WO2004032880A2 - Method for inhibiting angiogenesis with ship-1 inhibitors - Google Patents

Abstract

Methods for inhibiting angiogenesis using inhibitors of Ship-1 are provided. The net result is prevention, reduction or treatment of angiogenesis. Methods of treating angiogenic diseases and conditions and conditions associated with aberrant or excessive blood vessel growth are provided. Ship-1 inhibitors of the present invention include small molecules, antibodies, peptides (including dominant negative peptides) and antisense compounds, including ribozymes, inhibitory RNA molecules including siRNA molecules and antisense oligonucleotides.

Description

METHOD FOR INHIBITING ANGIOGENESIS WITH SHIP-1 INHIBITORS

BACKGROUND OF THE INVENTION

The formation of new blood vessels (or capillaries) is known as angiogenesis. Angiogenesis is normally virtually absent in healthy adult mammals, and is restricted to a few conditions. Examples of these conditions include wound healing and the formation of corpus luteum, endometrium and placenta. The endothelial cell plays a key role in the formation of new capillaries, and the neovascularization process occurs via a series of sequential steps. These steps are similar, regardless of the nature of the inducing stimulus. The steps may be summarized as follows: (a) the endothelial cells that line existing microvessels focally degrade the basement membrane through a finely-tuned elaboration of proteolytic enzymes and their inhibitors, and form tiny sprouts which invade the perivascular connective tissue; (b) as these sprouts elongate by migration of endothelial cells below the tip, a lumen is gradually formed; (c) the hollow sprouts thus generated anastomose with each other to form capillary loops through which blood begins to flow; (d) new sprouts then arise from each loop and eventually give rise to an entire capillary network.

Normally, during cyclical changes in the female reproductive tract or in response to wounding, the coordinated sequential cellular events leading to new capillaries are spatially and temporally restricted so that the disturbed balance between naturally occurring inducers and inhibitors of neovascularization rapidly reverts to the normal situation, in which inhibitory influences predominate. In certain pathological conditions, however, angiogenesis is dramatically enhanced and is no longer self-limited. That is, there is no longer a well-balanced activity of angiogenesis inhibitors and stimulators. Pathological angiogenesis is seen during the development and progression of many diseases, such as in rheumatoid arthritis, psoriasis and diabetic retinopathy and other diseases and conditions listed hereinbelow. Diseases or conditions characterized or caused by abnormal or excessive angiogenesis are designated as angiogenic diseases or conditions. Angiogenic conditions are a form of hyperproliferative condition. Perhaps, the clinically most important manifestation of pathological angiogenesis is that induced by solid tumors. Folkman, J., 1985, Adv. Cancer Res . 43, 175-203 and Folkman, J. , 1995, Nature Med. , 1, 27-31. If a neoplasm is to grow progressively as a solid mass consisting of layers of living cells more than a few millimeters thick, it must induce nearby capillaries to sprout and develop a new vascular network around and within the tumor. The new vascular network supplies the tumor with vital nutrients and oxygen and provides a removal route for toxic products of the active cell metabolism. Furthermore, new tumor vessels provide a port of exit for tumor cells to metastize to distant sites. Thus, the progressive growth of a solid tumor to develop into a life-threatening malignancy is strictly dependent on angiogenesis. Thus tumor growth and metastasis are both angiogenic conditions. It has recently become understood that many diverse diseases and pathological conditions are characterized or caused by abnormal or excessive angiogenesis. These angiogenic conditions include cancer, infectious diseases (pathogens express or induce angiogenic genes) , autoimmune disorders, vascular malformations, DiGeorge syndrome, cavernous hemangioma, atherosclerosis, transplant arteriopathy, obesity (angiogenesis induced by fatty diet) , psoriasis, warts, allergic dermatitis, scar keloids, pyogenic granulomas, blistering disease, Kaposi sarcoma, persistent hyperplastic vitreous syndrome, diabetic retinopathy, retinopathy of prematurity, choroidal neovascularization, primary pulmonary hypertension, asthma, nasal polyps, inflammatory bowel and periodontal disease, asσites, peritoneal adhesions, endometriosis, uterine bleeding, ovarian cysts, ovarian hyperstimulation, arthritis, synovitis, osteomyelitis and osteophyte formation (Carmeliet, P., 2003, Nature Med. , 9 , 653-660). Various compounds and methods have been employed for inhibiting angiogenesis in mammals. However, many are ineffective and/or cause undesirable side effects. What is needed, therefore, is an improved method for inhibiting angiogenesis . It is surprisingly discovered that an inhibitor of Ship-1 is effective in inhibiting angiogenesis. Furthermore, it is discovered that these inhibitors are effective in treating angiogenic diseases and conditions.

Ship-1 (also known as SH2-containing phosphatidylinositol phosphatase-1, IΝPP5D or in earlier papers, simply SHIP) is a phosphatase that selectively removes the phosphate from the 5- position of the inositol ring in inositol-containing lipids (Liu and Dumont, Genomics, 1997, 39, 109-112; Ware et al . , Blood, 1996, 88 , 2833-2840) . In doing so, Ship-1 plays a significant role in the termination of signal transduction cascades by regulating the level of soluble phospholipid messengers. This enzyme, expressed in a variety of hematopoietic cells, specifically dephosphorylates inositol (1,3,4,5) tetrakisphosphate and phosphatidylinositol (3,4,5) triphosphate (Drayer et al . , Biochem . Biophys . Res . Commun . , 1996, 225, 243- 249; Geier et al . , Blood, 1997, 89, 1876-1885). In addition to its lipid hydrolyzing properties, Ship-1 has been shown to interact with the adapter protein, She, through a protein- protein interaction domain and to be phosphorylated upon cytokine stimulation (Lamkin et al . , J. Biol . Chem. , 1997, 212, 10396-10401) . Upon phosphorylation, Ship-1 relocates to the actin cytoskeleton and this relocation has recently been shown to be thrombin mediated thereby implicating Ship-1 in platelet activation (Giuriato et al . , J^". Biol . Chem. , 1997, 272, 26857- 26863) .

Ship-1 has also been implicated in the cellular processes of apoptosis (Liu et al . , J. Biol . Chem. , 1997, 272, 8983-8988), calcium signaling (Okada et al . , J. Immunol . , 1998, 161 , 5129- 5132) and modulation of immune receptor responses (Bolland et al . , Tirimunity, 1998, 8, 509-516) . Im unoprecipitation and immunoblotting studies of murine hematopoietic cells revealed that multiple forms of Ship-1 are generated by C-terminal truncation implying that the Ship-1 phosphatase performs several distinct functions within the cell (Da en et al . , Blood, 1998, 92, 1199-1205) . Disclosed in PCT publication WO 9710252 and US patent 6,283,903, are nucleic acid sequences encoding human Ship-1 polynucleotide, a cDNA construct for the expression of Ship and cell systems in which to express the construct (Krystal, 2001; Rohrschneider and Lioubin, 1997). In addition, a monoclonal antibody to Ship-1 is claimed as well as methods to detect Ship-1 using the antibody (Rohrschneider and Lioubin, 1997) . Antisense inhibition of overexpressed or mutant Ship-1 is also disclosed but specific antisense sequences are not provided in PCT publication WO 97/10252 (Rohrschneider and Lioubin, 1997) .

It is now surprisingly discovered that inhibitors of Ship-1 can be used to inhibit angiogenesis. SUMMARY OF THE INVENTION

It is now surprisingly discovered that inhibitors of Ship-1 can inhibit angiogenesis. Methods for inhibiting angiogenesis in a cell by contacting the cell with an inhibitor of Ship-1 activity or expression are provided. Methods for treating, preventing or delaying the onset of diseases or conditions associated with angiogenesis are also provided. The inhibitor of Ship-1 may be a small molecule, antibody, peptide and/or antisense compound. Additional advantages and aspects of the present invention are apparent in the following detailed description and claims.

DETAILED DESCRIPTION OF THE INVENTION

It is now surprisingly discovered that the inhibition of Ship-1 can inhibit angiogenesis.

During the process of angiogenesis, endothelial cells perform several distinct functions, including the degradation of the extracellular matrix (ECM) , migration, proliferation and the formation of tube-like structures. Assays have been developed for studying the angiogenesis process in cells, and such assays have been used as described herein for identification of compounds which inhibit or reduce angiogenesis.

The inhibition of abnormal or excessive angiogenesis is advantageous for the treatment of angiogenic conditions, i.e, diseases and pathological conditions characterized or caused by abnormal or excessive angiogenesis. These include cancer, infectious diseases, autoimmune disorders, vascular malformations, DiGeorge syndrome, cavernous hemangioma, atherosclerosis, transplant arteriopathy, obesity, psoriasis, warts, allergic dermatitis, scar keloids, pyogenic granulomas, blistering disease, Kaposi sarcoma, persistent hyperplastic vitreous syndrome, diabetic retinopathy, retinopathy of prematurity, choroidal neovascularization, primary pulmonary hypertension, asthma, nasal polyps, inflammatory bowel and periodontal disease, ascites, peritoneal adhesions, endometriosis, uterine bleeding, ovarian cysts, ovarian hyperstimulation, arthritis, synovitis, osteomyelitis and osteophyte formation (Carmeliet, P., 2003, Nature Med. , 9, 653- 660) . It is believed that an animal having an angiogenic condition may be effectively treated by inhibiting Ship-1 in the animal . In one embodiment of the present invention, inhibitors of Ship-1 may be administered to inhibit angiogenesis. Furthermore, conditions associated with excessive or abnormal angiogenesis may also be treated by the administration of a Ship-1 inhibitor. Non-limiting examples of angiogenic conditions include cancer, infectious diseases, autoimmune disorders, vascular malformations, DiGeorge syndrome, cavernous hemangioma, atherosclerosis, transplant arteriopathy, obesity, psoriasis, warts, allergic dermatitis, scar keloids, pyogenic granulomas, blistering disease, Kaposi sarcoma, persistent hyperplastic vitreous syndrome, diabetic retinopathy, retinopathy of prematurity, choroidal neovascularization, primary pulmonary hypertension, asthma, nasal polyps, inflammatory bowel and periodontal disease, ascites, peritoneal adhesions, endometriosis, uterine bleeding, ovarian cysts, ovarian hyperstimulation, arthritis, synovitis, osteomyelitis and osteophyte formation, or any disease or disorder caused or characterized by uncontrolled, excessive or abnormal blood vessel formation or growth. As used herein, "treatment" includes prophylactic as well as therapeutic use, i.e., treatment of a disease or condition includes prevention as well as delay of onset of the disease or condition.

In a broad embodiment, the Ship-1 protein of a mammal may be modulated by the administering to the mammal a therapeutically effective amount of a modulator of Ship-1. As used herein, "modulate" means increased (enhanced) or decreased (inhibited) . Inhibition is presently a preferred form of modulation. As used herein, a Ship-1 inhibitor is a compound that inhibits Ship-1 expression, levels, or activity. As used herein, "inhibit" may be partial or complete reduction in the amount or activity of Ship-1 to a level at or below that found under normal physiological conditions if used prophylactically, or below the existing (pre-treatment) levels if used in treatment of an active or acute condition. In one embodiment, the activity or amount of Ship-1 is inhibited by about 10%. Preferably, the activity or amount of Ship-1 is inhibited by about 30%. More preferably, the activity or amount of Ship-1 is inhibited by 50% or more. In one embodiment, the reduction of the expression of targets may be measured in adipose, liver, blood or other tissue of the mammal. Preferably, the cells being inhibited contain therein a nucleic acid molecule encoding for a Ship-1 protein and/or the Ship-1 protein itself. As used herein, a mammal is a warm-blooded vertebrate animal, which includes a human. Any inhibitor of Ship-1 may be employed in accordance with the present invention. Compounds useful as Ship-1 inhibitors include compound that act on the Ship-1 protein to directly inhibit Ship-1 function or activity, as well as compounds which indirectly inhibit Ship-1 by reducing amounts of Ship-1, e.g., by reducing expression of the gene encoding Ship-1 via interference with transcription, translation or processing of the mRNA encoding Ship-1. Inhibitors of Ship-1 also include compounds that bind to Ship-1 and inhibit its function, including ability to bind substrate or receptor molecules and/or any enzymatic or other activity that Ship-1 may have. Thus inhibitors of Ship-1 include small molecules, preferably organic small molecule compounds; antibodies; peptides and peptide fragments, particularly Ship-1 dominant negative peptides and fragments, and the like. Inhibitors of Ship-1 also include compounds which inhibit the expression or reduce the levels of Ship-1, including small molecules, antibodies, peptides and peptide fragments, nucleic acids and the like which are designed to bind to a particular target nucleic acid and thereby inhibiting its expression. In one embodiment, Ship-1 inhibitors used in accordance with the present invention are antisense compounds. Non-limiting examples of antisense compounds in accordance with the present invention include ribozymes; short inhibitory RNAs (siRNAs) ; long double-stranded RNAs, antisense oligonucleotides; antisense oligonucleotide mi etics such as peptide nucleic acid (PNA) , morpholino compounds and locked nucleic acids (LNA) ; external guide sequence (EGS) ; oligonucleotides (oligozymes) and other short catalytic RNAs or catalytic oligonucleotides which hybridize to the target nucleic acid and modulate its expression, and mixtures thereof. Antisense inhibitors of Ship-1 are disclosed in U.S. Patent No. 6, XXX, XXX, filed on November 27, 2001 as U.S. Patent application serial no. 10/003,919 and published as U.S. Patent Application US2003-0114401, which is incorporated herein in its entirety.

In one embodiment, small molecules are administered as Ship-1 inhibitors in accordance with the present invention. Libraries of small organic molecules may be obtained commercially, for example from ChemBridge Corp. in San Diego,

California or LION Bioscience, Inc. (formerly Trega Biosciences) in San Diego, California. Libraries of small molecules may also be prepared according to standard methods that are well known in the art. An appropriate screening or assaying for inhibitors of the desired molecule is essential to finding inhibitors with the desired selectivity and specificity, and such screening and assaying may be readily practiced by one of ordinary skill in the art .

In another embodiment, Ship-1 inhibitors are antibodies or fragments thereof. These antibodies or fragments thereof may selectively bind to Ship-1 and in so doing, selectively inhibit or interfere with the Ship-1 polypeptide, preferably with the activity thereof. Standard methods for preparation of monoclonal and polyclonal antibodies and active fragments thereof are well known in the art. Antibody fragments, particularly Fab fragments and other fragments which retain epitope-binding capacity and specificity are also well known, as are chimeric antibodies, such as "humanized" antibodies, in which structural (not determining specificity for antigen) regions of the antibody are replaced with analogous or similar regions from another species. Thus antibodies generated in mice can be "humanized" to reduce negative effects which may occur upon administration to human mammals. Chimeric antibodies are now accepted therapeutic modalities with several now on the market. The present invention therefore includes use of antibody inhibitors of Ship-1 which include F(ab')2, Fab, Fv and Fd antibody fragments, chimeric antibodies in which one or more regions have been replaced by homologous human or non-human portions, and single chain antibodies. U.S. Patent No. 6,150,401 discloses techniques for antibodies specific for a protein, for example Ship-1. These techniques may be employed to produce inhibiting antibodies which are specific for Ship-1. The disclosure of U.S. Patent No. 6,150,401 is incorporated in its entirety herein by reference. Antibodies to Ship-1 are commercially available, for example from Santa Cruz Biotechnology, Santa Cruz CA (Catalog #sc-8425) . In other embodiments, the present invention provides use of Ship-1 inhibitors which are peptides, for example dominant negative Ship-1 polypeptides. A dominant negative polypeptide is an inactive variant or fragment of a protein which competes with or otherwise interferes with the active protein, reducing the function or effect of the normal active protein. If the target protein is an enzyme, dominant negatives may include polypeptides which have an inactive or absent catalytic domain, so that the polypeptide binds to the substrate but does not phosphorylate it, or polypeptides which have a catalytic domain with reduced enzymatic activity or reduced affinity for the substrate. One of ordinary skill in the art can use standard and accepted mutagenesis techniques to generate dominant negative polypeptides. For example, one of ordinary skill in the art can use the nucleotide sequence of Ship-1 along with standard techniques for site-directed mutagenesis, scanning mutagenesis, partial deletions, truncations, and other such methods known in the art. For examples, see Sambrook et al . , Molecular Cloning : A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY, 1989, pp. 15.3-15.113. U.S. Patent No. 6,150,401, which is incorporated in its entirety herein by reference, also discloses techniques which may readily be adapted to create dominant negative polypeptides to Ship-1. Inhibitors of Ship-1 may be antisense compounds, including antisense oligonucleotides, ribozymes and other catalytic oligonucleotides, and inhibitory RNAs including transfected, intracellularly expressed single stranded antisense RNAs or double stranded RNAs, as well as small intefering RNAs (siRNA) . Ribozymes are catalytic RNAs. A number of labs around the world are now using these ribozymes to study gene function in precisely the manner described above most notably in the study of HIV, the AIDS virus, and in cancer research. Ribozymes may be synthetically engineered via the technologies of Ribozyme Pharmaceuticals, Inc. (RPI) , Boulder, Colorado, to act as "molecular scissors" capable of cleaving target RNA, for example the RNA encoding Ship-1, in a highly specific manner, blocking gene expression. Various types of ribozymes and their uses are taught, for example, in U.S. Patent 6,436,644 and 6,194,150. siRNAs are short double stranded RNAs (dsRNA) which may be designed to inhibit a specific mRNA, for example the RNA encoding Ship-1. PCT publication WO 00/44895 (Kreutzer and Limmer) discloses methods for inhibiting the expression of a predetermined target gene in a cell . Such method comprises introducing an oligoribonucleotide with double stranded structure (dsRNA) or a vector coding for the dsRNA into the cell, where a strand of the dsRNA is at least in part complementary to the target gene. U.S. patent 6,506,559 discloses and claims gene-specific inhibition of gene expression by double-stranded ribonucleic acid (dsRNA) and is incorporated herein by reference in its entirety. See also PCT publications

WO 01/48183, WO 00/49035, WO 00/63364, WO 01/36641, WO 01/36646, WO 99/32619 and WO 00/44914, and Elbashir et al . , Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate, EMBO J., 2001, 20, 6877-6888. Thus, one of ordinary skill in the art can readily design an inhibitory RNA, such as a dsRNA (e.g., an RNAi or siRNA compound) or a vector coding for the inhibitory RNA, which is capable of inhibiting the nucleotide sequence encoding the Ship- 1 protein. Antisense oligonucleotides and antisense oligonucleotide mimetics such as peptide nucleic acid (PNA) and morpholino compounds are preferred antisense compounds. Antisense compounds specifically hybridize with one or more nucleic acids encoding Ship-1. Examples of antisense inhibitors of Ship-1, as well as various chemical modifications and methods for making and using them are disclosed in U.S. Patent No. 6, XXX, XXX, filed on November 27, 2001 as U.S. Patent application serial no. 10/003,919 and published as U.S. Patent Application US2003- 0114401, which is incorporated herein in its entirety.

The inhibitors used in the present invention may also admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S.: 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804, 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528,

5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5 , 595 , 756 , each of which is herein incorporated by reference .

The compounds used in the present invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. The methods of the present invention may also use pharmaceutical compositions and formulations of one or more Ship-1 inhibitors. The pharmaceutical compositions may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery) , pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal , epidermal and transdermal) , oral or parenteral . Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

Pharmaceutical formulations may conveniently be presented in unit dosage form and may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrie (s) or excipient (s) . In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compositions used in the methods of the invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

Pharmaceutical compositions include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations used may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients. One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.

Preferred formulations for topical administration may include those in which the compounds to be administered are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearoylphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidyl ethanolamine (DOTMA) .

For topical or other administration, Ship-1 inhibitors used in the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, inhibitors may be complexed to lipids, in particular to cationic lipids.

Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or initablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. In some embodiments, inhibitors are administered in conjunction with one or more penetration enhancers, surfactants and chelators . Examples of surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Combinations of penetration enhancers may also be used. Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

Certain embodiments of the methods of the invention involve use of pharmaceutical compositions containing one or more inhibitors of Ship-1 and one or more other agents that function by a non-Ship-1 mechanism. Examples of such agents include but are not limited to cancer chemotherapeutic drugs, anti- inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs. In preferred embodiments, the other agent (s) may be an anti-cancer drug. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, ethylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4- hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU) , 5- fluorodeoxyuridine (5-FUdR) , methotrexate (MTX) , colchicine, taxol, vincristine, vinblastine, etoposide (VP-16) , trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DΞS) . When used with the compounds of the invention, such chemotherapeutic agents may be used individually {e. g. , 5-FU and oligonucleotide) , sequentially (e . g. , 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide) , or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide) . When used in combination, the Ship-1 inhibitor and the additional agent may be used individually, sequentially or in combination.

The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient.

Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual inhibitors, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the inhibitor is administered in maintenance doses .

Various U.S. Patents and applications have been cited herein. The contents of these documents are incorporated in their entirety herein by reference. A patent application directed to antisense inhibitors of Ship-1 was filed on November 27, 2001 (Docket No. RTS-0256) and issued on xxxx, xxxx as US Patent 6,xxx,xxx; the disclosure of this document is incorporated in its entirety herein by reference.

While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.

EXAMPLES Example 1 Matrix Metalloproteinase (MMP) Activity Assay:

During angiogenesis, endothelial cells need to be able to degrade the extracellular matrix so they can migrate and form new vessels. Endothelial cells secrete matrix metalloproteinases (MMPs) in order to accomplish this degradation. MMPs are a family of zinc-dependent endopeptidases that fall into eight distinct classes: five are secreted and three are membrane-type MMPs (MT-MMPs) . MMPs exert their effects by cleaving a diverse group of substrates, which include not only structural components of the extracellular matrix, but also growth-factor-binding proteins, growth-factor precursors, receptor tyrosine kinases, cell-adhesion molecules and other proteinases . MMPs include gelatinases, collagenases and stro elysins . In this assay the activity of MMPs (gelatinases and collagenases) secreted into the medium above antisense oligonucleotide-treated endothelial cells is measured.

MMP activity in the medium above human umbilical vein endothelial cells (HUVECs) is measured using the EnzChek

Gelatinase/Collagenase Assay Kit (Molecular Probes, Eugene, OR) . HUVECs are plated at 3000 cells/well in 96-well plates. One day later, cells are transfected with antisense oligonucleotides according to standard published procedures (Monia et al . , (1993) J Biol Chem. 1993 Jul 5 ; 268 (19) : 14514-22) with 75nM oligonucleotide in lipofectin (Gibco, Grand Island, NY) . Antisense oligonucleotides are tested in triplicate on each 96- well plate, except for positive and negative antisense controls, which are measured up to six times per plate. Twenty hours post-transfection, MMP production is stimulated by the addition of recombinant human vascular endothelial growth factor (VEGF) . Fifty hours post-transfection, a p-aminophenylmercuric acetate (APMA; Sigma-Aldrich, St. Louis, MO) solution is added to each well of a Corning-Costar 96-well clear bottom plate (VWR International, Brisbane, CA) . The APMA solution is used to promote cleavage of inactive MMP precursor proteins (Nagase et al., (1991) Biomed Biochim Acta, 50 (4-6) : 749-54) . Media above the HUVECs is then transferred to the wells. After 30 minutes, the quenched, fluorogenic MMP cleavage substrate is added, and baseline fluorescence is read immediately at 485nm excitation/53Onm emission. Following an overnight incubation at 37°C in the dark, plates are read again to determine the amount of fluorescence, which corresponds to MMP activity. Total protein from HUVEC lysates is used to normalize the readings, and MMP activities ± standard deviation are expressed relative to transfectant-only controls. MMP activity may be increased or decreased by treatment with Ship-1 inhibitor. The MMP assays herein employed a Ship-1 inhibitor comprising ISIS No. 168278 having the sequence ATGGACTCGCTGGCACGCAC (SEQ ID NO: 1) , and a control antisense compound, ISIS No. 29848. ISIS No. 29848 is a 20-mer having the sequence: NNNNNNNNNNNNNNNNNNNN, where N is a random mixture of A, G, T and C. The concentration of the inhibitor and control used was 75 nM.

The Ship-1 inhibitor caused a 66% reduction of MMP activity, as compared to MMP activity in control oligonucleotide-treated cells. Thus, it is shown that Ship-1 inhibitors can prevent angiogenesis.

Example 2

Endothelial Tube Formation Assay: Angiogenesis is stimulated by numerous factors that promote interaction of endothelial cells with each other and with extracellular matrix molecules, resulting in the formation of capillary tubes. This morphogenic process is necessary for the delivery of oxygen to nearby tissues and plays an essential role in embryonic development, wound healing, and tumor growth.

Moreover, this process can be reproduced in tissue culture by the formation of tube-like structures by endothelial cells. There are several different variations of the assay that use different matrices, such as collagen I [Kanayasu, 1991] , Matrigel [Yamagishi, 1997] and fibrin [Bach, 1998] as growth substrates for the cells. In this assay, HUVECs are plated on a matrix derived from the Engelbreth-Holm-Swarm mouse tumor, which is very similar to Matrigel [Kleinman, 1986; Madri, 1986] . Untreated HUVECs form tube-like structures when grown on this substrate. Loss of tube formation in-vi tro has been correlated with the inhibition of angiogenesis in-vivo (Carmeliet et al . , (2000) Nature 407:249-257; and Zhang et al . , (2002) Cancer Research 62:2034-42), which supports the use of in-vi tro tube formation as an endpoint for angiogenesis.

The Tube Formation Assay is performed using an In-vi tro Angiogenesis Assay Kit (Chemicon International, Temecula, CA) , or growth factor reduced Matrigel (BD Biosciences, Bedford, MA) . Cells are plated and transfected with Ship-1 inhibitors (antisense oligonucleotides) as described for the MMP activity assay, except cells are plated at 4000 cells/well. Fifty hours post-transfection, cells are transferred to 96-well plates coated with ECMatrix™ (Chemicon International) or growth factor depleted Matrigel. Under these conditions, untreated HUVECs form tube-like structures. After an overnight incubation at 37° C, treated and untreated cells are inspected by light microscopy. Individual wells are assigned discrete scores from 1 to 5 depending on the extent of tube formation. A score of 1 refers to a well with no tube formation while a score of 5 is given to wells where all cells are forming an extensive tubular networ .

The tube formation assays herein employed a TARGET inhibitor, ISIS No. 168278; SEQ ID NO: 1, and a control antisense compound comprising ISIS No. 29848. ISIS No. 29848 is a 20-mer having the sequence: NNNNNNNNNNNNNNNNNNNN, where N is a random mixture of A, G, T and C. The concentration of the inhibitor and control used was 75 nM. As calculated from the assigned discrete scores, cells treated with Ship-1 inhibitors had tube formation score reduction of about 46% as compared to control oligonucleotide- treated cells. Thus, it is shown that Ship-1 inhibitors can inhibit angiogenesis . Example 3

RNA Expression Levels of Angiogenesis Hallmark Genes:

Endothelial cells must regulate the expression of many genes in order to perform the functions necessary for angiogenesis. This gene regulation has been the subject of intense scrutiny, and many genes have been identified as being important for the angiogenic phenotype. The expression levels of four genes, previously identified as being highly expressed in angiogenic endothelial cells, is measured here (Integrin beta 3, endoglin/CD105, TEM5 and MMP-14/MT-MMP1) . These genes are herein referred to as angiogenesis hallmark genes.

Integrin beta 3 is part of a family of heterodimeric transmembrane receptors that consist of alpha and beta subunits. Each subunit recognizes a unique set of ECM ligands, thereby allowing cells to transmit angiogenic signals from the extracellular matrix. Integrin beta 3 is prominently expressed on proliferating vascular endothelial cells, and it plays roles in allowing new blood vessels to form at tumor sites as well as allowing the epithelial cells of breast tumors to spread.

Blockage of Integrin alpha 3 with monoclonal antibodies or low molecular weight antagonists inhibits blood vessel formation in a variety of in-vivo models, including tumor angiogenesis and neovascularization during oxygen-induced retinopathy. Endoglin is a Transforming Growth Factor receptor- associated protein highly expressed on endothelial cells, and present on some leukemia cells and minor subsets of bone marrow cells. Its expression is upregulated in endothelial cells of angiogenic tissues and is therefore used as a prognostic indicator in various tumors. Endoglin functions as an ancillary receptor influencing binding of the Transforming Growth Factor beta (TGF-beta) family of ligands to signaling receptors, thus mediating cell survival. Mutations of the endoglin gene result in a genetic disease of the vasculature- Hereditary Haemorrhagic Telangiectasia (HHT) , which is characterized by bleeding from malformed blood vessels. Defective signaling by different TGF- beta ligands and receptors is thought to be involved.

Tumor endothelial marker 5 (TEM5) is a putative 7-pass transmembrane protein (GPCR) for which EST sequence but no other information is available. The mRNA transcript, designated KIAA1531, encodes one of many tumor endothelium markers (TEMs) that display elevated expression (greater than 10-fold) during tumor angiogenesis. TEM5 is coordinately expressed with other TEMs on tumor endothelium in humans and mice.

MMP-14, a membrane-type MMP (MT-MMP) covalently linked to the cell membrane, is involved in matrix detachment and migration. MMP-14 is thought to promote tumor angiogenesis; antibodies directed against the catalytic domain of MMP-14 block endothelial-cell migration, invasion and capillary tube formation in-vi tro. MMP-14 can degrade the fibrin matrix that surrounds newly formed vessels potentially allowing the endothelial cells to invade further into the tumor tissue. MMP- 14 null mice have impaired angiogenesis during development, further demonstrating the role of MMP-14 in angiogenesis.

Cells are plated and transfected as described for the MMP activity assay. Twenty hours post-transfection, cells are stimulated with recombinant human VEGF . Total RNA is harvested 52 hours post-transfection, and the amount of total RNA from each sample is determined using a Ribogreen Assay (Molecular Probes, Eugene, OR) . Real-time PCR is performed on the total RNA using primer/probe sets for four Angiogenic Hallmark Genes: integrin beta 3, endoglin, Tumor endothelial marker 5 (TEM5) and Matrix Metalloproteinase 14 (MMP14/MT1-MMP) . Expression levels for each gene are normalized to total RNA, and values are expressed relative to controls . Expression of each gene may be increased or decreased by treatment with Ship-1 inhibitor.

Claims

What is claimed is:

1. A method for inhibiting tube formation by epithelial cells comprising contacting said endothelial cells with an effective amount of an inhibitor of Ship-1, whereby tube formation is inhibited.

2. A method for inhibiting angiogenesis by epithelial cells comprising contacting said endothelial cells with an effective amount of an inhibitor of Ship-1, whereby angiogenesis is inhibited.

3. A method for inhibiting angiogenesis in an animal comprising contacting said animal with an inhibitor of Ship-1, whereby angiogenesis in the animal is inhibited.

4. A method of treating a disease or condition caused or characterized by angiogenesis in an animal comprising administering to said animal an effective amount of an inhibitor of Ship-1, whereby angiogenesis is inhibited.

5. Use of an inhibitor of Ship-1 in the manufacture of a medicament to inhibit angiogenesis.

6. Use of an inhibitor of Ship-1 in the manufacture of a medicament to inhibit tube formation by endothelial cells.

7. A method for inhibiting secretion of matrix metalloproteinase by endothelial cells comprising contacting said endothelial cells with an effective amount of an inhibitor of Ship-1, whereby MMP secretion is inhibited.

8. The method of claim 8 wherein the matrix metalloproteinase is gelatinase or collagenase.