrahydro-2H-l,4- thiazinyl, tetrahydrofuryl (or tetrahydrofuranyl), tetrahydrothienyl, dihydrofuryl, tetrahydropyranyl, dihydropyranyl, 1,3-dioxolanyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-oxathianyl, 1,3-dithianyl, oxazolinyl, thiazolinyl and pyrazolinyl.
"Aryl" represents a group or moiety comprising an aromatic, monovalent monocyclic or bicyclic hydrocarbon radical containing from 6 to 10 carbon ring atoms, which may be unsubstituted or substituted by one or more of the substituents defined herein, and to which may be fused one or more cycloalkyl rings, which may be unsubstituted or substituted by one or more substituents defined herein. Generally, in the compounds of this invention, aryl is phenyl.
"Heteroaryl" represents a group or moiety comprising an aromatic monovalent monocyclic, bicyclic, or tricyclic radical, containing 5 to 18 ring atoms, including 1 to 5 heteroatoms selected from nitrogen, oxygen and sulfur, which may be unsubstituted or substituted by one or more of the substituents defined herein. This term also encompasses bicyclic or tricyclic heterocyclic-aryl compounds containing an aryl ring moiety fused to a heterocycloalkyl ring moiety, containing 5 to 16 ring atoms, including 1 to 5 heteroatoms , selected from nitrogen, oxygen and sulfur, which may be unsubstituted or substituted by one or more of the substituents defined herein. Illustrative examples of heteroaryls include, but are not limited to, thienyl, pyrrolyl, imidazolyl, pyrazolyl, furyl (or furanyl), isothiazolyl, furazanyl, isoxazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyridyl (or pyridinyl), pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, tetrazinyl, triazolyl, tetrazolyl, benzo[b]thienyl, naphtho[2,3-b]thianthrenyl, isobenzofuryl, 2,3-dihydrobenzofuryl, chromenyl, chromanyl, xanthenyl, phenoxathienyl, indolizinyl, isoindolyl, indolyl, indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthridinyl, quinzolinyl, benzothiazolyl, benzimidazolyl, tetrahydroquinolinyl, cinnolinyl, pteridinyl, carbozolyl, beta-carbolinyl, phenanthridinyl, acridinyl, perimidinyl, phenanthrolinyl, phenazinyl, isothiazolyl, phenathiazinyl, and phenoxazinyl. Generally, in the compounds of this invention, heteroaryl is a monocyclic heteroaryl, such as thienyl, pyrrolyl, imidazolyl, pyrazolyl, furyl, isothiazolyl, furazanyl, isoxazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, tetrazinyl, triazolyl and tetrazolyl.
The terms "halogen" and "halo" represent chloro, fluoro, bromo or iodo substituents. "Hydroxy" is intended to mean the radical -OH. "Alkoxy" is intended to mean the radical -ORa, where Ra is an optionally substituted alkyl group. Exemplary alkoxy include methoxy, ethoxy, propoxy, and the like. "Lower alkoxy" groups have optionally substituted alkyl moieties from 1 to 4 carbons. "Alkylenedioxy" is intended to mean the divalent radical -ORaO- which is bonded to adjacent atoms (e.g., adjacent atoms on a phenyl or naphthyl ring), wherein Ra is a d-Q alkyl group. Exemplary alkylenedioxy-substituted phenyls include benzo[l,3]dioxyl and 2,3-dihydro-benzo[l,4]dioxyl.
This invention is directed to compounds wherein at least one of R , R , R , R R , R or W is as defined hereinabove. In one specific embodiment of the compounds of this invention, R1 is amino, -0(C Q alkyl)C(0)NH2, -0(Q-Q alkyl)C(0)NH(Q-Q alkyl), -0(Cι-Q alkyl)C(0)N(d-Q alkyl)(d-C4 alkyl), -0(C Q alkyl)C02H, or -0(d-Q alkyl)C02(Ci-C4 alkyl). In another specific embodiment of the compounds of this invention, R2 is -N=CH-N(CH3)2. In yet another specific embodiment of this invention, R4 is nitro. In yet another specific embodiment, R6 is -CF3. In another embodiment, R7 is -C(OC Q alkyl)=C(H)(C02C C2 alkyl), -C(H)=C(C02CrC2 alkyl)(NHCO(CrC2 alkyl)), -d-Q alkyl-OC(0)NH2, -d-Q alkyl-OC(0)NH(d-Q alkyl), -Q-Q alkyl-OC(0)N(Q-C2 alkyl)2, -O-d-Q alkyl-C(0)NH-d-C3 alkyl-C(0)NH2, -0-Q-C2 alkyl-C(0)NH-d-Q alkyl-C(0)NHC C2 alkyl, -0-Ci-C2 alkyl-C(0)NH-CrC3 alkyl-C(0)N(CrC2 alkyl)2, -0-d-C2 alkyl-C(0)N(C,-C2 alkyl)-CrC3 alkyl-C(0)NH2, -0-C C2 alkyl-C(0)N(d-C2 alkyl)-C C3 alkyl-C(0)NHCrC2 alkyl, -O-d-Q alkyl-C(0)N(d-C2 alkyl)-CrC3 aikyl-C(0)N(d-Q alkyl)2, -O- Q-C2 alkyl-C(=NH)NH2, -O-Q-Q alkyl-C(=NH)NH(C,-C2 alkyl), -O- d-C2 alkyl-C(=NH)N(C C2 alkyl)2, -0-C C2 alkyl-C(=N(Q-Q alkyl))NH(C C2 alkyl), -O-Ci-Q alkyl-C(=N(Q-C2 alkyl))N(CrC2 alkyl)2, -C(=NH)NH2, - C(=NH)NH(d~Q alkyl), -C(=NH)N(CrC2 alkyl)2, -C(=N(C C2 alkyl))NH(CrC2 alkyl), - C(=N(d-Q alkyl))N(CrC2 alkyl)2, -C(0)-C C2 alkyl-C(0)C02(Ci-Q alkyl), 2-oxo- pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-[(d-C4 alkyl)C(0)NH-]thiazol~4- yl- or, 2-[(Q-C2 alkyl)C(0)N(CrC2 alkyl)-]thiazol-4-yl-.
More specifically, R7 is, -C(OCrQ alkyl)=C(H)(C02CrC2 alkyl), -C(H)=C(C02Q-C2 alkyl)(NHCO(d-Q alkyl)), -C,-C2 alkyl-OC(0)NH2, -Ci-Q alkyl-OC(0)NH(C C2 alkyl), -C C2 alkyl-OC(0)N(CrQ alkyl)2, -C2 alkenyl- OC(0)NH2, -Q alkenyl-OC(0)NH(C,-Q alkyl), -Q alkenyl-OC(0)N(d-C2 alkyl)2, -O- d-C2 alkyl-C(0)NH-CrC3 alkyl-C(0)NH2, -0-C C2 alkyl-C(0)NH-d-Q alkyl-C(0)NHd-C2 alkyl,
-0-CrC2 alkyl-C(0)NH-CrC3 alkyl-C(0)N(d-C2 alkyl)2, -0-C C2 alkyl-C(=NH)NH2, -O- d-Q alkyl-C(=NH)NH(C C2 alkyl), -0-CrC2 alkyl-C(=NH)N(d-C2 alkyl)2, - C(=NH)NH2, -C(=NH)NH(CrC2 alkyl), -C(=NH)N(C Q alkyl)2, -C(O)- Q-Q alkyl-C(0)C02(Ci-Q alkyl), 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol- 3-yl, or, 2-[(CrQ alkyl)C(0)NH-]thiazol-4-yl-.
In specific embodiments, R7 is -C(0CH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH20C(0)NH2, -0CH2C(0)NHCH2C(0)N(CH3)2, 2-oxo- pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-. In another embodiment, this invention is directed to compounds wherein R8 is -0(Q-Q alkyl) or -0(Q-C4 alkenyl), where the Q-Q alkyl or C2-Q alkenyl- group is unsubstituted or substituted with a substituent selected from -CON(Cι-Q alkyl)(Cι-Q alkyl), -CONH(C Q alkyl), -CONH2. In specific embodiments, R8 is -OCH3, -0CH2C0NH2, or -OCH=CHCONH2. In a further embodiment, W is -Q-Q alkyl-C(0)d-C4 alkyl or -Q-Q alkyl-C(0)N(d-C4 alkyl)2; specifically, W is -CH2C(0)C(CH3)3 or -CH2C(0)N(CH3)2. In the embodiments of the compounds of this invention, when at least one of R1, R2, R4, R6 R7, R8 or W is defined as above, R3 and R5, or the other of R1, R2, R4, R6 R7, R8 and W may be any substituent defined herein.
In the following embodiments, the following definitions apply: each Ra is independently H or Q-Q alkyl; each Rb is independently H or Q-Q alkyl, where the alkyl is optionally unsubstituted or substituted by one or more substituents independently selected from the group consisting of halogen, cyano, -OQ-Q alkyl, -OH, -N(Q-Q alkyl)(C C alkyl), -NH(C Q alkyl), -NH2, -C02H, -C(0)OQ-C4 alkyl, -CON(C Q aιkyl)(Q-C4 alkyl), -CONH(Cι-Q alkyl), -CONH2, aryl, heteroaryl, heterocycloalkyl, -C(0)aryl, -C(0)heterocycloalkyl, and -C(0)heteroaryl, where said aryl, heteroaryl, heterocycloalkyl, -C(0)aryl, -C(0)heterocycloalkyl, or -C(0)heteroaryl is unsubstituted or substituted with one or more substituents independently selected from C C4 alkyl, Q-Q haloalkyl, halogen, -ORa, -SR\ -NRaRa, cyano and nitro; each Rc is independently Q-Q alkyl, optionally unsubstituted or substituted by one or more substituents independently selected from the group consisting of halogen, cyano, -OQ-Q alkyl, -OH, -N(C,-Q alkyl)(CrQ alkyl), -NH(C Q alkyl), -NH2, -C02H, -C(0)OQ-Q alkyl, -CON(C,-C4 alkyl)(C C4 alkyl), -CONH(CrC4 alkyl), -CONH2, aryl and heteroaryl, and where said aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from C Q alkyl, Q-Q haloalkyl, halogen, -0R , -SRa, -NRaRa, cyano and nitro; each Rd is independently H or Q-Q alkyl, where the alkyl is optionally substituted by one or more substituents independently selected from the group consisting of halogen, cyano, -Od-Q alkyl, -OH, -N(Q-C4 alkyl)(d-C4 alkyl), -NH(CrC4 alkyl), -NH2, -C02H, -C(0)OC Q alkyl, -CON(Q-C4 alkyl)(C C4 alkyl), -CONH(d-Q alkyl), -CONH2, -C(0)Q-Q alkyl, -C(0)aryl, -C(0)heteroaryl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, and where said aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, d-Q haloalkyl, halogen, -0Ra, -SR\ -NRaRa, cyano and nitro; or, when present in any NRaRb or NRaRd, each Ra and Rb or each Ra and Rd , independently, taken together with the nitrogen atom to which they are attached form a 5- or 6-membered heterocycloalkyl ring, which optionally contains one or more heteroatoms selected from oxygen or nitrogen and which is unsubstituted or substituted with one or more substituents selected from the group halogen, cyano, -OQ-Q alkyl, -OH, -N(Q-Q alkyl)(d-C4 alkyl), -NH(Q-Q alkyl), -NH2, -C02H, -C(0)OQ-C4 alkyl, -C(0)C C4 alkyl, -CON(CrQ alkyl)(CrC4 alkyl), -CONH(C Q alkyl), -CONH2, -C(0)C Q alkyl. In one embodiment of the compounds of Formula I of this invention, R1 is hydrogen, halogen, Q-C4 alkyl, aryl, -ORa, -C(0)OH, -C(0)NHRa, cyano, nitro, amino, -0(C Q alkyl)C(0)NRaRa or -0(d-Q alkyl)C02Ra. In another embodiment, R1 is H, phenyl, -CH3, -OCH3, -N02, -NH2, F, Cl, Br, -OH, -C(0)OH, -C(0)NHCH3, -OCH2C(0)NH2 or -0CH2C02CH2CH3. Preferably, R1 is H, F, Cl, phenyl, -CH3, -OCH3, -N02, -NH2, -OH, -C(0)NHCH3, -OCH2C(0)NH2 or -OCH2C02CH2CH3. In the specific embodiments of the compounds described herein, R1 is H, -NH2, -OCH2C(0)NH2 or -OCH2C02CH2CH3.
In another embodiment, R2 is hydrogen, Q-Q alkyl, Q-Q alkenyl, Q-Q haloalkyl, aryl, heteroaryl, nitro, cyano, halogen, -C(0)ORa, -C(0)C Q alkyl, -C(0)NRaRa, -ORb, protected -OH, -SRb, -S(0)Rc, -S(0)2Rb, -NRaRc, -N=CH-N(Ra)2, -NRaC(0)CrC6 alkyl, -NRaCOaryl, -NRaCO(C C4 alkyl)aryl, -NRaC(0)heteroaryl,
-NRaC(0)(C C4 alkylheteroaryl, -NRaC(0)cycloalkyl, -NRaC(0)(CrC4 alkyl)cycloalkyl, -NRaC(0)heterocycloalkyl, -NRaC(0)(CrQ alkylheterocycloalkyl, where said C C6 alkyl or Q-Q alkenyl is optionally unsubstituted or substituted by one or more substituents independently selected from the group consisting of cyano, -OQ-Q alkyl, -OH, -N(C Q alkylXd-Q alkyl), -NH(d-Q alkyl), -NH2, -C02H, -C(0)OQ-C4 alkyl, -CON(Q-C4 alkyl)(CrC4 alkyl), -CONH(d-Q alkyl), and -CONH2, and where each of said aryl, heteroaryl, cycloalkyl, or heterocycloalkyl is optionally unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, d-Q haloalkyl, halogen, -ORa, -SRa, -NRaRa, -CON(C Q alkyl)(CrC4 alkyl),
-CONH(C Q alkyl), -CONH2, nitro and cyano. In a preferred embodiment, R2 is hydrogen, halogen, CrQ alkyl, -ORb', -NHRb', N02, or -N=CH-N(Q-C2 alkyl)2, where Rb'is H or Q-Q alkyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C02H, -CONH2, -C(0)OC C2 alkyl, -CONH(Q-Q alkyl), and unsubstituted monocyclic heteroaryl. In specific embodiments of this invention, R2 is H, F, Cl, Br, I, -OH, -OCH3, -CH3, -CH2(4-OCH3-phenyl), -CH=CHC(0)NH2, -N02, -NH2, -NHCH3, -N(CH3)2, -N=CH-N(CH3)2., -CONHCH3, -CON(CH3)2, -C02H, -C02CH2CH3, -0(CH2)2CH(CH3)2, -0(CH2)3CN, -OCH2CN, -0(CH2)20CH3, -0(CH2)2OH, -0CH2CH(0H)CH2CH3> -0(CH2)2N(CH3)2, -OCH2phenyl, -OCH2CONH2, -0(6-Br-pyridin-2-yl), -0(6-0CH3-pyridin-2-yl), -OSi(CH3)2(tBu), -NHCH2C02H, -NHCH2C02CH2CH3, -NH(CH2)2C02CH3, -NHCH2-2-furyl, -NH(CH2)2OH, -NHCH2CN, -NHCH2C(0)NH2, -NHC(0)CH3, -NHC(0)CH2CH(CH3)2, -NHC(0)CH2N(CH3)2, -NHC(0)phenyl, -NHC(0)(3-CH30-phenyl), -NHC(0)(4-N02- phenyl), -NHC(0)(3-CN-phenyl), -NHC(0)(3-CF3-phenyl), -NHC(0)(3-F-phenyl), -NHC(0)(3-pyridyl), -NHC(0)(2-furyl), -NHC(0)(2-thienyl), -NHC(0)(4-OCH3-phenyl), -NHC(OXcyclopentyl). Preferably, R2 is H F, Cl, -OH, -NH2, N02, -CH3, -OCH3, -NHCH3, -0(CH2)2OH, -NH(CH2)2OH, -OCH2CN, -NHCH2CN, -OCH2CONH2, -NHCH2C02H, -NHCH2C02Et, -NHCH2(2-furyl), or -N=CH-N(CH3)2.
In yet another embodiment, R1 and R2 taken together are methylenedioxy. In the specific embodiments of the compounds described herein, R2 is H, F, or -N=CH-N(CH3)2.
In yet another embodiment of the compounds of this invention, R3 is H, halogen, -OH or -C(0)OH, preferably H or F. In the specific embodiments of the compounds described herein, R3 is H. In a further embodiment, R4 is H, halogen, CrQ alkyl or nitro. In specific embodiments, R4 is H, Br, F or nitro. In the specific embodiments of the compounds described herein, R4 is H or nitro.
In another embodiment, R5 is H, halogen, d-Q alkyl, or -OR . In specific embodiments, R5 is H, Br, Cl, methyl, methoxy, or hydroxyl. In the specific embodiments of the compounds described herein, R5 is H or Cl. In one other embodiment, R6 is H, halogen, Q-Q alkyl, Q-Q haloalkyl or -ORa. In specific embodiments, R6 is H, hydroxyl, methoxy, Br, Cl or CF3. In the specific embodiments of the compounds described herein, R6 is H or CF3.
In one embodiment of the compounds of Formula I of this invention, R7 is hydrogen, Q-Q alkyl, Q-Q alkenyl, C2-Q alkynyl, aryl, heteroaryl, nitro, cyano, halogen, -C(0)OR\ -C(0)d-Q alkyl, -C(0)NRaRd, -ORb, -NRaRd, -N(Ra)C(0)Rd, -C(Od-Q alkyl)=C(H)(C02Ra), -C(H)=C(C02Q-Q alkyl)(NHCORa), -(d-C2 alkyl)-0-C(0)NH2, -0(d-C2 alkyl)C(0)NH-d-C2 alkyl-C(0)NRaRd, 2-oxo- pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-acetamidothiazol- 4-yl-,-OC(0)NRaRd, or -N(Ra)C(0)NRaRd, where said alkyl, alkenyl or alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -ORa, -SRa, -NRaRa, cyano, nitro, -C02H, -C(0)OCrQ alkyl, , -CON(d-Q alkyl)(CrC4 alkyl), -CONH(C,-Q alkyl), -CONH2, aryl, and heteroaryl, and where said aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from CrQ alkyl, Q-Q haloalkyl, halogen, -ORa, -SRa, -NRaRa, cyano and nitro. Preferably, R7 is hydrogen, halogen, Q-Q alkyl, Q alkenyl, -C(0)ORa, -C(0)Ra', -ORb", -NRaRd', -C(0)NRaRd', -C(OCrQ alkyl)=C(H)(C02Ra), -C(H)=C(C02Q-C2 alkyl)(NHCORa), -(Q-Q alkyl)-0-C(0)NH2, -0(Q-Q alkyl)C(0)NH-d-C2 alkyl-C(0)NRaRd, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5- dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-, where said C Q alkyl, or Q alkenyl is unsubstituted or substituted with a substituent selected from -NH2 and -CONH2, Ra is H or methyl, Rb is H or Q-Q alkyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -NH2, -C02H, -CONH2, -C(0)Od-Q alkyl, -CON(CrQ alkyl)(Q-C4 alkyl), -CONH(Q-Q alkyl), monocyclic heteroaryl, -C(0)monocyclic heterocycloalkyl, and -C(0)monocyclic heteroaryl, where said heteroaryl, -C(0)heterocycloalkyl, or -C(0)heteroaryl are unsubstituted or substituted one or more of Q-Q alkyl, halogen, cyano, -OH, -NH2, and -CONH2, Rd is H or Q-Q alkyl, where the Q-Q alkyl is unsubstituted or substituted by a substituent selected from the group consisting of cyano and unsubstituted aryl, or Ra and Rd taken together with the nitrogen atom to which they are attached form a 5- or 6-membered heterocycloalkyl ring, which optionally contains an additional nitrogen heteroatom and which is unsubstituted or substituted with -C(0)Q-Q alkyl. hi another embodiment, R? is H, -CH3, -OH, -OCH3, phenyl, F, Cl, Br, I, N02, -NH2, -N(CH3)2, -NHCH2CN, -CN, -CH2NH2, -CH2CH2C(0)NH2, -CH=CHC(0)NH2, -CH=CHC(0)NH2, -C(0CH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5- dihydro-isoxazol-3-yl, 2-acetamidothiazol-4-yl-, -(CH2)2CH(CH3)OCH3, -CHO, -C(0)CH3, -C02CH3, -C02H, -C(0)NH2, -C(0)NHCH3, -C(0)N(CH3)2, -OCH2C02CH3, -OCH2C02H, -0CH2CH(NH2)CH2CH3, -0(CH2)2N(CH3)2, -OCH2CN, -0(CH2)2NH2, -0CH2C(0)NH2, -0CH2C0NHCH3, -0CH2C0N(CH3)2, -0CH(CH3)C(0)NH2, -OCH2-tetrazol-5-yl, -OCH2C(0)(3-pyridyl), -OCH2C(0)(N-pyrrolidinyl), -OCH2C(0)(N-piperazinyl), -OCH2C(0)(N-morpholinyl), -OCH2(5-methyl-l,3,4-oxadiazol-2-yl), -C(0)NH(CH2)3(N- imidazoyl), -C(0)NHCH2CH(OCH3)2, -C(0)(4-acetylpiperizin-l-yl), -C(0)NHCH2(2- tetrahydrofuryl), -C(0)NHCH2phenyl, -C(0)NH(CH2)3N(CH2CH3)2, -C(0)(N-pyrrolidinyl), -C(0)NH(CH2)2(4-OCH3phenyl), or -NHCH2phenyl. Preferably, R? is H, F, Cl, -CH3, -CH2NH2, -CH2CH2CONH2, -CH=CHC(0)NH2, -C(0CH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHC0CH3), -CH2OC(0)NH2, -0CH2C(0)NHCH2C(0)N(CH3)2, 2-oxo- pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-acetamidothiazol-4-yl-, -OH, -OCH3, -0(CH2)2NH2, -OCH2CH((R)-NH2)CH2CH3, -OCH2CN, -OC(CH3)2CONH2, -OCH2C02CH3, -OCH2CONH2, -OCH2CONHCH3, -OCH2CON(CH3)2, -OCH2C02H, -OCH2C(0)(3-pyridinyl), -OCH2C(0)(N-pyrrolidinyl), -OCH2C(0)(N-morpholinyl), -OCH2(5-methyl-l,3,4-oxadiazol-2-yl), -OCH(CH3)CONH2, -OCH2-tetrazol-5-yl, -NH2, -N(CH3)2, -NHCH2CN, -NHCH2Ph, -C02CH3, -C02H, -C(0)NH2, -C(0)NHCH3, -C(0)N(CH3)2, -CHO, -C(0)(N-acetylpiperizinyl), or -C(0)(N-pyrrolidinyl).
7 In the specific embodiments of the compounds described herein, R is H,
-C(OCH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol- 3-yl, 2-acetamidothiazol-4-yl-, nitro or -OCH2CN.
In another embodiment, Rs is hydrogen, -ORb8 or -NHRb8, where Rbs is H or Q-Q alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C02H, -CONH2, -C(0)OC C2 alkyl, -CONH(Q-C2 alkyl), and -CON(Q-Q alkyl)2, or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C02H, -CONH2, -C(0)OC Q alkyl, ~CONH(Q-C2 alkyl) and -CON(Q-Q alkyl)2. In specific embodiments, R8 is H, -OCH3, -OCH2CONH2, or -OCH=CHCONH2.
In another embodiment, W is hydrogen, -C(0)ORa, C3-C8 alkyl, Q-Q alkenyl, Q-Q alkynyl,-Cι-Q alkyl-C(0)Q-Q alkyl, -Q-C2 alkyl-C(0)N(CrC4 alkyl)2, -(C1-C4 alkyl)-(C3-C5 cycloalkyl), -(C C4 alkyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, or -(C1-C4 alkyl)-heteroaryl, where the Q-Q alkyl, Q-Q alkenyl or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, cyano, -0R\ -SRa, -S(0)d-Q alkyl, -S(0)2C C4 alkyl, and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of the -(Q-Q alkyl)-(Q-Q cycloalkyl), -(Q-Q alkyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, or -(Q-Q alkyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, d-Q haloalkyl, halogen, nitro, cyano, -ORa, -NRaRa. Preferably, W is Q-Q alkyl, Q alkenyl, Q alkynyl, -(Q-Q alkyl)-(Q-Q cycloalkyl), -(Ci alkyl)-heterocycloalkyl, -(Q alkyl)-aryl, or -(Q alkyl)-heteroaryl, where the Q-Q alkyl, Q alkenyl or Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -OCH , -SCH3, and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of the
-(d-Q alkyl)-(C3-Q cycloalkyl), -(d-Q alkyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, or -(Q-Q alkyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from -CH3, halogen, nitro, cyano, -ORa, -NRaRa.
In specific embodiments, W is H, -(CH2)ι-3-phenyl, -CH2-(2-CN-phenyl), -(CH^^ cyclopropyl, -CH2(2-CH3-cycloprop-l-yl), -(CH2)-cyclobutyl, -(CH2)-cyclopentyl, -(CH2)-cyclohexyl, -CH2-(2-tetrahydrofuryl), -CH2-(3 -tetrahydrofuryl), -CH2-(3-pyridyl), -CH2-(6-NH2-3-pyridyl), -CH2-(4-pyridyl), -CH2-(2-NH2-4-pyridyl), -CH2-(2-CH3-4- pyridyl), -CH2-(4-bromophenyl), -CH2-(3-bromophenyl), -CH2-(3-N02-phenyl), -CH2-(3-furyl), -(CH2)2-(2-thienyl), -(CH2)2-(3-thienyl), -(CH2)2CH(CH3)2, -(CH2)2C(CH3)3, -(CH2)2CH(CH3)CH 2CH3, -(CH2)2CH(CH3)(CF3), -(CH2)2CH=CH2, -CH2CH=CH2, -(CH2)2CHBr(CH3), -(CH2)CH=C(CH3)2, -(CH2)3CF3, -(CH2)3CN, -(CH2)3.4OH, -(CH2)2CH(CH3)OCH3, -(CH2)2C≡CH, -(CH2)3C≡CH, -C02CH2CH3, -(CH2)2CH(CH3)CH2CH3, -(CH2)2SCH3, (CH2)3SCH3, -(CH2)2S(0)CH3, -(CH2)2S(0)2CH3, -CH2C(0)C(CH3)3, or -CH2C(0)N(CH3)2. Preferably, W is -(CH2)2CH(CH3)2, -(CH2)2C(CH3)3, -(CH2)2CH(CH3)CH2CH3, -(CH2)2CH=CH2, -(CH2)2C≡CH, -(CH2)3CF3, -(CH2)2CH(CH3)(CF3), -(CH2)2CHBrCH3, -(CH2)4OH, -(CH2)2CH(CH3)OCH3, -(CH2)2SCH3, -CH2C(0)C(CH3)3, -CH2C(0)N(CH3)2,-CH2(cyclopropyl), -(CH2)2(cyclopropyl), -CH2(2-CH3-cycloprop-l-yl), -CH2(cyclobutyl), -CH2(cyclopentyl), -CH2(cyclohexyl), -CH2(3-Br-phenyl), -(CH2(3-N02-phenyl), -CH2(4-Br-phenyl), -CH2(3-furyl), -(CH2)2(3-thienyl), -CH2(4-pyridyl), or -CH2(2-CH3-4-pyridinyl). In the specific embodiments of the compounds described herein, W is -(CH2)2CH(CH3)2, -CH2C(0)C(CH3)3, -CH2C(0)N(CH3)2, or -(CH2)2(cyclopropyl).
Preferably, in the compounds of this invention, X is O, Y is OH.
In another embodiment of the compounds of this invention, Z is H or methyl. Preferably, Z is H. It is to be understood that the present invention covers all combinations of specific and preferred groups described herein.
Accordingly, one embodiment of this invention comprises compounds wherein:
R1 is hydrogen, halogen, CrQ alkyl, aryl, -ORa, -C(0)OH, -C(0)NHRa, cyano, nitro, amino, -0(Q-Q alkyl)C(0)NRaRa or -0(Q-Q alkyl)C02Ra;
R2 is hydrogen, halogen, d-Q alkyl, -ORb', -NHRb', N02, or -N=CH-N(Q-C2 alkyl)2, where Rb' is H or C Q alkyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, - OH, -C02H, -CONH2, -C(0)OC,-Q alkyl, -CONH(Q-Q alkyl), and unsubstituted monocyclic heteroaryl; or R1 and R2 taken together are methylenedioxy;
R3 is H, halogen or -C(0)OH;
R4 is H, halogen, Q-Q alkyl or nitro;
R5 is H, halogen, C Q alkyl, or -ORa; R6 is H, halogen, Q-Q alkyl, Q-Q haloalkyl or -ORa;
R' is hydrogen, halogen, -Q-Q alkyl, -Q alkenyl, -C(0)ORa, -C(0)Ra, -OR b"" , -NRaRd', -C(0)NRaRd',
R7 is -C(OC C2 alkyl)=C(H)(C02C,-C2 alkyl), -C(H)=C(C02Q-Q alkyl)(NHCO(d-Q alkyl)), -CrC2 alkyl-OC(0)NH-Q-Q alkyl-C(0)NH2,
-Q-C2 alkyl-OC(0)NH-d-C3 alkyl-C(0)NH(CrC2 alkyl), -d-Q alkyl-OC(0)NH-Q-Q alkyl-C(0)N(Q-C2 alkyl)2, -O-d-Q alkyl-C(0)NH-Cι-Q alkyl-C(0)NH2, -O-C1-C2 alkyl-C(0)NH-C C3 alkyl-C(0)NHCrQ alkyl, -0-CrC2 alkyl-C(0)NH-Q-C3 alkyl-C(0)N(CrQ alkyl)2, -0-C C2 alkyl-C(=NH)NH2, -0-CrC2 alkyl-C(=NH)NH(Q-Q alkyl), -0-Q-C2 alkyl-C(=NH)N(Q-Q alkyl)2, - C(=NH)NH2, -C(=NH)NH(C C2 alkyl), -C(=NH)N(Q-Q alkyl)2, -C(O)- C C2 alkyl-C(0)C02(C C2 alkyl), 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol- 3-yl, or 2-[(C C4 alkyl)C(0)NH-]thiazol-4-yl-, where said -Q-Q alkyl or said -Q alkenyl is unsubstituted or substituted with a substituent selected from -NH2 and -CONH2, Ra' is H or methyl, Rb" is H or C Q alkyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -NH2, -C02H, -CONH2, -C(0)OCrQ alkyl, -CON(d-Q alkyiχCι-Q alkyl), -CONH(C,-C4 alkyl), -OC(0)NH2, -OC(0)NH(C C2 alkyl), -OC(0)N(d-Q alkyl)2, monocyclic heteroaryl, -C(0)monocyclic heterocycloalkyl, and -C(0)monocyclic heteroaryl, where said heteroaryl, -C(0)heterocycloalkyl, or -C(0)heteroaryl are unsubstituted or substituted one or more of Q-Q alkyl, halogen, cyano, -OH, -NH2, and -CONH2, Rd' is H or Q-Q alkyl, where the Q-Q alkyl is unsubstituted or substituted by a substituent selected from the group consisting of cyano and unsubstituted aryl, or Ra and Rd taken together with the nitrogen atom to which they are attached form a 5- or 6-membered heterocycloalkyl ring, which optionally contains an additional nitrogen heteroatom and which is unsubstituted or substituted with -C(0)Q-Q alkyl;
R8 is hydrogen, -ORb8, -NHRb8, where Rb8 is H or Q-Q alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl), or -CON(Q-Q alkyl)2, or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl) or -CON(Q-C4 alkyl)2; W is Q-Q alkyl, Q alkenyl, Q alkynyl, W is -Q-Q alkyl-C(0)Q-C4 alkyl,
-Ci-Q alkyl-C(0)N(Q-Q alkyl)2, -(Q-Q alkyι)-(Q-Q cycloalkyl), -(Ci alkyl)-heterocycloalkyl, -(Q alkyl)-aryl, or -(Q alkyl)-heteroaryl, where the Q-Q alkyl, Q alkenyl or Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -OCH3, -SCH3, and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of the
-(Q-Q alkyl)-(Q-Q cycloalkyl), -(Q-Q alkyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, or -(Q-Q alkyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from -CH3, halogen, nitro, cyano, -ORa, -NRaRa; X is O; Y is OH; and Z is H; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows: wherein:
R1 is amino, -0(Q-Q alkyl)C(0)NH2, -0(Q-Q alkyi)C(0)NH(Q-Q alkyl), -0(CrQ alkyl)C(0)N(Q-Q alkyl)(Q-C4 alkyl), -0(Q-Q alkyl)C02H, or -0(CrQ alkyl)C02(Q-C4 alkyl). R2 is -N=CH-N(Q-Q alkyl)2;
R4 is nitro;
R6 is CrC4 haloalkyl;
R7 is -C(OCι-C2 alkyl)=C(H)(C02Q-C2 alkyl), -C(H)=C(C02d-Q alkyl)(NHCO(C C2 alkyl)), -(C C2 alkyl)-0-C(0)NH2, -0(C Q alkyl)C(0)NH-Q-C2 alkyl-C(0)NH2, -0(CrQ alkyT)C(0)NH-d-Q alkyl-C(0)NHQ-Q alkyl,
-0(C C2 alkyl)C(0)NH-Ci-C2 alkyl-C(0)N(C Q alkyl)2, 2-oxo-pyrrolidin-3-yl-oxy,
5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-;
R8 is, -ORb8, -NHRb8, where Rb8 is C C4 alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(d~Q alkyl), or -CON(C Q alkyl)2, or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl) or -CON(Q-Q alkyl)2.; or W is -Q-Q alkyl-C(0)Q-Q alkyl or -Q-Q alkyl-C(0)N(CrQ alkyl)2; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
Another embodiment of this invention comprises compounds of Formula I, wherein
R1 is H, phenyl, -CH3, -OCH3, -N02, -NH2, F, Cl, Br, -OH, -C(0)OH, -C(0)NHCH3, -OCH2C(0)NH2 or -OCH2C02CH2CH3; R2 is H F, Cl, -OH, -NH2, N02, -CH3, -OCH3, -NHCH3, -0(CH2)2OH,
-NH(CH2)2OH, -OCH2CN, -NHCH2CN, -OCH2CONH2, -N=CH-N(CH3)2, -NHCH2C02H, -NHCH2C02Et, or -NHCH2(2-furyl); or R1 and R2 taken together are methylenedioxy;
R3 is H or halogen; R4 is H or nitro;
R is H, halogen or -OH; R6 is H or CF3;
R7 is H, F, Cl, -CH3, -CH2NH2, -CH2CH2CONH2, -C(H)=C(H)(C(0)NH2), -C(OCH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -0CH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl- oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-acetamidothiazol-4-yl-, -OH, -OCH3, -0(CH2)2NH2, -OCH2CH((R)-NH2)CH2CH3, -OCH2CN, -OC(CH3)2CONH2, -OCH2C02CH3, -OCH2CONH2, -OCH2CONHCH3, -OCH2CON(CH3)2, -OCH2C02H, -OCH2C(0)(3-pyridinyl), -OCH2C(0)(N-pyrrolidinyl), -OCH2C(0)(N-morpholinyl), -OCH2(5-methyl-l ,3,4-oxadiazol-2-yl), -OCH(CH3)CONH2, -OCH2-tetrazol-5-yl, -NH2, -N(CH3)2, -NHCH2CN, -NHCH2Ph, -C02CH3, -C02H, -C(0)NH2, -C(0)NHCH3, -C(0)N(CH3)2, -CHO, -C(0)(N-acetylpiperizinyl), or -C(0)(N-pyrrolidinyl); R8 is H, -OCH3, -0CH2C0NH2, or -OCH=CHCONH2. W is -(CH2)2CH(CH3)2, -(CH2)2C(CH3)3, -(CH2)2CH(CH3)CH2CH3, -(CH2)2CH=CH2, -(CH2)2C≡CH, -(CH2)3CF3, -(CH2)2CH(CH3)(CF3), -(CH2)2CHBrCH3, -(CH2)4OH, -(CH2)2CH(CH3)OCH3, -(CH2)2SCH3, -CH2C(0)C(CH3)3, -CH2C(0)N(CH3)2,-CH2(cyclopropyl), -(CH2)2(cyclopropyl), -CH2(2-CH3-cycloprop-l-yl), -CH2(cyclobutyl), -CH2(cyclopentyl), -CH2(cyclohexyl), -CH2(3-Br-phenyl), -(CH2(3-N02-phenyl), -CH2(4-Br-phenyl), -CH2(3-furyl), -(CH2)2(3-thienyl), -CH2(4-pyridyl), or -CH2(2-CH3-4-pyridinyl);
X is O; Y is OH; Z is H; provided that at least one of R1, R2, R4, Rδ R7, R8 or W is defined as follows, wherein:
R1 is -NH2, -OCH2C(0)NH2 or -OCH2C02CH2CH3; R2 is -N=CH-N(CH3)2;
R4 is nitro;
R6 is -CF3;
R7 is -C(OCH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-;
R8 is -OCH3, -0CH2C0NH2, or -OCH=CHCONH2; or
W is -CH2C(0)C(CH3)3 or -CH2C(0)N(CH3)2. tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
Yet another embodiment of this invention, comprises compounds of Formula I wherein:
R1 is H, -NH2, -0CH2C(0)NH2 or -OCH2C02CH2CH3;
R2 is H F, or -N=CH-N(CH3)2;
R3 is H;
R4 is H or nitro; R5 is H or Cl;
R6 is H or CF3;
R7 is H, -C(0CH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-acetamidothiazol-4-yl-, nitro or -OCH2CN;
R8 is H, -OCH3, -OCH2CONH2, or -OCH=CHCONH2;
W is -(CH2)2CH(CH3)2, -CH2C(0)C(CH3)3, -CH2C(0)N(CH3)2, or -(CH2)2(cyclopropyl); X is O; Y is OH; Z is H; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows, wherein: R1 is -NH2, -OCH2C(0)NH2 or -OCH2C02CH2CH3 ;
R2 is -N=CH-N(CH3)2;
R4 is nitro;
R6 is -CF3; R7 is -C(0CH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3),
-CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-;
R8 is -OCH3, -0CH2C0NH2, or -OCH=CHCONH2; or
W is -CH2C(0)C(CH3)3 or -CH2C(0)N(CH3)2. or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
One embodiment of this invention relates to a compound of Formula II:
Figure imgf000025_0001
or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof, wherem R1, R2, R6, R7, R8 and W are as defined herein. Another embodiment of this invention relates to a compound of Formula III:
Figure imgf000025_0002
or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof, wherein R2, R7, R8 and W are as defined herein.
Another embodiment of this invention relates to a compound of Formula IV:
Figure imgf000025_0003
or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof, wherein R2, R7, R8 and W are as defined herein. Preferably, in the compounds of this invention, at least one of R1, R2, R3, R4, R5, R6, R7 or R8 is not H. In another preferred embodiment, at least one of R1, R2, R6, R7 or R8 is not H. In yet other preferred embodiments, at least one of R2 or R7 or at least one of R2 or R8 is not H. If a substituent described herein is not compatible with the synthetic methods of this invention, the substituent may be protected with a suitable protecting group that is stable to the reaction conditions used in these methods. The protecting group may be removed at a suitable point in the reaction sequence of the method to provide a desired intermediate or target compound. Suitable protecting groups and the methods for protecting and de- protecting different substituents using such suitable protecting groups are well known to those skilled in the art; examples of which may be found in T. Greene and P. Wuts, Protecting Groups in Chemical Synthesis (3rd ed.), John Wiley & Sons, NY (1999), which is incorporated herein by reference in its entirety. In some instances, a substituent may be specifically selected to be reactive under the reaction conditions used in the methods of this invention. Under these circumstances, the reaction conditions convert the selected substituent into another substituent that is either useful as an intermediate compound in the methods of this invention or is a desired substituent in a target compound.
In the compounds of this invention, various substituents may be a "protected -OH" group. This term refers to a substituent represented as -ORp, where Rp refers to a suitable protecting group for an -OH moiety. Hydroxyl protecting groups are well known in the art and any hydroxyl protecting group that is useful in the methods of preparing the compounds of this invention may be used. Exemplary hydroxyl protecting groups include benzyl, tetrahydropyranyl, silyl (trialkyl-silyl, diaryl-alkyl-silyl, etc.) and various carbonyl-containing protecting groups, as disclosed in T. Greene and P. Wuts, supra. For example, in the compounds of this invention, R2 may be the protected hydroxyl moiety -OSi(tert-butyl)(CH3)2.
The compounds of this invention may contain at least one chiral center and may exist as single stereoisomers (e.g., single enantiomers), mixtures of stereoisomers (e.g. any mixture or enantiomers or diastereomers) or racemic mixtures thereof. All such single stereoisomers, mixtures and racemates are intended to be encompassed within the broad scope of the present invention. Compounds identified herein as single stereoisomers are meant to describe compounds that are present in a form that are at least 90% enantiomerically pure. Where the stereochemistry of the chiral carbons present in the chemical structures illustrated herein is not specified, the chemical structure is intended to encompass compounds containing either stereoisomer of each chiral center present in the compound. Such compounds may be obtained synthetically, according to the procedures described herein using optically pure (enantiomerically pure) or substantially optically pure materials. Alternatively, these compounds may be obtained by resolution/separation of a mixture of stereoisomers, including racemic mixtures, using conventional procedures. Exemplary methods that may be useful for the resolution/separation of mixtures of stereoisomers include chromatography and crystallization/re-crystallization. Other useful methods may be found in "Enantiomers, Racemates, and Resolutions, " J. Jacques et al., 1981, John Wiley and Sons, New York, NY, the disclosure of which is incorporated herein by reference. The compounds of this invention may possess one or more unsaturated carbon- carbon double bonds. All double bond isomers, both the cis (Z) and trans (E) isomers, and mixtures thereof are intended to be encompassed within the scope of the present invention.
The term "pharmaceutically acceptable salt" is intended to describe a salt that retains the biological effectiveness of the free acid or base of a specified compound and is not biologically or otherwise undesirable.
If an inventive compound is a base, a desired salt may be prepared by any suitable method known in the art, including treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or with an organic acid, such as acetic acid, trifluoroacetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acid, such as glucuronic acid or galacturonic acid, alpha-hydroxy acid, such as citric acid or tartaric acid, amino acid, such as aspartic acid or glutamic acid, aromatic acid, such as benzoic acid or cinnamic acid, sulfonic acid, such as p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid or the like. Examples of pharmaceutically acceptable salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates succinates, suberates, sebacates, fumarates, maleates, butyne-l,4-dioates, hexyne- 1,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, phenylacetates, phenylpropionates, phenylbutrates, citrates, lactates, γ-hydroxybutyrates, glycollates, tartrates mandelates, and sulfonates, such as xylenesulfonates, methanesulfonates, propanesulfonates, naphthalene- 1 -sulfonates and naphthalene-2-sulfonates.
If an inventive compound is an acid, a desired salt may be prepared by any suitable method known to the art, including treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary, or tertiary), an alkali metal or alkaline earth metal hydroxide, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids such as glycine and arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as ethylene diamine, dicyclohexylamine, ethanolamine, piperidine, morpholine, and piperazine, as well as inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Particular pharmaceutically acceptable salts of a compound of Formulas I, II, III or IV include the sodium salt and the potassium salt.
Because the compounds of this invention may contain both acid and base moieties, pharmaceutically acceptable salts may be prepared by treating these compounds with an alkaline reagent or an acid reagent, respectively. Accordingly, this invention also provides for the conversion of one pharmaceutically acceptable salt of a compound of this invention, e.g., a hydrochloride salt, into another pharmaceutically acceptable salt of a compound of this invention, e.g., a sodium salt. The term "solvate" is intended to mean a pharmaceutically acceptable solvate form of a specified compound that retains the biological effectiveness of such compound. Examples of solvates include compounds of the invention in combination with water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine. In the case of compounds, salts, or solvates that are solids, it is understood by those skilled in the art that the inventive compounds, salts, or solvates may exist in different crystal forms, all of which are intended to be within the scope of the present invention and specified formulas. Also included within the scope of this invention are prodrugs of the compounds of this invention. The term "prodrug" is intended to mean a compound that is converted under physiological conditions, e.g., by solvolysis or metabolically, to a compound of Formulas I, II, III or IV, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. A prodrug may be a derivative of one of the compounds of this invention that contains, for example, a carboxylic acid ester or amide moiety or an enol-ester moiety that may be cleaved under physiological conditions. A prodrug containing such a moiety may be prepared according to conventional procedures, for example, by treatment of a compound of Formula I, containing an amino, amido or hydroxyl moiety with a suitable derivatizing agent, for example, a carboxylic acid halide or acid anhydride, or by converting a compound of Formula I, containing a carboxyl moiety to an ester or amide or by converting a compound of Formula I, containing a carboxylic acid ester moiety to an enol-ester. Prodrugs of the compounds of this invention may be determined using techniques known in the art, for example, through metabolic studies. See, e.g., "Design of Prodrugs," (H. Bundgaard, Ed.) 1985, Elsevier Publishers B.V., Amsterdam, The Netherlands.
The present invention is directed to a method of inhibiting an RNA-containing virus which comprises contacting the virus with an effective amount of a compound of Formulas I, II, III or IV. This invention is also directed to a method of treating infection or disease caused by an RNA-containing virus comprising administering to a subject in need thereof, an effective amount of the compound of Formulas I, II, III or IV. Specifically, this invention is directed to a method of inhibiting HCV activity, comprising contacting the virus with an effective amount of a compound of Formulas I, II, III or IV, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. For example, HCV activity may be inhibited in mammalian tissue by administering to a subject in need thereof a compound of Formula I or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
A therapeutically "effective amount" is intended to mean that amount of a compound that, when administered to a mammal in need of such treatment, is sufficient to effect treatment, as defined herein. Thus, e.g., a therapeutically effective amount of a compound of Formula I or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof is a quantity of an inventive agent that, when administered to a mammal in need thereof, is sufficient to modulate or inhibit the activity of HCV such that a disease condition which is mediated by that activity is reduced, alleviated or prevented. The amount of a given compound that will correspond to such an amount will vary depending upon factors such as the particular compound (e.g., the potency (IQ0), efficacy (EQ0), and the biological half-life of the particular compound), disease condition and its severity, the identity (e.g., age, size and weight) of the mammal in need of treatment, but can nevertheless be routinely determined by one skilled in the art. Likewise, the duration of treatment and the time period of administration (time period between dosages and the timing of the dosages, e.g., before/with/after meals) of the compound will vary according to the identity of the mammal in need of treatment (e.g., weight), the particular compound and its properties (e.g., pharmaceutical characteristics), disease or condition and its severity and the specific composition and method being used, but can nevertheless be determined by one of skill in the art.
In addition, this invention is directed to a method for inhibiting replication of hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises contacting a cell infected with said virus with an effective amount of a compound of Formulas I, II, III or IV. This invention is also directed to a method of treating infection or disease caused by hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises administering to a subject in need thereof, an effective amount of a compound of Formulas I, II, HI or IV. More specifically, this invention is directed to a method of inhibiting replication of both positive and negative strand HCV-RNA with a compound of Formulas I, II, III or IV, wherein the compounds demonstrate substantially equal inhibition of positive strand HCV-RNA replication and negative strand HCV-RNA replication. That is, for a given compound of this invention, the IQ0 for inhibition of positive strand HCV-RNA replication is not statistically different (less than a 2-fold difference) from the IQ0 for inhibition of negative strand HCV-RNA replication. Generally, the compounds of this invention demonstrate an IQ0 for inhibition of positive strand HCV-RNA replication that is +30% the IQo for inhibition of negative strand HCV-RNA replication.
"Treating" or "treatment" is intended to mean at least the mitigation of a disease condition (acute, chronic, latent, etc.) in a subject (a mammal, such as a human), where the disease condition is caused by an infectious RNA-containing virus. The methods of treatment for mitigation of a disease condition include the use of the compounds in this invention in any conventionally acceptable manner, for example for prevention, retardation, prophylaxis, therapy or cure of a disease. The compounds of Formula I, Formula II and Formula Ul of this invention are particularly useful for the treatment of acute, chronic or latent HCV diseases, such as acute and chronic hepatitis infection, hepatocellular carcinoma, liver fibrosis, or other HCV-related diseases. The compounds of Formula I, Formula II and Formula HI of this invention may also be useful for treatment of diseases caused by infectious RNA-containing viruses other than HCV, including, but not limited to, Dengue, HIV or picornaviruses. Chronic fatigue syndrome is another disease that may be treatable using the compounds of this invention. An inventive compound of Formulas I, II, III or IV, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof may be administered to a subject as a pharmaceutical composition in any pharmaceutical form that is recognizable to the skilled artisan as being suitable. Suitable pharmaceutical forms include solid, semisolid, liquid, or lyophilized formulations, such as tablets, powders, capsules, suppositories, suspensions, liposomes, and aerosols. Pharmaceutical compositions of the invention may also include suitable excipients, diluents, vehicles, and carriers, as well as other pharmaceutically active agents, depending upon the intended use or mode of administration. Administration of a compound of the Formulas I, II, III or IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, may be performed according to any of the generally accepted modes of administration available to those skilled in the art. The compounds of this invention may be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, topical, transdermal, or transmucosal administration. For systemic administration, oral administration is preferred. For oral administration, for example, the compounds can be formulated into conventional oral dosage forms such as capsules, tablets and liquid preparations such as syrups, elixirs and concentrated drops. Alternatively, injection (e.g., parenteral administration) may be used, e.g., intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the compounds of the invention are formulated in liquid solutions, preferably, in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution. The compounds of the invention may also be formulated in liposome-containing preparations, particularly liposome-containing preparations useful for delivery of the compounds of this invention to the liver or potentially to nonhepatic reservoirs of infection. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms can also be produced. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration, for example, may be through nasal sprays, rectal suppositories, or vaginal suppositories. For topical administration, the compounds of the invention can be formulated into ointments, salves, gels, or creams, as is generally known in the art.
Compositions containing a compound of Formulas I, II, IE or IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which are active when given orally can be formulated as syrups, tablets, capsules and lozenges. A syrup formulation will generally consist of a suspension or solution of the compound or salt in a liquid carrier for example, ethanol, peanut oil, olive oil, glycerine or water with a flavoring or coloring agent. Where the composition is in the form of a tablet, any pharmaceutical carrier routinely used for preparing solid formulations may be used. Examples of such carriers include starch, calcium sulfate dihydrate, magnesium stearate, terra alba, talc, gelatin, acacia, stearic acid, starch, lactose and sucrose. Where the composition is in the form of a capsule, any routine encapsulation is suitable, for example using the aforementioned carriers in a hard gelatin capsule shell. Where the composition is in the form of a soft gelatin shell capsule, any pharmaceutical carrier routinely used for preparing dispersions or suspensions may be considered, for example aqueous gums, celluloses, silicates or oils, and may be incorporated in a soft gelatin capsule shell.
Typical parenteral compositions consist of a solution or suspension of a compound or salt in a sterile aqueous or non-aqueous carrier optionally containing a parenterally acceptable oil, for example polyethylene glycol, polyvinylpyrrolidone, lecithin, arachis oil or sesame oil.
Typical compositions for inhalation are in the form of a solution, suspension or emulsion that may be administered as a dry powder or in the form of an aerosol using a conventional propellant such as dichlorodifluoromethane or trichlorofluoromethane. A typical suppository formulation comprises a compound of Formulas I, II, III or
IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which is active when administered in this way, with a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other low melting vegetable waxes or fats or their synthetic analogs. Typical dermal and transdermal formulations comprise a conventional aqueous or non-aqueous vehicle, for example a cream, ointment, lotion or paste or are in the form of a medicated plaster, patch or membrane.
Preferably the composition is formulated and administered in a unit dosage form. For oral application, for example, one or more tablets or capsules may be administered, for nasal application, a metered aerosol dose may be administered, for transdermal application, a topical formulation or patch may be administered and for transmucosal delivery, a buccal patch may be administered. A dose of the pharmaceutical composition contains at least a therapeutically effective amount of the active compound (i.e., a compound of Formulas I, II, Ul or IV, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof). The selected dose may be administered to a mammal, for example, a human patient, in need of treatment mediated by inhibition of HCV activity by any known or suitable method of administering the dose, including: topically, for example, as an ointment, or cream, orally, rectally, for example, as a suppository, parenterally by injection, or continuously by intravaginal, intranasal, intrabronchial, intraaural, or intraocular infusion. Treatment of all forms of infection or disease (acute, chronic, latent etc) or as prophylaxis with these compounds (or their salts etc.) may be achieved using the compounds of this invention as a monotherapy, in dual or multiple combination therapy, such as in combination with other antivirals, in combination with an interferon, in combination with an interferon and ribavirin or levovirin, or in combination with one or more agents which include but are not limited to: immunomodulatory agents (such as cytokines, suppressors of cytokines and/or cytokine signalling, or immune modifiers, adjuvants and the like), immunomodulatory agents that enhance the body's immune system (such as vitamins, nutritional supplements, antioxidant compositions, vaccines or immunostimulating complexes, such as vaccines comprising a multimeric presentation of an antigen and adjuvant), other direct antiviral agents, indirect antiviral agents or agents which target viral RNA and impair translation or replication or modulate signalling or cellular host factors, or host- viral interface, immunoglobulins, antisense agents against HCV, peptide-nucleic acid conjugates, oligonucleotides, ribozymes, polynucleotides, anti-inflammatory agents, pro- inflammatory agents, antibiotics, hepatoprotectants, or any anti-infectious agents and the like, or combinations thereof. Moreover, the additional agents may be combined with the compounds of this invention to create a single dosage form. Alternatively, these additional agents may be separately administered as part of a multiple dosage form. As used herein the term "an interferon" is intended to mean any form of interferon, which includes, but is not limited to, natural or recombinant forms of alpha, beta or gamma interferons, albumin-linked interferons, or pegylated interferons.
Representative compounds of this invention include the compounds of the Examples described herein, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. Representative of preferred compounds of this invention comprise the following: (Z)-2-acetylamino-3-{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-
3-yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl} aery lie acid methyl ester;
6-fluoro-4-hydroxy-3-(8-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3- yl)-l-(3-methylbutyl)-lH-quinolin-2-one;
2-{3-[6-fluoro-4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy } acetamide;
2- { 5-chloro-3-[ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydro- quinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-8-yloxy } acetamide ;
3- { 5 -chloro-3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2- dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-8-yloxy } -acrylamide; 1 -(2-cyclopropylethyl)-3-( 1 , 1 -dioxo-6-trifluoromethyl- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy-lH-quinolin-2-one; l-(2-cyclopropylethyl)-3-[ 1 , l-dioxo-7-(5-oxo-4,5-dihydro-isoxazol-3-yl)- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one;
2-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydro-quinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-8-yloxy}acetamide; carbamic acid, 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl]- 1 , 1 -dioxo-1 ,4-dihydro-benzo[ 1 ,2,4]thiadiazin-7-yl, methyl ester,
2-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-7-yloxy } acetamidine, 3-[ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazine-7-carboxamidine,
4-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-2,4-dioxobutyric acid, methyl ester,
3-( 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-3-yl)-4-hy droxy- 1 -(3- methylbutyl)-8-nitro-lH-quinolin-2-one; or l-(2-cyclopropyl-ethyl)-3-[l,l-dioxo-7-(2-oxo-pyrrolidin-3-yloxy)-l,4-dihydro- benzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
GENERAL SYNTHETIC METHODS
This invention is also directed to methods for the synthesis of the compounds of Formula I and tautomers thereof.
Included in the present invention is a process according to Scheme 1 for the synthesis of the compounds:
Scheme 1
Figure imgf000034_0001
Conditions: i. phosgene, THF; ii. peracetic acid, AcOH; iii. W-X, NaH, DMA or W-OH, PPh3, DIAD, THF; iv. NaH, THF, reflux or DBU, THF, 40-45°C; v. AcOH, reflux or acetic acid, then HCI.
An appropriately substituted 2-aminobenzoic acid (a) such as 2-amino-5- fluorobenzoic acid, 2-amino-5-tert-butyldimethylsilyloxybenzoic acid or 2-amino-5- methylbenzoic acid can be treated with phosgene or a phosgene equivalent such as triphosgene or ethyl chloroformate in an appropriate solvent such as tetrahydrofuran to afford the benzo[J][l,3]oxazines (b). Alternatively, an indole-2,3-dione (c) such as 4- bromoindole-2,3-dione may be oxidised with a peracid such as peracetic acid to afford the benzo[J|[l,3]oxazines (b). The benzo[J][l,3]oxazines (b) such as 1H- benzo[J|[l,3]oxazine-2,4-dione, 6-methyl-lH-benzo[J][l,3]oxazine-2,4-dione or 6-fluoro- lH-benzo[J|[l,3]oxazine-2,4-dione may be alkylated with an appropriate alkylating agent such as 3-methyl-l-bromobutane, benzyl bromide or (bromomefhyl)cyclopropane in the presence of an appropriate base such as potassium carbonate or sodium hydride in an appropriate solvent such as tetrahydrofuran, dimethylacetamide or dimethylformamide to afford the N-alkylated lH-benzo[J|[l,3]oxazine-2,4-dione (d). Alternatively, compounds (d) can be prepared by the alkylation of benzo[J|[l,3]oxazines (b) in a Mitsunobu reaction with an appropriate alcohol such as 2-cyclopropylethanol, 3,3-dimethylbutanol, 2-furancarbinol or 4-pyridinylcarbinol in the presence of a phosphine such as triphenylphosphine and an azodicarboxylate such as diethyl azodicarboxylate or diisopropyl azodicarboxylate in a solvent such as tetrahydrofuran. Compounds of Formula I may be prepared by the coupling of N-alkylated benzo[<fj[l,3]oxazines (d) with an appropriate thiadiazine such as ethyl l,l-dioxo-2H-benzo-l,2,4-thiadiazinyl-3-acetate, methyl (7- bromo-l,l-dioxo-l,2-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate or ethyl (l,l-dioxo-7- hydroxy-l,2-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate in the presence of a base such as sodium hydride or DBU (l,8-diazabicyclo[5.4.0]undec-7-ene) in an appropriate solvent such as dimethylformamide, dimethylacetamide or tetrahydrofuran followed by acidification with an acid such as acetic acid or acetic acid followed by hydrochloric acid.
Also included in the present invention is a process according to Scheme 2:
Scheme 2
Figure imgf000036_0001
Conditions: i. methyl cyanoacetate, NaH, DMF; ii. NH4C1, AlMe3, THF; iii. 2- chloro-5-nitrobenzenesulfonyl chloride, NaH, THF; iv. 2- aminobenzenesulfonamide, AlMe3, THF
A benzo[d][l,3]oxazine-2,4-dione (f) such as l-(3-methylbutyl)-lH- benzo[d][l,3]oxazine-2,4-dione can be treated with a cyanoacetate such as methyl cyanoacetate or ethyl cyanoacetate in the presence of an appropriate base such as sodium hydride in an appropriate solvent such as tetrahydrofuran or dimethylformamide then acidified with an acid such as acetic acid to afford the 3-cyanoquinolines (g). These cyano compounds (g) may be then condensed with an appropriate 2-aminobenzenesulfonamide such as 2-aminobenzenesulfonamide, 2-amino-5-chlorobenzenesulfonamide or 2-amino-4- bromobenzenesulfonamide in the presence of trimethylaluminum in an appropriate solvent such as dioxane, toluene or tetrahydrofuran to afford the compounds of Formula I. Alternatively, compounds (g) may be treated with ammonium chloride and triethylaluminum in an appropriate solvent such as toluene or dioxane to give amidines (h) which may then be coupled with an appropriate 2-chlorobenzenesulfonyl chloride such as 5- nitro-2-chlorobenzenesulfonyl chloride in the presence of a base preferably sodium hydride to give compounds of Formula I.
Also included in the present invention is a process according to Scheme 3:
Scheme 3
Figure imgf000037_0001
Conditions: i) C1S02-N=C=0, nitroethane; then A1C13; ii) aqu. H2S04, heat; iii) ethyl chloromalonate, pyridine; or ethyl chloromalonate, triethylamine, THF, 4°C; or diethyl malonate, heat; iv) P0C13 (neat), reflux; or Na2C03, water or CsC03, ethanol, 77°C; v) NaH, THF, reflux then AcOH, reflux or DBU, THF, 40-45°C, then acetic acid, then HCI.
An aniline (j) such as 4-methoxyaniline or 2-methylaniline can be treated with chlorosulfonylisocyanate in an appropriate solvent such as nitroethane then treated with a acid such as aluminum trichloride to give the cyclized compound (k). Compound (k) can be hydrolysed with an aqueous acid such as aqueous sulfuric acid to afford the 2- aminobenzenesulfonamides (1). Amides (m) can be formed by treating amines (1) with ethyl chloromalonate in the presence of a base such as pyridine, triethylamine or pyridine in a solvent such as tetrahydrofuran or dichloromethane. Cyclisation of amides (m) to afford thiadiazines (n) may occur on treatment with a dehydrating agent, such as phosphorus oxychloride, either neat or in a solvent, such as toluene, or with a base, such as sodium carbonate, cesium carbonate or sodium bicarbonate, in a solvent, such as water or aqueous ethanol. Condensation of the thiadiazines (n) with benzo[J][l,3]oxazines as described in Scheme 1 provides compounds of Formula I.
Also included in the present invention is a process according to Scheme 4:
Scheme 4
Figure imgf000038_0001
Conditions: i. BBr3, DCM then EtOH, H2S04; ii. benzo[J|[l,3]oxazine, NaH, THF then AcOH; iii. R-Br, NaH.
7-Methoxythiadiazines (p) can be treated with a demethylation reagent, such as boron tribromide or hydrobromic acid, in an appropriate solvent, such as dichloromethane or acetic acid, and any ester hydrolysis product may then be re-esterified by treatment with an alcohol, such as ethanol in the presence of an acid, such as sulfuric acid, to give the 7- hydroxy compounds (q). Compounds (q) may be coupled with benzo[J][l,3]oxazines as described in Scheme 1 to gives hydroxy compounds of Formula I. The free hydroxyl group may then be optionally treated with an alkylating agent, such as bromoacetamide or bromoacetonitrile, in the presence of a base such as sodium hydride or potassium carbonate to give alkylated compounds of Formula I.
Alternate methods for preparing the N-alkylated lH-benzo[J][l,3]oxazine-2,4-dione (d) are shown in Scheme 5 and Scheme 6.
Scheme 5
Figure imgf000039_0001
(a) (0 (d)
Conditions: i. W-CHO, NaBH4. THF; ii. triphosgene, THF
One alternate method for the preparation of the N-alkylated 1H- benzo[<f|[l,3]oxazine-2,4-dione (d), shown in Scheme 5, comprises treating the 2-aminobenzoic acid (a) under reductive amination conditions by treating the 2- aminobenzoic acid with an appropriate aldehyde (W-CΗO) in the presence of an appropriate reducing agent, such as sodium borohydride, sodium cyanoborohydride or diborane, in a suitable solvent such as tetrahydrofuran or dichloromethane, to form the N-akylated 2- aminobenzoic acid (r). Treatment of the N-akylated 2-aminobenzoic acid (r) with phosgene or a phosgene equivalent such as triphosgene or ethyl chloroformate in an appropriate solvent such as tetrahydrofuran, as described above, provides the N-alkylated 1H- benzo[J|[l,3]oxazme-2,4-dione (d).
Scheme 6
Figure imgf000039_0002
(s) (r) (d)
Conditions: i. W-NΗ2, 6 mol% CuBr2,K2C03, THF, 63°C; ii. triphosgene, THF
Scheme 6 illustrates an alternate method for the preparation of the intermediate N-akylated 2-aminobenzoic acid (r) by coupling of a 2-halobenzoic acid (s), such as a 2-bromobenzoic acid or a 2-chlorobenzoic acid, with an N-substituted amine (W-NH2) in the presence of an appropriate copper catalyst, for example copper (II) bromide, in the presence of a suitable base, such as potassiuim carbonate or triethylamine, in an appropriate solvent such as tetrahydrofuran or dimethylformamide. Conversion of the N-akylated 2- aminobenzoic acid (r) to the N-alkylated lH-benzo[ |[l,3]oxazine-2,4-dione (d). may be accomplished as described above.
Optionally, a salt of a compound of Formula I, prepared using any of the methods described in Schemes 1-6 above, may be prepared by treating the compound with an appropriate base, such as sodium hydroxide or potassium hydroxide, in an appropriate solvent, such as water or water and methanol.
Also included within the scope of the present invention are intermediate compounds that are useful for the preparation of the compounds of Formulas I, II, Ul and/or IV. Such useful intermediate compounds include: 3- [(7-(2-bromoethanoyl)- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl] -6- fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one, 3-[(7-(2-bromoethanoyl)-l,l- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl] - 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy- lH-quinolin-2-one, N-(sulfamoyl-4-trifluoromethylphenyl)-2-malonamic acid ethyl ester, (l,l-dioxo-6-trifluoromethyl-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
The activity of the inventive compounds as inhibitors of ΗCV activity may be measured by any of the suitable methods known to those skilled in the art, including in vivo and in vitro assays. For example, the ΗCV NS5B inhibitory activity of the compounds of Formulas I, π, HI and IV was determined using standard assay procedures described in Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001). Unless otherwise noted, the compounds of this invention have demonstrated in vitro HCV NS5B inhibitory activity in such standard assays and have IQ0's in the range of 0.0001 μM to 100 μM. Representative compounds of Formula I, Examples 10-20, 60-75, 110-120, 130-139, and 141-160 have all demonstrated in vitro HCV NS5B inhibitory activity and have IQ0's in the range of
0.0005 μM to 3 μM. Recently, cell-based replicon systems for HCV have been developed, in which the nonstructural proteins stably replicate subgenomic viral RNA in Huh7 cells (Lohmann et al., Science (1999) and Blight et al., Science (2000). In the absence of a purified, functional HCV replicase consisting of viral non-structural and host proteins, our understanding of Flaviviridae RNA synthesis comes from studies using active recombinant RdRps and validation of these studies in the HCV replicon system. Inhibition of recombinant purified HCV polymerase with compounds in in vitro biochemical assays may be validated using the replicon system whereby the polymerase exists within a replicase complex, associated with other viral and cellular polypeptides in appropriate stoichiometry. Demonstration of cell-based inhibition of HCV replication may be more predictive of in vivo function than demonstration of HCV NS5B inhibitory activity in in vitro biochemical assays.
Advantageously, the compounds of this invention inhibit both positive and negative strand HCV-RNA replication. The following methods have been developed and used for determining the positive and negative strand HCV-RNA replication inhibition activity of the compounds of this invention.
Test Method 1 Method for positive strand replicon HCV-RNA detection in replicon cells Replicon cells were plated at 3 X 103 cells per well in a 96-well plate plates at 37° and
5% C02 in DMEM (Dulbecco's Minimal Essential Medium) containing 10% FCS (fetal calf serum), 1% NEAA (nonessential amino acids) and 1 mg/ml Geneticin (G418 neomycin). After allowing 4 h for cell attachment, 1 μl of a solution of candidate antiviral agent was added to the medium (n = 8 wells per dilution). Briefly, eleven 2.5-fold dilutions of 1 mM stock test compound in DMSO (dimethylsulfoxide) were prepared with final concentration ranging from 10000 nM to 1.0 nM. Plates were incubated for 40 h, until reaching 80% confluence. After removal of medium, 150 μl Buffer RLT (Qiagen, Valencia, California, US) was added to each well and RNA purified according to manufacturer's recommendations (Qiagen RNAeasy) and were eluted twice in 45 μl dH20 prior to RT-PCR. Approximately 40 μl of TaqMan EZ RT-PCR (Applied Biosystems, Foster City, California, US) master mix (IX TaqMan EZ Buffer, 3 mM Mn(OAc)2, 0.3 mM dATP, 0.3 mM dCTP, 0.3 mM dGTP, 0.6 mM dUTP, 0.2 mM neo-forward, 0.2 mM neo-reverse, 0.1 mM neo-probe, IX Cyclophilin Mix, 0.1 Unit/μl rTth DNA Polymerase, 0.01 Unit/μl AmpErase UNG, and H20 to 40 μl) was added to each tube of 96-tube optical plate along with 10 μl of RNA elution. Primers and probes specific for the positive strand RNA detection of neomycin gene were: neo-forward: 5'CCGGCTACCTGCCCATTC3' (SEQ ID NO 1); neo-reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 2); neo-probe: 5'FAM- ACATCGCATCGAGCGAGCACGTAC-TAMRA3' (SEQ ID NO 3). For negative strand RNA detection, the cDNA primer used was 5 ACA TGC GCG GCA TCT AGA CCG GCT ACC TGC CCA TTC3' (SEQ ID NO 4) whereby the first 18 bases represent SEQ ID NO 5 linked to neo sequences; neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 6); neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ ID NO 3). Additionally, the PDAR control reagent human cyclophilin was used for normalization. Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 60°C, 30 min; and 95°C, 5 min, with cycling parameters set to 94°C, 20 s; 55°C, 1 min for 40 cycles. The relative cDNA levels for neo and cyclophilin were determined compared to DMSO-only treated controls and the ratio of neo: cyclophilin was used for IQ0 calculation (n = 8).
Test Method 2
Method for negative strand replicon HCV-RNA detection in replicon cells
To achieve strand-specific detection, a primer containing HCV RNA (or replicon RNA sequences such as neomycin gene) and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction, 5ΑCATGCGCGGCATCTAGACCGGCTACCTGCCCATTC3' (SEQ ID NO 4). A
Thermoscript-RT-PCR system (Invitrogen) was used for the RT reaction according to the manufacturer's protocol, with approximately 9 μl of the cell-harvested RNA and 1 μl of primer (10 μM) incubated with RT at 60°C for 1 h. Following that incubation, 2 μl of cDNA product containing the 5' tag was amplified for TaqMan quantification using the 48 μl of TaqMan Universal Master Mix (Applied Biosystems) as well as primers, neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse:
5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 6); and neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ ID NO 3). Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 95°C, 10 min, with cycling parameters set to 94°C, 15 s; 55°Q 1 min for 40 cycles. The negative strand copy number in each reaction was determined using linear regression analysis based on the slope and intercept generated with a negative strand copy standard curve. The negative strand copies per cell were determined by dividing the total negative strand copies per reaction by the total cells per reaction. Through routine experimentation, including appropriate manipulation and protection of any chemical functionality, synthesis of the compounds of Formulas I, II, Ul and IV is accomplished by methods analogous to those above and to those described in the following Experimental section. Example 1 N'-[3-(7-Cyanomethoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3- methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-6-yl] -N,N-dimethylf ormamidine a) 1 -(3-Methylbutyl)-6-nitrobenzo [d] [ 1 ,3]oxazine-2,4-dione : 6-Nitro- 1H- benzo[Jj[l,3]oxazine-2,4-dione (1.4 g, 6.7 mmol) was added portionwise to a suspension of sodium hydride (60% suspension in mineral oil) (300 mg, 7.5 mmol) in anhydrous dimethylformamide. After 15 min, l-bromo-3-methylbutane (0.82 mL, 6.7 mmol) was added and the mixture was stirred at 70°C for 6h, then at room temperature for 72h. The mixture was poured onto ice, acidified with acetic acetate, extracted into ethyl acetate and purified by chromatography (silica gel, 20% ethyl acetate in hexanes) to give the title compound (800 mg, 43%). Η NMR (300MHz, d6-DMSO) δ 8.62 (m, 1H), 8.58 (dd,
1H), 7.63 (d, 1H), 4.04-4.12 (m, 2H), 1.65-1.81 (m, 1H), 1.50 (m, 2H), 0.95 (d, 6H). b) 6-Amino-l-(3-methylbutyl)benzo[J|[l,3]oxazine-2,4-dione: A solution of l-(3- methylbutyl)-6-nitrobenzo[<f|[l,3]oxazine-2,4-dione (0.700 g, 2.52 mmol) in ethyl acetate/methanol (2:1, 15 mL) was stirred with palladium-on-charcoal (5%, 0.100 g, 0.047 mmol) under 1 atmosphere of hydrogen for lh. The hydrogen was removed and the mixture filtered through a pad of Celite®. The filtrate was evaporated under r duced pressure. The residue was dissolved in dichloromethane/methanol and ether added to precipitate a solid which was filtered, washed (ether) and dried to give the title compound (0.246 mg, 39%) as a solid. !H NMR (400MHz, d6-DMSO) δ 7.17-7.15 (2H, m), 7.10 (1H, dd, 78.9, 2.6 Hz),
5.46 (2H, s), 3.93 (2H, m), 1.69 (1H, m), 1.50 (2H, m), 0.95 (6H, d, 7 = 6.6 Hz). c) 7-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-one: 4-Anisidine (20 g, 162 mmol) in nitroethane (100 mL) was added drop wise to a solution of chlorosulfonyl isocyanate (17 mL, 195 mmol) in nitroethane (150 mL) stirred at -40°C. After 5 min, aluminum chloride (28 g, 210 mmol) was added and the mixture was immediately transferred to an oil bath, previously heated to 110°C. The mixture was stirred at this temperature for 20 min then poured onto ice to give the title compound as a purple solid (24 g, 65%). !H NMR (300MHz, d6-DMSO) δ 11.14 (s, N ), 7.20 (m, 3H), 3.81 (s, 3H). d) 2-Amino-5-methoxybenzenesulfonamide: 7-Methoxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-one (3.2 g, 14 mmol) was heated in 50% sulfuric acid (25 mL) at 130°C until dissolved. The mixture was poured onto ice, neutralized and extracted into ethyl acetate. Evaporation of the solvent gave the title compound (2.0 g, 70%). !H NMR (300MHz, d6-DMSO) δ 7.25 (s, NH2, 2H), 7.11 (d, 7 = 3 Hz, 1H), 6.94 (dd, 7 = 3 and 9 Hz, 1H), 6.77 (d, 7 = 9 Hz, 1H), 5.44 (s, NH2, 2H), 3.67 (s, 3H). e) Ν-(4-Methoxy-2-sulfamoylphenyl)malonamic acid ethyl ester: A mixture of 2- amino-5-methoxybenzenesulfonamide (9.1 g, 45 mmol) and diethyl malonate (14 mL, 92 mmol) were heated together at 160°C for lh. The mixture was cooled and diluted with ether to give the title compound as a solid (8.5 g, 60%). !H NMR (300MHz, d6-DMSO) δ 9.44 (s, NH), 7.75 (d, 7 = 9 Hz, 1H) 7.51 (s, NH2, 2H), 7.37 (d, 7 = 3 Hz, 1H), 7.20 (dd, 7 =
3 and 9 Hz, 1H), 4.14 (q, 2H), 3.81 (s, 3H), 3.57 (s, 2H), 1.23 (t, 3H). f) (7-Methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid, ethyl ester: Ν-(4-Methoxy-2-sulfamoylphenyl)malonamic acid ethyl ester (2.4 g, 7.6 mmol) was heated under reflux in phosphorus oxychloride (50 mL) for 2.5h. The solvent was evaporated and the residue dissolved in ethyl acetate. The solution was neutralized, washed with 2M aqueous hydrochloric acid, dried and evaporated to a solid. Trituration with ether gave the title compound (1.8 g, 79%). !H NMR (300MHz, dg-acetone) δ 11.10 (s, NH), 7.26-7.80 (m, 3H), 4.32 (q, 2H), 3.79 (s, 3H), 3.26 (s, 2H), 1.49 (t, 3H). g) 6-Amino-4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin- 3-yl)- l-(3-methylbutyl)-lH-quinolin-2-one hydrobromide: Sodium hydride (0.080 g of a 60% oil suspension, 2.00 mmol) was added to an ice-cooled, stirred solution of (7-methoxy- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester (0.308 g, 1.03 mmol) and 6-amino-l-(3-methylbutyl)benzo[cf|[l,3]oxazine-2,4-dione (0.245 g, 0.987 mmol) in tetrahydrofuran (10 mL) under argon. After 10 min, the mixture was heated under reflux for 1.5h, then cooled slightly. Acetic acid (1 mL) was added carefully, and the mixture heated under reflux for 0.25h, then cooled and evaporated under reduced pressure. The residue was heated under reflux in acetic acid (15 mL) and 48% aqueous Hydrobromic acid (3.5 mL) for 32h. Water (120 mL) was added slowly to the mixture while cooling to room temperature. The precipitated solid was filtered, washed (water) and dried to give the title compound (0.372 g, 72%) as a solid. JH ΝMR (400MHz, d6-DMSO) δ 14.53 (1H, s),
10.46 (1H, s), 7.60-7.54 (3H, m), 7.41 (1H, dd, 7 = 9.0, 2.4 Hz), 7.20-7.17 (2H, m), 4.30 (2H, m), 1.78 (1H, m), 1.54 (2H, m), 1.00 (6H, d, 7 = 6.6 Hz). h) { 3-[6-Amino-4-hydroxy- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy Jacetonitrile: Sodium hydride (0.016 g of a 60% oil suspension, 0.409 mmol) was added to a stirred solution of 6-amino-4-hydroxy-3- (7-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)- l-(3-methylbutyl)-lH- quinolin-2-one hydrobromide (0.071 g, 0.136 mmol) in dimethylformamide (1 mL). After gas evolution had finished, bromoacetonitrile (0.020 g, 0.163 mmol) was added and the mixture stirred at 60°C in a microwave synthesizer for 15 min, then cooled. Acetic acid (0.3 mL) was added dropwise with stirring followed by water (10 mL). The precipitate was filtered, washed with water and ether and dried to give the title compound (0.057 g, 88%) as a green powder. !H NMR (400MHz, d6-DMSO) δ 14.87 (1H, br s), 7.77 (1H, d, 7 = 9.0
Hz), 7.60 (1H, s), 7.49 (1H, dd, 7 = 9.0, 2.7 Hz), 7.43 (1H, d, 7= 9.1 Hz), 7.31 (1H, d, 7 = 2.4 Hz), 7.23 (1H, d, 7 = 7.3 Hz), 5.55 (2H, br s), 5.37 (2H, s), 4.28 (2H, m), 1.78 (1H, m), 1.53 (2H, m), 1.00 (6H, d, 7 = 6.6 Hz). i) N'-[3-(7-Cyanomethoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-4- hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-6-yl]-N,N-dimethylformamidine: A solution of { 3-[6-amino-4-hydroxy- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetonitrile (0.018 g, 0.037 mmol), N,N- dimethylformamide dimethyl acetal (0.011 g, 0.092 mmol) and p-toluenesulf onic acid monohydrate (0.0015 g, 0.008 mmol) in dimethylformamide (1 mL) was stirred at 100°C for 45 min in a microwave synthesiser, then cooled and diluted slowly with water (10 mL). The mixture was allowed to stand for 18h, then the precipitate filtered, washed with water and ether, and dried to give the title compound (0.016 g, 80%) as a solid. !H NMR (400MHz, d6-DMSO) δ 15.98 (1H, s), 8.63 (1H, s), 8.09 (1H, s), 7.56 (1H, d, 7= 8.7 Hz),
7.39-7.34 (4H, m), 5.30 (2H, s), 4.15 (2H, m), 3.36 (3H, s), 3.19 (3H, s), 1.74 (1H, m), 1.46 (2H, m), 1.00 (6H, d, 7 = 6.5 Hz).
Example 2 3-Ethoxy-3-{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl} acrylic acid ethyl ester a) (7-Iodo-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester:
2-Amino-5-iodo-benzenesulfonamide (20.0 g, 67.1 mmol), pyridine (5.3 g, 67.1 mmol), and ethylchloromalonate (10.0 g, 67.1 mmol) were dissolved in methylene chloride (250 mL) and stirred for 18h at room temperature. Ethyl acetate (100 mL) and 1M aqueous hydrochloric acid were added and the resulting slurry filtered. The filtered solid was washed with water and ether then air-dried. The resulting white solid was heated under reflux in neat POCl3 (60 mL) for lh. The phosphorous oxychloride was removed in vacuo. The crude reaction slurry was diluted with ethyl acetate (150 mL), poured onto ice (200 g), and brought to pH=5 with sodium bicarbonate. The resulting precipitate was filtered and washed with ethyl acetate and ether to give the title compound as an off-white solid (11.01 g, 45%).1H NMR (d6-DMSO) δ 12.4 (br s, IH), 8.0 (m, 2H), 7.1 (m, IH), 4.2 (q, 2H), 3.7
(s, 2H), 1.15 (t, 3H). MS(ES+) m/e 395 [M+H]+. b) 4-Hydroxy-3-(7-iodo- 1 , 1-dioxo- 1 ,4-dihydro- l/ benzo[ 1 ,2,4]thiadiazin-3-yl)- 1- (3-methylbutyl)-lH-quinolin-2-one: Sodium hydride (1.01 g. of a 60% oil dispersion, 25.3 mmol) was added to a stirred suspension of l-(3-methylbutyl)-lH-benzo[J][l,3]oxazine- 2,4-dione (1.18 g, 5.08 mmol) and (7-Iodo-l, 1-dioxo- 1,4-dihy drobenzo[l, 2,4]thiadiazin-3- yl)-acetic acid ethyl ester (2.0 g, 5.08 mmol) in dry tetrahydrofuran (15 mL). The mixture was stirred under reflux for lh, cooled, and acetic acid (2 mL) added. The mixture was heated under reflux for lh, cooled, and poured into 1.0M aqueous hydrochloric acid. The precipitate was filtered, washed with hexanes and ether, then dried to give the title compound as an off white solid (1.88 g, 69%). *Η NMR (d6-DMSO) δ 15.0 (br s, IH), 14.4 (br s, IH), 8.15 (m, 2H), 8.05 (m, IH), 7.85 (m, IH), 7.75 (m, IH), 7.7 (m, IH), 7.4 (m, IH),
4.4 (t, 2H), 1.7 (m, IH), 1.5 (m, 2H), 1.0 (s, 3H), 0.99 (s, 3H). MS(ES+) m/e 538 [M+H]+. c) 3-Ethoxy-3-{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-acrylic acid ethyl ester: The product of example 2b) (200 mg, 0.372 mmol), ethyl-3-ethoxyacrylate (80.6 μL, 0.558 mmol), 5% palladium on carbon (100 mg), and potassium carbonate (56 mg, 0.409 mmol) in acetonitrile (3 mL) were place in a sealed tube and heated at 120°C for 12h. After to cooling to room temperature the reaction mixture was diluted with water (15 mL) and extracted with chloroform (20 mL) and ethyl acetate (20 mL). The organic layers were combined, dried over magnesium sulfate, filtered and concentrated. Purification by column chromatography (silica gel, 1% methanol in chloroform) gave the title compound as a yellow solid (43.3 mg, 21%) as a mixture of cis/trans isomers. !H NMR (CDC13) δ 15.04 and 14.95 (2s, IH), 14.69 and 14.55 (2s, IH), 8.20 and 8.18 (2dd, 7 = 5.0 and 1.5 Hz, IH,); 8.13 and 8.0 (2d, 7= 1.77 Hz, IH), 7.75 (dd, 7 = 8.6 and 2.0 Hz, IH), 7.68-7.59 (m, 1.5H), 7.33, 7.31 and 7.18 (3d, 7 = 4.0 Hz , 1.5H), 7.29-7.20 (m, 1.5H), 5.66 and 5.23 (2s, IH), 4.24 (t, 2H), 4.14 and 4.10 (2q, 7 = 7.1 Hz, 2H), 3.99 and 3.95 (2q, 7= 7.1 Hz, 2H), 1.75 (m, IH), 1.55 (m, 2H), 1.40 (m,
3H) 1.26 and 1.11 (2t, 7 = 7.1 Hz, 3H) 1.0 (d, 7= 6.8 Hz, 6H), MS(ES+) m/e 554 [M+H]+.
Example 3
(rac)-2-Acetylamino-3-{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-acrylic acid methyl ester
The product of example 2b) (200 mg, 0.372 mmol), methyl-2-acetamidoacrylate (80.0 mg, 0.558 mmol), 5% palladium on carbon (100 mg), and potassium carbonate (56 mg, 0.409 mmol) in acetonitrile (3 mL) were place in a sealed tube and heated at 120°C for 12h. After to cooling to room temperature the reaction mixture was diluted with water (15 mL) and extracted with chloroform (20 mL) and ethyl acetate (20 mL). The organic layers were combined, dried over magnesium sulfate, filtered and solvent removed in vacuo. Purification by column chromatography (silica gel, 1% methanol in chloroform) gave the title compound as a yellow solid (26.0 mgl3%) as a mixture of cis/trans isomers. !H NMR (CDC13) δ 15.02 (br s, IH), 14.63 (s, IH), 8.20 (dd, 7 = 8.0 and 1.6 Hz, IH,); 7.9 (s, IH), 7.69 (m, IH), 7.56 (d, 7= 8.3, IH), 7.33, (d, 7= 8.4 Hz , IH), 7.27 (t, 7= 8.0 Hz, IH), 7.22 (d, 7 = 8.4 Hz, IH) 6.5 and 5.8 (2s, IH), 4.27 (t, 2H), 3.9 and 3.8 (2s, 3H), 3.7 and 3.6 (2s, 3H), 1.75 (m, IH), 1.55 (m, 2H), 1.6 and 1.2 (2br s, IH) 1.0 (d, 7 = 6.6 Hz, 6H), MS(ES+) m/e 553 [M+H]+.
Example 4 6-Fluoro-4-hydroxy- 1 -(3-methylbutyl)-8-nitro-3-(7-nitro- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one a) 6-Fluorobenzo[J][l,3]oxazine-2,4-dione: A solution of 5-fluoroanthranilic acid (1.0 g, 6.44 mmol) in tetrahydrofuran (20 mL) was treated with a 20 % solution of phosgene in toluene (4.0 mL) and stirred for 12h. Saturated sodium hydrogen carbonate solution was added and the mixture extracted with ethyl acetate. Evaporation of the organic layer gave the title compound that crystallised from diethyl ether. The product was filtered, washed with diethyl ether and hexanes, (960 mg, 82%). *H NMR (300MHz, CDCI3) δ 11.81 (s,
NH), 7.70 (m, 2H), 7.67 (m, IH). b) l-(3-Methylbutyl)-6-fluorobenzo[J|[l,3]oxazine-2,4-dione: The compound from Example 4a (940 mg, 5.2 mmol) was added portionwise to a suspension of sodium hydride (60% suspension in mineral oil) (240 mg, 6.0 mmol) in anhydrous dimethylformamide.
After 30 min, l-bromo-3-methylbutane (0.9 ml, 7.1 mmol) was added and the mixture was stirred at 80°C for 16h. The mixture was poured onto ice, acidified with acetic acid, and extracted into ethyl acetate. The title compound crystallized from hexanes (380 mg, 23%). Η ΝMR (300MHZ, d6-DMSO) δ 7.72-7.81 (m, 2H), 7.47-7.51 (m, IH), 4.02 (m, 2H) 1.73 (m, IH), 1.54 (m, 2H) 0.96 (d, 7 = 6.5 Hz, 6H). c) 3-( 1 , 1 -Dioxo- 1 ,2-dihydrobenzo[ 1 ,2,4] thiadiazin-3-yl)-6-fmoro-4-hydroxy- 1-(3- methylbutyl)-lH-quinolin-2-one: Sodium hydride (130 mg of a 60% suspension in mineral oil, 3.25 mmol) was added to a mixture of l-(3-methylbutyl)-6-fluorobenzo[_fl[l,3]oxazine- 2,4-dione (250 mg, 0.8 mmol) and ethyl l,l-dioxo-2H-benzo-l,2,4-thiadiazinyl-3-acetate (215 mg, 0.8 mmol) in tetrahydrofuran (15.0 mL). The mixture was heated under reflux for 1.5h, cooled and acidified with acetic acid. The mixture was then heated under reflux for an additional 1.5h, cooled and water added. The product was collected, washed with water, diethyl ether and hexanes to give the title compound (220 mg, 64%). !H NMR (300MHz, d6-DMSO) δ 15.10 (br s, IH), 14.21 (s, IH), 7.93 (d, 7= 7 Hz, IH), 7.59-7.54 (m, 5H) 7.55
(dd, IH), 4.29 (m, 2H),1.78 (m, IH), 1.52 (m, 2H) 0.99 (d, 7 = 6.5 Hz, 6H). Anal. (C21H20FN3O4S) calcd: C, 58.73; H, 4.69; F, 4.42; N, 9.78; S, 7.47. Found: C, 58.54; H,
4.54; F, 4.83; N, 9.59; S, 7.41. d) 6-Fluoro-4-hydroxy-l-(3-methylbutyl)-8-nitro-3-(7-nitro-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: To a solution of the product from example 4c (200 mg, 0.466 mmol) and potassium nitrate (141 mg, 1.390 mmol) in chloroform (10 mL) was added concenctrated sulfuric acid (6 mL). The reaction was stirred for 10 min then poured onto ice. The aqueous solution was extracted with ethyl acetate. The organic layer was separated, dried over magnesium sulfate, and concentrated. Purification by column chromatography (silica gel, 1% methanol in chloroform) gave the title compound (35 mg, 14%) as a brown solid. JH NMR (CDC13) δ 15.3 (s, IH), 14.71 (s, IH), 9.0 (s, IH), 8.59 (dd, 7 = 9 and 2.2 Hz, IH), 8.3 (dd, 7 = 7.6 and 3.0 Hz, IH), 7.85 (dd, 7 = 6.6 and 3.0 Hz, IH), 7.6 (d, 7 = 9 Hz, IH), 4.19 (m, 2H), 1.65 (m, IH), 1.56 (m, 2H), 1.0
(d, 7 = 6.0 Hz, 6H), MS(ES+) m/e 520 [M+H]+.
Example 5 6-Fluoro-4-hydroxy-3-(8-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(3- methylbutyl)- lH-quinolin-2-one: a) 2-Amino-3-chloro-6-methoxybenzenesulfonamide: A solution of 2-chloro-5- methoxyaniline (4.07 g, 25.8 mmol) in nitroethane (30 mL) was added dropwise to a stirred solution of chlorosulfonyl isocyanate (2.47 mL, 28.3 mmol) in nitroethane (50 mL) at -60 °C under argon, then the mixture stirred at 0 °C for 20 min. Aluminum chloride (4.13 g, 31.0 mmol) was added and the resulting solution heated at 80 °C for lh, then cooled and poured into iced water (500 mL). The precipitate was filtered, washed with cold water and dried. A mixture of this intermediate, 9M aqueous sulfuric acid (25 mL) and dioxane (25 mL) was heated under reflux for 48h, then cooled. Most of the solvent was removed under reduced pressure and the pH adjusted to 4.5 with 4M aqueous sodium hydroxide. After cooling in ice, the precipitate was filtered, washed with cold water and dried to give the title compound (2.31 g, 38%) as a pinkish solid. JH NMR (400MHz, d6-DMSO) δ 7.39 (IH, d, 7 = 8.8 Hz), 7.22 (2H, s), 6.36 (2H, s), 6.35 (IH, d, 7 = 8.8 Hz), 3.83 (3H, s). b) 2-Amino-6-methoxybenzenesulfonamide: A solution of 2-amino-3-chloro-6- methoxybenzenesulfonamide (0.275 g, 1.16 mmol) in methanol (15 mL) and 2M aqueous sodium hydroxide (2.5 mL) was shaken with palladium-on-charcoal (5%, 0.270 g, 0.130 mmol) under hydrogen at 50 p.s.i. for 18h, then the hydrogen removed. The mixture was filtered through Celite® and most of the solvent removed under reduced pressure. IM aqueous hydrochloric acid (10 mL) was added and the pH adjusted to 6-7 with saturated aqueous sodium bicarbonate. The mixture was saturated with sodium chloride then extracted with ethyl acetate. The extracts were dried (magnesium sulfate) and evaporated under reduced pressure to give the title compound (0.191 g, 81%) as a solid. !H NMR (400MHz, d6-DMSO) δ 7.10 (IH, t, 7 = 8.2 Hz), 6.97 (2H, s), 6.35 (IH, dd, 7 = 8.4, 0.9
Hz), 6.25 (2H, s), 6.21 (IH, dd, 7= 8.1, 0.9 Hz), 3.80 (3H, s). c) (8-Methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid, ethyl ester: A solution of 2-amino-6-methoxybenzenesulfonamide (0.188 g, 0.930 mmol) in diethyl malonate (3 mL) was heated under nitrogen at 150°C for 2h, then cooled and diluted with ether (20 mL). The precipitate was filtered, washed with ether and dried, then heated under reflux in phosphorus oxychloride (5 mL) for lh. After cooling, iced water (150 mL) was added and the mixture stirred 2h, then extracted with ethyl acetate. The extracts were evaporated under reduced pressure and the residue slurried in 0.1 M aqueous hydrochloric acid (20 mL). The mixture was cooled in ice, then the solid filtered, washed with cold water and ether and dried to give the title compound (0.169 g, 61%) as a solid. !H NMR (400MHz, d6-DMSO) δ 12.04 (IH, s), 7.60 (IH, t, 7 = 8.3 Hz), 7.04 (IH, d, 7 = 8.0 Hz),
6.85 (IH, dd, 7 = 8.1, 0.6 Hz), 4.16 (2H, q, 7 = 7.1 Hz), 3.91 (3H, s), 3.65 (2H, s), 1.22 (3H, t, 7 = 7.1 Hz). d) 5-Fluoro-2-(3-methylbutylamino)benzoic acid: A mixture of 2-bromo-5- fluorobenzoic acid (5.00 g, 22.8 mmol), 3-methylbutylamine (2.78 mL, 23.0 mmol), potassium carbonate (6.30 g, 45.6 mmol), copper (II) bromide (0.255 g, 1.14 mmol) and tetrahydrofuran was heated at 75 °C for 3.5h, then cooled and diluted with water (20 mL). The organic solvent was removed under reduced pressure and IM aqueous hydrochloric acid (90 mL) added dropwise. After stirring 30 min, the solid was filtered, washed with water and dried to give the title compound (4.47 g, 87%) as a solid. ]H NMR (400MHz, dg-
DMSO) δ 7.49 (IH, dd, 7= 9.8, 3.1 Hz), 7.28 (IH, m), 6.75 (IH, dd, 7 = 9.3, 4.5 Hz), 3.16 (2H, t, 7 = 7.2 Hz), 1.68 (IH, m), 1.48 (2H, m), 0.92 (6H, d, 7 = 6.6 Hz). e) 6-Fluoro-l-(3-methylbutyl)benzo[J|[l,3]oxazine-2,4-dione.: A solution of triphosgene (2.65 g, 8.93 mmol) in ethyl acetate (11 mL) was added dropwise to a stirred mixture of 5-fluoro-2-(3-methylbutylamino)benzoic acid (4.47 g, 19.8 mmol), potassium carbonate (2.58 g, 18.7 mmol) and ethyl acetate (35 mL) warmed in an oil bath at 30 °C. After stirring 30 min, the mixture was cooled, filtered and the filtrate washed (water, brine), dried (magnesium sulfate) and evaporated under reduced pressure. The residue was dissolved in toluene (10 mL) and hexane (50 mL) added slowly. The mixture was cooled in ice, then the solid filtered, washed with hexane and dried to give the title compound (3.96 g, 80%) as a solid. JH NMR (300MHz, d6-DMSO) δ 7.81-7.72 (2H, m), 7.49 (IH, m), 4.02 (2H, m) 1.73 (IH, m), 1.54 (2H, m), 0.96 (6H, d, 7 = 6.5 Hz). f) 6-Fluoro-4-hydroxy-3-(8-methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin- 3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one: Sodium hydride (0.087 g of a 60% oil suspension, 2.17 mmol) was added to a stirred suspension of 6-fluoro-l-(3- methylbutyl)benzo[J][l,3]oxazine-2,4-dione (0.182 g, 0.723 mmol) and (8-methoxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazm-3-yl)acetic acid, ethyl ester (0.196 g, 0.689 mmol) in tetrahydrofuran (7 mL) under nitrogen. After the gas evolution had stopped, the mixture was heated under reflux for 1.5h, then acetic acid (1 mL) added dropwise and the reflux continued for 0.5h. After cooling, water (50 mL) was added and the mixture stirred 15 min, then the solid filtered, washed with water and ether and dried to give the title compound (0.235 g, 74%) as a pale yellow solid. Η NMR (400MHz, d6-DMSO) δ 15.14 (IH, s),
14.05 (IH, s), 7.90 (IH, dd, 7 = 8.8, 3.0 Hz), 7.79-7.70 (2H, m), 7.68 (IH, t, 7= 8.3 Hz), 7.16-7.12 (2H, m), 4.32 (2H, m), 3.96 (3H, s), 1.78 (IH, m), 1.53 (2H, m), 1.00 (6H, d, 7 = 6.6 Hz).
Example 6
2- { 3-[6-Fluoro-4-hydroxy- l-(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ l,2,4]thiadiazin-8-yloxy } acetamide a) 6-Fluoro-4-hydroxy-3-(8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin- 3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one: A mixture of 6-fluoro-4-hydroxy-3-(8- methoxy- 1 , 1 -dioxo-1 ,4-dihydrobenzo[ 1 ,2,4] thiadiazin-3-yl)- l-(3-methylbutyl)- lH-quinolin- 2-one (Example 5, 0.223 g, 0.485 mmol), acetic acid (15 mL) and 48% aqueous hydrobromic acid (2 mL) was heated under reflux for 42h, then cooled and diluted with water (35 mL). After stirring 30 min, the solid was filtered, washed with water, dichloromethane and 5% methanol/dichloromethane then dried to give the title compound (0.072 g, 33%) as a white powder. ]H NMR (400MHz, d6-DMSO) δ 15.36 (IH, s), 13.97
(IH, s), 11.16 (IH, s), 7.90 (IH, dd, 7 = 8.8, 2.9 Hz), 7.79-7.71 (2H, m), 7.51 (IH, t, 7 = 8.3 Hz), 6.97 (IH, d, 7 = 7.9 Hz), 6.90 (IH, d, 7 = 8.3 Hz), 4.32 (2H, m), 1.78 (IH, m), 1.53 (2H, m), 1.00 (6H, d, 7 = 6.6 Hz). b) 2-{3-[6-Fluoro-4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]-
1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy } acetamide: Potassium carbonate (0.181 g, 1.31 mmol) was added to a stirred solution of 6-fluoro-4-hydroxy-3-(8-hydroxy- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)- 1 -(3-methylbutyl)- 1 H-quinolin-2-one (0.195 g, 0.438 mmol) in dimethylformamide (3 mL) at 90°C under nitrogen. After 5 min, 2-chloroacetamide (0.040 g, 0.428 mmol) was added and the mixture stirred for 3h at 80°C, then cooled and diluted with water (40 mL) and acidified to ~ pH 1 with IM aqueous hydrochloric acid. The mixture was extracted with ethyl acetate and the extracts washed with water, then evaporated under reduced pressure. The residue was boiled in 5% methanol/dichloromethane (10 mL), cooled, filtered, and dried to give the title compound (0.055 g, 25%) as a solid. Η NMR (400MHz, d6-DMSO) δ 14.90 (IH, br s), 14.16 (IH, s),
7.91 (IH, dd, 7= 8.8, 3.0 Hz), 1.19-1.12 (3H, m), 7.69 (IH, t, 7 = 8.3 Hz), 7.23 (IH, s), 7.21 (IH, s), 7.14 (IH, d, 7 = 8.4 Hz), 4.72 (2H, s), 4.33 (2H, m), 1.79 (IH, m), 1.53 (2H, m), 1.00 (6H, d, 7= 6.6 Hz).
Example 7
2-{5-Chloro-3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-8-yloxy Jacetamide a) (5-Chloro-8-methoxy- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)acetic acid, ethyl ester: A mixture of 2-amino-3-chloro-6-methoxybenzenesulfonamide (example 5(a), 2.31 g, 9.80 mmol) and diethyl malonate (20 mL) was heated under argon at 150°C for 17h, then cooled. The mixture was diluted with ether (100 mL), then the solid filtered, washed with ether and dried to give the title compound (2.41 g, 74%) as a solid. !H NMR (400MHz, d6-DMSO) δ 11.11 (IH, s), 7.82 (IH, d, 7 = 9.1 Hz), 7.12 (IH, d, 7= 9.1 Hz),
4.17 (2H, q, 7 = 7.1 Hz), 3.94 (3H, s), 3.86 (2H, s), 1.23 (3H, t, 7 = 7.1 Hz). b) (5-Chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid, methyl ester: A IM solution of boron tribromide in dichloromethane (2.46 mL, 2.46 mmol) was injected into an ice-cooled, stirred suspension of (5-chloro-8-methoxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid, ethyl ester (0.235 g, 0.706 mmol) in 1,2-dichloroethane (10 mL) under nitrogen. After 5 min, the mixture was warmed to room temperature and stirred for 3.5h. Iced water (50 mL) was added rapidly and the organic solvent removed under reduced pressure. The solids in the mixture were filtered off and dried, and the filtrate extracted with ethyl acetate. The extracts were washed with brine, dried (magnesium sulfate) and evaporated under reduced pressure. The residue was combined with the solids filtered off above and the mixture heated under reflux in methanol (10 mL)/concentrated sulfuric acid (0.5 mL) for 2.5h. After cooling, water (10 mL) was added and the mixture partially evaporated under reduced pressure. A further 20 mL of water was added and the mixture cooled in ice, then the solid filtered, washed with cold water and dried to give the title compound (0.201 g, 93%) as a solid. !H NMR (400MHz, d6-DMSO) δ 11.27 (IH, s), 11.00 (IH, s), 7.63 (IH, d, 7= 8.9 Hz), 6.86 (IH, d, 7= 8.9 Hz),
3.87 (2H, s), 3.70 (3H, s). c) 6-Fluorobenzo[J][l,3]oxazine-2,4-dione: A solution of 5-fluoroanthranilic acid (1.26 g, 8.12 mmol) in tetrahydrofuran (20 mL) was treated with triphosgene (1.2 g, 4.04 mmol) and stirred at 50°C overnight. Ice-cold dilute sodium hydrogen carbonate solution was added and the solid was collected, washed with water, then ether and dried to give the title compound (1.31 g, 89%). 2H NMR (300MHz, d6-DMSO) δ 11.80 (IH, s), 7.67 (2H, m), 7.18 (IH, m). d) l-(2-Cyclopropylethyl)-6-fluorobenzo[J][l,3]oxazine-2,4-dione: 6-Fluorobenzo[J][l,3]oxazine-2,4-dione (1.0 g, 5.58 mmol), triphenylphosphine (1.44 g, 5.58 mmol) and 2-cyclopropylethanol (1.0 g, 11.6 mmol) were stirred together in chloroform and treated with diethyl azodicarboxylate (0.875 ml, 5.58 mmol). The reaction was stirred under a nitrogen atmosphere overnight, evaporated onto silica and purified by chromatography (silica gel, ethyl acetate - hexanes) to give the title compound (722 mg, 51%) as a solid. !H NMR (300MHz, CDC1 ) δ 7.80 (IH, dd, 7= 7, 3 Hz), 7.48 (IH, m), 7.08 (IH, dd, 7= 9, 4 Hz), 4.15 (2H, m), 1.65 (2H, m) 0.74 (IH, m), 0.51 (2H, m), 0.09 (2H, m). e) 3-(5-Chloro-8-hydroxy- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]fhiadiazin-3-yl)- 1-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one: l,8-Diazabicyclo[5.4.0]undec-7- ene (0.294 mL, 1.96 mmol) was injected into a stirred solution of (5-chloro-8-hydroxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid, methyl ester (0.200 g, 0.656 mmol) in dimethylformamide (3 mL) under nitrogen. After 5 min, l-(2-cyclopropylethyl)- 6-fluorobenzo[JI[l,3]oxazine-2,4-dione (0.327 g, 1.31 mmol) was added and the mixture stirred for 60h at room temperature. Acetic acid (1 mL) was added and the mixture diluted with water (20 mL) slowly. The precipitate was filtered, washed with water and dried. The crude material was boiled in ethyl acetate (30 mL) containing a few drops of acetic acid, then cooled and the solid filtered, washed (ethyl acetate) and dried to give the title compound (0.184 g, 59%) as a solid. 'H NMR (400MHz, d6-DMSO) δ 15.29 (IH, br s),
14.77 (IH, s), 11.49 (IH, s), 7.92 (IH, dd, 7= 8.8, 2.9 Hz), 7.86 (IH, m), 7.79 (IH, m), 7.74 (IH, d, 7= 8.9 Hz), 6.93 (IH, d, 7 = 8.9 Hz), 4.44 (2H, m), 1.58 (2H, m), 0.81 (IH, m), 0.39 (2H, m), 0.07 (2H, m). f) 2-{5-Chloro-3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy } acetamide, monosodium salt: Potassium carbonate (0.017 g, 0.123 mmol) was added to a stirred solution of 3-(5-chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one (0.019 g, 0.0398 mmol) in dimethylformamide (1 mL) at 100°C under nitrogen. After 5 min, 2-chloroacetamide (0.005 g, 0.0535 mmol) was added and the mixture stirred for lh at 100°C and for 2h at 80°C, then cooled. Acetic acid (0.3 mL) was added, then the mixture diluted slowly with water (20 mL). The precipitate was filtered, then washed with water and diethyl ether. The solid was dissolved in hot methanol (5 mL) and 0.1M aqueous sodium carbonate (1 mL) and the solution filtered, then diluted with hot water (4 mL) and allowed to cool. The precipitate was filtered, washed with cold water and dried to give the title compound (0.012 g, 55%) as a solid. JH NMR (400MHz, d6-DMSO) δ 7.79 (IH, dd, 7 = 9.5, 3.0 Hz), 7.71 (IH, d, 7 = 8.9 Hz), 7.67 (IH, s), 7.49 (IH, s), 7.42-7.38 (2H, m), 6.95 (IH, d, 7 = 8.9 Hz), 4.64 (2H, s), 4.18 (2H, m), 1.48 (2H, m), 0.80 (IH, m), 0.43 (2H, m), 0.12 (2H, m).
Example 8 N-(4-{3-[6-Fluoro-4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yl } thiazol-2-yl)acetamide a) 6-Fluoro-4-hydroxy-3-(7-iodo- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3- yl)- l-(3-methylbutyl)-lH-quinolin-2-one: Sodium hydride (1.01 g. of a 60% oil dispersion, 25.3 mmol) was added to a stirred suspension of l-(3-methylbutyl)-lH- benzo[J][l,3]oxazine-2,4-dione, (1.18 g, 5.08 mmol) (7-iodo- 1,1 -dioxo- 1,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester, (2.0 g, 5.08 mmol) in dry tetrahydrofuran (15 ml). The mixture was stirred under reflux for lh, cooled, and acetic acid (2 mL) added. The mixture was heated under reflux for lh, cooled, and poured into 1.0 M aqueous hydrochloric acid. The precipitate was filtered, washed with hexanes and ether, then dried to give the title compound as an off white solid (1.88 g, 69%). JΗ NMR (dg- DMSO) δ 14.8 (br s, IH), 14.4 (br s, IH), 8.19 (s, IH), 8.1 (dd, 7 = 8.5 and 1.76 Hz, IH), 7.91 (dd, 7 = 9.1 and 3.0 Hz, IH), 7.75 (m, 2H), 7.51 (d, 7 = 8.6 Hz, IH), 4.35 (t, 2H), 1.8
(m, IH), 1.55 (m, 2H), 1.04 (s, 3H), 1.02 (s, 3H). MS(ES+) m/e 556 [M+H]+. b) 3-(7-Acetyl-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-6-fluoro-4- hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one: To the product obtained in example 8a) (300 mg, 0.559 mmol) in N,N-dimethylformamide (3 mL) was added vinyl butyl ether (360 μL, 2.795 mmol), triethylamine (170 μL, 1.23 mmol), 2,2'-bis(diphenyl-phosphino)-l,l - binaphthyl (13.8 mg, 0.0335 mmol), and palladium acetate (7.52 mg, 0.0355 mmol). The reaction mixture was heated at 78°C for 18h under a nitrogen atmosphere. After cooling to room temperature, IM aqueous hydrochloric acid (10 mL) was added and the solution was stirred for 35 min. The aqueous reaction mixture was extracted with chloroform (3 x 25 mL), the organic layers were combined and washed with water (30 mL) and brine (30 mL), dried over magnesium sulfate and the solvent removed in vacuo. The crude material was purified using flash column chromatography (silica gel, chloroform) to give the title compound as a yellow powder (205 mg, 77%). MS(ES+) m/e 472 [M+Η]+. c) 3-[(7-(2-Bromo-ethanoyl)- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl]-6- fluoro-4-hydroxy-l-(3-methylbutyl)-lH-qumolin-2-one: The product of example 8b) (135 mg, 0.287 mmol) in chloroform (3 mL) was treated with bromine (IM in glacial acetic acid, 290 μL, 0.287 mmol) and allowed to stir at room temperature for 13h. The reaction mixture was diluted with chloroform (50 mL) and water (50 mL). The organic layer was separated, dried over magnesium sulfate, and solvent removed in vacuo to give the title compound as a pale yellow solid (103 mg). The product was not purified further and was used immediately in the next reaction. MS(ES+) m/e 550 [M+H]+. d) N-(4-{ 3-[6-Fluoro-4-hydroxy- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-thiazol-2-yl)-acetamide: To a solution of the product of example 8c) (125 mg, 0.264 mmol) in ethanol (2 mL) and chloroform (2 mL) was added N-acetylthiourea (31 mg, 0.264 mmol). The solution was heated to reflux for 3h. After cooling to room temperature the precipitate that formed during the reaction was collected by filtration and washed with ethanol to afford the product as an insoluble yellow powder (102 mg, 67%) •H NMR (d6-DMSO) δ 8.17 (s, IH), 7.8 (d, 7 = 8.6
IH), 7.7 (d, 7 = 9.6 Hz, IH), 7.2 (m, 2H), 7.1 (t, 7 = 8.3 Hz, IH), 5.75 (br s, IH), 4.21 (t, 2H), 1.9 (s, 3H), 1.65 (m, IH), 1.40 (m, 2H), 0.88 (s, 3H), 0.86 (s, 3H). MS(ES+) m/e 570
[M+H]+. Example 9 N-(4-{ 3-[ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl]- 1 , 1- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-7-yl } -thiazol-2-yl) acetamide a) l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Following the procedure of example 8a) but substituting l-(2-cyclopropylethyl)-6-fluoro-lH-benzo[J][l,3]oxazine-2,4- dione, for l-(3-methylbutyl)-lH-benzo[_t][l,3]oxazine-2,4-dione, the title compound was obtained as a pale yellow powder (89%) JΗ NMR (d6-DMSO) δ 14.2 (br s, IH), 8.1 (s, IH), 8.05 (dd, 7= 8.6 and 1.6 Hz, IH), 7.82 (dd, 7= 8.8 and 2.8 Hz, IH), 7.77 (dd, 7= 9.3 and 4.1 Hz, IH), 7.70 (t, IH), 7.45 (d, 7 = 8.6 Hz, IH), 4.3 (t, 2H), 1.5 (m, 2H), 0.7 (m, IH), 0.3
(m, 2H), 0.0 (m, 2H). MS(ES+) m/e 554 [M+H]+. b) 3-(7-Acetyl-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- Cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one: Following the procedure of examples 8b) the product of example 9a) was converted into the title compound. !H NMR (CDC13) δ 15.1 (s, IH), 14.9 (s, IH), 8.5 (s, IH), 8.2 (dd, 7 = 8.6 and 1.76 Hz, IH), 7.97 (dd, ' 7 = 8.3 and 3.0 Hz, IH), 7.75 (m, IH), 7.46 (m, IH), 7.41 (d, 7 = 8.8 Hz, IH), 4.42 (m, 2H),
2.6 (s, 3H) 1.6 (m, 2H), 0.8 (m, IH), 0.5 (m, 2H), 0.1 (m, 2H). MS(ES+) m/e 470 [M+H]+. c) 3-[(7-(2-Bromo-ethanoyl)-l,l-dioxo-l,4-dihydro-l/l -benzo[l,2,4]thiadiazin-3- yl]- l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one: Following the procedure of example 8c) the product of example 9b) was converted to the title compound in 70% yield as an off white solid. MS(ES+) m/e 548 [M+H]+. d) N-(4- { 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin- 3-yl] -1,1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-7-yl } -thiazol-2-yl)-acetamide: Following the procedure of example 8d) the product of example 9c) was converted to the title compound in 65% yield. MS(ES+) m/e 568 [M+H]+.
Example 10 (E)-3- { 5-Chloro-3- [ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin- 3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-8-yloxy } acrylamide Methyl propiolate (0.018 g, 0.210 mmol) was added to a stirred solution of 3-(5- chloro-8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one (example 7e), 0.050 g, 0.105 mmol) and N-methylmorpholine (0.016 g, 0.158 mmol) in dimethylformamide (1.5 mL) at 80°C under nitrogen. The mixture was stirred for 4h at 80°C, then cooled and acetic acid (0.5 mL) added, followed by water (20 mL) slowly. The mixture was stirred 0.5h, filtered and the solid washed with water and dried to give the crude acrylate ester. This compound was heated in a sealed tube at 50°C in 2M methanolic ammonia solution for 3h, then the mixture cooled and evaporated under reduced pressure. The residue was stirred in 0.0 IM aqueous hydrochloric acid (10 mL) for lh, then the solid filtered, washed with water and dried. The material was chromatographed (silica gel, 5-10% methanol/dichloromethane) and the product partitioned between 0.1M aqueous potassium carbonate and ethyl acetate. The organic extracts were washed (IM aqueous hydrochloric acid, water, brine), dried (magnesium sulfate) and evaporated under reduced pressure. The residue was triturated with diethyl ether and the solid filtered and dried to give the title compound (0.004 g, 7%) as a solid. Η NMR (400MHz, d6-DMSO) δ 15.45 (IH, s), 7.96 (IH, d, 7 = 8.9 Hz), 7.91
(IH, dd, 7= 8.9, 2.8 Hz), 7.77-7.73 (2H, m), 7.67 (IH, d, 7 = 12.0 Hz), 7.47 (IH, s), 7.35
(IH, d, 7 = 8.6 Hz), 7.03 (IH, s), 5.87 (IH, d, 7 = 12.0 Hz), 4.40 (2H, m), 1.56 (2H, m), 0.81
(IH, m), 0.40 (2H, m), 0.07 (2H, m).
Example 11
1 -(2-Cyclopropylethyl)-3-( 1 , 1 -dioxo-6-trifluoromethyl- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-
3-yl)-6-fluoro-4-hydroxy-lH-quinolin-2-one a) 2-Nitro-4-trifluoromethylbenzene sulfonamide: 2-Nitro-4- trifluoromethylbenzene sulfonyl chloride (10 .0 g, 34.5 mmol) was added portionwise to a cooled, ethanolic solution of ammonia (2M). The flask was sealed and stirred at room temperature for 72h. The solvent was evaporated and the residue was washed with water and dried to give the title compound (9.0 g, 96%). 1H NMR (d6-DMSO) δ 8.51 (s, 1Η), 8.31 (d, J=7 Ηz, 1Η), 8.26 (d, J=7 Ηz, 1Η), 8.15 (br s, 2Η). b) 2-Amino-4-trifluoromethylbenzene sulfonamide: A solution of the compound from example 1 la) (9.0 g, 33.3 mmol) in tetrahydrofuran (100 mL) was shaken with 10% Pd/C catalyst under a hydrogen atmosphere (50 p.s.i.) for 3h. The mixture was filtered through celite, washed through with ethanol and evaporated. The residue was slurried in ether, filtered and the filtrate evaporated to give a solid that was washed with hexane- dichloromethane to give the title compound (5.5 g, 69%). 1H NMR (d6-DMSO) δ 7.66 (d, J=8.4Hz, IH), 7.41 (br s, 2H), 7.09 (s, IH), 6.83 (d, J=8.3 Hz, IH), 6.18 (br s, 2H). c) N-(Sulfamoyl-4-trifluoromethylphenyl)-2-malonamic acid ethyl ester: A mixture of the compound from example lib) (5.5 g) and diethyl malonate (15 mL) was heated at 180°C for lh. Purification of the mixture by chromatography (silica gel, 1% methanol in dichloromethane) followed by crystallization from diethyl ether gave the title compound (2.5 g, 31%) 1H NMR (d6-DMSO) δ 8.44 (d, J=1.3Hz, IH), 8.11 (d, J=8.4Hz, IH), 7.90 (br s, 2H), 7.76 (dd, J=1.3 and 8.4 Hz, IH), 4.19 (q, J=7 Hz, 2H), 3.70 (s, 2H), 1.26 (t, J=7 Hz, 3H). d) (l,l-Dioxo-6-trifluoromethyl-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester: The compound from example 1 lc) (2.5 g, 7.0 mmol) was heated under reflux in phosphorus oxy chloride (10 mL) for 2h. The solvent was evaporated and the residue was slurried in diethyl ether for 2h then filtered to give the title compound as a colorless solid
(1.35 g, 57%). *H NMR (d6-DMSO) δ 12.65 (s, IH), 8.15 (d, J=8.4 Hz, IH), 7.87 (dd, J=l .3 and 8.4Hz, IH), 7.69 (s, IH), 4.22 (q, J=7 Hz, 2H), 3.82 (s, 2H), 1.28 (t, J=7 Hz, 3H). e) 1 -(2-Cyclopropylethyl)-3-( 1 , 1 -dioxo-6-trifluoromethyl- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy-lH-quinoline-2-one: 1,8- Diazabicyclo[5.4.0]undec-7-ene (0.3 ml, 2.0 mmoles) was added dropwise to a stirred solution of the compounds from examples 7d) (250 mg, 1.0 mmoles) and lid) (336 mg, 1.0 mmoles) in dimethylformamide (5.0 mL). The mixture was then stirred overnight at room temperature. Acetic acid (4.0 ml) was added and the mixture stirred for a further 2h. Water was added, the mixture stirred for lh and the solid collected, washed with water, ether and hexane then dried to give the title compound (110 mg, 22%). 1H NMR (d6-DMSO) δ 14.39 (br s, 2Η), 8.15 (s, IH), 8.05 (d, J=8 Hz, IH), 7.82 (dd, J=3 and 9 Hz, IH), 7.74-7.77 (m, 2H), 7.68 (m, IH), 4.32 (m, 2H), 1.50 (m, 2H), 0.73 (m, IH), 0.33 (m, 2H), 0.01 (m, 2H).
MS(ES+) m/e 496 [M+H]+.
Example 12 l-(2-Cyclopropylethyl)-3-[ 1 , l-dioxo-7-(5-oxo-4,5-dihydro-isoxazol-3-yl)- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one a) 3- { 3-[ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-3-ethoxyacrylic acid ethyl ester : Following the procedure of example 2c), the product obtained in example 9a), l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one, was converted to the title compound (25%) MS(ES+) m/e 570 [M+Η]+. b) 1 -(2-Cyclopropylethyl)-3-[ 1 , 1 -dioxo-7-(5-oxo-4,5-dihydro-isoxazol-3-yl)- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one: The product of example 12a) (89 mg, 0.156 mmol) was stirred in 4M aqueous hydrochloric acid in dioxane (15 mL) for 4h. The solvent was removed in vacuo. The crude residue was resuspended in methanol (2 mL) and hydoxylamine hydrochloride (17.8 mg, 0.281 mmol) was added. The solution was heated under reflux for 4h. After cooling to room temperature the solvents were removed by rotary evaporation. The residue was dissolved in chloroform (20 mL) and washed with water (15 mL) and brine (15 mL). The organic layer was dried over magnesium sulfate, filtered and concentrated. Purification by column chromatography (silica gel, 1% methanol in chloroform) gave the title compound (44.2 mg, 89%). *H NMR (CDC13) δ 14.9 (s, IH), 14.8 (s, IH), 8.1 (dd, 7 = 8.6 and 1.9 Hz, IH), 7.98 (d, 7= 1.8 Hz, IH), 7.90 (dd, 7 = 8.4 and 2.9 Hz, IH), 7.45 (dd, 7 = 7.3 and 2.9 Hz, IH), 7.40 (d, 7 = 4.2 Hz, IH), 7.38 (d, 7 = 8.6, IH), 4.35 (t, 2H), 3.8 (s, 2H), 1.62 (m, 2H), 0.8 (m, IH), 0.5 (m,
2H), 0.1 (m, 2H). MS(ES+) m/e 511 [M+H]+.
Example 13 2- { 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1- dioxo- 1 ,4-dihydrobenzo[ l,2,4]thiadiazin-8-yloxy } acetamide a) l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(8-hydroxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: A mixture of 3-(5-chloro-8- hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)- l-(2-cyclopropylethyl)-6- fluoro-4-hydroxy-lH-quinolin-2-one (example 7e), 0.120 g, 0.251 mmol), palladium-on- charcoal (5%, 0.144 g, 0.068 mmol), methanol (30 mL) and IM aqueous sodium hydroxide (1 mL) was stirred under 1 atm of hydrogen for 24h, then the hydrogen removed and acetic acid (1 mL)/dichloromethane (100 mL) added. The mixture was filtered through a pad of Celite® and the filtrate evaporated under reduced pressure. The residue was slurried in water (20 mL), and the solid filtered, washed with water, then dissolved in 10% methanol/dichloromethane. The solvent was removed under reduced pressure to give the title compound (0.091 g, 75%) as a solid. *H NMR (400MHz, d6-DMSO) δ 15.38 (IH, s),
14.04 (IH, s), 11.17 (IH, s), 7.90 (IH, dd, 7 = 8.8, 2.9 Hz), 7.83-7.77 (2H, m), 7.51 (IH, t, 7 = 8.2 Hz), 6.97 (IH, d, 7 = 7.5 Hz), 6.90 (IH, d, 7 = 8.2 Hz), 4.42 (2H, m), 1.58 (2H, m), 0.83 (IH, m), 0.41 (2H, m), 0.08 (2H, m). b) 2-{ 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]-l , 1 -dioxo-1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy } acetamide: Following the procedure of example 6b), except substituting l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-3- (8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one for 6- fluoro-4-hydroxy-3-(8-hydroxy-l , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1-(3- methylbutyl)-lH-quinolin-2-one, gave the title compound (79%) as a solid. !H NMR (400MHz, d6-DMSO) δ 14.88 (IH, br s), 14.19 (IH, s), 7.92 (IH, dd, 7 = 8.8, 3.0 Hz), 7.87-
7.73 (3H, m), 7.69 (IH, t, 7 = 8.3 Hz), 7.24-7.22 (2H, m), 7.15 (IH, d, 7 = 8.4 Hz), 4.73 (2H, s), 4.42 (2H, m), 1.58 (2H, m), 0.83 (IH, m), 0.42 (2H, m), 0.09 (2H, m).
Example 14
Carbamic acid, 3-[ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroqumolin-3-yl] - l,l-dioxo-l,4-dihydro-benzo[l,2,4]thiadiazin-7-yl, methyl ester, potassium salt a) 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-carboxylic acid, methyl ester: The compound from Example 9a) (1.0 g, 1.81 mmol) and triethylamine (0.554 mL, 3.97 mmol) were added to a solution of l,3-bis(diphenylphosphino)propane (48.5 mg, 0.118 mmol) and palladium(II) acetate (26.4 mg, 0.118 mmol) in dimethylsulfoxide (20 mL) and methanol (15 mL). The system was degassed and then purged two times with carbon monoxide. The reaction mixture was stirred at 88°C for 6h, and then at 75°C for 40 h. Thin layer chromatographic analysis showed residual starting material. Additional 1,3- bis(diphenylphosphino)propane (48.5 mg) and palladium(II) acetate (27 mg) were then added. The system was evacuated and refilled with carbon monoxide. After addition of triethylamine (0.5 mL), the reaction mixture was stirred at 90°C for 6h, cooled to room temperature and partitioned between chloroform and IM aqueous hydrochloric acid. The separated organic layer was washed with water, brine, dried over sodium sulfate and evaporated under reduced pressure. The residue was triturated from chloroform to give the desired product as a white powder (280 mg, 32%). !H NMR (d6-DMSO) δ 14.50 (br s, IH), 8.31 (s, IH), 8.22 (dd, J = 8.7, 1.3 Hz, IH), 7.89-7.73 (m, 4H), 4.40 (t, J = 7.4 Hz, 2H), 3.91 (s, 3H), 1.58 (q, J = 7.3 Hz, 2H), 0.86-0.79 (m, IH), 0.43-0.39 (m, 2H), 0.10-0.07 (m, 2H). b) 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Lithium aluminum hydride (1 M solution in tetrahydrofuran, 0.865 mL, 0.865 mmol) was added dropwise to a cooled suspension (0°C) of the compound from Example 14a) (280 mg, 0.577 mmol) in tetrahydrofuran (5 mL). The resulting solution was stirred at 0°C for 2h, then treated with saturated sodium potassium tartrate aqueous solution (3.5 mL) and stirred at room temperature for 30 min. The reaction mixture was then filtered, the solid washed with methanol and the filtrate made acidic by the addition of IM aqueous hydrochloric acid. After stirring at room temperature for 20 min, the precipitate obtained was collected and redissolved in 5% methanol in chloroform. The solution was dried over sodium sulfate, filtered and the solvent evaporated under reduced pressure to afford the title compound as a yellow powder (180 mg, 68%). Η NMR (CDC13) δ 15.26 (br s, IH), 14.58 (br s, IH), 7.98 (d, J = 1.0 Hz, IH), 7.95 (dd, J = 8.4, 2.9 Hz, IH), 7.67 (dd, J = 8.5, 1.9 Hz, IH), 7.52-7.42 (m, 2H), 7.32 (d, J = 8.4 Hz, IH), 4.80 (s, 2H), 4.42 (t, J = 7.5 Hz, 2H), 1.68 (q, J = 7.5 Hz, 2H), 0.84-0.76 (m, IH), 0.55-0.51 (m, 2H), 0.15-0.12 (m, 2H). MS(ES+) m/e 458 [M+H]+. c) Carbamic acid, 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro-benzo [ 1 ,2,4] thiadiazin-7-yl, methyl ester, potassium salt: Trichloroacetyl isocyanate (0.022 mL, 0.180 mmol) was added dropwise to a suspension of the compound from Example 14b) (63.5 mg, 0.139 mmol) in dichloromethane (3.5 mL) cooled at 0°C and the mixture was stirred for 2h at the same temperature. The solvent was evaporated under reduced pressure and the residue was suspended in t-butanol (4 mL) and saturated potassium carbonate aqueous solution (2 mL). The suspension was warmed to 60°C and stirred at this temperature until the reaction was completed (monitored by LC/MS analysis). Then the mixture was quenched by pouring into water and standing overnight. The solid was collected by filtration, washed with water, then diethyl ether and dried to give the title compound as a white solid (42 mg, 56%). ]H NMR (d6-DMSO) δ 16.10 (br s, IH), 7.77 (dd, J = 9.4, 2.9 Hz, IH), 7.65 (d, J = 1.3 Hz, IH), 7.51 (dd, J = 8.3, 1.8 Hz, IH), 7.41-7.32 (m, 2H), 7.27 (d, J = 8.4 Hz, IH), 6.76 (br s, IH), 6.55 (br s, IH), 5.02 (s, 2H), 4.16 (t, J = 7.5 Hz, 2H), 1.46 (q, J = 7.4 Hz, 2H), 0.83-0.73 (m, IH), 0.44-0.39
(m, 2H), 0.12-0.08 (m, 2H). MS(ES+) m/e 501 [M+H]+.
Example 15 2-{[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-7-yloxy}-H-dimethylcarbamoylmethylacetamide a) 7-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-one: A solution of 4- anisidine (20 g, 162 mmol) in nitroethane (100 mL) was added dropwise to a solution of chlorosulfonyl isocyanate (17 mL, 195 mmol) in nitroethane (150 mL) strirred at -40°C. After 5 min, aluminum chloride (28 g, 210 mmol) was added and the mixture was immediately transferred to an oil bath, previously heated to 110°C. The mixture was stirred at this temperature for 20 min then poured onto ice to give the title compound as a purple solid (24 g, 65%). IH NMR (300MHz, d6-DMSO) 11.14 (s, NH), 7.20 (m, 3H), 3.81 (s,
3H). b) 2-Amino-5-methoxybenzenesulfonamide: 7-Methoxy- 1,1 -dioxo- 1,4- dihydrobenzo[l,2,4]thiadiazin-3-one (3.2 g, 14 mmol) was heated in 50% sulfuric acid (25 mL) at 130 °C until dissolved. The mixture was poured onto ice, neutralized and extracted into ethyl acetate. Evaporation of the solvent gave the title compound (2.0 g, 70%). IH NMR (300MHz, d6-DMSO) 7.25 (s, NH2, 2H), 7.11 (d, J = 3 Hz, IH), 6.94 (dd, J = 3 and
9 Hz, IH), 6.77 (d, J = 9 Hz, IH), 5.44 (s, NH2, 2H), 3.67 (s, 3H). c) N-(4-Methoxy-2-sulfamoylphenyl)malonamic acid ethyl ester: A mixture of 2- amino-5-methoxybenzenesulfonamide (9.1 g, 45 mmol) and diethyl malonate (14 mL, 92 mmol) were heated together at 160 °C for 1 h. The mixture was cooled and diluted with diethyl ether to give the title compound as a solid (8.5 g, 60%). IH NMR (300MHz, d6- DMSO) 9.44 (s, IH), 7.75 (d, J = 9 Hz, IH) 7.51 (s, 2H), 7.37 (d, J = 3 Hz, IH), 7.20 (dd, J = 3 and 9 Hz, IH), 4.14 (q, 2H), 3.81 (s, 3H), 3.57 (s, 2H), 1.23 (t, 3H). d) (7-Methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester: The compound from Example 15c) (2.4 g, 7.6 mmol) was heated under reflux in phosphorus oxychloride (50 mL) for 2.5 h. The solvent was evaporated and the residue dissolved in ethyl acetate. The solution was neutralized, washed with 2M hydrochloric acid, dried and evaporated to a solid. Trituration with ether gave the title compound (1.8 g, 79%). IH NMR (300MHz, dg-acetone) 11.10 (s, NH), 7.26-7.80 (m, 3H), 4.32 (q, 2H), 3.79 (s,
3H), 3.26 (s, 2H), 1.49 (t, 3H). e) Ethyl (7-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate: A mechanically stirred suspension of the compound from example 15d) (17.0 g, 57.0 mmol) in 1,2-dichloroethane (800 mL) was cooled over an ice bath (5-10°C) under nitrogen. A solution of boron tribromide (IM solution in dichloromethane, 200 mL) was added dropwise over 20 min, the ice bath was removed and the mixture stirred at ambient temperature for 3h. The mixture was poured onto ice, the organic layer was separated and the aqueous layer was extracted thrice with ethyl acetate. The combined organic solutions were washed with brine, dried and evaporated to a foam. The product was dissolved in ethanol (100 mL) and concentrated sulfuric acid (1.0 mL) was added. The mixture was heated under reflux for 45 min, partially evaporated and diluted with ethyl acetate. The solution was washed with water and the aqueous layer was extracted with ethyl acetate. The combined organic solutions were dried and evaporated to an oil. Crystallization from dichloromethane gave the title compound as a gray solid (6.30 g, 39%). 1H NMR (400MHz, D6-DMSO) δ 12.1 (s, IH), 10.2 (s, IH), 7.29-7.02 (m, 3H),
4.15 (q, 2H), 1.21 (t, 3H). f) l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: A mixture of the compound from Example 7d) (211 mg, 0.85 mmol) and the compound from Example 15e) (240 mg, 0.85 mmol) in anhydrous tetrahydrofuran (20 mL) under argon was treated with sodium hydride (60% suspension in mineral oil) (182 mg, 4.5 mmol) and heated under reflux for 1 h. The mixture was acidified with acetic acid and heated under reflux for an additional 1 h. The solvent was partially removed and the mixture diluted with water. The solid was collected by filtration, washed with water, ether and hexanes to give the title compound as a yellow solid (105 mg, 28%). !H NMR (400MHz, d6-DMSO) δ 15.3 (br s, IH), 14.1 (s, IH), 10.4
(s, IH), 7.88 (dd, IH, J = 3, 9 Hz), 7.78 (ddd, IH, J = 3, 9, 10 Hz), 7.72 (dd, IH, J = 5, 10 Hz), 7.58 (d, IH, J = 10 Hz), 7.18 (dd, IH, J = 3, 10 Hz), 7.17 (d, IH, J = 3 Hz), 4.42 (m,
2H), 1.58 (m, 2H), 0.83 (m, IH), 0.41 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e 444 [M+H]+. g) {3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetamide: A suspension of the compound from Example 15h) (109 mg, 0.25 mmol) in anhydrous N,N-dimethylformamide (5.0 mL) was treated with sodium hydride (60% dispersion in mineral oil) (28.0 mg, 0.70 mmol) and stirred (with gentle warming) until the anion formed. 2-Bromoacetamide (0.035 mL, 0.50 mmol) was slowly added and the mixture was stirred at 60 °C for 2 h. The mixture was acidified with acetic acid, diluted with water, and filtered to yield the title compound as a yellow solid (45 mg, 39%). JH NMR (400MHz, d6-DMSO) δ 15.3 (br s,
IH), 14.2 (s, IH), 7.77 (dd, IH, J = 3, 9 Hz), 7.63 (s, IH), 7.42 (s, IH), 7.38 (ddd, IH, J = 3, 9, 9 Hz), 7.34 (dd, IH, J = 5, 9 Hz), 7.26 (d, IH, J = 9 Hz), 7.20 (dd, IH, J = 3, 9 Hz), 7.14 (d, IH, J = 3 Hz), 4.49 (s, 2H), 4.15 (t, 2H, J = 7 Hz), 1.46 (m, 2H), 0.78 (m, IH), 0.42 (m,
2H), 0.10 (m, 2H). MS(ES+) m/e 501 [M+H]+.
h) 2-{[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}-H-dimethylcarbamoylmethylacetamide: A solution of the compound from Example 15g) (100 mg, 0.20 mmol) in anhydrous N,N- dimethylformamide (5.0 mL) was treated with sodium hydride (60% dispersion in mineral oil) (24.0 mg; 0.60 mmol) followed by N,N-dimethyl 2-chloroacetamide (27.0 mg, 0.22 mmol). The reaction was heated to 80 °C for 18h followed by quenching with IM aqueous hydrochloric acid. The mixture was diluted with brine, extracted thrice with ethyl acetate, dried over magnesium sulfate, filtered, concentrated in vacuo, and purified via flash column chromatography (silica gel, 0-10% methanol/ethyl acetate) to give the title compound as an off-white solid (61 mg, 52%). 1H NMR (400MHz, d6-DMSO) δ 15.2 (br s, IH), 14.3 (s,
IH), 8.23 (t, IH, J = 5 Hz), 7.88 (dd, IH, J = 3, 9 Hz), 7.84 (dd, IH, J = 4, 10 Hz), 7.76 (ddd, IH, J = 3, 8, 9 Hz), 7.71 (d, IH, J = 10 Hz), 7.43 (d, IH, J = 4 Hz), 7.42 (dd, IH, J = 3, 8 Hz), 4.73 (s, 2H), 4.41 (t, 2H, J = 7 Hz), 4.01 (d, 2H, J = 5 Hz), 2.96 (s, 3H), 2.85 (s, 3H), 1.58 (q, 2H, J = 7 Hz), 0.82 (m, IH), 0.41 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e 586 [M+H]+.
Example 16 2- [3-( 1 , 1 -Dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4] thiadiazin-3-yl)-6-fluoro-4-hydroxy-2-oxo-2H- quinolin- 1 -yl] -N,N-dimethylacetamide a) 3-( 1 , 1 -Dioxo-1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy- 1H- quinolin-2-one: l-[3-(Dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride (0.200 g, 1.04 mmol) was added to a solution of 5-fluoro-2-aminobenzoic acid (0.155 g, 1.00 mmol), (l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid (M.G. Andrisano et. al., Farmaco, Ed. Sci., 1981, 36(11), 905; 0.240 g, 1.00 mmol) and 1-hydroxybenzotriazole (0.135 g, 1.00 mmol) in N,N-dimethylformamide (2 mL) and the mixture stirred for 24 h. A further 0.200 g of l-[3-(dimethylamino)propyl]-3-ethylcarbodiimide hydrochloride (1.04 mmol) was added, followed by triethylamine (0.70 mL, 5.00 mmol) and stirring continued for 4 h. IM aqueous hydrochloric acid (20 mL) was added and the mixture extracted with ethyl acetate. The extracts were washed (water, brine), dried (magnesium sulfate), and evaporated under reduced pressure to give the crude amide intermediate. Diazomethane in a stream of ether saturated nitrogen, generated from N-methyl-N-nitroso-p- toluenesulfonamide (0.64 g, 3.00 mmol) in a mixture of 60% aqueous potassium hydroxide (7 mL), 2-(2-ethoxyethoxy)ethanol (7 mL) and ether (7 mL), was bubbled through a solution of the crude amide in 10% methanol/ethyl acetate (10 mL). After the nitrogen stream had been turned off, acetic acid (1 mL) was added and the solvent removed under reduced pressure. The residue was azeotroped with toluene three times to leave a crude ester. Sodium hydride (0.120 g of a 60% oil suspension, 3.00 mmol) was added to a stirred solution of the crude ester in N,N-dimethylformamide (5 mL) under nitrogen and the , mixture stirred for 3 h. Water (50 mL) was added and the pH adjusted to 1-2 by adding IM aqueous hydrochloric acid slowly. The precipitate was filtered, washed with water and ether, then dried to give the title compound (0.147 g, 41%) as a solid. !H NMR (400MHz, d6-DMSO) δ 15.06 (IH, s), 14.51 (IH, s), 12.50 (IH, s), 7.93 (IH, d, J = 8.0 Hz), 7.81-7.75
(2H, m), 7.70 (IH, m), 7.62 (IH, d, J = 7.7 Hz), 7.55 (IH, m), 7.49 (IH, m). b) 2-[3-( 1 , 1-Dioxo-l ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy-2- oxo-2H-quinolin-l-yl]-N,N-dimethylacetamide: Sodium hydride (0.016 g of a 60% oil suspension, 0.400 mmol) was added to a stirred suspension of 3-( 1,1 -dioxo- 1,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy-lH-quinolin-2-one (0.050 g, 0.139 mmol) in N,N-dimethylformamide (2 mL) under nitrogen. 2-Chloro-N,N- dimethylacetamide (0.025 g, 0.206 mmol) was added and the mixture stirred at 100°C in a microwave synthesiser for 0.5 h. Acetic acid (0.5 mL) was added, followed by water (10 mL) slowly, then the precipitate filtered, dried and purified by flash chromatogaphy (silica gel, 1% methanol/dichloromethane, then ethyl acetate, then 5% methanol/dichloromethane) to give the title compound (0.024 g, 39%) as a solid. 2H NMR (400MHz, dg-DMSO) δ 15.21 (IH, br s), 14.25 (IH, br s), 7.90-7.89 (2H, m), 7.73-7.51 (5H, m), 5.23 (2H, s), 3.18 (3H, s), 2.88 (3H, s).
Example 17 1 -(3,3-Dimethyl-2-oxobutyl)-3-( 1 , 1-dioxo-l ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-6- fluoro-4-hydroxy-lH-quinolin-2-one
Following the procedure of Example 16b), except substituting l-bromo-3,3- dimethyl-2-butanone for of 2-chloro-N,N-dimethylacetamide, the title compound was obtained (50%) as a solid. !H NMR (400MHz, d6-DMSO) δ 15.11 (IH, br s), 13.89 (IH, br s), 7.96-7.93 (2H, m), 7.78-7.75 (2H, m), 7.62 (IH, d, J = 8.2 Hz), 7.56 (IH, t, J = 7.6 Hz), 7.46 (IH, m), 5.55 (2H, s), 1.31 (9H, s).
Example 18 2- { 3- [ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamidine a) 2-{3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]fhiadiazin-7-yloxy } acetonitrile : Powdered potassium carbonate (0.278 g, 2.01 mmol) was added to a stirred solution of l-(2-cyclopropylethyl)-6- fluoro-4-hydroxy-3-(7-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH- quinolin-2-one (example 15, 0.255 g, 0.575 mmol) in dimethylformamide (5 mL) at 100 °C under argon. After 5 min, chloroacetonitrile (0.051 mL, 0.805 mmol) was injected and stirring continued for 2 h. The mixture was cooled and acetic acid (1.5 mL) added followed by water (45 mL) slowly. The precipitate was filtered, washed with water and ether and dried to give the title compound (0.233 g, 84%) as a powder. MS(ES+) m/e 483 [M+H]+ b) 2- { 3-[ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetamidine: Ethanol (0.5 mL, 8.5 mmol) was added to a stirred mixture of 2-{3-[l-(2-cyclopropylethyl)-6-fluoro-4- hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-7- yloxy} acetonitrile (0.233 g, 0.483 mmol) and 4M hydrogen chloride in dioxane (3 mL, 12.0 mmol). After stirring 18 h, the mixture was cooled in ice and 2M methanolic ammonia (20 mL, 40 mmol) added rapidly. The mixture was stirred a further 4 h while warming to room temperature, then evaporated under reduced pressure. The residue was chromatographed (silica gel, 10-50% methanol/dichloromethane, then 70% methanol/dichloromethane + 2% acetic acid) to give a solid which was slurried in 20% methanol/water (30 mL), then filtered, washed (10% methanol/water) and dried to give the title compound (0.045 g, 19%) as a solid. !H NMR (400MHz, d6-DMSO) δ 16.09 (IH, s), 9.05 (4H, br s), 7.78 (IH, dd, J = 9.5,
3.0 Hz), 7.39-7.34 (3H, m), 7.28-7.23 (2H, m), 5.02 (2H, s), 4.16 (2H, m), 1.46 (2H, m), 0.79 (IH, m), 0.43 (2H, m), 0.11 (2H, m).
Example 19
3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo- l,4-dihydrobenzo[l,2,4]thiadiazine-7-carboxamidine a) 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- l,l~dioxo-l,4-dihydrobenzo[l,2,4]thiadiazine-7-carbonitrile: A mixture of l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo- 1 , 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one (Example 9a), 0.300g, 0.542 mmol), zinc cyanide (0.127 g, 1.08 mmol), tetrakis(triphenylphosphine)palladium(0) (0.055 g, 0.048 mmol) and dimethylformamide (5 mL) was stirred under argon in an oil bath at 105 °C for 18 h, then cooled and diluted with water (50 mL). The precipitate was filtered off, washed with water and ether, then dried. A sample (0.060 g) of this solid was boiled in ethyl acetate (15 mL) for 15 min, then cooled, filtered, washed (ethyl acetate) and dried to give the title compound (0.032 g, 63%) as a solid. !H NMR (400MHz, dg-DMSO) δ 8.14 (IH, br s), 7.95
(IH, m), 7.77 (IH, dd, J = 9.3, 2.5 Hz), 7.47 (IH, d, J = 8.6 Hz), 7.44-7.42 (2H, m), 4.18 (2H, m), 1.49 (2H, m), 0.79 (IH, m), 0.43 (2H, m), 0.12 (2H, m). b) 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazine-7-carboxamidine: A 2M solution of trimethylaluminium in toluene (1.65 mL, 3.30 mmol) was injected into a stirred mixture of powdered ammonium chloride (0.180 g, 3.37 mmol) and dioxane (5 mL) under argon. The mixture was stirred at room temperature for 45 min and at 70 °C for 20 min then transferred by cannula to a flask containing 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazine-7-carbonitrile (0.226 g, 0.500 mmol) under argon. This mixture was stirred at 70 °C for 18 h and under reflux for 3 h, then cooled. IM aqueous hydrochloric acid (40 mL) was added slowly with cooling followed by water (10 mL). The solid was filtered, washed with IM aqueous HCI and water and dried, then chromatographed (silica gel, 10-20% methanol/dichloromethane, 30-70% methanol/dichloromethane + 1% acetic acid, 70% methanol/dichloromethane + 10% dimethylformamide) to give a product which was slurried in 20% methanol/water (25 mL), then filtered, washed (20% methanol/water, water, ether) and dried to give the title compound (0.034 g, 14%) as a cream solid. ]H NMR (400MHz, d6-DMSO) δ 9.35 (2H, br s), 8.88 (2H, br s), 8.21 (IH, d, J = 1.9 Hz), 7.95 (IH, dd, J = 8.6, 1.9 Hz), 7.78 (IH, dd, J = 9.5, 2.9 Hz), 7.54 (IH, d, J = 8.7 Hz), 7.45-7.37 (2H, m), 4.18 (2H, m), 1.48 (2H, m), 0.80 (IH, m), 0.42 (2H, m), 0.11 (2H, m).
Example 20 4-{3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-2,4-dioxobutyric acid, methyl ester
The product of Example 9b) (325 mg, 0.693 mmol) and dimethyl oxalate (122 mg, 1.04 mmol) in N,N-dimethylformamide (5.0 mL) was treated with sodium hydride (55 mg, 1.38 mmol, 60%). The reaction mixture was stirred at room temperature for lh and at 50 °C for 4h. After cooling to room temperature, 3M aqueous hydrochloric acid (10 mL) was added and the resulting solution was extracted with chloroform (3 x 30 mL). The organic layers were combined, dried over magnesium sulfate, and the solvent removed en vacuo.
Purification by flash chromatography (slica gel, 10% methanol/dichloromethane) gave the title compound as a brown solid (201 mg, 52%) ]H NMR (CDC13) δ 15.0 (s, IH), 14.9 (s, IH), 8.5 (d, 7 = 2.0 Hz, IH), 8.2 (dd, 7 = 8.8 and 2.0 Hz, IH), 7.81 (dd, 7= 8.4 and 2.8 Hz, IH), 7.42-7.36 (m, IH), 7.36-7.28 (m, IH), 7.0 (s, IH), 4.5 (m, 2H), 3.85 (s, 3H), 3.83 (s, 2H), 1.6 (m, 2H), 0.8 (m, IH), 0.5 (m, 2H), 0.1 (m, 2H). MS(ES+) m/e 556 [M+H]+.
Example 21 5 3-(l,l-Dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3-methylbutyl)-8- nitro- 1 H-quinolin-2-one a) 2-(3-Methyl-butylamino)-3-nitrobenzoic acid: Copper(II) bromide (68.1 mg, 0.30 mmol) was added to a suspension of 2-bromo-3-nitro-benzoic acid (1.0 g, 4.06 mmol), isoamylamine (0.495 mL, 4.26 mmol) and potassium carbonate (1.4 g, 10.2 mmol) in
10 tetrahydrofuran (15 mL). The reaction mixture was stirred at reflux overnight, cooled to rt, poured in IM aqueous hydrochoric acid and the pH adjusted to 9.0 by the addition of 2.5M aqueous sodium hydroxide. The mixture was then filtered and the filtrate was made acidic (pH 4-5) by the addition of IM aqueous hydrochloric acid. The precipitate was collected, washed with water and dried to give the desired product (710 mg, 69%) as yellow crystals.
15 !H NMR (dg-DMSO) δ 13.56 (bs, IH); 8.57 (bs, IH); 8.09-7.97 (m, 2H); 6.75-6.73 (m, IH); 2.88-2.86 (m, 2H); 1.65-1.42 (m, 3H); 0.84 (d, J = 6.3 Hz, 6H). b) l-(3-Methyl-butyl)-8-nitro-lH-benzo[<7|[l,3]oxazine-2,4-dione: Triphosgene (294 mg, 0.99 mmol) was added portionwise to a warmed (35 °C) suspension of 2-(3- methyl-butylamino)-3-nitrobenzoic acid (500 mg, 1.98 mmol) and potassium carbonate (411
20 mg, 2.97 mmol) in ethyl acetate (10.0 mL). The suspension was stirred at 35 °C for 1.0 h, cooled to 0 °C and treated with water. The organic layer was separated, washed with brine, dried over sodium sulfate and evaporated to give the title compound as yellow powder. !H NMR (d6-DMSO) δ 8.28 (dd, J = 7.8, 1.6 Hz, IH); 8.26 (dd, J = 7.8, 1.5 Hz, IH); 7.49 (t, J = 7.9 Hz, IH); 3.67-3.63 (m, 2H); 1.53-1.47 (m, 3H); 0.84 (d, J = 6.5 Hz, 6H). 5 c) 3-( 1 , 1-Dioxo- 1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- 1-(3- methylbutyl)-8-nitro-lH-quinolin-2-one: Sodium hydride (60% dispersion in mineral oil, 81.4 mg, 2.04 mmol) was added to a suspension of the compound from Example 21b) (195 mg) and (1,1 -dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester (145 mg, 0.539 mmol) in tetrahydrofuran (7.0 mL). The suspension was heated to reflux and allowed
■'0 to stir at this temperature for 2 h. After cooling to room temperature, glacial acetic acid (3.0 mL) was carefully added and the mixture was refluxed for an additional hour. It was cooled to room temperature and poured into IM aqueous hydrochloric acid. The solid obtained was collected by filtration, washed with water, then diethyl ether and dried to give the title compound as a yellow powder (140 mg, 57% yield). JH NMR (d6-DMSO) δ 13.59
35 (br s, IH); 8.46 (dd, J = 7.8, 1.6 Hz, IH); 8.26 (dd, J = 7.9, 1.6 Hz, IH); 7.91 (d, J = 7.3 Hz, IH); 7.75 (ddd, J = 8.2, 7.3, 1.3 Hz, IH); 7.64 (d, J = 7.8 Hz, IH); 7.57-7.52 (m, 2H); 3.97- 3.94 (m, 2H); 1.51-1.43 (m, 3H); 0.84 (d, J = 6.1 Hz, 6H). MS(ES+) m/e 457 [M+H]+.
Examples 22-23 5 2-[3-( 1 , 1 -Dioxo- 1 ,4-dihydro-benzo[l ,2,4] thiadiazin-3-yl)-4-hydroxy- l-(3-methyl-butyl)-2- oxo- 1 ,2-dihydro-quinolin-5-yloxy] -acetamide and [3-( 1 , 1 -Dioxo- 1 ,4-dihydro- benzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3-methyl-butyl)-2-oxo-l,2-dihydro-quinolin-5- yloxy]-acetic acid ethyl ester
The title compounds of this invention, 2-[3-(l,l-dioxo-l,4-dihydro- 10 benzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3-methyl-butyl)-2-oxo-l,2-dihydro-quinolin-5- yloxy] -acetamide and [3-( 1 , 1 -dioxo- 1 ,4-dihydro-benzo [ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- 1 - (3-methyl-butyl)-2-oxo-l,2-dihydro-quinolin-5-yloxy]-acetic acid ethyl ester, may be prepared by one skilled in the art by routine derivitaization of 3-( 1,1 -dioxo- 1,4- dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-4,5-dihydroxy- l-(3-methylbutyl)- lH-quninolin-2-one, 15 which may be prepared by the following procedure: a) 5-(tert-Butyldimethylsilyloxy)-l-benzo[d][l,3]oxazine-2,4-dione: To a solution of 5-hydroxy isatoic anhydride (5.0 g, 27.9 mmol) in anhydrous N,N-dimethylformamide (20 mL) are added imidazole (2.85 g, 41.9 mmol) and tert-butyldimethylsilyl chloride (6.28 g, 41.9 mmol). The mixture is stirred overnight at ambient temperature prior to pouring into 20 water (50 mL). The product is extracted with ethyl acetate (3 x 30 mL), is dried over magnesium sulfate, and is concentrated in vacuo. The precipitate iss filtered and washed with ether to give the title compound as a white solid (5.8g, 70%). H NMR (400MHz, d6- DMSO) δ 11.6 (s, IH), 7.31 (dd, IH, J = 3, 9 Hz), 7.25 (d, IH, J = 3 Hz), 7.09 (d, IH, J = 9
Hz), 0.95 (s, 9H), 0.19 (s, 6H). MS(ES+) m/e 294 [M+H]+
25 b) 5-(tert-Butyldimethylsilyloxy)- l-(3-methylbutyl)- lH-benzo[d] [ 1 ,3]oxazine-2,4- dione: To a solution of the compound from Example 223a) (2.0 g, 6.8 mmol) in anhydrous N,N-dimethylformamide (20 mL) is added sodium hydride (60% dispersion in mineral oil) (548 mg, 13.7 mmol) followed by l-iodo-3-methylbutane (1.8 mL, 13.7 mmol). The mixture is stirred overnight at ambient temperature prior to pouring into ice water. The
^ product is extracted with ethyl acetate, is dried over magnesium sulfate, and is concentrated in vacuo to give the title compound as a yellow oil (2.2 g, 91%), which is used without further purification. MS(ES+) m/e 364 [M+H]+. c) 3-( 1 , 1 -Dioxo-1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-4,5-dihydroxy- 1-(3- methylbutyl)-lH-quninolin-2-one: Sodium hydride (60% dispersion in mineral oil) (37.2 mg, 0.93 mmol) is added to a mixture of the compound from Example 22b) (112 mg, 0.31 mmol) and ethyl l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl-acetate (prepared by the method of Kovalenko, S. N.; Chernykh, V. P.; Shkarlat, A. E.; Ukrainets, I. V.; Gridasov, V. I.; Rudnev, S. A. Chem. Heterocycl. Compd. (Engl. Trans.) 1998, 34, 791, in anhydrous N,N-dimethylformamide (10.0 mL). The mixture is heated to 80 °C under a nitrogen atmosphere for 3h, is cooled to ambient temperature, and is acidified with acetic acid. The mixture is again heated to 80 °C for an additional lh, is cooled to ambient temperature, and is diluted with water. The product is extracted with ethyl acetate, is dried ver magnesium sulfate, and is concentrated in vacuo to give the title compound as a yellow solid. 1H NMR (400MHz, d6-DMSO) δ 15.1 (s, IH), 14.6 (s, IH), 10.0 (s, IH), 7.93 (d, IH, J = 7 Hz), 7.77 (dd, IH, J = 7, 8 Hz), 7.69 (dd, IH, J = 1, 8 Hz), 7.56 (dd, IH, J = 1, 8 Hz), 7.55 (m, IH), 7.52 (d, IH, J = 3 Hz), 7.39 (ddd, IH, J =1, 8, 9 Hz), 4.31 (m, 2H), 1.78 (m, IH), 1.54 (m,
2H), 1.00 (d, 6H, J = 7 Hz). MS(ES+) m/e 429 [M+H]+.
Example 24
5-Amino-3-( 1 , 1-dioxo- 1 ,4-dihydro-benzo[ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- 1-(3- methyl-butyl)- lH-quinolin-2-one
The compond of this invention, 5-amino-3-(l,l-dioxo-l,4-dihydro- benzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3-methyl-butyl)-lH-quinolin-2-one, may be prepared by reduction of 3-(l, 1-dioxo- l,4-dihydro-l-benzo[l, 2, 4]fhiadizain-3-yl)-4- hydroxy-l-(3-methylbutyl)-5-nitro-lH-quinolin-2-one, which may be prepared by the following proceduire. a) 2-(3-Methylbutylarnino)-6-nitrobenzoic acid: Isoamylamine (3.5 mL, 30 mmol) was added to a mixture of 2-chloro-6-nitro-benzoic acid (1 g, 5 mmol), potassium carbonate (1.38 g, 10 mmol) and copper (II) oxide (50 mg, 0.35 mmol). The mixture was refluxed overnight. The excess isoamylamine was removed under reduced pressure, water (50 mL) and activated carbon (2 g) were added to the residue and the mixture was refluxed for lh and filtered. The precipitate was collected after acidification and purified by chromatography (silica gel, gradient, 0-10% methanol/chloroform) to give the title compound as a yellow solid. (480 mg, 38%). MS(ES+) m/e 253 [M+H]+. b) l-(3-Methylbutyl)-5-nitro-lH-benzo[l,3]oxazine-2,4-dione: Triphosgene (94 mg, 0.32 mmol) was added to a solution of the product of Example 28a) (160 mg, 0.64 mmol) in tetrahydrofuran (10 mL). The mixture was refluxed for 3 h, cooled down to room temperature, and poured into ice water. The precipitate was collected and washed with water and ether to give the title compound as a yellow solid (50 mg, 28%). The title compound was used in next reaction without purification. c)3-(l, l-Dioxo-l,4-dihydrobenzo[l, 2, 4] thiadizain-3-yl)-4-hydroxy-l-(3- methylbutyl)-5-nitro-lH-quinolin-2-one: Sodium hydride (60% dispersion in mineral oil) (125 mg, 3.12 mmol) was added to a mixture of the compound from Example 28b) (290 mg, 1.04 mmol) and ethyl-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-3-yl acetate (278 mg, 1.04 mmol) (prepared by the method of Kovalenko, S. N.; Chernykh, V. P.; Shkarlat, A. E.; Ukrainets, I. V.; Gridasov, V. I.; Rudnev, S. A. Chem. Heterocycl Compd. (Engl. Trans.) 1998, 34, 791) in anhydrous dimethylformamide (10.0 mL). The mixture was heated to 80°C under a nitrogen atmosphere for 3 h, cooled to ambient temperature, and acidified with glacial acetic acid. The mixture was again heated to 80 °C for an additional 1 h, cooled to room temperature and diluted with water. The product was extracted with ethyl acetate, dried over magnesium sulfate, and concentrated in vacuo. The residue was washed with acetone and filtered to give the title compound as a yellow solid (110 mg, 27%). ^H NMR (400MHz, 6-DMSO) δ 14.1 (s, IH), 8.15 (t, J = 8.7 Hz, IH), 8.06 (dd, J = 7.6, 6.6 Hz, 2H), 7.92 (m, IH), 7.86 (dd, J = 7.6, 8.1 Hz, 2H), 7.71 (m, IH), 4.52 (t, J = 8.3 Hz, 2H), 1.96 (m,
IH), 1.71 (m, 2H), 1.17 (d, J = 6.6 Hz, 6H). MS(ES+) m/e 457 [M+H]+.
Example 25 l-(2-Cyclopropyl-ethyl)-3-[l,l-dioxo-7-(2-oxo-pyrrolidin-3-yloxy)-l,4-dihydro- benzo[l,2,4]thiadiazin-3-yl]-6fluoro-4-hydroxy-lH-quinolin-2-one
The title compound (M+H = 527), can be prepared following the procedure from Example 15g), substituting toluene-4-sulfonic acid (S)-2-oxo-pyrrolidin-3-yl ester, obtained by tosylation of (S)-(-)-3-hydroxypyrrolidin-2-one (Tomooka, K.; Nakazaki, A.; Nakai, T. J. Am. Chem. Soc. 2000, 122, 408-409), for 2-bromo-acetamide.
The HCV NS5B inhibitory activity of the compounds of Formulas I, II, III and IV was determined using standard procedures well known to those skilled in the art and described in, for example Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001).
All publications, including, but not limited to, patents and patent applications cited in this specification, are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth. The above description fully discloses how to make and use the present invention. However, this invention is not limited to the particular embodiments described hereinabove, but includes all modification thereof within the scope of the appended claims and their equivalents. Those skilled in the art will recognise through routine experimentation that various changes and modifications can be made without departing from the scope of this invention.

Claims

What is claimed is:
1. A compound according to Formula I:
Figure imgf000072_0001
wherein: I
R1 is hydrogen, halogen, C Q alkyl, -OR11, -SR11, -NR10Rπ, aryl, -C(0)OH,
-C(0)NHRπ, cyano, nitro, amino, -0(Q-Q alkyl)C(0)NH2,
-0(Q-Q alkyl)C(0)NH(C C4 alkyl), -0(Q-Q alkyl)C(0)N(C C4 alkyl)(CrC4 alkyl),
-0(C C4 alkyl)C02H, or -0(Q-C4 alkyl)C02(d-C4 alkyl); R2 is hydrogen, Ci-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, nitro, cyano, halogen, -C(0)OR9, -C(0)R9, -C(0)NR9R10,
-OR9, -SR9, -S(0)R12, -S(0)2R12, -NR9R10, protected -OH, -N(R10)C(O)R9, -OC(0)NR9R10,
-N(R10)C(O)NR9R10, -P(0)(OR9)2, -S02NR9R10, -S03H, -N(R10)SO2R12, -N=CH-NH2,
-N=CH-NH(C,-Q alkyl), or -N=CH-N(C C4 alkyl)2, where said Q-Q alkyl, Q-Q alkenyl or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -SH,
-OCi-Q alkyl, -Sd-Q alkyl, -NR10Rπ, cyano, nitro, -C02R10, -C(0)OQ-Q alkyl,
-CONR10Rπ, -CONH2, aryl, and heteroaryl, and where said cycloalkyl, heterocycloalkyl, aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, d-Q haloalkyl, halogen, -OH, -SH, -NH2, -OQ-Q alkyl, -SQ-C4 alkyl,
-N(Q-Q alkylXd-Q alkyl), -NH(Q-C4 alkyl), cyano, nitro, -C02H, -C(0)OCrQ alkyl,
-CON(C Q alkyl)(CrQ alkyl), -CONH(Q-Q alkyl) and -CONH2;
R3 is hydrogen, halogen, cyano, Q-Q alkyl, -OH, or -C02H; R4 and R6 are each independently selected from the group consisting of hydrogen, halogen, cyano, Q-Q alkyl, -OH, -OQ-Q alkyl, Q-Q haloalkyl, nitro and amino;
R5 is selected from the group consisting of hydrogen, halogen, cyano, Q-Q alkyl,
-OH, and -OQ-C4 alkyl;
R7 is hydrogen, Q-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, C3-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, nitro, cyano, halogen, -C(0)OR9, -C(0)R9, -C(0)NR9R10,
-OR9, -SR9, -S(0)R12, -S(0)2R12, -NR9R10, protected -OH, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10, -P(0)(0R9)2, -S02NR9R10, -S03H, -N(R10)SO2R12, -C(OQ-C4
Figure imgf000073_0001
alkyl), -C(H)=C(C02Q-Q alkyl)(NHCO(Q-Q alkyl)), -O-Q-Q alkyl-C(0)NH-d-Q alkyl-C(0)NH2, -0-C C4 alkyl-C(0)NH-C C3 alkyl-C(0)NHC C4 alkyl, -O-d-Q alkyl-C(0)NH-d-C3 alkyl-C(0)N(Q-C4 alkyl)2, -0-CrC4 alkyl-C(0)N(d-C4 alkyl)-Q-Q alkyl-C(0)NH2, -O-d-Q alkyl-C(0)N(Q-Q alkyl)-Q-C3 alkyl-C(0)NHQ-C4 alkyl, -O-d-Q alkyl-C(0)N(Q-Q alkyl)-Q-C3 alkyl-C(0)N(C,-C4 alkyl)2, -O-d-Q alkyl-C(=NH)NH2, -0-C C4 alkyl-C(=NH)NH(Q-Q alkyl), -O-d-Q alkyl-C(=NH)N(C C4 alkyl)2,
-0-C C4 alkyl-C(=N(d-Q alkyl))NH(Q-Q alkyl),
-0-C C4 alkyl-C(=N(Q-C4 alkyl))N(Q-C4 alkyl)2, -C(=NH)NH2,
-C(=NH)NH(CrC4 alkyl), -C(=NH)N(Q-C4 alkyl)2, -C(=N(Q-C4 alkyl))NH(CrC4 alkyl),
-C(=N(C Q alkyl))N(Q-C4 alkyl)2, or -C(0)-Q-Q alkyl-C(0)C02(Q-C4 alkyl), where said Q-Q alkyl, Q-Q alkenyl or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -SH, -OQ-Q alkyl, -SQ-Q alkyl, -NR10Rn, cyano, nitro, -C02H, -C(0)OQ-Q alkyl, -CONR10Rπ, -CONH2, -0-C(0)NH2, -0-C(0)NHQ-Q alkyl, -0-C(0)N(Q-Q alkyl)2, aryl, heteroaryl, heterocycloalkyl, -C(0)aryl, -C(0)heterocycloalkyl, and -C(0)heteroaryl, where said aryl, heteroaryl, heterocycloalkyl, aryl, -C(0)aryl, -C(0)heterocycloalkyl, or
-C(0)heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-C4 alkyl, Q-Q haloalkyl, halogen, -OH, -SH, -NH2, -OQ-Q alkyl, -SQ-Q alkyl, -N(Q-Q alkyl)(Q-Q alkyl), -NH(CrQ alkyl), cyano and nitro, and where said cycloalkyl, heterocycloalkyl, aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OH, -SH, -NH2, -OCrQ alkyl, -SCrQ alkyl, -N(Q-Q alkyl)(Q-C alkyl), -NH(Cι-Q alkyl), cyano, nitro, oxo(as a substituent for cycloalkyl, heterocycloalkyl, or heteroaryl), -C02H, -C(0)OQ-Q alkyl, -CON(C Q alkyl)(Cι-Q alkyl), -CONH(Q-Q alkyl), -CONH2, -NHC(0)Q-Q alkyl, and -N(Q-Q alkyl)C(0)Q-C4 alkyl or R7 is -O-Q-Q cycloalkyl, -O-heterocycloalkyl, -0-heteroaryl, -O-Q-Q alkyl-Q-Q cycloalkyl, -O-Q-Q alkyl-heterocycloalkyl, -O-Q-Q alkyl-heteroaryl, where any of said cycloalkyl, heterocycloalkyl, or heteroaryl is substituted by oxo and is optionally substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rπ, -OCONR10Rn, -SO2NR10Rπ, and -COR11;
R8 is hydrogen, halogen, hydroxyl, Q-Q alkyl, -C(0)OR9, -C(0)R9, -C(0)NR9R10, -OR14, -NR9R10, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10 or -N(R10)SO2R12; or R1 and R2 or R5 and R6 or R6 and R7 or R7 and R8 taken together are alkylenedioxy;
W is hydrogen, -C(0)ORn, Q-C10 alkyl, Q-Q0 alkenyl, C2-Q0 alkynyl, C3-C6 cycloalkyl, -(d-Q alkyl)-(Q-Q cycloalkyl), -(C2-C6 alkenyl)-(Q-Q cycloalkyl), -(C2-C6 alkynyl)-(C3-C6 cycloalkyl), -(Q-Q alkyl)-heterocycloalkyl, -(Q-Q alkenyl)-heterocycloalkyl, -(Q-Q alkynyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, (Q-Q alkenyl)-aryl, -(Q-Q alkynyl)-aryl, -(Q-Q alkyl)-heteroaryl, -(Q-Q alkenyl)-heteroaryl, or -(Q-Q alkynyl)-heteroaryl, where said Q-Qo alkyl, C2-d0 alkenyl, Q-Q0 alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, cyano, -OH, -OQ-Q alkyl, -SH, -SQ-Q alkyl, -S(0)(Q-Q alkyl), -S03H, -S(0)2(Q-Q alkyl), -C(0)Q-Q alkyl, or -C(0)N(Q-Q alkyl)2, said Q-Q cycloalkyl is unsubstituted or substituted with one or more substituents independently selected from halogen, cyano, Q-Q alkyl, -OH, -OQ-Q alkyl, -SH, -SQ-Q alkyl, -S(0)(Q-Q alkyl), -S03H, and -S(0)2(Q-Q alkyl), and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of said
-(Q-Q alkyl)-(Q-Q cycloalkyl), -(Q-Q alkenyl)-(Q-Q cycloalkyl), -(Q-Q alkynyl)-(Q-Q cycloalkyl), -(Q-Q alkyl)-heterocycloalkyl, -(Q-Q alkenyl)-heterocycloalkyl, -(Q-Q alkynyl)-heterocycloalkyl, -(Q-Q alkyl)-aryl, (Q-Q alkenyl)-aryl, -(Q-Q alkynyl)-aryl, -(Q-Q alkyl)-heteroaryl, -(Q-Q alkenyl)-heteroaryl, or -(Q-Q alkynyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, cyano, nitro, -OH, -NH2, -OCrQ alkyl, -N(Q-Q alkyι)(Q-Q alkyl), and -NH(d-Q alkyl); X is O or S; Y is -OH or -SH;
Z is hydrogen or Q-Q alkyl; wherein each R9 is independently selected from the group consisting of hydrogen, Q-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, and -Q-Q alkyl-heteroaryl, -Q-Q alkenyl-Q-Q cycloalkyl, -Q-Q alkenyl-heterocycloalkyl, -Q-Q alkenyl-aryl, -Q-Q alkenyl-heteroaryl,
-Q-Q alkynyl-Q-Q cycloalkyl, -Q-Q alkynyl-heterocycloalkyl, -Q-Q alkynyl-aryl, and
-Q-Q alkynyl-heteroaryl, where said Q-Q alkyl, Q-Q alkenyl, or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OR11, -NR10Rn, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rn, -OCONR10Rn, -SO2NR10Rπ, and -COR11, and where any of said cycloalkyl, heterocycloalkyl, aryl or heteroaryl (including the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moieties of said -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, or -Q-Q alkyl-heteroaryl) is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OR11, -NR10Rπ, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rπ, -OCONR10Rn, -SO2NR10Rn, and -COR11; each R10 is independently selected from hydrogen and Q-Q alkyl; each R11 is independently selected from the group consisting of hydrogen,
Q-Q alkyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, or -Q-Q alkyl-heteroaryl where said cycloalkyl, heterocycloalkyl, aryl , heteroaryl, -alkylcycloalkyl, -alkylheterocycloalkyl, -alkylaryl or -alkylheteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen -OQ-Q alkyl, -OQ-Q haloalkyl, cyano, -N(Q-Q alkyl)(Q-C6 alkyl), -NH(Q-Q alkyl), -NH2, -C02Q-Q alkyl, -C02H, -CON(C Q alkyl)(Q-Q alkyl), -CONH(Q-Q alkyl), and -CONH2; or, when present in any NR9R10 or NR^R1 ! , each R9 and R10 or each R10 and R11 , independently, taken together with the nitrogen to which they are attached represent a 3-6-membered saturated ring optionally containing one other heteroatom selected from oxygen and nitrogen, where said 3-6-membered ring is unsubstituted or substituted with one or more substituents independently selected from hydrogen, Q-Q alkyl, halogen, cyano, -OQ-Q alkyl, -OH, -N(Q-Q alkyl)(Q-Q alkyl), -NH(Q-Q alkyl), -NH2, -C02H, -C(0)OQ-Q alkyl, -C(0)Q-Q alkyl, -CON(Q-Q alkyl)(Q-Q alkyl), -CONH(Q-Q alkyl), -CONH2, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, Q-Q cycloalkyl-Q-Q alkyl-, heterocycloalkyl-Q-Q alkyl-, aryl-Ci-Q alkyl- and heteroaryl-Q-Q alkyl-, and where said cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylalkyl-, heterocycloalkylalkyl-, arylalkyl- or heteroarylalkyl- is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen -OQ-Q alkyl, -OQ-Q haloalkyl, cyano, -N(Q-Q alkylXQ-Q alkyl), -NH(Q-Q alkyl), -NH2, -C02Q-Q alkyl, -C02H, -CON(Q-Q alkyl)(d-Q alkyl), -CONH(C C6 alkyl), and -CONH2; each R12 is independently selected from the group consisting of Q-Q alkyl,
Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, and -Q-Q alkyl-heteroaryl, -Q-Q alkenyl-Q-Q cycloalkyl, -Q-Q alkenyl-heterocycloalkyl, -Q-Q alkenyl-aryl, -Q-Q alkenyl-heteroaryl, -Q-Q alkynyl-Q-Q cycloalkyl, -Q-Q alkynyl-heterocycloalkyl, -Q-Q alkynyl-aryl, and -Q-Q alkynyl-heteroaryl, where said Q-Q alkyl, Q-Q alkenyl, or Q-Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OR13, -NR10R13, cyano, nitro, -C02R13, -CONR10R13, -NR10CONR10R13, -OCONR10R13, -SO2NR10R13, and -COR13, and where any of said cycloalkyl, heterocycloalkyl, aryl or heteroaryl (including the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moieties of said -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, or -Q-Q alkyl-heteroaryl) is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OR13, -NR10R13, cyano, nitro, -C02R13, -CONR10R13, -NR10CONR10R13, -OCONR10R13, -SO2NR10R13, and -COR13; each R13 is independently selected from the group consisting of hydrogen, Q-Q alkyl, Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, and -Q-Q alkyl-heteroaryl; and and R14 is selected from the group consisting of substituted Q-Q alkyl and substituted or unsubstituted Q-Q alkenyl, Q-Q alkynyl, Q-Q cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -Q-Q alkyl-Q-Q cycloalkyl, -Q-Q alkyl-heterocycloalkyl, -Q-Q alkyl-aryl, -Q-Q alkyl-heteroaryl, -Q-Q alkenyl-Q-Q cycloalkyl, -Q-Q alkenyl-heterocycloalkyl, -Q-Q alkenyl-aryl, -Q-Q alkenyl-heteroaryl, -Q-Q alkynyl-Q-Q cycloalkyl,
-Q-Q alkynyl-heterocycloalkyl, -Q-Q alkynyl-aryl or -Q-Q alkynyl-heteroaryl, where said substituted Q-Q alkyl, Q-Q alkenyl, or Q-Q alkynyl is substituted with one or more substituents independently selected from halogen, -OR11, -NR10Rn, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rn, -OCONR10Rn, -SO2NR10Rπ, and -COR11, and where any of said cycloalkyl, heterocycloalkyl, aryl or heteroaryl is unsubstituted or substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OR11, -NR10Rn, cyano, nitro, -C02Rπ, -CONR10Rπ, -NR10CONR10Rπ, -OCONR10Rn, -SO2NR10Rπ, and -COR11; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows: wherein:
R1 is amino, -0(Q-Q alkyl)C(0)NH2, -0(C C4 alkyl)C(0)NH(CrC4 alkyl), -0(Q-C4 alkyl)C(0)N(Q-Q alkyl)(Q-C4 alkyl), -0(CrC4 alkyl)C02H, or -0(Q-Q alkyl)C02(Q-C4 alkyl); R2 is -N=CH-NH2, -N=CH-NH(CrC4 alkyl), or -N=CH-N(Q-Q alkyl)2;
R4 is Q-Q haloalkyl, nitro or amino;
R6 is Q-Q haloalkyl, nitro or amino;
R7 is -C(OQ-Q alkyl)=C(H)(C02Q-Q alkyl), -C(H)=C(C02C C4 alkyl)(NHCO(Q-C4 alkyl)), -O-Q-Q alkyl-C(0)NH-Q-Q alkyl-C(0)NH2,
-O-Q-C4 alkyl-C(0)NH-Q-Q alkyl-C(0)NHQ-C4 alkyl, -O-Q-Q alkyl-C(0)NH-Q-C3 alkyl-C(0)N(Q-Q alkyl)2, -0-Q-C4 alkyl-C(0)N(C C4 alkyl)-Q-C3 alkyl-C(0)NH2, -O-Q-Q alkyl-C(0)N(C C4 alkyl)-Q-Q alkyl-C(0)NHQ-C4 alkyl, -O-Q-Q alkyl-C(0)N(Q-Q alkyl)-Q-C3 alkyl-C(0)N(Q-Q alkyl)2, -0-Q-C4 alkyl-C(=NH)NH2, -0-Q-C4 alkyl-C(=NH)NH(Q-C4 alkyl), -O-Q-Q alkyl-C(=NH)N(Q-C4 alkyl)2, -O-Q-Q alkyl-C(=N(d-Q alkyl))NH(CrC4 alkyl), -0-Q-C4 alkyl-C(=N(Q-Q alkyl))N(Q-C4 alkyl)2, -C(=NH)NH2, -C(=NH)NH(Q-Q alkyl), -C(=NH)N(Q-C4 alkyl)2, -C(=N(CrC4 alkyl))NH(Q-Q alkyl), -C(=N(C C4 alkyl))N(C C4 alkyl)2, -C(0)-Q-Q alkyl-C(0)C02(Q-Q alkyl), a Cι-C8 alkyl, Q-Q alkenyl or Q-Q alkynyl group substituted with -0-C(0)NH2, -0-C(0)NHQ-Q alkyl or -0-C(0)N(Q-Q alkyl)2, a cycloalkyl, heterocycloalkyl, aryl or heteroaryl substituted with at least one substituent independently selected from oxo(as a substituent for cycloalkyl, heterocycloalkyl, or heteroaryl), -NHC(0)Q-Q alkyl, and -N(Q-Q alkyl)C(0)Q-Q alkyl, or a -O-Q-Q cycloalkyl, -O-heterocycloalkyl, -O-heteroaryl, -O-Q-Q alkyl-Q-Q cycloalkyl, -O-Q-Q alkyl-heterocycloalkyl, -O-Q-Q alkyl-heteroaryl group substituted by oxo, and optionally substituted with one or more substituents independently selected from Q-Q alkyl, Q-Q haloalkyl, halogen, -OR11, -NR10Rn, cyano, nitro, -C02Rn, -CONR10Rπ, -NR10CONR10Rn, -OCONR10Rn, -SO2NR10R11, and -COR11;
R8 is -C(0)OR9, -C(0)R9, -C(0)NR9R10, -OR14, -NR9R10, -N(R10)C(O)R9, -OC(0)NR9R10, -N(R10)C(O)NR9R10 or -N(R10)SO2R12;
W is Q-Qo alkyl substituted with -C(0)Q-Q alkyl or -C(0)N(Q-Q alkyl)2; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
2. The compound according to claim 1, wherein: R1 is hydrogen, halogen, Q-Q alkyl, aryl, -ORa, -C(0)OH, -C(0)NHRa, cyano, nitro, amino, -0(Q-Q alkyl)C(0)NRaRa or -0(Q-Q alkyl)C02Ra;
R2 is hydrogen, halogen, Q-C2 alkyl, -0Rb', -NHRb', N02, or -N=CH-N(Q-Q alkyl)2, where Rb'is H or Q-Q alkyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, - OH, -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl), and unsubstituted monocyclic heteroaryl; or R1 and R2 taken together are methylenedioxy;
R3 is H, halogen or -C(0)OH;
R4 is H, halogen, Q-Q alkyl or nitro; R5 is H, halogen, Q-Q alkyl, or -ORa;
R6 is H, halogen, C Q alkyl, Q-Q haloalkyl or -ORa;
R7 is hydrogen, halogen, -C Q alkyl, -Q alkenyl, -C(0)ORa', -C(0)Ra', -ORb",
-NRaRd', -C(0)NRaRd',
R7 is -C(OQ-C2 alkyl)=C(H)(C02Q-C2 alkyl), -C(H)=C(C02Q-Q alkyl)(NHCO(C,-C2 alkyl)),
-0-Q-C2 alkyl-C(0)NH-Q-Q alkyl-C(0)NH2,
-0-C C2 alkyl-C(0)NH-Q-C3 alkyl-C(0)NHQ-C2 alkyl,
-O-Q-Q alkyl-C(0)NH-Q-Q alkyl-C(0)N(Q-C2 alkyl)2, -O-d-Q alkyl-C(=NH)NH2,
-0-Q-C2 alkyl-C(=NH)NH(Q-C2 alkyl), -O-Q-Q alkyl-C(=NH)N(Q-Q alkyl)2, -C(=NH)NH2, -C(=NH)NH(Q-Q alkyl), -C(=NH)N(CrC2 alkyl)2,
-C(0)-Cι-C2 alkyl-C(0)C02(Q-Q alkyl), 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro- isoxazol-3-yl, or 2-[(Q-Q alkyl)C(0)NH-]thiazol-4-yl-; where said -Q-Q alkyl or said -Q alkenyl is unsubstituted or substituted with a substituent selected from -NH2 and -CONH2, Ra is H or methyl, Rb is H or Q-Q alkyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -NH2, -C02H, -CONH2, -C(0)OQ-Q alkyl, -CON(Cι-C4 alkyl)(CrC4 alkyl), -CONH(CrQ alkyl), -OC(0)NH2, -OC(0)NH(Q-C2 alkyl), -OC(0)N(Q-Q alkyl)2, monocyclic heteroaryl, -C(0)monocyclic heterocycloalkyl, and -C(0)monocyclic heteroaryl, where said heteroaryl, -C(0)heterocycloalkyl, or -C(0)heteroaryl are unsubstituted or substituted one or more of Q-Q alkyl, halogen, cyano, -OH, -NH2, and -CONH2, Rd' is H or Q-Q alkyl, where the Q-Q alkyl is unsubstituted or substituted by a substituent selected from the group consisting of cyano and unsubstituted aryl, or Ra and Rd taken together with the nitrogen atom to which they are attached form a 5- or 6-membered heterocycloalkyl ring, which optionally contains an additional nitrogen heteroatom and which is unsubstituted or substituted with -C(0)Q-Q alkyl;
R8 is hydrogen, -ORb8, -NHRb8, where Rb8 is H or Q-Q alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl), or -CON(Q-Q alkyl)2, or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl) or -CON(C Q alkyl)2;
W is Q-Q alkyl, Q alkenyl, Q alkynyl, W is -Q-Q alkyl-C(0)Q-Q alkyl, -Q-Q alkyl-C(0)N(Q-Q alkyl)2, -(Q-Q alkyl)-(Q-Q cycloalkyl), -(Q alkyl)-heterocycloalkyl, -(Ci alkyl)-aryl, or -(Q alkyl)-heteroaryl, where the
Q-Q alkyl, Q alkenyl or Q alkynyl is unsubstituted or substituted with one or more substituents independently selected from halogen, -OH, -OCH3, -SCH3, and where the cycloalkyl, heterocycloalkyl, aryl or heteroaryl moiety of the -(Q-Q alkyl)-(Q-Q cycloalkyl), -(Q-Q alkyl)-he.erocycloalkyl, -(Q-Q alkyl)-aryl, or -(Q-Q alkyl)-heteroaryl is unsubstituted or substituted with one or more substituents independently selected from -CH3, halogen, nitro, cyano, -ORa, -NRaRa; X is O; Y is OH; and Z is H; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows: wherein: R1 is amino, -0(Q-Q alkyl)C(0)NH2, -0(Q-Q alkyl)C(0)NH(Q-Q alkyl),
-0(Q-Q alkyl)C(0)N(Q-C4 alkyl)(Q-Q alkyl), -0(Q-C2 alkyl)C02H, or -0(Q-Q alkyl)C02(Q-C4 alkyl).
R2 is -N=CH-N(Q-Q alkyl)2; R4 is nitro; R6 is C1-C4 haloalkyl; R7 is -C(OQ-Q alkyl)=C(H)(C02Q-Q alkyl), -C(H)=C(C02CrC2 alkyl)(NHCOCrC2 alkyl), -(Q-Q alkyl)-0-C(0)NH2, -0(C C2 alkyl)C(0)NH-Q-C2 alkyl-C(0)NH2, -0(Q-Q alkyl)C(0)NH-Q-C2 alkyl-C(0)NHQ-Q alkyl, -0(Q-Q alkyl)C(0)NH-CrC2 alkyl-C(0)N(C C2 alkyl)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-;
R8 is, -ORbS, -NHRb8, where Rb8 is Q-Q alkyl or Q-Q alkenyl, where the Q-Q alkyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of cyano, -OH, -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl), or -CON(Q-Q alkyl)2, or the Q-Q alkenyl is optionally unsubstituted or substituted by a substituent selected from the group consisting of -C02H, -CONH2, -C(0)OQ-Q alkyl, -CONH(Q-Q alkyl) or -CON(Q-Q alkyl)2.; or
W is -Q-Q alkyl-C(0)Q-Q alkyl or -Q-Q alkyl-C(0)N(Q-Q alkyl)2; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
3. The compound according to claim 1, wherein:
R1 is H, phenyl, -CH3, -OCH3, -N02, -NH2, F, Cl, Br, -OH, -C(0)OH, -C(0)NHCH3, -OCH2C(0)NH2 or -OCH2C02CH2CH3;
R2 is H F, Cl, -OH, -NH2, N02, -CH3, -OCH3, -NHCH3, -0(CH2)20H, -NH(CH2)2OH, -OCH2CN, -NHCH2CN, -OCH2CONH2, -N=CH-N(CH3)2, -NHCH2C02H, -NHCH2C02Et, or -NHCH2(2-furyl); or R1 and R2 taken together are methylenedioxy;
R3 is H or halogen;
R4 is H or nitro; R5 is H, halogen or -OH;
R6 is H or CF3;
R7 is H, F, Cl, -CH3, -CH2NH2, -CH2CH2CONH2, -C(H)=C(H)(C(0)NH2), -C(OCH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl- oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-acetamidothiazol-4-yl-, -OH, -OCH3, -0(CH2)2NH2, -OCH2CH((R)-NH2)CH2CH3, -OCH2CN, -OC(CH3)2CONH2, -OCH2C02CH3, -OCH2CONH2, -OCH2CONHCH3, -OCH2CON(CH3)2, -OCH2C02H, -OCH2C(0)(3-pyridinyl), -OCH2C(0)(N-pyrrolidinyl), -OCH2C(0)(N-morpholinyl), -OCH2(5-methyl-l,3,4-oxadiazol-2-yl), -OCH(CH3)CONH2, -OCH2-tetrazol-5-yl, -NH2, -N(CH3)2, -NHCH2CN, -NHCH2Ph, -C02CH3, -C02H, -C(0)NH2, -C(0)NHCH3, -C(0)N(CH3)2, -CHO, -C(0)(N-acetylpiperizinyl), or -C(0)(N-pyrrolidinyl);
R8 is H, -OCH3, -OCH2CONH2, or -OCH=CHCONH2,
W is -(CH2)2CH(CH3)2, -(CH2)2C(CH3)3, -(CH2)2CH(CH3)CH2CH3, -(CH2)2CH=CH2, -(CH2)2C≡CH, -(CH2)3CF3, -(CH2)2CH(CH3)(CF3), -(CH2)2CHBrCH3, -(CH2)4OH, -(CH2)2CH(CH3)OCH3, -(CH2)2SCH3, -CH2C(0)C(CH3)3, -CH2C(0)N(CH3)2,-CH2(cyclopropyl), -(CH2)2(cyclopropyl), -CH2(2-CH3-cycloprop-l-yl), -CH2(cyclobutyl), -CH2(cyclopentyl), -CH2(cyclohexyl), -CH2(3-Br-phenyl), -(CH2(3-N02-phenyl), -CH2(4-Br-phenyl), -CH2(3-furyl), -(CH2)2(3-thienyl), -CH2(4-pyridyl), or -CH2(2-CH3-4-pyridinyl) ;
X is O; Y is OH; Z is H; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows, wherein:
R1 is -NH2, -OCH2C(0)NH2 or -OCH2C02CH2CH3; R2 is -N=CH-N(CH3)2;
R4 is nitro;
R6 is -CF3;
R7 is -C(OCH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-;
R8 is -OCH3, -OCH2CONH2, or -OCH=CHCONH2; or
W is -CH2C(0)C(CH3)3 or -CH2C(0)N(CH3)2, tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
4. The compound according to claim 1, wherein:
R1 is H, -NH2, -OCH2C(0)NH2 or -OCH2C02CH2CH3; R2 is H F, or -N=CH-N(CH3)2; R3 is H; R4 is H or nitro; R5 is H or Cl;
R6 is H or CF3;
R7 is H, -C(0CH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3), -CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, 2-acetamidothiazol-4-yl-, nitro or -OCH2CN; R8 is H, -OCH3, -OCH2CONH2, or -OCH=CHCONH2;
W is -(CH2)2CH(CH3)2, -CH2C(0)C(CH3)3, -CH2C(0)N(CH3)2, or -(CH2)2(cyclopropyl);
X is O; Y is OH; Z is H; provided that at least one of R1, R2, R4, R6 R7, R8 or W is defined as follows, wherein:
R1 is -NH2, -OCH2C(0)NH2 or -OCH2C02CH2CH3;
R2 is -N=CH-N(CH3)2;
R4 is nitro;
R6 is -CF3; R7 is -C(OCH2CH3)=C(H)(C02CH2CH3), -C(H)=C(C02CH3)(NHCOCH3),
-CH2OC(0)NH2, -CH2OC(0)NHCH2C(0)N(CH3)2, -OCH2C(0)NHCH2C(0)N(CH3)2, 2-oxo-pyrrolidin-3-yl-oxy, 5-oxo-4,5-dihydro-isoxazol-3-yl, or 2-acetamidothiazol-4-yl-;
R8 is -OCH3, -OCH2CONH2, or -OCH=CHCONH2; or
W is -CH2C(0)C(CH3)3 or -CH2C(0)N(CH3)2, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
5. A compound according to any one of claims 1-4, having the formula:
Figure imgf000082_0001
or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
6. A compound according to any one of claims 1-4, having the formula:
Figure imgf000082_0002
or a tautomer thereof, or a pharmaceutically aceptable salt or solvate thereof.
7. A compound according to any one of claims 1-4, having the formula:
Figure imgf000083_0001
or a tautomer thereof, or a pharmaceutically aceptable salt or solvate thereof.
8. A compound selected from the group consisting of:
5 N'-[3-(7-cyanomethoxy- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-4- hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-6-yl]-N,N-dimethylformamidine;
3-ethoxy-3- { 3-[4-hydroxy- l-(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1,1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}acrylic acid ethyl ester;
(rac)-2-acetylamino-3-{3-[4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin- 10 3-yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-acrylic acid methyl ester; 6-fluoro-4-hydroxy- 1 -(3-methylbutyl)-8-nitro-3-(7-nitro- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one;
6-fluoro-4-hydroxy-3-(8-methoxy- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3- yl)-l-(3-methylbutyl)-lH-quinolin-2-one; 15 2- { 3- [6-fluoro-4-hydroxy- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1,1- dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy } acetamide;
2- { 5-chloro-3-[ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2- dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]fhiadiazin-8-yloxy } acetamide; N-(4-{3-[6-fluoro-4-hydroxy-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]- 20 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yl }thiazol-2-yl)acetamide;
N-(4-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-thiazol-2-yl)acetamide;
(E)-3- { 5-chloro-3- [ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2- dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy } acrylamide; 25 l-(2-cyclopropylethyl)-3-( 1 , l-dioxo-6-trifluoromethyl- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy-lH-quinolin-2-one;
1 -(2-cyclopropylethyl)-3-[ 1 , l-dioxo-7-(5-oxo-4,5-dihydro-isoxazol-3-yl)- 1 ,4- dihydrobenzo [ 1 ,2,4] thiadiazin-3 -yl] -6-fluoro-4-hydroxy- 1 Η-quinolin-2-one ;
2-{3-[l-(2-cycloρropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- ^0 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-8-yloxy }acetamide; carbamic acid, 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2- dihydroquinolin-3-yl]-l,l-dioxo-l,4-dihydro-benzo[l,2,4]thiadiazin-7-yl, methyl ester;
2-{[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-7-yloxy } -H-dimethylcarbamoylmethylacetamide ; 2-[3-(l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-6-fluoro-4-hydroxy-2-oxo-
2H-quinolin-l-yl]-N,N-dimethylacetamide; l-(3,3-dimethyl-2-oxobutyl)-3-(l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)- 6-fluoro-4-hydroxy-lH-quinolin-2-one;
2- { 3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamidine;
3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazine-7-carboxamidine;
4-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-2,4-dioxobutyric acid, methyl ester; 3-( 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-3-yl)-4-hydroxy- 1 -(3 - methylbutyl)-8-nitro-lH-quinolin-2-one; l-(2-cyclopropyl-ethyl)-3-[l,l-dioxo-7-(2-oxo-pyrrolidin-3-yloxy)-l,4-dihydro- benzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one;
2-[3-( 1 , 1 -dioxo-1 ,4-dihydro-benzo[ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- l-(3-methyl- butyl)-2-oxo-l,2-dihydro-quinolin-5-yloxy]-acetamide;
[3-( 1 , 1 -dioxo- 1 ,4-dihydro-benzo [ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- 1 -(3-methyl- butyl)-2-oxo-l,2-dihydro-quinolin-5-yloxy]-acetic acid ethyl ester; or
5-amino-3-(l,l-dioxo-l,4-dihydro-benzo[l,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3- methyl-butyl)- 1 H-quinolin-2-one or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
9. A pharmaceutically acceptable salt of the compound according to claim 7, or tautomer thereof, wherein said pharmaceutically acceptable salt is a sodium salt or a potassium salt.
10. A method of inhibiting an RNA-containing virus which comprises contacting said virus with an effective amount of the compound according to any one of claims 1 to 9.
11. A method of treating infection caused by an RNA-containing virus which comprises administering to a subject in need thereof an effective amount of the compound according to any one of claims 1 to 9.
12. A method according to claim 11 comprising treating an HCV infection.
13. A method according to claim 10 or claim 11 comprising inhibiting hepatitis C virus.
14. A method according to claim 11, wherein said HCV infection is acute hepatitis infection, chronic hepatitis infection, hepatocellular carcinoma or liver fibrosis.
15. A method according to claim 11 comprising treating an infection caused by Dengue, HIV or a picornavirus.
16. A method according to claim 11 comprising administering said compound in combination with one or more agents selected from the group consisting of an immunomodulatory agent and an antiviral agent.
17. A method according to claim 16, wherein the immunomodulatory agent is selected from the group consisting of alpha interferon, beta interferon, gamma interferon, a cytokine, a vitamin, a nutritional supplement, an antioxidant compound, a vaccine and a vaccine comprising an antigen and an adjuvant.
18. A method according to claim 11 comprising administering said compound in combination with an interferon.
19. A method according to claim 11 comprising administering said compound in combination with an interferon and ribavirin.
20. A method according to claim 11 comprising administering said compound in combination with an interferon and levovirin.
21. A method according to claim 11 comprising administering said compound in combination with an HCV antisense agent.
22. A method according to claim 11 comprising administering said compound in combination with an immunoglobulin, a peptide-nucleic acid conjugate, an oligonucleotide, a ribozyme, a polynucleotide, an anti-inflammatory agent, a pro-inflammatory agent, an antibiotic or a hepatoprotectant.
23. A method for inhibiting replication of hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, said method comprising contacting a cell infected with said virus with an effective amount of the compound according to any one of claims 1 to 9.
24. A method of treating infection caused by hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, said method comprising administering to a subject in need thereof an effective amount of the compound according to any one of claims 1 to 9.
25. The method according to claim 23, wherein said compound substantially equally inhibits positive strand HCV-RNA replication and negative strand HCV-RNA replication.
26. The method according to claim 24, wherein said compound substantially equally inhibits positive strand HCV-RNA replication and negative strand HCV-RNA replication.
PCT/US2003/039983 2002-12-11 2003-12-11 Anti-infectives WO2004052313A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003300957A AU2003300957A1 (en) 2002-12-11 2003-12-11 Anti-infectives

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US43246202P 2002-12-11 2002-12-11
US60/432,462 2002-12-11

Publications (2)

Publication Number Publication Date
WO2004052313A2 true WO2004052313A2 (en) 2004-06-24
WO2004052313A3 WO2004052313A3 (en) 2004-09-02

Family

ID=32507933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/039983 WO2004052313A2 (en) 2002-12-11 2003-12-11 Anti-infectives

Country Status (2)

Country Link
AU (1) AU2003300957A1 (en)
WO (1) WO2004052313A2 (en)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006117306A1 (en) 2005-05-04 2006-11-09 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
US7479489B2 (en) 2004-08-23 2009-01-20 Roche Palo Alto Llc Heterocyclic antiviral compounds
US7531534B2 (en) 2006-02-17 2009-05-12 Roche Palo Alto Llc Heterocyclic antiviral compounds
US7576103B2 (en) 2004-12-21 2009-08-18 Roche Palo Alto Llc Tetralin and indane derivatives and uses thereof
US7754759B2 (en) 2005-11-03 2010-07-13 Roche Palo Alto Llc Arylsulfonyl chromans as 5-HT6 inhibitors
WO2010100178A1 (en) 2009-03-06 2010-09-10 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010122082A1 (en) 2009-04-25 2010-10-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010149598A2 (en) 2009-06-24 2010-12-29 F. Hoffmann-La Roche Ag Heterocyclic antiviral compound
WO2011033045A1 (en) 2009-09-21 2011-03-24 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011058084A1 (en) 2009-11-14 2011-05-19 F. Hoffmann-La Roche Ag Biomarkers for predicting rapid response to hcv treatment
WO2011061243A1 (en) 2009-11-21 2011-05-26 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011067195A1 (en) 2009-12-02 2011-06-09 F. Hoffmann-La Roche Ag Biomarkers for predicting sustained response to hcv treatment
EP2361922A1 (en) 2006-10-10 2011-08-31 Medivir AB Intermediate to HCV-Nucleoside Inhibitors
WO2012110789A1 (en) 2011-02-15 2012-08-23 Isis Innovation Limited Method for assaying ogfod1 activity
WO2013014449A1 (en) 2011-07-28 2013-01-31 Isis Innovation Limited Assay for histidinyl hydroxylase activity
WO2014148949A1 (en) 2013-03-22 2014-09-25 Асави, Ллс Alkyl 2-{[(2r,3s,5r)-5-(4-amino-2-oxo-2н-pyrimidin-1-yl)-3-hydroxy- tetrahydro-furan-2-yl-methoxy]-phenoxy-phosphoryl-amino}-propionates, nucleoside inhibitors of hcv ns5b rna-polymerase, and methods for producing and use thereof
CN105294648A (en) * 2015-11-30 2016-02-03 山东罗欣药业集团股份有限公司 Preparation method of sitafloxacin

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001085172A1 (en) * 2000-05-10 2001-11-15 Smithkline Beecham Corporation Novel anti-infectives

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001085172A1 (en) * 2000-05-10 2001-11-15 Smithkline Beecham Corporation Novel anti-infectives

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7479489B2 (en) 2004-08-23 2009-01-20 Roche Palo Alto Llc Heterocyclic antiviral compounds
US7576103B2 (en) 2004-12-21 2009-08-18 Roche Palo Alto Llc Tetralin and indane derivatives and uses thereof
US7674810B2 (en) 2005-05-04 2010-03-09 Roche Palo Alto Llc 1,1-dioxo-1H-1Λ6-benzo[d]isothiazol-3-yl)-4-hydroxy-1,5-dihydro-pyrrol-2-one inhibitors of HCV polymerase
WO2006117306A1 (en) 2005-05-04 2006-11-09 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
US7754759B2 (en) 2005-11-03 2010-07-13 Roche Palo Alto Llc Arylsulfonyl chromans as 5-HT6 inhibitors
US7531534B2 (en) 2006-02-17 2009-05-12 Roche Palo Alto Llc Heterocyclic antiviral compounds
EP2361922A1 (en) 2006-10-10 2011-08-31 Medivir AB Intermediate to HCV-Nucleoside Inhibitors
WO2010100178A1 (en) 2009-03-06 2010-09-10 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010122082A1 (en) 2009-04-25 2010-10-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010149598A2 (en) 2009-06-24 2010-12-29 F. Hoffmann-La Roche Ag Heterocyclic antiviral compound
WO2011033045A1 (en) 2009-09-21 2011-03-24 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011058084A1 (en) 2009-11-14 2011-05-19 F. Hoffmann-La Roche Ag Biomarkers for predicting rapid response to hcv treatment
WO2011061243A1 (en) 2009-11-21 2011-05-26 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011067195A1 (en) 2009-12-02 2011-06-09 F. Hoffmann-La Roche Ag Biomarkers for predicting sustained response to hcv treatment
WO2012110789A1 (en) 2011-02-15 2012-08-23 Isis Innovation Limited Method for assaying ogfod1 activity
WO2013014449A1 (en) 2011-07-28 2013-01-31 Isis Innovation Limited Assay for histidinyl hydroxylase activity
WO2014148949A1 (en) 2013-03-22 2014-09-25 Асави, Ллс Alkyl 2-{[(2r,3s,5r)-5-(4-amino-2-oxo-2н-pyrimidin-1-yl)-3-hydroxy- tetrahydro-furan-2-yl-methoxy]-phenoxy-phosphoryl-amino}-propionates, nucleoside inhibitors of hcv ns5b rna-polymerase, and methods for producing and use thereof
CN105294648A (en) * 2015-11-30 2016-02-03 山东罗欣药业集团股份有限公司 Preparation method of sitafloxacin

Also Published As

Publication number Publication date
AU2003300957A8 (en) 2004-06-30
AU2003300957A1 (en) 2004-06-30
WO2004052313A3 (en) 2004-09-02

Similar Documents

Publication Publication Date Title
US20040147739A1 (en) Novel anti-infectives
WO2004052313A2 (en) Anti-infectives
WO2003059356A2 (en) Novel anti-infectives
KR100847181B1 (en) Heterocyclic antiviral compounds
US20040034041A1 (en) Novel anti-infectives
EP1805172A1 (en) 4-methoxymethyl-pyrrolidine-2-carboxylic acid compounds and derivatives thereof as hepatitis c virus inhibitors
WO2009003009A1 (en) Substituted pyrrolidine as anti-infectives
EP1440068A1 (en) Acyl dihydro pyrrole derivatives as hcv inhibitors
WO2007088148A1 (en) Derivatives of thiophene carboxilic acid as antiviral agent
WO2004058150A2 (en) Anti-infectives
WO2003099801A1 (en) Novel anti-infectives
AU2006243245A1 (en) Heterocyclic antiviral compounds
WO2007039145A1 (en) C (2) -heteroarylmethyl-c (4) -pyrazinyl-2-yl acyl pyrrolidine compounds and their use for treating viral infections, especially hepatitis c virus
WO2003037262A2 (en) Novel anit-infectives
WO2004096210A1 (en) Acylated indoline and tetrahydroquinoline derivatives as hcv inhibitors
WO2007039142A1 (en) C (2) -heteroarylmethyl-c (4) -methoxymethyl acyl pyrrolidine compounds and their use for treating viral infections, especially hepatitis c virus
WO2005103045A1 (en) Acyl dihydro pyrrole derivatives as hcv inhibitors
WO2004052312A2 (en) Anti-infectives
WO2004096774A1 (en) Acyl isoindoline derivatives and acyl isoquinoline derivatives as anti-viral agents
EP1812431A1 (en) 4-(pyrazine-2-yl)-pyrrolidine-2-carboxylic acid compounds and derivatives thereof as hepatitis c virus inhibitors
WO2006100106A1 (en) 3-carboxy pyrroles as anti-viral agents
WO2003097646A1 (en) Acyl bicyclix derivatives of pyrrol
AU2002345636A1 (en) Novel anti-infectives
WO2004009543A2 (en) 1-carbonyl-4-cyano-pyrrolidine-2-carboxylic acid derivatives as hepatitis c virus inhibitors
WO2004076415A1 (en) 1- (hetero)aroyl-pyrrolidine-2-carboxylic acid derivatives useful as anti.viral agents

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AU BA BB BR BZ CA CN CO CR CU DM DZ EC EG GD GE HR ID IL IN IS JP KP KR LC LK LR LT LV MA MG MK MN MX NO NZ OM PH PL RO SC SG TN TT UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP