WO2004052312A2 - Anti-infectives - Google Patents

Anti-infectives Download PDF

Info

Publication number
WO2004052312A2
WO2004052312A2 PCT/US2003/039982 US0339982W WO2004052312A2 WO 2004052312 A2 WO2004052312 A2 WO 2004052312A2 US 0339982 W US0339982 W US 0339982W WO 2004052312 A2 WO2004052312 A2 WO 2004052312A2
Authority
WO
WIPO (PCT)
Prior art keywords
dioxo
thiadiazin
hydroxy
benzo
fluoro
Prior art date
Application number
PCT/US2003/039982
Other languages
French (fr)
Other versions
WO2004052312A3 (en
Inventor
Deping Chai
Kevin J. Duffy
Duke M. Fitch
Antony N. Shaw
Rosanna Tedesco
Kenneth J. Wiggall
Michael N. Zimmerman
Original Assignee
Smithkline Beecham Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation filed Critical Smithkline Beecham Corporation
Priority to AU2003300956A priority Critical patent/AU2003300956A1/en
Publication of WO2004052312A2 publication Critical patent/WO2004052312A2/en
Publication of WO2004052312A3 publication Critical patent/WO2004052312A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals

Definitions

  • the present invention relates to compounds that inhibit an RNA-containing virus and methods of making and using the same. Specifically, the present invention relates to inhibitors of hepatitis C virus (HCV).
  • HCV hepatitis C virus
  • HCV infection is responsible for 40-60% of all chronic liver disease and 30% of all liver transplants. The CDC estimates that the number of deaths due to HCV will minimally increase to 38,000/yr. by the year 2010.
  • Alpha-interferon (alone or in combination with ribavirin) has been widely used since its approval for treatment of chronic HCV infection.
  • adverse side effects are commonly associated with this treatment: flulike symptoms, leukopenia, thrombocytopenia, and depression from interferon, as well as hemolytic anemia induced by ribavirin (Lindsay, K.L. (1997) Hepatology 26 (Suppl. 1):71S-77S).
  • HCV post- transfusion non A, non-B hepatitis
  • HCV is an enveloped virus containing a single strand RNA molecule of positive polarity.
  • the HCV genome is approximately 9.6 kilobases (kb) with a long, highly conserved, noncapped 5' nontranslated region (NTR) of approximately 340 bases which functions as an internal ribosome entry site (IRES) (Wang, C.Y., Le, S.Y., Ali, N., Siddiqui, A., Rna-A Publication of the Rna Society. 1(5): 526-537, 1995 Jul). This element is followed by a region which encodes a single long open reading frame (ORF) encoding a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins.
  • ORF long open reading frame
  • the HCV-RNA Upon entry into the cytoplasm of the cell, the HCV-RNA is directly translated into a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins. This large polypeptide is subsequently processed into the individual structural and nonstructural proteins by a combination of host and virally-encoded proteinases (Rice, CM. (1996) in B.N. Fields, D.M.Knipe and P.M. Howley (Eds.) Virology, 2nd Edition, p931- 960, Raven Press, NY).
  • 3 'NTR which roughly consists of three regions: an - 40 base region which is poorly conserved among various genotypes, a variable length poly(U)/polypyrimidine tract, and a highly conserved 98 base element also called the "3'X-tail" (Kolykhalov, A. et al, (1996) J. Virology 70:3363-3371; Tanaka, T. et al, (1995) Biochem Biophys. Res. Commun. 215:744-749; Tanaka, T. et al., (1996) J. Virology 70:3307-3312; Yamada, N. et al, (1996) Virology 223:255-261).
  • the 3' NTR is predicted to form a stable secondary structure that is essential for HCV growth in chimps and is believed to function in the initiation and regulation of viral RNA replication.
  • the NS5B protein (591 amino acids, 65 kDa) of HCV (Behrens, S.E., et al, (1996) EMBO J. 15:12-22), encodes an RNA-dependent RNA polymerase (RdRp) activity and contains canonical motifs present in other RNA viral polymerases.
  • RdRp RNA-dependent RNA polymerase
  • the NS5B protein is fairly well conserved both intra-typically (-95-98% amino acid (aa) identity across lb isolates) and inter-typically (-85% aa identity between genotype la and lb isolates).
  • HCV NS5B RdRp activity for the generation of infectious progeny virions has been formally proven in chimpanzees (Kolykhalov, A.A., et al, (2000) J. Virology 74:2046-2051).
  • inhibition of NS5B RdRp activity is predicted to cure HCV infection.
  • Positive strand hepatitis C viral RNA is the nucleic acid strand that is translated and initially copied upon entry of the HCV-RNA into the cell. Once in the cell, positive strand viral RNA generates a negative strand replicative intermediate.
  • Negative strand RNA is the template used to generate the positive strand message that is generally packaged into productive virions.
  • HCV inhibitor compounds are only evaluated for their ability to inhibit positive strand HCV-RNA. However, it would be desirable to develop inhibitor compounds having the ability to inhibit both positive and negative strand replication to obtain complete clearance of the HCV virus.
  • This invention is directed to a compound: 2- ⁇ 3-[ l-(3,3-dimethylbutyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-7-yloxy ⁇ acetamide; 3-[7-( 1 -butoxy vinyl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo[ 1 ,2,4]thiadiazin-3-yl] -4-hydroxy- 1 -(3 -methylbutyl)- 1 H-quinolin-2- one ; 2- ⁇ 3 - [4-hy droxy-6-methy 1- 1 -(3 -methy lbuty l)-2-oxo- 1 , 2-dihydroquinolin
  • This invention is also directed to a prodrug of said compound, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • this invention is directed to pharmaceutical compositions comprising said compound, or a tautomer thereof, or a prodrug thereof, or a salt or solvate thereof.
  • this invention is directed to a method of inhibiting an RNA- containing virus comprising contacting the virus with an effective amount of said compound.
  • this invention is directed to a method of treating infection or disease caused by an RNA-containing virus which comprises administering to a subject in need thereof, an effective amount of said compound.
  • This invention is particularly directed to methods of inhibiting hepatitis C virus.
  • This invention is also directed to a method for inhibiting replication of hepatitis C virus which comprises inhibiting replication of both positive and negative strand HCV-RNA.
  • the compounds of this invention may contain at least one chiral center and may exist as single stereoisomers (e.g., single enantiomers), mixtures of stereoisomers (e.g. any mixture or enantiomers or diastereomers) or racemic mixtures thereof. All such single stereoisomers, mixtures and racemates are intended to be encompassed within the broad scope of the present invention.
  • Compounds identified herein as single stereoisomers are meant to describe compounds that are present in a form that are at least 90% enantiomerically pure. Where the stereochemistry of the chiral carbons present in the chemical structures illustrated herein is not specified, the chemical structure is intended to encompass compounds containing either stereoisomer of each chiral center present in the compound.
  • Such compounds may be obtained synthetically, according to the procedures described herein using optically pure (enantiomerically pure) or substantially optically pure materials.
  • these compounds may be obtained by resolution/separation of a mixture of stereoisomers, including racemic mixtures, using conventional procedures.
  • Exemplary methods that may be useful for the resolution/separation of mixtures of stereoisomers include chromatography and crystallization/re-crystallization. Other useful methods may be found in "Enantiomers, Racemates, and Resolutions, " J. Jacques et al., 1981, John Wiley and Sons, New York, NY, the disclosure of which is incorporated herein by reference.
  • the compounds of this invention may possess one or more unsaturated carbon- carbon double bonds. All double bond isomers, both the cis (Z) and trans (E) isomers, and mixtures thereof are intended to be encompassed within the scope of the present invention.
  • pharmaceutically acceptable salt is intended to describe a salt that retains the biological effectiveness of the free acid or base of a specified compound and is not biologically or otherwise undesirable.
  • a desired salt may be prepared by any suitable method known in the art, including treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or with an organic acid, such as acetic acid, trifluoroacetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acid, such as glucuronic acid or galacturonic acid, alpha-hydroxy acid, such as citric acid or tartaric acid, amino acid, such as aspartic acid or glutamic acid, aromatic acid, such as benzoic acid or cinnamic acid, sulfonic acid, such as p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid or the like.
  • an inorganic acid such
  • Examples of pharmaceutically acceptable salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates succinates, suberates, sebacates, fumarates, maleates, butyne-l,4-dioates, hexyne- 1,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, phenylacetates, phenylpropionates, phenylbutrates, citrates, lactates, ⁇ -hydroxybutyrates, glycollates, tartrates mandelates,
  • an inventive compound is an acid
  • a desired salt may be prepared by any suitable method known to the art, including treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary, or tertiary), an alkali metal or alkaline earth metal hydroxide, or the like.
  • an inorganic or organic base such as an amine (primary, secondary, or tertiary), an alkali metal or alkaline earth metal hydroxide, or the like.
  • suitable salts include organic salts derived from amino acids such as glycine and arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as ethylene diamine, dicyclohexylamine, ethanolamine, piperidine, morpholine, and piperazine, as well as inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium.
  • Particular pharmaceutically acceptable salts of a compound of this invention include the sodium salt and the potassium salt.
  • pharmaceutically acceptable salts may be prepared by treating these compounds with an alkaline reagent or an acid reagent, respectively. Accordingly, this invention also provides for the conversion of one pharmaceutically acceptable salt of a compound of this invention, e.g., a hydrochloride salt, into another pharmaceutically acceptable salt of a compound of this invention, e.g., a sodium salt.
  • solvate is intended to mean a pharmaceutically acceptable solvate form of a specified compound that retains the biological effectiveness of such compound.
  • solvates include compounds of the invention in combination with water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine.
  • inventive compounds, salts, or solvates may exist in different crystal forms, all of which are intended to be within the scope of the present invention and specified formulas.
  • prodrugs of the compounds of this invention are also included within the scope of this invention.
  • prodrug is intended to mean a compound that is converted under physiological conditions, e.g., by solvolysis or metabolically, to a compound of this invention, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • a prodrug may be a derivative of one of the compounds of this invention that contains, for example, a carboxylic acid ester or amide moiety or an enol-ester moiety that may be cleaved under physiological conditions.
  • a prodrug containing such a moiety may be prepared according to conventional procedures, for example, by treatment of a compound of this invention, containing an amino, amido or hydroxyl moiety with a suitable derivatizing agent, for example, a carboxylic acid halide or acid anhydride, or by converting a compound of this invention, containing a carboxyl moiety to an ester or amide or by converting a compound of this invention, containing a carboxylic acid ester moiety to an enol-ester.
  • a suitable derivatizing agent for example, a carboxylic acid halide or acid anhydride
  • Prodrugs of the compounds of this invention may be determined using techniques known in the art, for example, through metabolic studies. See, e.g., "Design of Prodrugs," (H. Bundgaard, Ed.) 1985, Elsevier Publishers B.V., Amsterdam, The Netherlands.
  • the present invention is directed to a method of inhibiting an RNA-containing virus which comprises contacting the virus with an effective amount of a compound of this invention.
  • This invention is also directed to a method of treating infection or disease caused by an RNA-containing virus comprising administering to a subject in need thereof, an effective amount of the compound of this invention.
  • this invention is directed to a method of inhibiting HCV activity, comprising contacting the virus with an effective amount of a compound of this invention, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • HCV activity may be inhibited in mammalian tissue by administering to a subject in need thereof a compound of this invention or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • a therapeutically "effective amount” is intended to mean that amount of a compound that, when administered to a mammal in need of such treatment, is sufficient to effect treatment, as defined herein.
  • a therapeutically effective amount of a compound of this invention or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof is a quantity of an inventive agent that, when administered to a mammal in need thereof, is sufficient to modulate or inhibit the activity of HCV such that a disease condition which is mediated by that activity is reduced, alleviated or prevented.
  • the amount of a given compound that will correspond to such an amount will vary depending upon factors such as the particular compound (e.g., the potency (IC 50 ), efficacy (EC 50 ), and the biological half-life of the particular compound), disease condition and its severity, the identity (e.g., age, size and weight) of the mammal in need of treatment, but can nevertheless be routinely determined by one skilled in the art.
  • the particular compound e.g., the potency (IC 50 ), efficacy (EC 50 ), and the biological half-life of the particular compound
  • disease condition and its severity e.g., the identity of the mammal in need of treatment, but can nevertheless be routinely determined by one skilled in the art.
  • duration of treatment and the time period of administration (time period between dosages and the timing of the dosages, e.g., before/with/after meals) of the compound will vary according to the identity of the mammal in need of treatment (e.g., weight), the particular compound and its properties (e.g., pharmaceutical characteristics), disease or condition and its severity and the specific composition and method being used, but can nevertheless be determined by one of skill in the art.
  • this invention is directed to a method for inhibiting replication of hepatitis C viras comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises contacting a cell infected with said virus with an effective amount of a compound of this invention.
  • This invention is also directed to a . method of treating infection or disease caused by hepatitis C viras comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises administering to a subject in need thereof, an effective amount of a compound of this invention.
  • this invention is directed to a method of inhibiting replication of both positive and negative strand HCV-RNA with a compound of this invention, wherein the compounds demonstrate substantially equal inhibition of positive strand HCV-RNA replication and negative strand HCV-RNA replication. That is, for a given compound of this invention, the IC 50 for inhibition of positive strand HCV-RNA replication is not statistically different (less than a 2-fold difference) from the IC 50 for inhibition of negative strand HCV-RNA replication. Generally, the compounds of this invention demonstrate an IC 50 for inhibition of positive strand HCV-RNA replication that is ⁇ 30% the IC 50 for inhibition of negative strand HCV-RNA replication.
  • Treating is intended to mean at least the mitigation of a disease condition (acute, chronic, latent, etc.) in a subject (a mammal, such as a human), where the disease condition is caused by an infectious RNA-containing virus.
  • the methods of treatment for mitigation of a disease condition include the use of the compounds in this invention in any conventionally acceptable manner, for example for prevention, retardation, prophylaxis, therapy or cure of a disease.
  • the compounds of this invention are particularly useful for the treatment of acute, chronic or latent HCV diseases, such as acute and chronic hepatitis infection, hepatocellular carcinoma, liver fibrosis, or other HCV-related diseases.
  • the compounds of this invention may also be useful for treatment of diseases caused by infectious RNA-containing viruses other than HCV, including, but not limited to, Dengue, HIV or picornaviruses.
  • Chronic fatigue syndrome is another disease that may be treatable using the compounds of this invention.
  • a compound of this invention, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof may be administered to a subject as a pharmaceutical composition in any pharmaceutical form that is recognizable to the skilled artisan as being suitable.
  • suitable pharmaceutical forms include solid, semisolid, liquid, or lyophilized formulations, such as tablets, powders, capsules, suppositories, suspensions, liposomes, and aerosols.
  • Pharmaceutical compositions of the invention may also include suitable excipients, diluents, vehicles, and carriers, as well as other pharmaceutically active agents, depending upon the intended use or mode of administration.
  • Administration of a compound of the this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof may be performed according to any of the generally accepted modes of administration available to those skilled in the art.
  • the compounds of this invention may be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, topical, transdermal, or transmucosal administration.
  • oral administration is preferred.
  • the compounds can be formulated into conventional oral dosage forms such as capsules, tablets and liquid preparations such as syrups, elixirs and concentrated drops.
  • injection e.g., parenteral administration
  • intramuscular, intravenous, intraperitoneal, and subcutaneous e.g., intramuscular, intravenous, intraperitoneal, and subcutaneous.
  • the compounds of the invention are formulated in liquid solutions, preferably, in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution.
  • the compounds of the invention may also be formulated in liposome-containing preparations, particularly liposome-containing preparations useful for delivery of the compounds of this invention to the liver or potentially to nonhepatic reservoirs of infection.
  • the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms can also be produced.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration for example, may be through nasal sprays, rectal suppositories, or vaginal suppositories.
  • the compounds of the invention can be formulated into ointments, salves, gels, or creams, as is generally known in the art.
  • compositions containing a compound of this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which are active when given orally can be formulated as syrups, tablets, capsules and lozenges.
  • a syrup formulation will generally consist of a suspension or solution of the compound or salt in a liquid carrier for example, ethanol, peanut oil, olive oil, glycerine or water with a flavoring or coloring agent.
  • a liquid carrier for example, ethanol, peanut oil, olive oil, glycerine or water with a flavoring or coloring agent.
  • any pharmaceutical carrier routinely used for preparing solid formulations may be used. Examples of such carriers include starch, calcium sulfate dihydrate, magnesium stearate, terra alba, talc, gelatin, acacia, stearic acid, starch, lactose and sucrose.
  • composition is in the form of a capsule
  • any routine encapsulation is suitable, for example using the aforementioned carriers in a hard gelatin capsule shell.
  • composition is in the form of a soft gelatin shell capsule
  • any pharmaceutical carrier routinely used for preparing dispersions or suspensions may be considered, for example aqueous gums, celluloses, silicates or oils, and may be incorporated in a soft gelatin capsule shell.
  • Typical parenteral compositions consist of a solution or suspension of a compound or salt in a sterile aqueous or non-aqueous carrier optionally containing a parenterally acceptable oil, for example polyethylene glycol, polyvinylpyrrolidone, lecithin, arachis oil or sesame oil.
  • Typical compositions for inhalation are in the form of a solution, suspension or emulsion that may be administered as a dry powder or in the form of an aerosol using a conventional propellant such as dichlorodifluoromethane or trichlorofiuoromethane.
  • a typical suppository formulation comprises a compound of this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which is active when administered in this way, with a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other low melting vegetable waxes or fats or their synthetic analogs.
  • a binding and/or lubricating agent for example polymeric glycols, gelatins, cocoa-butter or other low melting vegetable waxes or fats or their synthetic analogs.
  • Typical dermal and transdermal formulations comprise a conventional aqueous or non-aqueous vehicle, for example a cream, ointment, lotion or paste or are in the form of a medicated plaster, patch or membrane.
  • the composition is formulated and administered in a unit dosage form.
  • a metered aerosol dose may be administered, for transdermal application, a topical formulation or patch may be administered and for transmucosal delivery, a buccal patch may be administered.
  • a dose of the pharmaceutical composition contains at least a therapeutically effective amount of the active compound (i.e., a compound of this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof).
  • the selected dose may be administered to a mammal, for example, a human patient, in need of treatment mediated by inhibition of HCV activity by any known or suitable method of administering the dose, including: topically, for example, as an ointment, or cream, orally, rectally, for example, as a suppository, parenterally by injection, or continuously by intravaginal, intranasal, intrabronchial, intraaural, or intraocular infusion.
  • Treatment of all forms of infection or disease (acute, chronic, latent etc) or as prophylaxis with these compounds (or their salts etc.) may be achieved using the compounds of this invention as a monotherapy, in dual or multiple combination therapy, such as in combination with other antivirals, in combination with an interferon, in combination with an interferon and ribavirin or levovirin, or in combination with one or more agents which include but are not limited to: immunomodulatory agents (such as cytokines, suppressors of cytokines and/or cytokine signalling, or immune modifiers, adjuvants and the like), immunomodulatory agents that enhance the body's immune system (such as vitamins, nutritional supplements, antioxidant compositions, vaccines or immunostimulating complexes, such as vaccines comprising a multimeric presentation of an antigen and adjuvant), other direct antiviral agents, indirect antiviral agents or agents which target viral RNA and impair translation or replication or modulate signalling or cellular host factors, or host- viral interface, immunoglobul
  • an interferon is intended to mean any form of interferon, which includes, but is not limited to, natural or recombinant forms of alpha, beta or gamma interferons, albumin-linked interferons, or pegylated interferons.
  • the compounds of this invention are the compounds of Examples 1-31 or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
  • a preferred compound of this invention is 3-[7-(l-butoxyvinyl)-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-3- yl]-4-hydroxy- l-(3-methylbutyl)- 1 H-quinolin-2-one ; 2- ⁇ 3- [4-hydroxy-6-methyl- 1 -(3- methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[ 1 ,2,4]thiadiazin-7-yloxy ⁇ acetamide; 2-[3-( l-cyclobutylmethyl-4-hydroxy-2-oxo- 1 ,2- dihydroquinolin-3-yl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4
  • intermediate compounds that are useful for the preparation of the compounds of this invetion.
  • useful intermediate compounds include: (8-methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)acetic acid ethyl ester, 6-fluoro-4-hydroxy-3-(8-methoxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one, (6- chloro-7- methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (6- chloro-7-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)
  • the activity of the inventive compounds as inhibitors of ⁇ CV activity may be measured by any of the suitable methods known to those skilled in the art, including in vivo and in vitro assays.
  • the ⁇ CV NS5B inhibitory activity of the compounds of Formulas I, II and HI was determined using standard assay procedures described in Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001).
  • the compounds of this invention have demonstrated in vitro HCV NS5B inhibitory activity in such standard assays and have IC 50 's in the range of 0.0001 ⁇ M to 100 ⁇ M.
  • Representative compounds of this invention, Examples 3-6, 8, 12-14, 16, 17, and 20-23 have all demonstrated in vitro HCV NS5B inhibitory activity and have IC 50 's in the range of 0.0005 ⁇ M to .05 ⁇ M.
  • cell-based replicon systems for HCV have been developed, in which the nonstructural proteins stably replicate subgeno ic viral RNA in Huh7 cells (Lohmann et al., Science (1999) and Blight et al., Science (2000).
  • the compounds of this invention inhibit both positive and negative strand HCV-RNA replication.
  • the following methods have been developed and used for determining the positive and negative strand HCV-RNA replication inhibition activity of the compounds of this invention.
  • Test Method 1 Method for positive strand replicon HCV-RNA detection in replicon cells
  • Buffer RLT Qiagen, Valencia, California, US
  • RNA purified according to manufacturer's recommendations Qiagen RNAeasy
  • Primers and probes specific for the positive strand RNA detection of neomycin gene were: neo-forward: 5'CCGGCTACCTGCCCATTC3' (SEQ ID NO 1); neo-reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 2); neo-probe: 5'FAM- ACATCGCATCGAGCGAGCACGTAC-TAMRA3' (SEQ JD NO 3).
  • the cDNA primer used was 5 ⁇ CA TGC GCG GCA TCT AGA CCG GCT ACC TGC CCA TTC3' (SEQ ID NO 4) whereby the first 18 bases represent SEQ JD NO 5 linked to neo sequences; neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse 5'CCAGATCATCCTGATCGACAAG3' (SEQ JD NO 6); neo probe: 5FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ JD NO 3). Additionally, the PDAR control reagent human cyclophilin was used for normalization.
  • Test Method 2 Method for negative strand replicon HCV-RNA detection in replicon cells To achieve strand-specific detection, a primer containing HCV RNA (or replicon
  • RNA sequences such as neomycin gene and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction,
  • neo-forward tag 5'ACA TGC GCG GCA TCT AGA3' (SEQ JD NO 5); neo reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ JD NO 6); and neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ JD NO 3).
  • N-(4-Methoxy-2-sulfamoylphenyl)malonamic acid ethyl ester A mixture of 2- amino-5-methoxybenzenesulfonamide (9.1 g, 45 mmol) and diethyl malonate (14 mL, 92 mmol) were heated together at 160 °C for 1 h. The mixture was cooled and diluted with diethyl ether to give the title compound as a solid (8.5 g, 60%).
  • Example 2 3-[7-( 1-Butoxy- vinyl)- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4jthiadiazin-3-yl]-4-hydroxy- 1-(3- methylbutyl)- lH-quinolin-2-one a) (7-Iodo-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester: 2-Amino-5-iodo-benzenesulfonamide (20.0 g, 67.1 mmol), pyridine (5.3 g, 67.1 mmol), and ethylchloromalonate (10.0 g, 67.1 mmol) were dissolved in methylene chloride (250 ml) and stirred for 18h at room temperature.
  • Example 2b (300 mg, 0.559 mmol) in N,N-dimethylformamide (3 ml) was added vinyl butyl ether (360 ⁇ l, 2.795 mmol), triethylamine (170 ⁇ l, 1.23 mmol), 2,2'-bis(diphenyl- phosphino)-l,l'-binaphthyl (13.8 mg, 0.0335 mmol), and palladium acetate (7.52 mg, 0.0355 mmol). The reaction mixture was heated at 78°C for 18 h under a nitrogen atmosphere. After cooling to room temperature, 1M aqueous hydrochloric acid (10 ml) was added and the solution was stirred for 35 min.
  • Example 3 2- ⁇ 3- [4-hydroxy-6-methyl- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydro-quinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yloxy ⁇ acetamide a) Ethyl (7-hydroxy- 1,1 -dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate: A mechanically stirred suspension of the compound from example If) (17.0 g, 57.0 mmol) in 1,2-dichloroethane (800 mL) was cooled over an ice bath (5-10°C) under nitrogen.
  • Example 4 2-[3-(l-Cyclobutylmethyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxo-l,4- dihydrobenzo [ 1 ,2,4] thiadiazin-7-yloxy] acetamide a) l-Cyclobutylmethyl-lH-benzo[d][l,3]oxazine-2,4-dione: Isatoic anhydride (1.0 g, 6.13 mmol) was added portion wise to a suspension of sodium hydride (60% suspension in mineral oil, 294 mg, 7.36 mmol) in anhydrous N,N-dimethylacetamide.
  • Aluminium chloride (4.13 g, 31.0 mmol) was added and the resulting solution heated at 80°C for lh, then cooled and poured into iced water (500 mL). The precipitate was filtered, washed with cold water and dried. A mixture of this intermediate, 9M aqueous sulfuric acid (25 mL) and dioxane (25 mL) was heated under reflux for 48h, then cooled. Most of the solvent was removed under reduced pressure and the pH adjusted to 4.5 with 4M aqueous sodium hydroxide. After cooling in ice, the precipitate was filtered, washed with cold water and dried to give the title compound (2.31 g, 38%) as a pink solid.
  • Example 7 2- ⁇ 3- [ 1 -(2-Cyclopropylethyl)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4- dihydrobenzofl ,2,4]thiadiazin-7-yloxy ⁇ acetamide a) l-(2-Cyclopropylethyl)-lH-benzo[l,3]oxazine-2,4-dione: Following the procedure from Example 5a), except substituting 2-cyclopropyl-ethanol for 3,3-dimethyl-l- butanol, the title compound was obtained as a white powder after flash chromatography (25% ethyl acetate in hexane) and trituration from diethyl ether (556 mg, 78%).
  • Example 5c except substituting l-(2-cyclopropylethyl)-4-hydroxy-3-(7-hydroxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one for l-(3,3-dimethylbutyl)- 4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1 H-quinolin-2- one, the title compound was obtained as a tan powder (44 mg, 66%).
  • Example 8 3-(6-Chloro-7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy- 1 H-quinolin-2-one a) (6-Chloro-7-methoxy-l , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazm-3-yl)acetic acid ethyl ester: Following the procedures of Examples 6a) and 6c), except substituting 3- chloro-4-methoxyaniline for 2-chloro-5-methoxyaniline, the title compound was obtainied suitable for use in the next procedure without further purification.
  • Example 10 (R)-2- ⁇ 3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy ⁇ propionic acid ethyl ester a) 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: A mixture of the compound from Example 8d) (211 mg, 0.85 mmol) and the compound from Example 3a) (240 mg, 0.85 mmol) in anhydrous tetrahydrofuran (20 mL) under argon was treated with sodium hydride (60% suspension in mineral
  • Example 13 l-(2-Cyclopropylethyl)-3-[7-((E)-3-dimethylaminoallanoyl)- 1, 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one a) 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo- 1 , 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Following the procedure of Example 2b, except substituting the product obtained in Example 8d), l-(2- cyclopropylethyl)-6-fluoro-lH-benzo[d][l,3]oxazine-2,4-dione, for l-(3-methylbutyl)-lH-
  • Example 14 3-(5-Chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolfn-2-one a) (5-Chloro-8-methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)acetic acid ethyl ester: A mixture of 2-amino-3-chloro-6-methoxybenzenesulfonamide (Example 6a), 2.31 g, 9.80 mmol) and diethyl malonate (20 mL) was heated under argon at 150°C for 17h, then cooled.
  • Example 18 l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1-dioxo- 1 ,4- dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)- lH-quinolin-2-one a) 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-carboxylic acid methyl ester: The compound from Example 13a) (1.0 g, 1.81 mmol) and triethylamine (0.554 mL, 3.97 mmol) were added to a solution of l,3-bis(diphenylphosphino)propane (48.5 mg, 0.118 mmol) and palladium(II)
  • the system was degassed and then purged two times with carbon monoxide.
  • the reaction mixture was stirred at 88°C for 6h, and then at 75°C for 40 h. Thin layer chromatographic analysis showed residual starting material. Additional 1,3- bis(diphenylphosphino)propane (48.5 mg) and palladium(II) acetate (27 mg) were then added.
  • the system was evacuated and refilled with carbon monoxide. After addition of triethylamine (0.5 mL), the reaction mixture was stirred at 90°C for 6h, cooled to room temperature and partitioned between chloroform and 1M aqueous hydrochloric acid.
  • Example 20 3-[7-(2-Amino-thiazol-4-yl)- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl]-6-fluoro-4- hydroxy- l-(3-methylbutyl)- lH-quinolin-2-one a) 6-Fluoro-4-hydroxy-3-(7-iodo- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3- yl)- l-(3-methylbutyl)-lH-quinolin-2-one: Following the procedure of Example 2b), except substituting 6-fluoro-l-(3-methylbutyl)-lH-benzo[d][l,3]oxazine-2,4-dione for l-(3- ethylbutyl)-lH-benzo[d][l,3]o
  • Example 21 3-[l,l-Dioxo-7-(2H-pyrazol-3-yl)-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4- hydroxy- 1 -(3-methylbutyl)- lH-quinolin-2-one a) 3-[7-((E)-3-dimethylaminoallanoyl)- 1 , 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2- one: Following the procedure of Example 13c, except substituting the compound of Example 20b) for the compound from Example 2b), and hydrolysis of the crade product with 3M aqueous hydrochloric acid, the title compound.was obtained (87%). MS(ES+) m/e
  • Example 22 3-(5-Bromo- 1 , 1 -dioxo- 1 ,4-dihydro- 1-benzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(2-cyclopropylethyl)-6- fluoro-4-hydroxy-lH-quinolin-2-one a) 5-Bromo- 1 , 1 -dioxo- 1 ,4-dihydro-2H- 1 -benzo [ 1 ,2,4]thiadiazin-3-one: 2-Bromoaniline (11.96 g, 70 mmoles) in nitroethane (100 ml) was added dropwise to a stirred solution of chlorosulfonylisocyanate (7.0 ml, 80 mmol) in nitroethane (60 ml) at 50°C under nitrogen atmosphere.
  • the mixture was heated to 80 °C under a nitrogen atmosphere for 3h, cooled to ambient temperature, and acidified with acetic acid.
  • the mixture was again heated to 80 °C for an additional lh, cooled to ambient temperature, and diluted with water.
  • the product was extracted with ethyl acetate, dried over magnesium sulfate, and concentrated in vacuo.
  • the residue was purified via flash column chromatography (silica gel, 95:5:0.5 chloroform/methanol/NH40H) to give the title compound as a yellow solid (3.3 mg, 2%).
  • Example 23c Following the procedure of Example 23c), except substituting ethyl l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl-acetate (prepared by the method of Kovalenko, S. N.; Chernykh, V. P.; Shkarlat, A. E.; Ukrainets, I. V.; Gridasov, V. I.; Rudnev, S. A. Chem. Heterocycl. Compd. (Engl. Trans.) 1998, 34, 791) for the compound from Example If), the title compound was obtained as a yellow solid (33 mg, 25%).
  • Example 26 1 -(2-Cyclopropylethyl)-3-( 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-8-fluoro-4- hy droxy- lH-quinolin-2-one
  • 2-(2-Cyclopropylethylamino)-3-fluoro-benzoic acid Copper(II) bromide (76.5 mg, 0.342 mmol) was added to a suspension of 2-bromo-3-fluoro-benzoic acid (1.0 g, 4.57 mmol), (2-cyclopropyl)ethylamine hydrochloride (610.8 mg, 5.02 mmol) and potassium carbonate (2.0 g, 14.6 mmol) in tetrahydrofuran (15 mL).
  • reaction mixture was stirred at 78 °C overnight, cooled to rt, poured in 1M aqueous hydrochloric acid and the pH adjusted to 9.0 by the addition of 2.5 M aqueous sodium hydroxide. The mixture was then filtered and the filtrate was made acidic (pH 5) by the addition of 1M aqueous hydrochloric acid. The precipitate was collected, washed with water and dried to give the desired product (570 mg, 56%) as a tan powder. !
  • Example 28 3-(l, l-Dioxo-l,4-dihydro-l-benzo[l, 2, 4]thiadizain-3-yl)-4-hydroxy-l-(3-methylbutyl)-5- nitro- 1 H-quinolin-2-one
  • 2-(3-Methylbutylamino)-6-nitrobenzoic acid Isoamylamine (3.5 mL, 30 mmol) 0 was added to a mixture of 2-chloro-6-nitro-benzoic acid (1 g, 5 mmol), potassium carbonate (1.38 g, 10 mmol) and copper (II) oxide (50 mg, 0.35 mmol). The mixture was refluxed overnight.
  • Example 29 5- ⁇ 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl ⁇ -lH-pyrazole-3-carboxylic acid methyl ester a) 4- ⁇ 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl ⁇ -2,4-dioxobutyric acid methyl ester: The product of Example 13b) (325 mg, 0.693 mmol) and dimethyl oxalate (122 mg, 1.04 mmol) in N,N-dimethylform
  • reaction mixture was stirred at room temperature for lh and at 50°c for 4h. After cooling to room temperature, 3M aqueous hydrochloric acid (10 mL) was added and the resulting solution was extracted with chloroform (3 x 30 mL). The organic layers were combined, dried over magnesium sulfate, and the solvent removed en vacuo.
  • Example 30 5- ⁇ 3- [ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-7-yl ⁇ isoxazole-3-carboxylic acid methyl ester
  • the product obtained in Example 29 (93 mg, 0.167 mmol) and hydroxy lamine hydrochloride (35 mg, 0.502 mmol) were heated under reflux in methanol (3 mL) for 4h. After cooling to room temperature the solvent was removed by rotary evaporation.
  • Example 31 4-[3-( 1 , 1 -Dioxo- 1 ,4-dihydro- 1-benzo [ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- l-(3-methylbutyl)-2- oxo-l,2-dihydroquinolin-6-ylamino]butyric acid methyl ester
  • HCV NS5B inhibitory activity of the compounds of Formulas I-A to I-F was ⁇ determined using standard procedures well known to those skilled in the art and described in, for example Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001).

Abstract

Compounds useful as HCV anti-infectives are disclosed. Also disclosed are methods of making and using the same.

Description

ANTI-INFECTiVES
FIELD OF THE INVENTION The present invention relates to compounds that inhibit an RNA-containing virus and methods of making and using the same. Specifically, the present invention relates to inhibitors of hepatitis C virus (HCV).
BACKGROUND OF THE INVENTION In the U.S., an estimated 4.5 million Americans are chronically infected with HCV. Although only 30% of acute infections are symptomatic, greater than 85% of infected individuals develop chronic, persistent infection. Treatment costs for HCV infection have been estimated at $5.46 billion for the U.S. in 1997. Worldwide, over 200 million people are estimated to be infected chronically. HCV infection is responsible for 40-60% of all chronic liver disease and 30% of all liver transplants. The CDC estimates that the number of deaths due to HCV will minimally increase to 38,000/yr. by the year 2010.
Due to the high degree of variability in the viral surface antigens, existence of multiple viral genotypes, and demonstrated specificity of immunity, the development of a successful vaccine in the near future is unlikely. Alpha-interferon (alone or in combination with ribavirin) has been widely used since its approval for treatment of chronic HCV infection. However, adverse side effects are commonly associated with this treatment: flulike symptoms, leukopenia, thrombocytopenia, and depression from interferon, as well as hemolytic anemia induced by ribavirin (Lindsay, K.L. (1997) Hepatology 26 (Suppl. 1):71S-77S). This therapy remains less effective against infections caused by HCV genotype 1 (which constitutes ~75% of all HCV infections in the developed markets) compared to infections caused by the other 5 major HCV genotypes. Unfortunately, only -50-80% of the patients respond to this treatment (measured by a reduction in serum HCV RNA levels and normalization of liver enzymes) and, of those treated, 50-70% relapse within 6 months of cessation of treatment. Recently with the introduction of pegylated interferon (Peg-IFN), both initial and sustained response rates have improved substantially, and combination treatment of Peg-IFN with ribavirin constitutes the gold standard for therapy. However, the side effects associated with combination therapy and the impaired response in patients with genotype 1 present opportunities for improvement in the management of this disease.
First identified by molecular cloning in 1989 (Choo, Q-L. et al., (1989) Science 244:359-362), HCV is now widely accepted as the most common causative agent of post- transfusion non A, non-B hepatitis (NANBH) (Kuo,G. et al, (1989) Science 244:362-364). Due to its genome structure and sequence homology, this virus was assigned as a new genus in the Flaviviήdae family. Like the other members of the Flaviviridae (such as flaviviruses (e.g., yellow fever virus and Dengue virus types 1-4) and pestiviruses (e.g., bovine viral diarrhea virus, border disease virus, and classic swine fever virus (Choo et al., 1989; Miller, R.H. and R.H. Purcell (1990) Proc. Natl. Acad. Sci. USA 87:2057-2061)), HCV is an enveloped virus containing a single strand RNA molecule of positive polarity. The HCV genome is approximately 9.6 kilobases (kb) with a long, highly conserved, noncapped 5' nontranslated region (NTR) of approximately 340 bases which functions as an internal ribosome entry site (IRES) (Wang, C.Y., Le, S.Y., Ali, N., Siddiqui, A., Rna-A Publication of the Rna Society. 1(5): 526-537, 1995 Jul). This element is followed by a region which encodes a single long open reading frame (ORF) encoding a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins.
Upon entry into the cytoplasm of the cell, the HCV-RNA is directly translated into a polypeptide of -3000 amino acids comprising both the structural and nonstructural viral proteins. This large polypeptide is subsequently processed into the individual structural and nonstructural proteins by a combination of host and virally-encoded proteinases (Rice, CM. (1996) in B.N. Fields, D.M.Knipe and P.M. Howley (Eds.) Virology, 2nd Edition, p931- 960, Raven Press, NY). Following the termination codon at the end of the long ORF, there is a 3 'NTR which roughly consists of three regions: an - 40 base region which is poorly conserved among various genotypes, a variable length poly(U)/polypyrimidine tract, and a highly conserved 98 base element also called the "3'X-tail" (Kolykhalov, A. et al, (1996) J. Virology 70:3363-3371; Tanaka, T. et al, (1995) Biochem Biophys. Res. Commun. 215:744-749; Tanaka, T. et al., (1996) J. Virology 70:3307-3312; Yamada, N. et al, (1996) Virology 223:255-261). The 3' NTR is predicted to form a stable secondary structure that is essential for HCV growth in chimps and is believed to function in the initiation and regulation of viral RNA replication.
The NS5B protein (591 amino acids, 65 kDa) of HCV (Behrens, S.E., et al, (1996) EMBO J. 15:12-22), encodes an RNA-dependent RNA polymerase (RdRp) activity and contains canonical motifs present in other RNA viral polymerases. The NS5B protein is fairly well conserved both intra-typically (-95-98% amino acid (aa) identity across lb isolates) and inter-typically (-85% aa identity between genotype la and lb isolates). The essentiality of the HCV NS5B RdRp activity for the generation of infectious progeny virions has been formally proven in chimpanzees (Kolykhalov, A.A., et al, (2000) J. Virology 74:2046-2051). Thus, inhibition of NS5B RdRp activity (inhibition of RNA replication) is predicted to cure HCV infection. Positive strand hepatitis C viral RNA is the nucleic acid strand that is translated and initially copied upon entry of the HCV-RNA into the cell. Once in the cell, positive strand viral RNA generates a negative strand replicative intermediate. Negative strand RNA is the template used to generate the positive strand message that is generally packaged into productive virions. Presently, HCV inhibitor compounds are only evaluated for their ability to inhibit positive strand HCV-RNA. However, it would be desirable to develop inhibitor compounds having the ability to inhibit both positive and negative strand replication to obtain complete clearance of the HCV virus.
Accordingly, there exists a significant need to identify synthetic or biological compounds for their ability to inhibit HCV. Preferably, such synthetic or biological compounds inhibit both positive and negative strand replication of the hepatitis C virus.
SUMMARY OF THE INVENTION This invention is directed to a compound: 2-{ 3-[ l-(3,3-dimethylbutyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamide; 3-[7-( 1 -butoxy vinyl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo[ 1 ,2,4]thiadiazin-3-yl] -4-hydroxy- 1 -(3 -methylbutyl)- 1 H-quinolin-2- one ; 2- { 3 - [4-hy droxy-6-methy 1- 1 -(3 -methy lbuty l)-2-oxo- 1 , 2-dihydroquinolin-3-y 1] -1,1- dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}acetamide; 2-[3-(l-cyclobutylmethyl- 4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-7-yloxy]acetamide; 2-{3-[l-(3,3-dimethylbutyl)-4-hydroxy-2-oxo- l,2-dihydroquinolin-3-yl]-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-7- yloxy } acetamide ; 6-fluoro-4-hydroxy-3-(8-hydroxy- 1 , 1-dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one; 2-{3-[l-(2- cyclopropylethyl)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo-l,4-dihydro-l- benzo [1,2,4] thiadiazin-7-yloxy } acetamide; 3-(6-chloro-7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2- one; 2-{6-chloro-3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin- 3-yl]-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}acetamide; (R)-2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazfn-7-yloxy}-propionic acid ethyl ester; (S)-2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihy droquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy } -butyramide; (R)-2-{ 3-[ 1 -(2-cyclopropylethyl)- 6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo[ 1 ,2,4]thiadiazin-7-yloxy } -butyramide; 1 -(2-cyclopropylethyl)-3-[7-((E)-3- dimethylamino-allanoyl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo[ 1 ,2,4]thiadiazin-3-yl] -6-fluoro-4- hydroxy-lH-quinolin-2-one; 3-(5-chloro-8-hydroxy-l,l-dioxo-l,4-dihydro-l- benzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one; (R)-2-{ 3-[ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-propionic acid; 2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-3,3,3-trifluoro-propionamide; 2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo-1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-2-methyl-propionic acid ethyl ester; l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one; (R)-2-{3-[l-(2-cyclopropylethyl)-6-fluoro- 4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-7-yloxy}-N-methyl-propionamide; 3-[7-(2-amino-thiazol-4-yl)-l,l- dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-3-yl] -6-fluoro-4-hy droxy- 1 -(3-methylbutyl)- lH-quinolin-2-one; 3-[l,l-dioxo-7-(2H-pyrazol-3-yl)-l,4-dihydro-l- benzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one; 3- (5-bromo- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-3-yl)- 1 -(2-cyclopropylethyl)-6- fluoro-4-hydroxy- 1 H-quinolin-2-one; 4,5-dihydroxy-3 -(7-methoxy- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[l,2,4]thiadiazin-3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one; 3-(l,l-dioxo-l,4- dihydro-l-benzo[l,2,4]thiadiazin-3-yl)-4,5-dihydroxy-l-(3-methylbutyl)-lH-quinolin-2- one ; 3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazine-7-carbonitrile; l-(2-cyclopropylethyl)-3-(l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-8-fluoro-4-hydroxy-lH-quinolin-2-one; 3- (5-chloro-8-hydroxy-7-nitro-l , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one; 3-(l, l-dioxo-l,4-dihydro-l- benzo[l, 2, 4]thiadizain-3-yl)-4-hydroxy-l-(3-methylbutyl)-5-nitro-lH-quinolin-2-one; 5- { 3-[ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-lH-pyrazole-3-carboxylic acid methyl ester; 5-{3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy -2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-7-yl}isoxazole-3-carboxylic acid methyl ester; or 4-[3-(l,l- dioxo- 1 ,4-dihydro- 1 -benzo[ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy-l-(3-methylbutyl)-2-oxo- 1 ,2- dihydroquinolin-6-ylamino]butyric acid methyl ester; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. This invention is also directed to a prodrug of said compound, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. In addition, this invention is directed to pharmaceutical compositions comprising said compound, or a tautomer thereof, or a prodrug thereof, or a salt or solvate thereof.
In another embodiment, this invention is directed to a method of inhibiting an RNA- containing virus comprising contacting the virus with an effective amount of said compound. In yet another embodiment, this invention is directed to a method of treating infection or disease caused by an RNA-containing virus which comprises administering to a subject in need thereof, an effective amount of said compound. This invention is particularly directed to methods of inhibiting hepatitis C virus. This invention is also directed to a method for inhibiting replication of hepatitis C virus which comprises inhibiting replication of both positive and negative strand HCV-RNA.
DETAILED DESCRIPTION OF THE INVENTION It will be appreciated by those skilled in the art that the compounds of this invention exist in tautomeric forms, represented by Formula I-A and Formula I-B, as follows:
Figure imgf000006_0001
I-A I-B wherein the aryl ring moieties are optionally substituted, as described above.
In addition, it will be appreciated by those skilled in the art, that the compounds of this invention may exist in several other tautomeric forms. All tautomeric forms of the compounds described herein are intended to be encompassed within the scope of the present invention. Examples of some of the other possible tautomeric forms of the compounds of this invention include, but are not limited to:
Figure imgf000006_0002
I-C I-D
Figure imgf000007_0001
I-E I-F
wherein the aryl ring moieties are optionally substituted, as described above. As a convention, the compounds exemplified herein have been assigned names based on the structure of the tautomer of Formula I-A. It is to be understood that any reference to named compounds of this invention is intended to encompass all tautomers of the named compounds and any mixtures of tautomers of the named compounds.
The compounds of this invention may contain at least one chiral center and may exist as single stereoisomers (e.g., single enantiomers), mixtures of stereoisomers (e.g. any mixture or enantiomers or diastereomers) or racemic mixtures thereof. All such single stereoisomers, mixtures and racemates are intended to be encompassed within the broad scope of the present invention. Compounds identified herein as single stereoisomers are meant to describe compounds that are present in a form that are at least 90% enantiomerically pure. Where the stereochemistry of the chiral carbons present in the chemical structures illustrated herein is not specified, the chemical structure is intended to encompass compounds containing either stereoisomer of each chiral center present in the compound. Such compounds may be obtained synthetically, according to the procedures described herein using optically pure (enantiomerically pure) or substantially optically pure materials. Alternatively, these compounds may be obtained by resolution/separation of a mixture of stereoisomers, including racemic mixtures, using conventional procedures. Exemplary methods that may be useful for the resolution/separation of mixtures of stereoisomers include chromatography and crystallization/re-crystallization. Other useful methods may be found in "Enantiomers, Racemates, and Resolutions, " J. Jacques et al., 1981, John Wiley and Sons, New York, NY, the disclosure of which is incorporated herein by reference.
The compounds of this invention may possess one or more unsaturated carbon- carbon double bonds. All double bond isomers, both the cis (Z) and trans (E) isomers, and mixtures thereof are intended to be encompassed within the scope of the present invention. The term "pharmaceutically acceptable salt" is intended to describe a salt that retains the biological effectiveness of the free acid or base of a specified compound and is not biologically or otherwise undesirable. If an inventive compound is a base, a desired salt may be prepared by any suitable method known in the art, including treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or with an organic acid, such as acetic acid, trifluoroacetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acid, such as glucuronic acid or galacturonic acid, alpha-hydroxy acid, such as citric acid or tartaric acid, amino acid, such as aspartic acid or glutamic acid, aromatic acid, such as benzoic acid or cinnamic acid, sulfonic acid, such as p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid or the like. Examples of pharmaceutically acceptable salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates succinates, suberates, sebacates, fumarates, maleates, butyne-l,4-dioates, hexyne- 1,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, phenylacetates, phenylpropionates, phenylbutrates, citrates, lactates, γ-hydroxybutyrates, glycollates, tartrates mandelates, and sulfonates, such as xylenesulfonates, methanesulfonates, propanesulfonates, naphthalene- 1-sulfonates and naphthalene-2-sulfonates.
If an inventive compound is an acid, a desired salt may be prepared by any suitable method known to the art, including treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary, or tertiary), an alkali metal or alkaline earth metal hydroxide, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids such as glycine and arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as ethylene diamine, dicyclohexylamine, ethanolamine, piperidine, morpholine, and piperazine, as well as inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum, and lithium. Particular pharmaceutically acceptable salts of a compound of this invention include the sodium salt and the potassium salt.
Because the compounds of this invention may contain both acid and base moieties, pharmaceutically acceptable salts may be prepared by treating these compounds with an alkaline reagent or an acid reagent, respectively. Accordingly, this invention also provides for the conversion of one pharmaceutically acceptable salt of a compound of this invention, e.g., a hydrochloride salt, into another pharmaceutically acceptable salt of a compound of this invention, e.g., a sodium salt. The term "solvate" is intended to mean a pharmaceutically acceptable solvate form of a specified compound that retains the biological effectiveness of such compound. Examples of solvates include compounds of the invention in combination with water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine. In the case of compounds, salts, or solvates that are solids, it is understood by those skilled in the art that the inventive compounds, salts, or solvates may exist in different crystal forms, all of which are intended to be within the scope of the present invention and specified formulas. Also included within the scope of this invention are prodrugs of the compounds of this invention. The term "prodrug" is intended to mean a compound that is converted under physiological conditions, e.g., by solvolysis or metabolically, to a compound of this invention, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. A prodrug may be a derivative of one of the compounds of this invention that contains, for example, a carboxylic acid ester or amide moiety or an enol-ester moiety that may be cleaved under physiological conditions. A prodrug containing such a moiety may be prepared according to conventional procedures, for example, by treatment of a compound of this invention, containing an amino, amido or hydroxyl moiety with a suitable derivatizing agent, for example, a carboxylic acid halide or acid anhydride, or by converting a compound of this invention, containing a carboxyl moiety to an ester or amide or by converting a compound of this invention, containing a carboxylic acid ester moiety to an enol-ester. Prodrugs of the compounds of this invention may be determined using techniques known in the art, for example, through metabolic studies. See, e.g., "Design of Prodrugs," (H. Bundgaard, Ed.) 1985, Elsevier Publishers B.V., Amsterdam, The Netherlands.
The present invention is directed to a method of inhibiting an RNA-containing virus which comprises contacting the virus with an effective amount of a compound of this invention. This invention is also directed to a method of treating infection or disease caused by an RNA-containing virus comprising administering to a subject in need thereof, an effective amount of the compound of this invention. Specifically, this invention is directed to a method of inhibiting HCV activity, comprising contacting the virus with an effective amount of a compound of this invention, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. For example, HCV activity may be inhibited in mammalian tissue by administering to a subject in need thereof a compound of this invention or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
A therapeutically "effective amount" is intended to mean that amount of a compound that, when administered to a mammal in need of such treatment, is sufficient to effect treatment, as defined herein. Thus, e.g., a therapeutically effective amount of a compound of this invention or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof is a quantity of an inventive agent that, when administered to a mammal in need thereof, is sufficient to modulate or inhibit the activity of HCV such that a disease condition which is mediated by that activity is reduced, alleviated or prevented. The amount of a given compound that will correspond to such an amount will vary depending upon factors such as the particular compound (e.g., the potency (IC50), efficacy (EC50), and the biological half-life of the particular compound), disease condition and its severity, the identity (e.g., age, size and weight) of the mammal in need of treatment, but can nevertheless be routinely determined by one skilled in the art. Likewise, the duration of treatment and the time period of administration (time period between dosages and the timing of the dosages, e.g., before/with/after meals) of the compound will vary according to the identity of the mammal in need of treatment (e.g., weight), the particular compound and its properties (e.g., pharmaceutical characteristics), disease or condition and its severity and the specific composition and method being used, but can nevertheless be determined by one of skill in the art.
In addition, this invention is directed to a method for inhibiting replication of hepatitis C viras comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises contacting a cell infected with said virus with an effective amount of a compound of this invention. This invention is also directed to a . method of treating infection or disease caused by hepatitis C viras comprising inhibiting replication of both positive and negative strand HCV-RNA, which method comprises administering to a subject in need thereof, an effective amount of a compound of this invention. More specifically, this invention is directed to a method of inhibiting replication of both positive and negative strand HCV-RNA with a compound of this invention, wherein the compounds demonstrate substantially equal inhibition of positive strand HCV-RNA replication and negative strand HCV-RNA replication. That is, for a given compound of this invention, the IC50 for inhibition of positive strand HCV-RNA replication is not statistically different (less than a 2-fold difference) from the IC50 for inhibition of negative strand HCV-RNA replication. Generally, the compounds of this invention demonstrate an IC50 for inhibition of positive strand HCV-RNA replication that is ±30% the IC50 for inhibition of negative strand HCV-RNA replication.
"Treating" or "treatment" is intended to mean at least the mitigation of a disease condition (acute, chronic, latent, etc.) in a subject (a mammal, such as a human), where the disease condition is caused by an infectious RNA-containing virus. The methods of treatment for mitigation of a disease condition include the use of the compounds in this invention in any conventionally acceptable manner, for example for prevention, retardation, prophylaxis, therapy or cure of a disease. The compounds of this invention are particularly useful for the treatment of acute, chronic or latent HCV diseases, such as acute and chronic hepatitis infection, hepatocellular carcinoma, liver fibrosis, or other HCV-related diseases. The compounds of this invention may also be useful for treatment of diseases caused by infectious RNA-containing viruses other than HCV, including, but not limited to, Dengue, HIV or picornaviruses. Chronic fatigue syndrome is another disease that may be treatable using the compounds of this invention.
A compound of this invention, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof may be administered to a subject as a pharmaceutical composition in any pharmaceutical form that is recognizable to the skilled artisan as being suitable. Suitable pharmaceutical forms include solid, semisolid, liquid, or lyophilized formulations, such as tablets, powders, capsules, suppositories, suspensions, liposomes, and aerosols. Pharmaceutical compositions of the invention may also include suitable excipients, diluents, vehicles, and carriers, as well as other pharmaceutically active agents, depending upon the intended use or mode of administration. Administration of a compound of the this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, may be performed according to any of the generally accepted modes of administration available to those skilled in the art. The compounds of this invention may be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, topical, transdermal, or transmucosal administration. For systemic administration, oral administration is preferred. For oral administration, for example, the compounds can be formulated into conventional oral dosage forms such as capsules, tablets and liquid preparations such as syrups, elixirs and concentrated drops. Alternatively, injection (e.g., parenteral administration) may be used, e.g., intramuscular, intravenous, intraperitoneal, and subcutaneous. For injection, the compounds of the invention are formulated in liquid solutions, preferably, in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution. The compounds of the invention may also be formulated in liposome-containing preparations, particularly liposome-containing preparations useful for delivery of the compounds of this invention to the liver or potentially to nonhepatic reservoirs of infection. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms can also be produced.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration, for example, may be through nasal sprays, rectal suppositories, or vaginal suppositories. For topical administration, the compounds of the invention can be formulated into ointments, salves, gels, or creams, as is generally known in the art.
Compositions containing a compound of this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which are active when given orally can be formulated as syrups, tablets, capsules and lozenges. A syrup formulation will generally consist of a suspension or solution of the compound or salt in a liquid carrier for example, ethanol, peanut oil, olive oil, glycerine or water with a flavoring or coloring agent. Where the composition is in the form of a tablet, any pharmaceutical carrier routinely used for preparing solid formulations may be used. Examples of such carriers include starch, calcium sulfate dihydrate, magnesium stearate, terra alba, talc, gelatin, acacia, stearic acid, starch, lactose and sucrose. Where the composition is in the form of a capsule, any routine encapsulation is suitable, for example using the aforementioned carriers in a hard gelatin capsule shell. Where the composition is in the form of a soft gelatin shell capsule, any pharmaceutical carrier routinely used for preparing dispersions or suspensions may be considered, for example aqueous gums, celluloses, silicates or oils, and may be incorporated in a soft gelatin capsule shell.
Typical parenteral compositions consist of a solution or suspension of a compound or salt in a sterile aqueous or non-aqueous carrier optionally containing a parenterally acceptable oil, for example polyethylene glycol, polyvinylpyrrolidone, lecithin, arachis oil or sesame oil. Typical compositions for inhalation are in the form of a solution, suspension or emulsion that may be administered as a dry powder or in the form of an aerosol using a conventional propellant such as dichlorodifluoromethane or trichlorofiuoromethane.
A typical suppository formulation comprises a compound of this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof, which is active when administered in this way, with a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other low melting vegetable waxes or fats or their synthetic analogs.
Typical dermal and transdermal formulations comprise a conventional aqueous or non-aqueous vehicle, for example a cream, ointment, lotion or paste or are in the form of a medicated plaster, patch or membrane. Preferably the composition is formulated and administered in a unit dosage form. For oral application, for example, one or more tablets or capsules may be administered, for nasal application, a metered aerosol dose may be administered, for transdermal application, a topical formulation or patch may be administered and for transmucosal delivery, a buccal patch may be administered. A dose of the pharmaceutical composition contains at least a therapeutically effective amount of the active compound (i.e., a compound of this invention, or a tautomer thereof, or pharmaceutically acceptable salt or solvate thereof). The selected dose may be administered to a mammal, for example, a human patient, in need of treatment mediated by inhibition of HCV activity by any known or suitable method of administering the dose, including: topically, for example, as an ointment, or cream, orally, rectally, for example, as a suppository, parenterally by injection, or continuously by intravaginal, intranasal, intrabronchial, intraaural, or intraocular infusion.
Treatment of all forms of infection or disease (acute, chronic, latent etc) or as prophylaxis with these compounds (or their salts etc.) may be achieved using the compounds of this invention as a monotherapy, in dual or multiple combination therapy, such as in combination with other antivirals, in combination with an interferon, in combination with an interferon and ribavirin or levovirin, or in combination with one or more agents which include but are not limited to: immunomodulatory agents (such as cytokines, suppressors of cytokines and/or cytokine signalling, or immune modifiers, adjuvants and the like), immunomodulatory agents that enhance the body's immune system (such as vitamins, nutritional supplements, antioxidant compositions, vaccines or immunostimulating complexes, such as vaccines comprising a multimeric presentation of an antigen and adjuvant), other direct antiviral agents, indirect antiviral agents or agents which target viral RNA and impair translation or replication or modulate signalling or cellular host factors, or host- viral interface, immunoglobulins, antisense agents against HCV, peptide-nucleic acid conjugates, oligonucleotides, ribozymes, polynucleotides, anti-inflammatory agents, pro- inflammatory agents, antibiotics, hepatoprotectants, or any anti-infectious agents and the like, or combinations thereof. Moreover, the additional agents may be combined with the compounds of this invention to create a single dosage form. Alternatively, these additional agents may be separately administered as part of a multiple dosage form. As used herein the term "an interferon" is intended to mean any form of interferon, which includes, but is not limited to, natural or recombinant forms of alpha, beta or gamma interferons, albumin-linked interferons, or pegylated interferons. The compounds of this invention are the compounds of Examples 1-31 or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. A preferred compound of this invention is 3-[7-(l-butoxyvinyl)-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-3- yl]-4-hydroxy- l-(3-methylbutyl)- 1 H-quinolin-2-one ; 2- { 3- [4-hydroxy-6-methyl- 1 -(3- methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamide; 2-[3-( l-cyclobutylmethyl-4-hydroxy-2-oxo- 1 ,2- dihydroquinolin-3-yl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy] acetamide; 2-{3-[l-(3,3-dimethylbutyl)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo-l,4- dihydro- l-benzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamide; 6-fluoro-4-hydroxy-3-(8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(3-methylbutyl)- 1 H-quinolin-2-one; 2-{3-[l-(2-cyclopropylethyl)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo-l,4- dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-7-yloxy } acetamide; 3-(6-chloro-7-hydroxy- 1 , 1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH- quinolin-2-one; 2-{ 6-chloro-3-[ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2- dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamide; (R)-2-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy } -propionic acid ethyl ester; (S)-2- { 3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro- 1 -benzo[ 1 ,2,4] thiadiazin-7-yloxy } -butyramide ; (R)-2- { 3- [ 1 -(2-cyclopropylethyl)- 6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo[ 1 ,2,4]thiadiazin-7-yloxy }-butyramide; l-(2-cyclopropylethyl)-3-[7-((E)-3- dimethyla inoallanoyl)- 1 , 1-dioxo- 1 ,4-dihydro-l -benzo[ 1 ,2,4]thiadiazin-3-yl]-6-fluoro-4- hydroxy-lH-quinolin-2-one; 3-(5-chloro-8-hydroxy-l,l-dioxo-l,4-dihydro-l- benzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one; (R)-2-{ 3-[ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy } -propionic acid; 2- { 3-[ 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-3,3,3-trifluoropropionamide; 2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-2-methylpropionic acid ethyl ester; l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one; (R)-2-{3-[l-(2-cyclopropylethyl)-6-fluoro- 4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1- benzo [ 1 ,2,4] thiadiazin-7-yloxy } -N-methyl-propionamide ; 3-( 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-4,5-dihydroxy-l-(3-methylbutyl)-lH-quninolin-2-one; 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazine-7-carbonitrile ; 1 -(2-cyclopropylethyl)-3-( 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-8-fluoro-4-hydroxy-lH-quinolin-2-one; or 3-(5- chloro-8-hydroxy-7-nitro-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one;or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof. Optionally, a salt of a compound of this invention, prepared using any of the methods described herein, may be prepared by treating the compound with an appropriate base, such as sodium hydroxide or potassium hydroxide, in an appropriate solvent, such as water or water and methanol.
Also included within the scope of this invention are intermediate compounds that are useful for the preparation of the compounds of this invetion. Such useful intermediate compounds include: (8-methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)acetic acid ethyl ester, 6-fluoro-4-hydroxy-3-(8-methoxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one, (6- chloro-7- methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (6- chloro-7-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (5-chloro-8-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (5-chloro-8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)acetic acid methyl ester, 3-[(7-(2-bromoethanoyl)-l, l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl]-6- fιuoro-4-hydroxy- 1 -(3-methylbutyl)- 1 H-quinolin-2-one, 5-bromo- 1 , 1 -dioxo- 1 ,4-dihydro- 2H-1 -benzo[ 1 ,2,4]thiadiazin-3-one, (5-bromo- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin- 3-yl)acetic acid ethyl ester, 5-(tert-butyldimethylsilyloxy)benzo[d][l,3]oxazine-2,4-dione, 5-(tert-butyldimethylsilyloxy)-l-(3-methylbutyl)benzo[d][l,3]oxazine-2,4-dione, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
The activity of the inventive compounds as inhibitors of ΗCV activity may be measured by any of the suitable methods known to those skilled in the art, including in vivo and in vitro assays. For example, the ΗCV NS5B inhibitory activity of the compounds of Formulas I, II and HI was determined using standard assay procedures described in Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001). Unless otherwise noted, the compounds of this invention have demonstrated in vitro HCV NS5B inhibitory activity in such standard assays and have IC50's in the range of 0.0001 μM to 100 μM. Representative compounds of this invention, Examples 3-6, 8, 12-14, 16, 17, and 20-23 have all demonstrated in vitro HCV NS5B inhibitory activity and have IC50's in the range of 0.0005 μM to .05 μM. Recently, cell-based replicon systems for HCV have been developed, in which the nonstructural proteins stably replicate subgeno ic viral RNA in Huh7 cells (Lohmann et al., Science (1999) and Blight et al., Science (2000). In the absence of a purified, functional HCV replicase consisting of viral non-structural and host proteins, our understanding of Flaviviridae RNA synthesis comes from studies using active recombinant RdRps and validation of these studies in the HCV replicon system. Inhibition of recombinant purified HCV polymerase with compounds in in vitro biochemical assays may be validated using the replicon system whereby the polymerase exists within a replicase complex, associated with other viral and cellular polypeptides in appropriate stoichiometry. Demonstration of cell-based inhibition of HCV replication may be more predictive of in vivo function than demonstration of HCV NS5B inhibitory activity in in vitro biochemical assays.
Advantageously, the compounds of this invention inhibit both positive and negative strand HCV-RNA replication. The following methods have been developed and used for determining the positive and negative strand HCV-RNA replication inhibition activity of the compounds of this invention.
Test Method 1 Method for positive strand replicon HCV-RNA detection in replicon cells
Replicon cells were plated at 3 X 103 cells per well in a 96-well plate plates at 37° and 5% C02 in DMEM (Dulbecco's Minimal Essential Medium) containing 10% FCS (fetal calf serum), 1% NEAA (nonessential amino acids) and 1 mg/ml Geneticin (G418 neomycin). After allowing 4 h for cell attachment, 1 μl of a solution of candidate antiviral agent was added to the medium (n = 8 wells per dilution). Briefly, eleven 2.5-fold dilutions of 1 mM stock test compound in DMSO (dimethylsulfoxide) were prepared with final concentration ranging from 10000 nM to 1.0 nM. Plates were incubated for 40 h, until reaching 80% confluence. After removal of medium, 150 μl Buffer RLT (Qiagen, Valencia, California, US) was added to each well and RNA purified according to manufacturer's recommendations (Qiagen RNAeasy) and were eluted twice in 45 μl dH20 prior to RT-PCR. Approximately 40 μl of TaqMan EZ RT-PCR (Applied Biosystems, Foster City, California, US) master mix (IX TaqMan EZ Buffer, 3 mM Mn(OAc)2, 0.3 mM dATP, 0.3 mM dCTP, 0.3 mM dGTP, 0.6 mM dUTP, 0.2 mM neo-forward, 0.2 mM neo-reverse, 0.1 mM neo-probe, IX Cyclophilin Mix, 0.1 Unit/μl τTth DNA Polymerase, 0.01 Unit/μl AmpErase UNG, and H20 to 40 μl) was added to each tube of 96-tube optical plate along with 10 μl of RNA elution. Primers and probes specific for the positive strand RNA detection of neomycin gene were: neo-forward: 5'CCGGCTACCTGCCCATTC3' (SEQ ID NO 1); neo-reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ ID NO 2); neo-probe: 5'FAM- ACATCGCATCGAGCGAGCACGTAC-TAMRA3' (SEQ JD NO 3). For negative strand RNA detection, the cDNA primer used was 5ΑCA TGC GCG GCA TCT AGA CCG GCT ACC TGC CCA TTC3' (SEQ ID NO 4) whereby the first 18 bases represent SEQ JD NO 5 linked to neo sequences; neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ ID NO 5); neo reverse 5'CCAGATCATCCTGATCGACAAG3' (SEQ JD NO 6); neo probe: 5FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ JD NO 3). Additionally, the PDAR control reagent human cyclophilin was used for normalization. Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 60°C, 30 min; and 95°C, 5 min, with cycling parameters set to 94°C, 20 s; 55 °C, 1 min for 40 cycles. The relative cDNA levels for neo and cyclophilin were determined compared to DMSO-only treated controls and the ratio of neo:cyclophilin was used for IC50 calculation (n = 8).
Test Method 2 Method for negative strand replicon HCV-RNA detection in replicon cells To achieve strand-specific detection, a primer containing HCV RNA (or replicon
RNA sequences such as neomycin gene) and an 18 base tag of nonrelated sequence at the 5' end was for the reverse transcription (RT) reaction,
5ΑCATGCGCGGCATCTAGACCGGCTACCTGCCCATTC3' (SEQ ID NO 4). A Thermoscript-RT-PCR system (Invitrogen) was used for the RT reaction according to the manufacturer's protocol, with approximately 9 μl of the cell-harvested RNA and 1 μl of primer (10 μM) incubated with RT at 60°C for 1 h. Following that incubation, 2 μl of cDNA product containing the 5' tag was amplified for TaqMan quantification using the 48 μl of TaqMan Universal Master Mix (Applied Biosystems) as well as primers, neo-forward tag: 5'ACA TGC GCG GCA TCT AGA3' (SEQ JD NO 5); neo reverse: 5'CCAGATCATCCTGATCGACAAG3' (SEQ JD NO 6); and neo probe: 5'FAM-ACA TCG CAT CGA GCG AGC ACG TAC-TAMRA3' (SEQ JD NO 3). Samples were mixed briefly and placed in an ABI7700 (Applied Biosystems) at 50°C, 2 min; 95°C, 10 min, with cycling parameters set to 94°C, 15 s; 55°C, 1 min for 40 cycles. The negative strand copy number in each reaction was determined using linear regression analysis based on the slope and intercept generated with a negative strand copy standard curve. The negative strand copies per cell were determined by dividing the total negative strand copies per reaction by the total cells per reaction.
Through routine experimentation, including appropriate manipulation and protection of any chemical functionality, synthesis of the compounds of Formulas I-A to I-F is accomplished by methods analogous to those above and to those described in the following Experimental section.
Example 1 2-{3-[l-(3,3-Dimethylbutyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-7-yloxy } acetamide a) 6-Fluoro-lH-benzo[d][l,3]oxazine-2,4-dione: Triphosgene (12.0 g, 40.4 mmol) was added portionwise to a solution of 5-fluoroanthranilic acid (11.0 g, 64.5 mmol) in tetrahydrofuran (400 mL) and the solution was stirred at 40°C for 3.5 h. Saturated aqueous sodium hydrogen carbonate was added and the mixture was diluted with water. The precipitate was collected by filtration, washed with water, then diethyl ether (20 mL) and dried to give the title compound (10.6g, 90%). !H NMR (CDC13) 5 11.81 (br s, IH), 7.70
(m, 2H), 7.67 (m, IH). b) 1 -(3 ,3-Dimethylbutyl)-6-fluoro- 1 H-benzo [d] [ 1 ,3] oxazine-2,4-dione: Diisopropyl azodicarboxylate (1.63 mL, 8.28 mmol) was added dropwise to a suspension of 6-fluoro- lH-benzo[d] [l,3]oxazine-2,4-dione (1.50 g, 8.28 mmol), 3,3-dimethyl-l-butanol (1.0 mL, 8.28 mmol) and triphenylphosphine (2.20 g, 8.28 mmol) in dichloromethane (15.0 mL). The solution was stirred at room temperature for 18h, the solvent was evaporated under reduced pressure and the residue was purified by flash chromatography (silica gel, gradient 1% to 10% ethyl acetate in hexanes) to give the title compound (550 mg, 23%). !H NMR (d6- DMSO) δ 7.80-7.74 (m, 2H), 7.38 (dd, J = 8.9, 4.0 Hz, IH), 4.02-3.98 (m, 2H), 1.55-1.51
(m, 2H), 1.00 (s, 9H). MS(ES+) m/e 266 [M+H]+. c) 7-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-one: A solution of 4- anisidine (20 g, 162 mmol) in nitroethane (100 mL) was added dropwise to a solution of chlorosulfonyl isocyanate (17 mL, 195 mmol) in nitroethane (150 mL) strirred at -40°C. After 5 min, aluminum chloride (28 g, 210 mmol) was added and the mixture was immediately transferred to an oil bath, previously heated to 110°C. The mixture was stirred at this temperature for 20 min then poured onto ice to give the title compound as a purple solid (24 g, 65%). IH NMR (300MHz, d6-DMSO) 11.14 (s, NH), 7.20 (m, 3H), 3.81 (s,
3H). d) 2-Amino-5-methoxybenzenesulfonamide: 7-Methoxy- 1,1 -dioxo- 1,4- dihydrobenzo[l,2,4]thiadiazin-3-one (3.2 g, 14 mmol) was heated in 50% sulfuric acid (25 mL) at 130 °C until dissolved. The mixture was poured onto ice, neutralized and extracted into ethyl acetate. Evaporation of the solvent gave the title compound (2.0 g, 70%). IH NMR (300MHz, d6-DMSO) 7.25 (s, NH2, 2H), 7.11 (d, J = 3 Hz, IH), 6.94 (dd, J = 3 and 9 Hz, IH), 6.77 (d, J = 9 Hz, IH), 5.44 (s, NH2, 2H), 3.67 (s, 3H). e) N-(4-Methoxy-2-sulfamoylphenyl)malonamic acid ethyl ester: A mixture of 2- amino-5-methoxybenzenesulfonamide (9.1 g, 45 mmol) and diethyl malonate (14 mL, 92 mmol) were heated together at 160 °C for 1 h. The mixture was cooled and diluted with diethyl ether to give the title compound as a solid (8.5 g, 60%). IH NMR (300MHz, d6- DMSO) 9.44 (s, IH), 7.75 (d, J = 9 Hz, IH) 7.51 (s, 2H), 7.37 (d, J = 3 Hz, IH), 7.20 (dd, J = 3 and 9 Hz, IH), 4.14 (q, 2H), 3.81 (s, 3H), 3.57 (s, 2H), 1.23 (t, 3H). f) (7-Methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester: The compound form Example le) (2.4 g, 7.6 mmol) was heated under reflux in phosphorus oxychloride (50 mL) for 2.5 h. The solvent was evaporated and the residue dissolved in ethyl acetate. The solution was neutralized, washed with 2M hydrochloric acid, dried and evaporated to a solid. Trituration with ether gave the title compound (1.8 g, 79%). IH NMR (300MHz, d6-acetone) 11.10 (s, NH), 7.26-7.80 (m, 3H), 4.32 (q, 2H), 3.79 (s, 3H), 3.26 (s, 2H), 1.49 (t, 3H). g) l-(3,3-Dimethylbutyl)-6-fluoro-4-hydroxy-3-(7-methoxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Sodium hydride (60% dispersion in mineral oil, 211.2 mg, 5.28 mmol) was added to a suspension of the compound from Example lb) (350 mg, 1.32 mmol) and the compound from Example If) (393.6 mg, 1.32 mmol) in tetrahydrofuran (10 mL). The suspension was heated to reflux and allowed to stir at this temperature for 2.5 h. After cooling to room temperature, acetic acid (3 mL) was carefully added and the mixture was heated under reflux for an additional 1 h. It was cooled to room temperature and poured into 1M aqueous hydrochloric acid. The solid obtained was collected by filtration, washed with water, hexane and diethyl ether and dried to give the title compound as a yellow powder (410 mg, 66% yield). H NMR (CDC13) δ 15.25 (br s, IH), 14.49 (br s, IH), 7.95 (dd, J = 8.6, 3.0 Hz, IH), 7.52-7.47 (m, IH), 7.42 (d, J = 2.7 Hz, IH), 7.38 (dd, J = 9.4, 4.2 Hz, IH), 7.28 (d, J = 9.0 Hz, IH), 7.20 (dd, J = 9.0, 2.7 Hz, IH), 4.35-4.30 (m, 2H), 3.90 (s, 3H), 1.64-1.60 (m, 2H), 1.12 (s, 9H). MS(ES+) m/e 474
[M+H]+. h) l-(3,3-Dimethylbutyl)-6-fluoro-4-hydroxy-3-(7-hydroxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one The compound from Example lg) (400 mg, 0.845 mmol) was suspended in 25 mL of glacial acetic acid. The mixture was warmed until a solution was obtained, treated with 5 mL of 48% aqueous hydrobromic acid and heated under reflux for 2 days. Additional 48% aq hydrobromic acid (3 mL) was added and the mixture was stirred for 7h at refluxing temperature. After cooling to room temperature, the resulting precipitate was collected, washed with water, then diethyl ether and dried. The solid obtained was triturated in 3% methanol in dichloromethane to give the title compound (267 mg, 69%). JH NMR (d6-DMSO) δ 15.28 (br s, IH), 14.10 (br s, IH), 10.46 (s, IH), 7.89 (dd, J = 8.7, 3.0 Hz, IH), 7.83-7.79 (m, IH), 7.62-7.57 (m, 2H), 7.19- 7.16 (m, 2H), 4.35-4.31 (m, 2H), 1.55-1.51 (m, 2H), 1.05 (s, 9H). MS(ES+) m/e 460
[M+H]+. i) 2-{3-[l-(3,3-Dimethylbutyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetamide The compound from Example lh) (120 mg, 0.261 mmol) and potassium carbonate (135 mg, 0.979 mmol) in N,N-dimethylformamide (7 mL) was warmed to 85 °C and then treated with 2- bromoacetamide (39.6 mg, 0.287 mmol). Stirring was continued for 2.5h at the same temperature, and for an additional 35 min after the addition of another portion of 2- bromoacetamide (10 mg). Water was then added to the cooled mixture and the precipitate obtained was collected by filtration, washed with water, then diethyl ether and dried to give the title compound as a white powder as the potassium salt (85 mg, 59%). *H NMR (d6- DMSO) δ 16.00 (br s, IH), 7.78 (dd, J = 9.2, 3.1 Hz, IH), 7.63 (br s, IH), 7.44-7.39 (m, 2H), 7.26 (d, J = 8.8 Hz, IH), 7.22-7.17 (m, 2H), 7.14 (d, J = 2.8 Hz, IH), 4.49 (s, 2H),
4.14-4.06 (m, 2H), 1.45-1.41 (m, 2H), 1.03 (s, 9H). MS(ES+) m/e 517 [M+H]+.
Example 2 3-[7-( 1-Butoxy- vinyl)- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4jthiadiazin-3-yl]-4-hydroxy- 1-(3- methylbutyl)- lH-quinolin-2-one a) (7-Iodo-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester: 2-Amino-5-iodo-benzenesulfonamide (20.0 g, 67.1 mmol), pyridine (5.3 g, 67.1 mmol), and ethylchloromalonate (10.0 g, 67.1 mmol) were dissolved in methylene chloride (250 ml) and stirred for 18h at room temperature. Ethyl acetate (100 ml) and 1M aqueous hydrochloric acid were added and the resulting slurry filtered. The filtered solid was washed with water and ether then air-dried. The resulting white solid was heated under reflux in neat POCl (60 ml) for 1 h. The POCl3 was removed in vacuo. The crude reaction slurry was diluted with ethyl acetate (150 ml), poured onto ice (200 g), and brought to pH=5 with sodium bicarbonate. The resulting precipitate was filtered and washed with carefully with ethyl acetate and ether to give the title compound as an off-white solid (11.01 g, 45%). Η NMR (d6-DMSO) δ 12.4 (br s, IH), 8.0 (m, 2H), 7.1 (m, IH), 4.2 (q, 2H), 3.7 (s, 2H), 1.15 (t, 3H).
MS(ES+) m/e 395 [M+H]+. b) 4-Hydroxy-3-(7-iodo- 1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)- 1 -(3- methylbutyl)-lH-quinolin-2-one: Sodium hydride (1.01 g. of a 60% oil dispersion, 25.3
5 mmol) was added to a stirred suspension of l-(3-methylbutyl)-lH-benzo[d][l,3]oxazine- 2,4-dione (1.18 g, 5.08 mmol) and (7-iodo-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3- yl)-acetic acid ethyl ester (2.0 g, 5.08 mmol) in dry tetrahydrofuran (15 ml). The mixture was stirred under reflux for 1 h, cooled, and acetic acid (2 mL) added. The mixture was heated under reflux for 1 h, cooled, and poured into 1M aqueous hydrochloric acid. The ^ precipitate was filtered, washed with hexanes and ether, then dried to give the title compound as an off white solid (1.88 g, 69%). !H NMR (d6-DMSO) δ 15.0 (br s, IH), 14.4 (br s, IH), 8.15 (m, 2H), 8.05 (m, IH), 7.85 (m, IH), 7.75 (m, IH), 7.7 (m, IH), 7.4 (m, IH),
4.4 (t, 2H), 1.7 (m, IH), 1.5 (m, 2H), 1.0 (s, 3H), 0.99 (s, 3H). MS(ES+) m/e 538 [M+H]+. c) 3- [7-( 1 -Butoxy vinyl)- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl]-4- 5 hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one: To a solution of the product obtained in
Example 2b (300 mg, 0.559 mmol) in N,N-dimethylformamide (3 ml) was added vinyl butyl ether (360 μl, 2.795 mmol), triethylamine (170 μl, 1.23 mmol), 2,2'-bis(diphenyl- phosphino)-l,l'-binaphthyl (13.8 mg, 0.0335 mmol), and palladium acetate (7.52 mg, 0.0355 mmol). The reaction mixture was heated at 78°C for 18 h under a nitrogen atmosphere. After cooling to room temperature, 1M aqueous hydrochloric acid (10 ml) was added and the solution was stirred for 35 min. The aqueous reaction mixture was extracted with chloroform (3 x 25 ml), the organic layers were combined and washed with water (30 ml) and brine (30 ml), dried over magnesium sulfate and the solvent removed in vacuo. The crude material was purified using flash column chromatography (silica gel, chloroform) to 5 give he title compound as a minor product as yellow powder (11 mg, 6%). !H NMR
(CDC13) δ 15.3 (s, IH), 14.4 (s, IH), 8.3 (d, J = 8.1 Hz, IH,); 8.2 (s, IH), 7.85 (d, J = 8.6 Hz, IH), 7.74 (m, IH), 7.36 (m, 2H), 7.2 (d, J = 8.6 Hz, IH), 6.33 (d, J = 6.93 Hz, IH), 5.26 (d, J = 6.95 Hz, IH), 4.3 (t, J = 8.1 Hz, 2H), 4.0 (t, J = 6.57 Hz, 2H), 1.84 (m, IH), 1.76 (m, 2H), 1.65 (m, 2H), 1.5 (m, 2H), 1.10 (s, 3H), 1.08 (s, 3H), 1.02 (t, J = 7.3 Hz, 3H). 0 MS(ES+) m/e 510 [M+H]+.
Example 3 2- { 3- [4-hydroxy-6-methyl- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydro-quinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yloxy } acetamide a) Ethyl (7-hydroxy- 1,1 -dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetate: A mechanically stirred suspension of the compound from example If) (17.0 g, 57.0 mmol) in 1,2-dichloroethane (800 mL) was cooled over an ice bath (5-10°C) under nitrogen. A solution of boron tribromide (1M solution in dichloromethane, 200 mL) was added dropwise over 20 min, the ice bath was removed and the mixture stirred at ambient temperature for 3h. The mixture was poured onto ice, the organic layer was separated and the aqueous layer was extracted thrice with ethyl acetate. The combined organic solutions were washed with brine, dried and evaporated to a foam.
The product was dissolved in ethanol (100 mL) and concentrated sulfuric acid (1.0 mL) was added. The mixture was heated under reflux for 45 min, partially evaporated and diluted with ethyl acetate. The solution was washed with water and the aqueous layer was extracted with ethyl acetate. The combined organic solutions were dried and evaporated to an oil. Crystallization from dichloromethane gave the title compound as a gray solid (6.30 g, 39%). 1H NMR (400MHz, D6-DMSO) δ 12.1 (s, IH), 10.2 (s, IH), 7.29-7.02 (m, 3H), 4.15 (q, 2H), 1.21 (t, 3H). b) 6-Methylbenzo[d][l,3]oxazine-2,4-dione: A solution of 5-methylanthranilic acid (1.0 g, 6.6 mmol) in tetrahydrofuran (20 mL) was treated with a 20 % solution of phosgene in toluene (4.0 mL) and stirred overnight. Saturated aqueous sodium hydrogen carbonate solution was added and the mixture extracted with ethyl acetate. Evaporation of the organic layer gave the title compound (1.01 g, 86%). *H NMR (300MHz, Dg-DMSO) δ 11.66 (br s,
IH), 7.72 (d, J=2Hz, IH), 7.57 (dd, J=8 and 2 Hz, IH) 7.06 (d, J=8Hz, IH), 2.33 (s, 3H). c) l-(3-Methylbutyl)-6-methylbenzo[d][l,3]oxazine-2,4-dione: The compound from example 3b) (1.0 g, 5.6 mmol) was added portion wise to a suspension of sodium hydride (60% suspension in mineral oil) (250 mg, 6.25 mmol) in anhydrous N,N- dimethylformamide. After 30 min, l-bromo-3-methylbutane (0.9 ml, 7.1 mmol) was added and the mixture was stirred at 80°C for 16h.
The mixture was poured onto ice, acidified with acetic acid, and extracted into ethyl acetate. The residue was purified by chromatography (silica gel, 20% ethyl acetate in hexanes) gave the title compound, (592 mg, 43%). lU NMR (300MHz, D6-DMSO) δ 7.82 (d, J = 1 Hz, IH), 7.68 (dd, J = 8 and 2Hz, IH) 7.33 (d, J = 8Hz, IH), 4.00 (m, 2H), 2.37 (s, IH), 1.70 (m, IH), 1.52 (m, 2H) 0.96 (d, J = 6.5 Hz, 6H). d) 4-Hydroxy-3-(7-hydroxy- 1 , 1 -dioxo-1 ,4- 1 -benzo[ 1 ,2,4]thiadiazin-3-yl)-6-methyl- l-(3-methylbutyl)-lH-quinolin-2-one: l,8-Diazabicyclo[5.4.0]undec-7-ene (0.7 ml, 4.67 mmol) was added dropwise to a stirred solution of the compounds from examples 3c) (500 mg, 2.02 mmol) and 3a) (531 mg, 1.87 mmol) in N,N-dimethylformamide (10.0 mL). The mixture was then stirred overnight at room temperature. Acetic acid (4.0 ml) was added and the mixture stirred for a further 3h. Water was added, the mixture stirred for lh and the solid collected, washed with water, ether and hexane then dried to give the title compound (50 mg, 6%).!H NMR (d6-DMSO) δ 15.3 (br s, IH), 14.5 (br s, IH), 10.5 (br s, IH), 8.1 (d, IH), 7.8 (m, IH), 7.7 (m, 2H), 7.30 (m, 2H), 4.42 (m, 2H), 2.52 (s, 3H), 1.90 (m, IH), 1.62
(m, 2H), 1.09 (d, 6H). MS(ES+) m/e 442 [M+H]+. e) 2-{3-[4-hydroxy-6-methyl-l-(3-methylbutyl)-2-oxo-l,2-dihydroquinolin-3-yl]- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetamide: The compound from Example 3d) (30 mg, 0.07 mmol) was heated in N,N-dimethylformamide (1.0 ml) at 80°C until dissolved. Potassium carbonate (29 mg, 0.21 mmol) was added and the mixture stirred for 5 min. Chloroacetamide (6.5 mg, 0.07 mmol) was added and stirring was continued for 30 min. After this time a second portion of chloroacetamide (6.5 mg, 0.07 mmol) was added and the reaction was allowed to continue for a further 30 min. The mixture was diluted with water and the gummy solid triturated then collected and washed successively with water, ether and hexanes to give the title compound (25 mg, 72%). 1H NMR (d6- DMSO) δ 15.3 (br s, IH), 14.5 (br s, IH), 7.92 (s, IH), 7.64 (s, IH), 7.42 (m, IH), 7.34 (m, IH), 7.22 (m, IH), 7.14 (m, IH), 4.49 (s, 2H), 4.08 (m, 2H), 2.34 (s, 3H), 1.71 (m, IH), 1.43
(m, 2H), 0.98 (d, 6H). MS(ES+) m/e 499 [M+HJ+.
Example 4 2-[3-(l-Cyclobutylmethyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxo-l,4- dihydrobenzo [ 1 ,2,4] thiadiazin-7-yloxy] acetamide a) l-Cyclobutylmethyl-lH-benzo[d][l,3]oxazine-2,4-dione: Isatoic anhydride (1.0 g, 6.13 mmol) was added portion wise to a suspension of sodium hydride (60% suspension in mineral oil, 294 mg, 7.36 mmol) in anhydrous N,N-dimethylacetamide. After 5 min, (bromomethyl)cyclobutane (0.83 ml, 7.36 mmol) was added and the mixture was stirred at room temperature for 24h, then at 60°C for 2h. After cooling to room temperature, the mixture was poured onto ice/water. The solid was collected by filtration, washed with water, then hexane and dried to give the title compound (556 mg, 39%). Η NMR (CDC13) δ 8.16 (dd, J = 7.9, 1.6 Hz, IH), 7.74 (td, J = 7.8, 1.3 Hz, IH), 7.30 (d, J = 7.6 Hz, IH), 7.17 (d, J = 8.5 Hz, IH), 4.15 (d, J = 7.2 Hz, 2H), 2.80 (sept, J = 7.4 Hz, IH), 2.13-1.87 (m, 6H). b) l-Cyclobutylmethyl-4-hydroxy-3-(7-methoxy-l, l-dioxo-1,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: The procedure of Example lg) was followed, except substituting l-cyclobutylmethyl-lH-benzo[d][l,3]oxazine-2,4-dione for 1- (3,3-dimethylbutyl)-6-fluoro-lH-benzo[d][l,3]oxazine-2,4-dione, to give the title compound. MS(ES+) m/e 440 [M+H]+. c) l-Cyclobutylmethyl-4-hydroxy-3-(7-hydroxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: The compound from Example 4b) (280 mg, 0.637 mmol) was suspended in 10 mL of glacial acetic acid. The mixture was warmed until a solution was obtained, treated with 3 mL of 48% aqueous hydrobromic acid and heated under reflux overnight. Additional 48% aqueous hydrobromic acid (2 mL) was added and the mixture was stirred and heated under reflux for 2.5h . After cooling to room temperature, the resulting precipitate was collected, washed with water, then diethyl ether and dried to give the title compound (201 mg, 74%). !H NMR (d6-DMSO) δ 15.35 (br s, IH), 14.27 (br s, IH), 10.46 (br s, IH), 8.20 (d, J = 7.9 Hz, IH), 7.89-7.77 (m, 2H), 7.60 (d, J = 9.0 Hz, IH), 7.45 (t, J = 7.6 Hz, IH), 7.20-7.16 (m, 2H), 4.47 (d, J = 6.8 Hz, 2H), 2.83-
2.75 (m, IH), 1.97-1.77 (m, 6H). MS(ES+) m/e 426 [M+H]+. d) 2-[3-( 1 -Cyclobutylmethyl-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)- 1 , 1 -dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy]acetamide: Following the procedure of Example li), the compound from Example 4c) was converted to the title compound. The solid obtained was suspended in methanol, warmed until a solution was obtained and treated with 1M aqueous hydrochloric acid. After cooling, the precipitate was collected, washed with water and dried to give the title compound as a white powder (74 mg, 47%). Η NMR (d6- DMSO) δ 15.26 (br s, IH), 14.34 (br s, IH), 8.21 (dd, J = 8.1, 1.5 Hz, IH), 7.88 (t, J = 7.0 Hz, IH), 7.79 (d, J = 8.9 Hz, IH), 7.74 (d, J = 8.7 Hz, IH), 7.68 (br s, IH), 7.68-7.39 (m, 4H), 4.61 (s, 2H), 4.47 (d, J = 7.1 Hz, 2H), 2.81 (sept, J = 7.7 Hz, IH), 1.96-1.78 (m, 6H).
MS(ES+) m/e 483 [M+H]+.
Example 5 2-{3-[l-(3,3-Dimethylbutyl)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-7-yloxy}aceta ide a) l-(3,3-Dimethylbutyl)-lH-benzo[d][l,3]oxazine-2,4-dione: Diisopropyl azodicarboxylate (1.21 mL, 6.13 mmol) was added dropwise to a suspension of isatoic anhydride (1.0 g, 6.13 mmol), 3,3-dimethyl-l-butanol (0.742 mL, 6.13 mmol) and triphenylphosphine (1.60 g, 6.13 mmol) in dichloromethane (25.0 mL). The solution was stirred at room temperature for 18h, the solvent was evaporated under reduced pressure and the residue was purified by flash chromatography (silica gel, gradient 1-10% ethyl acetate/hexanes) to give the title compound (510 mg, 34%). *H NMR (CDC13) δ 8.17 (dd, J = 7.8, 1.5 Hz, IH), 7.76 (td, J = 7.5, 1.3 Hz, IH), 7.29 (t, J = 7.6 Hz, IH), 7.14 (d, J = 7.5
Hz, IH), 4.10-4.05 (m, 2H), 1.67-1.62 (m, 2H), 1.07 (s, 9H). MS(ES+) m/e 248 [M+H]+. b) l-(3,3-Dimethylbutyl)-4-hydroxy-3-(7-hydroxy-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Following the procedures of
Example 4b) and 4c), except substituting l-(3,3-dimethylbutyl)-lH-benzo[d][l,3]oxazine- 2,4-dione for l-cyclobutylmethyl-lH-benzo[d][l,3]oxazine-2,4-dione, the title compound was obtained as a tan solid (271 mg, 51%). !H NMR (CDC13) δ 8.30 (dd, J = 8.1, 1.4 Hz, IH), 7.77 (td, J = 7.9, 1.5 Hz, IH), 7.42-7.32 (m, 3H), 7.26 (d, J = 8.9 Hz, IH), 7.15 (dd, J = 8.9, 2.7 Hz, IH), 4.34-4.32 (m, 2H), 1.66-1.61 (m, 2H), 1.12 (s, 9H). MS(ES+) m/e 442
[M+H]+. c) 2-{3-[l-(3,3-Dimethylbutyl)-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetamide: The compound from Example 5b) (140 mg, 0.317 mmol) and potassium carbonate (153 mg, 1.11 mmol) in N,N- dimethylformamide (7 mL) was warmed to 85°C and then treated with 2-bromoacetamide (65.6 mg, 0.476 mmol). The reaction mixture was stirred overnight at the same temperature, and for an additional 1.5h after the addition of another portion of 2- bromoacetamide (1 equiv) and potassium carbonate (1 equiv). 1M Aqueous hydrochloric acid was then added to the cooled mixture and the precipitate obtained was collected by filtration, washed with water, then diethyl ether and dried to give the title compound as a tan powder (136 mg, 86%). Η NMR (d6-DMSO) δ 15.23 (br s, IH), 14.26 (br s, IH), 8.21 (dd, J = 8.1, 1.4 Hz, IH), 7.93-7.90 (m, IH), 7.73 (d, J = 8.7 Hz, IH), 7.68 (br s, IH), 7.58 (d, J = 8.6 Hz, IH), 7.48-7.39 (m, 4H), 4.61 (s, 2H), 4.38-4.34 (m, 2H), 1.59-1.54 (m, 2H), 1.07 (s,
9H). MS(ES+) m/e 499 [M+H]+.
Example 6 6-Fluoro-4-hydroxy-3 -(8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(3- methylbutyl)- lH-quinolin-2-one a) 2-Amino-3-chloro-6-methoxybenzenesulfonamide: A solution of 2-chloro-5- methoxyaniline (4.07 g, 25.8 mmol) in nitroethane (30 mL) was added dropwise to a stirred solution of chlorosulfonyl isocyanate (2.47 mL, 28.3 mmol) in nitroethane (50 mL) at -60°C under argon, then the mixture stirred at 0°C for 20 min. Aluminium chloride (4.13 g, 31.0 mmol) was added and the resulting solution heated at 80°C for lh, then cooled and poured into iced water (500 mL). The precipitate was filtered, washed with cold water and dried. A mixture of this intermediate, 9M aqueous sulfuric acid (25 mL) and dioxane (25 mL) was heated under reflux for 48h, then cooled. Most of the solvent was removed under reduced pressure and the pH adjusted to 4.5 with 4M aqueous sodium hydroxide. After cooling in ice, the precipitate was filtered, washed with cold water and dried to give the title compound (2.31 g, 38%) as a pink solid. XH NMR (400MHz, d6-DMSO) δ 7.39 (IH, d, J = 8.8 Hz),
7.22 (2H, s), 6.36 (2H, s), 6.35 (IH, d, J = 8.8 Hz), 3.83 (3H, s). b) 2-Amino-6-methoxybenzenesulfonamide: A solution of 2-amino-3-chloro-6- methoxybenzenesulfonamide (0.275 g, 1.16 mmol) in methanol (15 mL) and 2M aqueous sodium hydroxide (2.5 mL) was shaken with palladium-on-charcoal (5%, 0.270 g, 0.130 mmol) under hydrogen at 50 lb/in2 for 18h, then the hydrogen removed. The mixture was filtered through Celite® and most of the solvent removed under reduced pressure. 1M aqueous hydrochloric acid (10 mL) was added and the pH adjusted to 6-7 with sodium bicarbonate. The mixture was saturated with sodium choride then extracted with ethyl acetate. The extracts were dried (magnesium sulfate) and evaporated under reduced pressure to give the title compound (0.191 g, 81 %) as a solid. *H NMR (400MHz, dg-
DMSO) δ 7.10 (IH, t, J = 8.2 Hz), 6.97 (2H, s), 6.35 (IH, dd, J = 8.4, 0.9 Hz), 6.25 (2H, s), 6.21 (IH, dd, J = 8.1, 0.9 Hz), 3.80 (3H, s). c) (8-Methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester: A solution of 2-amino-6-methoxybenzenesulfonamide (0.188 g, 0.930 mmol) in diethyl malonate (3 mL) was heated under nitrogen at 150°C for 2h, then cooled and diluted with ether (20 mL). The precipitate was filtered, washed with ether and dried, then heated under reflux in phosphorus oxychloride (5 mL) for 1 h. After cooling, iced water (150 mL) was added and the mixture stirred 2h, then extracted with ethyl acetate. The extracts were evaporated under reduced pressure and the residue slurried in 0.1 M aqueous hydrochloric acid (20 mL). The mixture was cooled in ice, then the solid filtered, washed with cold water and ether and dried to give the title compound (0.169 g, 61%) as a solid. !H NMR (400MHz, d6-DMSO) δ 12.04 (IH, s), 7.60 (IH, t, J = 8.3 Hz), 7.04 (IH, d, J = 8.0 Hz),
6.85 (IH, dd, J = 8.1, 0.6 Hz), 4.16 (2H, q, J = 7.1 Hz), 3.91 (3H, s), 3.65 (2H, s), 1.22 (3H, t, J = 7.1 Hz). d) 5-Fluoro-2-(3-methylbutylamino)benzoic acid: A mixture of 2-bromo-5- fluorobenzoic acid (5.00 g, 22.8 mmol), 3-methylbutylamine (2.78 mL, 23.0 mmol), potassium carbonate (6.30 g, 45.6 mmol), copper (II) bromide (0.255 g, 1.14 mmol) and tetrahydrofuran was heated at 75 °C for 3.5h, then cooled and diluted with water (20 mL). The organic solvent was removed under reduced pressure and 1M aqueous hydrochloric acid (90 mL) added dropwise. After stirring 30 min, the solid was filtered, washed with water and dried to give the title compound (4.47 g, 87%) as a solid. !H NMR (400MHz, dg-
DMSO) δ 7.49 (IH, dd, J = 9.8, 3.1 Hz), 7.28 (IH, m), 6.75 (IH, dd, J = 9.3, 4.5 Hz), 3.16 (2H, t, J = 7.2 Hz), 1.68 (IH, m), 1.48 (2H, m), 0.92 (6H, d, J = 6.6 Hz). e) 6-Fluoro-l-(3-methylbutyl)benzo[d][l,3]oxazine-2,4-dione.: A solution of triphosgene (2.65 g, 8.93 mmol) in ethyl acetate (11 mL) was added dropwise to a stirred mixture of 5-fluoro-2-(3-methylbutylamino)benzoic acid (4.47 g, 19.8 mmol), potassium carbonate (2.58 g, 18.7 mmol) and ethyl acetate (35 mL) warmed in an oil bath at 30°C. After stirring 30 min, the mixture was cooled, filtered and the filtrate washed (water, brine), dried (magnesium sulfate) and evaporated under reduced pressure. The residue was dissolved in toluene (10 mL) and hexane (50 mL) added slowly. The mixture was cooled in ice, then the solid filtered, washed with hexane and dried to give the title compound (3.96 g, 80%) as a solid. JH NMR (300MHz, d6-DMSO) δ 7.81-7.72 (2H, m), 7.49 (IH, m), 4.02
(2H, m) 1.73 (IH, m), 1.54 (2H, m), 0.96 (6H, d, J = 6.5 Hz). f) 6-Fluoro-4-hydroxy-3-(8-methoxy-l,l-dioxo-l,4~dihydrobenzo[l,2,4]thiadiazin-
3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one: Sodium hydride (0.087 g of a 60% oil suspension, 2.17 mmol) was added to a stirred suspension of 6-fluoro-l-(3- methylbutyl)benzo[d][l,3]oxazine-2,4-dione (0.182 g, 0.723 mmol) and (8-methoxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester (0.196 g, 0.689 mmol) in tetrahydrofuran (7 mL) under nitrogen. After the gas evolution had stopped, the mixture was heated under reflux for 1.5 h, then acetic acid (1 mL) added dropwise and the reflux continued for 0.5 h. After cooling, water (50 mL) was added and the mixture stirred 15 min, then the solid filtered, washed with water and ether and dried to give the title compound (0.235 g, 74%) as a pale yellow solid. !H NMR (400MHz, d6-DMSO) δ 15.14 (IH, s), 14.05 (IH, s), 7.90 (IH, dd, J = 8.8, 3.0 Hz), 7.79-7.70 (2H, m), 7.68 (IH, t, J = 8.3 Hz), 7.16-7.12 (2H, m), 4.32 (2H, m), 3.96 (3H, s), 1.78 (IH, m), 1.53 (2H, m), 1.00 (6H, d, J = 6.6 Hz). g) 6-Fluoro-4-hydroxy-3-(8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin- 3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one: A mixture of 6-fluoro-4-hydroxy-3-(8- methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4] thiadiazin-3-yl)- 1 -(3-methylbutyl)- 1 H-quinolin- 2-one (0.223 g, 0.485 mmol), acetic acid (15 mL) and 48% aqueous hydrobromic acid (2 mL) was heated under reflux for 42h, then cooled and diluted with water (35 mL). After stirring 30 min, the solid was filtered, washed with water, dichloromethane and 5% methanol/dichloromethane then dried to give the title compound (0.072 g, 33%) as a white powder. *H NMR (400MHz, d6-DMSO) δ 15.36 (IH, s), 13.97 (IH, s), 11.16 (IH, s), 7.90
(IH, dd, J = 8.8, 2.9 Hz), 7.79-7.71 (2H, m), 7.51 (IH, t, J = 8.3 Hz), 6.97 (IH, d, J = 7.9 Hz), 6.90 (IH, d, J = 8.3 Hz), 4.32 (2H, m), 1.78 (IH, m), 1.53 (2H, m), 1.00 (6H, d, J = 6.6 Hz).
Example 7 2- { 3- [ 1 -(2-Cyclopropylethyl)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4- dihydrobenzofl ,2,4]thiadiazin-7-yloxy }acetamide a) l-(2-Cyclopropylethyl)-lH-benzo[l,3]oxazine-2,4-dione: Following the procedure from Example 5a), except substituting 2-cyclopropyl-ethanol for 3,3-dimethyl-l- butanol, the title compound was obtained as a white powder after flash chromatography (25% ethyl acetate in hexane) and trituration from diethyl ether (556 mg, 78%). *H NMR (CDC13) δ 8.17 (dd, J = 8.7, 1.6 Hz, IH), 7.78-7.73 (m, IH), 7.30 (d, J = 7.8 Hz, IH), 7.20 (d, J = 8.4 Hz, IH), 4.18 (t, J = 7.5 Hz, 2H), 1.67 (q, J = 7.4 Hz, 2H), 0.81-0.72 (m, IH), 0.54-0.48 (m, 2H), 0.13-0.01 (m, 2H). b) 1 -(2-Cyclopropylethyl)-4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: l,8-Diazabicyclo[5.4.0]undec-7- ene (0.356 mL, 2.38 mmol) was added dropwise to a solution of the compound from Example 7a) (250 mg, 1.08 mmol) and the compound from Example 3a) (307 mg, 1.08 mmol) in N,N-dimethylformamide (8 mL). The reaction mixture was then stirred at room temperature for 40h, treated with glacial acetic acid (2.5 mL) and stirred for additional 4h at rt. The solution was poured in 1M aqueous hydrochloric acid and the precipitate was collected by filtration, washed with water, then diethyl ether and dried to give the title compound (75 mg, 16%). !H NMR (d6-DMSO) δ 15.33 (br s, IH), 14.26 (br s, IH), 10.45 (br s, IH), 8.21 (d, J = 7.9 Hz, IH), 7.89 (t, J = 7.1 Hz, IH), 7.79 (d, J = 8.4 Hz, IH), 7.62- 7.60 (m, IH), 7.47 (t, J = 7.6 Hz, IH), 7.20-7.17 (m, 2H), 4.44 (t, J = 7.4 Hz, 2H), 1.60 (q, J = 7.5 Hz, 2H), 0.88-0.79 (m, IH), 0.43-0.40 (m, 2H), 0.11-0.08 (m, 2H). MS(ES+) m/e 426 [M+H]+. c) 2- { 3-[l-(2-Cyclopropylethyl)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]-l , 1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}acetamide: Following the procedure from
Example 5c), except substituting l-(2-cyclopropylethyl)-4-hydroxy-3-(7-hydroxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one for l-(3,3-dimethylbutyl)- 4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1 H-quinolin-2- one, the title compound was obtained as a tan powder (44 mg, 66%). H NMR (d6-DMSO) δ 15.21 (br s, IH), 14.32 (br s, IH), 8.19 (dd, J = 8.2, 1.4 Hz, IH), 7.87 (td, J = 8.6, 1.4 Hz, IH), 7.77 (d, J = 8.6 Hz, IH), 7.72 (d, J = 8.8 Hz, IH), 7.67 (br s, IH), 7.46-7.38 (m, 4H), 4.60 (s, 2H), 4.42 (t, J = 7.6 Hz, 2H), 1.59 (q, J = 7.6 Hz, 2H), 0.88-0.78 (m, IH), 0.44-0.39
(m, 2H), 0.11-0.07 (m, 2H). MS(ES+) m/e 483 [M+H]+.
Example 8 3-(6-Chloro-7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy- 1 H-quinolin-2-one a) (6-Chloro-7-methoxy-l , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazm-3-yl)acetic acid ethyl ester: Following the procedures of Examples 6a) and 6c), except substituting 3- chloro-4-methoxyaniline for 2-chloro-5-methoxyaniline, the title compound was obtainied suitable for use in the next procedure without further purification. b) (6-Chloro-7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)acetic acid ethyl ester: A stirred suspension of (6-chloro-7-methoxy- 1,1 -dioxo- 1,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester (0.509 g, 1.53 mmol) in 1,2- dichloroethane (800 ml) under nitrogen was cooled in an ice bath. A solution of boron tribromide (6.7 mL of a 1M solution in dichloromethane. 6.70 mmol) was added dropwise over 20 min, the ice bath removed and the mixture stirred at ambient temperature for 3 h. The mixture was poured onto ice, the organic layer separated and the aqueous layer extracted with ethyl acetate. The combined organic solutions were washed with brine, dried and evaporated under reduced pressure. A solution of the residue in ethanol (10 mL) and sulfuric acid (0.1 mL) was heated under reflux for 2h, then cooled and partially evaporated under reduced pressure. Water (10 mL) was added and the mixture extracted with ethyl acetate. The extracts were were dried (magnesium sulfate) and evaporated under reduced pressure to give the title compound (0.377 g, 77%) as a gum. LCMS (m/z) 319 (MH+). c) 6-Fluorobenzo[d][l,3]oxazine-2,4-dione: A solution of 5-fluoroanthranilic acid (1.26 g, 8.12 mmol) in tetrahydrofuran (20 mL) was treated with triphosgene (1.2 g, 4.04 mmol) and stirred at 50 °C overnight. Ice-cold dilute sodium hydrogen carbonate solution was added and the solid was collected, washed with water, then ether and dried to give the title compound (1.31 g, 89%). Η NMR (300MHz, d6-DMSO) δ 11.80 (IH, s), 7.67 (2H, m), 7.18 (lH, m). d) l-(2-Cyclopropylethyl)~6-fluorobenzo[d][l,3]oxazine-2,4-dione: 6-Fluorobenzo[d][l,3]oxazine-2,4-dione (1.0 g, 5.58 mmol), triphenylphosphine (1.44 g, 5.58 mmol) and 2-cyclopropylethanol (1.0 g, 11.6 mmol) were stirred together in chloroform and treated with diethyl azodicarboxylate (0.875 ml, 5.58 mmol). The reaction was stirred under a nitrogen atmosphere overnight, evaporated onto silica and purified by chromatography (silica gel, ethyl acetate - hexanes) to give the title compound (722 mg, 51%) as a solid. Η NMR (300MHz, CDC13) δ 7.80 (IH, dd, J = 7, 3 Hz), 7.48 (IH, m), 7.08 (IH, dd, J = 9, 4 Hz), 4.15 (2H, m), 1.65 (2H, m) 0.74 (IH, m), 0.51 (2H, m), 0.09 (2H, m). e) 3-(6-Chloro-7-hydroxy- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)- 1-(2- cycloρropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one: l,8-Diazabicyclo[5.4.0]undec-7- ene (0.533 mL, 3.56 mmol) was injected into a stirred solution of l-(2-cyclopropylethyl)-6- fluorobenzo[d][l,3]oxazine-2,4-dione (0.300 g, 1.20 mmol) and (6- chloro-7-hydroxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester (0.377 g, 1.18 mmol) in N,N-dimethylformamide (8 mL) under nitrogen and the mixture stirred for 18h at room temperature. Acetic acid (2 mL) was added and the mixture stirred at 60°C for lh, then cooled and diluted with water (100 mL) slowly. The precipitate was filtered, washed with water and ether and dried. The crude material was purified by flash chromatogaphy (silica gel, 3% methanol/dichloromethane) to give a solid which was triturated with ether and dried to give the title compound (0.110 g, 20%) as a solid. !H NMR (400MHz, dg-DMSO) δ
15.15 (IH, s), 14.23 (IH, s), 11.29 (IH, s), 7.97 (IH, s), 7.90-7.77 (3H, m), 7.35 (IH, s),
4.42 (2H, m), 1.58 (2H, m), 0.82 (IH, m), 0.43 (2H, m), 0.09 (2H, m).
Example 9
2- { 6-chloro-3-[ 1 -(2-cyclopropylethyl)-6~fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -
1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4] thiadiazin-7-yloxy } acetamide
Potassium carbonate (0.069 g, 0.501 mmol) was added to a stirred solution of 3-(6- chloro-7-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one (Example 8, 0.080 g, 0.167 mmol) in N,N-dimethylformamide (2 mL) at 80°C under nitrogen. After 5 min, 2-chloroacetamide
(0.017 g, 0.184 mmol) was added and the mixture stirred for 3h at 80°C, then cooled.
Acetic acid (0.5 mL) was added, followed by water (50 mL) slowly. The precipitate was filtered, washed with water and ether and dried. The crude product was boiled in 5% methanol/dichloromethane (20 mL), cooled, filtered, washed (5% methanol/dichloromethane) and dried to give the title compound (0.066 g, 74%) as a solid.
*H NMR (400MHz, d6-DMSO) δ 15.05 (IH, br s), 14.29 (IH, s), 8.07 (IH, s), 7.91-7.75 (3H, m), 7.53 (1H, s), 7.50 (IH, s), 7.41 (1H, s), 4.78 (2H, s), 4.42 (2H, m), 1.59 (2H, m), 0.83 (IH, m), 0.42 (2H, m), 0.10 (2H, m).
Example 10 (R)-2- { 3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy} propionic acid ethyl ester a) 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: A mixture of the compound from Example 8d) (211 mg, 0.85 mmol) and the compound from Example 3a) (240 mg, 0.85 mmol) in anhydrous tetrahydrofuran (20 mL) under argon was treated with sodium hydride (60% suspension in mineral oil) (182 mg, 4.5 mmol) and heated under reflux for 1 h. The mixture was acidified with acetic acid and heated under reflux for an additional 1 h. The solvent was partially removed and the mixture diluted with water. The solid was collected by filtration, washed with water, ether and hexanes to give the title compound as a yellow solid (105 mg, 28%). !H NMR (400MHz, d6-DMSO) δ 15.3 (br s, IH), 14.1 (s, IH), 10.4
(s, IH), 7.88 (dd, IH, J = 3, 9 Hz), 7.78 (ddd, IH, J = 3, 9, 10 Hz), 7.72 (dd, IH, J = 5, 10 Hz), 7.58 (d, IH, J = 10 Hz), 7.18 (dd, IH, J = 3, 10 Hz), 7.17 (d, IH, J -= 3 Hz), 4.42 (m,
2H), 1.58 (m, 2H), 0.83 (m, IH), 0.41 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e 444 [M+H]+. b) (S)-2-methanesulfonyloxypropionic acid ethyl ester: To a solution of (S)-2- hydroxy-propionic acid ethyl ester (2.0 g, 16.7 mmol) in methylene chloride (50 mL) at 0 °C were added pyridine (4.0 mL, 50.1 mmol) and methanesulfonyl chloride (1.4 mL, 18.6 mmol). The mixture was stirred for lh at 0 °C followed by concentration in vacuo. The residue was triturated with cold methylene chloride and filtered to yield the title compound as a white solid (1.2 g, 38%). MS(ES+) m/e 197 [M+H]+. c) (R)-2-{3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-
3-yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}propionic acid ethyl ester: To a solution of the compound from Example 10a) (100 mg, 0.22 mmol) in anhydrous N,N- dimethylformamide (5.0 mL) at 80 °C was added potassium carbonate (93 mg, 0.67 mmol). After stirring 5 min, the compound from Example 10b) (44.2 mg, 0.22 mmol) was added and the mixture was stirred overnight at 80 °C. Following a quench with water and acidification with 1M aqueous hydrochloric acid, the precipitate was collected by filtration and washed with water and ether. The title compound was obtained as a yellow solid (80 mg, 66%). 1H NMR (400MHz, d6-DMSO) δ 15.2 (s, IH), 14.3 (s, IH), 7.90 (dd, IH, J = 3, 9 Hz), 7.87-7.61 (m, 3H), 7.35 (dd, IH, J = 3, 9 Hz), 7.29 (s, IH), 5.21 (q, IH, J = 7 Hz), 4.42 (m, 2H), 4.17 (q, 2H, J = 7 Hz), 1.61-1.58 (m, 2H), 1.54 (d, 3H, J = 7 Hz), 1.18 (t, 3H, J = 7 Hz), 0.83 (m, IH), 0.41 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e 544 [M+H]+.
Example 11 (S)-2-{ 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-7-yloxy }butyramide
Following the procedure of Example 10c), except substituting 2-chlorobutyramide for the compound from Example 10b), then floowed by purification via preparative chiral HPLC (Chiralpak AD 20 x 250 mm column, 6/1/1 hexanes/methanol/ethanol containing 0.1 % i-PrNH2, 18.9 mL/min, λ = 220 and 254 nm, Tr = 20.4 min), the title compound was obtained as a yellow solid (6.1 mg, 5%). 1H NMR (400MHz, d6-DMSO) δ 15.2 (s, IH), 14.3 (s, IH), 7.90 (dd, IH, J = 3, 9 Hz), 7.86 (dd, IH, J = 5, 9 Hz), 7.78 (ddd, IH, J = 3, 9, 9 Hz), 7.71 (d, IH, J = 9 Hz), 7.70 (s, IH), 7.38 (s, IH), 7.36 (dd, IH, J = 3, 9 Hz), 7.32 (d, IH, J = 3 Hz), 4.63 (t, IH, J = 6 Hz), 4.43 (t, 2H, J = 7 Hz), 1.86 (m, 2H), 1.59 (q, 2H, J = 7 Hz), 0.99 (t, 3H, J = 7 Hz), 0.83 (m, IH), 0.41 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e 529
[M+H]+.
Example 12 (R)-2-{ 3-[ 1 -(2-yclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1- dioxo-1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-yloxy Jbutyramide
Following the procedure of Example 11 with purification via preparative chiral HPLC (Chiralpak AD 20 x 250 mm column, 6/1/1 hexanes/methanol/ethanol containing 0.1% i-PrNH2, 18.9 mL/min, λ = 220 and 254 nm, Tr = 11.6 min), the title compound was also obtained as a yellow solid (6.1 mg, 5%). H NMR (400MHz, d6-DMSO) δ 15.2 (s, IH), 14.3 (s, IH), 7.90 (dd, IH, J = 3, 9 Hz), 7.86 (dd, IH, J = 5, 9 Hz), 7.78 (ddd, IH, J = 3, 9, 9 Hz), 7.71 (d, IH, J = 9 Hz), 7.70 (s, IH), 7.38 (s, IH), 7.36 (dd, IH, J = 3, 9 Hz), 7.32 (d, IH, J = 3 Hz), 4.63 (t, IH, J = 6 Hz), 4.43 (t, 2H, J = 7 Hz), 1.86 (m, 2H), 1.59 (q, 2H, J = 7 Hz), 0.99 (t, 3H, J = 7 Hz), 0.83 (m, IH), 0.41 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e ,+
529 [M+H]
Example 13 l-(2-Cyclopropylethyl)-3-[7-((E)-3-dimethylaminoallanoyl)- 1, 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one a) 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo- 1 , 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Following the procedure of Example 2b, except substituting the product obtained in Example 8d), l-(2- cyclopropylethyl)-6-fluoro-lH-benzo[d][l,3]oxazine-2,4-dione, for l-(3-methylbutyl)-lH- benzo[d][l,3]oxazine-2,4-dione, the title compound was obtained as a pale yellow powder (89%) *H NMR (d6-DMSO) δ 14.2 (br s, IH), 8.1 (s, IH), 8.05 (dd, J = 8.6 and 1.6 Hz, IH), 7.82 (dd, J = 8.8 and 2.8 Hz, IH), 7.77 (dd, J = 9.3 and 4.1 Hz, IH), 7.70 (t, IH), 7.45 (d, J = 8.6 Hz, IH), 4.3 (t, 2H), 1.5 (m, 2H), 0.7 (m, IH), 0.3 (m, 2H), 0.0 (m, 2H). MS(ES+) m/e
554 [M+H]+. ° b) 3-(7-Acetyl- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [1 ,2,4]thiadiazin-3-yl)- 1-(2-
Cyclopropylethyl)-6-fluoro~4-hydroxy-lH-quinolin-2-one: Following the procedure of Example 2c), except substituting the compound from Example 13a) for the compound from Example 2b), and hydrolysis of the crude product with 3M aqueous hydrochloric acid, the title compound was obtained (68%). Η NMR (CDC13) δ 15.1 (s, IH), 14.9 (s, IH), 8.5 (s, 5 IH), 8.2 (dd, J = 8.6 and 1.76 Hz, IH), 7.97 (dd, J = 8.3 and 3.0 Hz, IH), 7.75 (m, IH), 7.46 (m, IH), 7.41 (d, J = 8.8 Hz, IH), 4.42 (m, 2H), 2.6 (s, 3H) 1.6 (m, 2H), 0.8 (m, IH), 0.5 (m,
2H), 0.1 (m, 2H). MS(ES+) m/e 470 [M+H]+. c) l-(2-Cyclopropylethyl)-3-[7-((E)-3-dimethylamino-allanoyl)-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-lH-quinolin-2-one: The product of 0 Example 13b) (50 mg, 0.106 mmol), N,N-dimethylformamide dimethyl acetal (28.3 μl, 0.213 mmol) and acetonitrile (1 ml) were heated in a sealed tube at 85°c for 18 h. The solvent was removed in vacuo. The crude residue was then partitioned between water (10 ml) and chloroform (10 ml). The organic layer was separated and the solvent removed by rotary evaporation. Purification by silica gel column chromatography (10% 5 methanol/chloroform) gave the title compound as an off white solid (50 mg, 89%). !H NMR (CDCI3) δ 15.1 (s, IH), 14.6 (s, IH), 8.5 (s, IH), 8.3 (dd, J = 8.6 and 1.76 Hz, IH), 8.0 (m, IH), 7.95 (dd, J = 8.5 and 3.0 Hz, IH), 7.47 (m, 2H), 7.37 (d, J = 8.6 Hz, IH), 5.78 (d, J = 12.6, IH), 4.42 (t, 2H), 3.22 (s, 3H), 3.0 (s, 3H), 1.7 (m, 2H), 0.8 (m, IH), 0.5 (m,
,+
2H), 0.1 (m, 2H). MS(ES+) m/e 525 [M+H] 0
Example 14 3-(5-Chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolfn-2-one a) (5-Chloro-8-methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)acetic acid ethyl ester: A mixture of 2-amino-3-chloro-6-methoxybenzenesulfonamide (Example 6a), 2.31 g, 9.80 mmol) and diethyl malonate (20 mL) was heated under argon at 150°C for 17h, then cooled. The mixture was diluted with ether (100 mL), then the solid filtered, washed with ether and dried to give the title compound (2.41 g, 74%) as a solid. !H NMR (400MHz, d6-DMSO) δ 11.11 (IH, s), 7.82 (IH, d, J = 9.1 Hz), 7.12 (IH, d, J = 9.1 Hz),
4.17 (2H, q, J = 7.1 Hz), 3.94 (3H, s), 3.86 (2H, s), 1.23 (3H, t, J = 7.1 Hz). b) (5-Chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid methyl ester: Following the procedure of Example 8b), excpet substituting (5-chloro-8- methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester for 6- chloro-7-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester and methanol in place of ethanol, the title compound was obtained (93%) as a solid. !H NMR (400MHz, d6-DMSO) δ 11.27 (IH, s), 11.00 (IH, s), 7.63 (IH, d, J = 8.9 Hz), 6.86
(IH, d, J = 8.9 Hz), 3.87 (2H, s), 3.70 (3H, s). c) 3-(5-Chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one: Following the procedure of Example 8e), excpet substituting (5-chloro-8-hydroxy- 1,1 -dioxo- 1,4- ι dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid methyl ester for (6- chloro-7-hydroxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, the title compound was obtained (16%) as a solid. !H NMR (400MHz, d6-DMSO) δ 15.29 (IH, br s), 14.77 (IH, s),
11.49 (IH, s), 7.92 (IH, dd, J = 8.8, 2.9 Hz), 7.86 (IH, m), 7.79 (IH, m), 7.74 (IH, d, J = 8.9 Hz), 6.93 (IH, d, J = 8.9 Hz), 4.44 (2H, m), 1.58 (2H, m), 0.81 (IH, m), 0.39 (2H, m), 0.07 (2H, m).
Example 15
(R)-2- { 3- [ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}propionic acid
A solution of the compound from Example 10c) (121 mg; 0.22 mmol) in tetrahydrofuran (2.0 mL) was treated with 1M aqueous sodium hydroxide (2.0 mL) and the solution was stirred and heated under reflux for 2h.
The mixture was cooled and evaporated and the residue dissolved in water (2 mL) then acidified with 3M aqueous hydrochloric acid to give a suspension. The suspension was filtered and the precipitate washed with water to give the title compound (78.0 mg; 68%) as a cream solid. MS(ES+) m/e 516 [M+H]+. Η-NMR (400 MHz, d6-DMSO) δ 15.1 (br s, IH), 14.2 (br s, IH), 13.1 (br s, IH), 7.82 (dd, J = 8.8 and 3.0 Hz, IH), 7.77 (dd, m, IH), 7.69 (m, IH), 7.61 (d, J = 9.1 Hz, IH), 7.26 (dd, J = 9.1 and 2.7 Hz, IH), 7.17 (d, J = 2.7 Hz, IH), 5.00 (q, J = 6.8 Hz, IH), 4.24 (m, IH), 1.49 (m, 2H), 1.45 (d, J = 6.8 Hz, 3H), 0.74 (m, IH), 0.32 (m, 2H), 0.00 (m, 2H).
Example 16 2- { 3-[ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo- 1 ,4-dihydrobenzo[l ,2,4]thiadiazin-7-yloxy } -3,3,3-trifluoropropinamide
Following the procedure of Example 10c), except substituting 2,3,3,3-tetrafluoro- propionamide for the compound from Example 10b), the title compound was obtained as a yellow solid (81 mg, 62%). 1H NMR (400MHz, d6-DMSO) δ 15.0 (s, IH), 14.4 (s, IH), 8.07 (s, IH), 7.91 (s, IH), 7.91 (dd, IH, J = 3, 9 Hz), 7.82 (ddd, IH, J = 3, 9, 9 Hz), 7.80 (dd, IH, J = 5, 9 Hz), 7.63 (d, IH, J = 9 Hz), 7.55 (dd, IH, J = 3, 9 Hz), 7.48 (d, IH, J = 3 Hz), 5.60 (dt, IH, J = 7, 46 Hz), 4.42 (t, 2H, J = 7 Hz), 1.58 (q, 2H, J = 7 Hz), 0.82 (m, IH), 0.40 (m, 2H), 0.08 (m, 2H). MS(ES+) m/e 569 [M+H]+.
Example 17 2- { 3-[ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yloxy}-2-methylpropionic acid ethyl ester Potassium carbonate (0.045 g, 0.326 mmol) was added to a stirred solution of
1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxy- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one (Example 10a), (0.036 g, 0.0812 mmol) in N,N-dimethylformamide (2 mL) at 80°C under nitrogen. After 5 min, ethyl 2- bromo-2-methylpropionate (0.032 g, 0.164 mmol) was added and the mixture stirred for 2h at 80°C, then cooled. Acetic acid (0.3 mL) was added, followed by water (20 mL) slowly. The precipitate was filtered, washed with water, then taken up in ethyl acetate and the solution washed twice with 0.1M aqueous potassium carbonate, 0.1M aqueous hydrochloric acid and brine. After drying (magnesium sulfate), the solvent was removed under reduced pressure and the residue triturated with ether, then dried to give the title compound (0.041 g, 91%) as a solid. !H NMR (400MHz, d6-DMSO) δ 15.10 (IH, s), 14.27 (IH, s), 7.91 (IH, dd, J = 8.8, 3.0 Hz), 7.86 (IH, m), 7.79 (IH, m), 7.69 (IH, d, J = 9.0 Hz), 7.30 (IH, dd, J = 9.0, 2.8 Hz), 7.18 (IH, d, J = 2.8 Hz), 4.43 (2H, m), 4.21 (2H, q, J = 7.1 Hz), 1.59 (8H, m), 1.20 (3H, t, J = 7.1 Hz), 0.83 (IH, m), 0.42 (2H, m), 0.08 (2H, m). Example 18 l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1-dioxo- 1 ,4- dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)- lH-quinolin-2-one a) 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-7-carboxylic acid methyl ester: The compound from Example 13a) (1.0 g, 1.81 mmol) and triethylamine (0.554 mL, 3.97 mmol) were added to a solution of l,3-bis(diphenylphosphino)propane (48.5 mg, 0.118 mmol) and palladium(II) acetate (26.4 mg, 0.118 mmol) in dimethylsulfoxide (20 mL) and methanol (15 mL). The system was degassed and then purged two times with carbon monoxide. The reaction mixture was stirred at 88°C for 6h, and then at 75°C for 40 h. Thin layer chromatographic analysis showed residual starting material. Additional 1,3- bis(diphenylphosphino)propane (48.5 mg) and palladium(II) acetate (27 mg) were then added. The system was evacuated and refilled with carbon monoxide. After addition of triethylamine (0.5 mL), the reaction mixture was stirred at 90°C for 6h, cooled to room temperature and partitioned between chloroform and 1M aqueous hydrochloric acid. The separated organic layer was washed with water, brine, dried over sodium sulfate and evaporated under reduced pressure. The residue was triturated from chloroform to give the desired product as a white powder (280 mg, 32%). :H NMR (d6-DMSO) δ 14.50 (br s, IH), 8.31 (s, IH), 8.22 (dd, J = 8.7, 1.3 Hz, IH), 7.89-7.73 (m, 4H), 4.40 (t, J = 7.4 Hz, 2H), 3.91 (s, 3H), 1.58 (q, J = 7.3 Hz, 2H), 0.86-0.79 (m, IH), 0.43-0.39 (m, 2H), 0.10-0.07 (m, 2H). b) 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one: Lithium aluminum hydride (1 M solution in tetrahydrofuran, 0.865 mL, 0.865 mmol) was added dropwise to a cooled suspension (0°C) of the compound from Example 18a) (280 mg, 0.577 mmol) in tetrahydrofuran (5 mL). The resulting solution was stirred at 0°C for 2h, then treated with saturated sodium potassium tartrate aqueous solution (3.5 mL) and stirred at room temperature for 30 min. The reaction mixture was then filtered, the solid washed with methanol and the filtrate made acidic by the addition of 1M aqueous hydrochloric acid. After stirring at room temperature for 20 min, the precipitate obtained was collected and redissolved in 5% methanol in chloroform. The solution was dried over sodium sulfate, filtered and the solvent evaporated under reduced pressure to afford the title compound as a yellow powder (180 mg, 68%). !H NMR (CDC13) δ 15.26 (br s, IH), 14.58 (br s, IH), 7.98 (d, J = 1.0 Hz, IH), 7.95 (dd, J = 8.4, 2.9 Hz, IH), 7.67 (dd, J = 8.5, 1.9 Hz, IH), 7.52-7.42 (m, 2H), 7.32 (d, J = 8.4 Hz, IH), 4.80 (s, 2H), 4.42 (t, J = 7.5 Hz, 2H), 1.68 (q, J = 7.5 Hz, 2H), 0.84-0.76 (m, IH), 0.55-0.51 (m, 2H), 0.15-0.12 (m, 2H). MS(ES+) m/e 458 [M+H]+. Example 19 (R)-2-{3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-7-yloxy } -N-methylpropionamide To a solution of the compound from Example 15 (50 mg, 0.10 mmol) in dichloromethane (5.0 mL) were added methylamine (0.050 mL, 2M solution in tetrahydrofuran, 0.10 mmol), diisopropylethylamine (0.019 mL, 0.10 mmol), l-hydroxy-7- azabenzotriazole (26.4 mg, 0.20 mmol) and polystyrene-supported carbodiimide (194 mg, 0.20 mmol). The mixture was stirred overnight under a nitrogen atmosphere. The polymer was filtered and washed with dichloromethane (3 x 10 mL). The filtrate was concentrated in vacuo and purified via flash column chromatography (0-10% methanol in chloroform) to give the title compound as a pale yellow solid (6.0 mg, 11%). 1H NMR (400MHz, d6- DMSO) δ 15.1 (s, IH), 14.3 (s, IH), 8.14 (q, IH, J = 5 Hz), 7.77 (dd, IH, J = 3, 9 Hz), 7.37 (ddd, IH, J = 3, 9, 9 Hz), 7.35 (dd, IH, J = 5, 9 Hz), 7.26 (d, IH, J = 9 Hz), 7.18 (dd, IH, J = 3, 9 Hz), 7.12 (d, IH, J = 3 Hz), 4.72 (q, IH, J = 7 Hz), 4.16 (t, IH, J = 8 Hz), 2.61 (d, 3H, J = 5 Hz), 1.49-1.42 (m, 2H), 1.43 (d, J = 7 Hz, 3H), 0.78 (m, IH), 0.42 (m, 2H), 0.10 (m,
2H). MS(ES+) m/e 529 [M+H]+.
Example 20 3-[7-(2-Amino-thiazol-4-yl)- 1 , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl]-6-fluoro-4- hydroxy- l-(3-methylbutyl)- lH-quinolin-2-one a) 6-Fluoro-4-hydroxy-3-(7-iodo- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3- yl)- l-(3-methylbutyl)-lH-quinolin-2-one: Following the procedure of Example 2b), except substituting 6-fluoro-l-(3-methylbutyl)-lH-benzo[d][l,3]oxazine-2,4-dione for l-(3- ethylbutyl)-lH-benzo[d][l,3]oxazine-2,4-dione, the title compound was obtained as a pale yellow powder (81%) Η NMR (d6-DMSO) δ 14.8 (br s, IH), 14.4 (br s, IH), 8.19 (s, IH), 8.1 (dd, J = 8.5 and 1.76 Hz, IH), 7.91 (dd, J = 9.1 and 3.0 Hz, IH), 7.75 (m, 2H), 7.51 (d, J = 8.6 Hz, IH), 4.35 (t, 2H), 1.8 (m, IH), 1.55 (m, 2H), 1.04 (s, 3H), 1.02 (s, 3H). MS(ES+) m/e 556 [M+H]+. b) 3-(7-Acetyl- 1 , 1-dioxo- 1 ,4-dihydro- ll6-benzo[ 1 ,2,4]thiadiazin-3-yl)-6-fluoro-4- hydroxy- l-(3-methylbutyl)- lH-quinolin-2-one: Following the procedure of Example 2c), except substituting the product of Example 20a for the compound from Example 2b), and hydrolysis of the crade product with 3M aqueous hydrochloric acid, the title compound was obtained (45%). MS(ES+) m/e 472 [M+H]+. c) 3-[(7-(2-Bromo-ethanoyl)- 1 , 1-dioxo- 1 ,4-dihydro- ll6-benzo[ 1 ,2,4]thiadiazin-3- yl]-6-fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one: The product of Example 20b) (135 mg, 0.287 mmol) in chloroform (3 ml) was treated with bromine (1M in glacial acetic acid, 290 μl, 0.287 mmol) and allowed to stir at room temperature for 13 h. The reaction mixture was diluted with chloroform (50 ml) and water (50 ml). The organic layer was separated, dried over magnesium sulfate, and solvent removed in vacuo to give the title compound as a pale yellow solid (103 mg) which was used without further purification.
MS(ES+) m/e 550 [M+H]+. d) 3-[7-(2-Amino-thiazol-4-yl)-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl]- 6-fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one: To the compound of Example 20c (190 mg, 0.345 mmol) in ethanol (3 ml) and chloroform (3 ml) was added thiourea (26.2 mg, 0.345 mmol). The cloudy solution was heated to 85°C where it became a homogenous yellow solution. After 10 min at 85°C the desired product began to precipitate out of solution. The reaction mixture was cooled to room temperature and the precipitate collected by filtration and washed with ethanol. After drying the title compound was obtained as a pale yellow solid (89 mg, 0.168 mmol). *H NMR (d6-DMSO) δ 14.8 (br s, IH), 14.2 (s, IH), 8.17 (s, IH), 8..03 (dd, J = 8.4 and 2.0 Hz, IH), 7.79 (dd, J = 8.7 and 3.0 Hz, IH), 7.65 (m, 3H), 7.27 (s, IH), 4.5 (br s, 2H), 4.21 (t, 2H), 1.65 (m, IH), 1.40 (m, 2H),
0.88 (s, 3H), 0.86 (s, 3H). MS(ES+) m/e 528 [M+H]+.
Example 21 3-[l,l-Dioxo-7-(2H-pyrazol-3-yl)-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4- hydroxy- 1 -(3-methylbutyl)- lH-quinolin-2-one a) 3-[7-((E)-3-dimethylaminoallanoyl)- 1 , 1-dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2- one: Following the procedure of Example 13c, except substituting the compound of Example 20b) for the compound from Example 2b), and hydrolysis of the crade product with 3M aqueous hydrochloric acid, the title compound.was obtained (87%). MS(ES+) m/e
527 [M+H]+. b) 3-[l,l-Dioxo-7-(2H-pyrazol-3-yl)-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl]-6- fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one: To the product of Example 21a) (200 mg, 0.380 mmol) in methanol (6 ml) was added acetic acid (32.5 μl, 0.570 mmol) and hydrazine hydrate (28.55 mg, 0.570 mmol). The mixture was stirred at room temperature for 12 h. The solvents were removed in vacuo and the crude residue dissolved in ethyl acetate and washed with water and brine. The organic layer was dried over magnesium sulfate and the solvent removed evaporation. Purification by chromatography [ODS silica, gradient 20-100% acetonitrile/water (0.01%TFA)] gave the title compound (92 mg, 0.186 mmol) as a light brown solid. !H NMR (d6-DMSO) δ 15.1 (br s, IH), 14.3 (s, IH), 8.3 (s, IH), 8..21 (dd, J = 8.6 and 1.76 Hz, IH), 7.92 (dd, J = 8.8 and 3.0 Hz, IH), 7.78 (m, 4H), 6.95 (d, J = 2.2 Hz, IH), 4.3 (t, 2H), 1.7 (m, IH), 1.5 (m, 2H), 1.0 (s, 3H), 0.98 (s, 3H).
MS(ES+) m/e 496 [M+H]+.
Example 22 3-(5-Bromo- 1 , 1 -dioxo- 1 ,4-dihydro- 1-benzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(2-cyclopropylethyl)-6- fluoro-4-hydroxy-lH-quinolin-2-one a) 5-Bromo- 1 , 1 -dioxo- 1 ,4-dihydro-2H- 1 -benzo [ 1 ,2,4]thiadiazin-3-one: 2-Bromoaniline (11.96 g, 70 mmoles) in nitroethane (100 ml) was added dropwise to a stirred solution of chlorosulfonylisocyanate (7.0 ml, 80 mmol) in nitroethane (60 ml) at 50°C under nitrogen atmosphere. After the addition, the mixture was stirred for 5 min then aluminum chloride (12.05 g, 90.35 mmoles) was added and the mixture immediately heated to reflux temperature. After 30 min the reaction mixture was poured onto ice, the solid collected, washed with water, ether and dried to give a grey solid (11.5 g, 60%). 1H NMR (d6-DMSO) δ 10.33 (s, 1Η), 8.03 (dd, J=1.3 and 8.1 Ηz, 1Η), 7.89 (d, J=7.8 Ηz, 1Η), 7.31 (t, J= 8.1 Hz, IH). b) 2-Amino-3-bromobenzenesulfonamide: The compound from Example 22a)
(11.5 g, 41.5 mmoles) was added portionwise to 50% sulfuric acid, stirred at 145°C, such that the foaming ceased prior to the addition of the next portion. The mixture was stirred for a further 30 min, cooled, and poured onto ice. The mixture was neutralized with 2.5M aqueous sodium hydroxide solution then extracted with ethyl acetate (x3). The organic solution was dried and evaporated to give the title compound (10 g, 96%). 1H NMR (dg-DMSO) δ 7.67 (t, J=7.6 Hz, 2H), 7.53 (s, 2H, NH2), 6.65 (t, J=7.8 Hz, IH), 5.90 (s, 2H,
NH2). c) (5-Bromo-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester: The compound from Example 22b) (3.0 g, 11.9 mmoles) and diethyl malonate (6.0 ml, 39.5 mmoles) were heated together at 180°C for 4h. The mixture was then purified by chromatography (silica gel, 2% methanol/dichloromethane) to give the title compound as an off-white solid (1.3 g, 31%). 1H NMR (d6-DMSO) δ 11.20 (s, IH), 8.07 (dd, J=1.2 and 7.8 Hz, J=1.2 and 7.8 Hz, IH), 7.90 (dd, J=1.2 and7.8 Hz, IH), 7.45 (t, J=7.8 Hz, IH), 4.17
(q, J=7.3 Hz, 2H), 3.94 (s, 2H), 1.22 (t, J=7.1 Hz, 3H). MS(ES+) m/e 348 [M+H]+. d) (5-Bromo- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one: A mixture of the compounds from Example 22c) (1.28 g, 3.7 mmol) and the compound from Example 8d) (922 mg, 3.7 mmol) was stirred under argon in anhydrous tetrahydrofuran (20 ml) and treated with 60% sodium hydride in mineral oil (600 mg, 15 mmoles). The mixture was heated under reflux for 2h, cooled, acidified carefully with acetic acid and heated under reflux for a further 1.5h. The mixture was cooled, diluted with water to give a solid that was collected, washed with water, ether and dried to give the title compound (650 mg, 35%). 1H NMR (Dg-DMSO) δ
14.98 (br m, 2Η), 8.07 (dd, J=1.2 and 8 Hz, IH), 7.89 (d, J=8 Hz, IH), 7.82 (dd, J=2.8 and 8.8 Hz, IH), 7.77 (dd, J=4.4 and 9.6 Hz, IH), 7.70 (m, IH), 7.43 (t, J=8 Hz, IH), 4.36 (m,
2H), 1.51 (m, 2H), 0.73 (m, IH), 0.32 (m, 2H), 0.00 (m, 2H). MS(ES+) m/e 507 [M+H]+.
Example 23
4,5-Dihydroxy-3- (7-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(3- methylbutyl)- lH-quninolin-2-one a) 5-(tert-Butyldimethylsilyloxy)-l-benzo[d][l,3]oxazine-2,4-dione: To a solution of 5-hydroxy isatoic anhydride (5.0 g, 27.9 mmol) in anhydrous N,N-dimethylformamide (2o mL) were added imidazole (2.85 g, 41.9 mmol) and tert-butyldimethylsilyl chloride (6.28 g, 41.9 mmol). The mixture was stirred overnight at ambient temperature prior to pouring into water (50 mL). The product was extracted with ethyl acetate (3 x 30 mL), dried over magnesium sulfate, and concentrated in vacuo. The precipitate was filtered and washed with ether to give the title compound as a white solid (5.8g, 70%). H NMR (400MHz, d6-DMSO) δ 11.6 (s, IH), 7.31 (dd, IH, J = 3, 9 Hz), 7.25 (d, IH, J = 3 Hz), 7.09
(d, IH, J = 9 Hz), 0.95 (s, 9H), 0.19 (s, 6H). MS(ES+) m/e 294 [M+H]+. b) 5-(tert-Butyldimethylsilyloxy)- l-(3-methylbutyl)- lH-benzo[d] [1 ,3]oxazine-2,4- dione: To a solution of the compound from Example 23a) (2.0 g, 6.8 mmol) in anhydrous N,N-dimethylformamide (20 mL) was added sodium hydride (60% dispersion in mineral oil) (548 mg, 13.7 mmol) followed by l-iodo-3-methylbutane (1.8 mL, 13.7 mmol). The mixture was stirred overnight at ambient temperature prior to pouring into ice water. The product was extracted with ethyl acetate, dried over magnesium sulfate, and concentrated in vacuo to give the title compound as a yellow oil (2.2 g, 91%), which was used without further purification. MS(ES+) m/e 364 [M+H]+. c) 4,5-Dihydroxy-3-(7-methoxy- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3- yl)-l-(3-methylbutyl)-lH-quninolin-2-one: Sodium hydride (60% dispersion in mineral oil) (37.2 mg, 0.93 mmol) was added to a mixture of the compound from Example 23b) (112 mg, 0.31 mmol) and the compound from Example If) (92.0 mg, 0.31 mmol) in anhydrous N,N-dimethylformamide (10.0 mL). The mixture was heated to 80 °C under a nitrogen atmosphere for 3h, cooled to ambient temperature, and acidified with acetic acid. The mixture was again heated to 80 °C for an additional lh, cooled to ambient temperature, and diluted with water. The product was extracted with ethyl acetate, dried over magnesium sulfate, and concentrated in vacuo. The residue was purified via flash column chromatography (silica gel, 95:5:0.5 chloroform/methanol/NH40H) to give the title compound as a yellow solid (3.3 mg, 2%). H NMR (400MHz, d6-DMSO) δ 15.2 (s, IH), 14.5 (s, IH), 10.0 (s, IH), 7.68 (d, IH, J = 10 Hz), 7.54 (d, IH, J = 9 Hz), 7.50 (d, IH, J = 3 Hz), 7.39-7.35 (m, 3H), 4.29 (t, 2H, J = 8 Hz), 3.88 (s, 3H), 1.77 (m, IH), 1.53 (m, 2H),
-+
0.99 (d, 6H, J = 7 Hz). MS(ES+) m/e 458 [M+Hf
Example 24 3-( 1 , 1 -Dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)-4,5-dihydroxy- l-(3-methylbutyl)- 1H- quninolin-2-one
Following the procedure of Example 23c), except substituting ethyl l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl-acetate (prepared by the method of Kovalenko, S. N.; Chernykh, V. P.; Shkarlat, A. E.; Ukrainets, I. V.; Gridasov, V. I.; Rudnev, S. A. Chem. Heterocycl. Compd. (Engl. Trans.) 1998, 34, 791) for the compound from Example If), the title compound was obtained as a yellow solid (33 mg, 25%). 1H NMR (400MHz, d6- DMSO) δ 15.1 (s, IH), 14.6 (s, IH), 10.0 (s, IH), 7.93 (d, IH, J = 7 Hz), 7.77 (dd, IH, J = 7, 8 Hz), 7.69 (dd, IH, J = 1, 8 Hz), 7.56 (dd, IH, J = 1, 8 Hz), 7.55 (m, IH), 7.52 (d, IH, J = 3 Hz), 7.39 (ddd, IH, J =1, 8, 9 Hz), 4.31 (m, 2H), 1.78 (m, IH), 1.54 (m, 2H), 1.00 (d, 6H, J
= 7 Hz). MS(ES+) m/e 429 [M+H]+.
Example 25 3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazine-7-carbonitrile
A mixture of l-(2-cycloρropylethyl)-6-fluoro-4-hydroxy-3-(7-iodo-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one (Example 13(a), 0.300g, 0.542 mmol), zinc cyanide (0.127 g, 1.08 mmol), tetrakis(triphenylphosphine)palladium(0) (0.055 g, 0.048 mmol) and N,N-dimethylformamide (5 mL) was stirred under argon in an oil bath at 105 °C for 18 h, then cooled and diluted with water (50 mL). The precipitate was filtered, washed with water and ether, then dried. A sample (0.060 g) of this solid was boiled in ethyl acetate (15 mL) for 15 min, then cooled, filtered, washed (ethyl acetate) and dried to give the title compound (0.032 g, 63%) as a solid. !H NMR (400MHz, d6-DMSO) δ 8.14
(IH, br s), 7.95 (IH, m), 7.77 (IH, dd, J = 9.3, 2.5 Hz), 7.47 (IH, d, J = 8.6 Hz), 7.44-7.42 (2H, m), 4.18 (2H, m), 1.49 (2H, m), 0.79 (IH, m), 0.43 (2H, m), 0.12 (2H, m).
Example 26 1 -(2-Cyclopropylethyl)-3-( 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)-8-fluoro-4- hy droxy- lH-quinolin-2-one a) 2-(2-Cyclopropylethylamino)-3-fluoro-benzoic acid: Copper(II) bromide (76.5 mg, 0.342 mmol) was added to a suspension of 2-bromo-3-fluoro-benzoic acid (1.0 g, 4.57 mmol), (2-cyclopropyl)ethylamine hydrochloride (610.8 mg, 5.02 mmol) and potassium carbonate (2.0 g, 14.6 mmol) in tetrahydrofuran (15 mL). The reaction mixture was stirred at 78 °C overnight, cooled to rt, poured in 1M aqueous hydrochloric acid and the pH adjusted to 9.0 by the addition of 2.5 M aqueous sodium hydroxide. The mixture was then filtered and the filtrate was made acidic (pH 5) by the addition of 1M aqueous hydrochloric acid. The precipitate was collected, washed with water and dried to give the desired product (570 mg, 56%) as a tan powder. !H NMR (d6-DMSO) δ 13.01 (bs, IH); 7.76 (bs, IH); 7.65- 7.62 (m, IH); 7.25 (ddd, J = 14.6, 7.8, 1.5 Hz, IH); 6.58 (td, J = 8.0, 4.5 Hz, IH); 3.45 (td, J = 6.8, 4.3 Hz, 2H); 1.43 (q, J = 6.8 Hz, 2H); 0.74-0.65 (m, IH); 0.42-0.38 (m, 2H); 0.07- 0.04 (m, 2H). b) l-(2-Cyclopropylethyl)-8-fluoro-lH-benzo[ ][l,3]oxazine-2,4-dione: Triphosgene (333 mg, 1.1 mmol) was added portionwise to a warmed (35 °C) suspension of 2-(2-cyclopropylethylamino)-3-fluoro-benzoic acid (500 mg, 2.2 mmol) and potassium carbonate (464 mg, 3.36 mmol) in ethyl acetate (10 mL). The suspension was stirred at 35 °C for 45 min, cooled to 0 °C and treated with water. The organic layer was separated, washed with brine, dried over sodium sulfate and evaporated to give the title compound (520 mg, 93%) as tan crystals. !Η NMR (d6-DMSO) δ 7.89-7.87 (m, IH); 7.76 (ddd, J = 14.6, 8.1, 1.5 Hz, IH); 7.33 (td, J = 8.0, 4.1 Hz, IH); 4.16-4.12 (m, 2H); 1.63-1.57 (m, 2H); 0.79-0.69 (m, IH); 0.45-0.40 (m, 2H); 0.08-0.04 (m, 2H). c) 1 -(2-Cyclopropylethyl)-3-(l , 1-dioxo- 1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3-yl)-8- fluoro-4-hydroxy-lH-quinolin-2-one: Sodium hydride (60% dispersion in mineral oil, 200 mg, 5.0 mmol) was added to a suspension of the compound from Example 26b) (250 mg, 1.0 mmol) and (l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-acetic acid ethyl ester (269 mg, 1.0 mmol) in tetrahydrofuran (7.0 mL). The suspension was heated to reflux and allowed to stir at this temperature for 2.0 h. After cooling to room temperature, acetic acid (3 mL) was carefully added and the mixture was refluxed for an additional hour. It was 5 cooled to room temperatare and poured into IM aqueous hydrochloric acid. The solid obtained was collected by filtration, washed with water, then diethyl ether and dried to give the title compound as a pale yellow powder (310 mg, 73% yield). !H NMR (d6-DMSO) δ 15.21 (br s, IH); 14.08 (br s, IH); 8.05 (dd, J = 7.9, 0.9 Hz, IH); 7.93 (d, J = 7.6 Hz, IH); 7.80-7.70 (m, 3H); 7.56 (td, J = 8.0, 1.1 Hz, IH); 7.43 (td, J = 8.1, 4.3 Hz, IH); 4.47-4.44 ° (m, 2H); 1.64 (q, J = 7.4 Hz, 2H); 0.81-0.71 (m, IH); 0.46-0.41 (m, 2H); 0.09-0.05 (m, 2H).
MS(ES+) m/e 428 [M+H]+.
Example 27 3-(5-Chloro-8-hydroxy-7-nitro- 1 , 1-dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-3-yl)- 1-(2- cycloproρylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one
70% Aqueous nitric acid (0.105 mL, 1.17 mmol) was added to a stirred mixture of 3-(5-chloro-8-hydroxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one (Example 14, 0.300 g, 0.628 mmol), sodium nitrite (0.002 g, 0.029 mmol) and acetic acid (4 mL) and the mixture stirred 0 for 24 h, then diluted slowly with water (50 mL). The solid was filtered, washed with water and dried to give the title compound (0.285 g, 87%) as a yellow powder. JH NMR (400MHz, d6-DMSO) δ 15.19 (IH, br s), 8.48 (IH, s), 7.93 (IH, dd, J = 8.8, 3.0 Hz), 7.87
(IH, dd, J = 9.6, 4.3 Hz), 7.79 (IH, m), 4.44 (2H, m), 1.59 (2H, m), 0.81 (IH, m), 0.41 (2H, m), 0.07 (2H, m). 5
Example 28 3-(l, l-Dioxo-l,4-dihydro-l-benzo[l, 2, 4]thiadizain-3-yl)-4-hydroxy-l-(3-methylbutyl)-5- nitro- 1 H-quinolin-2-one a) 2-(3-Methylbutylamino)-6-nitrobenzoic acid: Isoamylamine (3.5 mL, 30 mmol) 0 was added to a mixture of 2-chloro-6-nitro-benzoic acid (1 g, 5 mmol), potassium carbonate (1.38 g, 10 mmol) and copper (II) oxide (50 mg, 0.35 mmol). The mixture was refluxed overnight. The excess isoamylamine was removed under reduced pressure, water (50 mL) and activated carbon (2 g) were added to the residue and the mixture was refluxed for lh and filtered. The precipitate was collected after acidification and purified by chromatography (silica gel, gradient, 0-10% methanol/chloroform) to give the title compound as a yellow solid. (480 mg, 38%). MS(ES+) m/e 253 [M+H]+. b) l-(3-Methylbutyl)-5-nitro-lH-benzo[l,3]oxazine-2,4-dione: Triphosgene (94 mg, 0.32 mmol) was added to a solution of the product of Example 28a) (160 mg, 0.64 mmol) in tetrahydrofuran (10 mL). The mixture was refluxed for 3 h, cooled down to room temperature, and poured into ice water. The precipitate was collected and washed with water and ether to give the title compound as a yellow solid (50 mg, 28%). The title compound was used in next reaction without purification. c)3-(l, l-Dioxo-l,4-dihydrobenzo[l, 2, 4] thiadizain-3-yl)-4-hydroxy-l-(3- methylbutyl)-5-nitro-lH-quinolin-2-one: Sodium hydride (60% dispersion in mineral oil) (125 mg, 3.12 mmol) was added to a mixture of the compound from Example 28b) (290 mg, 1.04 mmol) and ethyl-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-3-yl acetate (278 mg, 1.04 mmol) (prepared by the method of Kovalenko, S. N.; Chernykh, V. P.; Shkarlat, A. E.; Ukrainets, I. V.; Gridasov, V. I.; Rudnev, S. A. Chem. Heterocycl Compd. (Engl Trans.) 1998, 34, 791) in anhydrous dimethylformamide (10.0 mL). The mixture was heated to
80°C under a nitrogen atmosphere for 3 h, cooled to ambient temperature, and acidified with glacial acetic acid. The mixture was again heated to 80 °C for an additional 1 h, cooled to room temperature and diluted with water. The product was extracted with ethyl acetate, dried over magnesium sulfate, and concentrated in vacuo. The residue was washed with acetone and filtered to give the title compound as a yellow solid (110 mg, 27%). 1H NMR (400MHz, d6-DMSO) δ 14.1 (s, IH), 8.15 (t, J = 8.7 Hz, IH), 8.06 (dd, J = 7.6, 6.6 Hz, 2H), 7.92 ( , IH), 7.86 (dd, J = 7.6, 8.1 Hz, 2H), 7.71 (m, IH), 4.52 (t, J = 8.3 Hz, 2H), 1.96 (m,
IH), 1.71 (m, 2H), 1.17 (d, J = 6.6 Hz, 6H). MS(ES+) m/e 457 [M+H]+.
Example 29 5- { 3-[ l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-lH-pyrazole-3-carboxylic acid methyl ester a) 4-{3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-2,4-dioxobutyric acid methyl ester: The product of Example 13b) (325 mg, 0.693 mmol) and dimethyl oxalate (122 mg, 1.04 mmol) in N,N-dimethylformamide (5 mL) was treated with sodium hydride (55 mg, 1.38 mmol, 60%). The reaction mixture was stirred at room temperature for lh and at 50°c for 4h. After cooling to room temperature, 3M aqueous hydrochloric acid (10 mL) was added and the resulting solution was extracted with chloroform (3 x 30 mL). The organic layers were combined, dried over magnesium sulfate, and the solvent removed en vacuo. Purifation by flash column chromatography (10% methanol in dichloromethane) gave the title compound as a brown solid (201 mg, 52%) Η NMR (CDC13) δ 15.0 (s, IH), 14.9 (s, IH), 8.5 (d, J= 2.0 Hz, IH), 8.2 (dd, 7= 8.8 and 2.0 Hz, IH), 7.81 (dd, J = 8.4 and 2.8 Hz, IH), 7.42-7.36 (m, IH), 7.36-7.28 (m, IH), 7.0 (s, IH), 4.5 (m, 2H), 3.85 (s, 3H), 3.83 (s,
2H), 1.6 (m, 2H), 0.8 (m, IH), 0.5 (m, 2H), 0.1 (m, 2H). MS(ES+) m/e 556 [M+H]+. b) 5-{3-[l-(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-7-yl } - 1 H-pyrazole-3-carboxylic acid methyl ester: The product obtained in Example 29a (100 mg, 0.18 mmol) and hydrazine hydrate (8.7μL, 0.18 mmol) were heated under reflux in ethanol (3 mL) for 5h. After cooling to room temperature the solvent was removed by rotary evaporation and the residue washed with petroleum ether and air dried to give the title compound as a brown solid (16.1 mg, 16%) lU NMR (CDC13) δ 14.8 (s, IH), 14.6 (s, IH), 8.7 (d, J = 1.2 Hz, IH), 8.35 (s, IH), 8.29 (dd, J = 8.8 and 2.0 Hz, IH), 8.1 (m, IH), 7.9 (m, IH), 7.5-7.4 (m, 2H), 5.5 (s, IH), 4.4 (m, 2H), 4.0 (s, 3H), 1.6 (m, 2H), 0.8 (m, IH), 0.5 (m, 2H), 0.1 (m, 2H). MS(ES+) m/e 552 [M+H]+.
Example 30 5- { 3- [ 1 -(2-Cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4]thiadiazin-7-yl } isoxazole-3-carboxylic acid methyl ester The product obtained in Example 29 (93 mg, 0.167 mmol) and hydroxy lamine hydrochloride (35 mg, 0.502 mmol) were heated under reflux in methanol (3 mL) for 4h. After cooling to room temperature the solvent was removed by rotary evaporation. Purification of the residue by chromatography (silica gel, 10% methanol/chloroform) gave the title compound as a brown solid (64.5 mg, 70%) Η NMR (CDC13) δ 14.9 (s, IH), 14.8 (s, IH), 8.29 (d, J = 2.0 Hz, IH), 7.9 (dd, J = 8.8 and 2.0 Hz, IH), 7.84 (s, IH), 7.81 (dd, / = 8.4 and 2.8 Hz, IH), 7.42-7.32 (m, 2H), 7.96 (s, IH), 4.3(m, 2H), 3.9 (s, 3H), 1.5 (m, 2H),
0.7 (m, IH), 0.4(m, 2H), 0.1 (m, 2H). MS(ES+) m/e 553 [M+H]+.
Example 31 4-[3-( 1 , 1 -Dioxo- 1 ,4-dihydro- 1-benzo [ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- l-(3-methylbutyl)-2- oxo-l,2-dihydroquinolin-6-ylamino]butyric acid methyl ester
A mixture of the compound from Example 17 (100 mg, 0.235 mmol), triethylamine (0.2 ml, 1.44 mmol) and methyl 4-bromobutyrate (0.1 ml, 0.5 mmol) in N,N- dimethylformamide (4 ml) was heated at 100 °C under a nitrogen atmosphere for 2 h. The mixture was evaporated and the residue purified by flash chromatography (silica gel, 1% methanol/dichloromethane) gave the title compound (30 mg, 76%). H NMR (400MHz, D6-DMSO) δ 15.10 (br.s, IH), 14.75 (s, IH), 7.83 (d, J= 8 Hz, IH), 7.68 (t, J=7 Hz, IH), 7.58 (d, J = 8Hz, IH), 7.45 (t, J = 8 Hz, IH), 7.38 (d, J=9 Hz, IH), 7.18 (m, IH), 7.04 (d, J = 1Hz, IH), 6.05 (br s, IH, NH), 4.20 (m, 2Η), 3.51 (s, 3H), 3.00 (m, 2H), 2.39 (t, J=7 Hz, 2H), 1.74 (t, J=7 Hz, 2H), 1.68 (m, IH), 1.44 (m, 2H), 0.89 (d, 6H).
The HCV NS5B inhibitory activity of the compounds of Formulas I-A to I-F was ■ determined using standard procedures well known to those skilled in the art and described in, for example Behrens et al., EMBO J. 15:12-22 (1996), Lohmann et al., Virology 249:108-118 (1998) and Ranjith-Kumar et al., J. Virology 75:8615-8623 (2001).
All publications, including, but not limited to, patents and patent applications cited in this specification, are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.
The above description fully discloses how to make and use the present invention. However, this invention is not limited to the particular embodiments described hereinabove, but includes all modification thereof within the scope of the appended claims and their equivalents. Those skilled in the art will recognise through routine experimentation that various changes and modifications can be made without departing from the scope of this invention.

Claims

What is claimed is:
1. A compound:
2-{ 3-[ 1 -(3,3-dimethylbutyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-7-yloxy } acetamide; 3- [7-( 1 -butoxy vinyl)- 1 , 1 -dioxo- l,4-dihydro-l-benzo[l,2,4]thiadiazin-3-yl]-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2- one ; 2- { 3-[4-hydroxy-6-methyl- 1 -(3-methylbutyl)-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy } acetamide ; 2-[3-( 1 -cyclobutylmethyl- 4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl)-l , 1 -dioxo- 1 ,4-dihydro- 1- benzo[l,2,4]thiadiazin-7-yloxy]acetamide; 2-{3-[l-(3,3-dimethylbutyl)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7- yloxy } acetamide ; 6-fluoro-4-hydroxy-3-(8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one; 2-{3-[l-(2- cyclopropylethyl)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo [ 1 ,2,4]thiadiazin-7-yloxy } acetamide; 3-(6-chloro-7-hy droxy- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2- one; 2- { 6-chloro-3-[ l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin- 3-yl]-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}acetamide; (R)-2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-propionic acid ethyl ester; (S)-2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-7-yloxy } -butyramide ; (R)-2- { 3-[ 1 -(2-cyclopropylethyl)- 6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-7-yloxy}-butyramide; l-(2-cyclopropylethyl)-3-[7-((E)-3- dimethylamino-allanoyl)- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-3-yl]-6-fluoro-4- hydroxy-lH-quinolin-2-one; 3-(5-chloro-8-hydroxy-l,l-dioxo-l,4-dihydro-l- benzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(2-cyclopropylethyl)-6-fluoro-4-hy droxy- 1 H-quinolin-2-one; (R)-2-{ 3-[ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l ,2-dihydroquinolin-3-yl]- 1 , 1 - dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-7-yloxy } -propionic acid ; 2- { 3-[ 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazm-7-yloxy}-3,3,3-trifluoro-propionamide; 2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-2-methyl-propionic acid ethyl ester; l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one; (R)-2-{3-[l-(2-cyclopropylethyl)-6-fluoro- 4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo[ 1 ,2,4]thiadiazin-7-yloxy } -N-methyl-propionamide; 3-[7-(2-amino-thiazol-4-yl)- 1,1- dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4] thiadiazin-3-yl] -6-fluoro-4-hy droxy- l-(3-methylbutyl)- lH-quinolin-2-one; 3-[l,l-dioxo-7-(2H-pyrazol-3-yl)-l,4-dihydro-l- benzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-l-(3-methylbutyl)-lH-quinolin-2-one; 3- (5-bromo- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-3-yl)- 1 -(2-cyclopropy lethyl)-6- fluoro-4-hydroxy- lH-quinolin-2-one ; 4,5-dihydroxy-3-(7-methoxy- 1 , 1 -dioxo- 1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-3-yl)- 1 -(3-methylbutyl)- lH-quinolfn-2-one; 3-( 1 , 1-dioxo- 1 ,4- dihydro- 1 -benzo[l ,2,4]thiadiazin-3-yl)-4,5-dihydroxy- l-(3-methylbutyl)- lH-quinolin-2- one; 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l- dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazine-7-carbonitrile; 1 -(2-cyclopropylethyl)-3-( 1,1- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-8-fluoro-4-hydroxy-lH-quinolin-2-one; 3- (5-chloro-8-hydroxy-7-nitro- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [ 1 ,2,4] thiadiazin-3-yl)- 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one; 3-(l, 1 -dioxo- 1,4-dihydro-l- benzo[l, 2, 4]thiadizain-3-yl)-4-hydroxy-l-(3-methylbutyl)-5-nitro-lH-quinolin-2-one; 5- {3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-7-yl}-lH-pyrazole-3-carboxylic acid methyl ester; 5-{3- [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-7-yl}isoxazole-3-carboxylic acid methyl ester; or 4-[3-(l,l- dioxo-1 ,4-dihydro- l-benzo[ 1 ,2,4]thiadiazin-3-yl)-4-hydroxy- l-(3-methylbutyl)-2-oxo- 1 ,2- dihydroquinolin-6-ylamino]butyric acid methyl ester; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
2. A compound: 3-[7-(l-butoxyvinyl)-l,l-dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-3-yl]-4-hydroxy-l-(3- methylbutyl)- 1 H-quinolin-2-one ; 2- { 3- [4-hydroxy-6-methyl- 1 -(3-methylbutyl)-2-oxo- 1 ,2- dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy } acetamide ; 2-[3-(l-cyclobutylmethyl-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl)-l,l-dioxo-l,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy]acetamide; 2-{3-[l-(3,3-dimethylbutyl)-4- hydroxy-2-oxo- 1 ,2-dihydroquinolin-3 -yl] -1,1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin- 7-yloxy } acetamide ; 6-fluoro-4-hydroxy-3-(8-hy droxy- 1 , 1 -dioxo- 1 ,4-dihydro- 1- benzo[l,2,4]thiadiazin-3-yl)-l-(3-methylbutyl)-lH-quinolin-2-one; 2-{3-[l-(2- cyclopropylethyl)-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo [ 1 ,2,4] thiadiazin-7-yloxy } acetamide ; 3-(6-chloro-7-hy droxy- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[ 1 ,2,4]thiadiazin-3-yl)- 1 -(2-cyclopropy lethyl)-6-fluoro-4-hy droxy- lH-quinolin-2-one; 2- { 6-chloro-3 - [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] - 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-7-yloxy } acetamide; (R)-2- { 3- [ 1 -(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-propionic acid ethyl ester; (S)-2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4- dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-butyramide; (R)-2-{3-[l-(2-cyclopropylethyl)- 6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-7-yloxy}-butyramide; l-(2-cyclopropylethyl)-3-[7-((E)-3- dimethylamino-allanoyl)- 1 , 1 -dioxo- 1 ,4-dihydro- 1 -benzo [ 1 ,2,4]thiadiazin-3-yl]-6-fiuoro-4- hydroxy- 1 H-quinolin-2-one; 3-(5-chloro-8-hydroxy- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH-quinolin-2-one; (R)-2-{ 3 - [ 1 -(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1- dioxo-l,4-dihydro-l-benzo[l,2,4]thiadiazin-7-yloxy}-propionic acid; 2-{3-[l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3-yl]-l,l-dioxo-l,4- dihydro- 1 -benzof 1 ,2,4]thiadiazin-7-yloxy } -3,3,3-trifluoro-propionamide; 2-{ 3-[ l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl] -1,1 -dioxo- 1 ,4- dihydro- l-benzo[l,2,4]thiadiazin-7-yloxy}-2-methyl-propionic acid ethyl ester; l-(2- cyclopropylethyl)-6-fluoro-4-hydroxy-3-(7-hydroxymethyl- 1 , 1 -dioxo- 1 ,4-dihydro- 1 - benzo[l,2,4]thiadiazin-3-yl)-lH-quinolin-2-one; (R)-2-{3-[l-(2-cyclopropylethyl)-6-fluoro- 4-hydroxy-2-oxo- 1 ,2-dihydroquinolin-3-yl]- 1 , 1 -dioxo- 1 ,4-dihydro- 1- benzo [ 1 ,2,4] thiadiazin-7-yloxy } -N-methyl-propionamide ; 3 -( 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-4,5-dihydroxy-l-(3-methylbutyl)-lH-quninolin- 2-one; 3-[l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-2-oxo-l,2-dihydroquinolin-3- yl]- 1 , 1 -dioxo- 1 ,4-dihydrobenzo [1 ,2,4]thiadiazine-7-carbonitrile; l-(2- cyclopropylethyl)-3-(l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-8-fluoro-4- hydroxy-lH-quinolin-2-one; or 3-(5-chloro-8-hydroxy-7-nitro-l,l-dioxo-l,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(2-cyclopropylethyl)-6-fluoro-4-hydroxy-lH- quinolin-2-one; or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
3. A pharmaceutically acceptable salt of the compound according to claim 1 or claim 2, or tautomer thereof, wherein said pharmaceutically acceptable salt is a sodium salt or a potassium salt.
4. A method of inhibiting an RNA-containing virus which comprises contacting said viras with an effective amount of the compound according to any one of claims 1 to 3.
5. A method of treating infection caused by an RNA-containing virus which comprises administering to a subject in need thereof an effective amount of the compound according to any one of claims 1 to 3.
6. A method according to claim 5 comprising treating an HCV infection.
7. A method according to claim 4 or claim 5 comprising inhibiting hepatitis C viras.
8. A method according to claim 6, wherein said HCV infection is acute hepatitis infection, chronic hepatitis infection, hepatocellular carcinoma or liver fibrosis.
9. A method according to claim 5 comprising treating an infection caused by Dengue, HIV or a picornavirus.
10. A method according to claim 5 comprising administering said compound in combination with one or more agents selected from the group consisting of an immunomodulatory agent and an antiviral agent.
11. A method according to claim 10, wherein the immunomodulatory agent is selected from the group consisting of alpha interferon, beta interferon, gamma interferon, a cytokine, a vitamin, a nutritional supplement, an antioxidant compound, a vaccine and a vaccine comprising an antigen and an adjuvant.
12. A method according to claim 5 comprising administering said compound in combination with an interferon.
13. A method according to claim 12 comprising administering said compound in combination with an interferon and ribavirin.
14. A method according to claim 12 comprising administering said compound in combination with an interferon and levovirin.
15. A method according to claim 5 comprising administering said compound in combination with an HCV antisense agent.
16. A method according to claim 5 comprising administering said compound in combination with an immunoglobulin, a peptide-nucleic acid conjugate, an oligonucleotide, a ribozyme, a polynucleotide, an anti-inflammatory agent, a pro-inflammatory agent, an antibiotic or a hepatoprotectant.
17. A method for inhibiting replication of hepatitis C virus comprising inhibiting replication of both positive and negative strand HCV-RNA, said method comprising contacting a cell infected with said virus with an effective amount of the compound according to any one of claims 1 to 3.
18. A method of treating infection caused by hepatitis C viras comprising inhibiting replication of both positive and negative strand HCV-RNA, said method comprising administering to a subject in need thereof an effective amount of the compound according to any one of claims 1 to 3.
19. The method according to claim 17, wherein said compound substantially equally inhibits positive strand HCV-RNA replication and negative strand HCV-RNA replication.
20. The method according to claim 18, wherein said compound substantially equally inhibits positive strand HCV-RNA replication and negative strand HCV-RNA replication.
21. A compound: (8-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, 6- fluoro-4-hydroxy-3-(8-methoxy-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)-l-(3- methylbutyl)- 1 H-quinolin-2-one, (6- chloro-7-methoxy- 1 , 1 -dioxo- 1 ,4- dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (6- chloro-7-hy droxy- 1,1 -dioxo- l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (5-chloro-8-methoxy-l,l- dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid ethyl ester, (5-chloro-8-hydroxy- l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl)acetic acid methyl ester, 3-[(7-(2- bromoethanoyl)-l,l-dioxo-l,4-dihydrobenzo[l,2,4]thiadiazin-3-yl]-6-fluoro-4-hydroxy-l- (3-methylbutyl)- lH-quinolin-2-one, 5-bromo- 1 , 1 -dioxo- 1 ,4-dihydro-2H- 1 - benzof 1 ,2,4]thiadiazin-3-one, (5-bromo- 1 , 1 -dioxo-1 ,4-dihydrobenzo[ 1 ,2,4]thiadiazin-3- yl)acetic acid ethyl ester, 5-(tert-butyldimethylsilyloxy)benzo[d][l,3]oxazine-2,4-dione, or 5-(tert-butyldimethylsilyloxy)-l-(3-methylbutyl)benzo[d][l,3]oxazine-2,4-dione, or a tautomer thereof, or a pharmaceutically acceptable salt or solvate thereof.
PCT/US2003/039982 2002-12-11 2003-12-11 Anti-infectives WO2004052312A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003300956A AU2003300956A1 (en) 2002-12-11 2003-12-11 Anti-infectives

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US43241302P 2002-12-11 2002-12-11
US60/432,413 2002-12-11

Publications (2)

Publication Number Publication Date
WO2004052312A2 true WO2004052312A2 (en) 2004-06-24
WO2004052312A3 WO2004052312A3 (en) 2007-08-02

Family

ID=32507921

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/039982 WO2004052312A2 (en) 2002-12-11 2003-12-11 Anti-infectives

Country Status (2)

Country Link
AU (1) AU2003300956A1 (en)
WO (1) WO2004052312A2 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1916298A1 (en) * 2005-06-14 2008-04-30 Dnavec Corporation Method for production of antibody
US7479489B2 (en) 2004-08-23 2009-01-20 Roche Palo Alto Llc Heterocyclic antiviral compounds
US7576103B2 (en) 2004-12-21 2009-08-18 Roche Palo Alto Llc Tetralin and indane derivatives and uses thereof
US7674810B2 (en) 2005-05-04 2010-03-09 Roche Palo Alto Llc 1,1-dioxo-1H-1Λ6-benzo[d]isothiazol-3-yl)-4-hydroxy-1,5-dihydro-pyrrol-2-one inhibitors of HCV polymerase
US7754759B2 (en) 2005-11-03 2010-07-13 Roche Palo Alto Llc Arylsulfonyl chromans as 5-HT6 inhibitors
WO2010100178A1 (en) 2009-03-06 2010-09-10 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010122082A1 (en) 2009-04-25 2010-10-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010149598A2 (en) 2009-06-24 2010-12-29 F. Hoffmann-La Roche Ag Heterocyclic antiviral compound
WO2011033045A1 (en) 2009-09-21 2011-03-24 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011058084A1 (en) 2009-11-14 2011-05-19 F. Hoffmann-La Roche Ag Biomarkers for predicting rapid response to hcv treatment
WO2011061243A1 (en) 2009-11-21 2011-05-26 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011067195A1 (en) 2009-12-02 2011-06-09 F. Hoffmann-La Roche Ag Biomarkers for predicting sustained response to hcv treatment
EP2361922A1 (en) 2006-10-10 2011-08-31 Medivir AB Intermediate to HCV-Nucleoside Inhibitors
WO2014148949A1 (en) 2013-03-22 2014-09-25 Асави, Ллс Alkyl 2-{[(2r,3s,5r)-5-(4-amino-2-oxo-2н-pyrimidin-1-yl)-3-hydroxy- tetrahydro-furan-2-yl-methoxy]-phenoxy-phosphoryl-amino}-propionates, nucleoside inhibitors of hcv ns5b rna-polymerase, and methods for producing and use thereof
WO2018011527A1 (en) * 2016-07-13 2018-01-18 bioMérieux Reagents for reversibly protecting biological molecules

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6919331B2 (en) * 2001-12-10 2005-07-19 Bristol-Myers Squibb Company Substituted 2-methyl-benzimidazole respiratory syncytial virus antiviral agents

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6919331B2 (en) * 2001-12-10 2005-07-19 Bristol-Myers Squibb Company Substituted 2-methyl-benzimidazole respiratory syncytial virus antiviral agents

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7479489B2 (en) 2004-08-23 2009-01-20 Roche Palo Alto Llc Heterocyclic antiviral compounds
US7576103B2 (en) 2004-12-21 2009-08-18 Roche Palo Alto Llc Tetralin and indane derivatives and uses thereof
US7674810B2 (en) 2005-05-04 2010-03-09 Roche Palo Alto Llc 1,1-dioxo-1H-1Λ6-benzo[d]isothiazol-3-yl)-4-hydroxy-1,5-dihydro-pyrrol-2-one inhibitors of HCV polymerase
EP1916298A4 (en) * 2005-06-14 2009-04-08 Dnavec Corp Method for production of antibody
EP1916298A1 (en) * 2005-06-14 2008-04-30 Dnavec Corporation Method for production of antibody
US7754759B2 (en) 2005-11-03 2010-07-13 Roche Palo Alto Llc Arylsulfonyl chromans as 5-HT6 inhibitors
EP2361922A1 (en) 2006-10-10 2011-08-31 Medivir AB Intermediate to HCV-Nucleoside Inhibitors
WO2010100178A1 (en) 2009-03-06 2010-09-10 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010122082A1 (en) 2009-04-25 2010-10-28 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2010149598A2 (en) 2009-06-24 2010-12-29 F. Hoffmann-La Roche Ag Heterocyclic antiviral compound
WO2011033045A1 (en) 2009-09-21 2011-03-24 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011058084A1 (en) 2009-11-14 2011-05-19 F. Hoffmann-La Roche Ag Biomarkers for predicting rapid response to hcv treatment
WO2011061243A1 (en) 2009-11-21 2011-05-26 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2011067195A1 (en) 2009-12-02 2011-06-09 F. Hoffmann-La Roche Ag Biomarkers for predicting sustained response to hcv treatment
WO2014148949A1 (en) 2013-03-22 2014-09-25 Асави, Ллс Alkyl 2-{[(2r,3s,5r)-5-(4-amino-2-oxo-2н-pyrimidin-1-yl)-3-hydroxy- tetrahydro-furan-2-yl-methoxy]-phenoxy-phosphoryl-amino}-propionates, nucleoside inhibitors of hcv ns5b rna-polymerase, and methods for producing and use thereof
WO2018011527A1 (en) * 2016-07-13 2018-01-18 bioMérieux Reagents for reversibly protecting biological molecules
FR3053968A1 (en) * 2016-07-13 2018-01-19 Biomerieux REAGENTS FOR THE REVERSIBLE PROTECTION OF BIOLOGICAL MOLECULES
CN109831913A (en) * 2016-07-13 2019-05-31 生物梅里埃公司 For reversibly protecting the reagent of biomolecule
JP2019522058A (en) * 2016-07-13 2019-08-08 ビオメリューＢｉｏｍｅｒｉｅｕｘ Reagents for reversible protection of biomolecules
CN109831913B (en) * 2016-07-13 2022-01-21 生物梅里埃公司 Reagent for reversibly protecting biomolecules
JP7231540B2 (en) 2016-07-13 2023-03-01 ビオメリュー Reagents for reversible protection of biomolecules
US11708375B2 (en) 2016-07-13 2023-07-25 bioMérieux Reagents for reversibly protecting biological molecules

Also Published As

Publication number Publication date
AU2003300956A1 (en) 2004-06-30
AU2003300956A8 (en) 2004-06-30
WO2004052312A3 (en) 2007-08-02

Similar Documents

Publication Publication Date Title
WO2003059356A2 (en) Novel anti-infectives
WO2004052312A2 (en) Anti-infectives
US20040147739A1 (en) Novel anti-infectives
KR100847181B1 (en) Heterocyclic antiviral compounds
WO2007088148A1 (en) Derivatives of thiophene carboxilic acid as antiviral agent
WO2006045613A1 (en) 4-methoxymethyl-pyrrolidine-2-carboxylic acid compounds and derivatives thereof as hepatitis c virus inhibitors
KR20070098914A (en) Indole derivatives for treating viral infections
MX2007013415A (en) Heterocyclic antiviral compounds.
WO2003099801A1 (en) Novel anti-infectives
WO2003037893A1 (en) Acyl dihydro pyrrole derivatives as hcv inhibitors
WO2007039145A1 (en) C (2) -heteroarylmethyl-c (4) -pyrazinyl-2-yl acyl pyrrolidine compounds and their use for treating viral infections, especially hepatitis c virus
CA2574354A1 (en) Imidazole and thiazole derivatives as antiviral agents
WO2009003009A1 (en) Substituted pyrrolidine as anti-infectives
EP1292310A1 (en) Novel anti-infectives
JP2005511573A (en) 4- (5-membered) -heteroarylacylpyrrolidine derivatives as HCV inhibitors
EP1740582A1 (en) Acyl dihydro pyrrole derivatives as hcv inhibitors
WO2004096210A1 (en) Acylated indoline and tetrahydroquinoline derivatives as hcv inhibitors
WO2004052313A2 (en) Anti-infectives
WO2004058150A2 (en) Anti-infectives
WO2003037262A2 (en) Novel anit-infectives
WO2008017688A1 (en) 2-carboxy thiophene derivatives as anti-viral agents
EP1663105B1 (en) Cycloalkyl heterocycles for treating hepatitis c virus
WO2008043791A2 (en) Thiophene derivatives for treating hepatitis c
WO2004096774A1 (en) Acyl isoindoline derivatives and acyl isoquinoline derivatives as anti-viral agents
EP1812431A1 (en) 4-(pyrazine-2-yl)-pyrrolidine-2-carboxylic acid compounds and derivatives thereof as hepatitis c virus inhibitors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AU BA BB BR BZ CA CN CO CR CU DM DZ EC EG GD GE HR ID IL IN IS JP KP KR LC LK LR LT LV MA MG MK MN MX NO NZ OM PH PL RO SC SG TN TT UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP