WO2004020664A2 - Polymorphous microsatellite loci in genes for pre-diagnostic purposes - Google Patents

Abstract

The invention relates to a method for typifying genes comprising at least one microsatellite locus, a method for determining markers in genes comprising microsatellite loci regarding the predisposition to diseases, and a method for prediagnosing diseases that are associated with genes comprising one or several microsatellite loci.

Description

 Polymorphic microsatellite loci in genes for prediagnostics

The present invention relates to a typing method for genes which have at least one microsatellite locus, a method for determining markers in genes which contain microsatellite loci with regard to the predisposition of diseases and a ner method for pradiagnostics of diseases which are associated with genes which have one or more microsatellite loci.

Genetic analyzes are mostly aimed at DΝA variants within populations or families. Microsatellites are common candidates for such investigations. However, it was assumed that they occur on average approximately every 10 to 50 kbp in DNA and only rarely within genes (cf., for example, Schlötterer 2000).

For many genes that are associated with diseases, no or only a few polymorphisms are known and these usually do not allow fast (i.e. efficient) typing. An example of this are the degenerative diseases of the nervous system in humans and animals, grouped under the name Transmissible Spongiform Encephalopathies (TSE), which are caused by an unusual type of pathogen. Pathogens of such encephalopathies, e.g. scrapie (sheep, disease known for over 250 years), bovine spongiform encephalopathy (BSE; cattle), Creutzfeldt-Jakob disease (CJD; human) or related diseases contain essentially no nucleic acids (neither DNA nor RNA ), but rather have an infectious character due to their protein component. This type of pathogen was given the name "Prion" (proteinaceous infectious particles, Prusiner 1982).

An incubation period of several months to a few years with subsequent clinical symptoms, for example signs of, is characteristic of TSE diseases Restlessness, movement disorders, such as a trot-like walk on the north legs in sheep. In the case of scrapie, there are also sensitivity disorders (severe itching, which leads to damage to the fleece by rubbing). The physical condition of infected animals or of CJD patients deteriorates dramatically until after a few weeks they are no longer able to eat.

TSE diseases can be transmitted horizontally from animal to animal. Injection of an extract from the brain of a diseased animal into a healthy animal leads to infection with subsequent manifestation of the typical clinical symptoms. In the case of scrapie, the fact that nucleic acids can have no significant significance for the infection was demonstrated by experiments with scrapie fir extracts which remained infectious, even though they had previously been treated with UV light and with short-wave ionizing radiation. This regularly damages or destroys nucleic acids (Prusiner 2000). Based on these and similar experiments, other hypotheses regarding the nature of the pathogen of TSE have been pushed into the background, e.g. the virino hypothesis (Bruce and Dickinson 1987), which states that the actual pathogen is a nucleic acid that is only included by the PrP ^Sc . This also applies to the other assumption (e.g. Dron and Manuelidis 1996) that conventional viruses play a role or that an altered gene expression may be the cause.

The gene coding for the Pάon protein (PrP gene) was found in the genome of all examined mammals. Its product, the cellular Pdon protein (PrP ^c ), is expressed especially in nerve cells, but also in cells of the placenta. So-called. "Knock-out" mice, in which the PrP gene was genetically eliminated or switched off, showed no phenotypic finding after injection of infectious material (Büeler et al. 1992, 1993). The function of the PrP (e.g. Cu transport, Signal transmission) has not yet been finally clarified.

TSE is probably transmitted by an isoform of the normal cell-specific PrP ^c , which is referred to as PrP ^Sc (Prusiner 1998). The two forms differ in their conformation, i.e. in the way they are spatially folded. Fourier transform infrared spectroscopy with highly purified PrP ^c indicated a high proportion of α-helix, whereas PrP ^Sc , i.e. the infectious form, a large proportion of ß-sheet Structure (Pan et al. 1993, Caughey et al. 1991, Gasset et al. 1993). The PrP ^Sc can multiply in the host animal by catalyzing the conformational reversal from PrP ^c to PrP ^Sc and triggering a cascade with domino effect. This results in PrP ^Sc capable of agglomeration, which cannot be broken down by proteinase K (resistance to proteases). As a result, amyloid-like deposits form. The pathogenicity of the pathogen is due to the disruption and impairment of the nerve tissue.

Overall, considerable efforts have been made in the prior art to gain knowledge about the structure and function of the PrP gene or PrP protein in animals and humans. For example, the sheep's PrP gene was developed in 1998 by Lee et al. sequenced. The 31 412 bp sequence is stored in GenBank under the accession number U67922. The PrP gene of the sheep (FIG. 2) contains 3 exons with lengths of 52, 98 and 4 028 bp and 2 introns (2 421 and 14 031 bp). In addition, the database entry also comprises a region of 5,665 bp 5'-wards of exon 1 and a 3'-sided region of 5,117 bp.

The 5 ^C -UTR of the RNA encoded by the ovine PrP gene is encoded by exons 1, 2 and 3 and consists of a total of 160 bp (FIG. 3). The 771 bp DNA section that is translated (Open Reading Frame, ORF) is located in exon 3 and encodes 256 amino acids. Exon 3 also encodes the sequence of the 3'-UTR. The 3'-UTR of the ovine PrP mRNA with 3246 bp is much longer than the z. B of humans and mice (Lee et al. 1998) because it contains repetitive elements: a BovB (LINE, Long Interspersed Element), a Bov-tA2 / -tA3 (SINE, Short Interspersed Element) and the Mariner Element ( Lee et al. 1998).

The protein PrP in sheep consists of 256 amino acids, including the 24 amino acid signal peptide. The 5 repetitions of a motif mostly comprising 8 amino acids (octapeptide) from position 54 (Fig. 4) are striking.

At least 11 polymorphic positions in the ovine PrP gene are known in the prior art (Table 1). In all of the animals examined, only one deviation from the wild type was found, i.e. h a mutated position. Since the amino acid glycine at position 171 can be substituted by both arginine and histidine, there are a total of 12 different allelic variants of the ovine PrP gene. TSE can only be transferred if there is homology between the PrP of the donor and the PrP of the host, i.e. the amino acid sequences have a minimum correspondence (Wilkens 1997). In this context, one speaks in the case of transfers between species of “species barrier” and in the case of transfers within one species of “polymorphism barrier”. The genetic predisposition therefore plays an important role in the transmission of the disease and its pathogenesis (see also Manson et al. 2000). Pronounced effects of DNA variants within the PrP gene were found in humans in Gerstmann-Sträussler-Scheinker syndrome (Hsiao et al. 1989) and hereditary Creutzfeld-Jakob disease (Palmer et al. 1991).

Three of the 11 polymorphic positions in sheep PrP (codon 136: valine or alanine, codon 154: histidine or airginine and codon 171: glutamine or histidine or arginine) were included in the study of associations with scrapie incubation time (Belt et al. 1995 , Hunter et al. 1996). A combination of 3 letters is used to describe the haplotypes (e.g. VRQ: valine (V) at position 136, arginine (R) at position 154 and glutamine (Q) at position 171). Since only one position compared to the wild type was found to be mutated, a total of 5 haplotypes with the following names appear: VRQ, ARQ (wild type), ARH, AHQ and ARR.

Due to the genotyping of numerous animals suffering from scrapie from different breeds in different countries, it is assumed that the haplotypes VRQ and ARQ are associated with an increased susceptibility to scrapie. In contrast, animals with the PrP ARR / ARR genotype, with the exception of one case in Japan, showed no signs of scrapie disease. The rarer haplotypes AHQ and ARH are classified as a middle range in terms of scrapie susceptibility.

By combining the 5 haplotypes mentioned above, 15 different genotypes are obtained. The Scottish "Scrapie Information Group" (Dawson et al. 1998) divided these 15 genotypes into 5 different risk groups (Rl to R5) taking into account the breed (Tab. 2). The frequencies of the ORF variants in the PrP gene in 15 races were determined by Drögemüller et al. (2001). The observed variants of the PrP gene were highly race-specific. So came z. B. in the Texel breed with the exception of AHQ / AHQ all 15 genotypes before, while in some breeds only two or three genotypes were observed. In the breeds Deutsches Weißkopf, Deutsches Schwarzkopf and Bleu du Maine, more than 50% of the animals had the genotype ARR / ARR. This genotype was not present in many breeds, such as Merinoland and Gotiand. The ARQ / AHQ genotype, which occurs relatively frequently in these breeds, was not observed in the breeds Deutsches Weißkopf, Deutsches Schwarzkopf and Bleu du Maine.

While evidence of a connection between disease incidence and ORF polymorphisms could be found in sheep, these do not fully explain the scrapie distribution and breed-specific differences (O'Doherty et al. 2000). On the other hand, in the case of BSE (cattle), no (Hunter et al. 1994) or only slight (Neibergs et al. 1994) relationships between PrP polymorphisms and the BSE incidence have been shown. No amino acid substitutions were found in the bovine PrP, and a silent mutation and a variable repeat motif encoding an octapeptide in the PrP are the only known changes in the bovine PrP gene so far.

As previously stated, the genotype is of paramount importance for the risk of infection with TSE. This results in the need to determine the genotype in animals and humans at an early stage in order to assess the risk of infection. In the case of animal breeding, the division of the genotypes into risk classes (Tab. 2) forms the basis for breeding programs. For animal breeding, animals with the resistant genotype ARR / AR are to be bred with gradual elimination of PrP alleles associated with a very high scrapie susceptibility (Drögemüller and DisÜ 2001).

With the investigation of the genetic predisposition to disease risk for sheep with certain genotypes or haplotypes of the PrP gene located on chromosome 13, a possibility for breeding measures, such as selection decisions, was created. Three closely coupled polymorphisms in codons 136, 154 and 171 with 5 Known haplotype forms (VRQ, ARQ, AHQ, ARH, ARR) show a close relationship to the disease rate (incubation period) with scrapie (Dawson et al. 1998). However, the examination in the PrP gene at the corresponding positions requires complex sequencing, the cost of which in 2001 in Germany was around DM 50 per animal.

According to the prior art, genotyping in animals and humans is carried out by sequencing, a method which is relatively expensive and time-consuming. The object of the present invention is now to provide methods which permit simpler, faster and, in particular, more cost-effective genotyping in humans and animals. Furthermore, it is an object of the present invention to provide methods which make it possible to deal with diseases, e.g. TSE, to find related gene markers for susceptibility to such diseases and to use them for quick and inexpensive prediagnostics.

These objects are achieved by the embodiments of the present invention characterized in the claims.

In particular, from one aspect of the present invention, there is provided a method of typing a gene having one or more polymorphic microsatellite loci in an individual, comprising the steps of:

(a) Amplifying at least one DNA region of the gene to be typed by PCR with primers selected according to the size of the DNA region, the DNA region containing at least one polymorphic microsatellite locus and serving as a template a sample of the individual containing a DNA which comprises at least a portion of the gene with the polymorphic microsatellite locus / loci, and

(b) determining the length of the amplificate (s) from step (a).

The genotyping method according to the invention is based on the fact known per se that in the genome of eukaryotes, sections occur which are comparatively short and consist of sequence motifs repeated several times. The number of repetitions (also known as "Repeats") of the motif can differ from individual to individual in these sections labeled "microsatellites". The number of repetitions therefore also changes the length of the respective microsatellite locus. For a certain species, the number of sequence motif repetitions and thus the length of the microsatellite locus between individuals or races is different, the microsatellite locus is referred to as "polymorphic". Therefore, in order to use microsatellite loci for the typing of individual genes, it is first necessary for the applicability of the typing method according to the invention that the typing method to be typed, ie the gene to be analyzed for belonging to a group with regard to a certain property has at least one microsatellite locus, advantageously a plurality of microsatellite loci, the length of which differs / differs between different individuals of a species differentiate, ie is / are polymorphic.

In the first step of the genotyping method according to the invention, the length and thus indirectly the number of repetitions of the sequence motif of the respective polymorphic microsatellite locus is determined. For this purpose, according to the invention, a section or region of the DNA containing the gene to be typified, which comprises the microsatellite locus to be analyzed, is amplified for each microsatellite locus by means of PCR, i.e. amplified.

Of course, it is to be assumed that a sample of the individual in question contains a corresponding DNA which comprises at least a section of the gene to be typed with the polymorphic microsatellite locus or loci.

The amplification is carried out according to the invention by PCR (“polymerase chain reaction”), using selected primers (short DNA oligonucleotides as starter molecules) according to the DNA section or region to be reproduced. The technique of PCR is well known to a person skilled in the art and is described, for example, in Griffin and Griffin 2001, the disclosure content of which in this regard is fully included in the present invention. With this procedure, the sample of the individual already set out above serves as a template, specifically the DNA contained therein. Amplification by means of PCR has the advantages which are characteristic of this method, in particular a high speed and the fact that even the smallest amounts of sample DNA are required, ultimately a single DNA molecule containing the corresponding section of the gene is sufficient.

In general, all DNA-containing materials of the individual concerned can be used as sample sources. These include, for example, blood, serum, secretions, such as sweat, ejaculate, etc., synovial fluid, amniotic fluid, excrement, cerebrospinal fluid, etc. However, it is also possible to use individual cells or fragments thereof, for example individual skin cells, hair root cells, which are preferably attached to torn or -fallen hair, etc. can be used.

The expression “gene which has one or more microsatellite loci” means that the section of the genome in question which contains the gene to be typed contains at least one microsatellite locus, this section in particular exon and intron regions of the gene and those associated with the gene , in particular inherited with it, 5 'and 3' regions, for example those regions which are involved in the regulation of the gene in question.

The size of the amplified DNA section or region is not particularly restricted according to the invention. For microsatellite positions, lengths of approximately 50 to approximately 500 bp, in particular approximately 50 to approximately 300 bp, are preferred.

In step (b) of the genotyping method according to the invention, the length of the ampH ficate or the amplificates obtained in step (a) is determined. For this purpose, according to a preferred embodiment, electrophoresis, ie the separation of the amplified products with the aid of an electrical field, is advantageously carried out. A gel, in particular agarose or polyacrylamide gels, the production of which is familiar to a person skilled in the art, is preferably used as the separation medium; see. For example, Maniatis 2001. Particularly preferred when the amplificates are from about 50 to about 300 bp in length, their separation in gels, which enable the fragments to be separated down to a few or even 1 bp. Such gels are also used, for example, in the sequencing of DNA molecules. The use of automatic laser fluorescence DNA sequencing devices (for example ALF from Pharmacia) with corresponding gels (for example. Hydrolink), the use of internal and external standard fragments which are commercially available or can be produced in a simple manner by means of PCR starting from a known template DNA, such as, for example, λ-DNA, is advantageous as a comparison.

Experience has shown that the number of repetitions of the respective sequence motif is a rough indicator of the degree of polymorphism of the microsatellite locus. Of course, microsatellite loci are generally all the more informative, that is, the more individual microsatellite loci are present, that is, the more individuals there are, the more the number of sequence motif repetitions in the microsatellite locus fluctuates between the individual individuals. Accordingly, it is preferred according to the invention if the polymorphic microsatellite locus has a sequence motif which is repeated at least three times, more preferably at least four times, particularly preferably at least five times. Polymorphic microsatellite loci can be mentioned as examples, which are selected from the following consensus sequences: (ATA) ₇ , (GA) ₇ , (GT) ₂₈ , (AGG) ₄ , (AC) ₅ , (TTTGT) ₅ , <TA) ₇ , (TC) ₅ , (TAAA) ₁₂ , (ATTTT) ₁₂ , (TTTC) ₁₈ , (CA) ₁₈ , (CAGTT) ₄ , (AGC) ₅ , (GA) ₅ , <TTTGT) ₄ , CTCAGT) ₄ , ( TTCAG) ₄ , (ACTGA) ₃ , (ACTGA) ₄ , (CA) ₁₂ , (ATC) ₄ , (I) ₂₅ , CTTG) ₅ , (T) ₂₉ , (CAA) ₃ , (TTCAG) ₃ , (AGTG ) ₄ , (CAC) ₅ , (AAAACA) ₄ , (ACC) ₄ , (ATCAG) ₅ , (AC) ₃ , (CTG) ₅ , (GTT) ₅ , (T) ₁₅ , (CAA) ₄ , (AC ) ₄ , (T) ₁₆ , (A) ₁₆ and (A).

In principle, the typing method according to the invention can be carried out for all genes which have at least one polymorphic microsatellite locus. On the one hand, its sequence and its position and position in the gene to be typed can already be known. On the other hand, the polymorphic microsatellite locus / loci can be determined in a preferred embodiment of the method according to the invention.

The identification of the polymorphic microsatellite locus / loci is preferably carried out as follows:

In a first step (A), the gene to be typed is screened for microsatellite loci, ie screened. This generally requires a genomic sequence of the gene in question which has at least one microsatellite locus. Genomic sequence information relating to a large number of genes is known in the prior art and is stored in particular in the databases of GenBank and the EMBL under corresponding access numbers. For example, if only one cDNA sequence is available or only EST sequences, it is of course possible for a person skilled in the art to obtain the required genomic sequence information using the conventional molecular biological methods; see also Maniatis et al. 2001. The genomic sequence is preferably screened for microsatellite loci using appropriately designed computer programs. As examples of suitable software, the programs can be found in the program package EMBOSS (from HGMP-RC, London), Sputnik (Abijian 1994) and Software RepeatMasker (Smit and Green, http :: //ftp.genome. Washington.edu/cgi- bin / repeatmasker). On the other hand, even if there is very little or no sequence information at all for a gene to be typed from a certain species, it is possible to type this gene as well, or to determine the polymorphic microsatellite loci in it, if the gene sequence is in another species is known to a sufficient extent and microsatellite loci located therein have also been identified. In this case, with the proviso that there is sufficient sequence homology with regard to the gene to be typed between the species, for example the primer used in the species for which sufficient sequence information is available, also in the course of the p-pation of the unknown Gene of the other species to be performed amplification of the corresponding DNA sections. In this case, it is therefore also possible to determine polymorphic microsatellite loci in a gene with only an incomplete or no (genomic) sequence at all, without screening this gene for microsatellite loci per se.

In a (further) step (B) analogous to step (a) above of the genotyping method according to the invention, the microsatellite loci corresponding to the gene obtained during screening of the gene (one DNA section or area per microsatellite locus obtained) are obtained in a plurality of Individuals of the organism containing the gene to be typified were amplified by PCR, ie reproduced. With regard to the amplification, the statements made above for step (a) of the above typing method also apply. In the next step (C) - analogously to step (b) of the typing method according to the invention - the length of the ampH ficate or the amplified products which were obtained in each individual is determined. The above statements with regard to step (b) of the genotyping method according to the invention apply accordingly to the determination of the length of the AmpH ficates. In addition to the determination of the length of the AmpHfikate obtained for each individual or alternatively, according to the invention, sequencing of the respective AmpHfikate or a section thereof, which, however, must contain at least the microsatellite locus itself, can also be carried out. Suitable sequencing methods are well known to a person skilled in the art and can be reacted in particular by means of automated sequencing devices (eg ALF from Pharmacia).

Finally, the lengths of the AmpHfikate between the individuals or the nucleotide sequences obtained are compared. Thus, in the last step (D), the microsatel locus / loci is determined whose ampHficate (s) has a different length between the individuals or whose nucleotide sequence (s) is / are different between the individuals. These microsatellite loci, which differ between the individuals (with respect to which different axles therefore exist), are thus polymorphic. As already explained above, the most different genes can be typed with the aid of the typing method according to the invention. The only requirement is that the gene to be typed contains at least one polymorphic microsatellite locus. The typing method according to the invention is preferably used for genes which are directly or indirectly associated with the expression of a disadvantageous or advantageous characteristic of an organism. With regard to the disadvantageous expression of a characteristic, genes are to be mentioned here in particular which are associated with a disease or other characteristics which are of medical or economic importance (for example in (useful) animals). Specific examples of such genes are PrP (BSE disorders such as scrapie in sheep, BSE in cattle, Creutzfeld-Jakob disease in humans), CFTR (cystic fibrosis), genes associated with metabolic disorders in humans and animals, such as α -Manosidosis, Pompe disease, citrullinemia and bovine leukocytic adhesion deficiency in cattle (each a defective gene, the variants of which can be distinguished at the DNA level), susceptibility to stress (MaHgnes hyperthermia Syndrome) in pigs (RYRI gene, variant T), genes that encode milk proteins, hormones or transcription factors, etc.

There are also no restrictions according to the invention with regard to the organism whose respective gene is to be typed, since microsatellite loci can be found in all eukaryotic genes. Due to economic and scientific considerations, preferred examples of organisms include To name humans, monkeys, horses, sheep, cattle, pigs, goats, mice, rats, rabbits, guinea pigs, dogs, cats and chickens.

Due to the availability of diverse sequence information and the importance in population studies, a particularly preferred target gene of the method according to the invention is the PrP gene already described above, which is associated with TSE diseases which occur in humans and other mammalian species. In particular, the genotyping method according to the invention is applied to the human PrP gene, the sequence motif (s) of the polymorphic microscopic locus / loci being selected from the following consensus sequences: (ATA) ₇ , (GA) ₇ , ( GT) ₂₈ , (AGG) ₄ , (AC) ₅ ,

CΓTTGT) _5, CΓA) _7, (y c) _5, CΓAAA) _12, (ATTTT) _12, CΠTQ _18, (CA) _18, (Γ) _16, (A) ₁₆ and (A) _a so ie the sequence of Octapeptidregion of the human PrP gene according to Table 7B, footnote d).

The consensus sequences (ATA) ₇ , (GA) ₇ , (GT) ₂₈ , (TAAA) ₁₂ , (ATTTT) ₁₂ , (CA) ₁₈ , (A) ₁₆ and (A ^) are particularly preferred.

Furthermore, with regard to the human PrP gene, it is preferred if the amplified DNA region (s) in step (a) of the genotyping method according to the invention contains nucleotides 3621 to 3641, 25415 to 25428, 39450 to 39505, 50315 to 50326, 58346 to 58385, 72392 to 72416, 78300 to 78313, 92615 to 92624, 108429 to 108476, 116907 to 116966, 125528 to 125599, 147980 to 148015, 55617 to 55632, 55806 to 55819, 64328 to 64349 and / or 64474 to 64489 and 69764 to 69886 according to GenBank accession number AL133396. In particular, for genotyping according to the invention, DNA regions for amplification according to step (a) are preferred which contain the nucleotides 3621 to 3641, 25415 to 25428, 39450 to 39505, 108429 to 108476, 116907 to 116966, 147980 to 148015, 64328 to 64349 and / or 64474 to 64489 according to GenBank accession number ALI 33396.

Preferred sequence motifs of the polymorphic microsatten locus / loci of the bovine PrP gene have the following consensus sequences: (CAGTT) ₄ , (TC) ₅ , (AGC) ₅ , (GA) ₅ , (TTGT) ₄ , CTCAGT) ₄ , TΪCAG) ₄ , (ACTGA) ₃ , (ACTGA) ₄ , (CA) ₁₂ , (ATC) ₄ , (T) ₂₅ , (ITG) _S - (T) ₂₉ , (CAA) ₃ , (TTCAG) ₃ , ( AGTG) ₄ , (CAC) ₅ , (AAAACA) ₄ , (ACC) ₄ , (ATCAG) ₅ and (AC) ₃ .

The consensus sequences (AGC) ₅ , (TTTGT) ₄ , (CA) ₁₂ , (T) ₂₅ , (T) ₂₉ , (TTCAG) ₃ , (AAAACA) ₄ and (ATCAG) _{5 are} particularly preferred.

In the bovine PrP gene, DNA regions are preferably amplified which contain the nucleotides 444 to 463, 4121 to 4130, 7615 to 7629, 19808 to 19817, 25288 to 25307, 30633 to 30652, 32320 to 32339, 37891 to 37910, 39943 to 39957, 44220 to 44239, 44507 to 44530, 46259 to 46278, 48409 to 48420, 50471 to 50495, 53219 to 53233, 54990 to 55018, 60452 to 60460, 62703 to 62717, 64685 to 64700, 66178 to 66192, 68762 to 68785 68926 to 68937, 72474 to 72498 and / or 74333 to 74340 according to GenBank accession number AJ298878. More preferably, the amplified DNA regions of the bovine PrP gene comprise nucleotides 7615 to 7629, 25288 to 25307, 44507 to 44530, 50471 to 50495, 54990 to 55018, 62703 to 62717, 68762 to 68785 and / or 72474 to 72498 according to GenBank accession number AJ298878.

According to a further preferred embodiment, the gene to be typed is the PrP gene of the sheep. The polymorphic microsatel loci preferably have the following sequence motifs (consensus sequences): (CAGTT) ₄ , (TC) ₅ , (AGC) ₅ , (GA) ₅ , CTTTGT) ₄ , (TCAGT) ,, (ACTGA) ₃ , (ACTGA ) ₄ , (CA) ₁₂ , (CTG) * (ATC) ₄ , (GTT) ₅ , (TTG) ₅ , (T) _1S , (CAA) ₃ , (CAA) ₄ , (TTCAG) ₃ , (AGTG) ₄ , (CAC) ₅ , (ACC) ₄ and (AC) ₄ . Microsatelten loci in the sheep's PrP gene with the consensus sequences (GA) ₅ , (TTTGT) ₄ , (CA) ₁₂ , (GTT) ₅ , (T) ₁₅ and (CAA) ₄ are particularly preferred.

In the inventive typing of the sheep PrP gene, the DNA regions amplified according to step (a) above comprise the nucleotides 301 to 320, 590 to 613, 1033 to 1047, 2477 to 2496, 4651 to 4662, 6627 to 6641, 9433 to 9447, 11277 to 11291, 16748 to 16756, 18100 to 18119, 19372 to 19386, 21383 to 21398, 22853 to 22867, 25422 to 25433, 25580 to 25591 and / or 30168 to 30175 according to GenBank accession number U67922, as well as seven other genomic DNA areas that are 5 'of the in U67922 sequence is located and for which no GenBank entry exists. DNA regions of the sheep PrP gene which are particularly preferably amplified comprise nucleotides 590 to 613, 6627 to 6641, 11277 to 11291 and / or 25422 to 25433 according to GenBank accession number U67922, and seven further genomic DNA regions which are 5 'of the are located in the sequence disclosed in U67922 and for which there is no GenBank entry.

From the point of view of genotyping, the use of microsatites for typing genes is thus provided according to the invention. For the first time, microsatuites are available for the first time, particularly in the PrP gene of humans, cattle and sheep, which differ between the individuals of the individual species, i.e. are polymorphic, so there are several different oils related to this microsatellite loci.

In a further aspect of the following invention, the genotyping method described above is used in a method which is suitable for determining microsatellite markers for the predisposition of an individual to a disease, the disease being associated with a gene which has one or more polymorphic microsatel loci having.

In a first step (i) of this identification method, the corresponding gene is typed in a plurality of individuals according to the typing method described above. Regarding particular embodiments of this typing method, reference is made to the above statements in the first aspect of the invention.

Each of the plurality of individuals is known, for example, to have or not to have the disease, for example the diseases mentioned above. Additionally or alternatively, for example from examinations of the respective known in the prior art

Disease with other genetic markers, e.g. ORF polymorphisms,

Restriction fragment length polymorphisms, etc., from each individual of the

Most individuals know that each individual has a particular

Degree of predisposition to the disease. A specific example of such a relationship between known genetic markers and the degree of predisposition one Disease can be called the ORF polymorphism in the ovine PrP gene described above (cf. Tables 1 and 2). Preferably in step (i) at least 100, particularly preferably 500 or more individuals are genotyped.

In a further step (H) of the identification method according to the invention for microsatelite markers, the genotype frequencies for each polymorphic microsatelite locus in the individuals who are known to be ill or not or have a certain degree of predisposition to the disease are determined.

Finally, it is determined in the last step (üi) in which the polymorphic microsatel loci has the greatest statistical significance for the characteristic "sick" or "not sick" or for the known specific degree of predisposition, on the basis of the genotype frequencies determined in the previous step (H) , If, for example, an expression of the polymorphic microsatellite locus is found in healthy individuals, ie individuals who do not suffer from the disease in question, and the frequency of this genotype, ie this allele, is increased or particularly high in non-diseased individuals, the polymorphic microsatellite locus in question becomes a marker be suitable for a lack of predisposition to the disease and thus be selected. In contrast, a variant, ie an AHel, of a microsatellite locus, which is found exclusively or frequently in diseased individuals, is selected as a microsatellite marker for an increased predisposition to the disease in question. Between these extremes, that is, expressions occurring only in healthy or exclusively in diseased individuals, there are of course also intermediate stages which are nevertheless correct with a certain degree of predisposition. As already explained above, the specific degree of predisposition can also be related according to the invention on the basis of other genetic markers which are known to correct with a specific degree of predisposition. As an example, the ORF polymorphism known in the ovine PrP gene may be mentioned here. In the case of the ORF polymorphism in the ovine PrP gene known in the prior art, it can be assumed on the basis of the genotyping of numerous sheep of various breeds from various breeds and in different countries that the ORF AUele (ORF: open reading fiame, open reading frame (ie variants in protein-coding gene regions) VRQ and ARQ are associated with a greatly increased scrapie receptivity (

16

ARR / ARR genotype a particularly high scrapie resistance (with the exception of one observation in Japan, sheep with the ARR / ARR genotype were never diagnosed with scrapie disease). The other ORF oils described are arranged in terms of scrapie susceptibility in between (see Dawson et al. 1998, Hunter et al. 2000).

Furthermore, the above-described polymorphic microsat position in the ovine PrP gene is in the region of this gene (provided that the ovine PrP gene has no insertions against the bovine PrP gene in this region, the most 5 'located microsatellite locus is only 29 kbp away from exon 1; the most distant microsatel focus lies even in exon 3) and its inheritance is therefore very closely linked to that of the ORF variants. Coupling breaks will therefore occur so rarely that they cannot be observed within races. Thus, based on the statistically excellent ORF genotyping in connection with their coupling with the polymorphic microsat position in the sheep PrP gene, it can be concluded with certainty that the microsat variants are associated with scrapie resistance or susceptibility, which are of the same order of magnitude like that of the ORF variants. This is confirmed by the direct experimental evidence found in Example 3 below. The example of the ovine PrP gene can of course be applied analogously to other genetic markers in other genes and other organisms, which will not cause any theoretical or experimental difficulties for a person skilled in the art.

There are therefore no restrictions with regard to the organisms and genes in which microsatellite markers are to be identified with the aid of the determination method according to the invention. Preferred organisms or genes have been set out above with respect to the genotyping method of the present invention.

Another aspect of the present invention relates to a method for pre-diagnosing diseases. The diseases are associated with a gene that has at least one polymorphic microsatten locus. The prediagnostic method of the present invention initially again comprises a typing step (1) which is carried out with the aid of the genotyping method defined above. The gene of an individual to be examined is related to one or more Microsatel locus / loci, which is a marker for the degree of predisposition to the respective disease. In a further step (2), the genotype obtained is then compared with the degree of predisposition to this disease that is assigned to this genotype.

In this prediagnostic method, the microsatelite markers are preferably determined with the aid of the identification method described above. Thus, with regard to genes, organisms, etc., the statements made above from the viewpoint of the present invention apply.

The prediagnostic method according to the invention is used in particular for TSE prediagnostics, the human PrP gene, the bovine PrP gene and the ovine PrP gene being particularly preferred. In the prediagnostic of the human PrP gene, polymorphic microsattenoid loci are suitably used, which have one of the sequence motifs given above with reference to the typing method according to the invention. Preferred amplified DNA regions in TSE diagnostics in humans are also given above from the point of view of the typing method according to the invention. In the FaU of the bovine PrP gene, polymorphic microsatten loci are preferred which have the sequence motifs given above with regard to the typing method according to the invention. DNA regions which are preferably amplified here comprise the positions defined above with regard to the typing method of the present invention. In scrapie prediagnostics (sheep's PrP gene), polymorphic microsatel loci with sequence motifs are advantageously used, the consensus sequences of which have also been raised above in the typing process. With regard to preferred positions of such microsatel loci in the sheep PrP gene, which are suitably amplified in the genotyping carried out initially in the pradiagnostic method according to the invention, reference is also made to the above explanations regarding the typing method of the present invention.

The present invention is explained in more detail by the figures and tables described below: 1 shows the tertiary structure of the prion protein (from: Pringle: BSE, Scrapie, CJD and the Prion Protein, http://www.uni-mainz.de/~cfrosch/bc4s/prions.html). where the original form (PrP ^c ) is shown in FIG. 1 a and the pathogenic form of the protein in scrapie (PrP ^Sc ) is shown in FIG. 1 b.

2 shows the exon / intron structure of the ovine PrP gene. The information used relates to GenBank entry U67922,

Fig. 3 shows the structure of the transcript of the ovine PrP gene (from Geldermann et al. 2002).

Figure 4 is a representation of the ovine PrP primary sequence (Geldermann et al., 2002). The PrP protein of sheep therefore consists of 256 amino acids, including an N-terminal signal peptide of 24 amino acids. ^1J denotes a 5-fold repetition (5 × R) of a motif from 8th or 9 or 5 amino acids (PQGGGGWGQ, (PHGGGWGQ) ₃ or PHGGG) which is conserved in the PrP protein. The respective amino acid and its position of the PrP-AUele ^) are given (see Tab. 1). The darkly marked amino acid variants were used in association analyzes with scrapie receptivity.

In Fig. 5 the MicrosatelHtenloci in the ovine and bovine Prp gene are shown schematically. Microsatellite motifs with> 3 repeats (repetitions) and> 90% homology were identified with the help of the program etandem of the EMBOSS program package. Additional microsatuites were obtained using the information in Lee et al. (1998) (marked with *), the Sputnik program (Abajian 1994) (marked with *) or the RepeatMasker program (marked with ³ )). If a microsatellite focus was found in only one species with these measures, the homologous control in the DNA of the other species was also searched. Microsatelten loci that were identified using this method are marked with ⁴ ). The reference scale in the middle refers to the sequences stored in GenBank (cattle: accession number AJ298878; sheep: accession number U67922). The 5 ^" ends of the ovine and bovine exons 3 are aligned with one another. The dotted line in the sheep gene shows an area in relation to which no sequence information is available in GenBank, whereby only estimated positions of the microsatel loci are given. In both species homologous microsatel loci are given by the same numbers characterized. The loci SOI to S06 and S09 in sheep were examined with primers designed for the PrP sequence in cattle. The primers for the loci in cattle R07 and R08 gave no PCR products in sheep. Regarding further details, reference is made to Table 3 described below.

6 shows an example of a comparison of all DNA sequences of selected polymorphic microsateloid loci. The respective sequence from GenBank is given as reference (R) in the first line. The different residues are marked in the oil sequences. FIG. 6A shows the comparison of all DNA sequences for the Sll locus in the oval PrP gene. 6B shows a corresponding comparison for a further polymorphic microsatten locus locus in the sheep's PrP gene (S15). FIG. 6C shows a comparison of all DNA sequences of the R21 locus in the bovine PrP gene.

7 shows a diagram in which the number of microsatellite motifs per kbp in the PrP gene of cattle and sheep (black bars) with the corresponding values in other genes (heUe bars) for different gene areas, namely exon, intron and 5 ' - Area, as well as the entire gene area are shown. What is striking is the significantly increased density of repeat DNA in exons compared to other genes in the ovine and bovine PrP gene (p <0.05). The detailed data with respect to Fig. 7 are given in Table 6 described below.

The experimental procedure for identifying suitable microsatelite markers for TSE diagnosis is illustrated schematically in FIG. 8 using the example of analysis in sheep.

Fig. 9 shows examples of electropherograms of the MicrosateUitenlocus S15. Lane 1 shows a homozygous, lane 2 and 3 heterozygous genotypes.

10 shows examples of electropherograms from the MicrosateUitenlocus Sll. Lanes 1, 2, 3 and 6 show different animals with a heterozygous genotype, lanes 4 and 5 represent homozygous genotypes.

11 shows examples of electropherograms of the S24 locus. Lane 1 and 2 show homozygous, lane 3 a heterozygous genotype. A PCR product appears in lane 4 with the length 152 in combination with the allele 147, in lane 5 it can be observed together with the alleles 144 and 147.

9 to 11 show some examples of AmpH fikates for the loci S15, Sll and S24 as a result of the fragment length analysis of the microsateUites. All homozygous genotypes showed well-developed peaks with no SHppage appearance. In the heterozygous observations, the two all PCR products were clearly separated even at 2 bp spacing (see FIG. 10, lanes 1, 3 and 6). Misleading by-products were not detected on any gel.

A special feature was observed at Locus S24. A fragment of length 152 occurred in 25 merino landscapes, either in combination with 144 or 147 (FIG. 11, lane 4) or in 15 observations with both other AUeles simultaneously (FIG. 11, lane 5). In order to clarify the nature of these 3 oils, they were sequenced after previous cloning. With the A.L.F. The fragment lengths measured were each 2 bp shorter than those determined by sequencing (Table 16).

Fig. 12 is an AHgnment of the 3 sequenced S24 oils with a section of the corresponding database entry in GenBank. The microsate unit of the database sequence consists of 4 repetitions of the CAA motif. The 147 bp long nobility of sheep S102 corresponds to the database entry except for a point mutation from A to C. Due to this mutation, the allele 147 contains one more repetition of the motif CAA with the same length as the database sequence. The microsateUit of AUels 144 from Schaf 33 consists only of 3 repetitions of the motif, which makes this fragment 3 bp shorter than the GenBank AUel. In addition, an SNP from C to T occurs at position 57 (based on the GenBank sequence). The AUel with fragment length 152 (sheep 311) is identical to AUel 147 in terms of microsatellite. However, between positions 29 and 30 there is a 5 bp insert. In addition, an A occurs at position 103 instead of a T.

13 shows a schematic representation of the positions of the microsatellite loci in the human PrP gene. Microsate motifs with> 4 repetitions (repeats) and> 90% homology were identified using the program etandem of the EMBOSS software package. 12 of these identified MicrosatelHtenloci (M01 to M12) over the entire Sequence distributed were selected for more detailed analysis. In addition, 4 monorepeats (MM1 to MM04) and the octapeptide region MOct were genotyped in external samples. The polymorphic loci are highlighted by white letters on a black background. The detailed data of the microsatellite loci are given in Tables 7A and 7B.

Fig. 14 shows examples of all DNA sequences from human microsatel loci. In the FaU of locus M02, different outputs arise due to a variable number of repeats (A). At locus Mll there are different oils due to single nucleotide exchanges ("single nucleotide polymorphism", SNP), insertions and deletions within the repeat region (B). The sequences of the M12 locus differ by an AU-specific SNP within the repeat region and 2 SNPs in the flanking region of each AU (C).

Tables 1 to 26 in the appendix are referenced to the corresponding control units in the present description. In these tables, the principles on which the present invention is based and the results obtained in accordance with the following exemplary embodiments are given.

Tab. 1 summarizes the amino acid polymorphisms found in the PrP gene of sheep (according to Hunter 2000, supplemented).

Tab. 2 shows the risk classification (risk) due to the amino acid polyoiorphisms in positions 136, 154 and 171 of the sheep PrP, as it was carried out by the "Scrapie Information Group" (Dawson et al. 1998).

Table 3A shows the data from 24 microsatten loci with 3 or more motif repeats found in the bovine PrP gene. Tab. 3B shows the corresponding data of the 23 microsatlten loci found in the PrP gene of the sheep. 9 primer pairs specific for the bovine DNA were also tested with sheep DNA as a template in order to analyze the previously unpublished region of the sheep sequence (about 44 kbp). Using this procedure, 7 microsatel loci could be identified in the sheep PrP gene. In the DNA area, in which both sheep and cattle Sequence information is available in GenBank, 13 of 16 of the loci examined in the sheep homologous microsate motifs were found in the bovine DNA sequence. These motifs consisted of 4-5 repetitions, in most cases with different sequences. Mononucleotide repeats found in introns 1 and 2 of the bovine gene and in intron 2 of the sheep gene showed 15 and more repeats.

Tab. 4 shows a summary of the results of an analysis of all PrP microsate DNA variants in the bovine (Tab. 4A) and ovine (Tab. 4B) PrP gene. Variants were obtained in about 30% of the analyzed loci. As summarized in Tab. 4, 4 of the 8 variable microsattenten loci showed 2 AUele in cattle, and 2 loci were highly variant (6 or 10 AUele). The data for the sheep gene in Table 4B show a locus with 2 AUelen, 2 loci with 3 AUelen and 3 Loci with 4 and more AUelen. Some of the variants were only found in one breed (9 out of 31 AUelen in cattle and 2 out of 22 AUelen in sheep), while the other variants occur in more than one breed.

The DNA sequences of all fragments showed differences in different positions, sometimes even within a certain AU (see Tab. 4 and Fig. 6). In addition to polymorphic repetition numbers and SNPs in microsate motifs, variable levels (SNPs as well as insertions and deletions) were also found in the non-repetitive sequences flanking the microsate repeats. In 7 of 12 loci, none of the sequenced AUele corresponded to the DNA sequences stored in GenBank. No database sequence information was available for 2 polymorphic loci. Examples of sequenced oils from 3 of the microsate loci are shown in FIG. 6A and show a variability in the fragment lengths which result from the changing number of repetitions of the microsate motif. In fists with composite microsatellite sequences, the number of repetitions in each motif was varied independently (Fig. 6B). However, it was often found that the flanking regions of the repeat motifs were altered (FIGS. 6B and 6C) and contained SNPs, insertions and deletions. This leads to the complex differences in some of the oils, which is summarized in Table 4. As further shown in Table 4, the fragment lengths of the oils were measured with the ALF DNA sequencer and compared with the number of nucleotides of the analyzed DNA sequences. In 35 of 41 faults, the fragment length analysis with the ALF device showed 1-3 nucleotides shorter values (in 15 faults 1 Nucleotide, in 16 cases 2 nucleotides and in 4 cases 3 nucleotides less) than the results obtained by sequencing. These deviations are probably due to secondary structure ties due to the repeats in the microsatellite DNA fragments, which influence the mobility of the respective species. For the typing of genes, this deviation from the actual length does not matter because the fragment length measured by electrophoresis is constant for any given genotype and therefore a characteristic value is obtained for each AU using the same electrophoresis system.

Tab. 5 controls the microsateloid loci determined as polymorphic in the bovine (Tab. 5A) and ovine (Tab. 5B) PrP gene. In 6 of the polymorphic microsatten loci in cattle and in all 6 polymorphic microsatel loci in sheep, a frequency of the most common AU was found to be <0.95. A total of> 0.10 heterozygosity was observed in 11 of the 14 polymorphic loci found in both species.

Table 6 shows comparative data for the microsatten loci of bovine and ovine genes. Thereafter, microsateloid loci can be localized not only in the PrP gene of sheep and cattle but also in other genes of this species. On average, 1.12 microsatten loci per 1 kbp DNA were obtained in the 8 genes analyzed. The results according to Table 6 are shown graphically in FIG. 7 described above.

Tab. 7A shows the 16 microsatelten loci and the octapeptide repeat found in the human PrP gene, 9 of which showed more than 1 AUel in 18 healthy volunteers examined. The frequency of the prevailing AU in these was <0.95. The observed degree of heterozygosity would be> 0.10 for external loci. Furthermore, the PCR conditions with regard to the attachment temperature and MgC ^ concentration as well as the primers used are given. The number and lengths of the individual oils found in the microsatel loci in the human PrP gene are combined in Table 7B.

Table 8 shows the number of sheep examined in Example 3 below and their ORF genotypes. Table 9 shows the PCR approaches for ampHfication of the microsatel loci Sll, S24 and S15 in the PrP gene of the sheep, Table 10 shows the PCR program carried out and Table 11 shows the sequences of the primers used.

Table 12 shows the running conditions for the electrophoresis that was carried out to separate the microsate units and ampicules.

Tables 13 to 15 summarize information on the sequencing of cloned PCR products which resulted from the amplification of the microsatel locus S24 of the sheep's PrP gene.

Tab. 16 shows the results of the fragment length analysis of the microsattenoid locus S24 of the sheep PrP gene obtained by electrophoresis or sequencing (cf. also FIGS. 9 to 11 described above).

The frequencies and frequencies of the polymorphic microsatten loci in the PrP gene area for the 8 sheep breeds examined are shown in Table 17. For locus III the total fragment length 152 was determined as the most common oil with the lowest oil sequence 0.54 in the Suffolk breed and highest frequency 0.93 in the Merinoland and Schwarzkopf breeds. Another high oil frequency was found in the Suffolk breed for the total fragment length 158 at 0.45. The other frequencies for this locus for the individual breeds ranged from 0.007 (4 observations of fragment length 154 for the Merino region) to 0.149 (26 observations of fragment length 158 for milk sheep).

Of the 5 fragment lengths to locus III, only fragment lengths 150 and 152 were detected in 8 races. The fragment length 154 was only seen in the Merinoland breed.

The counting of all fragment lengths to locus S24 was done in a simplified form. For this locus, fragment lengths were detected which could not be clearly assigned to the locus (3-fold repeat) or which should be made accessible by sequencing an interpretation. It is the fragment length 146 (6 observations on all breeds) coded to 147 and the fragment length 152 (25 observations in the Merino region) that O 2004/020664

25

only occurred in combination with 144 or 147 and was detected as the third peak in 15 observations (FIG. 11). This fragment length was negated as information. The analyzed fragment lengths 144 and 147 were determined in external breeds, whereby fragment 144 was most frequently represented in the Dorper, Isle de France, Merinoland, Schwarzkopf and Texel breeds with frequencies between 0.61 and 0.885 and fragment 147 in the Gotland, milk sheep breeds and Suffolk was the most common AUel with frequencies between 0.53 and 0.75.

The microsatellite locus S15 showed 3 aUele fragment lengths with the most common fragment 179 in outside races and frequencies between 0.57 (Gotland breed) and 0.98 (Dorper breed). The fragment length 182 was represented in external breeds with low frequencies between 0.008 (1 observation for breed Suffolk) and 0.192 (33 observations for breed milk sheep). Fragment 173, which was absent in 4 races and was found with frequencies between 0.016 (2 observations of the Suffolk breed) and 0.286 (4 observations of the Gotland breed), was even rarer.

Frequencies and frequencies for the amino acid variants of the PrP genotypes are in Tab ^' . 18 rose. Frequencies between 0.885 and 1.0 could be determined for the amino acids alanine (A) for the individual breeds for all variants of codon 136 (ORF1). The amino acid valine (V), given in the literature with a high risk of scrapie susceptibility in animals with this expression, could only be observed with low frequencies up to 0.115 (Isle de France breed), with no animal with this variant in the Gotland and dairy sheep breeds occurred.

The all variant histidine (H) was present in very small numbers on codon 154 (ORF2 label) (highest frequency 0.258 in milk sheep). This amino acid expression was absent in all breeds, apart from Müchschaf (46 observations), Merinoland (40 observations) and Texel (1 observation). The amino acid arginine (R) was found at this position with frequencies above 0.74.

Codon 171 (ORF3 code) was able to determine 3 general values for the 8 breeds. The amino acid histidine (H) occurred at a very low frequency with the exception of the Texel breed, frequency 0.21 (30 observations). This O 2004/020664

26

Amino acid expression could only be determined with one observation in the Merino Land breed. The varieties glutamine (Q) and arginine (R) were represented in the breeds with very different frequencies. Gotland glutamine with 20 observations (100%), arginine with the Schwarzkopf breed with 70 observations (80%).

The observed degrees of heterozygosity (D.C .: direct count estimate) and the undistorted heterozygosity values (unb: unbiased estimate) of the 3 microsatellite loci and 3 ORF loci including the mean degrees of hetrozygoty are shown in Table 19.

The lowest observed degree of heterozygosity for the Dorper breed was found to be 0.13 for the MikrosatelHtenlocus Sll and the highest for the Suffolk breed to be 0.50. For the MicrosateUitenlocus S24, the lowest observed degree of heterozygosity was 0.231 for the Isle de France breed and the highest for the Suffolk breed was 0.594. For the MikrosatelHtenlocus S15, the values were between 0.044 for the Dorper breed and 0.714 for the Gotland breed. The lowest mean observed degree of heterozygosity at 0.157 was found in the Schwarzkopf breed and the highest in the Gotland breed at 0.571. The observation values showed small, insignificant deviations from the expected values for all breeds.

In the lower part of Tab. 19 the degrees of heterozygosity of the ORF loci are shown. The highest degree of heterozygosity at the ORF1 locus was observed in the Isle de France breed at 0.231. The highest levels of heterozygosity were determined for ORF2 in the breed Müchschaf 0.315 and for ORF3 in the breed Texel 0.662. Frequently, only homozygous animals appeared at the ORF loci in the individual breeds (Gotland and milk sheep at ORF1, Dorper, Gotland Ile de France, Schwarzkopf and Suffolk at ORF2 and Gotland at ORF3).

The locus Sl 1 with 5 AUelen is the highest polymorphic locus in the investigation. When examining the genotype frequencies of the microsatel loci for equilibrium (Hardy-Weinberg equilibrium) in the examined breeds (Table 20), no deviations could be determined. At locus S24 with AUelen 144 and 147 the heterozygote animals were overrepresented in all breeds. The genotype 144/147 was too common across the breeds with 23 observations (267 observed, 244 expected). However, this did not lead to a significant deviation of the genotype frequencies from an equilibrium situation in any race.

The locus S15 showed no deviation from the Hardy-Weinberg-Equüibrium (HWE) in one of the breeds in 3 AUelen with the rare AUelen 173 and 182.

Regarding the examination of the genotype observations of the ORF loci, no deviation from the HWE could be determined for the locus ORF1 (codon with the amino acid variants A (alanine) and V (valine)) (Table 21). Noteworthy V observations occurred only in the Dorper and Texel breeds, whereby only one sheep of the Texel breed was recognized homozygously with V / V. At the ORF2 locus (codon 154 with the amino acid variants H (histidine) and R (ajrginine) with a very low H content observed in the Merinoland, Milchschaf and Texel breeds (1 observation), there was also no significant deviation from the HWE. An underrepresentation the heterozygote could be recognized in milk sheep.

The ORF3 locus (codon 171 with amino acid variants H, R and Q (glutamine) showed a significant deviation (P <0.05) from the HWE in the Merinoland breed with a significant underrepresentation of the type Q / R (14 observations too few) In the Suffolk breed this type occurred too frequently with 6 observations (not significantly different from the HWE).

The rare form H (histidine) was almost exclusively present in the Texel breed and showed no abnormality in the frequencies.

The association of the microsate loci with the scrapie risk groups is shown in Tables 22 to 24 (for the definition of the risk groups (characteristic Risk) see Table 2).

The results of studies on the association between polymorphic microsat position according to the invention and various dementia groups in humans are shown in Table 25. In the first line of Tab. 25, the microsat positions are designated, as in the preceding Tab. 7A and 7B are given, however, with "Octa" is the octapeptide region, which is referred to in the above tab. 7A and 7B as MOct. SNP129 denotes the variant in codon 129 which is recognized as "pathogenic", ie this variant Hess recognizes the strongest associations to date with CJD ("Creutzfeld-Jakob disease").

Tab. 26 documents the individual data of the AUs of the microsatelten loci in the PrP gene which were examined in relation to an association between the polymorphic microsatel loci and various dementia groups in humans.

In the analysis of variance with ModeU 1 (significance and measures of certainty; see the relevant explanations in the following 3rd exemplary embodiment) for breeds with numbers of animals> 60, the following results. In the Merino breed, only a share of 7.6% of the phenotypic variance of the Risk characteristic (Table 22) could be explained using the microsatel loci, whereby the Loci Sll and S15 did not contribute to the anteu. In Table 8 it can be seen that the Merinoland breed was mainly found in levels 3 and 4 in terms of risk assessment (90.5% of the observations) and thus showed a slight phenotypic variance in relation to the examined feature.

For the breed dairy sheep, Suffolk and Texel, on the other hand, determinative measures for ModeU 1 with values> 75% could be determined, whereas in other breeds S24 with a high level of significance, the variance of the characteristic had risk.

SchHeßHch resulted in the following estimated values for characteristic Risk from the analysis with ModeU 1 for the microsatel location considered. The analyzes of the individual breeds (Tab. 23) showed for locus S24 for animals with genotype 147/147 in comparison to animals with genotype 144/144 a clear increase in the risk characteristic with the greatest differentiation in the Suffolk breed in the two homozygous types with an expected selectivity of approx. 2.7 in the risk difference. The locus Sl 1 showed a higher characteristic value Risk in animals with AUel 150, particularly easy to recognize in the Texel breed. However, only heterozygous observations were available for this. The locus S15 shows inconsistent association sizes for the different genotypes. Noticeable was an increase in risk in the TexeL breed for animals that appeared with AUel 173.

In Table 24, the examined microsatten loci within ORF genotypes are upgraded, within which the microsatel loci were sorted according to genotype in order S24, Sll, S15. Within the ORF type ARR / ARR associated with the lowest risk of disease. With 76 observations in 6 breeds, all animals showed the same genotype combination of the 3 microsatten loci S24, Sll, S15 with 144/144, 152/152 and 179/179. This homozygous occurrence at the three loci occurred in the entire data material with 188 observations with an anusly decreasing tendency up to risk level 4 with 47 observations (20% of 233 observations at this level). This genotype combination was not represented in risk level 5. Risk level 2 could be determined with 16 observations in the Merinoland and Müchschaf breeds; it was observed once in the Texel breed.

This indicates that the amino acid expression H (histidine) on codon 154 is predominantly manifested in these two breeds, which was also confirmed in the ORF type ARQ / AHQ in risk class 3 with 53 observations. The remaining two ORF types with H at position 154 (AHQ / ARH, AHQ / VRQ) were not represented in the available data. Noticeable was the rare occurrence of genotype 144/144 in S24 with only 4 out of 70 observations of ORF types with H at position 154. The ORF type ARR / ARQ risk level 3 with 165 observations determined in external breeds was according to ARQ / ARQ on the second most frequently represented with 29% of 573 total observations (also observations with information on 3 microsatel loci and the ORF genotype). For this ORF type, a high proportion of the genotype combination of the microsateurs could be determined with 144/144, 152/152, 179/179 with 62 observations (37.6%). Within this type, the AUelel50, 154 and Locus S15 the AUel 182 each appeared for the first time in very low frequency. The ORF type ARR / ARH, risk level 3 with 10 observations shows the rare expression H (histidine) on codon 171. With the exception of one exception in the Merino breed, ORF types with this amino acid were only determined in the Texel breed (see also ORF types ARH / ARH and ARQ / ARH in risk level 4 and ARH / VRQ in risk level 5). , A total of 24 animals showed this Specification, whereby a clear assignment to certain genotypes of the microsatel loci could not be determined. The ORF type ARQ / AHQ level 3 (see also ARR / AHQ and AHQ / AHQ) only represented in the Merinoland and Müchschaf breeds was not noticeable except for the above-mentioned peculiarity. The ORF type ARQ / ARQ (wüdtyp) risk level 4 with 209 observations (36.5% of the total data) represented in external breeds showed a strong accumulation of the genotype 147/147 with S24 with 34% of the observations within this type. This genotype was only represented by 4% in risk levels 1 to 3. At Locus Sll, a significantly higher frequency of AUels 150 was found to be 7% within this ORF type and 2% within risk levels 1 to 3. The locus S15 showed a significant increase in the frequency of AUels 182 with 12.7% of the observations compared to the low occurrence of 2.3% within risk levels 1 to 3.

The AUele 150 to locus Sll and 182 to locus S15 occurred in the subsequent risk levels with V (valine) at position 136 with even higher anteu (28% anteü for AUel 150 and 26% anteü for AUel 182). However, the Locus S24 showed no abnormality in the frequencies of the microsattenoid genotypes in the highest risk level.

The present invention is explained in more detail by the following exemplary embodiments:

Example 1:

MATERIALS AND METHODS

Analysis of microsatellite motifs: Genomic DNA sequences of the genes coding for the PrP protein are available in GenBank (accession numbers: U67922 for sheep and AJ298878 in cattle) and were generated on microsate motifs using the software etandem of the EMBOSS program package (HGMP-RC, London ) searched, the motif size window was 2 to 25 nucleotides and only those microsate motifs with at least 3 repeats (repeats) and 90% homology were evaluated. Additional microsatel loci were accessible through the Sputnik program (Abajian 1994), the RepeatMasker program (Smit and Green) at http://fdp.genome.washington.edu/cgi- bin / RepeatMasker) and Lee et al. (1998) found information found. If a microsate motif was identified in only one species, the DNA sequence of the other species was compared by means of a comparison and the homologous region was checked for the same microsate motif. Sequence comparisons were carried out using the GeneDoc program, which is accessible at the URL http: //www.psc.ecu/biomed/genedoc.

Animals and samples: Blood samples were taken from 11 sheep breeds (3 animals per breed: Awassi, Changthangi, Dorper, Hu, Merinoland, Müchschaf, Gotland, Schwarzkopf, Shkodrane, Texel, White Karaman) and 8 cattle breeds (4 animals per breed: Busa, Holstein -Black-colored, Jersey, South Anatolian red cattle, Simmental, Nanjing cattle, Nguni, YerH Kara) collected.

Production of genomic DNA: DNA was isolated from EDTA-stabilized blood by chlorophore-phenol extraction or using IsoHerungskits (NucleonBAcc2, Pharmacia, Freiburg, or Nucleo Spin Blood Quick Pure, Macherey-Nagel, Düren). The quality of the DNA was checked by electrophoresis in 1% agarose gels and by photometric test at 260/280 nm. The DNA material obtained was stored in sterile TE buffer (10 fflM Tris-HCl, 1 mM EDTA, pH 7.5) at -80 ° C.

Primers. The primer sequences were constructed using the Primer 3 software (Rozen and SHetsky 1998) and synthesized by Roth (Karlsruhe), with one fluorescent primer being controlled per locus.

PCR: A standard protocol was used (initial denaturation for 5 min at 94 ° C followed by 30 cycles each with 1 min at 55 ° C, 1 min at 72 ° C and 1 min at 94 ° C, and a final extension for 15 min at 72 ° C), the reaction was carried out in a volume of 20 μi with 0.15 mM primer, 200 mM of each dNTP, 100 ng genomic DNA, 1.5 mM MgC ^ and 0.5 units Taq Polymerase (obtained from Roth, Karlsruhe). The efficiency and specificity of the PCR was optimized by changing the MgCl ₂ concentration (from 1.5 to 4.5 mM) together with the annealing temperature (48-65 ° C) in a gradient thermal cycler. The primers and further PCR conditions that were used for the fragment analysis according to embodiment 1 are given in Table 3. Fragment length analysis: Using an automatic laser fluorescence DNA sequencer (ALF Pharmacia) with 5% HydroHnk gels, the PCR products (0.5 μl each) were analyzed together with internal (99-198 nucleotides) and external (80-353 Standard fragments (prepared by PCR with λ-DNA as a template) were analyzed. Before loading the gel, the fragments were denatured (2 min at 90 ° C and then ice cooling). The electrophoresis was carried out in 0.6% TBE buffer at 1500 volts, 45 mA and 50 ° C. The data analysis was carried out using the AUeleLinks software (Pharmacia, Freiburg).

Cloning of PCR products: 0.067 pmol of purified PCR product was treated with the end conversion mix (Novagen, Madison, Wisconsin, USA) and sequenced in the pT7-Blue vector digested with EcoRV with blunt ends for the sequencing of separate AUeles. There was a heat shock transformation from

carried out according to the instructions of the manufacturer. Positive clones were identified by means of blue-white screening and the correct insert sizes were determined by vector PCR (upstream printer: 5'-TAATACGACTCACTATAGGG-3 '; downstream primer: 5'-TTGTAAAACGACGGCCAGTG-3') and electrophoresis on a 1.5 % Agarose gel checked.

Insert preparation and DNA sequencing. Template DNA was generated from the white clones by vector PCR and purified using the Cycle Pure KIT (Peqlab, Erlangen). Both strands of DNA were sequenced by MWG-Biotech (Ebersberg). The sequences obtained were analyzed using the Chromas (http://www.technelysium.com.au) and GeneDoc (http://www.psc.edu/biomed/genedoc) programs. The results were verified by sequencing, which was carried out using the Thermo Sequenase Primer Cycle Kit (Pharmacia, Freiburg) and was carried out on the A.L.F. DNA sequencer analyzed and with the A.L.F. Win software package (Pharmacia, Freiburg) evaluated.

According to the present exemplary embodiment 1, 24 microsate loci could be identified in the bovine and 23 in the ovine PrP gene. The following conclusions can be drawn from the results which are shown in FIGS. 5 to 7 and Tables 3 to 6: Number of microsatellite loci in genomic DNA. An average of 1 microsate locus per 0.9 kbp DNA was obtained within the coding gene regions and the flanking regions. This frequency was also observed for other coding genes and is much higher than documented in the prior art (cf. e.g. Schlötterer 2000). This surprising difference can result from the fact that, in the prior art, information about microsat position in DNA is usually obtained by screening libraries of genomic DNA elements with microscopic motifs, and the number of repeat motifs in the genome was therefore underestimated.

Function of microsates in coding genes: Repeated motifs within genes have been known for a long time. Microsatel loci within exons indicate repetitive

Codons. Regulatory DNA sequences can even have a pattern of microsatters with an even higher density, since for example response elements often incorporate repeated nucleotides and variants in gene regulation become functionally important (Wales et al.

1990, Tripathi and Brahmachari 1991, 1995). Involvement in human genetic diseases has been reported in some microsates (O'Hara 2000, Nadir et al.

1996, Murata 2001) and occasionally the observed symptoms worsened with an increase in the number of repetitions ("repeat expansion"). Christopher et al. (2000) describe a FaU of "repeat expansion" in a transcribed non-coding sequence that causes dysfunction of gene expression. It can therefore be assumed that the microsate motifs found in the PrP gene are important for gene expression and that the variants indicate loci that trigger the PrP gene.

Accumulation in infected ZeUen related.

Evolutionary stability of microsatellite motifs: The high intragenic variability caused by microsatellite loci can stimulate the evolution of eukaryotic genes. It was determined that microsatuites in the PrP gene of humans and mice are very different (Li et al. 1998). Surprisingly, however, similar positions of the microsate loci were found in the closely related species cattle and sheep in the present invention, which were stable despite all variability within the species. This variability leads to genes which are polymorphic with respect to more than one locus ("hetero-oils"), whereby new oils can be generated by intragenic recombination. In these cases variants of individual loci can be found have proven to be successful during evolution, which results in new functional, possibly superior oils.

Relationship between Syrian structure and polymorphism of microsatellite loci: It was determined according to the invention that microsatites with a high number of repetitions have a greater polymorphism than those loci with fewer repetitions. For example, only 4 out of 25 microsatelite loci with 4 or fewer repeats were polymorphic, compared to 10 out of 18 microsatelite loci with 5 or more repeats. This increase in polymorphism with the number of repetitions underlines the results described in the prior art (cf., for example, Schlötterer 2000).

Alleherteilung. Microsate sequences in genetically different breeds of cattle and sheep were examined in order to identify as many oils as possible. In 32 cattle (from 8 different breeds) 8 polymorphic loci (from 24 examined loci) were identified. The number of polymorphic microsatten loci (6 out of 23) found in sheep (33 individuals from 11 breeds) was similar to the number in cattle, although more oils were found in sheep that were evenly distributed between breeds. These results correspond to ORF data, in which only one variant in the octapeptide motif and one stubborn SNP in the bovine PrP-ORF were determined, while 11 amino acid substitutions are known for the ovine PrP-ORF. However, the variability of the ORF polymorphism is limited even in sheep, since the amino acid substitutions of the relevant codons (136, 154 and 171) only occur in 5 different haplotypes. In comparison, the microsate units shown in the present invention provide much more haplotypes and are therefore outstandingly suitable for typing individual individuals with respect to the PrP gene.

Use of microsatellite markers in conjunction with ORF variants: In cattle, only a few polymorphic control units are available in the PrP gene for its typing (Hunter 2000). Since no informative markers in the PrP gene are known in the prior art, no detailed investigation of the relationship between BSE disposition and gene variability has been able to be carried out to date. The new microsate loci will therefore be used for further genetic testing of BSE, in particular they can be used for pradiagnostics related to this disease. In the sheep, 3 of the polymorphic MikrosatelHtenloci used together with the ORF variants to examine more than 600 animals of different breeds, which is described in Example 3 below.

In summary, in the present exemplary embodiment 1 microsatelten loci within genes were analyzed using GenBank sequences of the bovine and ovine PrP gene. This procedure is used to screen a large number of polymorphic DNA markers per gene. This procedure was carried out using the PrP gene, but can be easily transferred to other eukariotic genes. When considering microsateUites with at least 3 repetitions, 24 loci in the bovine and 23 in the ovine PrP gene were identified. About 30% of the loci were polymorphic within the species. Of 32 cattle from 8 genetically different breeds, 4 polymorphic microsate units in 2.1 microsate units with 3, 1 microsate units with 4, 1 microsate units with 6 AUels and 1 microsate unit with 10 AUels occurred. The data from 33 sheep from 11 genetically different breeds showed a locus with 2 AUelen, 2 Loci with 3 AUelen and 3 Loci with 4 and more AUelen. It has been determined that microsatten loci with at least 5 repeats have a higher degree of polymorphism than those with 4 or fewer repeats. In cattle, 9 of the 31 AUele were found only in one breed, in sheep it was 2 out of 22 AUele. Frequencies of the prevailing AUel of <0.95 were observed in 6 microsatelten loci in cattle and in 6 microsatelten loci in sheep. In 35 of 41 comparisons, the fragment length analysis with an automatic DNA sequencer showed a length that was 1 to 3 nucleotides shorter than with the sequencing. The deviations in the measured molecular size can be explained with secondary structures, which are built by microsatical motifs that influence the electrophoretic mobility of the fragment. All DNA fragments differed not only in the microsatel loci but also in their flanking areas. On average, a microsatellite locus occurred in 8 genes of cattle and sheep approximately 0.9 kbp, whereas the density of microsatel loci is higher in PrP exons. Microsateloid loci within genes can be functionally important in expression and can therefore be related to PrP accumulation in TSE-infected cells. The intragenic variability caused by microsatten loci can stimulate the evolution of eurocariotic genes. The intragenic polymorphic microsatten loci according to the invention allow, in particular, use in prediagnostics. Example 2:

The methods according to the invention were also applied to the human PrP gene.

Materials and methods

Analysis of microsatellite motifs: The genomic DNA sequence (148,497 bp) of the human PrP gene (GenBank accession number AL133396) was considered with regard to microsatical motifs using the etandem software of the EMBOSS software package (obtained from UK HGMP Resource Center, see http: / /www.hgmp.mrc.ac.uk). The motif window size was 1 to 25 nucleotides and only those microsate motifs with at least 4 repeats (repetitions) and 90% homology were recorded. Of the 127 microsatites, 16 were selected, which are distributed over the entire GenBank sequence, motifs with a higher number of repetitions being preferred if possible and mononucleotide repeats (15 and more repeats) being allowed only in the vicinity of the PrP gene.

Primers and PCR reactions: Primers for the new PrP microsatelite and the octapeptide region were hoofed with the PRIMER3 software (S. Rozen and HJ Skaletzky, http://www.genome.wi.mit.edu/genome_software/other/ primer3.html). The PrP

Primers are given in Table 7A. The OHgonucleotides were from Roth (Karlsruhe,

Germany) was synthesized, with one primer per locus fluorescently labeled.

The following PCR protocol was carried out as standard: initial denaturation for 2 min at 94 ° C, followed by 32 cycles, each with 1 min at 55 ° C, 30 or 45 s at 72 ° C and 45 s at 94 ° C, as well as one last extension phase for 5 min at 72 ° C. The PCR was carried out in a reaction mixture of 20 μl, containing 0.15 μM primer, 200 μM of each dNTP, 100 ng genomic DNA, 1.5 mM MgC ^ and 0.5 units T ^ polymerase (Eppendorf,

Hamburg, Germany). The efficiency and specificity of the PCR was determined by changing the MgC ^ concentration (1.5 to 3.0 mM) and the annealing temperature

(50 to 72 ° C) optimized with the hoists of a gradient thermal cycler.

Extraction of genomic DNA and analysis of the PCR products: Blood samples were taken from 18 healthy adults in the Hanover region. The DNA was isoHert from EDTA-stabilized blood by chlorophore-phenol extraction and then used for the PCR. Using automatic laser fluorescence DNA sequencing devices (ALF, Pharmacia, Freiburg, Germany) with 5% Hydrolink genes, 0.5 to 4 μl of the denatured PCR product (2 min at 90 ° C., then ice cooling) were combined with internal (100 to 198 nucleotides) and external (80 to 300 nucleotides) standard fragments (prepared by PCR on a λ-DNA template) were analyzed. Monorepeats were analyzed using acrylamide instead of HydroHnk. The electrophoresis was carried out in 0.6% TBE buffer at 1500 V, 45 mA and 50 ° C for 2 h. The data obtained were analyzed using the AUelelinks software (Pharmacia, Freiburg, Germany).

DNA sequencing of individual microsatellite alleles: For the sequencing of individual AUele, 0.067 pmol of the purified PCR product was treated with a mixture for converting DNA ends (Novagen, Madison, WN, USA) and in the pT7- digested with EcόKV to generate blunt ends. Blue- vector ligated. The heat shock transformation of Nova Blue E. Λ? / Z host cells was carried out according to the manufacturer's instructions. Template DNA generated by means of vector PCR, starting from white clones, was purified using the Cycle Pure Kit (Peqlab, Erlangen, Germany). Both strands of DNA were sequenced by Biolux, Stuttgart, Germany. The sequences were analyzed with the hooves of the Chromas program (http://www.technelysium.com.au and Genedoc (http://www.psc.edu/biomed/genedoc).

Number of microsatellite loci in the human PrP gene: On average, one microsatite position per 1.2 kbp DNA was found. This frequency is much higher than the frequencies previously stated in the prior art for other genes. This difference could result from the fact that the information regarding microsat position in DNA was mostly obtained by screening banks of genomic DNA elements for muscular motifs and therefore underestimating the number of repeat motifs in the genome.

Screening of microsatellite positions for variants: the positions of the 16 identified

Microsate positions and the octapeptide repeat are shown in Figure 13 and Table 7A. In the 18 randomly selected people, oil variants occurred in 9 of the 17 Positions that were analyzed on (see Tab. 7A). Four of the variable microsatellite positions showed two eyes, and the other loci occurred in between 4 and 9 eyes. MicrosateUites with a higher repeat number were more polymorphic than those with a lower repeat number. For example. The 7 analyzed microsatten loci with 7 or fewer repeats occurred only in one or two external forms, whereas the 5 positions with> 12 repeats occurred in> 4 external oils. 4 loci had frequencies <0.4 for the most common AUel. A degree of heterozygosity of> 0.10 was observed in all positions. The DNA sequences of all fragments showed differences at different levels, sometimes even within a certain AU. In addition to polymorphic repeat numbers, SNPs, insertions and deletions in the microsate unit motifs, variants were also found in the non-repetitive sequences flanking the microsate unit repeats. In 5 of the 10 positions none of the oils corresponded to the GenBank sequence.

In summary, polymorphic microsate loci can thus also be used in humans for typing the PrP gene in order to diagnose AUele, from which a TSE predisposition of the wearer results. The carriers of certain oils can then, for example, adjust their lifestyle habits, in particular eating habits, to the predisposition.

Example 3:

Three of the microsate loci found in exemplary embodiment 1 in the region of the gene coding for prion protein (PrP gene) were tested for polymorphism in different breeds of sheep. The method according to the invention shown in FIG. 8 was carried out for the examination of the sample material. In addition, the relationships of the

Genotypes of these loci were analyzed for the ORF genotypes determined in preliminary examinations.

This is the expression of three variable positions in the Open Reading Frame (ORF) of the PrP gene, which in many studies have a close relationship to the earlyness for

Have shown scrapie. Dawson developed one of these ORF genotypes in 1998

Encryption based on disease risk. The data collected included 8 breeds of sheep with 623 animals from 47 herds for which blood samples had been collected. In 573 sheep, 3 microsatten loci were clearly typed.

MATERIALS AND METHODS

Animals, samples and preliminary examinations: 623 sheep from eight different breeds and two crossbreeding groups were included in the experiment (Table 8). Blood samples were obtained from all sheep and isolated from this gDNA. The genotypes for the ORF of the PrP gene had been determined from the gDNA (Table 8). According to the result of the ORF genotyping, the sheep were classified in risk classes (Tab. 2) with regard to the probability of illness for scrapie.

Eabormaterial: The following chemicals or reagents or the following materials were used for the experiments:

Agarose, Sea Kern® LE, FMC organic product, Rockland, Maryland, USA Alconox, Aldrich, Deisenhofen

Ammonium persulfate (APS), Pharmacia, Freiburg

AmpicüHn, Serva, Heidelberg

Bacto-agar, Difco, Detroit, USA

Bindesilan, Pharmacia, Freiburg Boric Acid, Merck, Darmstadt

CeHulose nitrate feeder SM 113 (pore size 0.45 μm), Sartorius, Göttingen

Deoxynucleotide triphosphate (dNTP mix), PEQLAB, Erlangen

Dextran blue, Pharmacia, Freiburg

DNA length standard, Gene Ruler ™ 100 bp DNA Ladder Plus, MBI Fermentas, St. Leon-Roth

Acetic acid, Merck, Darmstadt

Ethanol, Merck, Darmstadt

Ethidium bromide, Serva, Heidelberg

Etnylendiamintetraessigsäxire (EDTA), Merck, Darmstadt FicoU 400TM, Pharmacia, Freiburg Formamid, Sigma, Deisenhofen

H ₂ O (sterile) ROTIΘSOLV HPLC, Roth, Karlsruhe

Urea, Gibco, Eggenstein

Hydrolink Long Ranger Gel Solution, Serva, Heidelberg IPTG, Roth, Karlsruhe

Isopropanol, Roth, Karlsruhe

KaHumchlorid, Merck, Darmstadt

Kimwipes, Kimberly-Clark, Koblenz

N, N ^ NVtetramethylethylenediarned (TEMED), Serva, Heidelberg Perfecdy Blunt Cloning Kit for pT7Blue, Novagen, Schwalbach

Pipette tips, Roth, Karlsruhe

QIAquick Gel Extraction Kit and PCR Purification Kit, QIAGEN, Hüden

Reaction tubes (0.2 ml), PEQLAB, Erlangen

(0.5 ml, 1.5 ml, 2 ml), Eppendorf, Hamburg Sodium dodecyl sulfate (SDS), Sigma, Deisenhofen

Taq DNA polymerase with 10-fold reaction buffer and MgC ^, Eppendorf, Hamburg

Terazaki plates (MikroSample plate 60 weUs), Pharmacia, Freiburg

Tetracycline, Serva, Heidelberg

Tris (hydroxymethyl) aminomethane (Tris), Merck, Darmstadt Tryptone, Difco, Detroit

Yeast extract, Difco, Detroit

X-Gal, Roth, Karlsruhe

Aqua bidest was used to produce the following solutions and buffers. (manufactured by ultrafiltration, <16 MΩ-cm). Unless otherwise stated, storage was at +4 ° C.

APS stock solution: 10% (w / v) dissolved in H ₂ O; -20 ° C

Bindesuan stock solution: 40 ml ethanol; 98% (v / v); 150 µl of binding water; RT

Bindesüan solution: 800 μl of Bindesüan stock solution; 200 ul acetic acid; 10% (v / v); RT

Hydrolink solution (5%): 6 ml 50% HydroHnk; 25.2 g urea; 3.6 ml

10 x TBE; ad 60 ml H ₂ 0; 200 ul APS (10%); 50 ul TEMED O 2004/0206

41

Loading buffer: 50 ml formamide; 5 g mixed ion exchanger; 6 mg / ml

dextran; 1 ml EDTA (IM); pH 8.3; -20 ° C

10 x TBE buffer: 1 M Tris-HCl; 830 mM boric acid; 10 mM EDTA; pH 8.2;

RT stop buffer: 250 mM EDTA; 10% (w / v) FicoU 400TM; 1% (w / v)

SDS; 0.05% (w / v) bromophenol blue

Ethidium bromide solution: 500 μg ethidium bromide / ml H ₂ 0 LB medium: 10 g tryptone; 5 g yeast extract; 5 g NaCl; 14 g agar; ad 1 1

H ₂ O; autoclaved ampiculin: 50 mg / ml H ₂ 0; -20 ° C IPTG: 0.2 M IPTG; -20 ° C tetracycline: 5 mg / ml ethanol; -20 ° C X-gal: 10% X-gal in dimethylformamide; -20 ° C

The following were used as devices or devices:

DNA sequencer: A.L.F. (Automated Laser Fluorescence) DNA sequencer with ALFWin and AUelelinks software, Pharmacia, Freiburg

Electrophoresis chambers: DNA-Sub-CeUTM (15 x 15 cm), BioRad, Munich Pipettes: Eppendorf "Research", Hamburg Güson, "Pipetman", Vü-

Hers-le-Bel, France

Ultrapure water system: Barnstead E-Pure, Banstead, Dubuque, USA Thermocycler: PTC-200 with gradient function, MJ Research, Water- town, USA

Centrifuges: J6 B centrifuge, Beckman, Munich;

Benchtop centrifuge Biofuge A (Rotor 1386), Heraeus Sepatech,

Osterode

Amplification of the microsateUites by PCR: In our own investigations, PCR approaches (Tab. 9), a PCR program (Tab. 10) and primers (Tab. 11) were used, which had been established in preparatory work for the loci. Agarose gel electrophoresis of PCR products: To prepare the agarose gels, 2 g of agarose and 100 ml of IxTAE buffer were heated in the microwave until the agarose was dissolved, 20 μl of ethidium bromide were added and the mixture was poured into the gel chamber. The slotformer was used immediately afterwards. Approximately 30 minutes later it was removed and the gel was placed in the electrophoresis chamber which was filled with IxTAE buffer. 5 μl PCR products were mixed with 2 μl stop buffer and pipetted into the pockets. The separation process took approx. 40 min. The gel was then viewed under UV light. The result was read by comparison with the marker.

Fragment length analysis with the A.L.F. DNA sequencing machine: The PCR products were separated in 5% hydrogel gel with hooves of the A.L.F. The

The electrophoresis runs were controlled via the "ALFWin Instrument

Control ", the subsequent evaluation was carried out using the" AUelelinks "software

Automatic sequencer consists of an electrophoresis and a detection unit. This contained a laser and 40 photodiodes, which are arranged above the individual gel tracks. Since the forward primers of the PCR and thus also the AmpH fikates were fluorescence-labeled, they were excited when they passed by at the level of the laser. This led to an electrical signal in the photodiodes, which was digitized and stored in the connected computer. The fragment lengths of the individual oils were calculated on

Basis of the internal (99/198 bp) or external (additional Hch 80/160 bp) length standards, whereby the program AUelelinks converted the time measured values into bp and a representation of the

Fluorescence signals as a pherogram were possible (Fig. 9-11).

The HydroHnk gels were manufactured according to the instructions of the AX.F. HersteUers Pharmacia, Freiburg. After cleaning the glass plates with the fluorescence-free washing-up liquid Alconox, H ₂ O and 98% ethanol with subsequent air drying, the upper area was coated with binding water to fix the gel pockets. The plates were then assembled with spacers and light couplers to form a gel chamber. For the solution, 60 ml of filtered (membrane with 0.45 μm pores) and degassed (6 min) Long Ranger HydroHnk solution were mixed with 200 μl APS and 50 μl TEMED. The well mixed solution was poured between the glass plates free of air bubbles using a 60 ml syringe. A comb, which was pushed into the gel chamber, was used to shape the gel pockets. After about 90 minutes the gel was gone RT polymerized and could be installed in the sequencers. After the gel reached 50 ° C, the comb was carefully removed. After the gel had been installed, 0.6 × TBE buffer was added to the electrode container and the gel was loaded with sample material. The gels were used three times and the gel pockets were rinsed out with TBE buffer in between. The first time, more precise results were achieved than in the following two runs

For sample preparation and application, 0.1 - 4 μl DNA was mixed with 1 μl of a mixture of length standards and stop buffer in a Terazaki plate, depending on the PCR yield (1 μl DNA was used as standard). The samples were then denatured for 2 min at 80 ° C and then controlled on ice. After rinsing out the gel pockets with TBE buffer, the prepared samples were pipetted into them.

The running conditions for electrophoresis were entered using the ALFWin Instrument Control software and are listed in Table 12.

Cloning: In the fragment length analysis, unexpected fragments occurred at locus S24. To analyze whether the DNA section of the expected microsateUite is also present in the PCR product, individual sections of the DNA molecules were sequenced. For this purpose, the "PerfecÜy Blunt Cloning Kit" was cloned beforehand in the following experimental steps:

• Production of the PCR products (Locus S24) of the selected animals (approx. 10 ng in 100 μl solution).

• Cleaning of the PCR products with the PCR purification kit to obtain approx. 50 μl PCR product solution.

Examination of DNA products on agarose gel with regard to their quality (clean bands without by-products) and quantity.

• End conversion reaction: Incubation of 2 μl condensed PCR product as template in 2 μl water and 5 μl end conversion mix. Let it rest at RT for 30 min. Inactivate the mixture for approx. 5 min at 75 ° C, cool for 2 min on ice, then centrifugation.

• Ligation into the vector: 1 μl pT7Blue Blunt vector and 1 μl T4 DNA ligase were used, mixed carefully and then incubated for 1-2 h.

• Transformation in E. coH: 2 μl of mixture were pipetted into the thawed "Nova Blue Single ceüs" -Ahquot, then mixed carefully and stored on ice for 5 min as a suspension. The suspension was then heated for 35 s on heating blocks at a temperature of 42 ° C. and then placed on ice for 2 min. 300 μl of SOC medium were pipetted in and spread on agar plates. The plates were incubated for 24 hours at 38 ° C in an oven.

• Selection of the recombinant clones by means of Blue-Wlώe screening: The ligation point of the vector was in the LacZ gene, which in the presence of IPTG caused the colony to turn blue. When recombinant DNA was inserted, the gene sequence was interrupted and the affected colonies bHeben turned white. These white colonies were picked with pipette tips and suspended in 50 ul water. The pipette tips were spotted on a labeled plate in order to create a reserve colony.

Sequencing of DNA Inserts of the Recombinant Vector Molecules: The bacterial cell suspensions were heated at 99 ° C. for 15 min in order to kill the bacteria, then centrifuged and vortexed. A PCR then took place, in which the DNA in the reaction product was used as a template and the primers T7 and U19 (Tables 13 to 15).

The PCR products were checked using agarose gel electrophoresis. The clones whose PCR products had the expected length were ampHfected with the fluorescence-labeled primer pair for the locus S24 (Tab. 11) and the products on the A.L.F. dargesteUt. A clone whose fragment length matched the 152 bp length measured during genotyping was selected for sequencing.

A 100 ul PCR mix was made with primers T7 and U19 to get a sufficient amount of template for the sequencing reaction. The length and the concentration of the PCR products was checked again on an agarose gel. This was followed by the purification of the PCR products using the 'TCR Purification Kit'. The samples were then sequenced.

Statistical evaluation: The program package BIOSYS-1, version 1.7 (Swofford and Seiander 1989) was used for the frequency analysis of the microsate data and ORF data.

For codate-dominant inheritance, the allele frequencies for the microsate loci and PrP gene loci were calculated using the following formula:

_{Pi =}

2N

With:

pi: frequency of the i-th AUel, p AA. Frequency of the genotype with AUele i or j, i, j: indices of AUele, k: number of AUele of a locus, N: number of examined individuals.

The expected degrees of heterozygosity of a population for a locus with k AUelen were calculated using the hooves of the unbiased estimate (unbiased estimate, ΝEI 1978) using the following formula:

With:

H . Expected degree of heterozygosity of locus 1, frequency of the i-th AUel, N: number of individuals examined.

Deviations in genotype frequencies from the Hardy-Weinberg equilibrium were checked using the pooled χ ² test. Due to the low number of observations for individual genotypes (N <5) with the problem of overestimating the significance with low genotype expectations in the χ ² test, three genotype classes (i, ii, iii) are built in the pool method:

i: homozygous genotypes with the most common AUel,

H: aUe heterozygous genotypes with the most common AUel, iii: aUe ho o and heterozygous genotypes without the most common AUel.

MultifaktorieUes Variance Analysis ModeU with consideration of the 3 microsateUitenloci examined (SAS statistical package, V 6.12, GLM procedure)

Yi _jk i = μ + Sllt + S24 _j + SI5 _k + e _ß ι (ModeU 1)

With:

Yg _t j. Characteristic value (risk class for scrapie disease) of the animal ijkl, μ: population average,

S11; : fixed effect of the i-th S1 genotype, S24y. fixed effect of the jth S24 genotype,

S15 _k : fixed effect of the kth S15 genotype, e ^: residual error. j

(The fragment lengths given for the AUelen are given without the length unit Bp).

In embodiment 3, three of the informative polymorphic microsatuites obtained in embodiment 1, namely Sll, S15 and S24, in sheep breeds of Baden-Württemberg were analyzed in more detail and examined for their association with the three ORF variants that are important for scrapie reception. In order to be able to develop a cost-effective method for large numbers of animals, the PrP gene area was screened for polymorphic microsatelten loci (cf. 1st example). A selection of 3 loci that were easy to amplify was chosen from 6 suitable microsateurs, for which a codominant inheritance could be assumed with a high probability. The degree of polymorphism of these loci within the breeds of sheep in Baden-Württemberg was examined in order to be able to make statements about the susceptibility to scrapie on the basis of an examination of the relationships to the ORF genotypes determined from preliminary examinations and the risk classes derived therefrom with hooves of the polymorphic microsatten loci found ,

When analyzing the genotypes, there were no by-products, no SHppage effects and no preferred ampHfications. With two exceptions, each fragment length could be clearly assigned to a locus-specific AUel.

The first exception was the fragment length 146 at Locus S24, which occurred in a total of 6 cases with the breeds Schwarzkopf, Gotland and Suffolk. The uniqueness of the different fragment lengths 146 and 147 was reliably controlled on the one hand by repeating the PCR application on different gels, and by arranging animals with AUel 146 and 147 in successive traces of a gel. A fragment length difference around the precise value of 1 could not be traced back to track effects with simultaneous internal marker alignment. It can only be proven by sequencing whether fragment 146 is a very rare additional AUel. This could e.g. B. from a deletion of a base outside the actual microsate area from the allele with the fragment length 147.

The second exception was fragment length 152, which was observed in 25 merino sheep. This AUel never appeared homozygous but only in combination with AUel 144, AUel 147 or these two AUel together. In the 15 cases in which 3 peaks were observed at the same time, they always had comparable amp hours. By cloning and subsequent sequencing of AU 152, it was shown that this is identical to AU 147 with regard to the Mücrosatel sequence (FIG. 12). However, it differs from the microsate unit by a 5 bp long, 5 'side Insert Through further experiments it should be checked which causes led to the appearance of three apparently "outer" fragments per animal.

The information content of the 3 microsate loci showed mean degrees of heterozygosity> 0.35 for 4 of the 8 breeds considered (Gotland, Suffolk, Müchschaf and Texel) (Tab. 19). For the Dorper, Merinoland, Ile de France and Schwarzkopf breeds, the values were between 0.16 and 0.23. The information content was consistently lower for the ORF loci and showed values between 0.0 for Gotland and 0.29 for the Texel breed for the middle degrees of heterozygosity. These relatively low levels of information corresponded to the low number of observations by animals with a high risk of disease. In other words, low-risk genotypes have prevailed in the populations without the high-risk ones completely disappearing. This may be due to the fact that unfavorable PrP genotypes also have beneficial functions in the development of an animal, e.g. B. fertility or resistance to other pathogens.

The examination of the genotype frequencies for the equilibrium situation revealed a significant deviation from the HWE with the probability of iteration p <0.05 only for the ORF3 locus and only for the Merinoland breed in the χ ² test. The conspicuous overrepresentation of the homozygous animals can probably be explained with an average higher inbreeding coefficient, although sufficient kinship data were not available for testing.

The variance analysis results with ModeU 1 (Tab. 22), taking into account the 3 microsatellite loci as fixed factors, showed an almost uniform assignment of positive or negative effects to individual genotypes in the various separately examined

Sheep breeds. However, the differences in the estimated averages showed significant ones

Differences. In all 4 breeds analyzed with animal numbers> 60, the locus S24 took the highest part of the explained variance with significance level p <0.001 (F-Test, Tab. 22). This locus showed the homozygous type 144/144 with less

Disease risk as the homozygous type 147/147 (Tab. 23). The distinction between these two genotypes with regard to the expected disease key value varied from 0.5 in the Merino breed to 2.8 in the Suffolk breed. This locus is heterozygous for this locus

In the risk assessment, animals were almost halfway between the homozygous types. The big difference in the estimated mean difference was with highly likely to be attributed to breed-specific ORF characteristics and to different association sizes of the genotypes of the microsate locus locus to this investigated characteristic.

The locus Sll showed in the analysis of variance only in the breeds Müchschaf and Texel a significant influence on the trait constructed via ORF haplotypes with a pronounced increase in risk for animals with AUel 150 in the Texel breed. This allele was not sufficiently frequent in the breed Müchschaf for an examination, however, in this breed there was a higher risk for animals with AUel 156 compared to animals with AUel 158 at this locus.

For the Locus S15, a significant increase in risk for animals with the allele 173 could only be identified in the Texel breed. Correspondingly, the information content on this locus in the Merinoland, Müchschaf and Suffolk breeds was very low.

Based on the association with the given risk code defined here, a selection of sheep according to microsate genes with the characteristics 144/144 to S24, 152 / <156>, <150> to Sll and 179 / <173> to S15 with the prospect of minimizing the Risks of scrapie disease are recommended (o indicates AUE to be measured). However, this selection would include 47 ORF-type observations (ARQ / ARQ) with risk 4 in the available data. This is an indication that one or two further informative microsateurs should contribute to a genetic-level exclusion procedure if the validity of a genotype combination from microsatel loci is checked on the basis of ORF risk coding.

The results of embodiment 3 can therefore be summarized as follows:

The ORF genotypes showed only low information levels in the sheep breeds with values between 0.0 and 0.29 for the middle degrees of heterozygosity, which resulted in a value of 0.164 for the breeds. Nevertheless, 13 of a total of 15 ORF genotypes reported in the literature were found for the total material, with approx. 65% of the observations for the ARQ / ARQ (wüdtyp) and ARR / ARQ genotypes. The rare one Expression V (valine) on codon 136 with a high susceptibility to scrapie disease was only represented in this study with an age sequence of almost 3% across the breeds.

For the 3 microsate loci examined, mean heterozygosity levels of 0.16 to 0.57 with an average of 0.31 across the breeds could be determined in the individual breeds, with the locus S24 showing the highest information content in outside breeds except Gotland.

The microsate genotype sorted within ORF typing showed a uniform expression in the risk level 1 with the genotype combination 144/144, 152/152 and 179/179 for the loci S24, Sll and S15. Several genotype combinations occurred in the higher risk classes. In these classes, it was not possible to assign certain microsate genotypes to the ORF genotypes discreetly, but there were clear clusters of certain oils in the risk classifications.

In the analysis of variance analysis of the associations of the genotypes with the risk characteristic constructed from the ORF types, highly significant relationships could be established. In the evaluations of the breeds with more than 60 observations, the Locus S24 had the highest anteü of the declared variance without exception. The estimates showed the homozygous type 144/144 in each breed with a significantly lower risk of disease than the type 147/147, while the heterozygous animals were in the estimates in between.

According to the present exemplary embodiment, the inclusion of further informative microsatel loci and an association study with diseased and non-diseased sheep would be desirable for a high degree of clarification of the statement regarding the susceptibility to scrapie

Embodiment 4

The microsate unit loci in the human PrP gene recognized as polymorphic according to embodiment 2 were examined with regard to their association with different dementia groups in humans. For this purpose the microsatellite positions M01, M02, M09, MIO, Ml 2, M03, MM03, MM04 with regard to the occurrence of oil in people with CJD and other people with dementia (both groups included 100 people each). A group of 18 healthy people ("Han") served as a comparison group. Furthermore, the octapeptide region already known from the prior art was included in the investigation. In addition, the variant considered "pathogenic" in codon 129 (SNP 129) was used as a comparison. This variant has hitherto recognized the strongest associations with CJD.

The evaluation according to haplotypes compares the oil frequencies. The further evaluation was carried out according to genotype frequencies. Microsatlet positions with many AUele were not included in the genotype evaluation.

The results of these investigations are shown in Table 25. In Table 25 "AUele" means the test for differences between the 3 groups (CJD: people with Creuzfeldt-Jakob disease; dementia: people with other dementias; Han: comparison with 18 healthy people).

The individual data are documented in Tab. 26.

The results of these investigations can be summarized as follows:

For the variants of codon 129 in the PrP-ORF, no significant differences between the groups of people could be verified, possibly due to the small number of studies. Nevertheless, the observations remain in a direction similar to that already known in the art. Compared to the comparison group, the same frequency changes can be seen in both the CJD and dementia groups. When evaluating according to oil frequencies, the difference between the dementia group and the comparison group is statistically significant.

In the case of the octapeptide region (MOct = octa), results corresponding to the prior art were found. In particular, 3 of the AU oils deviating from the usual 5 repeats occurred in the CJD group, while one was found in the dementia group. In 6 of the 8 new microsat position in the human BnP gene, the oil distribution differs significantly in at least one of the comparisons. Another position (MIO) is significant when evaluating by genotype. In particular, it should be noted that there are strong allele frequency differences between the sick people and the comparison group for positions MO1 and M03 and significant differences between the CJD and dementia groups in positions MM03, MM04, M09 and M12. The determined microsatellite variants achieve such tight associations that a highly significant association between the polymorphic microsat position according to the invention and various dementia groups in humans could be ensured even when small groups of people were examined.

In summary, clear conspicuities in the distribution of the microsatellite variants according to the invention can be determined both in CJD and in other dementias. The DNA variants according to the invention in the PrP gene are therefore more suitable for an analysis of the predisposition than the position known in the prior art (SNP in codon 129) with the strongest relationship to the incidence of CJD.

credentials

Abajian (1994): Sputnik, http: / /abajian.net/sputnik/

Auge-Gouüou et al. (1995): Human and other mammalian genomes contain ttansposons of the mariner famüy. FEBS Letters 368, 541-546

Belt et al. (1995): Identification of five aUeHc variants of the sheep PrP gene and their association with natural scrapie. Journal of General Virology 76, 509-517

Bossers et al. (1996): PrP genotype contributes to deteö ining survival times of sheep with natural scrapie. J. Gen. Nirol. 77, 2669-2673 Brown (1999) Modern Genetics. 2nd edition, Spektrum-Nerlag, Heidelberg

Bruce and Dickinson (1987): Biological evidence that scrapie agent has an independent genom. J. Gen. Virol. 68, 79-89

Buhler et al. (1993): Mice Devoid of PrP Are Resistant to Scrapie. CeU 73, 1339-1347

Buhler et al. (1992): Normal development and behavior of mice lacking the neuronal ceUsurface PrP protein. Nature 356, 577-582 Caughey (1991) CeUular metaboHsm of normal and scrapie-associated forms of PrP. Sem. Virol. 2, 189-196

Christopher et al. (2000): Fourteen and counting: unraveHng tinucleotide repeat diseases. Hum. Mol. Genet. 6, 909-916 CoUinge, J. 2001: Prion diseases of humans and animals: Their causes and molecular basis. Ann. Rev. Neurosci. 24, 519-550.

Comincini et al. (2001): Genomic organization, comparative analysis, and genetic polymorphisms of bovine and ovine prion Doppel genes (PRND). Mamm. Genome 12, 729-733 Dawson et al. (1998): Guidance on the use of PrP genotyping as an aid to the control of clinical scrapie. The Net. Rec. 142, 623-625

DrögemüUer et al. (2001): Scrapie resistant in less than ten years! German sheep breeding 2/2001, 32-36

DrögemüUer et al. (2001): PrP genotype ftequencies in Germann breeding sheep and the potential to breed for resistance to scrapie, Veterinary Record 149, 349-352

Dron and ManueHdis (1996): VisuaHsation of viral candidate cDΝAs in infectious brain fractions from Creutzfeldt-Jacob diease by representational difference analysis. J. Eurovirol. 2, 240-248

Gasset et al. (1993): Perturbation of the secondary structure of the scrapie prion protein under conditions that alter infectivity. Proc. ΝatL Acad. Be. USA 90, 1-5

Geldermann et al. (2002): Structure of the gene encoding prion protein in sheep and cattle. Nova Acta Leopoldina (in press)

Goldmann et al. (1991): Different scrapie-associated fibril proteins (PrP) are encoded by Hnes of sheep selected for different aUeles of the Sip gene. J. Gen. Virol. 72, 2411-2417 Goldmann et al. (1990): Two aels of a neural protein gene Hnked to scrapie in sheep. Proc. Natl. Acad. Be. USA 87, 2476-2480

Griffin and Griffin (ed.), PCR Technology: Current Innovation, CRC Press, Boca Raton, FL, 2001

HiU et al. (1999): Protease-resistant prion protein produced in vitro lacks detectable infectivity. J. Gen. Virol. 80, 11-14

Horiuchi et al. (1998) Genomic structure of the bovine PrP gene and complete nucleotide sequence of bovine PrP cDNA. Anim Genet. 29, 37-40

Hsiao et al. (1989): Linkage of a prion protein missense variant to Gerstmann-Straussler syndrome. Nature 338, 342-345 Hunter et al. (1991): Restriction fragment length poly orphisms of the scrapie-associated fibrü protein (PrP) gene and their association with susceptibüity to natural scrapie in British sheep. J. Gen. Virol. 72, 1287-1292

Hunter et al. (1994): Frequencies of PrP gene variants in healthy cattle and cattle with BSE in Scotland. Vet Rec. 135, 400-403

Hunter et al. (1996): Natural scrapie in a closed flock of Cheviot sheep occurs only in specific PrP genotypes. Archives of Virology 141, 809-824

Hunter et al. (2000): Sheep and goats: natural and experimental TSEs and factors influencing incidence of disease. Arch. Virol. Suppl. 16, 181-188 Junghans et al. (1998): Genotyping of German sheep with respect to scrapie susceptibüity. Vet. Rec. 143, 340-341

Laplanche et al. (1993): PrP polymorphisms associated with natural scrapie discovered by denaturing gradient gel electrophoresis. Genomics 15, 30-37

Lee et al. (1998): Complete Genomic Sequence and Analysis of the Prion Protein Gene Region from Three MammaHan Species. Genome Res. 8, 1022-1037

Lee, HS, Sambuughin, N., Cervenakova, L., Chapman, J., Pocchiari, M., Litvak, S., Qi, HY, Budka, H., del Ser, T., Furukawa, H., Brown , P., Gajdusek, C, Long, JC, Korczyn, AD, Goldfarb, LG, 1999: Ancestral origins and worldwide distribution of the PRNP 200K mutation causing famüial Creutzfeldt-Jakob Disease. At the. J. Hum. Genet. 64, 1063-1070. Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 3rd ed., Cold Spring Harbor, NY, 2001

Manson et al. (2000): A single amino acid alteration in murine PrP dramaticaUy age TSE incubation tirne. Arch Virol Suppl 16, 95-102

Murata (2001): Clinical significance and strategies to analyze genetic polymorphisms. Rinsho Byori 49, 153-156

Nadir et al. (1996): MicrosatelHte spreading in the human genome: evolutionary mechanisms and structural impHcations. Proc. Natl. Acad. Be. USA 93, 6470-6475

Nei (1978): Estimation of heterozygosity and genetic distance from a smaU number of individuals. Genetics 89, 583-590 Neibergs et al. (1994): Polymorphism analysis of the prion gene in BSE-affected and unaffected cattle. Animal Genet. 25, 313-317

O'Doherty et al. (2000): Detection of polymorphisms in the prion protein gene in a population of Irish Suffolk sheep.Vet Rec. 146, 335-338

Ohara (2000): Triplet repeat disease from the aspect of psychiatric disease. Νihon Shinkei Seishin Yakurigaku Zasshi 20, 213-214 O'Rourke et al. (2000): Preclinical diagnosis of scrapie by immunohistochemistry of third eyeHd lymphoid tissue. J. Clin. Microbiol. 38, 3254-3259

Palmer et al. (1991): Homozygous prion protein genotype predisposes to sporadic Creutzfeld-Jakob disease. Nature 352, 340-342 Pan et al. (1993): Conversion of α-heHces into ß-sheets features in the formation of the scrapie prion proteins. Proc. Natl. Acad. Be. USA 90, 10962-10966

Prusiner (1982): Novel protein-like infectious particles cause scrapie. Science 216, 136-144

Prusiner (1998): Prions. Proc. Natl. Acad. Be. USA 23, 13363-13383

Prusiner (2000): Prion diseases. Zeit Document 4.2000, 4-14 Rossi et al. (2001): Onset of ataxia and Purkinje ceU loss in PrP nuU mice inversely correlated with Dpi level in brain. EMBO J 20, 694-702

Schlötterer (2000): Evolutionary dynamics of microsathe DNA. Chromosoma 109, 365-371

Thorgeirsdottir et al. (1999): PrP gene polymorphism and natural scrapie in Icelandic sheep. J. Gen. Virol. 80, 2527-2534 TranuHs et al. (1999): Prion protein gene polymorphisms in sheep with natural scrapie and healthy controls in Norway. J. Gen. Virol. 80, 1073-1077

Tripathi and Brahmachari (1991): Distribution of simple repetitive (TG / CA) n and (CT / AG) n sequences in human and rodent genomes. J. Biomol. Dyn. 9, 387-397

Vaccari et al. (2001) PrP genotype in Sarda breed sheep and its relevance to scrapie. Letter report. Arch. Virol. 146, 2029-2037

Wahls et al. (1990): The Z-DNA motif d (TG) 30 promotes reeeption of information during gene conversation events whüe stimulating homologous recombination in human ceUes in eulture. Mol. CeU Biol. 2, 785-793

Wükens (1997): The secret of the prions. http: / /www-pubHc.rz.uni- duesseldorf.de/~meske/biokular/12/PRJONl.HTM

Abbreviations

The following abbreviations have been used in the present patent application:

A.L.F. Automated Laser Fluorescence

APS ammonium persulfate BovB DNA repeat family from the class SINE (Short Interspersed

Elements)

Bov-tA2 / -tA3 DNA repeats from the FamiHe BovA, class SINE (Short Interspersed

Elements)

Bp base pairs

BSE Bovine Spongiform Encephalopathy

CJD Creutzfeldt-Jakob disease

DNA deoxyribonucleic acid

EDTA ethylenediaminetetraacetic acid gDNA genomic DNA

HWE Hardy-Weinberg Equüibrium

IPTG isopropyl-β-D-thiogalactopyranoside

LacZ gene gene of the β-galactosidase mRNA messenger RNA

MS microsate unit

ORF Open reading frame

PCR polymerase chain reaction

PrP prion protein

PrP gene Prion protein coding gene

RNA ribonucleic acid

RT room temperature

Taq DNA polymerase from the bacterium Thermus aquaticus

TBE buffer made from TRIS, boric acid and EDTA

TEMED N, N, N ^ NVTetrώnethylethylenendiamid

Tris tris (hyckoxyrnethyl) aminomethane

TSE transmissible spongiform encephalopathy

UTR untranslated region attachment

Tab. 1: Amino acid polymorphisms in the sheep's PrP gene (after Hunter (2000), supplemented)

Codon amino acid breed / country reference

No. (wüdtyp / mutante)

112 Met / Thr Romanov, Ile de France Laplanche et al. (1993

136 Ala / Val Various Goldmann et al. (1991)

137 Met / Thr Flemish Texel Bossers et al. (1996)

138 Ser / Asn Island, Thorgeisdottir et al. (1999)

Norway TranuHs et al. (1999)

141 Leu / Phe Swifter, UK breeds Bossers et al. (1996)

143 His / Arg Dorset O'Rourke et al. (2000)

151 Arg / Cys Island, Thorgeisdottir et al. (1999)

Norway TranuHs et al. (1999)

154 Arg / His Various Goldmann et al. (1990)

171 Gin / Arg Not specified Goldmann et al. (1990)

Gln / His Various Belt et al. (1995)

176 Asn / Lys Sarda Vaccari et al. (2001)

211 Arg / Gin Flemish Swifter, Texel Bossers et al. (1996)

Tab. 2: PrP genotype classification in risk groups in sheep (characteristic Risk; Dawson et al. 1998)

Group genotype interpretation

R5 VRQ / VRQ sheep with the highest scrapie receptivity ARQ / VRQ ARH / VRQ

R4 AHQ / VRQ Occasional occurrence of scrapie and an increased

ARR./VRQ Occurrence of congenial offspring possible in

ARQ / ARQ Comparison to the R3 offspring

ARQ / ARH

ARH / ARH

R3 ARQ / AHQ Lower scrapie receptivity of the individual sheep, but AHQ / ARH receptivity of the offspring depending on the genotype of the ARR / ARH second parent ARR / ARQ

R2 AHQ / AHQ Low scrapie reception of the individual sheep ARR / AHQ

Rl ARR / ARR Very low scrapie EmpfangHchkeit of individual sheep and a low risk in the F _r generation

Tab. 3A: MicrosateUitenloci in the bovine PrP gene

Locus ¹⁾ Position ²⁾ (bp) MS motif ³ * ¹ primer sequence ⁴⁾ PCR ⁵⁾

Start end T _A (° C) MgCl ₂ (mM)

ROI 444 463 (CAGTT) 4 AAT TAG AAC ACT TCC TAA CAC CA 62 1.5 CAT GAG TTT GAG TAA GCT CTA GG

R02 4121 4130 Crc) ₅ GGT TCA CAG ATC CAC AGT CT 62 2.0 GTG GTA CAA GGT CTA GTG AGG T

R03 7615 7629 (AGQ ₅ GTG TTC TTG CCT GGA GAG TC 62 2.0 CCA CTG CTG TCT ATA CTC CTC A

R04 19808 19817 (GA) ₅ TGT GGT GTT CTC ACA TCA TAA AAT C 62 2.0 CCA CTG CTG TCT ATA CTC CTC A

R05 25288 25307 (TTTGT) ₄ AAT CAG TGG GAT CAT AGA CTT TCA 55 2.0 TCC ATC TAG CTT CCA AAC TAT TGA C

R06 30633 30652 (TCAGT) 4 GGG AGA AAT AAG ACG GTA ACA GG 58 2.0 TCC ATC TAG CTT CCA AAC TAT TGA C

R07 32320 32339 (TTCAG) 4 GCA TTC TAT ITA TTC CCC TCA GC 55 1.5 CAT GGG GTC GCA AAG AGT

R08 37891 37910 (TTCAG) 4 GAT AAG AGA TTA ATT TCC AAC AT 55 3.5 GTT GCA GAG TCA GAC ATG A

R09 39943 39957 (ACTGA) ₃ AGA GTT GAC CAT GAC TGA GC 55 1.5 GCC AAA AAT GGA CTG ATG

RIO 44220 44239 (ACTGA) ₄ GAC TCA ATG GAC ATA GGT TTG 55 3.0 TCC TGT GAT TAA CTT GCT AGA GT

Rll 44507 44530 (CA) i2 TAG ATA GTG TCA GAA TTG AGT TGA A 55 3.0 AAT CTT TCT TAT CAC TGG TTA AAA T

R13 46259 46278 (ACTGA) ACT GAG GAT GAG ATG GTT GGA T 55 1.5 CTG GGG TCT GGA TAA AAC ACA G

R14 48409 48420 (ATC) ₄ TGC CTA ATA CTC ATT TCT AGC TG 62 2.0 TGA TGA ATA TAT GAA TGT GGA TG

R16 50471 50495 (T) 25 TTG ATT ATT AAA CAA CGA GAA GTC 55 2.0 TTG TTA AGA ATC TGG AGA CGA

R17 53219 53233 (ITG) 5 GGA ATA AGA TGA ATG GGA CA 55 1.5 CAA GTA TCA GAA TGG ATT GGA

R18 54990 55018 129 CAT TGT ACA TAC TAG CTG TTC CAT 55 2.0 TTT CTA AGT AGT CAT ATT CCT TGC

R19 60452 60460 (CAA) ₃ GAG TAG GAC ACG ACT GAA ATG AC 62 2.0 GGT AGG GTA AGT TGC TCT GGT G

R21 62703 62717 (TTCAG) 3 TCC TCC TAT TCC TAG TCT GCT 55 1.5 TGG GAG TTG GTG ATA GAC AG

R22 64685 64700 (AGTG) GCA CCA AAA ATT AAG AGA AAA TA 55 3.0 GTA AGA AAG GCT GTG TTC ATA AT

R23 66178 66192 (CAC) ₅ CCA ACC AAG TGT ACT ACA GAC 55 2.0 ATT ATC TTG ATG TCA GTT TCG

R24 68762 68785 (AAAACA) ₄ ATA ACT TTG ATG TTT GAG TTC CA 55 3.0 GTA TCC ACT GTT CAT CAA AAT CT

R25 68926 68937 (ACC) ₄ ATG GAA GAA ATT GTA GGG TGA G 62 3.0 GCT GCT TTC AGT TGG TCT AAT

R26 72474 72498 (ATCAG) ₅ AGA GGC TGT CTT TTC TCC ATT G 62 2.0 CGG GAG TTG GTG TTG GAC

R27 74333 74340 (AC) ₃ TCT CCA AGA AGC CAC ACC TC 55 1.5 CTG CTC CAG GGA AAG AAC AG Tab. 3B: Microsatelite loci in the ovine PrP gene

Locus ^••) position ²⁾ (bp) MS motif ³⁾ primer sequence ⁴ ) PCR ⁵⁾

Start end TA (° C) MgCl ₂ (mM)

S01 - - (CAGTT) ₄ AAT TAG AAC ACT TCC TAA CAC CA 62 1.5 CAT GAG TTT GAG TAA GCT CTA GG

S02 - - (TC) 5 GGT TCA CAG ATC CAC AGT CT 62 2.0 GTG GTA CAA GGT CTA GTG AGG T

S03 - - (AGC) ₅ GTG TTC TTG CCT GGA GAG TC 62 2.0 CCA CTG CTG TCT ATA CTC CTC A

S04 - - (GA) s TGT GGT GTT CTC ACA TCA TAA AAT C 62 2.0 CAA GGA TTC ACA AGT AGT GGG TTA C

S05 - - (TTTGT) ₄ AAT CAG TGG GAT CAT AGA CTT TCA 55 2.0 TCC ATC TAG CTT CCA AAC TAT TGA C

S06 - - {TCAGT) ₄ GGG AGA AAT AAG ACG GTA ACA GG 58 2.0 TCG AAG AAC ATG AGT TTG AGT GA

S09 - - (ACTGA) ₃ AGA GTT GAC CAT GAC TGA GC 55 1.5 GCC AAA AAT GGA CTG ATG

S10 301 320 (ACTGA) ₄ GAC TCA ATG GAC ATA GGT TTG 55 2.0 TCC TGT GAT TAA CTT GCT AGA GT

Sll 590 613 (CA) i2 TAG ATA GTG TCA GAA TTG AGT TGA A 55 3.0 AAT CTT TCT TAT CAC TGG TTA AAA T

S12 1033 1047 (CTG) ₅ AAG CAC AAG AAC AAG ATG AGA AC 55 1.5 CTC AGA GTC AGA CAC AAC TGA AG

S13 2477 2496 (ACTGA) ₄ ACT GAG GAT GAG ATG GTT GGA T 55 1.5 CTG GGG TCT GGA TAA AAC ACA G

S14 4651 4662 (ATC) ₄ TGC CTA ATA CTC ATT TCT AGC TG 50 4.0 TGA TGA ATA TAT GAA TGT GGA TG

S15 6627 6641 (GTT) ₅ GAT ATT TTC GCT GTC TCG ACT G 55 3.0 GGA CTT CTC CTC GTT GTT TAA TAA TC

S17 9433 9447 <TTG) ₅ GGA ATA AGA TGA ATG GGA CA 55 1.5 CAA GTA TCA GAA TGG ATT GGA

S18 11277 11291 I 5 CAT TGT ACA TAG TAG CTG TTC CAT 55 2.0 TTT CTA AGT AGT CAT ATT CCT TGC

S19 16748 16756 (CAA) ₃ GAG TAG GAC ACG ACT GAA ATG AC 59 4.0 GGT AGG GTA AGT TGC TCT GGT G

S20 18100 18119 (ACTGA) ₄ CTC GAT GGA CGT GAG TCT GA 55 1.5 AAA AAG GAA ATG AGG TGA GAA CC

S21 19372 19386 (TTCAG) 3 TCC TCC TAT TCC TAG TCT GCT 55 1.5 TGG GAG TTG GTG ATA GAC AG

S22 21383 21398 (AGTG) 4 GCA CCA AAA ATT AAG AGA AAA TA 55 3.0 GTA AGA AAG GCT GTG TTC ATA AT

S23 22853 22867 (CAC) ₅ CCA ACC AAG TGT ACT ACA GAC 55 2.0 ATT ATC TTG ATG TCA GTT TCG

S24 25422 25433 (CAA) ₄ ATA ACT TTG ATG TTT GAG TTC CA 55 2.0 GTA TCC ACT GTT CAT CAA AAT CT

S25 25580 25591 (ACC) ₄ ATG GAA GAA ATT GTA GGG TGA G 50 1.5 GCT GCT TTC AGT TGG TCT AAT

S27 30168 30175 (AC) ₄ TCT CCA AGA AGC CAC ACC TC 55 1.5 CTG CTC CAG GGA AAG AAC AG Tab. 4A: Number and size of identified aUeler fragments in the bovine PrP gene

Locus A * acc. ^b allele fragment sizes (bp) microsatellite sequences2 ^e differences in flanking regi number of observed ^f alleleS

ALF ^C Sequ

ROI R-138 (CAGTT) ₃ CAGCT

R03 R - 160 (AGQ ₃ CGC (AGC)

A AF532794 158 160 (AGC) ₃ CGC (AGC) (R) kD 54

B AF532795 160 162 (AGC) ₃ CAC (AGC) 2 bp ins., 3 SNP 10

R04 R _ 147 (GA) ₅

A 145 64 R05 R _ 148 (TTTGT) ₂ (T) ₅ (TTTGT)

A AF532796 128 129 (TTCT) ₅ (TTTGT) 13 bp del., 2 SNP 5

B AF532797 148 148 (TTTGT) ₂ (T) ₅ (TTTGT) (R) kD 59

R06 R - 155 (TCAGT) 4

A 152 64 R07 R - 235 CTTCAG) ₊

A 236 64 R08 R - 128 CTTCAG) ₄

A 129 64 R09 R - 133 (ACTGA) ₃

A 132 64 RIO R - 155 (ACTGA) ₄

A 155 64

R13 R - 181 (ACTGA) ₂ ATTGA (ACTGA)

A 180 64

Tab.4A (cont.)

Locus A * acc. allelic fragment sizes (bp) sequence microsatellite ^e differences in flanking REGI number beobachonen ^f Teter Alleleε

ALF ^C sequence ^d

R14 R _ 140 ATC ₄

J AF532806 167 167 (r) ₅ G (T) ι ₁ CC (T) 4C (T) 4 2 x 1 Bp-Del., 4 SNP 2 (Nanjing)

R17 R - 139 (TTG) ₄ TTC

A 138 - - - 64

R18 R - 173 (Tj5C (T) 3C (T) i9

A AF532807 167 168 (I) ₅ C (T) 3C (T) 3C (T) ιo 2 SNP 1 (Nanjing)

B AF532808 168 169 () ₅ C (T) ₃ C r) ₃ C (T) ιι 2 SNP 3

C AF532809 171 172 (T) ₅ ccrj ₃ ccrh ₈ 2 SNP 15

D AF532810 172 173 (I ₅ C (I ₃ C (I) i9 (R) 1 SNP 26

E 173 - - - 15

F AF532811 174 175 CT) ₅ C () 3C (T) 3Ccr) i7 kD * 4

R19 R - 208 (CAA) ₃

A 206 - - - 64

R21 R - 136 (TTCAG) 3

A AF532812 134 136 (TTCAG) 3 (R) k.D. 62

B AF532813 138 140 (TTCAG) ₃ (R) 4 bp ins., 2 SNP 2

R22 R - 108 (AGTG) 2AGTA (ACTG)

A 107 - - - 64

R23 R - 145 (CAC) CAA

A 143 - - - 64

Tab.4A (cont.)

Locus AUel ^{* 1} accession no. ^b allele fragment sizes (bp) microsatellite sequence ^e differences in flanking regi number of observations of ^f alleleS

ALF ^C sequence ^d

R24 R - 53 (A) _Ö (AAAACA) 3

A AF532814 145 47 (AAAACA) ₃ kD 1 (Yerli Kara)

B AF532815 151 53 (A) _< -AAACCA (AAAACA) ₂ kD 63

R25 R - 77 (ACC) AGC (ACC) ₂

A 177 60 R26 R - 60 (ATCAG) ₅

A AF532816 148 50 (ATCAG) ₃ IS 7

B 153 1 (Busa)

C 158 54

R27 R - 113 (AC) ₃

A 111 64

Tab. 4B: Number and size of allelic fragments identified in the ovine PrP gene

Locus AUel ^a accession no. ^b allele fragment sizes (bp) microsatellite sequence ^e differences in flanking regi number of observed alleles

ALF ^< - sequence ^d

SOI R-138 (CAGTT) ₃ CAGCT

A 136 - - - 60

S02 R - 162 (TC) ₂ CC (TC) ₂

A AF532817 157 159 (TC) ₂ CC (TC) CC 2 bp del., 1 bp del., 7 SNP 64

S03 R - 160 (AGC) ₃ CGC (AGC)

A 163 - - - 66

S04 R - 147 (GA) ₅

A AF532818 139 141 (GA) ₅ (R) 7 bp del., 1 bp ins., 5 SNP 35

B 140 - - - 10

C AF532819 146 148 (GA) ₅ (R) 1 bp ins., 5 SNP 21

S05 R - 148 (TTTGT) ₂ TTTΓΓ (TTTGT)

A 128 - - - 1 (White Karaman)

B 138 - - - 41

C 142 - - - 4

D 145 - - - 8

E 148 - - - 6

S06 R - 155 (TCAGT) 4

A AF532820 155 158 {TCAGT) ₅ 2 bp del., 7 SNP 62

S09 R-133 (ACTGA) ₃

A 132 - - - 66

S10 R - 155 (ACTGA)

A 155 - - - 66

Sll R - 160 (CA) «

A AF532821 151 152 (CA) ₈ kD 14

B AF532822 153 154 (CA) ₉ kD 43

C AF532823 155 156 (CA) ιo k.D. 2

D AF532824 157 158 (CA) π k.D. 3 (Texel)

E AF532825 159 159 (CA) «(R) 1 bp del. 4

S12 R-142 (CTG) ₄ CTA

A 141 - - - 66

Tab.4B (contd.)

Locus allel ^a acc. ^b allelic fragment sizes (bp) sequence microsatellite ^e differences in flanking REGI number beobachonen ^f Teter AUeles ALF ^C sequence ^d

S13 R - 181 (ACTGA); - ATTGA (ACTGA)

S14 R - 139 (ATC) ₂ TTC (ATC)

A 138 66 S15 R _ 179 <T) π (GTT) ₄ TT

A AF532826 173 173 (T) ₈ (GTT) ₃ TT 1 SNP 2

B AF532827 179 179 (T) ₈ (GTT) ₅ TT kD 48

C AF532828 182 182 (T) π (GTT) ₅ TT 1 SNP 16

S18 R - 141 (**

A AF532829 137 139 (1) 13 k.D. 19

B AF532830 138 140 1 SNP 10

C AF532831 139 140 (T) u k.D. 20

D AF532832 140 141 e ⁱ ) « ⁽ R ⁾ kD 9

S19 R-232 (CAA) ₃

A 230 62 S20 R _ 148 (ACTGA) * iACAGT

A 147 66 S21 R - 140 TTTAG (TTCAG) 2

A 138 66 S22 R - 108 (AGTG) * ₃ ACTG

A 108 66 S23 R - 145 (CAC) ₄ CAA

A 143 66 S24 R - 149 (CAA) ₄

A AF532833 144 146 (CAA) ₃ 1 SNP 34

B AF532834 147 149 (CAA) ₄ (R) 1 SNP 32

S25 R - 154 (ACC) ₄

A 153 66

Notes on TabeUen 4A and 4B: ^a R: GenBank reference; bovine motifs are used for loci without GenBank information at

Sheep used (SOI to S06); A, B, etc: found oil. ^b GenBank accession number ^c fragment lengths determined with the ALF sequencing device fragment lengths calculated on the basis of the results of DNA sequencing ^e (R): microsate sequence identical to GenBank ^f -: no sequence data; kD: no difference compared to the DNA sequence in GenBank; Del .: Deletion; Ins .: insertion; SNP: single nucleotide polymorphism; *: Not all variants are specified or additional variants are not certain ^ε The breeds are specified if an allele was only found in one breed. For a locus, the sum of the AUele is less than 2n animals, unless all samples allowed specific PCR amplification.

61

Tab. 5: Polymorphism values of the examined PrP microsate loci

(A): bovine PrP gene

Locus number of alleles Frequency of the previously observed heterosexuals

R03 2 0.84 0.25

R05 2 0.92 0.09

Rll 4 0.77 0.34

R16 1 0.22 0.47

R18 6 0.41 0.41

R21 2 0.97 0.06

R24 2 0.98 0.03

R26 3 0.87 0.19

(B): ovine PrP gene

Locus number of alleles Frequency of the previously observed degree indicates AU of heterozygosity

S04 3 0.53 0.24

S05 5 0.68 0.63

Sll 5 0.65 0.52

S15 3 0.73 0.33

S18 4 0.34 0.24

S24 2 0.52 0.36

Tab. 6: Comparison of microsatellite loci in bovine and ovine genes

Gene "number of microsatellite reions (> 3 repeats) in

Total exons introns 5 'flanking region

(<1 kBp)

Bp ²⁾ n MS / kBp Bp ² > n MS / kBp Bp ²⁾ n MS / kBp Bp ²⁾ n MS / kBp

beef:

PrP 4242 9 2.12 15988 15 0.94 1000 1 1.00 78056 83 1.06

IGFBP3 2434 1 0.41 6023 7 1.16 1000 0 0.00 13720 13 0.95

LZ 1615 2 1.24 7079 12 1.70 1000 1 1.00 12039 18 1.50 ß-casein 1089 1 0.92 7409 9 1.21 1000 2 2.00 10338 12 1.16

Sheep:

PrP 4178 8 1.91 16452 13 0.79 1000 2 2.00 31472 36 1.14

ACC-α 350 0 0.00 5353 10 1.87 1000 3 3.00 10066 15 1.49

CFTR 424 0 0.00 27702 34 1.23 1000 0 0.00 38503 42 1.09 ß-Casein 1088 1 0.92 8061 9 1.12 1000 0 0.00 13785 13 0.94

Abbreviations / GenBank accession numbers: PrP: Prion protein coding gene / AJ298878 (bovine), U67922 (sheep) IGFBP3: Insulin-like growth factor binding protein-3 / AF305712

LZ Lysozyme gene / U25810 β-casein: beta-casein gene / M55158 (bovine), X79703 (sheep) ACC-α acytyl-CoA carboxylase alpha gene / AJ292285

CFTR for regulator of transmembrane conductivity, involved in cystic fibrosis, coding gene (AF325412 - AF325422) ²⁾ Length of the gene region searched

Tab. 7A: Microsate motifs in the human PrP gene

Locus ^a) Position ¹⁵⁾ (bp) MS motif ^c) Primer sequence 'PCR ^') Number of frequencies of the previous - observed

Alleles,. ", Heterozygo

Start end T _A (° C) MgCl ₂ (mM) scanning AUels, -, deep

MOl 3621 3641 (ATA) ₇ ATATGTTTGCTTCCCCATC 60 2.5 0.86 0.28

CCTGGCATCTAAATTCTTGT

M02 25415 25428 (GA) ₇ CCTAGCTCCCTTACCTCTGT 57 2.1 0.94 0.11 TGGCATATACAGGACAACAC

M03 39450 39505 (GT) ₂₁ TACCACCACACCTTCCTAAT 58 * 2.5 0.39 0.83 TTTTGGTCTTTTTCATTACAGA

M04 50315 50326 (AGG) ₄ TAGGCATAGTGGTGCATGA 60 2.5 CACCCATTACTTTCTCTTTGTT

M05 58376 58385 (AC) ₅ ATAGGAACAGGGAATTGGAT 55 2.5 CCCCTTACTGGTTAGCTTTT

M06 72392 72416 (TTTGT) ₅ GCACAGTCGAAAATCTGC 60 2.5 TGTAGTCCCAGCTACTCAGG

M07 78300 78313 (TA) ₇ ACTCCGTCTCAAAAATAAAG 50 2.5 AATCACCTGTTATCCACCA

M08 92615 92624 (TC) ₅ GTTGGGATTTTGTTTTGC 55 2.5 CCATACTCCACATCATTCCT

M09 108429 108476 (TAAA) ₁₂ GCAACAGAGCAAGTCTCAG 62 2.5 4 0.69 0.61

TAAGCGAAGATGAAGGAAGA

MIO 116907 116966 (TTATT) π CTGGAATCAGAGAGTGATGAT 50 2.1 9 0.31 0.83

GTCTGGGTGACAGAGTGG

Mll 125528 125599 (CTTT) ₂₀ AGTTTGACTTCCTCTTTACCAG 52 2.5 (3.0) ^g 9 0.22 0.83 GCAGTGAGCCAAGATTATGT

M12 147980 148015 (CA) _I8 ATTTTGGGCTGGATGAAG 57 2.1 6 0.39 0.56

ACACATTTCGCATATACATTG

Tab. 7A: continued

MMOL 55617 55632 16 CTGTCTCTCGCCATTTGTA 60 3.0 1 ACCCTGTCTCACTCTTTGTC

MM02 55806 55819 T _1S AAGCAATCCTCCCATCTC 60 3.0 1 GAGACCAGAGTGAGCAACA

MM03 64328 64349 A ₂₂ CAATAATGTGTTGTGGGTCA 60 3.0 2 0.81 0.2 CTGAGTAGCTGGGACCAC

MM04 64414 64489 A _w GATCATGCCACTACACTTTG 60 3.0 2 0.83 0.2 GCTAGAACTGACCAATAACCA

MOcta 69764 69886 GGAGGAGGATGGAACACT 56 2.5 1 CATGTTGGTTTTTGGCTTAC

^a) M, microsate unit; MM, mononucleotide microsateUit; MOcta, Ocatapeptide Repeat ^b) According to GeneBank, accession no. AL133396 consensus sequence

^ 5 'after 3', upper toe: in front of primer; lower line: reverse primer ^{e) in} addition to the standard protocol; * 44 instead of 32 cycles ^e in one of the 18 samples a higher MgC ^ concentration was required, see Table 7B

Tab. 7B: Number and lengths of all microsatellite loci in the human PrP gene

Locus Allele 'Allele FragMikrosateUite sequence Differences in observation sizes flanking number (bp) ^b regions ⁰

MOl R - / 149 (ATA) ₆ AAA

A 147 / - - - 31

B 150/152 (ATA) ₇ AAA and 5

M02 R - / 128 (GA) ₇

A 130/126 (GA) _6th and 2nd

B 132/128 R 1 SNP 34

B 262/263 (GT) ι ₅ nd 1

C 268 / - - - 1

D 270/271 (GT) «n.d. 8th

E 274/275 R n.d. 14

F 276/277 (GT) _22nd 8

G 278 / - - - 2

H 280 / - - _ 1

M04 R - / 189 (AGG) ₂ TGG (AGG)

A 188 / - - 36

M05 R - / 161 (AC) ₂ AA (AC) ₂

A 159 / - - 36

M06 R - / 176 (TTTTT) (TTTGT) ₃ (TTTTT)

A 175/176 R n.d. 36

MOl R - / 124 (TA) ₇

^■ - i ffl UQ psj PQ OQW fe Ü ffi --H <ffl ü QW

Tab. 8: Number of sheep examined and their ORF genotypes

Gesamt¬

Race ORF genotype «number

Dorper 21 4 45

Gotland 10 10

Isle de France 2 8 13

Merino landscape 150 32 74 2 5 19 283

Milk sheep 43 26 8 9 1 87

Schwarzkopf 1 14 28 44

SK x M ^{2) 3)} 4 1 5

Suffolk 16 37 9 64

Suffolk x Texel ³⁾ 1

Texel 20 1 12 71

Total number 15 14 230 58 9 180 11 80 623

Empty tab fields: 0 ^1} Definition see P. 4

²⁾ SK x M: Schatzkopf x Merinoland

³⁾ Fj sheep from parent animals of the breeds mentioned

Tab. 9: PCR approaches for the Loci Sl 1, S24 and S15

Substance amount (μi)

S11 / S15 S24 5R 40 R 5R 40 R

H ₂ O 71.5 572 75.5 604

Buffer 10 x 10 80 10 80

MgCl ₂ (25 mM) 12 96 8 6 dNTP mix (100 mM) 0.2 1.6 0.2 1.6

Primer A (100 pmol / μl) 0.4 3.2 0.4 3.2

Primer B (100 pmol / μl) 0.4 3.2 0.4 3.2

Taq polymerase (5 units / μl) 0.5 4 0.5 4

DNA (approx. 10-100 ng / μl) jel Jel jel jel

Total amount 100 800 100 800

R: reactions

16

Tab. 10: PCR program for Loci Sl 1, S24 and S15

Cycle No.Temperature (° C) Duration (min)

94 4:10

55 0:30

72 0:30

2-34 94 0:10

55 0:30

72 0:30

35 94 0:10

55 0:30

72 5:30

Tab. 11: Primer for the Loci S 11, S24 and S 15

Locus primer primer reverse primer

Sll TAGATAGTGTCAGAATTGAGTTGAA AATCTTTCTTATCACTGGTTAAAAT

S24 ATAACTTTGATGTTTGAGTTCCA GTATCCACTGTTCATCAAAATCT

S15 GATATTTTCGCTGTCTCGACTG GGACTTCTCCTCGTTGTTTAATAATC

Tab. 12; Running conditions for electrophoresis

Parameter value

Electrode buffer 0.6 x TBE buffer

Tension 1500 N.

Current 45 A

Power 34 W.

Laser power 2 mW

Detection interval 2 s

Temperature 50 ° C

Duration of the runs 80-135 min (80 bp = 50 min; 300 bp ≤ 130 min)

Order _volume 2.6 - 5 μl _^^^^^^ Table 13: PCR program for sequencing the DNA inserts

Cycle No.Temperature (° C) Duration (min)

1 95 5:00 58 0:45

72 1:00

2-30 95 0:45 58 0:45

72 1:00

31 95 0:45 58 0:45

72 16:00

Tab. 14: PCR approach for sequencing the DNA inserts

Substance men

H ₂ O 10

Buffer 10 x (containing 15 mM MgCL) 2.5

DNTP mix (100 mM) 0.25

Primer A (5 pM) 1

Primer B (5 pM) 1

Taq polymerase 0.25

Template 10

Tab. 15: Primer for sequencing the DNA inserts

Primer sequence

T7 TAATAG GACTCA CTATAG GG U19 GTTTTC CCA GTCACGACG

Tab. 16: Fragment lengths of locus S24

Sequence A.L.F. length (bp) S See-squeezed length (bp) microsate unit

GenBankU67922 147 ¹⁾ 149 (CAA) ₄

Clone S33 144 146 (CAA) ₃

Clone Sl02 147 149 (CAA) ₅ ² >

Clone 311 152 154 (CAA) ₅ ²⁾

^α) Hypothetical length derived from the sequence in an ALF analysis ²⁾ The fifth repetition of the motif is not caused by an insertion of CAA but by a point mutation from A to C (see Fig. 9)

Tab. 17: Observed allele numbers and frequencies of the microsatellite loci in the sheep breeds examined

Locus FL sheep breed (bp)

Dorper Gotland Ile de France Merinoland milk sheep Schwarzkopf Suffolk Texel

B F B F B F B F B F B F B F B F

Sll 150 2 0.022 2 0.143 3 0.115 34 0.063 3 0.017 2 0.024 1 0.008 14 0.099

152 85 0.924 11 0.786 23 0.885 500 0.929 130 0.747 78 0.929 69 0.539 124 0.873

154 0 0.000 0 0.000 0 0.000 4 0.007 0 0.000 0 0.000 0 0.000 0 0.000

156 0 0.000 0 0.000 0 0.000 0 0.000 15 0.086 0 0.000 0 0.000 4 0.028

158 5 0.054 1 0.071 0 0.000 0 0.000 26 0.149 4 0.048 58 0.453 0 0.000

S24 144 56 0.609 4 0.286 23 0.885 380 0.704 44 0.250 74 0.881 60 0.469 100 0.714

147 36 0.391 10 0.714 3 0.115 160 0.296 132 0.750 10 0.119 68 0.531 40 0.286

S15 173 0 0.000 4 0.286 0 0.000 0 0.000 0 0.000 3 0.036 2 0.016 19 0.144

179 88 0.978 8 0.571 24 0.923 495 0.938 139 0.808 79 0.940 125 0.977 100 0.758

182 2 0.022 2 0.143 2 0.077 33 0.063 33 0.192 2 0.024 1 0.008 13 0.098

Tab. 18: Observed allele numbers and frequencies of the ORF loci in the sheep breeds examined

Locus AS sheep breeds

Dorper Gotland Isle de France Merinoland Müchschaf Schwarzkopf Suffolk Texel

B F B F B F B F B F B F B F B F

ORFl A 105 0.890 20 1,000 23 0.885 567 0.998 178 1,000 87 0.989 126 0.984 126 0.887

V 13 0.110 0 0.000 3 0.115 1 0.002 0 0.000 1 0.011 2 0.016 16 0.113

ORF2 H 0 0.000 0 0.000 0 0.000 40 0.070 46 0.258 0 0.000 0 0.000 1 0.007

R 118 1,000 20 1,000 26 1,000 528 0.930 132 0.742 88 1,000 128 1,000 141 0.993

ORF3 H 0 0.000 0 0.000 0 0.000 1 0.002 0 0.000 0 0.000 0 0.000 30 0.211

Q 72 0.610 20 1,000 6 0.231 449 0.790 169 0.949 18 0.205 72 0.563 54 0.380

R 46 0.390 0 0.000 20 0.769 118 0.208 9 0.051 70 0.795 56 0.438 58 0.408

B: observed allele count; F: frequency; ORF1, ORF2, ORF3: locus names for the genotypes at codons 136, 154 and 171; AS: amino acid (A: alanine; H: histidine; Q: glutamine; R: arginine; V: valine)

Tab. 19: Degrees of heterozygosity for the microsate and ORF loci

Locus breed of sheep

Dorper Gotland Isle de France Merinoland milk sheep Schwarzkopf Suffolk Texel h (DC h (unb) h (DC h (unb) h (DC) h (unb) h (DC h (unb) h (DC h (unb) h (DC h (unb) hζD.C. h (unb) h (DC h (unb)

Sll 0.130 0.145 0.429 0.385 0.231 0.212 0.134 0.132 0.368 0.414 0.143 0.137 0.500 0.508 0.239 0.229

S24 0.522 0.482 0.571 0.440 0.231 0.212 0.437 0.417 0.455 0.377 0.238 0.212 0.594 0.502 0.429 0.411

S15 0.044 0.044 0.714 0.615 0.154 0.148 0.117 0.117 0.291 0.312 0.095 0.115 0.047 0.046 0.394 0.399

MH 0.232 0.224 0.571 0.480 0.205 0.181 0.229 0.222 0.371 0.368 0.159 0.155 0.380 0.352 0.354 0.346

S.E. 0.147 0.132 0.082 0.070 0.026 0.022 0.104 0.098 0.047 0.030 0.159 0.155 0.169 0.153 0.058 0.059

ORFl 0.220 0.198 0.000 0.000 0.231 0.212 0.004 0.004 0.000 0.000 0.023 0.023 0.031 0.031 0.197 0.201

ORF2 0.000 0.000 0.000 0.000 0.000 0.000 0.127 0.131 0.315 0.385 0.000 0.000 0.000 0.000 0.014 0.014

ORF3 0.508 0.480 0.000 0.000 0.308 0.369 0.282 0.333 0.101 0.097 0.318 0.329 0.594 0.496 0.662 0.648

MH 0.243 0.226 0.000 0.000 0.180 0.194 0.138 0.156 0.139 0.161 0.114 0.117 0.208 0.173 0.291 0.288

S.E. 0.147 0.139 0.000 0.000 0.092 0.107 0.080 0.096 0.093 0.116 0.102 0.106 0.193 0.160 0.193 0.188

MH: medium degree of heterozygosity; SE: standard deviation; h (DC): degree of heterozygosity ("direct count estimate"); h (unb.): degree of heterozygosity ("unbiased estimate")

82

Tab. 20: Observed and expected genotype frequencies for the microsatula loci of the examined sheep breeds with a check for HWE

B: observed; E: expected; p: error probability for deviation from HWE; Sign .: level of significance; ns: not significant

B: Observed; E: Expected; p: Error probability for deviation from HWE; Sign: level of significance; ns not significant Tab. 22: F- values, significance and certainty measures for characteristic risk for 4 analyzed breeds with observations> 60 (evaluation according to model 1)

Breed Locus FG F-Value Significance Level Determination (%

Merinoland Sll 1 0.41 n.s. 7.6 S24 2 7.72 p <0.001 S15 1 0.03 n.s.

Milk sheep Sll 6 11.00 p <0.001 75.5 S24 2 51.96 p <0.001 S15 2 1.41 n.s.

Suffolk Sll 2 0.21 n.s. 84.2 S24 2 49.13 p <0.001 S15 1 0.08 n.s.

Texel Sll 3 9.75 p <0.001 83.3 S24 2 60.38 p <0.001 S15 2 19.67 p <0.001

FG: degrees of freedom ns: not significant

Tab. 23: Relationships between microsatellite loci and the characteristic risk (see Tab. 2; evaluation separated by race according to model 1)

Breed locus genotype number of animals Risk (MQS) » ⁾ SE

Merinoland Sll 150/152 33 3.88 0.41

152/152 220 3.36 0.41

S24 144/144 122 3.32 ^» 0.09

144/147 110 3.68 ^b 0.10

147/147 21 3.86 ^b 0.19

S15 179/179 221 3.68 0.40

179/182 32 3.55 0.43

Suffolk Sll 152/152 19 2.84 0.16

152/158 31 2.74 0.17

158/158 13 2.69 0.36

S24 144/144 11 1.24 »0.31

144/147 37 3.01 0.23

147/147 15 4.02 <- 0.20

S15 173/179 2 2.71 0.33

179/179 61 2.80 0.06

Milk sheep Sll 150/152 3 3.17 * ^* - ^{* d} 0.24

152/152 49 3.24 * ^d 0.11

152/156 9 3.45 * 0.17

152/158 17 2.53 ^be 0.15

156/156 2 3.76 * 0.28

156/158 2 2.84 ^de 0.29

158/158 3 2.67 ^ce 0.25

S24 144/144 2 2.43 * 0.29

144/147 39 3.00 0.12

147/147 44 3.84 ^<* 0.10

S15 179/179 56 3.01 0.11

179/182 25 3.17 0.15

182/182 4 3.10 0.23

Texel Sll 150/152 10 5.75 * 0.29

150/156 1 5.54 * 0.60

152/152 52 3.42 ^b 0.22

152/156 3 3.36 ^b 0.39

S24 144/144 33 3.24 * 0.19

144/147 28 4.71 ^b 0.19

147/147 5 5.61 * - 0.30

S15 173/179 13 5.24 * 0.31

173/182 6 5.03 * 0.32

179/179 40 4.03 ^b 0.27

179/182 7 3.79 ^b 0.29

MQS: minimum square estimate; S.E .: Standard Error

¹ Significant differences (p <0.05; t test) between individual factor levels within the

Loci and breeds are identified by different superscript letters Tab. 24: Observation numbers of microsate unit combinations within ORF type

ORF-Risk S24 Sll S15 B Beeoobb .. breed / n ^ (obs.) Genotype total

ARR / ARR 1 144/144 152/152 179/179 76 1 (4), 3 (8), 4 (16), 6 (27), 8 (9), 10 (12)

ARR / AHQ 2 144/144 152/152 179/179 2 5 (1), 10 (1)

144/147 152/152 179/179 5 4 AHQ / AHQ 2 144/147 152/152 179/179 1 4

144/147 152/158 179/179 8 5

147/147 152/152 179/179 1 4

ARR / ARQ 144/144 150/152 179/182 7 4 (6), 6 (1)

144/144 152/152 173/179 9 10

144/144 152/152 179/179 62 1 (7), 4 (46), 6 (3), 8 (2),

10 (4)

144/147 150/152 179/179 1 5

144/147 152/152 173/179 3 6 (2), 8 (1)

144/147 152/152 179/179 45 1 (10), 3 (2), 4 (14),

5 (6), 6 (3), 8 (6), 10 (4)

144/147 152/152 179/182 1 10

144/147 152/154 179/179 1 4

144/147 152/156 179/179 1 10

144/147 152/158 179/179 35 1 (2), 5 (1), 6 (4), 8 (28)

ARR / ARH 3 144/147 152/152 179/179 10 4 (1), 10 (9) AHQ / ARH 3 No observation ARQ / AHQ 3 144/144 150/152 179/182 1 4

144/144 152/152 179/179 1 5

144/147 150/152 179/182 4 4

144/147 152/152 179/179 27 4 (18), 5 (9)

144/147 152/152 179/182 6 5 ORF Risk S24 Sll S15 Obs. Breed / s Y ⁾ (observ.)

Total genotype

ARQ / AHQ 144/147 152/156 179/179 1 5

144/147 152/158 179/179 1 5

147/147 152/152 179/179 4 4

147/147 152/158 179/179 5 5

147/147 156/158 179/179 1 5

147/147 158/158 179/179 2 5

ARH / ARH 4 144/147 152/152 179/179 1 10

147/147 152/152 179/179 3 10

ARQ / ARH 4 144/147 152/152 173/179 4 10

144/147 152/152 179/179 1 10

147/147 152/156 179/179 2 10

ARQ / ARQ 4 144/144 150/150 182/182 1 4

144/144 150/152 179/182 11 4

144/144 152/152 179/179 47 1 (3), 4 (43), 6 (1)

144/147 150/152 173/182 1 2

144/147 150/152 179/179 1 4

144/147 150/152 179/182 10 2 (1), 4 (9)

144/147 152/152 173/179 1 2

144/147 152/152 173/182 1 10

144/147 152/152 179/179 55 1 (3), 2 (1), 4 (51)

144/147 152/152 179/182 3 5

144/147 152/154 179/179 2 4

144/147 152/156 179/179 2 5

144/147 152/158 179/179 2 1 (1), 8 (1)

144/147 156/156 179/179 1 5 ORF Risk S24 Sll S15 Obs. Race / s ^x) (obs.) Genotype total

ARQ / ARQ 147/147 150/152 179/182 2 5

147/147 150/158 179/182 1 1

147/147 152/152 173/179 2 2

147/147 152/152 179/179 24 4 (15), 5 (9)

147/147 152/152 179/182 10 5

147/147 152/152 182/182 4 5

147/147 152/156 179/179 3 5

147/147 152/156 179/182 3 5

147/147 152/158 173/179 1 8

147/147 152/158 179/179 4 2 (1), 5 (2), 8 (1)

147/147 152/158 179/182 1 5

147/147 156/156 179/179 1 5

147/147 156/158 179/179 1 5

147/147 158/158 179/179 14 5 (1), 8 (13)

ARR / VRQ 4 144/144 150/152 179/179 1 3 144/144 150/152 179/182 4 3 (1), 9 (1), 10 (2)

144/147 152/152 179/179 8 1 (5), 8 (1), 10 (2)

AHQ / VRQ 4 No observation

ARH / VRQ 5 144/147 150/152 179/182 3 10

ARQ / VRQ 5 144/144 150/152 173/182 4 10 144/147 150/152 173/182 1 6

144/147 150/152 179/182 1 3

144/147 150/156 179/182 1 10

144/147 150/158 179/182 1 8

144/147 152/152 179/179 3 1 (2), 4 (1) ORF Risk S24 Sll S15 Obs. Race / s ^l) (obs.) Genotype total

ARQ / VRQ 147/147 150/152 179/182 1 1 147/147 152/152 179/179 3 1

VRQ / VRQ 5 144/144 150/152 173/182 1 10

^ Breed code: 1 Dorper, 2 Gotland, 3 Ile de France, 4 Merinoland, 5 Müchschaf, 6 Schwarzkopf, 7 SK / Merinoland, 8 Suffolk, 9 Suffolk / Texel, 10 Texel

Tab. 25: Evaluation of the investigations into the association between polymorphic microsatelten loci in the human PrP gene and various dementia groups according to haplotypes and genotypes

haplotypes

genotypes

Tab. 26: Data of the investigations on the association between polymorphic microsate loci in the human PrP gene and various dementia groups in detail

MOI

Oil frequencies Number of samples

AUel 1 AUel 2 ok not examined

CJD 0.66 0.34 49 0

Dementia 0.68 0.32 49 0

Practice 0.86 0.14 18 0

M02

Oil frequencies Number of samples

AUel 1 AUel 2 ok not examined

CJD 0.07 0.93 49 0

Dementia 0.07 0.93 49 0

Practice 0.06 0.94 18 0

M03

Oil frequencies Number of samples

AUel l AUel 2 AUel 3 AUel 4 AUel 5 AUel 6 AUel 7 AUel 8 AUel 9 ok not examined

CJD 0.00 0.00 0.03 0.03 0.27 0.12 0.36 0.13 0.06 47 2

Dementia 0.00 0.00 0.06 0.05 0.31 0.01 0.37 0.14 0.05 47 2

Practice 0.03 0.06 0.00 0.03 0.19 0.39 0.22 0.06 0.03 18 0

Tab. 26: Continuation

M09

Oil frequencies Number of samples

Allel 1 AUel 2 Allel 3 AUel 4 AUel 5 AUel 6 ok not examined

CJD 0.00 0.13 0.03 0.81 0.03 0.00 47 2

Dementia 0.01 0.20 0.00 0.67 0.10 0.02 47 2

Han 0.00 0.22 0.06 0.69 0.03 0.00 18 0

M10

Oil frequencies Number of samples

Allel 1 AUel 2 AUel 3 AUel 4 AUel 5 Allel 6 AUel 7 AUel 8 AUel 9 AUel 10 AUel ll AUel 12 AUel 13 AUel 14 AUel 15 ok not examined

CJD 0.01 0.02 0.01 0.29 0.17 0.09 0.22 0.01 0.04 0.00 0.06 0.02 0.03 0.01 0.01 48 1

Dementia 0.01 0.00 0.00 0.22 0.24 0.13 0.19 0.00 0.02 0.01 0.06 0.02 0.06 0.05 0.00 44 5

Han 0.00 0.00 0.06 0.06 0.14 0.17 0.31 0.00 0.06 0.00 0.03 0.00 0.11 0.08 0.00 18

M12

Number of samples

Allel 1 AUel 2 AUel 3 AUel 4 AUel 5 AUel 6 AUel 7 ok not examined

Han 0.00 0.03 0.36 0.39 0.06 0.11 0.06 18 0

Dementia 0.02 0.04 0.29 0.50 0.01 0.08 0.05 46 3

CJD 0.00 0.00 0.31 0.44 0.01 0.22 0.02 48 1

Tab. 26: Continuation

MM03

Oil frequencies Number of samples

AUel l AUel 2 ok not examined

CJD 0.86 0.14 49 0

Dementia 0.71 0.29 48 1

Han 0.81 0.19 18 0

MM04

Oil frequencies Number of samples

AUel 1 AUel 2 ok not examined

CJD 0.17 0.83 48 1

Dementia 0.30 0.70 47 2

Han 0.25 0.75 18 0

MOCT

Oil frequencies Number of samples

AUel l AUel 2 AUel 3 AUel 4 AUel 5 ok not examined

CJD 0.01 0.97 0.00 0.01 0.01 49 0

Dementia 0.00 0.99 0.01 0.00 0.00 49 0

Han 0.00 1.00 0.00 0.00 0.00 18 0

Tab. 26: Continuation

S129

Oil frequencies Number of samples

AUel l AUel 2 ok not examined

CJD 0.84 0.16 28 21

Dementia 0.91 0.09 39 10

Han 0.73 0.27 15 3

S129 genotypes

Genotype frequencies Number of samples

MM MV W ok not examined

CJD 0.79 0.11 0.11 28 21

Dementia 0.82 0.18 0.00 39 10

Han 0.53 0.40 0.07 15 3

Claims

Patent claims

1. Method for typing a gene that contains one or more polymorphic

MicrosatelHtenloci has, in an individual, comprising the steps of:

(a) AmpHf decorate at least one DNA region of the gene to be typed by PCR with primers selected according to the size of the DNA region, the DNA region comprising at least one polymorphic microsate locus locus and serving as a template, a sample of the individual, containing a DNA, which comprises at least a section of the gene with the polymorphic microsatellite locus / loci, and

(b) Determine the length of the AmpHfikats / AmpHfikate from step (a).

2. The method of claim 1, wherein step (b) comprises electrophoresis of the AmpHfikate.

3. The method of claim 1 or 2, wherein the DNA region has a length of about 50 to about 500 bp.

4. The method according to any one of claims 1 to 3, wherein prior to step (a) the determination of the polymorphic microsate locus / loci in the gene to be typed is carried out.

5. The method according to claim 4, wherein determining the polymorphic microsate locus loci comprises the steps:

(A) screening the gene to be typed for microsattenten loci,

(B) AmpHfection of a DNA region in each case by PCR with primers selected according to the size of the DNA region, the DNA region containing the microsate locus locus found in step (A), per microsatel locus locate found in a plurality of individuals of the gene to be typed containing organism, (C) determining the length of the AmpHfikats / AmpHfikate and / or the nucleotide sequence of the MikrosatelHtenlocus / loci in the AmpHfikat (s) of step (B) for each individual and

(D) Determining the microsatel locus / loci whose ampH ficate (s) has a length different between the individuals or whose nucleotide sequence (s) is / are different between the individuals.

6. The method of claim 5, wherein step (C) comprises electrophoresis of the AmpHfikate.

7. The method of claim 5 or 6, wherein the DNA region has a length of about 50 to about 500 bp.

8. The method according to any one of claims 1 to 7, wherein the polymorphic (s)

MikrosatelHtenlocus / loci has a sequence motif which is repeated at least 3 times.

9. The method according to any one of claims 1 to 8, wherein the polymorphic microsatel locus / loci has one or more sequence motif (s) which consist of the group consisting of the consensus sequences (ATA) ₇ , ( GA) ₇ , (GT) ₂₈ , (AGG) ₄ , (AC) ₅ , (TTTGT) ₅ , (TA) ₇ , (TC) ₅ , (TAAA) ₁₂ , (ATTTT) ₁₂ , CTTTC) ₁₈ , (CA ) ₁₈ , (CAGTT) ₄ , (AGC) ₅ , (GA) ₅ , (TTTGT) ₄ , (TCAGT) ₄ , (TTCAG) ₄ , (ACTGA) ₃ , (ACTGA) ₄ , (CA) ₁₂ , (ATC ) ₄ , (T) ₂₅ , (ITG) ₅ , (T) ₂₉ , (CAA) ₃ , CTTCAG) ₃ , (AGTG) ₄ , (CAC) ₅ , (AAAACA) ₄ , (ACC) ₄ , (ATCAG) ₅ , (AC) ₃ , (CTG) * (GTT) ₅ ,

(T) ₁₅ , (CAA) ₄ , (AC) ₄ , (Υ) _u , (A) ₁₆ and (A) ,,, is selected.

10. The method according to any one of claims 1 to 9, wherein it is a gene from humans, monkeys, horses, sheep, cattle, pigs, goats, mice, rats, rabbits, guinea pigs, dogs, cats or chickens.

11. The method according to any one of claims 1 to 10, wherein the gene to be typed from the group consisting of genes which are associated with a disease, and Genes that code for milk proteins, homons or transcription factors is selected.

12. The method of claim 11, wherein the gene from the group consisting of PrP, CFTR, RYR1 and genes associated with metabolic disorders in humans and

Animal associated are selected.

13. The method according to claim 12, wherein it is the human PrP gene and the sequence motif (s) of the polymorphic microscope locus / loci from the group consisting of the consensus sequences (ATA) ₇ , (GA) ₇ ,

(GT) ₂₈ , (AGG) ₄ , (AC) ₅ , (TTTGT) ₅ , (TA) ₇ , (TC) ₅ , (TAAA) ₁₂ , (ATTTT) ₁₂ , CTTTC) ₁₈ , (CA) ₁₈ (T ) ₁₆ , (A) ₁₆ and (A) ^, is selected.

14. The method of claim 13, wherein the consensus sequence is (ATA) ₇ , (GA) ₇ , <TAAA) ₁₂ , (ATTTT) ₁₂ , (CA) ₁₈ , (A) ₁₆ or (A) - ,,.

15. The method of claim 12, wherein the amplified DNA region (s) of the human PrP gene comprises nucleotides 3621 to 3641, 25415 to 25428, 39450 to 39505, 50315 to 50326, 58346 to 58385, 72392 to 72416, 78300 to 78313, 92615 to 92624, 108429 to 108476, 116907 to 116966, 125528 to 125599,

147980 to 148015, 55617 to 55632, 55806 to 55819, 64328 to 64349 and / or 64474 to 64489 according to GenBank accession number ALI 33396.

16. The method of claim 15, wherein the amplified DNA region (s) of the human PrP gene comprises nucleotides 3621 to 3641, 25415 to 25428, 108429 to 108476, 116907 to 116966, 147980 to 148015, 64328 to 64349 and / or 64474 to 64489 according to GenBank accession number AL133396.

17. The method according to claim 12, wherein it is the bovine PrP gene and the sequence motif (s) of the polymorphic microsatel locus / loci from the group consisting of the consensus sequences (CAGTT) ₄ , (TC) ₅ , (AGC) ₅ , (GA) ₅ , (TTTGT) ₄ , (TCAGT) ₄ , (TTCAG) ₄ , (ACTGA) ₃ , (ACTGA) ₄ , (CA) ₁₂ , (ATC) ₄ , (T) ₂₅ , (TTG) ₅ , (T) ₂₉ , (CAA) ₃ , (TTCAG) ₃ , (AGTG) ₄ , (CAC) ₅ , (AAAACA) ₄ , (ACC) ₄ , (ATCAG) ₅ and (AC) ₃ , is selected.

18. The method of claim 17, wherein the consensus sequence is (AGC) ₅ , (TTTGT) ₄ , (CA) ₁₂ , (T) ₂₅ , 1) ₂ -, (TTCAG) ₃ , (AAAACA) ₄ or (ATCAG) ₅ ,

19. The method of claim 12, wherein the amplified DNA region (s) of the bovine PrP gene comprises nucleotides 444 to 463, 4121 to 4130, 7615 to 7629, 19808 to 19817, 25288 to 25307, 30633 to 30652, 32320 to 32339, 37891 to 37910, 39943 to 39957, 44220 to 44239, 44507 to 44530, 46259 to 46278,

48409 to 48420, 50471 to 50495, 53219 to 53233, 54990 to 55018, 60452 to 60460, 62703 to 62717, 64685 to 64700, 66178 to 66192, 68762 to 68785, 68926 to 68937, 72474 to 72498 and / or 74333 to 74340 according to GenBank accession number AJ298878 comprises / comprise.

20. The method of claim 19, wherein the amplified DNA region (s) of the bovine PrP gene comprises nucleotides 7615 to 7629, 25288 to 25307, 44507 to 44530, 50471 to 50495, 54990 to 55018, 62703 to 62717, 68762 to 68785 and / or 72474 to 72498 according to GenBank accession number AJ298878.

21. The method according to claim 12, which is the PrP gene of the sheep and the sequence motif (s) of the polymorphic microsatel locus / loci from the group consisting of the consensus sequences (CAGTT) ₄ , (TC) ₅ , (AGC) ₅ , (GA) ₅ , (πTGT) ₄ , (TCAGT) ₄ , (ACTGA) ₃ , (ACTGA) ₄ , (CA) ₁₂ , (CTG) ₅ , (ATC) ₄ ,

(GTT) ₅ , CTTG) ₅ , (T) ₁₅ , (CAA) ₃ , (CAA) ₄ , (TTCAG) ,, (AGTG) ₄ , (CAC) ₅ , (ACC) ₄ and (AC) ₄ is / are.

22. The method of claim 21, wherein the consecutive sequence is (GA) ₅ , TTTGT) ₄ , (CA) ₁₂ , (GTT) ₅ , (T) ₁₅ or (CAA) ₄ .

23. The method of claim 12, wherein the targeted DNA region (s) of the sheep's PrP gene comprises nucleotides 301 to 320, 590 to 613, 1033 to 1047, 2477 to 2496, 4651 to 4662, 6627 to 6641, 9433 to 9447, 11277 to 11291, 16748 to 16756, 18100 to 18119, 19372 to 19386, 21383 to 21398, 22853 to 22867, 25422 to 25433, 25580 to 25591 and / or 30168 to 30175 according to GenBank accession number U67922 comprises / comprise.

24. The method of claim 23, wherein the amplified DNA region (s) of the sheep's PrP gene comprises nucleotides 590 to 613, 6627 to 6641, 11277 to 11291 and / or 25422 to 25433 according to GenBank accession number U67922 includes / comprise.

25. A method for determining microsate markers for the predisposition to a disease associated with a gene which has one or more polymorphic microsateloid loci, comprising the steps:

(i) typing the gene in a plurality of individuals who are known to have or do not have the disease and / or who are known by a known marker to have a certain degree of predisposition to the disease, by the method according to one of claims 1 to 24, (ü) determining the genotype frequencies for each polymorphic microsatellite locus in the diseased / non-diseased or having a certain degree of predisposition and (Hi) selecting the polymorphic microsatel locus / loci as a marker , in which one has the greatest statistical significance for the characteristics “sick” / “not sick” or for the certain degree of predisposition on the basis of the genotype frequencies determined according to step (H).

26. The method according to claim 25, which is a gene from human, sheep, cattle, pork, goat, mouse, rat, rabbit or chicken and the typing in step (i) according to the method according to any one of claims 10 to 24 is carried out.

27. The method according to claim 25 or 26, wherein the gene is selected from the group consisting of PrP, CFTR, RYR1 and genes which are associated with metabolic disorders in humans and animals, and the typing in steps (i) and ( ü) is carried out according to the method according to any one of claims 12 to 24.

28. A method of prediagnosing a disease associated with a gene that has one or more polymorphic microsateloid loci, comprising the steps of:

(1) Typing the gene of an individual to be examined for one or more microsatten locus / loci that is a marker for the degree of predisposition to the disease by the method according to any one of claims 1 to 24 and

(2) Compare the genotype obtained with the degree of predisposition to the disease assigned to that genotype.

29. The method according to claim 28, wherein the microsatelite marker was determined by the method according to one of claims 25 to 27.

30. The method according to claim 28 or 29, wherein it is a gene from human, sheep, cattle, pork, goat, mouse, rat, rabbit or chicken and the

Typing is carried out in step (1) according to the method according to one of claims 10 to 24.

31. The method according to any one of claims 28 to 30, wherein the gene is selected from the group consisting of PrP, CFTR, RYR1 and genes which are associated with metabolic diseases in humans and animals, and the typing in step (1) according to the method is carried out according to one of claims 12 to 24.

32. The method according to claim 31, wherein it is the PrP gene of humans and the polymorphic microsatel locus / loci has a sequence motif (s) from the group consisting of the consensus sequences (ATA) ₇ , (GA) ₇ , (TAAA) ₁₂ , (ATTTT) ₁₂ , (CA) ₁₈ , (A) _lo and (A) ^ is selected.

33. The method according to claim 31, wherein it is the bovine PrP gene and the polymorphic microsatel locus loci has a sequence motif which consists of the group consisting of the consensus sequences (AGC) ₅ , CπTGT) ₄ , (CA) ₁₂ , (T) ₂₅ , (T) ₂₉ , CITCAG) ₃ , (ΓTCAG) ₃ , (AAAACA) ₄ and (ATCAG) ₅ .

34. The method according to claim 31, wherein it is the PrP gene of the sheep and the polymorphic microsatel locus / loci has a sequence motif (s), which consists of the group consisting of the consensus sequences (GA) ₅ , CπTGT ) ₄ , (CA) ₁₂ , (GTT) ₅ , (T) ₁₅ and (CAA) ₄ .

35. Use of microsatel loci for typing genes.

36. Using microsatel loci to identify markers in genes associated with a disease.

37. Use of microsate loci for the pre-diagnosis of genes that are associated with a disease.