WO2004038044A1

WO2004038044A1 - Kit of reagents for the identification of biological contaminants in a sample

Info

Publication number: WO2004038044A1
Application number: PCT/IT2002/000674
Authority: WO
Inventors: Vincenzo Romano-Spica
Original assignee: Vincenzo Romano-Spica
Priority date: 2002-10-22
Filing date: 2002-10-22
Publication date: 2004-05-06
Also published as: AU2002353504A1

Abstract

A kit of reagents for the identification of at least two biological contaminants in a sample, comprising a first component (component A) for multiple amplification formed of two amplification mixtures (A1 and A2), and a second component (component B) for reverse hybridization. Each amplification mixture comprises an amplification buffer, dNTP, MgCls and a couple of primers of mitochondrial gene of each biological species, at least one primer being labeled. Component B comprises a support on which at least one specific probe for eaach biological species is deposited.

Description

"KIT OF REAGENTS FOR THE IDENTIFICATION OF BIOLOGICAL CONTAMINANTS IN A SAMPLE"

The present invention relates to the biotechiiological field, and in particular it relates to a kit of reagents which can be used in a simple way for the identification of a wide range of biological contaminants in a sample of any kind, for example food, or environmental samples such as waters or soils, and to some oligonucleotides for the preparation of said kit.

It is known that in order to protect the public health it is mainly necessary to verify the presence of some biological contaminants such as an organism or a derivative thereof. For example, the recent biotechnology developments in the agroalimentary field have brought to the diffusion of new products, the genetically modified organisms, which have very advantageous features from some points of view, but whose toxicity for men or animals has been not yet excluded. Therefore, methods for the identification of the presence of such organisms in alimentary products have become necessary.

The case of the human variant of the Croizfeld Jacob disease has recently shown another situation in which the availability of a method for identification of some contaminants is necessary, and precisely for identificating the presence of animal flours in herbivore feeds. As a matter of fact, it is known that animal feeds might be responsible for the disease transmission since, if eaten by herbivores, they would introduce the prions in the food chain. Due to the high resistance of the prion in environment, it is also sometimes necessary to analyze the soils and/or the waters which might have been contaminated by means of carcasses of infectious animals.

Different methods for identification of some contaminant species in a sample are already known, however these methods generally require the use of complex and expensive instrumentation, in addition to particularly high professional capacities. Besides, none of the known methods is able to guarantee a suitable sensibility for the analysis of complex and heterogeneus samples and at the same time the possibility to identificate a wide range of biological species. In particular, the known methods, based on staining and/or classification of derivatives such as osseous microfragments or pollens by means of microscopy techniques, have a very limited sensibility, dependent on the magnifying power and resolution of the instrument, and a low reliability since the identification of the contaminants depend on the subjective interpretation of the operator.

Other methods which allow to obtain precise results in short times are based on molecular biology techniques, in particular on the chain reaction of the polymerase and on the analysis with restriction enzymes. However, such methods do not allow a wide range analysis, but they have to be set each time by highly qualified professionals, according to the searched contaminant. Besides, the applicability of such methods is limited to some biological species, that is, those for which a restriction enzyme capable of recognizing them is available. Furthermore, the used DNA staining products are dangerous for the operator since they are mutagens. Object of the present invention is therefore providing a kit for the identification of a wide range of biological contaminants in a sample, which can be used in a simple way and only with the help of the instrumentation normally present in the small and medium laboratories of molecular biology, and oligonucleotides for the preparation of said kit. Said object is achieved with a kit whose main features are specified in the first claim and other features are specified in the following claims. The features of the oligonucleotides are specified in claims 11 to 35.

The kit according to the present invention is based on the polymerase chain reaction technique. With respect to other methods for searching contaminants which use the polymerase chain reaction, the present invention differs first of all because it is based on the amplification and identification of a mitochondrial sequence instead of a genomic one. This measure implies a notable advantage as long as the amplification velocity is concerned, since this is directly proportional to the method sensibility. As a matter of fact, since for each protein the eukariote cells only have two couples of each gene in the nucleus but tens of mitochondria in the cytoplasm, the amplification velocity of the mitochondrial sequences is much higher than the already high amplification velocity of genome sequences. This is particularly important on difficult samples such as old or environmental samples with nucleic acid degradation. Besides, the method which is carried out by using the kit according to the present invention is based on a Nested type multiple amplification which allows to further increase the sensibility and the specificity of the technique.

Another advantage of the kit according to the present invention, with respect to the other known methods based on the polymerase chain reaction consists in that it does not require the use of restriction enzymes, of electrophoresis apparatus or DNA stamers, but it is based on reverse hybridization with oligonucleotidic probes and allows to search at the same time different biologic contaminants, for example four contaminants, in a single test. Then, by using other measures described in the following it is possible to expand the number of identifiable species. The detection of the contaminants can be carried out directly by observing a staining operation on the support, at the probe on which hybridization has occurred. However, the possibility of making a preliminary evaluation by electrophoresis and/or digestion with restriction enzymes according to the traditional procedures is not precluded.

Another advantage of the kit according to the present invention consists in that the amplification is carried out in a single operation, by using a single ready- to-use reaction mixture whereto only the Taq polymerase enzyme and the DNA collected and diluted in water must be added.

Further advantages and features of the kit according to the present invention will appear to those skilled in the art from the following detailed description of one embodiment thereof with reference to the accompanying operative examples.

The kit according to the present invention comprises two components. The first one of said components (component A) comprises the reagents for the multiple amplification of the mitochondrial gene, and the second component

(component B) the reagents for reverse hybridization as well as a support on which a multiplicity of probes is deposited.

Component A is formed of two amplification mixtures Al and A2, which comprise all the necessary reagents according to the known process for the polymerase chain reaction, commonly said PCR and described in patents USA 4,683,195 and 4,683,202, among others. These reagents are: the reaction buffer that allows the conditions for the enzyme functionality (pH, saline concentration); the dNTP, that is the deoxynucleotide triphosphate formed of nitrogenous bases (adenine, guanine, cytosine. thymine) monomers necessary for the polymerase reaction; magnesium chloride (MgCl₂) necessary in order to guarantee specificity and efficiency of the reaction (coupling of the primers and polymerase functionality); and the mixture of the primers, that is, oligonucleotides of specific sequence, necessary in order to start the DNA amplification from DNA sequences complementary thereto according to the known principle of the polymerase chain reaction. For the puiposes of the present invention, two oligonucleotides are homologous when they have at least 70% of the nucleotides in common in the same sequence. The amplification mixtures Al and A2 are used in sequence, according to the known principles of the Nested type multiple amplification.

In the components Al and A2 of the kit according to the present invention the reagents are present and dosed in such a way that the simultaneous amplification of the segments of genes of different biological species is allowed. The conducted researches have proved that said mixtures Al and A2 of the kit according to the present invention are sufficiently stable so that they may be included in the kit as such. The diagnostic laboratory will not have to dose separately the different reagents, in the way it is normally done. The laboratory will have to dose only the Taq polymerase and to add the DNA, extracted from the sample in any known way and diluted in water, in order to carry out the multiple amplification.

The mixture of the primers can be prepared starting from the following 5'- biotinylated oligonucleotides obtainable through the services of oligonucleotide synthesis of different companies such as the MWG-Biotech, Genset, Sigma and Phamiacia, and diluted in sterile water. The primers are necessary in order to amplify and label with biotin the segments of the mitochondrial gene that has to be identificated.

According to a preferred embodiment of the invention, mixtures Al and A2 comprise the primers corresponding to four biological species, for example the mitochondrial gene that codifies for cytochrome B (CYTB) in Bos taurus, Sus scrofa, Ovis aries and Homo sapiens. In this case, the mixture Al contains 10 parts of a 100 μM solution of the primers corresponding to Bos taurus; 10 parts of a 100 μM solution of the primers corresponding to Ovis aries; 8 parts of a 100 μM solution of the primers corresponding to Sus scrofa; and 5 parts of a 100 μiM solution of the primers corresponding to Homo sapiens. The primers for the A2 mixture are respectively: 8 parts of a 100 μM solution corresponding to Homo sapiens and 10 parts for each of the remaining solutions. The sequences 5'-3' of the primers are specified in the following with reference to the different animal species:

Mixture Al (External Primers):

Segment of the gene belonging to the Bos taurus species

CTAACATTCGAAAGTCCCACC

ATGCTGTGGCTATTACTGTG

Segment of the gene belonging to the Ovis aries species CAACATCCGAAAAACCCACC

ATGCTGTGGCTATGTCGC

Segment of the gene belonging to the Sus scrofa species

CCAACATCCGAAAATCACACC

AGCCTATGAAGGCTGTTGC Segment of the gene belonging to the Homo sapiens species

CCCCAATACGCAAAACTAACC

TGAAGGCTGTTGCTATAGTTGC

Mixture A2 (Internal Primers)

Segment of the gene belonging to the Bos taurus species CAGCCCCATCAAACATTTCATC

CCCGTAATATAAGCCTCGTCC Segment of the gene belonging to the Ovis aries species

CCCAGCTCCATCAAATATTTCATC

TCCATAGTATAGGCCTCGTCC

Segment of the gene belonging to the Sus scrofa species

GCCCCCTCAAACATCTCATC

TCCGTAGTATAGACCTCGG

Segment of the gene belonging to the Homo sapiens species

ACCCCATCCAACATCTCCG

ATCCGTAATATAGGCCTCGC

The mixtures Al and A2 according to the present embodiment of the invention preferably contain 26 parts of buffer solution [composition: tris-HCl

100 mM, KC1 500 mM, pH 8.3 (20°C)]; 60 parts of the mixture of primers

• (previously defined); 6 parts of 10 mM dNTP solution; 8 parts of 50 mM MgCl solution. These quotes can obviously vary within certain limits, which can be also

+10%, without compromising the effectiveness and the stability of the mixture. In order to increase the number of species identifiable with the kit according to the present invention, mixtures Al and A2 may be additioned with the primers corresponding to other searched species. For example, in order to verify the presence of derivatives of Gallus gallus, mixtures Al and A2 may be additioned with about 10 parts of a 100 μM solution of the following primers corresponding to the species Gallus gallus:

Mixture Al :

CCCAACATTCGAAAATCCCAC CGGTGGCTATGAGTGTGAG

Mixture A2:

AGCCCCATCCAACATCTCTG

CCGTAGTATAGGCCTCGTC

Now, considering component B of the kit according to the present invention, it is formed of a support of known type, for example a nylon or nitrocellulose strip, on which the probes specific for the searched biological species are deposited. The term "probe" is intended to mean an oligonucleotide having a known specific sequence which can be synthesized by suitable companies or directly in the laboratory by means of an instrument called oligonucleotide synthesizer. The important feature of the probe is that the 5 '-3' oriented sequence of A, T, C, G bases (adenine, cytosine, guanine, thymine) is defined. On the strip there are deposited the probes for identification of some species-specific forms of the gene of the mitochondrial B cytochrome. According to a preferred embodiment of the invention, the kit comprises probes for at least four biological species, so that simultaneous identification of at least four different contaminants is allowed. The probes have the purpose of binding the DNA segments of the tested sample, which have been amplified by using the mixtures Al and A2. Said segments are subjected to an hybridization reaction with the probes deposited onto the support, thus allowing the searched biological contaminants to be identified. Known processes and standard solutions can be employed for the hybridization, and any system implying incubation with a conjugate, capable of binding to a specific ligand incorporated in the primers which are comprised in component A, can be used for the detection.

The strip can be prepared according to a known process but it must contain the probes for the identification of the searched species, for example of Bos taurus, Sus scrofa, Ovis aries, Homo sapiens and optionally of other species such as for example Gallus gallus. In this case, the nucleotide sequences have been taken from the sequence of the gene CYTB and from the polymorphic forms given in the literature. In particular, the specific oligonucleotide sequences for the above mentioned species are specified in the following: Bos taurus

ATATCTGCCGAGACGTGAACTACG Ovis aries

CTAGGCATTTGCTTAATTTTACAGATTCTAAC Sus scrofa CGGATGAGTTATTCGCTATCTACATG Homo sapiens TGATCCTCCAAATCACCACAGGAC Gallus gallus CACTTGCCGGAACGTACAATACG

Other probes corresponding to other biological species can be added so as to obtain a strip allowing the kit according to the present invention to individualize with the same process other animal or vegetal species, microorganisms and OGMs. In alternative to the nylon or nitrocellulose strip, a microchip suitable for being introduced in an automitized apparatus for contaminant recognition can be used. The oligonucleotides can be obtained from different companies, such as the

MWG-Biotech, Genset, Pharmacia, Gibco S.r.l.

The preparation of the kit according to the present invention can be carried out as shown in the following examples.

EXAMPLE 1 In order to prepare the mixture Al of the primers, 80 μl taken from 100 μM solutions corresponding to each one of the two primers for Sus scrofa, 50 μl taken from 100 μM solutions corresponding to each one of the two primers for Homo sapiens, 100 μl taken from 100 μM solutions corresponding to each one of the two primers for Bos taurus and Ovis aries were introduced in a sterile tube. In order to prepare the primer mixture A2, 100 μl taken from 100 μM solutions corresponding to each one of the two primers for Bos taurus, Ovis aries and Sus scrofa and 80 μl taken from a 100 μM solution corresponding to each one of the two primers for Homo sapiens were introduced in a sterile tube. Said solutions were provided by the company MWG-Biotech of Florence. The so obtained mixture, after a mild stirring, was divided into sterile tubes and kept at -20° C in order to be used later in the preparation respectively of the amplification mixtures Al and A2 of component A.

The two mixtures for multiple amplification were then prepared by mixing in the order the four reagents, that is the amplification buffer solution, the dNTP, the primer mixtm-e and the MgCl₂ solution. The dNTP has been provided by the company Amersham-Pharmacia. The above mentioned reagents were taken and introduced in a sterile tube in the following order: 300 μl of amplification buffer lOx concentrated [composition: 100 mM tris-HCl, 500 mM KC1, pH 8,3 (20°C)](Labtek); 60 μl dNTP (triphosphate deoxynucleotides: adenine, cytosine, thymine, guanine) [10 mM] (Sigma); 90 μl MgCl₂ [50 mM] (Roche); 60 μl of the mixture containing the biotinylated primers separately prepared as above described. The obtained solution was mildly stirred and then aliquoted in sterile tubes which were kept at low temperature (-20°C) until they were used.

EXAMPLE 2 The necessary probes were synthesized, according to the above indicated needs, through the oligonucleotide synthesis service offered by the MWG-Biotech in Florence.

Once the probes were obtained, they were diluted with water to the concentration of 100 μM, and kept at -20°C, in order to guarantee the stability thereof.

Before depositing the probes on the membrane, in order to favor the fixing thereof onto the membrane, they were lengthened by adding a tail of poly-T, according to a known process. In particular, 200 pmoles of each probe for two hours at 37°C in a water solution obtained by additioning in a sterile, tube the following reagents in the following order: 19 μil of bidistilled sterile H₂O, 8 μl of CoCl₂ (25 mM), 8 μl of buffer 5x (1 M cacodylate potassium, 125 mM Tris HC1, 1,25 mg/ml bovine serum albumin pH 6,6 at 25°C), 2 μl of dTTP (deoxythymidine triphosphate, lithium salt 5 mM), 2 μl of each probe (100 pM). After mixing, 1 μl of enzyme was added (terminal transferase at the concentration of 25 u/μl) and the test tube was incubated in a thermostatic bath for two hours at 37°C. The reaction was interrupted by adding 4 μl of a 0.2 M EDTA solution. The so treated probes were deposited on the membrane in order to form the strips to be inserted in the kit according to the present invention.

The strips were prepared by depositing the probes (lengthened with a poly-T tail by means of incubation with terminal transferase) on a nylon membrane provided by Roche, a known general process and the apparatus Miniprotean II by Biorad were used.

Having used the rules for a good laboratory practice, a nylon membrane cut with the size suitable for the apparatus used for the deposition (7 x 8.4 cm) was taken and mounted inside the instrument by following the instructions indicated by the manufacturing company (Biorad). 20-30 pmoles of each probe previously incubated with terminal transferase (and 1-1 pmoles of biotin used as a positive check for the color reaction detection) were taken, which were diluted in 650 μl of SSC10X by using a 1,5 ml tube. Each diluted probe was arranged in the suitable cells (size 2.5 mm x 5.2 mm x 5 mm) and allowed to incubate at room temperature for 12 hours under stirring. At the end of the incubation, the solution containing the probe diluted in SSC was eliminated from the cells by washing with 650 μl of SSC10X. Then, the apparatus was disassembled, the membrane was washed with S SCI OX for 1-2 minutes and it was allowed to dry at room temperature on 3 mm paper hi a clean environment and protected from powder. The probes were fixed onto the membrane first by exposing to UN. rays the side of the membrane on which they were deposited for 1-3 minutes and then leaving it in an oven for 80-100°C for 1-2 hours.

Once the probes and the positive control (biotin) were fixed onto the membrane, this latter was cut into strips by using a cutter or a scalpel. Each strip was ready for hybridization with the amplification products labeled with biotin and obtained by using component A prepared according to Example 1.

In order to complete the kit, components A and B prepared in the above described and exemplified way are to be additioned with the other known reagent for hybridization, that is: the hybridization solution, the washing solution, the conjugate solvent, the concentrated conjugate to be diluted at the last moment with the relevant solvent, the blocking solution, the positive control, the table for reading the results and the relevant protocol. All this material is already known and needs no particular description. In case, the completing of the kit can be canied out by the same diagnostic laboratory, which can simply add this material to components A and B according to the present invention. In order to use the kit it is necessary to know the composition of the hybridization and washing solutions, as well as the washing and hybridization temperatures. However, these are solutions indicated in some known protocols indicated in scientific magazines, so that some tests are sufficient in order to establish the concentrations of salt and the most suitable temperatures for the purpose. Even if the composition of the hybridization solution and the optimal temperatures are not known, it is possible to define them experimentally.

Claims

CLAIMS 1. Kit of reagents for the identification of at least two biological contaminants in a sample, characterized in that it comprises a first component (component A) for multiple amplification formed of two amplification mixtures (Al and A2), each of which comprises an amplification buffer, dNTP, MgCl₂ and a solution comprising a couple of primers of a mitochondrial gene of each biological species, at least one primer being labeled, and a second component (component B) for reverse hybridization, comprising a support on which at least one specific probe for each biological species is deposited. ,

2. Kit of reagents according to claim 1, characterized in that said mitochondrial gene is the gene CYTB.

3. Kit of reagents according to claim 1 or 2, characterized in that both the couples of primes in the amplification mixtures (Al and A2) and the specific probes deposited on the support in component B are four.

4. Kit of reagents according to claim 3, characterized in that the first amplification mixture (Al) comprises a couple of primers corresponding to Bos taurus species, having sequences CTAACATTCGAAAGTCCCACC and ATGCTGTGGCTATTACTGTG; a couple of primers corresponding to the Ovis aries species, having sequences CAACATCCGAAAAACCCACC and ATGCTGTGGCTATGTCGC; a couple of primers corresponding to the Sus scrofa species, of sequences CCAACATCCGAAAATCACACC and AGCCTATGAAGGCTGTTGC; and a couple of primers corresponding to the Homo sapiens species, having sequences CCCCAATACGCAAAACTAACC and TGAAGGCTGTTGCTATAGTTGC; in that the second amplification mixture comprises a couple of primers corresponding to the Bos taurus species, having sequences CAGCCCCATCAAACATTTCATC and

CCCGTAATATAAGCCTCGTCC a couple of primers corresponding to the Ovis aries species, having sequences CCCAGCTCCATCAAATATTTCATC and TCCATAGTATAGGCCTCGTCC; a couple of primers corresponding to the Sus scrofa species, of . sequences GCCCCCTCAAACATCTCATC and TCCGTAGTATAGACCTCGG; and a couple of primers corresponding to the Homo sapiens species, having sequences ACCCCATCCAACATCTCCG and ATCCGTAATATAGGCCTCGC.

5. Kit of reagents according to claim 4, characterized in that on the strip in component B are deposited a probe specific for Bos taurus having sequence ATATCTGCCGAGACGTGAACTACG; a probe specific for Ovis aries having sequence CTAGGCATTTGCTTAATTTTACAGATTCTAAC; a probe specific for Sus scrofa having sequence CGGATGAGTTATTCGCTATCTACATG; and a probe specific for Homo sapiens having sequence

TGATCCTCCAAATCACCACAGGAC.

6. Kit of reagents according to claim 5, characterized in that the primers corresponding to the species Bos taurus, Ovis aries, Sus scrofa and Homo sapiens are in the ratio of about 10:10:8:5 respectively in the first amplification mixture and of about 10:10:10:8 respectively in the second amplification mixture.

7. Kit of reagents according to claim 2 or 3, characterized in that the first amplification mixture (Al) comprises a couple of primers corresponding to the species Gallus gallus having sequences CCCAACATTCGAAAATCCCAC and CGGTGGCTATGAGTGTGAG and in that the second amplification mixture (A2) comprises a couple of primers corresponding to the species Gallus gallus having sequences AGCCCCATCCAACATCTCTG and CCGTAGTATAGGCCTCGTC.

8. Kit of reagents according to claim 7, characterized in that on the support in component B there is deposited a probe specific for Gallus gallus having sequence CACTTGCCGGAACGTACAATACG.

9. Kit of reagents according to claim 7, characterized in that the primers corresponding to the species Bos taurus, Ovis aries, Sus scrofa; Homo sapiens and

Gallus gallus are in the ratio of about 10:10:8:5:10 in the first amplification mixture and of about 10:10:10:8:10 in the second amplification mixture.

10. Kit of reagents according to one of the preceding claims, characterized in that said support is formed of a microchip suitable for being introduced in a automatized device for bio-contaminants recognition.

11. Oligonucleotide having sequence CTAACATTCGAAAGTCCCACC or a sequence homologous thereto.

12. Oligonucleotide having sequence ATGCTGTGGCTATTACTGTG or a sequence homologous thereto.

13. Oligonucleotide having sequence CAACATCCGAAAAACCCACC or a sequence homologous thereto.

14. Oligonucleotide having sequence and ATGCTGTGGCTATGTCGC derivatives or homologous thereof.

15. Oligonucleotide having sequence CCAACATCCGAAAATCACACC or a sequence homologous thereto.

16. Oligonucleotide having sequence AGCCTATGAAGGCTGTTGC or a sequence homologous thereto.

17. Oligonucleotide having sequence CCCCAATACGCAAAACTAACC or a sequence homologous thereto.

18. Oligonucleotide having sequence TGAAGGCTGTTGCTATAGTTGC or a sequence homologous thereto.

19. Oligonucleotide having sequence CAGCCCCATCAAACATTTCATC or a sequence homologous thereto.

20. Oligonucleotide having sequence CCCGTAATATAAGCCTCGTCC or a sequence homologous thereto.

21. Oligonucleotide having sequence

CCCAGCTCCATCAAATATTTCATC or a sequence homologous thereto.

22. Oligonucleotide having sequence TCCATAGTATAGGCCTCGTCC or a sequence homologous thereto.

23. Oligonucleotide having sequence GCCCCCTCAAACATCTCATC or a sequence homologous thereto.

24. Oligonucleotide having sequence TCCGTAGTATAGACCTCGG or a sequence homologous thereto.

25. Oligonucleotide having sequence ACCCCATCCAACATCTCCG or a sequence homologous thereto.

26. Oligonucleotide having sequence ATCCGTAATATAGGCCTCGC or a sequence homologous thereto.

27. Oligonucleotide having sequence CCCAACATTCGAAAATCCCAC or a sequence homologous thereto.

28. Oligonucleotide having sequence CGGTGGCTATGAGTGTGAG or a sequence homologous thereto.

29. Oligonucleotide having sequence AGCCCCATCCAACATCTCTG or a sequence homologous thereto.

30. Oligonucleotide having sequence CCGTAGTATAGGCCTCGTC or a sequence homologous thereto.

31. Oligonucleotide having sequence ATATCTGCCGAGACGTGAACTACG or a sequence homologous thereto.

32. Oligonucleotide having sequence CTAGGCATTTGCTTAATTTTACAGATTCTAAC or a sequence homologous thereto.

33. Oligonucleotide having sequence CGGATGAGTTATTCGCTATCTACATG or a sequence homologous thereto.

34. Oligonucleotide having sequence TGATCCTCCAAATCACCACAGGAC or a sequence homologous thereto.

35. Oligonucleotide having sequence CACTTGCCGGAACGTACAATACG or a sequence homologous thereto.