WO2004022777A1 - METHODS USING dsDNA TO MEDIATE RNA INTERFERENCE (RNAi) - Google Patents
METHODS USING dsDNA TO MEDIATE RNA INTERFERENCE (RNAi) Download PDFInfo
- Publication number
- WO2004022777A1 WO2004022777A1 PCT/AU2003/001142 AU0301142W WO2004022777A1 WO 2004022777 A1 WO2004022777 A1 WO 2004022777A1 AU 0301142 W AU0301142 W AU 0301142W WO 2004022777 A1 WO2004022777 A1 WO 2004022777A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- double stranded
- sequence
- expression vector
- stranded dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
Definitions
- RNAi RNA interference
- the present invention relates to methods of producing libraries of DNA molecules the transcription of which results in the production of double stranded RNA or hairpin RNA.
- the present invention further relates to short interfering RNA expression vectors.
- dsRNA double stranded RNA
- RNAi RNA interference
- Fire et al 1998 found that dsRNA was more effective than antisense RNA alone.
- the dsRNA could be generated in vitro (Fire et al 1998) or in vivo (Tavernarakis et al 2000) and still mediate gene suppression with high specificity.
- dsRNA is an effective inducer of gene silencing in a wide range of eukaryotic organisms and that the mechanism behind this form of gene regulation is most likely conserved throughout evolution (Baulcombe, D. C. (1996) Plant Mol Biol32(l-2), 79-88; Lohmann, J. U., Endl, I., and Bosch, T. C. (1999) DevBiol2U(l), 211-4; Ngo, H., Tschudi, C, Gull, K., and Ullu, E. (1998) Proc Nati Acad Sci USA 95(25), 14687-92; Cogoni, C, and Macino, G.
- RNAi is postulated to involve both an initiation step and an effector step.
- dsRNA is processed by the RNaselH family nuclease Dicer to produce 21-23 nucleotide duplex siRNAs (small interfering RNAs).
- siRNAs are incorporated into a multiprotein complex called RISC (RNA-induced silencing complex) that targets transcripts by base pairing between one of the siRNA strands and the endogenous mRNA (Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000) Nature 404: 293-96).
- RISC RNA-induced silencing complex
- dsRNA-activated protein kinase PLR
- 2'5' oligoadenylate polymerase/RnaseL PLR-activated protein kinase
- the activation of these enzymes leads to a cessation of protein synthesis and eventually cell death via apoptosis.
- microRNAs which are postulated to be transcribed as hairpin RNA precursors that are processed by Dicer to produce the mature 21 base forms
- RNAs short hairpin RNAs
- Soohoo C, Affar, E., Gay, F., Shi, Y., Forrester, W. C, and Shi, Y.
- ShRNAs produced from these expression cassettes were processed by Dicer to 21 bp siRNAs which are believed to be the effectors of gene silencing. It is anticipated that these cassettes will be useful for reverse genetic approaches in mammalian cells and transgenic mice to better understand gene function, and also as therapeutics.
- RNAi in mammalian cells A major limitation with the state of the art for RNAi in mammalian cells is the lack of any strategy for using RNAi knockdowns in a forward genetic approach to identify new genes involved in cellular processes or different human diseases.
- synthetic siRNAs or RNAi expression constructs are designed on a gene-by-gene basis limiting the utility of these strategies for both generating and screening genome-wide RNAi expression libraries.
- the present invention provides methods which enable the production of RNAi libraries.
- the present invention provides a method of producing a DNA molecule wherein mRNA transcribed from the DNA molecule forms hairpin RNA (hRNA), the method comprising:
- the present invention provides a method of preparing an expression vector, expression of which produces double stranded RNA (dsRNA), the method comprising:
- the present invention provides a method for determining a function of a gene, the method comprising:
- the present invention provides a method for determining a function of a gene, the method comprising:
- the present invention provides an expression vector for use in suppressing expression of a target gene, the vector comprising a pair of convergent promoters and a DNA molecule positioned therebetween, the DNA molecule comprising a target-specific sequence flanked by two directional transcription terminators, the target-specific sequence comprising a sequence of at least 14 nucleotides having at least 90% identity to a segment of the target gene.
- the present invention provides a method for determining a function of a target gene, the method comprising:
- the present invention provides a method of producing a library of DNA molecules wherein mRNA transcribed from the DNA molecules forms hairpin RNA (hRNA) molecules, the method comprising:
- step (ii) ligating hairpin DNA to the DNA fragments from step (i);
- step (iii) ligating a double stranded DNA adaptor to the DNA from step (ii), wherein the DNA adaptor includes a primer binding site;
- step (iv) denaturing the DNA from step (iii) to form a library of single DNA strands
- the present invention provides a method of preparing a library of expression vectors, expression of which produces double stranded RNA (dsRNA) molecules, the method comprising:
- step (i) preparing a library of double stranded DNA fragments; (ii) ligating a double stranded DNA adaptor to each end of the DNA fragments from step (i), wherein the sequence of the DNA adaptor comprises at least four consecutive adenosine nucleotides at the 3' end; and
- step (iii) cloning the double stranded DNA from step (ii) into an expression vector between two convergent promoters.
- the present invention provides a method of producing a library of DNA molecules wherein mRNA transcribed from the DNA molecules forms hairpin RNA (hRNA) molecules, the method comprising:
- step (v) denaturing the DNA from step (iv) to form single stranded DNA
- the present invention provides a method of inhibiting expression of a target gene in a cell, the method comprising introducing into the cell an expression vector according to the fifth aspect of the present invention.
- FIG. 1 Enzymatic generation of DNA insert encoding a random shRNA.
- FIG. 3 Suppression of dEGFP-mediated cell fluorescence using a EGFP-specific shRNA expression plasmid.
- A Flow cytometry analysis of HEK 293 cells (containing a stably integrated dEGFP target gene) transiently transfected with pTZ(U6+l) vector alone (purple) or pTZ(U6+l)GFP (green overlay).
- B Quantitation of the FACs analysis represented in A. Each sample was transfected in triplicate.
- Figure 4 Construction of random shRNA expression library in a modified pLXSN. retroviral vector.
- A. The 45 bp stuffer fragment containing a unique Swal site was introduced between the Sail and Xbal sites downstream of the U6 promoter.
- B. Cloning site in pLXSNU ⁇ Swa.
- C. Generation of random shRNA expression vector using pLXSNU6Swa.
- Figure 5 Enzymatic generation of DNA insert encoding complementary sense and antisense RNAs specific for p53. The four steps involved in generating the DNA insert encoding complementary sense and antisense RNAs specific for human p53.
- Figure 6 Reduction in. dEGFP-mediated cell fluorescence in cells transiently transfected with a retroviral expression vector encoding EGFP siRNA.
- A Structure of the retroviral vector pLXSNU6/HlGFP encoding EGFP-specific siRNA.
- B Suppression of dEGFP- mediated cell fluorescence in HEK 293 cells (containing a stably integrated dEGFP transgene) after infection with pLXSNU6/HlGFP.
- Figure 7 Reduction in p53 protein levels in HCT116 colon carcinoma cells infected with a retroviral expression vector encoding p53 siRNA. Structure of the pLXSNU6/Hlp53 retroviral siRNA expression vector.
- Figure 8 Construction of a genome-wide siRNA retroviral expression library.
- Figure 9 Strategy for generating intracellular siRNAs and effect of the expressed siRNAs on transgene expression.
- A. The convergent U6 expression cassette encodes sense and antisense RNAs that terminate at directional termination sequences. The complementary RNAs anneal and undergo further Dicer-dependent processing to produce functional siRNAs.
- B. A U6 convergent expression vector containing an EGFP-specific insert (DualU6GFP) reduces dEGFP-mediated cell fluorescence.
- DualU6GFP dualU6GFP
- FIG. 10 Suppression of dEGFP transgene expression using a stably integrated convergent transcription vector.
- HEK 293 cells were cotransfected with either the pDualU6 vector or pDualU6GFP and the pREP7 plasmid in a 10:1 molar ratio, and cells selected for resistance to hygromycin. Following selection, cells were examined for level of dEGFP- mediated cell fluorescence.
- the DualU6GFP expression vector reduces dEGFP target gene expression in a Dicer-dependent manner.
- FIG. 13 5-FU-induced apoptosis in HCT116 cells containing pLXSNU6/Hlp53.
- A. Decrease in subGl population in cells expressing p53 siRNA.
- B. Cells expressing p53 siRNA display resistance to 5-FU-induced activation of caspase.
- C. Cells expressing p53 siRNA show increased cell viability following exposure to 5-FU.
- FIG. 1 Overview of the 5-FU genetic selection of spiked siRNA expression libraries.
- FIG. 1 Retroviral expression vectors for genome-wide RNAi libraries.
- Figure. 16 Method for constructing genome-specific shRNA and siRNA libraries.
- Figure 17 Schematic overview of the method for constructing shRNA and siRNA libraries specific for an expressed RNA population.
- FIG. 18 Identification of HIN-specific shR ⁇ A or siR ⁇ A using genetic selections.
- the present invention relates to methods which enable production of a library of DNA sequences encoding shRNA or siRNAs that are capable of recognising all target mRNA sites to identify, isolate and characterise unknown and known genes that contribute to a specific cellular phenotype or are modified by specific stimuli.
- These expression libraries are designed to suppress the expression of a target gene and based on the sequence of the encoded shRNA or siRNA identify the target gene responsible for the change in cellular phenotype.
- This method requires the construction of random shRNA and siRNA expression libraries that contain inserts encoding RNA sequences that form double-stranded RNA via intramolecular or intermolecular hybridisation in vivo, respectively.
- the present invention also provides a convergent promoter system capable of producing sense and antisense RNAs that mediate gene silencing in mammalian cells through the RNAi pathway. This system can be used to inhibit transgene and endogenous gene expression.
- dsRNA as a mediator has distinct advantages over hammerhead and hairpin ribozymes including the presence of a natural cellular protein complex (termed RISC) that binds the expressed dsRNA and mediates interaction with the target mRNA and cleavage of the target mRNA.
- RISC natural cellular protein complex
- the present invention provides a method of producing a DNA molecule wherein mRNA transcribed from the DNA molecule forms hairpin RNA (hRNA), the method comprising:
- a deoxyuracil nucleotide is included in the first sequence and prior to addition of the primer the single DNA strand is depurinated, preferably with uracil nucleotide glycosylase, and ⁇ -eliminated.
- the double stranded DNA is cloned into an expression vector. More preferably the double stranded DNA is cloned into an expression vector wherein the double stranded DNA is under the control of a promoter.
- the first DNA strand includes a restriction enzyme site.
- shRNA short hairpin RNA
- the random sequence is about 19 to about 30 base pairs in length. More preferably the random sequence is from 19 to 25 base pairs in length. Most preferably the random sequence is 19 base pairs in length.
- the term “complementary” is used in reference to "polynucleotides” and oligonucleotides” (which are interchangeable terms that refer to a sequence of nucleotides) related by the base pairing rules.
- sequence 5'-CTGAG-3' is complementary to the sequence 5'- CTCAG-3'.
- Complementarity can be partial or total. Partial complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. Total or complete complementarity is where each and every nucleic acid base is matched with another base according to base pairing rules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridisation between nucleic acid strands.
- loop refers to an unpaired secondary structure in a nucleic acid sequence in which a single-stranded nucleic acid sequence is flanked by nucleic acid sequences which are capable of pairing with each other to form a "stem” structure.
- unpaired when made in reference to nucleic acid refers to a secondary structure in an nucleic acid sequence in which nucleic acid is single-stranded and is flanked by nucleic acid sequences which are incapable of pairing with each other, but which are capable of pairing with other sequences. Loop structures of any length and any sequence are contemplated to be within the scope of this invention.
- RNAFOLD described in Hofacker et al. (1994) Monatshefte F. Chemie 125:167-188; McCaskill (1990) Biopolymers 29:1105-1119 and "DNASIS” (Hitachi).
- expression vector refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a host organism. Nucleic acid sequences necessary for expression in eukaryotic cells usually include a promoter and termination and polyadenylation signals. In a preferred embodiment the expression vector also incorporates stabilisation elements into the expressed RNA to increase the stability of the RNA.
- vector is used in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another. Vector includes plasmids, viruses, 5 retrotransposons and cosmids.
- the double stranded DNA is cloned into an expression vector suitable for expression in a mammalian cell.
- Methods which are well known to those skilled in the art can be used to construct expression vectors containing a sequence which encodes the RNA expression library. These methods include in vitro recombinant DNA techniques, synthetic 10 techniques and in vivo recombination or genetic recombination. Such techniques are described in Sambrook et al (1989) Molecular Cloning, A laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. and Asubel F M et al (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York N.Y.
- promoter refers to a single promoter sequence as well as to a 15 plurality (i.e., one or more) of promoter sequences which are operably linked to each other and to at least one DNA sequence of interest. Promoters consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis T. et al., Science 236:1237 (1987). Promoter elements have been isolated from a variety of eukaryotic sources including genes in plant, yeast, insect and mammalian cells and viruses. 20. The selection of a particular promoter depends on what cell type is to be used to express the DNA sequence of interest.
- the promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the site of transcription.
- the promoter may be constitutive, such as a promoter active under most environmental conditions or stages of development or the promoter may be inducible, and 25 respond to, for example, an extracellular stimulus.
- Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and are generally a few hundred nucleotides in length.
- the double stranded DNA is cloned into an expression vector under the control of a U6 snRNA, HI or T7 promoter. More preferably the double stranded DNA is cloned into an expression vector under the control of a U6 snRNA promoter.
- Synthesis of the second DNA strand may be achieved using second strand synthesis techniques well known to those of skill in the art for synthesizing a second strand of DNA from a first strand of DNA, for example utilizing a DNA polymerase such as AmpliTaq DNA polymerase (Perkin Elmer).
- Suitable techniques for second strand synthesis may be as set out in Sambrook et al (1989) Molecular Cloning, A laboratory Manual, Cold Spring Harbor Press, Plainview N.Y. and Asubel F M et al (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York N.Y.
- the present invention provides a method of preparing an expression vector, expression of which produces double stranded RNA (dsRNA), the method comprising:
- Transcription from the convergent promoters of two strands of the resident inserts results in the production of two small complementary RNAs that are capable of hybridising to form an siRNA with two to four base overhangs at their 3' ends.
- the expression vector produced according to the methods of the invention are useful in identifying the function of a gene or sequence of interest in an organism.
- the random sequence is about 19 to about 30 base pairs in length. More preferably the random sequence is from 19 to 25 base pairs in length. Most preferably the random sequence is 19 base pairs in length.
- the double stranded DNA is cloned into an expression vector between two convergent U6 snRNA, HI or T7 promoters. More preferably the double stranded DNA is cloned into an expression vector between two convergent U6 snRNA promoters.
- the random sequence of the first or second aspect of the present invention may be produced in a number of ways including synthetic generation by random insertion of nucleotides during synthesis, by use of an EST library or by random digestion of the genome of the organism of interest. Production of a library by random digestion of a genome may be of particular interest in analysing gene function in viral and other pathogens.
- Random digestion of a genome may be achieved by techniques known to those of skill in the art, such as DNAse I digestion.
- Synthetic sequences may be generated chemically according to known methods such as the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts. 22(20):1859-1862, e.g. using an automated synthesiser as described in Needham-VanDevanter et al (1984) Nucleic Acids Res., 12:6159- 6168.
- Purification of the molecule where necessary, is typically performed by either gel electrophoresis or by anion-exchange HPLC as described in Pearson and Regnier (1983) J. Chrom. 255:137-149.
- the sequence can be verified using the chemical degradation method of Maxam and Gilbert (1980) in Grossman and Moldave (eds.) Academic Press, New York, Methods in Enzymology 65:499-560.
- the expression vectors prepared according to the methods of the first or second aspect are used to transfect a host cell.
- the present invention provides a method for determining a function of a gene, the method comprising:
- the present invention provides a method for determining a function of a gene, the method comprising:
- the present invention provides an expression vector for use in suppressing expression of a target gene, the vector comprising a pair of convergent promoters and a DNA molecule positioned therebetween, the DNA molecule comprising a target-specific sequence flanked by two directional transcription terminators, the target-specific sequence comprising a sequence of at least 14 nucleotides having at least 90% identity to a segment of the target gene.
- siRNAs of the invention Delivery and transcription of the expression vectors of the present invention in a host cell provides an siRNA or hRNA specific for a target mRNA having complementarity with the target-specific sequence.
- the siRNAs of the invention have been shown to be effective modifiers of gene expression.
- the target-specific sequence is at least 19 base pairs in length. More preferably the target-specific sequence is 19 to about 30 base pairs in length. More preferably the target- specific sequence is from 19 to 25 base pairs in length. Most preferably the target-specific sequence is 19 base pairs in length.
- the target gene may be any gene of interest, the manipulation of which may be deemed desirable for any reason, by one of ordinary skill in the art.
- the target-specific sequence has at least 95% identity, and more preferably is identical, to a segment of the target gene.
- the expression vector is a retroviral expression vector.
- the expression vector encodes a selectable marker, for example an antibiotic resistance gene, for selection of cells transfected with the expression vector. More preferably the expression vector encodes the G418 selection marker.
- Transcription from the convergent promoters of two strands of the resident inserts results in the production of two small complementary RNAs that are capable of hybridising to form an siRNA with two to four base overhangs at their 3' ends.
- the convergent promoters are U6 snRNA, HI or T7 promoters. More preferably the convergent promoters are U6 snRNA promoters.
- the expression vector produced according to the methods of the invention are useful in identifying the function of a gene or sequence of interest in an organism.
- the present invention provides a method for determining a function of a target gene, the method comprising:
- the present invention provides methods for the identification of one or more functions of a nucleotide sequence in an organism.
- the methods of the invention selectively reduce, diminish or destroy the RNA encoded by the targeted coding sequence in order to render the RNA non-functional while the targeted gene in the host remains intact. These methods therefore employ a "knockdown" strategy to determine gene function instead of the traditional "knockout” methods.
- the invention is useful for the rapid identification of, for example, disease related genes which may be targeted for the treatment or prevention of disease.
- the methods of the present invention also have utility in identifying viral or pathogen-derived genes that play a major role in the susceptibility of cells to infection by viruses or pathogens.
- the expression vector is a retroviral expression vector.
- the. transfected cell is recovered and the double stranded DNA insert recovered or amplified by, for example, using the polymerase chain reaction, re-cloned and subjected to additional enrichment steps.
- the enriched insert is sequenced and used to identify potential target genes by, for example, homology searching, or utilised to capture the target mRNA.
- the expression vector encodes a selectable marker, for example an antibiotic resistance gene, for selection of cells transfected with the expression vector. More preferably the expression vector encodes the G418 selection marker.
- transfection refers to the introduction of a transgene, for example a vector, into a cell. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection or biolistics (i.e., particle bombardment). Transfection may be transient or stable transfection.
- stable transfection or "stably transfected” refers to the introduction and integration of a transgene into the genome of a transfected cell.
- transient transfection or “transiently transfected” refers to the introduction of one or more transgenes into a transfected cell in the absence of integration of the transgene into the genome of the host cell.
- gene of interest refers to any gene , the manipulation of which may be deemed desirable for any reason, by one of ordinary skill in the art.
- a shRNA or siRNA sequence is introduced into a cell in order to reduce the amount of RNA expressed by that genomic sequence.
- shRNA or siRNA it is desirable to express a sufficient amount of shRNA or siRNA such that substantially all the substrate RNA is cleaved. Such substantial abrogation of substrate RNA expression would facilitate the observation of the effect of depletion of gene function in the organism wherein the shRNA or siRNA is expressed. While desirable, complete elimination of the substrate RNA is not required by the methods of the invention.
- control cell includes a cell that is untransfected, has been mock transfected, or has been transfected with an "empty vector” such as an expression vector without the double stranded DNA insert.
- Host cells such as eukaryotic cells, harbouring the expression vectors described above also are provided by this invention.
- Suitable host cells include, but are not limited to, bacterial cells, rat cells, mouse cells and human cells.
- the methods of the invention are useful for determining the function of a gene or DNA sequence of interest in an organism by forward genetic approaches including observing the effects of reducing expression of the gene or DNA sequence in the organism or of a homologous gene or DNA sequence in another organism.
- data presented herein demonstrates that the function of the p53 or EGFP gene in HCT116 colon cancer cells or HEK 293 embryonic kidney cells respectively may be determined by siRNA or shRNA mediated cleavage of transcripts.
- the types of genetic selections that can be used in a forward genetic approach with a genome-wide RNAi library includes overcoming cell growth arrest by, for example, bypassing p53-mediated growth arrest and apoptosis; identifying new targets involved in chemotherapeutic drug resistance such as overcoming 5-FU-induced growth arrest, apoptosis and senescence; blocking activated signalling pathways, for example, identifying novel positive and negative regulators of signalling pathways implicated in cancer, such as the TGF ⁇ and Wnt pathways; elucidating resistance to viral and pathogen infection including genetic screens for genes that confer resistance to HIN infection or that interfere with the productive or latent phases of the viral life cycle or genetic screens for genes that interfere with the lifecycle of an intracellular parasite such as plasmodium; synthetic lethality screens to identify gene products whose inactivation leads to cell death, particularly in tumor cells deficient for either the p53 or pl6/Rb tumor suppression pathways; identifying genes involved in metastasis, for example using in vivo assays;
- the present invention provides a method of producing a library of D ⁇ A molecules wherein mR ⁇ A transcribed from the D ⁇ A molecules forms hairpin R ⁇ A (hR ⁇ A) molecules, the method comprising:
- step (ii) ligating hairpin D ⁇ A to the D ⁇ A fragments from step (i);
- step (iii) ligating a double stranded D ⁇ A adaptor to the D ⁇ A from step (ii), wherein the D ⁇ A adaptor includes a primer binding site;
- step (iv) denaturing the D ⁇ A from step (iii) to form a library of single D ⁇ A strands
- the present invention provides a method of preparing a library of expression vectors, expression of which produces double stranded RNA (dsRNA) molecules, the method comprising:
- step (ii) ligating a double stranded DNA adaptor to each end of the DNA fragments from step (i), wherein the sequence of the DNA adaptor comprises at least four consecutive adenosine nucleotides at the 3' end;
- step (iii) cloning the double stranded DNA from step (ii) into an expression vector between two convergent promoters.
- the library of double stranded DNA fragments is prepared by digestion of DNA.
- the DNA that is digested is preferably a gene, a genome or cDNA library.
- the digestion may be carried out using a range of enzymes well known in the field, however, it is preferred that the digestion is with DNAsel.
- the resulting double stranded DNA is preferably cloned into an expression vector under the control of a promoter selected from the group consisting of U6 snRNA, HI and T7, preferably a U6 snRNA promoter.
- the present invention provides a method of producing a library of DNA molecules wherein mRNA transcribed from the DNA molecules forms hairpin RNA (hRNA) mole ⁇ .ues, the method comprising:
- step (iii) allowing the cDNA from step (ii) to form a hairpin loop
- step (v) denaturing the DNA from step (iv) to form single stranded DNA
- step (vi) adding DNA polymerase to synthesize double stranded DNA thereby producing a library of double stranded DNA molecules.
- the enzyme in step (ii) is AMN reverse transcriptase.
- the double stranded D ⁇ A molecules are cloned into expression vectors under the control of a promoter selected from the group consisting of U6 snR ⁇ A, Hi and T7, preferably under the control of a U6 snR ⁇ A promoter.
- siRNAs that act through the R ⁇ Ai pathway allows for regulation of expression of genes and therapeutic applications to alleviate disease states resulting from expression of these genes.
- the present invention provides a method of inhibiting • expression of a target gene in a cell, the method comprising providing the cell with an expression vector according to the fifth aspect of the invention.
- the target gene may be a gene derived from a cell of the organism, a transgene, or a gene of a pathogen present in a cell of the organism, or remaining in the cell after infection by the pathogen.
- the cell maybe an animal or plant cell and may be isolated or form part of a complete organism.
- the expression vector of the fifth aspect may be provided to the organism by direct introduction, such as direct injection, or introduced by other means known to those of skill in the art including oral introduction or topical application.
- the expression vector may be introduced into a germ line or somatic cell, stem cell or other multipotent cell derived from the organism and re-introduced into the organism.
- the present invention may be used for treatment or prevention of a disease state resulting from expression of the target gene.
- Disease states include, but are not limited to, autoimmune diseases, inherited diseases, cancer, infection by a pathogen or overexpression of the target gene. Treatment would include prevention or amelioration of any symptom or clinical indication associated with the disease.
- Target genes include, but are not limited to, genes involved in chemotherapeutic drug resistance, apoptosis and senescence; genes implicated in cancer including genes involved in metastasis and genes responsible for tumorigenesis.
- the present invention also includes pharmaceutical compositions and formulations, which comprise at least one expression vector of the invention.
- the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
- the administration can be topical, pulmonary, oral or parenteral.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powders or oily bases, thickeners and the like may be necessary or desirable.
- composition and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules satchels or tablets.
- the expression vectors of the present invention can additionally be used to increase the susceptibility of tumour cells to anti-tumour therapies such as chemotherapy and radiation therapy.
- liposomes and other compositions containing (a) one or more expression vectors of the invention and (b) one or more chemotherapeutic agents which function by a non-hybridisation mechanism.
- chemotherapeutic agents include, but are not limited to, anticancer drugs such as taxol, daunorubicin, dacitinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-flurouracil, floxuridine, methotrexate, colchicine, vincristine, vinlastin, etoposide, cisplatin. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al eds., 1987, Rahway, N.J., pp 1206-1228.
- compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or diminution of the disease state is achieved. Optimal dosing schedules can be determined from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight and may be given daily, weekly, monthly or yearly.
- This template is composed of a primer binding site (TGTGGTGATTCGTCGAC), encompassing a Sail restriction enzyme site (underlined), a single deoxyribouridine base (bold), 19 nucleotides specific to human p53 (GACTCCAGTGGTAATCTAC) and a 21 base sequence capable of forming a stem loop (GTCGAGTCTCTTGAACTCGAC).
- the structure formed by the latter sequence is composed of six complementary bases flanking a loop sequence.
- the initial step in this methodology is the self-annealing of the internal stem loop structure (Step 1). This involves incubation of the oligonucleotide at 75 °C for 5 minutes followed by 37 °C for 20 minutes and 4 °C overnight.
- T4 • DNA polymerase was used to extend the complementary antisense strand (Step 2).
- the hairpin structure formed was then subjected to depurination of the deoxyribouridine (U) by uracil DNA glycosylase, which was then ⁇ -eliminated by piperidine treatment, resulting in the loss of the fragment 5' of the deoxyribouridine base (Step 3). Removal of this sequence exposes the primer-binding site.
- second strand synthesis was performed using a DNA polymerase capable of strand displacement (for example, Bst DNA polymerase) (Steps 4 and 5).
- the double-stranded DNA was digested with Sail and ligated to the appropriate vector (see below) (Step 6).
- the U6+1 promoter contained in pTZ(U6+l) was PCR-amplified using the following forward and reverse primers: 5'-GCGCCTCGAGATAGGGAATTCGAGCTCGGTA-3' and 5'-GCGCGGATCCTTGTAAACGACGGCCAGTGC-3'. Following digestion with Xhol and BamHI, this DNA fragment was ligated into the multiple cloning site of the retroviral vector pLXSN to produce pLXSN(U6+l). To test this vector system for expression of effective shRNAs, the insert encoding the EGFP-specific shRNA was cloned into the Sail site located downstream of the U6+1 promoter.
- a DNA primer (5'-GCGCCTGTTACCTCTAG-3') was annealed to the above oligonucleotide and second-strand synthesis performed using Klenow DNA polymerase. Following generation of double-stranded DNA, this fragment was digested with Sail and Xbal and ligated into an appropriate vector containing convergent RNA polymerase III promoters.
- convergent promoters drive the expression of short complementary RNAs, and there are no repeat sequences
- pLXSN retroviral vector to include convergent U6 snRNA and HI RNA polymerase III promoters ( Figure 6).
- the HI promoter region was PCR-amplified from pSilencer using the primers 5'-GCCTGCAGGATATTTGCATGTCGCTATGTTCTGG-3' and
- the oligonucleotides 5'-TCGACAAAAACGGCAAGCTGACCCTGAAGTTTTT-3' and 5'-CTCAGAAAAACTTCAGGGTCAGCTTGCCGTTTTTG-3' were annealed and cloned into the Sail and Xbal sites of pLXSNU6/Hl vector.
- the retroviral plasmid encoding GFPsiRNA (designated pLXSNU6/HlGFP) was transfected into Amphopack 293 packaging cells co- seeded with PG13 cells at a ratio of 10:1, respectively. Transfection efficiency approximated 40 %.
- VCM virus-containing medium
- the method described earlier for enzymatic generation of the second strand was performed and the DNA insert digested with Sail and Xbal and cloned between the U6 and HI convergent promoters in pLXSNU6/Hl ( Figure 7A).
- the resulting plasmid designated pLXSNU6 / Hlp53, was transfected into a 10:1 mixture of Amphopack 293 and PG13 packaging cells.
- the VCM was collected from these cells and used to infect HCT116 target cells.
- the infection efficiency approximated 63 %, and infected cells were subjected to G418 (500 ug/ml) selection.
- the pooled population was harvested 8 days after selection and ⁇ serially diluted to isolate single clones.
- HCT116 clones containing either pLXSNU6/Hl (vector alone) or pLXSNU ⁇ / Hlp53 were seeded at 5xl0 5 cells in a single well of a 6-well plate. The cells were allowed to recover for 24h and then transfected with varying concentrations of Dicer siRNA (6nM, 12nM and 60nM) or 60nM of a nonsense siRNA (Dharmacon) using Lipofectamine 2000.
- a total of 1 ⁇ mole of the above sequence (with 19 random nucleotides (N)) was synthesised using a special hand mix to ensure equimolar ratios of A, T, C and G (Integrated DNA Technologies, USA)534.
- a DNA primer (5'-GCGCCTGTTACCTCTAG-3') was annealed to this pool of oligonucleotides and second-strand extension performed using Klenow DNA polymerase. Following this extension step, the DNA was digested with Xhol and Xbal and then dephosphorylated using calf intestinal alkaline phosphatase to prevent the generation of concatemeric inserts in the final expression library (Figure 8A).
- the DNA inserts were gel-purified following electrophoresis on a non-denaturing 15% PAGE gel, excision of the 35 base pair fragments and extraction using the crush and soak method.
- the purified inserts were ligated in different insert to vector molar ratios (10:1 and 100:1) to 250ng of the pLXSNU6/Hl vector pre-digested with Sail and Xbal.
- the vector was not dephosphorylated.
- the ligation was treated with Sail and the ligated products transformed into highly competent DH5 bacterial cells.
- the transformed cells were either expanded as single clones or as liquid grown cells (Figure 8B).
- the convergent U6 promoter cassette indicated in Figure 9A was designed.
- the EGFP gene was used as a target.
- DualU6 containing convergent U6 promoters the primers 5'-GCG CAA GCT TAT-AGG GAA TTC GAG CTC GGT A-3', and
- DualU6GFP The oligonucleotides used to construct DualU6GFP were 5'-TCGACAAAAACGGCAAGCTGACCCTGAAGTTTTT-3' and 5'-CTAGAAAAACTTCAGGGTCAGCTTGCCGTTTTTG-3', while the following were used to construct DualU6p53: 5'-TCGACAAAAAGACTCCAGTGGTAATCTACTTTTT-3' and 5'-CTAGAAAAAGTAGATTACCACTGGAGTCTTTTTTTG-3'. These oligonucleotides were synthesised (Sigma Geriosys, Sydney, Australia), annealed and cloned into the Sail and Xbal sites of DualU6.
- RNA oligonucleotides used to form the siRNAs were synthesised by Dharmacon Research Inc (CO, USA) and the sequences were: GFP, 5'-CGGCAAGCUGACCCUGAAGdTdT (sense); P 53(siRNAl),
- RNA oligonucleotides were annealed with corresponding antisense strands as described (Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Nature 411(6836), 494-8).
- Mammalian cells used in this study included the human embryonic kidney cell line EcR293 (Invitrogen, CA, USA) and the human breast cancer cell line MDA MB 231.
- EcR293 cell line expressing the dEGFP gene has been described (Raponi, M., Dawes, I.W., and Arndt, G.M. (2000) Biotechniques 28, 840-844).
- EcR293 cells and their derivatives were maintained in DMEM containing 10% fetal calf serum supplemented with glutamine, streptomycin and penicillin.
- MDA MB 231 cells were grown in RPMI containing 10% fetal calf serum supplemented with glutamine.
- a U6 convergent expression vector containing a EGFP-specific insert (DualU ⁇ GFP) was constructed and co-transfected with the pEGFP-Nl plasmid and the lacZ expression vector pSV ⁇ into 293 embryonic kidney cells.
- Cells receiving DualU ⁇ GFP displayed a 40% reduction in cell fluorescence compared with cells transfected with the DualU ⁇ control vector.
- the DualU ⁇ GFP plasmid was delivered to 293 cells containing a stably integrated destabilised EGFP (dEGFP) transgene.
- dEGFP destabilised EGFP
- cells transfected with DualU ⁇ GFP displayed a reduction in dEGFP-mediated cell fluorescence with the level of reduction in fluorescence equal to that of the synthetic EGFP siRNA at 48h post-transfection.
- gene silencing via this vector displayed a 24h delay compared with a synthetic siRNA targeted to the same region of the dEGFP mRNA.
- DualU ⁇ GFP expression system in long term regulation of gene expression in mammalian cells, either the pDualU6GFP plasmid, or the pDualU ⁇ vector, was co-delivered with pREP7 (containing the marker conferring resistance to hygromycin) to HEK 293 cells expressing the dEGFP transgene.
- pREP7 containing the marker conferring resistance to hygromycin
- HEK 293 cells expressing the dEGFP transgene.
- cells were examined for dEGFP-mediated cell fluorescence.
- cells containing the DualU ⁇ GFP plasmid displayed a significant reduction in cell fluorescence compared with cells receiving the DualU ⁇ control vector. This result indicates that the convergent expression cassette described can be used to mediate long term regulation of gene expression in mammalian cells.
- the antibodies used for detection of specific proteins in the Western analysis included: GFP, mouse polyclonal (Clontech), PKR monoclonal (Cell Signaling), PKR phospho rabbit polyclonal (Cell Signaling), p53 mouse monoclonal (Oncogene Research Products) or ⁇ -actin mouse monoclonal (Sigma) antibodies.
- Secondary antibody detection was performed using either the goat anti-mouse horseradish peroxidase (HRP)-linked or the goat anti-rabbit HRP (SantaCruz), followed by visualisation using the luminol/ enhancer chemiluminescent substrate (Amersham Pharmacia Biotech, Piscataway, NJ).
- the gel illustrating this result shows the level of dEGFP mRNA and 18S rRNA in HEK 293 cells (containing an integrated dEGFP gene) transfected with DualU ⁇ , DualU ⁇ GFP or the GFP-specific siRNA.
- DualU ⁇ GFP produces siRNAs capable of mediating turnover of the target mRNA, an observation consistent with the mechanism of RNAi.
- the transcripts expressed from ' this plasmid were identified using northern blot analysis.
- RNA for RNA analysis was isolated using Trizol (Invitrogen, CA, USA) and immobilised onto nylon membrane (Invitrogen, CA, US), for detection using standard probe hybridisation.
- Trizol Invitrogen, CA, USA
- nylon membrane Invitrogen, CA, US
- the following oligonucleotides were end-labelled and hybridised to these membranes at 37°C for lh: 5'-TCGACAAAAACGGCAAGCTGACCCTGAAGTTTTT-3' or 5'-CTAGAAAAACTTCAGGGTCAGCTTGCCGTTTTTG-3'.
- Membranes were analysed using a phosphorimager (Molecular Dynamics, USA) and an ImageQuant software package (Molecular Dynamics, USA).
- the Dicer siRNA was utilised as a tool to determine if the observed suppression was Dicer-dependent (Hutvagner et al (2001) Science 293,834-838). 293 cells expressing the dEGFP transgene were transfected with DualU ⁇ GFP in the presence and' absence of the synthetic siRNA specific for Dicer. As shown in Figure 12, the Dicer siRNA completely reversed the reduction in cell fluorescence mediated by the EGFP-specific U ⁇ convergent plasmid.
- dsRNA greater than 30 base pairs in size induce a global response that results in activation of the double-stranded RNA-specific protein kinase PKR (Paddison, P., Caudy, A. A., and Hannon, G.J. (2002) Proc. Natl Acad. Sci. 99, 1443-1448).
- PKR protein kinase
- the U ⁇ convergent promoter system could be used to control the expression of endogenous genes in mammalian cells was determined.
- the TP53 gene that encodes the p53 tumor suppressor protein was chosen as a target.
- a U ⁇ convergent expression vector was constructed containing an insert encoding a p53-specific siRNA.
- the target site selected was identical to that reported earlier for synthetic p53-specific siRNAs (Brummelkamp, T.R., Bernards, R., and Agami, R. (2002) Science 296, 550-553).
- the p53-specific U ⁇ convergent expression plasmid, DualU6p53 was transfected into MDA MB 231 breast cancer and 293 cells and cells were harvested and analysed for p53 protein levels out to 120h post-transfection. Delivery of the DualU6p53 plasmid resulted in a significant and specific reduction of p53 protein.
- the gel illustrating this result shows the level of p53 and ⁇ -actin proteins in cells transfected with DualU ⁇ , DualU6p53 or p53-specific siRNAs. This result indicates that the U6 convergent promoter system can be used to effectively suppress the expression of endogenous genes through RNAi in mammalian cells.
- DualU ⁇ GFP expression vector can be used to regulate EGFP gene expression both in transient assays and stably selected pooled populations.
- endogenous p53 gene is suppressible by DualU6p53 in transiently transfected HEK 293 cells.
- pREP7 containing the hygromycin resistance gene
- HEK 293 cells containing the dEGFP transgene we also co-transfected these same cells with the DualU ⁇ GFP and pREP7.
- Clones containing pLXSNU6/Hl or pLXSNU6/Hlp53 were seeded at either 2.5 x 10 5 cells per well of a 6 well plate (to examine subGl and caspase activation) or 1 x 10 4 cells per well of a 96 well plate (for examining cell proliferation and viability).
- Cells were allowed to recover for 24 h and then treated with varying concentrations of 5-FU (lOOuM, 200uM and 400uM) for 24 h.
- 5-FU lOOuM, 200uM and 400uM
- cells were examined for cell cycle distribution using propidium iodide (PI) staining, induction of apoptosis using caspase activation assay and cell viability using the MTT cell proliferation assay ( Figure 13).
- PI propidium iodide
- Cells expressing the p53-specific siRNA showed- decreases in subGl cells and caspase activity compared with control cells ( Figure 13A and B).
- the cells suppressed for p53 protein levels using pLXSNU6/Hlp53 displayed increased cell survival in an MTT assay ( Figure 13C).
- Figure 13C Upon demonstration of a differential response of the clones containing either pLXSNU6/Hl or pLXSNU6/Hlp53 to 5-FU-induced apoptosis, cells from the latter are diluted in a larger background of cells containing pLXSNU6/Hl. These mixed cell populations are seeded at 2xl0 6 cells per T150 flask.
- the vector pLXSNU6/Hlp53 was diluted 1:10 3 and 1:10 4 in pLXSNU6/Hl and this DNA mix used to transfect a 7:1 mixture of Amphopack 293 and PG13 packaging cells.
- 2 x 10 6 AmphoPack 293 cells and 3 x 10 5 PG13 cells were seeded in 10 T75 culture flasks for both the 1:10 3 and 1:10 4 libraries.
- flasks were also established for pLXSNU6/Hl (vector control), pLXSNU6/Hlp53 (positive control), and pLXSNGFP (as a indicator of transfection efficiency).
- the cells were treated with 180 ⁇ M calcium phosphate containing 5 mM butyrate and 50 ⁇ M chloroquine with or without DNA.
- a total of 30 ⁇ g of reconstituted DNA (for example, 30 ng of pLXSNU6/Hlp53 plus 30ug of pLXSNU6/Hl for the 1:10 3 library) was delivered.
- the transfection solution was replaced with complete DMEM medium and cells allowed to recover for 24h. After this period, the media on the packaging cells was again replaced with 15 ml complete DMEM medium supplemented with ImM sodium py uvate, from which the VCM was collected after 16h.
- the VCM from 10 x T75 flasks were pooled, filtered through a 0.45 ⁇ M filter and combined with 5 ⁇ g/ml polybrene.
- This VCM was placed on 10 x T150 flask of HCT116 cells for 24 h, after which the VCM was replaced with McCoys5A medium.
- The'target HCT116 cells were initially seeded at 2.5 x 10 6 cells per T150 flasks 36 h prior to infection and a total of 10 flasks were used. The infection efficiency obtained using these conditions was at least 40%.
- the HCT116 cells reached 60% confluence. At this point, the media was changed to McCoys5A containing 400 ⁇ M 5-FU.
- the cells were exposed to 5-FU for 16h, after which they were harvested, pooled and re-seeded at 3.5 x 10 6 cells per T150 flask. Following 10 days of growth in the absence of 5-FU, cells were re-exposed to 400uM 5-FU for l ⁇ h, harvested and seeded at 4 x 10 5 cells per 150mm dish. These cells are allowed to form colonies over 10 to 14 days at which point independent colonies are characterised for the presence of pLXSNU6/Hl or pLXSNU6/Hlp53 proviral DNA. This analysis indicates that selection in the presence of 5-FU results in a significant enrichment in resistant colonies harbouring the pLXSNU6/Hlp53 vector. This result would suggest that random RNAi expression libraries, based around the convergent transcription expression cassettes described in this application, can be used in forward genetic selections in mammalian cells to identify relevant genetic inhibitors (and therefore target genes). EXAMPLE 9
- retroviral expression vectors can be used for the expression of genetic inhibitors, such as shRNAs, and the over-expression of specific genes.
- genetic inhibitors such as shRNAs
- retroviral expression vectors Figure 15
- the vector pLXSNU6/Hl has been described earlier and contains the convergent U6-H1 promoter cassette in the multiple cloning site of pLXSN ( Figure 15 A).
- the 5'LTR remains transcriptionally active upon proviral DNA integration and the U6-H1 cassette is located between the 5' and 3'LTRs.
- This vector also contains a NeoR gene that permits selection of cells containing the integrated retroviral vector using the agent G418.
- One alternative vector system illustrated in Figure 15B contains the U6-H1 expression cassette located in the 3'LTR. To construct this vector, the 3'LTR was first removed from pLXSN and subcloned into pSP72 as a Afllll-EcoRI fragment to produce pSP72LTR. The U ⁇ -Hl cassette was then PCR-amplified using the following PCR primers: 5'-GCGCTAGCCGTTAACTCGAGGATCCAAGGTCG-3' and 5'-GCGCTAGCCACAGCCGGATCCTTGTAAACGAC-3'.
- the PCR amplicon is digested with Nhel and subcloned into the unique Nhel site located within the 3' LTR in pSP72LTR. Following insertion of these sequences, the 3'LTR containing the U ⁇ -Hl convergent promoters are subcloned as an Afllll-EcoRI fragment back into pLXSN to replace the wild type 3'LTR. The end result is the positioning of the U ⁇ -Hl convergent promoter cassette in the 3'LTR region. Upon infection and proviral integration this cassette will be copied as part of the 5'LTR resulting in two copies of the cassette, one of which will be located upstream of the transcription start site in the 5'LTR.
- FIG. 15C The other form of the retroviral expression vector is shown in Figure 15C.
- a self-inactivating retroviral construct designated pQCXIN
- pQCXIN a self-inactivating retroviral construct
- the Xbal site located in the 3'LTR is removed by Xbal digestion, end-filling and re-ligation.
- the U ⁇ -Hl fragment is PCR-amplified using the following PCR primers: 5'-GCGCTAGCCGTTAACTCGAGGATCCAAGGTCG-3' and 5'-GCGCTCGAGCACAGCCGGATCCTTGTAAACGAC-3'.
- the DNA fragment is then digested with Xhol and subcloned into the unique Sail site located in the 3'LTR.
- the EGFP open reading frame (including a Kozak consensus sequence) is PCR-amplified from pEGFP-Nl using the following PCR primers:- 5'-GCAGTCGACGGTACCGCGGGCCCGGTCGC-3' and
- RNAi expression libraries that contain dsRNA genetic inhibitors for each of the expressed genes of any genome including mammalian cells. These same libraries also have utility for identifying both host genes and viral or pathogen-derived genes that play a major role in the susceptibility of cells to infection by viruses and pathogens.
- the described methods can be modified to construct RNAi expression libraries restricted to a specific viral or pathogen genome or to a limited number of targets genes. The latter application is particularly relevant for probing gene function of up- or down-regulated genes identified in large-scale microarray or subtractive hybridisation experiments where only a subset of genes is implicated in the phenotype under investigation.
- Figure 16 summarises the strategy for constructing target gene(s) and genome-specific shRNA and siRNA expression libraries.
- the target gene(s) or viral or pathogenic genome is treated with DNAsel to fragment the starting DNA into 19- 29 bp fragments ( Figure 16 A).
- the pool of DNA fragments is ligated to a universal hairpin sequence and all DNA fragments containing a single hairpin linker are isolated ( Figure 16B).
- a dsDNA adaptor (containing a primer- binding site) is then ligated to the end of these DNAs (that does not contain the hairpin linker) and all fragments having a single hairpin linker and dsDNA adaptor are isolated. ( Figure 16C).
- RNAi libraries specific for the expressed RNA population in specific cell types or tissues.
- An outline of this approach is shown in Figure 17.
- the phenomenon of self priming during cDNA synthesis is used.
- the 3' termini of single-stranded cDNA can form hairpin structures due to concomitant degradation of the template RNA (Steps 1 and 2).
- Transient formation of these hairpin structures provides a priming point for reverse transcriptase to initiate second strand synthesis (Step 3).
- This intramolecular dsDNA molecule (Step 4) is converted into an intermolecular dsDNA fragment by second strand synthesis using high temperature (to denature the template) and thermostable DNA polymerase (Step 5).
- the end result is the production of DNA inserts encoding long inverted repeat RNA sequences capable of forming dsRNA.
- long dsRNAs these could be targeted for maintenance within the nucleus using 5' decapping recognition sequences and a cis-acting hammerhead ribozyme.
- the resulting DNA fragments could be subjected to the method described in Figure 16 to generate siRNA or shRNA expression libraries. All of these libraries would be specific for the expressed gene set contained within a certain cell type or tissues.
- Genetic selection assays can be used to screen a HTV-specific RNAi expression library for effective RNAi construct that confer resistance to HIV infection or that interfere with the productive or latent phases of the viral life cycle.
- Such genetic selection assays using genetic suppressor element libraries have been described (Dunn, S.J., Park, S.W., Sharma, V., Raghu, G., Simone, J.M., Tavassoli, R., Young, L.M., Ortega, M.A., Pan, C-H., Alegre, G.J., Roninson, LB., Lipkina, G., Dayn, A., and Holzmayer, T.A. (1999) Gene Therapy 6, 130-137) and are outlined in Figure 18.
- an effective shR ⁇ A construct that interferes with productive infection can be identified by enriching for cells exhibiting the CD4-positive and p24-negative phenotype using FACs.
- FACs FACs
- the system described provides a novel alternative expression modality to shR ⁇ A-expressing plasmids for gene silencing in mammalian cells.
- the convergent promoter system also provides a basis for generating randomised R ⁇ Ai libraries in which random double- stranded D ⁇ A oligonucleotides can be introduced between the convergent U6 promoters.
- the expansion of this design to include two different R ⁇ A polymerase III promoters in opposing orientations, or combinations of R ⁇ A polymerase II and /or III promoters, with random oligonucleotide sequences between the convergent promoters, would produce a randomised R ⁇ Ai library expressing functional siRNAs in mammalian cells and containing no inverted repeat sequences.
- R ⁇ Ai libraries Such genome-wide R ⁇ Ai libraries would be useful for performing forward genetic screens similar to those reported using randomised ribozyme libraries (Kawasaki, H., Onuki, R., Suyama, E. and Taira, K. (2002) Nature Biotech 20:376- 380) and universal peptide libraries (Xu, X., Leo, C, Jang, Y., Chan, E., Padilla, D., Huang, B.C.B., Lin, T., Gururaja, T., Hitoshi, Y., Lorens, J.B., Anderson, D.C., Sikic, B., Luo, Y., Payan, D.G. and Nolan, G.P.
- RNAi libraries in forward genetic approaches in mammalian cells would be the identification of 21 bases of complete sequence complementarity to the intracellular target RNA that is linked to the modified cellular phenotype. This length of sequence conservation could be used to more effectively identify candidate genes using homology-based search tools. In addition, these sequences could be chemically synthesised and used as tools for further validation of the identified targets or as potential therapeutics.
- Hutvagner et al A cellular function for the RNA-interference enzyme dicer in the maturation of the let-7 small temporal RNA. (2001)Science 293: 834-838.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- AIDS & HIV (AREA)
- Crystallography & Structural Chemistry (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/526,475 US20110098200A1 (en) | 2002-09-04 | 2003-09-04 | Methods using dsdna to mediate rna interference (rnai) |
| JP2004533057A JP2005537015A (ja) | 2002-09-04 | 2003-09-04 | RNA干渉(RNAi)を媒介するためにdsDNAを使用する方法 |
| CA002501065A CA2501065A1 (en) | 2002-09-04 | 2003-09-04 | Methods using dsdna to mediate rna interference (rnai) |
| AU2003257256A AU2003257256A1 (en) | 2002-09-04 | 2003-09-04 | METHODS USING dsDNA TO MEDIATE RNA INTERFERENCE (RNAi) |
| EP03793475A EP1546402A4 (en) | 2002-09-04 | 2003-09-04 | METHODS OF USING DNADS IN INTERFERENT RNA MEDIATION (RNAi) |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2002951224A AU2002951224A0 (en) | 2002-09-04 | 2002-09-04 | Rnai library |
| AU2002951224 | 2002-09-04 | ||
| AU2003901418A AU2003901418A0 (en) | 2003-03-26 | 2003-03-26 | Sirna |
| AU2003901418 | 2003-03-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2004022777A1 true WO2004022777A1 (en) | 2004-03-18 |
Family
ID=31979112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2003/001142 Ceased WO2004022777A1 (en) | 2002-09-04 | 2003-09-04 | METHODS USING dsDNA TO MEDIATE RNA INTERFERENCE (RNAi) |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20110098200A1 (https=) |
| EP (1) | EP1546402A4 (https=) |
| JP (1) | JP2005537015A (https=) |
| CA (1) | CA2501065A1 (https=) |
| WO (1) | WO2004022777A1 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005111219A1 (en) * | 2004-04-16 | 2005-11-24 | University Of Washington | METHODS AND VECTORS FOR EXPRESSING siRNA |
| EP1672064A4 (en) * | 2003-09-22 | 2006-12-20 | Riken | EFFICIENT METHOD FOR GENERATING AN INVERTED REPEAT DNA STRUCTURE |
| WO2009071722A1 (es) * | 2007-12-07 | 2009-06-11 | Newbiotechnic, S.A. | MÉTODOS Y KITS PARA LA PREPARACIÓN DE GENOTECAS DE siRNAs ESPECÍFICAS DE UN TRANSCRIPTOMA MEDIANTE TRANSCRIPCIÓN CONVERGENTE |
| US7982105B2 (en) | 2005-12-19 | 2011-07-19 | Monsanto Technology Llc | Transgenic corn seed with enhanced free lysine |
| WO2012114111A1 (en) * | 2011-02-24 | 2012-08-30 | Isis Innovation Ltd | Gene silencing |
| CN101633930B (zh) * | 2009-06-11 | 2012-11-07 | 陕西师范大学 | 小干扰rna快速筛选的载体及其构建方法和应用 |
| US8318689B2 (en) | 2001-11-09 | 2012-11-27 | Centre National De La Recherche Scientifique | SiRNA-based cancer treatment |
| US9381208B2 (en) | 2006-08-08 | 2016-07-05 | Rheinische Friedrich-Wilhelms-Universität | Structure and use of 5′ phosphate oligonucleotides |
| US9399658B2 (en) | 2011-03-28 | 2016-07-26 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| US9738680B2 (en) | 2008-05-21 | 2017-08-22 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US10059943B2 (en) | 2012-09-27 | 2018-08-28 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013159109A1 (en) * | 2012-04-20 | 2013-10-24 | Isis Pharmaceuticals, Inc. | Modulation of hepatitis b virus (hbv) expression |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000063397A2 (en) * | 1999-04-20 | 2000-10-26 | Aventis Cropscience N.V. | Methods for delivering inhibitory rna to plants and applications thereof |
| EP1229134A2 (en) * | 2001-01-31 | 2002-08-07 | Nucleonics, Inc | Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell |
| WO2003046186A1 (fr) * | 2001-11-28 | 2003-06-05 | Toudai Tlo, Ltd. | Systeme d'expression d'arnsi et procede de production de cellule knockdown a gene fonctionnel ou analogue utilisant ce systeme |
| WO2003046173A1 (en) * | 2001-11-28 | 2003-06-05 | Center For Advanced Science And Technology Incubation, Ltd. | siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE-KNOCKDOWN CELLS AND THE LIKE USING THE SAME |
-
2003
- 2003-09-04 WO PCT/AU2003/001142 patent/WO2004022777A1/en not_active Ceased
- 2003-09-04 US US10/526,475 patent/US20110098200A1/en not_active Abandoned
- 2003-09-04 CA CA002501065A patent/CA2501065A1/en not_active Abandoned
- 2003-09-04 EP EP03793475A patent/EP1546402A4/en not_active Withdrawn
- 2003-09-04 JP JP2004533057A patent/JP2005537015A/ja active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000063397A2 (en) * | 1999-04-20 | 2000-10-26 | Aventis Cropscience N.V. | Methods for delivering inhibitory rna to plants and applications thereof |
| EP1229134A2 (en) * | 2001-01-31 | 2002-08-07 | Nucleonics, Inc | Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell |
| WO2003046186A1 (fr) * | 2001-11-28 | 2003-06-05 | Toudai Tlo, Ltd. | Systeme d'expression d'arnsi et procede de production de cellule knockdown a gene fonctionnel ou analogue utilisant ce systeme |
| WO2003046173A1 (en) * | 2001-11-28 | 2003-06-05 | Center For Advanced Science And Technology Incubation, Ltd. | siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE-KNOCKDOWN CELLS AND THE LIKE USING THE SAME |
Non-Patent Citations (4)
| Title |
|---|
| BRUMMELKAMP T.R., BERNARDS R., AGAMI R.: "A system for stable expression of short interfering RNAs in mammalian cells", SCIENCE, vol. 269, no. 5567, 19 April 2002 (2002-04-19), pages 550 - 553, XP002225638 * |
| MORRIS J.C. ET AL.: "Glycolysis modulates trypanosome glycoprotein expression as revealed by an RNAi library", THE EMBO JOURNAL, vol. 21, no. 17, 2 September 2002 (2002-09-02), pages 4429 - 4438, XP002972637 * |
| See also references of EP1546402A4 * |
| WANG Z. ET AL.: "Inhibition of trypanosoma brucei gene expression by RNA interference using an integratable vector with opposing T7 promoters", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 275, no. 51, 2000, pages 40174 - 40179, XP002964702 * |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8318689B2 (en) | 2001-11-09 | 2012-11-27 | Centre National De La Recherche Scientifique | SiRNA-based cancer treatment |
| EP1672064A4 (en) * | 2003-09-22 | 2006-12-20 | Riken | EFFICIENT METHOD FOR GENERATING AN INVERTED REPEAT DNA STRUCTURE |
| WO2005111219A1 (en) * | 2004-04-16 | 2005-11-24 | University Of Washington | METHODS AND VECTORS FOR EXPRESSING siRNA |
| US7982105B2 (en) | 2005-12-19 | 2011-07-19 | Monsanto Technology Llc | Transgenic corn seed with enhanced free lysine |
| US9381208B2 (en) | 2006-08-08 | 2016-07-05 | Rheinische Friedrich-Wilhelms-Universität | Structure and use of 5′ phosphate oligonucleotides |
| US10238682B2 (en) | 2006-08-08 | 2019-03-26 | Rheinische Friedrich-Wilhelms-Universität Bonn | Structure and use of 5′ phosphate oligonucleotides |
| WO2009071722A1 (es) * | 2007-12-07 | 2009-06-11 | Newbiotechnic, S.A. | MÉTODOS Y KITS PARA LA PREPARACIÓN DE GENOTECAS DE siRNAs ESPECÍFICAS DE UN TRANSCRIPTOMA MEDIANTE TRANSCRIPCIÓN CONVERGENTE |
| US10196638B2 (en) | 2008-05-21 | 2019-02-05 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US9738680B2 (en) | 2008-05-21 | 2017-08-22 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| US10036021B2 (en) | 2008-05-21 | 2018-07-31 | Rheinische Friedrich-Wilhelms-Universität Bonn | 5′ triphosphate oligonucleotide with blunt end and uses thereof |
| CN101633930B (zh) * | 2009-06-11 | 2012-11-07 | 陕西师范大学 | 小干扰rna快速筛选的载体及其构建方法和应用 |
| WO2012114111A1 (en) * | 2011-02-24 | 2012-08-30 | Isis Innovation Ltd | Gene silencing |
| US9399658B2 (en) | 2011-03-28 | 2016-07-26 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| US9896689B2 (en) | 2011-03-28 | 2018-02-20 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| US10072262B2 (en) | 2012-09-27 | 2018-09-11 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
| US10059943B2 (en) | 2012-09-27 | 2018-08-28 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
| US11142763B2 (en) | 2012-09-27 | 2021-10-12 | Rheinische Friedrich-Wilhelms-Universität Bonn | RIG-I ligands and methods for producing them |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1546402A1 (en) | 2005-06-29 |
| JP2005537015A (ja) | 2005-12-08 |
| CA2501065A1 (en) | 2004-03-18 |
| US20110098200A1 (en) | 2011-04-28 |
| EP1546402A4 (en) | 2006-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2003209128B2 (en) | Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules | |
| US8513401B2 (en) | Double stranded nucleic acid targeting low copy promoter-specific RNA | |
| US20040248299A1 (en) | RNA interference | |
| WO2004078950A2 (en) | METHODS AND COMPOSITIONS FOR SELECTIVE RNAi MEDIATED INHIBITION OF GENE EXPRESSION IN MAMMAL CELLS | |
| US20110098200A1 (en) | Methods using dsdna to mediate rna interference (rnai) | |
| JP2005537015A5 (https=) | ||
| WO2003091433A1 (en) | EXPRESSION SYSTEMS FOR STEM LOOP RNA MOLECULE HAVING RNAi EFFECT | |
| AU2003257934A1 (en) | Methods and kits for synthesis of sirna expression cassettes | |
| WO2006044663A2 (en) | THIO-siRNA APTAMERS | |
| US20070123485A1 (en) | Universal target sequences for siRNA gene silencing | |
| AU2003257256A1 (en) | METHODS USING dsDNA TO MEDIATE RNA INTERFERENCE (RNAi) | |
| Xu et al. | Epigenetic modulation of gene expression in mammalian cells | |
| WO2004031201A2 (en) | Systems and methods for selection and design of short interfering rna | |
| Class et al. | Patent application title: METHODS AND KITS FOR SYNTHESIS OF siRNA EXPRESSION CASSETTES Inventors: John J. Rossi (Rancho Cucamonga, CA, US) Daniela Castanotto (Altadena, CA, US) | |
| Zhang | Biochemistry and modeling of human Dicer, a key protein involved in RNA interference | |
| Lugongolo | Using Sodium Bisulphite Treatment and PCR to Construct Mammalian Anti-HIV-1 Long Hairpin RNA Expression Cassettes | |
| Hannon | Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2501065 Country of ref document: CA Ref document number: 2003257256 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004533057 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003793475 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003793475 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10526475 Country of ref document: US |