WO2004018633A2 - Abca13 nucleic acids and proteins, and uses thereof - Google Patents

Abca13 nucleic acids and proteins, and uses thereof Download PDF

Info

Publication number
WO2004018633A2
WO2004018633A2 PCT/US2003/026335 US0326335W WO2004018633A2 WO 2004018633 A2 WO2004018633 A2 WO 2004018633A2 US 0326335 W US0326335 W US 0326335W WO 2004018633 A2 WO2004018633 A2 WO 2004018633A2
Authority
WO
WIPO (PCT)
Prior art keywords
ofthe
abcal
seq
sequence
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/026335
Other languages
French (fr)
Other versions
WO2004018633A3 (en
Inventor
Micheal C. Dean
Isabelle Arnould-Reguigne
Catherine Prades
Marie-Francoise Rosier-Montus
Patrice Denefle
Sergey Shulenin
Tarmo Annilo
Marcia L. Triunfol
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharma SA
US Department of Health and Human Services
Original Assignee
Aventis Pharma SA
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aventis Pharma SA, US Department of Health and Human Services filed Critical Aventis Pharma SA
Priority to AU2003262789A priority Critical patent/AU2003262789A1/en
Publication of WO2004018633A2 publication Critical patent/WO2004018633A2/en
Anticipated expiration legal-status Critical
Publication of WO2004018633A3 publication Critical patent/WO2004018633A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the present disclosure is related to extra- and intra-cellular transport, including the mechanisms controlling transport, diseases that arise from defects in such mechanisms, and methods of influencing (either inhibiting or enhancing or otherwise changing) transport.
  • the ABC (ATP-binding cassette transporter) gene superfamily encodes active transporter proteins and constitutes a family of proteins that have been extremely well conserved through evolution, from bacteria to humans (Ames and Lecar, FASEB J. , 6: 2660-2666, 1992).
  • the ABC proteins are involved in extra- and intracellular membrane transport of various substrates, for example ions, metals, amino acids, lipids, peptides, sugars, vitamins, or steroid hormones, across membranes.
  • eleven members have been described as associated with human disease, such as ABCA1, ABCA4 (ABCR) and ABCC7, (CFTR) which are thought to be involved in Tangier disease (Bodzioch et l., Nat. Genet.
  • P-glycoprotein was first identified over 20 years ago in chemotherapeutic drug-resistant tumor cells, and is now known to be a major cause of multidrug resistance in many cancers (Van Asperen et al, J. Pharmaceut. Sci. 86: 881-884, 1997; Tsuji, Therap. Drug Monitor. 20: 588-590, 1998). These implications reveal the importance of the functional role ofthe ABC gene family. The discovery of a new family of ABC gene members is expected to provide new insights into the physiopathology and treatment of human diseases.
  • the prototype ABC protein binds ATP and uses the energy from ATP hydrolysis to drive the transport of various molecules across cell membranes.
  • the functional protein contains two ATP- binding domains (nucleotide binding fold, NBF) and multiple transmembrane (TM) domains.
  • NBF nucleotide binding fold
  • TM transmembrane domains.
  • the genes are typically organized as full transporters containing two of each domain, or half transporters with only one of each domain. Most full transporters are arranged in a TM-NBF-TM-NBF fashion (Dean etal, Curr Opin Genet 5: 79-785, 1995).
  • ABC ABC gene sub-families
  • a to G seven ABC gene sub-families named ABC (A to G) have been described in the human genome (ABC1, CFTR/MRP, MDR, ABC8, ALD, GCN20, OABP) with all except one (OABP) containing multiple members.
  • ABC ABC gene subfamily is probably the most evolutionary complex.
  • the ABCA subfamily consists exclusively of full transporter genes.
  • ABCA genes and OABP represent the only two sub-families of ABC genes that do not have identifiable orthologs in the yeast genome (Decottignies and Goffeau, Nat. Genet. Feb;15(2):137-145,1997; Michaelis and Berkower, Cold Spring Harb. Symp. Quant. Biol. 60:291-307, 1995). There is, however, at least one -45C4-related gene in C. elegans (ced-1) and several in Drosophila. Thus, the ABCA genes appear to have diverged after eukaryotes became multicellular and developed more sophisticated transport requirements.
  • ABCA1 was demonstrated to be the gene responsible for Tangier disease, a disorder characterized by high levels of cholesterol in peripheral tissues, and a very low level of HDLs, and familial hypoalphalipoproteinemia (FHD) (Bodzioch et al, Nat Genet 22: 347-351, 1999; Brooks- Wilson et al, Nat. Genet. 4: 336-345, 1999; Rust et al, Nat Genet 22: 352-355, 1999; Marcil et al, The Lancet 354: 1341-1346, 1999).
  • FHD familial hypoalphalipoproteinemia
  • the ABCA1 protein is proposed to function in the reverse transport of cholesterol from peripheral tissues via an interaction with the apolipoprotein 1 (ApoA-1) of HDL tissues (see Wang et al, JBC 275(42): 33053-33058, 2000).
  • the ABCA2 gene is highly expressed in the brain, and ABCA3 in the lung, but no function has been ascribed to these loci.
  • the ABCA4 gene is exclusively expressed in the rod photoreceptors ofthe retina and mutations thereof are responsible for several pathologies of human eyes, such as retinal degenerative disorders (Allikmets et al, Science 277: 1805-1807, 1997; Allikmets et al., Nat. Genet. 15: 236-246, 1997; Sun etal., J. Biol. Chem. 8269-8281, 1999; Weng et /., Cell 98: 13-23, 1999; Cremers et al., Hum. Mol. Genet.
  • ABCA4 is believed to transport retinal and/or retinal-phospholipid complexes from the rod photoreceptor outer segment disks to the cytoplasm, facilitating phototransduction.
  • Characterization of new genes from the ABCA subfamily is likely to yield biologically important transporters, which may have translocase activity for membrane lipid transport or the transport of other substances and which may play a role in human pathologies.
  • ABCA13 a new gene belonging to the ABCA protein sub-family
  • the protein is believed to be involved in the energy-dependent transport of one or a variety of substances, for example ions, metals, amino acids, lipids, peptides, sugars, vitamins and steroid hormones.
  • the newly discovered gene shows similar gene organization and considerable conservation ofthe amino acid sequence with other ABCA transporter genes, particularly within the transmembrane domains (TM) and two ATP-binding domains (nucleotide binding domain, NBD1 and NBD2).
  • TM transmembrane domains
  • NBD1 and NBD2 two ATP-binding domains
  • the present disclosure includes novel nucleic acids encoding the isoforms of ABCA13 (SEQ ID NO: 1, 18, 20, 22, 24, 26, and 28) and their predicted amino acid sequences (SEQ ID NO: 2, 19, 21, 23, 25, 27, and 29).
  • protein specific binding agents such as antibodies, that bind specifically to at least one epitope of an ABCA13 variant protein preferentially compared to wildtype ABCA13, and methods of using such antibodies in diagnosis and screening. Kits are also provided for carrying out the methods described herein.
  • Figure 1 is a series of diagrams showing the various transcripts gene and corresponding isoforms.
  • FIG 1A shows a physical map ofthe 7pl2.3 region containing the ABCAl 3 gene.
  • the location ofthe boundaries of BAG clones AC073927 is shown as an inset portion ofthe second Nucleotide Binding Domain region (NBD2) of ABCA] 3.
  • NBD2 Nucleotide Binding Domain region
  • FIG IB is a diagram showing the six different ABCA 13 transcripts that have been identified and are described herein. Termination codons are indicated by thick upright black lines. The large arrows symbolize the primers. The Taqman reagents are symbolized by a light grey star. Two ABCAl 3 proteins are depicted by dark grey lines. The small protein that can be predicted in the 5' part of transcripts 2, 4, and 6 is indicated at the bottom left, by a black line.
  • FIG IC is a first diagram ofthe predicted proteins from the six ABCA13 transcripts.
  • Amino acid numbering ofthe different protein domains is given. Key: SP, signal peptide; TM, predicted transmembrane domain, NBD, nucleotide binding domain; TMA, additional TM domain; C-term, C-terminal regions due to alternative splicing.
  • FIG ID is an alignment ofthe Isoforms of ABCA13 with the full length ABCA13.
  • the STOP position corresponds to last base pair ofthe codon triplet.
  • the base pair positions above or below each bar correspond to the respective Isoform.
  • Isoform 2B is depicted at the bottom left, between base pairs 26 and 2179.
  • Figure 2 is phylogenetic linkage tree showing the relationship ofthe ABCA gene family.
  • the phylogenetic tree was constructed with the alignments ofthe N- and C-terminal ATP-binding domains' sequence by the Neighbor joining method. The numbers indicate the bootstrap values
  • Figure 3 is an alignment ofthe N-terminal region of ABCA subfamily proteins. Amino acid number one corresponds to the first position in all proteins, otherwise, the numbering is according to the ABCAl sequence. Dashes indicate gaps.
  • Figure 4 is a diagram ofthe predicted amino-acid sequence of ABCAl 3 Isoform 1 (SEQ ID NO: 1
  • FIG 5 illustrates RNA expression analysis of human and mouse ABCAl 3.
  • FIG 5 A shows human ABCAl 3 expression.
  • This radial graph shows the expression profile that we have determined using the set of probe and primers specific for transcripts 1 and 2. The arbitrary unit has been calculated after normalization to ⁇ 2-microglobulin.
  • FIG 5B is a blot that shows mouse Abcal3 expression. PCR was performed on the panel of mouse tissue-specific cDNAs, as described in the examples. Amplification products of 255 bp
  • G3PDH glycosyldehyde 3-phos ⁇ hate dehydrogenase
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids, as defined in 37 C.F.R. ⁇ 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • SEQ ID NO: 1 shows a cDNA encoding human ABCAl 3 (Isoform 1) and the predicted amino acid sequence.
  • SEQ ID NO: 2 shows the amino acid sequence ofthe human ABCA13 Isoform 1 protein encoded by ABCAl 3 (SEQ ID NO: 1).
  • SEQ ID NO: 3 through 15 show the nucleic acid sequences of primers used to amplify particular regions within the several isoforms of ABCAl 3.
  • SEQ ID NO: 16 and 17 show primers that may be used to amplify mouse ABCA13.
  • SEQ ID NO: 18 shows a cDNA encoding human ABCAl 3 Isoform 2 A and the predicted amino acid sequence.
  • SEQ ID NO: 19 shows the amino acid sequence ofthe human ABCA13 Isoform 2A protein encoded by ABCAl 3 (SEQ ID NO: 18).
  • SEQ ID NO: 20 shows a cDNA encoding human ABCAl 3 Isoform 2B and the predicted amino acid sequence.
  • SEQ ID NO: 21 shows the amino acid sequence ofthe human ABCA13 Isoform 2B protein encoded by ABCAl 3 (SEQ ID NO: 20).
  • SEQ ID NO: 22 shows a cDNA encoding human ABCAl 3 Isoform 3, and the predicted amino acid sequence.
  • SEQ ID NO: 23 shows the amino acid sequence ofthe human ABCAl 3 Isoform 3 protein encoded by ABCAl 3 (SEQ ID NO: 22).
  • SEQ ID NO: 24 shows a cDNA encoding human ABCAl 3 Isoform 4 and the predicted amino acid sequence.
  • SEQ ID NO: 25 shows the amino acid sequence ofthe human ABCA13 Isoform 4 protein encoded by ABCAl 3 (SEQ ID NO: 24).
  • SEQ ID NO: 26 shows a cDNA encoding human ABCAl 3 Isoform 5 and the predicted amino acid sequence.
  • SEQ ID NO: 27 shows the amino acid sequence ofthe human ABCAl 3 Isoform 5 protein encoded by ABCAl 3 (SEQ ID NO: 26).
  • SEQ ID NO: 28 shows a cDNA encoding human ABCA 13 Isoform 6 and the predicted amino acid sequence.
  • SEQ ID NO: 29 shows the amino acid sequence ofthe human ABCAl 3 Isoform 6 protein encoded by ABCAl 3 (SEQ ID NO: 28).
  • SEQ ID NOs: 30-41 show a portion ofthe N-terminal amino acid sequence ofthe ABCAl, ABCA2, ABCA3, ABCA4, ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCAIO, ABCAl 1, ABCA12, and ABCA13 proteins, respectively.
  • SEQ ID NOs: 42-56 show nucleic acid sequences of primers used for RACE amplification of ABCA 13 sequences, and/or validation of such amplification.
  • SEQ ID NOs: 57-65 show nucleic acid sequences of primers used in real-time CPR analysis of ABCAl 3.
  • SEQ ID NOs: 66-72 show nucleic acid sequences of primers used in quantification of ABCAl 3 sequences.
  • SEQ ID NOs: 73-75 show nucleic acid sequences of additional primers used to amplify particular regions within isoforms of ABCAl 3.
  • BAC bacterial artificial chromosome bp base pair(s)
  • DNA deoxyribonucleic acid
  • gDNA genomic DNA
  • pfu plaque forming unit
  • TAE Tris acetate EDTA
  • Altered expression Expression of a nucleic acid (e.g., mRNA or protein) in a subject or biological sample from a subject that deviates from expression in a subject or biological sample from a subject having normal characteristics for the biological condition associated with the nucleic acid. Normal expression can be found in a control, a standard for a population, etc. For instance, where the altered expression manifests as a transporter disease condition, such as deficient extra- or intracellular transport, characteristics of normal expression might include an individual who is not suffering from the transport disorder, a population standard of individuals believed not to be suffering from the disease, etc.
  • a nucleic acid e.g., mRNA or protein
  • altered expression such as altered ABCAl 3 nucleic acid or ABCAl 3 protein expression
  • altered expression can be described as being associated with the biological conditions of altered (e.g., reduced) transporter function and tendency to develop a transporter deficiency.
  • altered expression may be associated with a disease.
  • the term "associated with” includes an increased risk of developing the disease as well as the disease itself.
  • Altered protein expression such as altered ABCAl 3 protein expression, also refers to expression of a protein that is in some manner different to expression ofthe protein in a normal (wild type) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more ofthe amino acid residues is different; (2) a short deletion or addition of one or a few amino acid residues to the sequence ofthe protein; (3) a longer deletion or addition of amino acid residues, such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount ofthe protein, compared to a control or standard amount; (5) expression of an decreased amount ofthe protein, compared to a control or standard amount; (6) alteration ofthe subcellular localization or targeting ofthe protein; (7) alteration ofthe temporally regulated expression ofthe protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); and (8) alteration ofthe localized (e.g., organ or tissue specific) expression ofthe protein (such that the protein
  • Amplification When used in reference to a nucleic acid, this refers to a collection of techniques that increase the number of copies of a nucleic acid molecule in a sample or specimen.
  • An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization ofthe primers to nucleic acid template in the sample.
  • the primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies ofthe nucleic acid.
  • the product of in vitro amplification can be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques.
  • Other examples of in vitro amplification techniques include strand displacement amplification (see U.S. Patent No. 5,744,311); transcription-free isothermal amplification (see U.S. Patent No. 6,033,881); repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Patent No. 5,427,930); coupled ligase detection and PCR (see U.S. Patent No. 6,027,889); and NASBATM RNA transcription-free amplification (see U.S. Patent No. 6,025,134).
  • Double-stranded DNA has two strands, a 5' -> 3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse compliment), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand ofthe DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).
  • Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA.
  • Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA.
  • Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
  • Binding or stable binding An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount ofthe oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by either physical or functional properties ofthe targe oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays. Binding can be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation and the like.
  • Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light abso ⁇ tion detection procedures.
  • DNase I or chemical footprinting gel shift and affinity cleavage assays
  • Northern blotting dot blotting
  • light abso ⁇ tion detection procedures For example, one method that is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased.
  • T m temperature at which 50% ofthe oligomer is melted from its target.
  • T m temperature at which 50% ofthe oligomer is melted from its target.
  • Biological condition Designates a condition of a subject that can be assessed through observation or through the analysis of a biological sample, e.g., altered expression level of ABCA13 protein in comparison to a control expression level, or ability of cells from a subject to transport cholesterol.
  • Biological sample Any sample in which the presence of a protein and/or ongoing expression of a protein may be detected. Suitable biological samples include samples containing genomic DNA or RNA (including mRNA), obtained from body cells of a subject, such as but not limited to those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material.
  • cDNA complementary DNA: A piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA can also contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA molecule. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
  • DNA deoxyribonucleic acid: A long chain polymer that comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)).
  • the repeating units in DNA polymers are four different nucleotides, each of which comprises one ofthe four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached.
  • Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide.
  • codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
  • any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single-strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence ofthe disclosed nucleic acid molecules. Deletion: The removal of a sequence of DNA, the regions on either side being joined together.
  • a polynucleotide is said to "encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof.
  • the anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
  • Functional fragments and variants of a polypeptide Included are those fragments and variants that maintain at least one function ofthe parent polypeptide. It is recognized that the gene or cDNA encoding a polypeptide can be considerably mutated without materially altering one or more the polypeptide' s functions. First, the genetic code is well known to be degenerate, and thus different codons encode the same amino acids. Second, even where an amino acid substitution is introduced, the mutation can be conservative and have no material impact on the essential functions of a protein (see Stryer, Biochemistry 4 th Ed., W. Freeman & Co., New York, NY, 1995).
  • part of a polypeptide chain can be deleted without impairing or eliminating all of its functions, e.g., sequence variants a protein, such as a 5' or 3' variant, may retain the full function of an entire protein.
  • insertions or additions can be made in the polypeptide chain for example, adding epitope tags, without impairing or eliminating its functions (Ausubel et al., Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1998).
  • Other modifications that can be made without materially impairing one or more functions of a polypeptide include, for example, in vivo or in vitro chemical and biochemical modifications or the incorporation of unusual amino acids.
  • Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquination, labeling, e.g., with radionucleides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art.
  • labeling e.g., with radionucleides
  • various enzymatic modifications as will be readily appreciated by those well skilled in the art.
  • a variety of methods for labeling polypeptides and labels useful for such purposes are well known in the art, and include radioactive isotopes such as 3Z P, ligands that bind to or are bound by labeled specific binding partners (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands. Functional fragments and variants can be of varying length.
  • a fragment may consist of 10 or more, 25 or more, 50 or more, 75 or more, 100 or more, or 200 or more amino acid residues.
  • a functional fragment or variant of ABCA 13 is defined herein as a polypeptide that is capable of transporter activity, including any polypeptide six or more amino acid residues in length that is capable of transporter activity. Fragments of ABCAl 3 that contain one or more domains as described herein, whether in the native arrangement or order, or in a different arrangement or order, are specifically contemplated.
  • Heterologous A type of sequence that is not normally (i.e. in the wild-type sequence) found adjacent to a second sequence. In one embodiment, the sequence is from a different genetic source, such as a virus or organism, than the second sequence.
  • nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing.” More specifically, A will hydrogen bond to T or U, and G will bond to C.
  • base pairing More specifically, A will hydrogen bond to T or U, and G will bond to C.
  • “Complementary” refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions ofthe same nucleic acid sequence.
  • oligonucleotide and oligonucleotide analog are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target.
  • the oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable.
  • An oligonucleotide or analog is specifically hybridizable when binding ofthe oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function ofthe target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding ofthe oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature ofthe hybridization method of choice and the composition and length ofthe hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na + concentration) ofthe hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11, herein incorporated by reference.
  • Hybridization 5x-6x SSC at 65°C-70°C for 16-20 hours Wash twice: 2x SSC at RT for 5-20 minutes each
  • Hybridization 6x SSC at RT to 55°C for 16-20 hours Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
  • Isoform As used herein, this term refers to are forms of a protein that have the same or similar biological function, but differ in the amino acid sequence comprising the protein (see e.g., Chen et al, J. Exp. Biol.205(Pt 17): 2677-2686, 2002). Isoforms of a protein may be produced by different genes or by alternative splicing of RNA transcripts from the same gene. The amino acid sequences of seven isoforms ofthe ABCA13 protein are disclosed herein as SEQ ID NO: 2, 19, 21, 23, 25, 27, and 29.
  • nucleic acid and proteins that have been isolated include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
  • Labeled A biomolecule attached covalently or noncovalently to a detectable label or reporter molecule.
  • Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al., Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989 and Ausubel et al, Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1998.
  • ATP can be labeled in any one of its three phosphate groups with radioisotopes such as 32 P or 33 P, or in its sugar moiety with radioisotopes such as 35 S.
  • Mammal This term includes both human and non-human mammals. Similarly, the term subject includes both human and veterinary subjects.
  • Modulator An agent that increases or decreases (modulates) the activity of a protein as measured by the change in an experimental parameter.
  • a modulator can be essentially any compound, such as a chemotherapeutic agent, a polypeptide, a hormone, a nucleic acid, a sugar, a lipid and the like.
  • Mutation Any change ofthe DNA sequence within a gene or chromosome. In some instances, a mutation will alter a characteristic or trait (phenotype), but this is not always the case. Types of mutations include base substitution point mutations (e.g., transitions or transversions), deletions, and insertions. Missense mutations are those that introduce a different amino acid into the sequence ofthe encoded protein; nonsense mutations are those that introduce a new stop codon. In the case of insertions or deletions, mutations can be in-frame (not changing the frame ofthe overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination ofthe encoded product due to the presence of a stop codon in the alternative frame).
  • This term specifically encompasses variations that arise through somatic mutation, for instance those that are found only in disease cells, but not constitutionally, in a given individual. Examples of such somatically-acquired variations include the point mutations that frequently result in altered function of various genes that are involved in development of cancers.
  • This term also encompasses DNA alterations that are present constitutionally, that alter the function ofthe encoded protein in a readily demonstrable manner, and that can be inherited by the children of an affected individual.
  • the term overlaps with "polymorphism,” as defined below, but generally refers to the subset of constitutional alterations that have arisen within the past few generations in a kindred and that are not widely disseminated in a population group. In particular embodiments, the term is directed to those constitutional alterations that have major impact on the health of affected individuals.
  • Nucleotide This term includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA).
  • a nucleotide is one monomer in a polynucleotide.
  • a nucleotide sequence refers to the sequence of bases in a polynucleotide.
  • Oligonucleotide A plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in length.
  • An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions.
  • oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.
  • Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
  • PNA peptide nucleic acid
  • Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15 or 20 bases.
  • a sequence such as DNA or RNA
  • a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression ofthe coding sequence.
  • operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
  • Open reading frame A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide.
  • Ortholog Two nucleic acid or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.
  • Polypeptide A polymer in which the monomers are amino acid residues that are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred.
  • polypeptide or protein as used herein encompasses any amino acid sequence and includes modified sequences such as glycoproteins.
  • polypeptide is specifically intended to cover naturally occurring proteins, as well as those that are recombinantly or synthetically produced.
  • polypeptide fragment refers to a portion of a polypeptide that exhibits at least one useful epitope.
  • the phrase "functional fragments of a polypeptide” refers to all fragments of a polypeptide that retain an activity, or a measurable portion of an activity, ofthe polypeptide from which the fragment is derived. Fragments, for example, can vary in size from a polypeptide fragment as small as an epitope capable of binding an antibody molecule to a large polypeptide capable of participating in the characteristic induction or programming of phenotypic changes within a cell.
  • An epitope is a region of a polypeptide capable of binding an immunoglobulin generated in response to contact with an antigen. Thus, smaller peptides containing the biological activity of insulin, or conservative variants o the insulin, are thus included as being of use.
  • the term soluble refers to a form of a polypeptide that is not inserted into a cell membrane.
  • Variations in the cDNA sequence that result in amino acid changes, whether conservative or not, are usually minimized in order to preserve the functional and immunologic identity ofthe encoded protein.
  • the immunologic identity ofthe protein may be assessed by determining whether it is recognized by an antibody; a variant that is recognized by such an antibody is immunologically conserved.
  • a cDNA sequence variant will preferably introduce no more than thirty, in some instances no more than twenty, and preferably fewer than ten amino acid substitutions into the encoded polypeptide.
  • Variant amino acid sequences may, for example, be 80, 90 or even 95% or 98% identical to the native amino acid sequence. Programs and algorithms for determining percentage identity can be found at the NCBI website.
  • Polymorphism Variant in a sequence of a gene, usually carried from one generation to another in a population. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, geographic locations.
  • the term polymorphism also encompasses variations that produce gene products with altered function, for instance variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, or increased or increased activity gene product.
  • Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic ofthe nucleic acid molecule or protein that is linked to the variation (e.g., an alteration of a secondary structure such as a stem-loop, or an alteration ofthe binding affinity ofthe nucleic acid for associated molecules, such as polymerases, RNases, and so forth).
  • Probes and primers Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided in this disclosure.
  • a probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule.
  • Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992).
  • Primers are short nucleic acid molecules, preferably DNA oligonucleotides 10 nucleotides or more in length. More preferably, longer DNA oligonucleotides can be about 15, 17, 20, or 23 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
  • PCR polymerase chain reaction
  • PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).
  • probes and primers can be selected that comprise at least 17, 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of ABCA13 nucleotide sequences.
  • the disclosure thus includes isolated nucleic acid molecules that comprise specified lengths ofthe disclosed ABCA13 cDNA sequences.
  • Such molecules can comprise at least 17, 20, 23, 25, 30, 35, 40, 45 or 50 or more consecutive nucleotides of these sequences, and can be obtained from any region ofthe disclosed sequences.
  • the ABCAl 3 cDNA sequences can be apportioned into halves, thirds or quarters based on sequence length, and the isolated nucleic acid molecules can be derived from the first or second halves ofthe molecules, from any ofthe three thirds or any ofthe four quarters.
  • the human ABCA13 cDNA, ORF, coding sequence and gene sequences can be apportioned into about halves, thirds or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) can be derived from the first or second halves ofthe molecules, from any ofthe three thirds, or any ofthe four quarters.
  • the cDNA also could be divided into smaller regions, e.g. about eighths, sixteenths, twentieths, fiftieths and so forth, with similar effect.
  • nucleic acid molecules for instance to be used as hybridization probe molecules, may be selected from the region encoding the N-terminal nucleotide binding domain (NBD1) region (e.g., about residues 3868-4050, or a fragment thereof), or from the region encoding the C-terminal nucleotide binding domain (NBD2) (e.g., about residues 4747-4932 or a fragment thereof), or the or the region encoding the N-terminal transmembrane domain (TMl) region (e.g., about residues 22-3774, or a fragment thereof) or the region encoding the C-terminal transmembrane domain (TM2) region (e.g., about residues 4225-4675) ofthe amino acid sequence encoding the human ABCA13 cDNA shown in S
  • residues corresponding to the hydrophobic regions that compose the transmembrane domains of ABCA13 are residues 20-42, 3571-3793, 3414-3636, 3646-3668, 3677-3697, 3751-3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654-4675 of SEQ ID NO: 2 (see Figure 4). It should be noted however, that these regions are predicted using computer programs; thus, prediction using a different computer program may generate slightly different regions than those disclosed herein. Another mode of division is to select the 5' (upstream) and/or 3' (downstream) region associated with an ABCA13 gene, or to select an intron or portion thereof.
  • purified In a more pure form than is found in nature.
  • the term purified does not require absolute purity; rather, it is intended as a relative term.
  • a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell.
  • substantially purified as used herein refers to a molecule (e.g., a nucleic acid, polypeptide, oligonucleotide, etc.) that is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the molecule is a polypeptide that is at least 50% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the polypeptide is at least at least 80% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • the polypeptide is at least 90% or at least 95% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
  • Recombinant A nucleic acid that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
  • Sequence identity The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms ofthe similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
  • homologs or orthologs ofthe ABCA13 protein, and the corresponding cDNA sequence will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or cDNAs are derived from species that are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences).
  • ABCA13 orthologs are at least 50% identical at the nucleotide level and at least 50%) identical at the amino acid level when comparing ABCA13 to an orthologous ABCA13.
  • Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman J Mol. Biol. 147(1): 195- 197, 1981; Needleman and Wunsch J. Mol. Biol. 48: 443-453, 1970; Pearson and Lipman Proc. Natl. Acad. Sci. USA 85: 2444-2448, 1988; Higgins and Sharp Gene, 73: 237-244, 1988; Higgins and Sharp CABIOS 5: 151-153, 1989; Corpet et al. Nuc. Acids Res.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. J. Mol. Biol. 215: 403- 410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx.
  • NCBI National Center for Biotechnology Information
  • the Search Tool can be accessed at the NCBI website, together with a description of how to determine sequence identity using this program.
  • Stringent conditions are sequence- dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5° C to 20° C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH. The T m is the temperature (under defined ionic strength and pH) at which 50% ofthe target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook et al.
  • Nucleic acid sequences that do not show a high degree of identity can nevertheless encode similar amino acid sequences, due to the degeneracy ofthe genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.
  • Specific binding agent An agent that binds substantially only to a defined target.
  • ABCAl 3 protein-specific binding agent binds substantially only an ABCAl 3 protein.
  • the phrase ABCAl 3 protein-specific binding agent includes anti-ABCA13 protein antibodies and other agents (such as soluble receptors) that bind substantially only to an ABCA 13 protein, such as the ABCAl 3 proteins ofthe disclosure, or conservative variants thereof.
  • Anti-ABCA13 protein antibodies can be produced using standard procedures described in a number of texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). The determination that a particular agent binds substantially only to the ABCA13 protein can readily be made by using or adapting routine procedures.
  • a phosphor-specific binding agent specifically binds to a peptide containing a phosphorylated residue.
  • Shorter fragments of antibodies can also serve as specific binding agents.
  • Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to ABCA13 would be ABCAl 3-specific binding agents.
  • These antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion ofthe heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment ofthe antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab')2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region ofthe light chain and the variable region ofthe heavy
  • Subject Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
  • Target sequence is a portion of ssDNA, dsDNA or RNA that, upon hybridization to a therapeutically effective oligonucleotide or oligonucleotide analog, results in the inhibition of expression. For example, hybridization of therapeutically effectively oligonucleotide to an ABCA13 target sequence results in inhibition of ABCA13 expression.
  • an antisense or a sense molecule can be used to target a portion of dsDNA, as both will interfere with the expression of that portion ofthe dsDNA.
  • the antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand.
  • target sequences can be ssDNA, dsDNA, and RNA.
  • Transfected A process by which a nucleic acid molecule is introduced into cell, for instance by molecular biology techniques, resulting in a transfected cell.
  • transfection encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transduction with viral vectors, transfection with plasmid vectors, and introduction of DNA by electroporation, lipofection, and particle gun acceleration.
  • Treating a disease Includes inhibiting or preventing the partial or full development or progression of a disease, for example in a person who is known to have a predisposition to a disease.
  • treating a disease refers to a therapeutic intervention that ameliorates at least one sign or symptom of a disease or pathological condition, or interferes with a pathophysiological process, after the disease or pathological condition has begun to develop.
  • Vector A nucleic acid molecule as introduced into a host cell, thereby producing a transfected host cell.
  • Recombinant DNA vectors are vectors having recombinant DNA.
  • a vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
  • a vector can also include one or more selectable marker genes and other genetic elements known in the art.
  • Viral vectors are recombinant DNA vectors having at least some nucleic acid sequences derived from one or more viruses.
  • SEQ ID NOs: 2, 19, 21, 23, 25, 27, and 29 Specific embodiments include purified proteins having high identity (e.g., 85%, 90%, 95%) to amino acid residues 2278-4942 of ABCAl 3 Isoform 1 (SEQ ID NO: 2). Specific embodiments disclose proteins having high identity to a conserved region shared by all isoform proteins, residues 2278-4942 of SEQ ID NO: 2.
  • the provided ABCA 13 proteins have ABCA13 protein biological activity, for instance in that they can complement an ABCA13 null phenotype.
  • Specific embodiments include ABCAl 3 proteins having biological activity as extra- and/or intracellular membrane transport proteins that can complement A BCA13 null phenotypes by ameliorating the respective transport deficiencies.
  • nucleic acid molecules encoding the seven Isoform proteins, having nucleotide sequences as set forth as SEQ ID NOs: 1, 18, 20, 22, 24, 26 and 28.
  • Recombinant polynucleotides encoding these sequences, including polynucleotides encoding the coding regions of SEQ ID NOs: 1, 18, 20, 22, 24, 26 and 28 are provided herein.
  • Methods to diagnose and detect defects or alterations in ABCAl 3 expression are provided, as are methods for screening for specific binding agents of ABCAl 3.
  • the methods are used to detect hypercholesterolemia, drug resistance, retinal degeneration, or neurological disease.
  • Other methods are used to detect chemotherapy resistant cells, or employ primers having sequences identical to at least 10 contiguous nucleotides of disclosed sequences, including SEQ ID NOs: 1, 18, 20, 22, 24, 26 or 28.
  • Antibodies specific to ABCA13 and the use of such antibodies (e.g., in Western blot to ELISA assays) are disclosed.
  • Kits for using the ABCAl 3 Isoform proteins are disclosed, including kits for screening defects in ABCAl 3 biological activity, and kits used to assay particular defects in individuals with defective ABCA13, including altered extra- or intracellular transport.
  • the ABCAl 3 gene encodes a protein proposed to be involved in the energy-dependent transport of one or a variety of substances, for example ions, metals, amino acids, lipids, peptides, sugars, vitamins and steroid hormones.
  • ABCAl 3 is located in a locus genetically linked to the Shwachmann-Diamond syndrome, a disorder ofthe pancreas, and a locus involved in T cell tumorigenesis.
  • ABCA 13 is a candidate gene for these phenotypes.
  • the gene is also highest expressed in certain tumor cell lines from leukemia, prostate and CNS, suggesting that it may play a role in these cancers.
  • ABCAl 3 cDNA sequences are used to pinpoint the location of ABCAl 3 in the human genome.
  • ABCAl 3 was localized by amplification of monochrome hybrids and radiation hybrids using the Polymerase Chain Reaction (PCR) (see Morten et al., Hum. Genet. 88(2): 200-203, 1991). Subsequently, the position of ABCAl 3 on the draft human map was determined using chromosomal assignment using somatic cell hybrids (CASH) (see Ryu et al., Mol Cells 10(5): 598-600, 2000). RT-PCR analysis shows that ABCA13 is expressed in brain, lung, skeletal muscle and ovary. In a study of sixty tumor cell lines, the expression of ABCAl 3 was detected in SR leukemia, SNB-19 CNS tumor, and DU-145 prostate tumor cell lines.
  • PCR Polymerase Chain Reaction
  • the ABCAl 3 gene maps to chromosome 7pl2.3, a region that contains an inherited disorder affecting the pancreas as well as a locus involved in tumorigenesis. ABCA 13 is therefore a positional candidate for these pathologies.
  • the ABCAl 3 gene is not present in zebrafish, indicated that it is a recently evolved gene specific to mammals.
  • ABCAl 3 transporter proteins and isoforms and variants thereof and nucleic acid molecules encoding these proteins, including cDNA sequences.
  • these sequences are used for ameliorating, treating, detecting, prognosing, and diagnosing diseases and conditions believed to be associated with altered ABCAl 3 expression (based on homology to other ABCA family members), such as hypercholesterolemia, drug resistance, retinal degeneration, or neurological disease.
  • an ABCA 13 nucleic acid has altered expression (e.g., increased or decreased expression, such as altered transcription of ABCAl 3 mRNA, a mutated or deleted expression product, improper subcellular localization of a nucleic acid, etc.) as compared to a control nucleic acid (e.g., a nucleic acid amplified, using positive control sequences, from a subject not suffering from the biological condition).
  • expression of an ABCAl 3 nucleic acid is more than 50%, more than 75%, more than 100%, more than 200%, or more than 300% different when compared to a suitable control.
  • Suitable controls include a known control, a known sample, or a standard value as assigned by one of ordinary skill in the art as a suitable standard value.
  • the nucleic acid molecule encodes a protein of 5058 amino acids in length (SEQ ID NO: 2).
  • Splice variants ofthe ABCAl 3 gene are also provided (e.g., SEQ ID NOs: 18, 20, 22, 24, 26, and 28); these encode various isoforms of ABCA13 (SEQ ID NOs: 19, 21, 23, 25, 27, and 29, respectively).
  • the full-length ABCA 13 gene is encoded by 62 exons and spans over 450 kb, making ABCAl 3 the largest ABC gene described to date, including the largest number of exons. Exon and intron positions and accompanying data for full-length ABCAl 3 are summarized in Table 1.
  • amino acids 20-42, 3571-3793, 3414-3636, 3646-3668, 3677-3697, 3751- 3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654-4675 of SEQ ID NO: 2 are predicted transmembrane domains (see Figure 5).
  • Amino acids 9-15 compose a conserved ABCA family motif.
  • Amino acids 3868-4050 and 4747-4932 are predicted nucleotide binding fold domains.
  • Amino acids 708-2911 compose the large extracellular domain exon.
  • Amino acids 3707-3729 compose a hydrophobic domain, and amino acids 4152-4156 and 5026-5030 are potential phosphorylation sites.
  • GenBank version 126 and 127): AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPl 1-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RPl 1-12G8, complete sequence, 70416 base pairs; AC073927 (gl3992793), Homo sapiens chromosome 7 BAG, clone RP11-604B16, complete sequence, 185676 base pairs; and AC091770 (gl5638906), Homo sapiens chromosome 7, BAG clone RPl 1-655M5, complete sequence, 93543 base pairs.
  • Isoform 2A is a protein encoded by a nucleotide sequence of 12,498 base pairs (SEQ ID NO: 18).
  • the protein sequence of Isoform 2A (SEQ ID NO: 19) is 2760 amino acids in length.
  • Isoform 2B is encoded by a nucleotide sequence of 12,498 base pairs (SEQ ID NO: 20) and its predicted amino acid sequence (SEQ ID NO: 21) is 717 amino acids in length.
  • GenBank GenBank
  • Isoform 3 (SEQ ID NO: 23) is 4958 amino acids in length and encoded by a nucleotide sequence of 15,970 base pairs (SEQ ID NO: 22).
  • GenBank GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RP11- 653017, complete sequence, 191141 base pairs; AC095039 (gl 6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAC, clone RP11-604B16, complete sequence, 185676 base pairs.
  • Relevant exon and intron positions and accompanying data are summarized in Table 3.
  • Isoform 4 ofthe ABCAl 3 gene is 11259 base pairs long (SEQ ID NO: 24) with an open reading frame of 8079 base pairs, corresponding to 2660 amino acids (SEQ ID NO: 25).
  • GenBank GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPll-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAC clone RP11- 604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 4. Table 4. ABCA13 Isoform 4 Positional Data
  • Isoform 5 ofthe ABCA13 gene is 15779 base pairs long (SEQ ID NO: 26) with an open reading frame of 14877 base pairs, corresponding to 4952 amino acids (SEQ ID NO: 27).
  • GenBank GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPll-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAG clone RPl 1- 604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 5. Table 5.
  • Isoform 6 ofthe ABCA13 gene is 11068 base pairs long (SEQ ID NO: 28) with an open reading frame of 8061 base pairs, corresponding to 2654 amino acids (SEQ ID NO: 29).
  • GenBank GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPl 1-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RPl 1-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAC clone RPl 1- 604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 6. Table 6. ABCA13 Isoform 6 Positional Data
  • in vitro nucleic acid amplification such as polymerase chain reaction (PCR)
  • PCR polymerase chain reaction
  • RNA is extracted from human cells by any one of a variety of methods well known to those of ordinary skill in the art (Sambrook et al., in Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989; and Ausubel et al., in Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992 provide descriptions of methods for RNA isolation).
  • primary cells are obtained from normal tissues.
  • cells are obtained from tissues from subjects exhibiting the effects of ABCA13 transporter deficiency.
  • cell lines, derived from normal or transporter-deficient tissues are used as a source of such RNA.
  • RNA is then used, for example, as a template for performing reverse transcription (RT)-PCR amplification of cDNA.
  • RT reverse transcription
  • primers may be chosen to amplify a segment of a cDNA or, in another embodiment, the entire cD A molecule. Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. ⁇ PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990).
  • the coding portion ofthe human ABCA13 cDNA molecule (approximately 15,198 base pairs) and the full-length human ABCA13 Isoform 1 cDNA, as shown in SEQ ID NO: 1, may be amplified using primers, such as SEQ ID NO: 3 through 15 ofthe disclosure.
  • the primers set forth as SEQ ID NO: 3, 4, 6-8, and 10-15 can be used to amplify a human ABCAl 3 Isoform 2A cDNA, as shown in SEQ ID NO: 18; the primers set forth as SEQ ID NO: 3-5, 7-15, and 73 can be used to amplify a human ABCAl 3 Isoform 3 cDNA, as shown in SEQ ID NO: 22; the primers set forth as SEQ ID NO: 3, 4, 7, 8, 10-15 and 73 can be used to amplify a human ABCAl 3 Isoform 4 cDNA, as shown in SEQ ID NO: 24; the primers set forth as SEQ ID NO: 3-5, 7-15, 74, and 75 can be used to amplify a human ABCAl 3 Isoform 5 cDNA, as shown in SEQ ID NO: 26; and the primers set forth as SEQ ID NO: 3, 4, 7, 8, 10-15, 74, 75 can be used to amplify a human ABCAl 3 I
  • primers are illustrative only; one skilled in the art will appreciate that many different primers may be derived from the provided cDNA or gene sequence in order to amplify particular regions ofthe ABCAl 3 cDNA isoforms, as well as the complete sequence ofthe human ABCAl 3 cDNA (Isoform 1, SEQ ID NO: 1).
  • Re-sequencing of PCR products obtained by amplification procedures optionally can be performed to facilitate confirmation ofthe amplified sequence and provide information about natural variation of this sequence in different populations or species.
  • Oligonucleotides derived from the provided ABCAl 3 sequences may be used in such sequencing methods.
  • Orthologs of human ABCA13 can be cloned in a similar manner, where the starting material consists of cells taken from a non-human species.
  • the mouse gene ortholog to human ABCA13 displays 54% amino acid identity and 69% similarity in the large extracellular domain.
  • orthologs will generally share at least 65% sequence identity with the disclosed human ABCAl 3 cDNA. Where the non-human species is more closely related to humans, the sequence identity will in general be greater.
  • closely related orthologous ABCAl 3 molecules may share at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 91%, at least 93%, at least 95%, or at least 98% sequence identity with the disclosed human sequences.
  • Oligonucleotides derived from the human ABCA13 cDNA isoform sequences are encompassed within the scope ofthe present disclosure.
  • such oligonucleotides may comprise a sequence of at least 10 consecutive nucleotides of the ABCAl 3 nucleic acid sequence. If these oligonucleotides are used with an in vitro amplification procedure (such as PCR), lengthening the oligonucleotides may enhance amplification specificity.
  • oligonucleotide primers comprising at least 15, 20, 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these sequences may be used. These primers for instance may be obtained from any region ofthe disclosed sequences.
  • the human ABCA 13 cDNA, ORF and gene sequences may be apportioned into about halves, thirds or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) may be derived from the first or second halves ofthe molecules, from any ofthe three thirds, or from any ofthe four quarters.
  • the full-length human ABCAl 3 cDNA shown in SEQ ID NO: 1, can be used to illustrate this.
  • the human ABCA13 cDNA is 17209 nucleotides in length, and the open reading frame begins at position 5 and ends at position 15202.
  • the open reading frame may be hypothetically divided into about halves (nucleotides 5-7600 and 7599-15202), in another specific embodiment, in about thirds (nucleotides 5- 5060, 5061-10120, 10121-15202) or in yet another specific embodiment, in about quarters (nucleotides 5-3800, 3801-7600, 7601-11400 and 11401-15202).
  • the cDNA sequences ofthe additional Isoforms 2A. 2B, and 3-6 can be similarly divided.
  • variant ABCAl 3 proteins include proteins that differ in amino acid sequence from the human ABCAl 3 sequences disclosed but that share at least 65% amino acid sequence identity with the provided human ABCAl 3 protein. In other embodiments, other variants will share at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% amino acid sequence identity.
  • a ABCA13 encoding sequence may be isolated by routine procedures, such as those provided in Example 1. For instance, a ABCAl 3 sequence may be isolated by homology screening using the cDNA sequence and the BLAST program. Direct sequencing, using the "longdistance sequence method," of one or more BAG or PAC clones that contain the ABCA13 sequence can be employed.
  • Manipulation ofthe nucleotide sequence ofthe ABCA13 isoforms using standard procedures, including in one specific, non-limiting, embodiment, site-directed mutagenesis or in another specific, non-limiting, embodiment, PCR, can be used to produce such variants.
  • the simplest modifications involve the substitution of one or more amino acids for amino acids having similar biochemical properties. These so-called conservative substitutions are likely to have minimal impact on the activity ofthe resultant protein.
  • more substantial changes in transporter function or other protein features may be obtained by selecting amino acid substitutions that are less conservative than conservative substitutions.
  • such changes include changing residues that differ more significantly in their effect on maintaining polypeptide backbone structure (e.g., sheet or helical conformation) near the substitution, charge or hydrophobicity ofthe molecule at the target site, or bulk of a specific side chain.
  • a hydrophilic residue e.g., seryl or threonyl
  • a hydrophobic residue e.g., leucyl, isoleucyl, phenylalanyl, or valyl
  • a cysteine or proline is substituted for (or by) any other residue
  • a residue having an electropositive side chain e.g., lysyl, arginyl, or histadyl
  • an electronegative residue e.g., glutamyl or aspartyl
  • a residue having a bulky side chain e.g., phenylalanine
  • one lacking a side chain e.g., glycine
  • changes in transporter activity or other protein features may be obtained by mutating, substituting or deleting regions of ABCAl 3 that have a known function, or regions where the function is yet to be determined.
  • a NBD (nucleotide binding domain) motif of ABCA13 corresponding to residues 3863 to 4044 or 4742 to 4894 of SEQ ID NO: 2 can be deleted, substituted with the NBD of another protein or a synthetic NBD, or residues within the NBD motif can be mutated.
  • residues within any ofthe twelve ABCA13 transmembrane domain (e.g., residues 20-42, 3571-3793, 3414-3636, 3646-3668, 3677-3697, 3751-3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654-4675 of SEQ ID NO: 2, see Figure 4) are mutated or deleted, or the TM is substituted with a transmembrane domain of another protein or a synthetic TM.
  • TM ABCA13 transmembrane domain
  • mutations may be made within the ABCA13 transmembrane domain or NBD motif of the sequences encoding ABCA 13 Isoforms 2A, 2B, and 3-6.
  • one or more domain from one ABCA13 isoform can be exchanged with the domain of another isoforms.
  • Variant ABCA 13 encoding sequences may be produced by standard DNA mutagenesis techniques.
  • M13 primer mutagenesis is performed.
  • DNA molecules and nucleotide sequences that are derivatives of those specifically disclosed herein, and which differ from those disclosed by the deletion, addition, or substitution of nucleotides while still encoding a protein that has at least 65% sequence identity with the human ABCA 13 encoding sequence disclosed (SEQ ID NO: 1), are comprehended by this disclosure.
  • At least one or more, at least 5 or more, at least 10 or more, at least 15 or more, at least 20 or more, or at least 25 or more nucleotides are deleted, added, or substituted while still encoding a protein that has at least 65% sequence identity with the human ABCAl 3 encoding sequence disclosed (SEQ ID NO: 1).
  • more closely related nucleic acid molecules that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% nucleotide sequence identity with the disclosed ABCAl 3 sequences are comprehended by this disclosure.
  • such variants may differ from the disclosed sequences by alteration ofthe coding region to fit the codon usage bias ofthe particular organism into which the molecule is to be introduced.
  • the coding region may be altered by taking advantage ofthe degeneracy ofthe genetic code to alter the coding sequence such that, while the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to the disclosed human ABCA13 protein sequences.
  • the genetic code because ofthe degeneracy ofthe genetic code, four nucleotide codon triplets - (GCT, GCG, GCC and GCA) - code for alanine.
  • the coding sequence of any specific alanine residue within the human ABCA13 protein therefore, could be changed to any of these alternative codons without affecting the amino acid composition or characteristics ofthe encoded protein.
  • variant DNA molecules may be derived from the cDNA and gene sequences disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences.
  • this disclosure also encompasses nucleic acid sequences that encode an ABCA 13 protein, but which vary from the disclosed nucleic acid sequences by virtue ofthe degeneracy ofthe genetic code.
  • variants ofthe ABCA13 isoform proteins may also be defined in terms of their sequence identity with the prototype human ABCAl 3 protein.
  • human ABCAl 3 proteins share at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% amino acid sequence identity with the human ABCAl 3 isoform 1 protein (SEQ ID NO: 2).
  • at least one or more, at least 5 or more, at least 10 or more, at least 15 or more, at least 20 or more, or at least 25 or more amino acids are deleted, added, or substituted while still encoding a protein that has at least 65% sequence identity with the ABCA13 isoform 1 encoding sequence (SEQ ID NO: 2).
  • Nucleic acid sequences that encode such proteins/fragments readily may be determined simply by applying the genetic code to the amino acid sequence of an ABCA 13 protein or fragment, and such nucleic acid molecules may readily be produced by assembling oligonucleotides corresponding to portions ofthe sequence.
  • Nucleic acid molecules that are derived from the human ABCA 13 cDNA nucleic acid sequences include molecules that hybridize under low stringency, high stringency, or very high stringency conditions to the disclosed prototypical ABCAl 3 nucleic acid molecules, and fragments thereof.
  • Human ABCAl 3 nucleic acid encoding molecules including the cDNA shown in SEQ ID NOs: 1, 18, 20, 22, 24, 26, 28 and nucleic acids comprising these sequences), and orthologs and homologs of these sequences, may be incorporated into transformation or expression vectors.
  • homologs ofthe ABCAl 3 nucleic acid may now be cloned from other species, such as the rat or a monkey, by standard cloning methods. Such homologs will be useful in the production of animal models demonstrating the formation and progression of a variety of tumors.
  • orthologous ABCA13 molecules will share at least 65% sequence identity with the human ABCA 13 nucleic acid disclosed herein; and in other embodiments, more closely related orthologous sequences will share at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity with this sequence.
  • the DNA sequence ofthe full-length ABCA13 cDNA (e.g., SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28) can be manipulated in studies to understand the expression ofthe gene and the function of its product.
  • Isoforms 2 A, 2B and 3-6 and/or mutant forms ofthe human ABCAl 3 may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, cellular localization, tissue specificity and functional properties ofthe encoded mutant ABCAl 3 protein.
  • partial or full-length cDNA sequences, which encode for the subject protein may be ligated into bacterial expression vectors.
  • E. coli Escherichia coli
  • fusion proteins consisting of amino terminal peptides encoded by a portion ofthe E. coli lacZ or trpE gene linked to ABCAl 3 proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins. Thereafter, these antibodies may be used in other embodiments to purify proteins by immunoaffinity chromatography, in diagnostic assays to quantitate the levels of protein and to localize proteins in tissues and individual cells by immunofluorescence.
  • Such antibodies may be specific for epitope tags, which can be added to the expression construct for identification and/or purification purposes.
  • Intact native protein also may be produced in E. coli or other cell culture systems in large amounts for functional studies. Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Ch. 17, CSHL, New York, 1989). Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response.
  • native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome binding site upstream ofthe cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy.
  • Vectors suitable for the production of intact native proteins include pKC30 (Belfort et al., J. Biol. Chem. 258(3):2045-2051, 1983), pKK177-3 (Amann and Brosius, Gene 40(2-3):183-190, 1985) and pET-3 (Srudier and Moffatt, J. Mol. Biol. 189(1):113-130, 1986).
  • ABCA13 fusion proteins may be isolated from protein gels, lyophilized, ground into a powder and used as an antigen.
  • the DNA sequence can also be transferred from its existing context to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al, Science 236:806-812, 1987).
  • other cloning vehicles such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al, Science 236:806-812, 1987).
  • vectors may then be introduced into a variety of hosts including, but not limited to, somatic cells, and simple or complex organisms, such as, but not limited to, bacteria, fungi (Timberlake and Marshall, Science 244:1313-1317, 1989), invertebrates, plants, and animals (Pursel etal, Science 244:1281-1288, 1989), which cells or organisms are rendered transgenic by the introduction ofthe heterologous ABCA13 cDNA.
  • the cDNA sequence is ligated to heterologous promoters.
  • it may be ligated to the simian virus (SV) 40 promoter in the pSV2 vector (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981), and introduced into cells, such as monkey COS-1 cells (Gluzman, Cell 23:175-182, 1981), to achieve transient or long-term expression.
  • the stable integration ofthe chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J. Mol. Appl. Genet.
  • cell lines expressing native ABCA13 are created.
  • cell lines expressing a mutant ABCA13 are created.
  • DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with nucleic acid amplification. These techniques are known to those of ordinary skill in the art.
  • the ABCA 13 cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques. These vectors are designed to permit the transcription of he cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription ofthe cDNA and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions ofthe SV40 or long terminal repeat (LTR) ofthe Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan et al., Proc. Natl. Acad. Sci.
  • LTR long terminal repeat
  • the level of expression ofthe cDNA can be manipulated with this type of vector by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S. frugiperda cells (Summers and Smith, in Genetically Altered Viruses and the Environment, Fields et al.
  • adenoviral vector containing a nuclear lacZ gene driven by a human ventricular/slow muscle myosin light chain 1 promoter (Shi et al, Hum Gene Ther. 8(4):403-410, 1997).
  • the expression ofthe cDNA can be monitored in the recipient cells 24 to 72 hours after induction (transient expression).
  • Some vectors contain selectable markers such as the gpt (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981) or neomycin (Southern and Berg, J. Mol. Appl. Genet. 1:327- 341, 1982) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression ofthe vectors (and therefore the cDNA).
  • the vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses, such as papilloma (Sarver et al, Mol. Cell Biol. 1:486-496, 1981) orEpstein- Barr (Sugden et al, Mol.
  • the vectors may contain an internal ribosomal entry site (IRES) between the cDNA and a marker gene, such as neomycin or enhanced green fluorescent protein (EGFP).
  • IRES internal ribosomal entry site
  • Ribosomes bind the isoform at both the 5' end to translate the cDNA and at the IRES to translate, in one specific, non-limiting embodiment, the antibiotic resistance marker, or in another specific, non-limiting embodiment, the fluorescent marker.
  • the bicistronic expression via the IRES sequence provides a high degree of correlation between the antibiotic resistance and stable expression ofthe cDNA. Alternatively, only cells expressing the cDNA will show green fluorescence. Thus, the use of expression vectors containing an IRES is an efficient way to select for cells expressing the cDNA of interest.
  • Recombinant expression vectors can be introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, Virology 52(2):456-467, 1973) or strontium phosphate (Brash et al, Mol. Cell Biol. 7(5):2031-2035, 1987), electroporation (Neumann etal, EMBOJ ⁇ (7): ⁇ -M5, 1982), lipofection ' (Feigner etal, Proc. Natl. Acad.
  • the ABCA 13 isoform cDNA sequences, or fragments thereof can be introduced by infection with virus vectors.
  • Systems are developed that use, for example, retroviruses (Huszar, et al, Proc. Natl. Acad. Sci.
  • eukaryotic expression systems can be used for studies of ABCAl 3 encoding nucleic acids and mutant forms of these molecules, the ABCAl 3 isoform proteins and mutant forms of these proteins. Regulatory elements located in the 5' region ofthe ABCAl 3 gene on genomic clones can be isolated from human genomic DNA libraries using the information contained herein. In other embodiments, the eukaryotic expression systems also may be used to study the function ofthe normal complete protein, specific portions ofthe protein, or of naturally occurring or artificially produced mutant proteins.
  • expression vectors containing the ABCAl 3 isoform gene sequences or cDNAs, or fragments or variants or mutants thereof can be introduced into human cells, mammalian cells from other species or non-mammalian cells, as desired.
  • the choice of cell is determined by the purpose ofthe treatment.
  • monkey COS cells Gluzman, Cell 23:175-182, 1981
  • Chinese hamster ovary CHO
  • mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts are used.
  • Embodiments described herein thus encompass recombinant vectors that comprise all or part of an ABCAl 3 encoding sequence, such as the ABCAl 3 isoform genes or cDNAs or variants thereof, for expression in a suitable host.
  • an ABCAl 3 DNA is operatively linked in a vector to an expression control sequence in the recombinant DNA molecule so that the ABCAl 3 polypeptide can be expressed.
  • the expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof.
  • the expression control sequence may be specifically selected from the group consisting ofthe lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter ofthe yeast alpha-mating factors and combinations thereof.
  • the host cell which may be transfected with a vector, may be selected from the group consisting of E. coli, Pseudomonas, Bacillus subtilis, Bacillus stearothermoph ⁇ lus or other bacilli; other bacteria; yeast; fungi; insect; mouse or other animal; or plant hosts; or human tissue cells.
  • mutant or variant ABCAl 3 DNA sequences e.g., ABCA13 isoforms encoded by SEQ ID NO: 18, 20, 22, 24, 26, or 28
  • similar systems are employed to express and produce the mutant product.
  • a diseased condition is in some instances attributed to overexpression of a protein (e.g., HER-2/neu is overexpressed in breast cancer, see Kaya et al, Pathol. Oncol Res. 7(4): 279-283, 2001).
  • reversal ofthe over-expression e.g., suppression
  • suppression of ABCA13 is achieved in a subject having a transporter malfunction due to overexpression of ABCAl 3.
  • Reduction of ABCA13 protein expression in a transgenic cell may be obtained for instance by introducing into cells an antisense construct based on an ABCA 13 encoding sequence, including the human ABCAl 3 cDNAs (SEQ ID NO: 1 18, 20, 22, 24, 26, and 28) or gene sequence or flanking regions thereof.
  • an antisense construct based on an ABCA 13 encoding sequence including the human ABCAl 3 cDNAs (SEQ ID NO: 1 18, 20, 22, 24, 26, and 28) or gene sequence or flanking regions thereof.
  • a nucleotide sequence from an ABCAl 3 encoding sequence e.g. all or a portion of one of UIQ ABCA13 CDNA isoform sequences, is arranged in reverse orientation relative to the promoter sequence in the transformation vector.
  • Other aspects of the vector may be chosen as discussed above (see Section VII).
  • the introduced sequence need not be the full-length human ABCAl 3 cDNA (SEQ ID NO: 1) or gene, and need not be exactly homologous to the equivalent sequence found in the cell type to be transfected.
  • portions or fragments ofthe human ABCAl 3 isoform cDNA SEQ ID NO: 1, 18, 20, 22, 24, 26, and 28
  • the introduced antisense sequence in the vector may be at least 15 nucleotides in length, and improved antisense suppression typically will be observed as the length ofthe antisense sequence increases.
  • the length ofthe antisense sequence in the vector advantageously may be greater than 100 nucleotides, and can be up to about the full length ofthe human ABCA13 cDNA or gene.
  • transcription of an antisense construct results in the production of RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous ABCAl 3 gene in the cell.
  • antisense RNA molecules bind to the endogenous mRNA molecules and thereby inhibit translation ofthe endogenous mRNA.
  • Ribozymes are synthetic RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to Cech and U.S. Patent No. 5,543,508 to Haselhoff.
  • the inclusion of ribozyme sequences within antisense RNAs may be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that bind to the antisense RNA are cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression.
  • dominant negative mutant forms of ABCAl 3 may be used to block endogenous ABCAl 3 activity.
  • Monoclonal or polyclonal antibodies may be produced to either the native ABCAl 3 protein or variant (e.g., isoform) forms of this protein.
  • antibodies raised against an ABCA13 protein would specifically detect the ABCA13 protein. That is, such antibodies would recognize and bind the ABCA13 protein, or fragments thereof, and would not substantially recognize or bind to other proteins found in human cells.
  • antibodies against the human ABCA13 protein may recognize ABCA13 from other species (e.g., murine ABCA13), and vice versa.
  • Monoclonal or polyclonal antibodies to the protein can be prepared as follows:
  • Monoclonal antibodies to epitopes ofthe ABCA 13 isoform proteins can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495-497, 1975) or derivative methods thereof.
  • a mouse is repetitively inoculated with a few micrograms ofthe selected protein over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells ofthe spleen isolated. The spleen cells are fused with mouse myeloma cells using polyethylene glycol, and the excess, non-fused, cells destroyed by growth ofthe system on selective media comprising aminopterin (HAT media).
  • HAT media aminopterin
  • Antibody-producing clones are identified by detection of antibody in the supernatant fluid ofthe wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol. 70(A): 419-439, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). B. Polyclonal Antibody Production by Immunization
  • Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein (for instance, expressed using a method described herein), which, in one specific, non-limiting embodiment, can be modified to enhance immunogenicity.
  • Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species.
  • small molecules may tend to be less immunogenic than others and may require the use of carriers and adjuvant, examples of which are known.
  • host animals may vary in response to site of inoculations and dose, with either inadequate or excessive doses of antigen resulting in low titer antisera.
  • a series of small doses (ng level) of antigen administered at multiple intradermal sites may be most reliable.
  • An effective immunization protocol for rabbits can be found in Vaitukaitis et al. J. Clin. Endocrinol. Metab. 33: 988-991, 1971.
  • booster injections will be given at regular intervals, and antiserum harvested when antibody titer thereof begins to fall, as determined semi-quantitative ly (for example, by double immunodiffusion in agar against known concentrations ofthe antigen). See, for example, Ouchterlony et al. (In Handbook of Experimental Immunology, Wier, D. (ed.) chapter 19, Blackwell, 1973).
  • the plateau concentration of antibody is usually in the range of about 0.1 to 0.2 mg/ml of serum (about 12 ⁇ M).
  • Affinity ofthe antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Ch. 42, 1980).
  • a third approach to raising antibodies against ABCA13 proteins is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence ofthe ABCA13 protein.
  • Polyclonal antibodies can be generated by injecting such peptides into, for instance, rabbits.
  • antibodies may be raised against an ABCAl 3 protein by subcutaneous injection of a recombinant DNA vector that expresses the ABCAl 3 protein into laboratory animals, such as mice.
  • delivery ofthe recombinant vector into the animals may be achieved using a hand-held form ofthe Biolistic system (Sanford et al, Particulate Sci. Technol 5:27-37, 1987), as described by Tang et al. (Nature 356:152-154, 1992).
  • expression vectors suitable for this purpose may include those that express the ABCA13 encoding sequence under the transcriptional control of either the human ⁇ -actin promoter or the cytomegalovirus (CMV) promoter.
  • Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.
  • ABCAl 3 isoform proteins and their functional variants are believed to participate in the regulation of energy-dependent transport of a wide variety of substrates, including ions, metals, amino acids, lipids, peptides, sugars, vitamins, and steroid hormones across membranes.
  • the lack of expression of ABCAl 3 in a cell leads to a defect in transporter activity.
  • the administration of an ABCA13 recombinant nucleotide to a subject suffering from a transporter deficiency ameliorates the effects ofthe deficiency.
  • mutant transporter proteins can yield important information about the importance of each amino acid in the protein as well as the details ofthe mechanism of action of these proteins.
  • Cells may have ABCAl 3 null mutations, ABCAl 3 missense mutations, or inactivation of ABCA13.
  • a mutant ABCA13 is expressed in a cell but is incapable of localizing to the correct subcellular location.
  • a mutant ABCAl 3 is incapable of binding to its intracellular binding partners.
  • a mutation in the upstream regulatory region ofthe ABCAl 3 gene abrogates the expression ofthe protein.
  • a mutant ABCAl 3 is incapable of transporting target substances.
  • mutations in the ABCAl 3 gene that may lead to tumor formation or progression are not included in the cDNA but rather are located in other regions of the ABCAl 3 gene. Mutations located outside ofthe ORF that encode the ABCA13 isoform proteins are not likely to affect the functional activity ofthe proteins, but rather are likely to result in altered levels ofthe proteins in the cell. For example, mutations in the promoter region ofthe ABCAl 3 gene may prevent transcription ofthe gene and therefore lead to the complete absence ofthe ABCA13 protein, or absence of certain transcripts ofthe protein, in the cell.
  • mutations within introns in the genomic sequence may also prevent expression ofthe ABCA13 protein.
  • the intron sequences are removed from the RNA molecule, in a process termed splicing, prior to translation ofthe RNA molecule that results in production of he encoded protein.
  • the cellular enzymes that perform the splicing function recognize sequences around the intron/exon border and in this manner recognize the appropriate splice sites. If a mutation exists within the sequence ofthe intron near and exon/intron junction, the enzymes may not recognize the junction and may fail to remove the intron. If this occurs, the encoded protein will likely be defective.
  • splice site mutations may also lead to defects in transporter activity.
  • knowledge ofthe exon structure and intronic splice site sequences ofthe ABCAl 3 gene is required to define the molecular basis of these abnormalities.
  • the provision herein of ABCAl 3 isoform cDNA sequences enables the cloning ofthe entire ABCA 13 gene (including the promoter and other regulatory regions and the intron sequences) and the determination of its nucleotide sequence. With this information in hand, diagnosis of a genetic predisposition to transporter deficiency based on DNA analysis will comprehend all possible mutagenic events at the ABCAl 3 locus.
  • Compounds that modulate the expression or activity of ABCA 13 can be used to regulate transporter activity. For instance, in some cases it may be determined that ABCA13 is expressed at low levels in a subject suffering from a transporter deficiency that arose as the result ofthe inefficient expression of ABCA13. Administration, to the subject, of an agent that up-regulates ABCA13 expression can improve transporter activity or ameliorate the transporter deficiency.
  • Changes in transporter activity can be assessed using a variety of in vitro and in vivo assays. These assays can be used to study the effect of ABCA13 on specific cell types or the effect of particular mutations on ABCAl 3 transporter activity. By systematically introducing mutant ABCA 13 constructs into cells and assessing their ability to transport substances across membranes, the importance of each amino acid for the protein's transporter activity can be determined. In addition, these assays can be used to screen for modulators of ABCAl 3 activity. The modulators identified in this way can then be used to alter ABCAl 3 expression in cells in vitro or in vivo.
  • cells expressing wild-type ABCA13 are assessed for their ability to transport substances in vitro, as compared to cells that express a mutant ABCA13.
  • ABCA13 is transfected into cells, and levels ofthe transported substance in these cells can be assayed and compared between wild-type and transfected cells for potential differences.
  • Methods of analysis include, for instance, immobilization ofthe protein on columns to search for compounds that bind the immobilized protein (see Wainer et al, J. Chromatogr. B. Biomed. Sci. Appl 724(1): 65-72, 1999) and disruption ofthe ABCAl 3 gene by antisense or RNAi technology (see Paddison et al, Proc. Natl Acad. Sci. U S. A. 99(3): 1443-1448, 2002).
  • samples or assays that are treated with a test compound that potentially modulates ABCAl 3 are compared to control samples that are not treated with the test compound, to examine the extent of modulation.
  • the compounds to be tested are present in the range from 0.1 nM to 10 mM.
  • Control samples (untreated with modulators) are assigned a relative ABCA13 activity value of 100%.
  • inhibition of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 90%.
  • inhibition of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 75%, about 50%, about 25%, or about 5%.
  • activation of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 110% (e.g. 10% more than the control). In other embodiments, activation of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 150%, about 175% or about 200%.
  • test compounds upon ABCAl 3 activity can be assessed using the assays described above.
  • assays include, but are not limited to, the ability to transport substances across membranes.
  • the compounds tested as modulators of ABCAl 3 are any small chemical compound, or biological entity, such as a polypeptide, sugar, nucleic acid or lipid.
  • the modulator is a genetically altered version of ABCAl 3.
  • the effect of potential modulators on ABCA 13 protein or mRNA levels, transcriptional activation or repression of a reporter gene is measured,
  • the ABCA 13 sequence information presented herein can be used in the area of genetic testing for predisposition to transporter deficiency owing to defects in ABCAl 3, such as deletion, duplication or mutation ofthe ABCAl 3 gene, or a portion thereof.
  • the gene sequence ofthe ABCAI3 gene, including intron-exon boundaries is also useful in such diagnostic methods. Whether an individual is carrying mutations in the ABCAl 3 gene (or a portion thereof), or has a duplication(s) or heterozygous or homozygous deletion(s) ofthe ABCAl 3 gene, may be detected at the DNA level with the use of a variety of techniques.
  • a biological sample ofthe subject which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated, duplicated or deleted ABCAl 3 gene.
  • Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material.
  • Biological samples can be obtained from normal, healthy subjects or from subjects who are predisposed to or who are suffering from any one of a variety ofthe effects of transporter deficiencies such as, but not limited to, hypercholesterolemia, or defective transport of hydrophobic compounds such as lipids, sterols or fatty acids.
  • the detection in the biological sample of either a mutant ABCAl 3 gene, a mutant ABCAl 3 RNA, or a duplicated or homozygously or heterozygously deleted ABCAl 3 gene may be performed by a number of methodologies, examples of which are discussed below.
  • amplification e.g., polymerase chain reaction amplification
  • RT- PCR reverse transcribed RNA
  • DNA extracted from a biological sample may be used directly for amplification.
  • Direct amplification from genomic DNA would be appropriate for analysis ofthe entire ABCAl 3 gene including regulatory sequences located upstream and downstream from the open reading frame, or intron/exon borders. Reviews of direct DNA diagnosis have been presented by Caskey (Science 236:1223-1228, 1989) and by Landegren et al (Science 242:229-237, 1989).
  • mutation scanning techniques appropriate for detecting unknown mutations within amplicons derived from DNA or cDNA could also be performed. These techniques include direct sequencing (without sequencing), single-strand conformational polymorphism analysis (SSCP) (for instance, see Hongyo et al, Nucleic Acids Res. 21 :3637-3642, 1993), chemical cleavage (including HOT cleavage) (Bateman et al, Am. J. Med. Genet. 45:233-240, 1993; reviewed in Ellis et al, Hum. Mutat.
  • SSCP single-strand conformational polymorphism analysis
  • DNA diagnostic methods can be designed to specifically detect the most common, or most closely disease-linked, ABCA13 defects.
  • the detection of specific DNA mutations may be achieved by methods such as hybridization using allele specific oligonucleotides (ASOs) (Wallace etal, CSHL Symp. Quant. Biol. 51:257-261, 1986), direct DNA sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988), the use of restriction enzymes (Flavell et al, Cell 15:25-41, 1978; Geever et al, 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp. Quant. Biol.
  • ASOs allele specific oligonucleotides
  • Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines. These oligonucleotides are optionally labeled radioactively with isotopes (such as 32 P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl. Acad. Sci.
  • Sequence differences between normal and mutant forms ofthe ABCA13 gene may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988). Cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with nucleic acid amplification, e.g. , PCR (Wrichnik et al, Nucleic Acids Res. 15 :529-542, 1987; Wong et al, Nature 330:384-386, 1987; Stoflet et al, Science 239:491-494, 1988).
  • a sequencing primer that lies within the amplified sequence is used with double-stranded PCR product or single-stranded template generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags.
  • Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or may eliminate existing restriction sites. Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization (Southern, J. Mol Biol 98:503-517, 1975). DNA fragments carrying the restriction site (either normal or mutant) are detected by their reduction in size or increase in corresponding restriction fragment numbers. Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme; fragments of different sizes are then visualized under UV light in the presence of ethidium bromide after gel electrophoresis.
  • Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing reagent. Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8 % non-denaturing polyacrylamide gel (WO 91/10734; Nagamine et al, Am. J. Hum. Genet. 45:337- 339, 1989).
  • DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al, Science 230:1242-1246, 1985).
  • a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR.
  • an invariant primer could be used in addition to a primer specific for a mutation.
  • the PCR products ofthe normal and mutant genes can then be differentially detected in acrylamide gels.
  • Another method, single-strand conformation polymorphism (SSCP) is based on the fact that a single- base substitution alters the conformation of single-stranded DNA under non-denaturing conditions.
  • Altered conformation affects the migration velocity of single-stranded DNA, which is detected as shifted or new bands on a non-denaturing gel.
  • the mutations underlying the shifted or new bands are then characterized by sequencing.
  • DNA fragments may also be visualized by methods in which the individual DNA samples are not immobilized on membranes.
  • the probe and target sequences may be both in solution, or the probe sequence may be immobilized (Saiki et al, Proc. Nat. Acad. Sci. USA 86: 6230-6234, 1989).
  • a variety of detection methods such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of scintillant), spectrophotometry involving calorigenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes.
  • a system capable of detecting such multiple mutations likely will be desirable.
  • a nucleic acid amplification reaction with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al, Nucl Acids Res. 16:1141-1155, 1988).
  • the procedure may involve immobilized sequence-specific oligonucleotide probes (Saiki et al, Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989).
  • Expression levels ofthe ABCA13 gene can also be determined by methods such as Northern or Southern blot analysis using labeled oligonucleotides specific to normal or mutant sequences. These oligonucleotides are labeled radioactively with isotopes (such as 32 P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl. Acad. Sci. USA 78: 6633-6657, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis.
  • isotopes such as 32 P
  • tags such as biotin
  • Quantitative or semi-quantitative PCR can also be used to measure the amount of ABCA13 cDNA in a sample using ABCA13 oligonucleotide primers.
  • Visualization methods such as autoradiography or fluorometric (Landegren et al, Science 242: 229- 237, 1989) or colorimetric reactions (Gebeyehu et al, Nucleic Acids Res. 15: 4513-4534, 1987) can be used to detect a signal and the signals quantitated using, for instance, a spectrophotometer, a scintillation counter, a densitometer or a Phosphorimager (Amersham Biosciences).
  • the Phosphorimager is able to analyze both DNA and protein samples from blots and gels using autoradiographic, direct fluorescence or chemifluorescence detection. Because the Phosphorimager is more sensitive than ordinary x-ray film, exposure times can be reduced up to ten-fold and signal quantitation of both weak and strong signals on the same blot is possible. Images can be visualized and evaluated with the aid of computer programs such as ImageQuantTM.
  • ABCAl 3 isoform sequence information presented herein is useful in detecting the presence or absence of ABCAl 3 in cultured cells or primary cells. Quantitative and qualitative methods of detection of proteins are well-known in the art, and are discussed herein. Quantitative detection is useful for diagnosing over- or underexpression of ABCA13 proteins in a subject, while qualitative information gives, for example, information regarding tissue types in which ABCAl 3 isoforms may be expressed. For such qualitative or quantitative assessment, a biological sample of the subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for the presence or absence of ABCA13.
  • Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material.
  • Biological samples can be obtained from normal, healthy subjects or from subjects who are predisposed to or who are suffering from any one of a variety ofthe effects of transporter deficiencies such as, but not limited to, hypercholesterolemia, or defective transport of hydrophobic compounds such as lipids, sterols or fatty acids.
  • Antibodies can be used to assess the presence or absence of ABCA13 proteins in cultured cells or primary cells. The determination whether an antibody specifically detects ABCAl 3 proteins is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al, In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989).
  • a given antibody preparation (such as one produced in a mouse) specifically detects ABCAl 3 proteins by Western blotting.
  • total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel.
  • the cellular protein is extracted from a biological sample.
  • the proteins are then transferred to a membrane (for example, nitrocellulose or PVDF) by Western blotting, and the antibody preparation is incubated with the membrane.
  • a membrane for example, nitrocellulose or PVDF
  • the presence of specifically bound antibodies is detected by the use of (by way of example) an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase.
  • an enzyme such as alkaline phosphatase.
  • Application of an alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immunolocalized alkaline phosphatase.
  • Antibodies that specifically detect ABCA13 proteins will, by this technique, be shown to bind to ABCA13 protein bands (which will be localized at a given position on the gel determined by its molecular weight, the full-length isoform of which is approximately 28 kDa based on its deduced amino acid sequence).
  • Non-specific binding ofthe antibody to other proteins may occur and may be detectable as a weak signal on the Western blot.
  • the non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody- ABCA13 protein binding.
  • substantially pure ABCA 13 protein suitable for use as an immunogen is isolated from the transfected cells as described above.
  • concentration of protein in the final preparation is adjusted, for example, by concentration on an
  • Amicon (Millipore, Bedford, Massachusetts) or similar filter device, to the level of a few micrograms per milliliter.
  • antibodies against ABCA13 proteins are used to localize ABCA13 to specific cell types or to specific subcellular locations in immunohistochemical or immunofluorescence assays.
  • the cells are selected from a variety of cell lines.
  • primary cells are isolated from a subject and are maintained in culture or the sample is sectioned and the sections are prepared directly for immunohistochemistry or immunofluorescence.
  • the cells are fixed, incubated in a blocking medium, incubated with the antibody directed against ABCA13 followed by a second incubation with a secondary antibody that is conjugated to a fluorescent probe or a colorimetric agent.
  • Cells that express an ABCAl 3 protein that is recognized by the antibody exhibit a color or are fluorescent when viewed under a light or fluorescence microscope, respectively.
  • An alternative method of diagnosing ABCA13 gene deletion, amplification, or mutation is to quantitate the level of ABCA13 protein in the cells of a subject.
  • this diagnostic tool would be useful for detecting reduced levels of ABCAl 3 protein that result from, for example, mutations in the promoter regions ofthe ABCAl 3 gene or mutations within the coding region ofthe gene that produce truncated, non-functional or unstable polypeptides, as well as from deletions ofthe entire ABCAl 3 gene.
  • duplications ofthe ABCAl 3 gene may be detected as an increase in the expression level of this protein.
  • the determination of reduced or increased ABCAl 3 protein levels would be an alternative or supplemental approach to the direct determination of ABCAl 3 deletion, duplication or mutation status, for instance by the methods described herein.
  • the availability of antibodies specific to ABCAl 3 proteins will facilitate the quantitation of cellular ABCA13 proteins by one of a number of immunoassay methods, which are well known in the art and are presented herein and in, for instance, Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). Many techniques are commonly known in the art for the detection and quantification of antigen.
  • the purified antigen will be bound to a substrate, the antibody ofthe sample will bind via its Fab portion to this antigen, the substrate will then be washed and a second, labeled antibody will then be added, which will bind to the Fc portion ofthe antibody that is the subject ofthe assay.
  • the second, labeled antibody will be species specific, i.e., if the serum is from a rabbit, the second, labeled antibody will be anti-rabbit-IgG antibody.
  • the specimen will then be washed and the amount ofthe second, labeled antibody that has been bound will be detected and quantified by standard methods.
  • a biological sample ofthe subject which sample includes cellular proteins, can be used.
  • a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, amniocentesis samples, surgical specimens and autopsy material.
  • Biological samples can be obtained from normal, healthy subjects or from subjects who are predisposed to or who are already suffering from any one of a variety of transporter deficiencies, such as, but not limited to, defective transport of cholesterol, fatty acids, or lipids, or the effects of defective steroid hormones derived from the cholesterol of individuals with mutant ABCAl 3.
  • Quantitation of ABCAl 3 protein can be achieved for instance by immunoassay and compared to levels ofthe protein found in healthy cells (e.g., cells from a subject known not to suffer from a transporter deficiency).
  • a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50%o or more) reduction in the amount of ABCAl 3 protein in the cells of a subject compared to the amount of ABCAl 3 protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the ABCAl 3 locus, whereas in another embodiment, a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) increase would indicate that a duplication or enhancing mutation had occurred.
  • Mutant organisms that under-express or over-express ABCA 13 proteins are useful for research. Such mutants allow insight into the physiological and/or pathological role of ABCA13 in a healthy and/or pathological organism via study using a mutant model system (e.g., a transgenic ABCA 13 knockout mouse). These mutants are "genetically engineered,” meaning that information in the form of nucleotides has been transferred into the mutant's genome at a location, or in a combination, in which it would not normally exist. Nucleotides transferred in this way are said to be “non-native.” In one embodiment, a non-ABCA13 promoter inserted upstream of a native ABCAl 3 gene would be non-native.
  • an extra copy of an ABCAl 3 gene or other encoding sequence on a plasmid, transfected into a cell would be non-native, whether that extra copy was ABCAl 3 derived from the same, or a different species.
  • Mutants may be, for example, produced from mammals, such as mice, that either over- express or under-express ABCAl 3 protein, or that do not express ABCAl 3 at all.
  • over-expression mutants are made by increasing the number of -4£IG4/3-encoding sequences (such as genes) in the organism.
  • over-expression mutants are made by introducing an ABCAl 3-encod g sequence into the organism under the control of a constitutive or inducible or viral promoter such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter or the metallothionein promoter.
  • MMTV mouse mammary tumor virus
  • WAP whey acidic protein
  • mutants that under-express ABCAl 3 may be made by using an inducible or repressible promoter, or by deleting the ABCAl 3 gene, or by destroying or limiting the function ofthe ABCAl 3 gene, for instance by disrupting the gene by transposon insertion.
  • antisense genes may be engineered into the organism, under a constitutive or inducible promoter, to decrease or prevent ABCAl 3 expression, as discussed above.
  • a gene is "functionally deleted" when genetic engineering has been used to negate or reduce gene expression to negligible levels.
  • a mutant is referred to in this application as having the ABCAl 3 gene altered or functionally deleted, this refers to the ABCAl 3 gene and to any ortholog of this gene.
  • a mutant is referred to as having "more than the normal copy number" of a gene, this means that it has more than the usual number of genes found in the wild-type organism, e.g., in the diploid mouse or human.
  • a mutant mouse over-expressing ABCAl 3 may be made by constructing a plasmid having the ABCA 13 gene driven by a promoter, such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter.
  • MMTV mouse mammary tumor virus
  • WAP whey acidic protein
  • this plasmid may be introduced into mouse oocytes by microinjection. The oocytes are implanted into pseudopregnant females, and the litters are assayed for insertion ofthe transgene. Multiple strains containing the transgene are then available for study.
  • WAP is quite specific for mammary gland expression during lactation, and MMTV is expressed in a variety of tissues including mammary gland, salivary gland and lymphoid tissues.
  • MMTV is expressed in a variety of tissues including mammary gland, salivary gland and lymphoid tissues.
  • other promoters might be used to achieve various patterns of expression, e.g., the metallothionein promoter.
  • an inducible system may be created in which the subject expression construct is driven by a promoter regulated by an agent that can be fed to the mouse, such as tetracycline.
  • an agent that can be fed to the mouse, such as tetracycline.
  • a mutant knockout animal from which the ABCA 13 gene is deleted or otherwise disabled can be made by removing coding regions ofthe ABCAl 3 gene from embryonic stem cells.
  • the methods of creating deletion mutations by using a targeting vector have been described (see, for instance, Thomas and Capecch, Cell 51: 503-512, 1987).
  • knockout mice are used as hosts to test the effects of various ABCA13 constructs on cell growth.
  • transgenic mice with the endogenous ABCA 13 gene knocked-out can be used in an assay to screen for compounds that modulate the ABCAl 3 activity.
  • a transgenic mouse that is heterozygous or homozygous for integrated transgenes that have functionally disrupted the endogenous ABCAl 3 gene can be used as a sensitive in vivo screening assay for the ABCA13 ligands and modulators of ABCA13 activity.
  • retroviruses are a preferred vector for experiments in medical genetics, as they yield a high efficiency of infection and stable integration and expression (Orkin et al, Prog. Med. Genet. 7:130-142, 1988).
  • the full-length ABCA 13 gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or, for instance, from the retroviral LTR (long terminal repeat).
  • viral transfection systems may also be utilized for this type of approach, including adenovirus, adeno- associated virus (AAV) (McLaughlin et al, J. Virol.
  • Vaccinia virus Moss et al, Annu. Rev. Immunol. 5:305-324, 1987
  • Bovine Papilloma virus Rosmussen et al, Methods Enzymol. 139:642-654, 1987
  • members ofthe herpesvirus group such as Epstein-Barr virus (Margolskee et ⁇ /., Mol. Cell Biol 8:2837-2847, 1988).
  • RNA-DNA hybrid oligonucleotides as described by Cole-Strauss, et al. (Science 273:1386-1389, 1996). This technique may allow for site- specific integration of cloned sequences, thereby permitting accurately targeted gene replacement.
  • lipidic and liposome-mediated gene delivery will be used for transfection of various genes (for reviews, see Templeton and Lasic, Mol Biotechnol 11:175-180, 1999; Lee and Huang, Crit. Rev. Ther. Drug Carrier Syst. 14:173-206; and Cooper, Semin. Oncol 23:172-187, 1996).
  • cationic liposomes will be used as a viable alternative to the viral vectors (de Lima et al, Mol. Membr. Biol 16:103-109, 1999).
  • cationic liposomes can be targeted to specific cells through the inclusion of, for instance, monoclonal antibodies or other appropriate targeting ligands (Kao et l, Cancer Gene Ther. 3:250-256, 1996).
  • Kits which contain the necessary reagents for determining ABCA 13 gene copy number, for determining altered expression of ABCA13 mRNA or ABCA13 protein, or for detecting polymorphisms in ABCAl 3 alleles.
  • Instructions provided in the diagnostic kits can include calibration curves, diagrams, illustrations, or charts or the like to compare with the determined (e.g., experimentally measured) values or other results.
  • Kits are also provided that contain cells that serve as either positive or negative controls. These control cells can be compared to experimental samples containing similar cells, for instance cells of unknown gene activity, mutational state, protein expression level, and so forth.
  • the nucleotide sequences disclosed herein, and fragments thereof, can be supplied in the form of a kit for use in detection of ABCA13 genomic sequences, for instance in order to diagnose a deficiency in transporter activity.
  • a kit for use in detection of ABCA13 genomic sequences for instance in order to diagnose a deficiency in transporter activity.
  • an appropriate amount of one or more ofthe -4. ⁇ C47.?-specific oligonucleotide primers is provided in one or more containers.
  • the oligonucleotide primers may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance.
  • the container(s) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles.
  • pairs of primers may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers.
  • the sample to be tested for the presence of ABCAl 3 genomic amplification can be added to the individual tubes and in vitro amplification carried out directly.
  • each oligonucleotide primer supplied in the kit can be any appropriate amount, depending for instance on the market to which the product is directed.
  • the kit is adapted for research or clinical use and the amount of each oligonucleotide primer provided is an amount sufficient to prime several in vitro amplification reactions.
  • Those of ordinary skill in the art know the amount of oligonucleotide primer that is appropriate for use in a single amplification reaction. General guidelines may for instance be found in Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990), Sambrook etal.
  • kits may include more than two primers, in order to facilitate the PCR in vitro amplification of ABCAl 3 sequences, for instance the ABCAl 3 gene, specific exon(s) or other portions ofthe gene, or the 5' or 3' flanking region thereof.
  • kits may also include the reagents necessary to carry out PCR in vitro amplification reactions, including, for instance, DNA sample preparation reagents, appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Instructions may also be included.
  • appropriate buffers e.g., polymerase buffer
  • salts e.g., magnesium chloride
  • dNTPs deoxyribonucleotides
  • kits may include either labeled or unlabeled oligonucleotide probes for use in detection ofthe in vitro amplified ABCA13 sequences.
  • the appropriate sequences for such a probe will be any sequence that falls between the annealing sites ofthe two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the in vitro amplification reaction.
  • the kit provides one or more control sequences for use in the amplification reactions.
  • the design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
  • Kits similar to those disclosed above for the detection of ABCAl 3 genomic sequences can be used to detect ABCA 13 mRNA expression levels.
  • One embodiment of such a kit may include an appropriate amount of one or more ofthe oligonucleotide primers for use in reverse transcription amplification reactions, similarly to those provided above, with art-obvious modifications for use with RNA.
  • kits for detection of ABCA 13 mRNA expression levels may also include the reagents necessary to carry out RT-PCR in vitro amplification reactions, including, for instance, RNA sample preparation reagents (including e.g., an RNAse inhibitor), appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Instructions also may be included.
  • RNA sample preparation reagents including e.g., an RNAse inhibitor
  • appropriate buffers e.g., polymerase buffer
  • salts e.g., magnesium chloride
  • dNTPs deoxyribonucleotides
  • kits may include either labeled or unlabeled oligonucleotide probes for use in detection ofthe in vitro amplified target sequences.
  • the. appropriate sequences for such a probe will be any sequence that falls between the annealing sites ofthe two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the PCR reaction.
  • the kit provides one or more control sequences for use in the RT- PCR reactions.
  • the design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
  • kits may be provided with the necessary reagents to carry out quantitative or semi-quantitative Northern analysis of ABCA 13 mRNA.
  • kits include, for instance, at least one ABCA 13-spec ⁇ f ⁇ c oligonucleotide for use as a probe.
  • This oligonucleotide may be labeled in any conventional way, including with a selected radioactive isotope, enzyme substrate, co-factor, ligand, chemiluminescent or fluorescent agent, hapten, or enzyme.
  • kits for the detection of ABCAl 3 protein expression include for instance at least one target protein specific binding agent (e.g., a polyclonal or monoclonal antibody or antibody fragment) and may include at least one control.
  • the ABCA 13 protein specific binding agent and control may be contained in separate containers.
  • the kits may also include means for detecting ABCA13:agent complexes, for instance the agent may be detectably labeled. If the detectable agent is not labeled, it may be detected by second antibodies, or protein A for example, which may also be provided in some kits in one or more separate containers. Such techniques are well known.
  • kits include instructions for carrying out the assay. Instructions will allow the tester to determine whether ABCA 13 expression levels are altered, for instance in comparison to a control sample.
  • reaction vessels and auxiliary reagents such as cells, chromogens, buffers, media, enzymes, etc. also may be included in the kits.
  • an effective and convenient immunoassay kit such as an enzyme-linked immunosorbant assay can be constructed to test anti-ABCA13 antibody in human serum, as reported for detection of non-specific anti-ovarian antibodies (Wheatcroft et al, Clin. Exp. Immunol 96:122-128, 1994; Wheatcroft et al, Hum. Reprod. 12:2617-2622, 1997).
  • expression vectors can be constructed using the human ABCAl 3 cDNA to produce the recombinant human ABCAl 3 protein in either bacteria or baculovirus (as described herein).
  • affinity purification is used to generate unlimited amounts of pure recombinant ABCA 13 protein.
  • an assay kit could provide the recombinant protein as an antigen and enzyme-conjugated goat anti-human IgG as a second antibody as well as the enzymatic substrates. Such kits can be used to test if the sera from a subject contain antibodies against human ABCA13.
  • kits for Detection of Homozygous versus Heterozygous Allelism also provided are kits that allow differentiation between individuals who are homozygous versus heterozygous for a polymorphism of ABCAl 3.
  • kits provide the materials necessary to perform oligonucleotide ligation assays (OLA), for instance as described at Nickerson et al. (Proc. Natl. Acad. Sci. USA 87:8923-8927, 1990).
  • these kits contain one or more microtiter plate assays, designed to detect allelism in the ABCAl 3 sequence of a subject, as described herein.
  • additional components in some of these kits may include instructions for carrying out the assay. Instructions will allow the tester to determine whether an ABCAl 3 allele is homozygous or heterozygous.
  • reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits.
  • the kit may provide one or more control sequences for use in the OLA reactions.
  • the design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art. E. Kits for Identifying Modulators of ABCA 13 activity
  • kits that permit the identification of modulators of ABCA13 activity.
  • such kits provide the materials necessary to assess the activity of ABCA13 in vitro.
  • this kit contains aliquots of isolated ABCAl 3 and cultured cells.
  • the kit contains cell lines that express either wildtype or mutant ABCA13.
  • additional components in some of these kits may include instructions for carrying out the assay.
  • reaction vessels and auxiliary reagents such as chromogens, buffers, media, enzymes, etc. may also be included in the kits.
  • This example provides a description ofthe methods by which the ABCAl 3 genomic sequence was first identified.
  • the genomic DNA analysis was performed by combination of several gene-finding programs such as GENSCAN (Burge and Karlin J. Mol. Biol 268(1): 78-94, 1997), FGENEH/FEXH (Solovyev and Salamov ISMB 5: 294-302, 1997), and XPOUND (Thomas and Skolnick J. Math. Appl. Med. Biol. 11(1): 1-16, 1994).
  • GENSCAN Bos and Karlin J. Mol. Biol 268(1): 78-94, 1997)
  • FGENEH/FEXH Solovyev and Salamov ISMB 5: 294-302, 1997)
  • XPOUND Thimas and Skolnick J. Math. Appl. Med. Biol. 11(1): 1-16, 1994.
  • the second step in the genomic DNA analysis was homology searching in the EST and protein databases. Combination of software performing database searching and software for exon/intron prediction gave the most sensitive and specific results.
  • ATP-binding domains defined by the Pfam signature ABCA tran were aligned using CLUSTALW (BCM Search Launcher, Baylor College of Medicine website).
  • CLUSTALW BCM Search Launcher, Baylor College of Medicine website.
  • the phylogenetic tree was obtained using MEGA version 2.1 (Kumar et al, Bioinformatics 17(12): 1244-1245, 2001).
  • GenBank accession numbers ofthe ABCA proteins were: ABCAl, 095477; ABCA2, NP_001597; ABCA3, NP_001080; ABCA4, NP_000341; ABCA5, NP_061142; ABCA6, NP_525023; ABCA7, NP_061985; ABCA8, NP_009099; ABCA9, NP 25022; ABCAIO, NP_525021; ABCA12, NP_056472.
  • Example 2 Prediction of ABCA13 Gene Structure. This example provides a description ofthe methods by which the ABCA13 genomic structure was predicted.
  • Genomic DNA analysis was performed using several gene predictors such as Genscan, FGENEH, FEXH on fragment 15 from BAC AC073424/gil 19229 (Dec.2000). This prediction was combined using GENEWISE and PSI-BLAST algorithms and HMMER packages.
  • the mouse Abcal3 gene was mapped using the T31 mouse/hamster radiation hybrid panel (Research Genetics). PCR was performed using primers Mal3F2, CAGCACCTCACAAATTGCCACC and Mal3R21, GCATGGGTAGGGTGCTGCCTG with Amplitaq Gold Taq polymerase. Samples were heated at 94°C for 10 minutes followed by 35 cycles at 94°C for 30 seconds, 65°C for 15 seconds, 72°C for 30 seconds, and extended at 72°C for 5 minutes. Reaction products were resolved on a 1.2% TAE agarose gel and data was submitted to The Jackson Laboratory Mouse Radiation Hybrid Database. Results
  • ABCAl 3 is unusual in that the putative extracellular domain between the first and second predicted transmembrane segments is unusually large (about 3500 amino acids, 70% ofthe protein) and is encoded in part by two very large exons of 4.7 and 1.8 kb. ABCAl 3 is the only described gene encoding a large exon that encodes an extracellular domain.
  • the mouse ABCAl 3 gene contains two large exons of similar size to human ABCAl 3, which encode an amino acid sequence 54% identical and 69% similar to human ABCAl 3. These sequences have no recognizable homology to any known human proteins and contain no identifiable domains by MOTIF or PFAM searches.
  • TTN which encodes a long muscle filament protein titin
  • BRCA1 and BRCA2 contain exons of 3.4 and 4.9 kb, respectively.
  • This example describes the isolation and identification of cDNA molecules encoding the full-length and additional isoforms ofthe human ABCA 13 protein.
  • Primers were designed using Oligo4 primer analysis software (Molecular Biology Insights, Cascade, CO) and ordered from Life Technologies, Invitrogen, Carlsbad, CA). The primers used to amplify regions of SEQ ID NO: 1 are listed in Table 7.
  • the primers used to amplify regions of SEQ ID NO: 18 are listed in Table 8.
  • the primers used to amplify regions of SEQ ID NO: 22 are listed in Table 9.
  • the primers used to amplify regions of SEQ ID NO: 24 are listed in Table 10. Table 10. Primers used to amplify regions of SEQ D3 NO: 24
  • the primers used to amplify regions of SEQ ID NO: 26 are listed in Table 11.
  • the primers used to amplify regions of SEQ ID NO: 28 are listed in Table 12.
  • RACE 5' and 3' rapid amplification of cDNA ends
  • the principal transcript ofthe ABCA13 gene is 17209 base pairs long with an open reading frame of 15195 base pairs (FIG. 1A and IB), corresponding to 5058 amino acids (FIG. IC and ID).
  • the predicted amino acid sequence ofthe protein is provided as SEQ ID NO: 2.
  • Analysis ofthe ABCA13 predicted protein disclosed features that are typical of an ABCA transporter. These include twelve predicted transmembrane domains, with two large extracellular domains and two nucleotide binding fold domains (NBD1 and NBD2) (see Figure 4). The position of the conserved nucleotide binding folds as well as that ofthe predicted transmembrane domains, are indicated in the Table 13. Each of these conserved regions is composed of hydrophobic segments. Table 13. Genomic structure of the human ABCA13 gene.
  • the ABCAl 3 gene is encoded by 62 exons and spans over 450 kb, making this the largest ABC gene described to date with the largest number of exons.
  • the most unusual feature is the presence of two large exons of 4779 and 1827 bp (exons 17 and 18). All the remaining coding exons are less than 300 bp.
  • Transcript 2 is 12,498 bp long (SEQ ID NO: 18) and codes for a 2760 amino acid protein (SEQ ID NO: 19).
  • Transcript 3 is 15,970 bp long (SEQ ID NO: 22) and encodes a 4958 amino acid protein (SEQ ID NO: 23).
  • Transcript 4 is 11,259 bp long (SEQ ID NO: 24) and codes for a 2660 amino acid protein (SEQ ID NO: 25).
  • Transcript 5 is 15,779 bp long (SEQ ID NO: 26) and encode a 4952 amino acid protein (SEQ ID NO: 27), and transcript 6 is 11,068 bp long (SEQ ID NO: 28) and its putative protein contains 2654 amino acids (SEQ ID NO: 29). These alternative transcripts result in the loss ofthe first transmembrane domain or in alternative C-termini, and can potentially encode functional transporters.
  • the PCR product was subjected to DNA cycle sequencing after purification with the Microcon-100 microconcentrators (Amicon, Inc., Charlotte, NC). The sequences were obtained using the ABI Prism BigDye terminator cycle sequencing kit (Perkin Elmer Applied Biosystems, Palo Alto). Sequencing reactions were resolved on an ABI 377 DNA sequencer (Perkin Elmer Applied Biosystems, Palo Alto, USA) according to the manufacturer's instructions.
  • Example 4 Reverse Transcriptase PCR (RT-PCR) Analysis of Human ABCA13 cDNA. This example provides a description of how human ABCA13 cDNA was procured and analyzed.
  • cDNA templates for amplification were synthesized by reverse transcribing 500 ng of mRNA poly(A)+ (Clontech, Palo Alto, CA) using 200 units of reverse transcriptase Superscript II (Life Technologies, Invitrogen, Carlsbad, CA) with 500 ng of oligodT primer (Life Technologies, Invitrogen, Carlsbad, CA) The reactions were denatured at 70°C for 10 minutes, and 10 units of RNAsin (Life Technologies, Invitrogen, Carlsbad, CA) were added, followed by incubation for 45 minutes at 42°C.
  • PCR was performed with AmpliTaq Gold DNA polymerase (Perkin Elmer Applied Biosystems, Palo Alto, CA), using 50 ng of DNA or about 25 ng of cDNA. Reactions were carried out for 30 PCR cycles in a 9700 thermal cycler (Perkin Elmer Applied Biosystems, Palo Alto, CA) in 96-well microtiter plates. After an initial denaturation at 94°C for 10 minutes, each cycle consisted of a denaturation step of 30 seconds (94°C), a hybridization step of 30 seconds (64°C for 2 cycles, 61°C for 2 cycles, 58°C for 2 cycles and 55°C for 28 cycles), and an elongation step of 1 minute/kb (72°C). PCR was concluded with a final 72°C extension, which lasted 7 minutes.
  • AmpliTaq Gold DNA polymerase Perkin Elmer Applied Biosystems, Palo Alto, CA
  • primers have been designed to validate electronically predicted sequences or products of RACE.
  • the initial fragment was validated using specific primers E (SEQ ID NO: 15) and F (SEQ ID NO: 49).
  • the second partial sequence derived from analysis of a BAC fragment was analyzed with primers A (SEQ ID NO: 50) and B (SEQ ID NO: 13). The link with the initial fragment was confirmed with primers C (SEQ ID NO: 51), B and E.
  • First RACE was validated with primers U3 (SEQ ID NO: 52), U5 (SEQ ID NO: 53), and Ll.
  • Second 5' RACE was validated with primer U16 (SEQ ID NO: 7) used with B followed by nested PCR with E and B.
  • This example provides a description of how the ABCAl 3 sequence was analyzed.
  • Example 6 Localization of ABCA13 to a Chromosome This example provides a description of how the human and mouse ABCAl 3 genes were localized to their chromosomal locations.
  • chromosomal localization of he human ABCAl 3 gene on chromosome 7 at 7pl2.3 was determined by PCR using primers E and F and T31 mouse/hamster radiation hybrid panel (Research Genetics) according to the manufacturer's protocol. Subsequently, the position of ABCAl 3 on the draft human map was determined using chromosomal assignment using somatic cell hybrids (CASH) (see Ryu et al, Mol Cells 10(5): 598-600, 2000).
  • Mouse Abcal3 was mapped to chromosome 11 between markers Dl lMit226 and DllMit259 using the T31 mouse/hamster radiation hybrid panel (Research Genetics, Huntsville, AL). PCR was performed using primers Mai 3F2 5 '-CAG CAC CTC ACA AAT TGC CAC C-3 ' (SEQ ID NO: 16) and Mal3R21 5'-GCA TGG GTA GGG TGC TGC CTG-3' (SEQ ID NO: 17) with Amplitaq Gold Taq polymerase. Samples were heated at 94°C for 10 minutes followed by 35 cycles at 94°C for 30 seconds, 65°C for 15 seconds, 72°C for 30 seconds, and a final extension at 72°C for 5 minutes.
  • This example provides a description of how the human ABCAl 3 homology and identity was determined with respect to other known ABCA proteins.
  • Example 8 Phylogenetic analysis of the relationship between the ABCA13 to other ABCA transporters. This example provides a description of how the evolutionary relationship between human ABCA13 and other ABCA transporters was determined. Phylogenetic analysis was performed using the ATP-binding domain, which is conserved across the species and in different subfamilies without large deletions or insertions (see Bodenmiller et al, DNA Seq. 13(2): 77-83, 2002). Analysis was conducted using both ATP-binding domains, as all twelve human ABCA subfamily members known to date contain two such domains.
  • ABCAl 3 belongs to the subgroup inside the A subfamily, which contains the best-characterized members of this subfamily, ABCAl (see Tanaka et al, Biochem. Biophys. Res. Commun. 25; 283(5): 1019-1025, 2001) and ABCA4 (see Bungert et al, J. Biol. Chem. 276(26): 23539-23546, 2001).
  • the second subgroup includes five genes that form a tandem cluster at chromosome 17q24.
  • ABCA 13 has a short (about 90 amino acids) region of similarity at the N-terminus, and larger region of similarity starting from amino acid 3070. This suggests that the large size of ABCA13 is due to the large insertion between these positions at the first extracellular domain.
  • Figure 2 A graphic representation ofthe phylogenetic analysis is shown in Figure 2.
  • Example 9 Reverse Transcription Analysis ofthe Expression Pattern of ABCA13.
  • the profile of expression of ABCAl 3 polynucleotides can be determined using art-known techniques, such as PCR-coupled reverse transcription, which has been described for instance by Sambrook et al. (Molecular cloning: a laboratory manual. 2 nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989). This example provides representative methods and results from various tissues.
  • a pair of primers as described herein may be synthesized and used to amplify a human ABCAl 3 cDNA (SEQ ID NO: 1).
  • the expression pattern of ABCA 13 was examined in a variety of human tissues using RT-
  • PCR polymerase chain reaction
  • CLONTECH commercially provided first-strand cDNA templates
  • Reverse transcription to cDNA was carried out with the enzyme SUPERSCRIPT II (GibcoBRL, Life Technologies) according to the conditions described by the manufacturer.
  • the polymerase chain reaction was carried out according to standard conditions, in 20 ⁇ l of reaction mixture with 25 ng of cDNA preparation.
  • the reaction mixture was composed of 400 ⁇ M of each ofthe dNTPs, 2 units of Thermus aquaticus (Taq) DNA polymerase (Ampli Taq Gold; Perkin Elmer), 0.5 ⁇ M of each primer, 2.5 mM MgCl , and PCR buffer.
  • ABCA13 presents a restricted tissue distribution.
  • the expression ofthe gene was also examined in a panel of tumor cell lines and was found to be expressed the highest in the SR leukemia, SNB-19 CNS tumor and DU-145 prostate tumor cell lines.
  • the profile of expression of ABCA13 polynucleotides also can be determined using real-time PCR analysis. This example provides representative methods and results from various tissues and cell lines.
  • Fwd SEQ ID NO: 63;
  • the probes were labeled at the 5' position with 6-carboxyfluorescein (6-FAM) reporter.
  • 6-FAM 6-carboxyfluorescein
  • the 3' end was coupled to a quencher, either 6-carboxytetramethyIrhodamine (TAMRA) or minor groove binder (MGB).
  • TAMRA 6-carboxytetramethyIrhodamine
  • MGB minor groove binder
  • RNAse inhibitor 1.25 U/ ⁇ l MultiScribeRTase.
  • the thermal cycling conditions consisted of 25°C for 10 minutes, 42°C for 50 minutes, and 95°C for 5 minutes. The reaction products ofthe 5 to 10 tubes were pooled.
  • Real-time PCR was carried out under duplex conditions, using 10 ⁇ l of 1:10 diluted cDNA in a total volume of 35 ⁇ l.
  • the PCR reaction master mix contains lx Master Mix, 900 nM of each primer specific of selected ABCA13 transcript, 50 nM of each primer specific of ⁇ 2-microglobulin transcript, and 200 nM of ABCA13 and ⁇ 2-microglobulin probes.
  • the thermal cycling conditions are 40 cycles of PCR amplification (UNG incubation: 50°C, 2 minutes; AmpliTaqGold activation: 95°C, 10 minutes; denaturation: 95°C, 15 seconds; annealing/extension: 60°C, 1 minute).
  • leukemia HL-60(TB) (leukemia); K-562 (leukemia); MOLT-4 (leukemia); RPMI-8226 (leukemia);
  • SR leukemia
  • A549/ATCC non-small cell lung
  • EKVX non-small cell lung
  • HOP-62 non-small cell lung
  • HOP-92 non-small cell lung
  • NCI-H226 non-small cell lung
  • NCI-H23 non-small cell lung
  • NCI-H322M non-small cell lung
  • NCI-H460 non-small cell lung
  • NCI-H522 non-small cell lung
  • COLO 205 colon
  • HCC-2998 colon
  • HCT-116 colon
  • HCT-15 colonn
  • HT29 colon
  • SNB-75 (CNS); U251 (CNS); LOX IMVI (melanoma); MALME-3M (melanoma); Ml 4 (melanoma); SK-MEL-2 (melanoma); SK-MEL-28 (melanoma); SK-MEL-5 (melanoma); UACC-257
  • OVCAR-5 ovarian
  • OVCAR-8 ovarian
  • SK-OV-3 ovarian
  • 786-0 renal
  • A498 renal
  • ACHN ACHN
  • prostate DU-145 (prostate); MCF7 (breast); NCI/ADR-RES (breast); MDA-MB-231/ATCC (breast); HS 578T (breast); MDA-MB-435 (breast); MDA-N (breast); BT-549 (breast); and T-47D
  • ABCAl 3 cDNA in these tumor cell lines was performed using a real time PCR assay on the ABI 7000 apparatus. A multiplex reaction was performed along with primers and probe for ⁇ -actin provided by the manufacturer (Applied Biosystems) as the endogenous control. ABCAl 3 mRNA was quantitated with primers -473C ⁇ 73-TAQ-F (SEQ ID NO: 66), .473C.4 -TAQ-R
  • MmAbcal3_R18 (SEQ ID NO: 72), were used to amplify a 381 bp fragment from exons 17 and 18.
  • the expression ofthe gene was also examined in a panel of tumor cell lines and was found to have the highest expression in the SR leukemia, SNB-19 CNS tumor, and DU-145 prostate tumor cell lines (Table 15).
  • the public databases contain 12 ESTs matching predicted mouse Abcal3 cDNA. They derive only from two tissues: nine from kidney and three from retina. These data provide independent support to our observation that mouse Abcal3 is primarily expressed in kidney. Six ESTs are spliced and originate from regions that are different from those that were used in the research described herein. Six ESTs are unspliced and originate from the 3' end ofthe cDNA. Retina was not included in the current analysis.
  • ABCAl 3 The expression level of ABCAl 3 is very low and could be detected by real-time-PCR in a small number of tissues and cell lines. In mouse, expression was detected only in kidney and in very low level also in skeletal muscle. Consistent with this is the observation that there are very few expressed sequence tags that represent portions ofthe ABCA 13 transcript. However it cannot currently be rule out that higher expression of one or more ABCAl 3 transcripts is present in specific cell types that has not yet examined.
  • the expression pattern of ABCA13 was also studied on a human Multiple Tissue Expression Array that contains polyA+ RNA from 76 different human normal and cancer tissues plus several control DNAs. Although the signal was clearly visible from human control DNA, no signal was detected from any RNAs on the array, even after prolonged exposure. No signal has been observed on human northern blots either, even after prolonged exposure.
  • the tissues tested included kidney, skeletal muscle, lung, trachea, bone marrow, and testis. It is believed that these results are because blotting conditions do not permit good transfer of long transcripts.
  • the profile of expression of ABCA13 polynucleotides can be determined using art-known techniques, such as Northern blot analysis, which has been described for instance by Sambrook et al. (1989, Molecular cloning: a laboratory manual. 2 nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). This example provides representative methods.
  • Preparation of probe PCR products are gel-purified using Qiaquick® column (Qiagen). 10-20 ng of purified PCR product are radiolabeled with [ ⁇ 32 P]dCTP (Amersham; 6000 Ci/mmol, 10 mCi/ml) by the random priming method (Rediprime kit; Amersham) according to the manufacturer's protocol. Unincorporated radioactive nucleotides are separated from the labeled probe by filtration on a G50 microcolumn (Pharmacia). The probe is competed with 50 ⁇ g of denatured human COT1 DNA for two hours at 65 °C.
  • Northern blots (MTN blot, Clontech, Palo Alto, USA) containing 2 ⁇ g of poly(A+) mRNA per lane from various adult and/or fetal tissues of a subject are hybridized with randomly radiolabeled with U17-L8 specific probe (2xl0 6 cpm/ml hybridization solution) in 50% formamide hybridization solution overnight at 65°C.
  • the filters were washed in 2x SSC for 30 minutes at room temperature, twice in 2x SSC-0.1% SDS for 10 minutes at 65°C and twice in lx SSC-0.1% SDS for 10 minutes at 65°C.
  • the filters are analyzed using the StormTM blot imaging system (Molecular Dynamics, Sunnyvale, USA) by overnight exposure.
  • RNA specific to affected or non-affected individuals makes it possible to detect notable variations in the level of expression ofthe gene studied, in particular the absence of transcription ofthe gene.
  • Polyclonal antibodies specific for a human ABCA13 polypeptide may be prepared as described herein in rabbits and chicks by injecting a synthetic polypeptide fragment derived from an ABCAl 3 protein, including all or part of an amino acid sequence as shown in SEQ ID NO: 2. These polyclonal antibodies are used to detect and/or quantify the expression ofthe ABCA13 gene in cells and animal models by immunoblotting and/or immunodetection.
  • An appropriate volume e.g., 100 to 300 ⁇ l
  • a medium containing the purified recombinant adenovirus (pABCA-AdV or pLucif-AdV) containing from 10 s to 10 9 lysis plaque- forming units (pfu) are infused into the Saphenous vein of mice (C57BL/6, both control mice and models of transgenic or knock-out mice) on day 0 ofthe experiment.
  • the evaluation ofthe physiological role ofthe ABCA13 protein in the transport of cholesterol or inflammatory lipid substances is carried out by determining the total quantity of cholesterol or appropriate inflammatory lipid substances before (day zero) and after (days 2, 4, 7, 10, 14) the administration ofthe adenovirus.
  • Kinetic studies with the aid of radioactively labeled products are carried out on day 5 after the administration ofthe vectors rLucif-AdV and rABCA-AdV in order to evaluate the effect ofthe expression or function of ABCA 13 on the transport of cholesterol and inflammatory lipid substances.
  • transgenic mice and rabbits over-expressing gene may be produced, in accordance with the teaching of Vaisman (J. Biol Chem. 270(20): 12269-12275, 1995) and Hoeg (Proc. Nat. Acad. Sci. USA. 93(21):11448-11453, 1996) using constructs containing the human ABCA 13 cDNA under the control of endogenous promoters such as ABCA 13 or CMV or apoE.
  • Embodiments of this disclosure provide several ABCA13 proteins and nucleic acid molecules, and methods of isolating, making, and using these molecules. Further embodiments provide methods for ameliorating, treating, detecting, prognosing and diagnosing diseases related to expression of ABCA13. It will be apparent that the precise details ofthe methods described may be varied or modified without departing from the spirit ofthe described invention. We claim all such modifications and variations that fall within the scope and spirit ofthe claims below.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This disclosure provides seven isoforms of a novel transporter protein, referred to as ABCA13, nucleic acid molecules encoding the disclosed isoforms, variants and fragments thereof, and methods of making and using these molecules. Also provided are methods of ameliorating, treating, detecting, prognosing, and diagnosing diseases and conditions believed to be associated with altered expression of ABCA13, such as hypercholesterolemia, drug resistance, retinal degeneration, or neurological disease. Kits are also provided.

Description

ABCA13 NUCLEIC ACIDS AND PROTEINS, AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 60/405,006, filed August 20, 2002, and No. 60/454,502, filed March 12, 2003. Both of these applications are incorporated herein in their entirety.
FIELD OF THE DISCLOSURE
The present disclosure is related to extra- and intra-cellular transport, including the mechanisms controlling transport, diseases that arise from defects in such mechanisms, and methods of influencing (either inhibiting or enhancing or otherwise changing) transport.
BACKGROUND OF THE DISCLOSURE
The ABC (ATP-binding cassette transporter) gene superfamily encodes active transporter proteins and constitutes a family of proteins that have been extremely well conserved through evolution, from bacteria to humans (Ames and Lecar, FASEB J. , 6: 2660-2666, 1992). The ABC proteins are involved in extra- and intracellular membrane transport of various substrates, for example ions, metals, amino acids, lipids, peptides, sugars, vitamins, or steroid hormones, across membranes. Among the forty characterized human ABC genes, eleven members have been described as associated with human disease, such as ABCA1, ABCA4 (ABCR) and ABCC7, (CFTR) which are thought to be involved in Tangier disease (Bodzioch et l., Nat. Genet. 22(4): 347-351, 1999; Brooks-Wilson et al, Nat. Genet. 22(4): 336-345, 1999; Rust et al, Nat. Genet. 22: 352-355, 1999), the Stargardt disease (Lewis et al, Am. J. Hum. Genet. 64: 422-434, 1999), and Cystic Fibrosis (Riordan et al, Science 245: 1066-1073, 1989), respectively. Another ABC transporter, mdrl (multidrug resistance) gene, encodes the protein mdrla, also called P-glycoprotein (P-gp). This protein functions as a drug-efflux transmembrane protein pump. P-glycoprotein was first identified over 20 years ago in chemotherapeutic drug-resistant tumor cells, and is now known to be a major cause of multidrug resistance in many cancers (Van Asperen et al, J. Pharmaceut. Sci. 86: 881-884, 1997; Tsuji, Therap. Drug Monitor. 20: 588-590, 1998). These implications reveal the importance of the functional role ofthe ABC gene family. The discovery of a new family of ABC gene members is expected to provide new insights into the physiopathology and treatment of human diseases.
The prototype ABC protein binds ATP and uses the energy from ATP hydrolysis to drive the transport of various molecules across cell membranes. The functional protein contains two ATP- binding domains (nucleotide binding fold, NBF) and multiple transmembrane (TM) domains. The genes are typically organized as full transporters containing two of each domain, or half transporters with only one of each domain. Most full transporters are arranged in a TM-NBF-TM-NBF fashion (Dean etal, Curr Opin Genet 5: 79-785, 1995).
Analysis of amino acids sequence alignments ofthe ATP-binding domains has allowed the ABC genes to be separated into seven sub-families (Allikmets et al, Hum Mol Genet 5: 1649-1655, 1996). Currently, according to the recent HUGO classification, seven ABC gene sub-families named ABC (A to G) have been described in the human genome (ABC1, CFTR/MRP, MDR, ABC8, ALD, GCN20, OABP) with all except one (OABP) containing multiple members. Among the ABC subfamilies, the ABCA gene subfamily is probably the most evolutionary complex. The ABCA subfamily consists exclusively of full transporter genes. The ABCA genes and OABP represent the only two sub-families of ABC genes that do not have identifiable orthologs in the yeast genome (Decottignies and Goffeau, Nat. Genet. Feb;15(2):137-145,1997; Michaelis and Berkower, Cold Spring Harb. Symp. Quant. Biol. 60:291-307, 1995). There is, however, at least one -45C4-related gene in C. elegans (ced-1) and several in Drosophila. Thus, the ABCA genes appear to have diverged after eukaryotes became multicellular and developed more sophisticated transport requirements.
ABCA1 was demonstrated to be the gene responsible for Tangier disease, a disorder characterized by high levels of cholesterol in peripheral tissues, and a very low level of HDLs, and familial hypoalphalipoproteinemia (FHD) (Bodzioch et al, Nat Genet 22: 347-351, 1999; Brooks- Wilson et al, Nat. Genet. 4: 336-345, 1999; Rust et al, Nat Genet 22: 352-355, 1999; Marcil et al, The Lancet 354: 1341-1346, 1999). The ABCA1 protein is proposed to function in the reverse transport of cholesterol from peripheral tissues via an interaction with the apolipoprotein 1 (ApoA-1) of HDL tissues (see Wang et al, JBC 275(42): 33053-33058, 2000).
The ABCA2 gene is highly expressed in the brain, and ABCA3 in the lung, but no function has been ascribed to these loci. The ABCA4 gene is exclusively expressed in the rod photoreceptors ofthe retina and mutations thereof are responsible for several pathologies of human eyes, such as retinal degenerative disorders (Allikmets et al, Science 277: 1805-1807, 1997; Allikmets et al., Nat. Genet. 15: 236-246, 1997; Sun etal., J. Biol. Chem. 8269-8281, 1999; Weng et /., Cell 98: 13-23, 1999; Cremers et al., Hum. Mol. Genet. 7: 355-362, 1998; Martinez-Mir etal, Genomics 40: 142- 146, 1997). ABCA4 is believed to transport retinal and/or retinal-phospholipid complexes from the rod photoreceptor outer segment disks to the cytoplasm, facilitating phototransduction.
Characterization of new genes from the ABCA subfamily is likely to yield biologically important transporters, which may have translocase activity for membrane lipid transport or the transport of other substances and which may play a role in human pathologies.
SUMMARY OF THE DISCLOSURE Disclosed herein are seven novel isoforms of a new gene belonging to the ABCA protein sub-family, which has been designated ABCA13. The protein is believed to be involved in the energy-dependent transport of one or a variety of substances, for example ions, metals, amino acids, lipids, peptides, sugars, vitamins and steroid hormones. The newly discovered gene shows similar gene organization and considerable conservation ofthe amino acid sequence with other ABCA transporter genes, particularly within the transmembrane domains (TM) and two ATP-binding domains (nucleotide binding domain, NBD1 and NBD2). The present disclosure includes novel nucleic acids encoding the isoforms of ABCA13 (SEQ ID NO: 1, 18, 20, 22, 24, 26, and 28) and their predicted amino acid sequences (SEQ ID NO: 2, 19, 21, 23, 25, 27, and 29).
Also disclosed are methods of using these molecules in detecting biological conditions associated with mutation, altered expression, or duplication of ABCA13 in a subject and methods of screening for agents that modulate ABCAl 3 transporter activity, such as specific transport inhibitors. Oligonucleotides for use in examples of such methods are also provided.
Also disclosed herein are protein specific binding agents, such as antibodies, that bind specifically to at least one epitope of an ABCA13 variant protein preferentially compared to wildtype ABCA13, and methods of using such antibodies in diagnosis and screening. Kits are also provided for carrying out the methods described herein.
The foregoing and other features and advantages will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a series of diagrams showing the various transcripts
Figure imgf000005_0001
gene and corresponding isoforms.
FIG 1A shows a physical map ofthe 7pl2.3 region containing the ABCAl 3 gene. The location ofthe boundaries of BAG clones AC073927 is shown as an inset portion ofthe second Nucleotide Binding Domain region (NBD2) of ABCA] 3. Gene orientation is indicated by the arrows and the size and location ofthe corresponding transcripts is shown in the map. Analysis was performed by combination of several gene-finding programs such as GENSCAN (Burge and Karlin, J Mol Biol; 268(l):78-94, 1997), FGENEH/FEXH (Solovyev and Salamov, Ismb; 5:294-302, 1997), and XPOUND (Thomas and Skolnick, J Math Appl Med Biol., 11(1):1-16, 1994). FIG IB is a diagram showing the six different ABCA 13 transcripts that have been identified and are described herein. Termination codons are indicated by thick upright black lines. The large arrows symbolize the primers. The Taqman reagents are symbolized by a light grey star. Two ABCAl 3 proteins are depicted by dark grey lines. The small protein that can be predicted in the 5' part of transcripts 2, 4, and 6 is indicated at the bottom left, by a black line. FIG IC is a first diagram ofthe predicted proteins from the six ABCA13 transcripts.
Amino acid numbering ofthe different protein domains is given. Key: SP, signal peptide; TM, predicted transmembrane domain, NBD, nucleotide binding domain; TMA, additional TM domain; C-term, C-terminal regions due to alternative splicing.
FIG ID is an alignment ofthe Isoforms of ABCA13 with the full length ABCA13. The STOP position corresponds to last base pair ofthe codon triplet. For each 3' end, the base pair positions above or below each bar correspond to the respective Isoform. Isoform 2B is depicted at the bottom left, between base pairs 26 and 2179.
Figure 2 is phylogenetic linkage tree showing the relationship ofthe ABCA gene family. The phylogenetic tree was constructed with the alignments ofthe N- and C-terminal ATP-binding domains' sequence by the Neighbor joining method. The numbers indicate the bootstrap values
(confidence interval for each branch after 100 conducted iterations, see Kumar et al., Bioinformatics
17(12): 1244-1245, 2001) between the bracketed genes.
Figure 3 is an alignment ofthe N-terminal region of ABCA subfamily proteins. Amino acid number one corresponds to the first position in all proteins, otherwise, the numbering is according to the ABCAl sequence. Dashes indicate gaps.
Figure 4 is a diagram ofthe predicted amino-acid sequence of ABCAl 3 Isoform 1 (SEQ ID
NO: 2). The predicted transmembrane domains (e.g., residues 20-42, 3571-3793, 3414-3636, 3646-
3668, 3677-3697, 3751-3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654- 4675 of SEQ ID NO: 2) and the hydrophobic domain at residues 3707-3729 of SEQ ID NO: 2 are shaded, large extracellular domains are underlined and the NBDs (e.g., residues 3868-4050 and 4747-
4932 of SEQ ID NO: 2) are boxed.
Figure 5 illustrates RNA expression analysis of human and mouse ABCAl 3. FIG 5 A shows human ABCAl 3 expression. This radial graph shows the expression profile that we have determined using the set of probe and primers specific for transcripts 1 and 2. The arbitrary unit has been calculated after normalization to β2-microglobulin.
FIG 5B is a blot that shows mouse Abcal3 expression. PCR was performed on the panel of mouse tissue-specific cDNAs, as described in the examples. Amplification products of 255 bp
(fragment of exons one, two and three) and 381 bp (fragment of exons 17 and 18) were seen in a reaction containing cDNA from kidney. A control reaction was performed with primers specific to
G3PDH (glyceraldehyde 3-phosρhate dehydrogenase).
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids, as defined in 37 C.F.R. § 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NO: 1 shows a cDNA encoding human ABCAl 3 (Isoform 1) and the predicted amino acid sequence.
SEQ ID NO: 2 shows the amino acid sequence ofthe human ABCA13 Isoform 1 protein encoded by ABCAl 3 (SEQ ID NO: 1).
SEQ ID NO: 3 through 15 show the nucleic acid sequences of primers used to amplify particular regions within the several isoforms of ABCAl 3. SEQ ID NO: 16 and 17 show primers that may be used to amplify mouse ABCA13.
SEQ ID NO: 18 shows a cDNA encoding human ABCAl 3 Isoform 2 A and the predicted amino acid sequence.
SEQ ID NO: 19 shows the amino acid sequence ofthe human ABCA13 Isoform 2A protein encoded by ABCAl 3 (SEQ ID NO: 18). SEQ ID NO: 20 shows a cDNA encoding human ABCAl 3 Isoform 2B and the predicted amino acid sequence.
SEQ ID NO: 21 shows the amino acid sequence ofthe human ABCA13 Isoform 2B protein encoded by ABCAl 3 (SEQ ID NO: 20). SEQ ID NO: 22 shows a cDNA encoding human ABCAl 3 Isoform 3, and the predicted amino acid sequence.
SEQ ID NO: 23 shows the amino acid sequence ofthe human ABCAl 3 Isoform 3 protein encoded by ABCAl 3 (SEQ ID NO: 22).
SEQ ID NO: 24 shows a cDNA encoding human ABCAl 3 Isoform 4 and the predicted amino acid sequence.
SEQ ID NO: 25 shows the amino acid sequence ofthe human ABCA13 Isoform 4 protein encoded by ABCAl 3 (SEQ ID NO: 24).
SEQ ID NO: 26 shows a cDNA encoding human ABCAl 3 Isoform 5 and the predicted amino acid sequence. SEQ ID NO: 27 shows the amino acid sequence ofthe human ABCAl 3 Isoform 5 protein encoded by ABCAl 3 (SEQ ID NO: 26).
SEQ ID NO: 28 shows a cDNA encoding human ABCA 13 Isoform 6 and the predicted amino acid sequence.
SEQ ID NO: 29 shows the amino acid sequence ofthe human ABCAl 3 Isoform 6 protein encoded by ABCAl 3 (SEQ ID NO: 28).
SEQ ID NOs: 30-41 show a portion ofthe N-terminal amino acid sequence ofthe ABCAl, ABCA2, ABCA3, ABCA4, ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCAIO, ABCAl 1, ABCA12, and ABCA13 proteins, respectively.
SEQ ID NOs: 42-56 show nucleic acid sequences of primers used for RACE amplification of ABCA 13 sequences, and/or validation of such amplification.
SEQ ID NOs: 57-65 show nucleic acid sequences of primers used in real-time CPR analysis of ABCAl 3.
SEQ ID NOs: 66-72 show nucleic acid sequences of primers used in quantification of ABCAl 3 sequences. SEQ ID NOs: 73-75 show nucleic acid sequences of additional primers used to amplify particular regions within isoforms of ABCAl 3.
DETAILED DESCRIPTION
Abbreviations
ABC: ATP-binding cassette transporter
BAC: bacterial artificial chromosome bp base pair(s)
DNA: deoxyribonucleic acid gDNA: genomic DNA pfu: plaque forming unit
ELISA: enzyme-linked immunosorbant assay
PCR: polymerase chain reaction
TAE: Tris acetate EDTA
77. Terms
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182- 9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review ofthe various embodiments ofthe invention, the following explanations of specific terms are provided: Altered expression: Expression of a nucleic acid (e.g., mRNA or protein) in a subject or biological sample from a subject that deviates from expression in a subject or biological sample from a subject having normal characteristics for the biological condition associated with the nucleic acid. Normal expression can be found in a control, a standard for a population, etc. For instance, where the altered expression manifests as a transporter disease condition, such as deficient extra- or intracellular transport, characteristics of normal expression might include an individual who is not suffering from the transport disorder, a population standard of individuals believed not to be suffering from the disease, etc. For instance, certain altered expression, such as altered ABCAl 3 nucleic acid or ABCAl 3 protein expression, can be described as being associated with the biological conditions of altered (e.g., reduced) transporter function and tendency to develop a transporter deficiency. Likewise, altered expression may be associated with a disease. The term "associated with" includes an increased risk of developing the disease as well as the disease itself.
Altered protein expression, such as altered ABCAl 3 protein expression, also refers to expression of a protein that is in some manner different to expression ofthe protein in a normal (wild type) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more ofthe amino acid residues is different; (2) a short deletion or addition of one or a few amino acid residues to the sequence ofthe protein; (3) a longer deletion or addition of amino acid residues, such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount ofthe protein, compared to a control or standard amount; (5) expression of an decreased amount ofthe protein, compared to a control or standard amount; (6) alteration ofthe subcellular localization or targeting ofthe protein; (7) alteration ofthe temporally regulated expression ofthe protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); and (8) alteration ofthe localized (e.g., organ or tissue specific) expression ofthe protein (such that the protein is not expressed where it would normally be expressed or is expressed where it normally would not be expressed), each compared to a control or standard. Animal: Living multi-cellular vertebrate organisms, a category that includes for example, mammals and birds.
Amplification: When used in reference to a nucleic acid, this refers to a collection of techniques that increase the number of copies of a nucleic acid molecule in a sample or specimen. An example of amplification is the polymerase chain reaction, in which a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization ofthe primers to nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies ofthe nucleic acid. The product of in vitro amplification can be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques. Other examples of in vitro amplification techniques include strand displacement amplification (see U.S. Patent No. 5,744,311); transcription-free isothermal amplification (see U.S. Patent No. 6,033,881); repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Patent No. 5,427,930); coupled ligase detection and PCR (see U.S. Patent No. 6,027,889); and NASBA™ RNA transcription-free amplification (see U.S. Patent No. 6,025,134).
Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5' -> 3' strand, referred to as the plus strand, and a 3' -> 5' strand (the reverse compliment), referred to as the minus strand. Because RNA polymerase adds nucleic acids in a 5' -> 3' direction, the minus strand ofthe DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand and identical to the plus strand (except that U is substituted for T).
Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a dsDNA target.
Binding or stable binding: An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount ofthe oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by either physical or functional properties ofthe targe oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays. Binding can be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation and the like.
Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absoφtion detection procedures. For example, one method that is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and the target disassociate from each other, or melt. The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (Tm) at which 50% ofthe oligomer is melted from its target. A higher (Tm) means a stronger or more stable complex relative to a complex with a lower (Tm).
Biological condition: Designates a condition of a subject that can be assessed through observation or through the analysis of a biological sample, e.g., altered expression level of ABCA13 protein in comparison to a control expression level, or ability of cells from a subject to transport cholesterol.
Biological sample: Any sample in which the presence of a protein and/or ongoing expression of a protein may be detected. Suitable biological samples include samples containing genomic DNA or RNA (including mRNA), obtained from body cells of a subject, such as but not limited to those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material. cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA can also contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA molecule. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
DNA (deoxyribonucleic acid): A long chain polymer that comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid (RNA)). The repeating units in DNA polymers are four different nucleotides, each of which comprises one ofthe four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides (referred to as codons) code for each amino acid in a polypeptide. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
Unless otherwise specified, any reference to a DNA molecule is intended to include the reverse complement of that DNA molecule. Except where single-strandedness is required by the text herein, DNA molecules, though written to depict only a single strand, encompass both strands of a double-stranded DNA molecule. Thus, a reference to the nucleic acid molecule that encodes a specific protein, or a fragment thereof, encompasses both the sense strand and its reverse complement. Thus, for instance, it is appropriate to generate probes or primers from the reverse complement sequence ofthe disclosed nucleic acid molecules. Deletion: The removal of a sequence of DNA, the regions on either side being joined together.
Encode: A polynucleotide is said to "encode" a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof. The anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
Functional fragments and variants of a polypeptide: Included are those fragments and variants that maintain at least one function ofthe parent polypeptide. It is recognized that the gene or cDNA encoding a polypeptide can be considerably mutated without materially altering one or more the polypeptide' s functions. First, the genetic code is well known to be degenerate, and thus different codons encode the same amino acids. Second, even where an amino acid substitution is introduced, the mutation can be conservative and have no material impact on the essential functions of a protein (see Stryer, Biochemistry 4th Ed., W. Freeman & Co., New York, NY, 1995). Third, part of a polypeptide chain can be deleted without impairing or eliminating all of its functions, e.g., sequence variants a protein, such as a 5' or 3' variant, may retain the full function of an entire protein. Fourth, insertions or additions can be made in the polypeptide chain for example, adding epitope tags, without impairing or eliminating its functions (Ausubel et al., Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1998). Other modifications that can be made without materially impairing one or more functions of a polypeptide include, for example, in vivo or in vitro chemical and biochemical modifications or the incorporation of unusual amino acids. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquination, labeling, e.g., with radionucleides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling polypeptides and labels useful for such purposes are well known in the art, and include radioactive isotopes such as 3ZP, ligands that bind to or are bound by labeled specific binding partners (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands. Functional fragments and variants can be of varying length. For example, a fragment may consist of 10 or more, 25 or more, 50 or more, 75 or more, 100 or more, or 200 or more amino acid residues. A functional fragment or variant of ABCA 13 is defined herein as a polypeptide that is capable of transporter activity, including any polypeptide six or more amino acid residues in length that is capable of transporter activity. Fragments of ABCAl 3 that contain one or more domains as described herein, whether in the native arrangement or order, or in a different arrangement or order, are specifically contemplated. Heterologous: A type of sequence that is not normally (i.e. in the wild-type sequence) found adjacent to a second sequence. In one embodiment, the sequence is from a different genetic source, such as a virus or organism, than the second sequence.
Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions ofthe same nucleic acid sequence.
Specifically hybridizable and specifically complementary are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding ofthe oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function ofthe target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding ofthe oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature ofthe hybridization method of choice and the composition and length ofthe hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) ofthe hybridization buffer will determine the stringency of hybridization, though waste times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11, herein incorporated by reference.
The following are exemplary hybridization conditions and are not meant to be limiting.
Very High Stringency (detects sequences that share 90% sequence identity) Hybridization: 5x SSC at 65°C for 16 hours Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65°C for 20 minutes each
High Stringency (detects sequences that share 80% sequence identity or greater") Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: 1 x SSC at 55°C-70°C for 30 minutes each
Low Stringency (detects sequences that share greater than 50% sequence identity') Hybridization: 6x SSC at RT to 55°C for 16-20 hours Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.
Isoform: As used herein, this term refers to are forms of a protein that have the same or similar biological function, but differ in the amino acid sequence comprising the protein (see e.g., Chen et al, J. Exp. Biol.205(Pt 17): 2677-2686, 2002). Isoforms of a protein may be produced by different genes or by alternative splicing of RNA transcripts from the same gene. The amino acid sequences of seven isoforms ofthe ABCA13 protein are disclosed herein as SEQ ID NO: 2, 19, 21, 23, 25, 27, and 29. Isolated: A biological component (such as a nucleic acid molecule, protein or organelle) that has been substantially completely separated or purified away from other biological components in the cell ofthe organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins that have been isolated include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
Labeled: A biomolecule attached covalently or noncovalently to a detectable label or reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al., Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989 and Ausubel et al, Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1998. For example, ATP can be labeled in any one of its three phosphate groups with radioisotopes such as 32P or 33P, or in its sugar moiety with radioisotopes such as 35S.
Mammal: This term includes both human and non-human mammals. Similarly, the term subject includes both human and veterinary subjects.
Modulator: An agent that increases or decreases (modulates) the activity of a protein as measured by the change in an experimental parameter. A modulator can be essentially any compound, such as a chemotherapeutic agent, a polypeptide, a hormone, a nucleic acid, a sugar, a lipid and the like.
Mutation: Any change ofthe DNA sequence within a gene or chromosome. In some instances, a mutation will alter a characteristic or trait (phenotype), but this is not always the case. Types of mutations include base substitution point mutations (e.g., transitions or transversions), deletions, and insertions. Missense mutations are those that introduce a different amino acid into the sequence ofthe encoded protein; nonsense mutations are those that introduce a new stop codon. In the case of insertions or deletions, mutations can be in-frame (not changing the frame ofthe overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination ofthe encoded product due to the presence of a stop codon in the alternative frame).
This term specifically encompasses variations that arise through somatic mutation, for instance those that are found only in disease cells, but not constitutionally, in a given individual. Examples of such somatically-acquired variations include the point mutations that frequently result in altered function of various genes that are involved in development of cancers. This term also encompasses DNA alterations that are present constitutionally, that alter the function ofthe encoded protein in a readily demonstrable manner, and that can be inherited by the children of an affected individual. In this respect, the term overlaps with "polymorphism," as defined below, but generally refers to the subset of constitutional alterations that have arisen within the past few generations in a kindred and that are not widely disseminated in a population group. In particular embodiments, the term is directed to those constitutional alterations that have major impact on the health of affected individuals.
Nucleotide: This term includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in a polynucleotide. A nucleotide sequence refers to the sequence of bases in a polynucleotide.
Oligonucleotide: A plurality of joined nucleotides joined by native phosphodiester bonds, between about 6 and about 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
Particular oligonucleotides and oligonucleotide analogs can include linear sequences up to about 200 nucleotides in length, for example a sequence (such as DNA or RNA) that is at least 6 bases, for example at least 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100 or even 200 bases long, or from about 6 to about 50 bases, for example about 10-25 bases, such as 12, 15 or 20 bases.
Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression ofthe coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
Open reading frame: A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide. Ortholog: Two nucleic acid or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.
Polypeptide: A polymer in which the monomers are amino acid residues that are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred. The term polypeptide or protein as used herein encompasses any amino acid sequence and includes modified sequences such as glycoproteins. The term polypeptide is specifically intended to cover naturally occurring proteins, as well as those that are recombinantly or synthetically produced. The term polypeptide fragment refers to a portion of a polypeptide that exhibits at least one useful epitope. The phrase "functional fragments of a polypeptide" refers to all fragments of a polypeptide that retain an activity, or a measurable portion of an activity, ofthe polypeptide from which the fragment is derived. Fragments, for example, can vary in size from a polypeptide fragment as small as an epitope capable of binding an antibody molecule to a large polypeptide capable of participating in the characteristic induction or programming of phenotypic changes within a cell. An epitope is a region of a polypeptide capable of binding an immunoglobulin generated in response to contact with an antigen. Thus, smaller peptides containing the biological activity of insulin, or conservative variants o the insulin, are thus included as being of use. The term soluble refers to a form of a polypeptide that is not inserted into a cell membrane.
Conservative amino acid substitution tables providing functionally similar amino acids are well known to one of ordinary skill in the art. The following six groups are examples of amino acids that are considered to be conservative substitutions for one another:
1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). Variations in the cDNA sequence that result in amino acid changes, whether conservative or not, are usually minimized in order to preserve the functional and immunologic identity ofthe encoded protein. The immunologic identity ofthe protein may be assessed by determining whether it is recognized by an antibody; a variant that is recognized by such an antibody is immunologically conserved. A cDNA sequence variant will preferably introduce no more than thirty, in some instances no more than twenty, and preferably fewer than ten amino acid substitutions into the encoded polypeptide. Variant amino acid sequences may, for example, be 80, 90 or even 95% or 98% identical to the native amino acid sequence. Programs and algorithms for determining percentage identity can be found at the NCBI website.
Polymorphism: Variant in a sequence of a gene, usually carried from one generation to another in a population. Polymorphisms can be those variations (nucleotide sequence differences) that, while having a different nucleotide sequence, produce functionally equivalent gene products, such as those variations generally found between individuals, different ethnic groups, geographic locations. The term polymorphism also encompasses variations that produce gene products with altered function, for instance variants in the gene sequence that lead to gene products that are not functionally equivalent. This term also encompasses variations that produce no gene product, an inactive gene product, or increased or increased activity gene product.
Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic ofthe nucleic acid molecule or protein that is linked to the variation (e.g., an alteration of a secondary structure such as a stem-loop, or an alteration ofthe binding affinity ofthe nucleic acid for associated molecules, such as polymerases, RNases, and so forth).
Probes and primers: Nucleic acid probes and primers can be readily prepared based on the nucleic acid molecules provided in this disclosure. A probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992). Primers are short nucleic acid molecules, preferably DNA oligonucleotides 10 nucleotides or more in length. More preferably, longer DNA oligonucleotides can be about 15, 17, 20, or 23 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
Methods for preparing and using probes and primers are described, for example, in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989), Ausubel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1998), and Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, MA). One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 30 consecutive nucleotides of ABCA13 encoding nucleotide will anneal to a target sequence, such as an ABCAl 3 gene homolog from the gene family contained within a human genomic DNA library, with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 17, 20, 23, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of ABCA13 nucleotide sequences.
The disclosure thus includes isolated nucleic acid molecules that comprise specified lengths ofthe disclosed ABCA13 cDNA sequences. Such molecules can comprise at least 17, 20, 23, 25, 30, 35, 40, 45 or 50 or more consecutive nucleotides of these sequences, and can be obtained from any region ofthe disclosed sequences. By way of example, the ABCAl 3 cDNA sequences can be apportioned into halves, thirds or quarters based on sequence length, and the isolated nucleic acid molecules can be derived from the first or second halves ofthe molecules, from any ofthe three thirds or any ofthe four quarters. By way of example, the human ABCA13 cDNA, ORF, coding sequence and gene sequences can be apportioned into about halves, thirds or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) can be derived from the first or second halves ofthe molecules, from any ofthe three thirds, or any ofthe four quarters. The cDNA also could be divided into smaller regions, e.g. about eighths, sixteenths, twentieths, fiftieths and so forth, with similar effect.
Another mode of division, provided byway of example, is to divide an ABCA13 encoding sequence based on the regions ofthe sequence that are relatively more or less homologous to other members ofthe ABC transporter family. Thus, nucleic acid molecules, for instance to be used as hybridization probe molecules, may be selected from the region encoding the N-terminal nucleotide binding domain (NBD1) region (e.g., about residues 3868-4050, or a fragment thereof), or from the region encoding the C-terminal nucleotide binding domain (NBD2) (e.g., about residues 4747-4932 or a fragment thereof), or the or the region encoding the N-terminal transmembrane domain (TMl) region (e.g., about residues 22-3774, or a fragment thereof) or the region encoding the C-terminal transmembrane domain (TM2) region (e.g., about residues 4225-4675) ofthe amino acid sequence encoding the human ABCA13 cDNA shown in SEQ ID NO: 1 (SEQ ID NO: 2). More specifically, the residues corresponding to the hydrophobic regions that compose the transmembrane domains of ABCA13 are residues 20-42, 3571-3793, 3414-3636, 3646-3668, 3677-3697, 3751-3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654-4675 of SEQ ID NO: 2 (see Figure 4). It should be noted however, that these regions are predicted using computer programs; thus, prediction using a different computer program may generate slightly different regions than those disclosed herein. Another mode of division is to select the 5' (upstream) and/or 3' (downstream) region associated with an ABCA13 gene, or to select an intron or portion thereof.
Purified: In a more pure form than is found in nature. The term purified does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the protein referred to is more pure than the protein in its natural environment within a cell.
The term substantially purified as used herein refers to a molecule (e.g., a nucleic acid, polypeptide, oligonucleotide, etc.) that is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. In one embodiment, the molecule is a polypeptide that is at least 50% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. In another embodiment, the polypeptide is at least at least 80% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. In yet other embodiments, the polypeptide is at least 90% or at least 95% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
Recombinant: A nucleic acid that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms ofthe similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or orthologs ofthe ABCA13 protein, and the corresponding cDNA sequence, will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or cDNAs are derived from species that are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences).
Typically, ABCA13 orthologs are at least 50% identical at the nucleotide level and at least 50%) identical at the amino acid level when comparing ABCA13 to an orthologous ABCA13. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman J Mol. Biol. 147(1): 195- 197, 1981; Needleman and Wunsch J. Mol. Biol. 48: 443-453, 1970; Pearson and Lipman Proc. Natl. Acad. Sci. USA 85: 2444-2448, 1988; Higgins and Sharp Gene, 73: 237-244, 1988; Higgins and Sharp CABIOS 5: 151-153, 1989; Corpet et al. Nuc. Acids Res. 16, 10881-10890, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-165, 1992; and Pearson et al. Meth. Mol. Bio. 24: 307-331, 1994. Furthermore, Altschul et al. (J. Mol. Biol. 215:403-410, 1990) present a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. J. Mol. Biol. 215: 403- 410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. The Search Tool can be accessed at the NCBI website, together with a description of how to determine sequence identity using this program.
An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence- dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5° C to 20° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% ofthe target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, CSHL, New York and Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes Part I, Chapter 2, Elsevier, New York. Nucleic acid molecules that hybridize under stringent conditions to a human ABCAl 3 gene sequence will typically hybridize to a probe based on either an entire human ABCA13 gene or selected portions ofthe gene under wash conditions of 2x SSC at 50° C. A more detailed discussion of hybridization conditions is presented herein.
Nucleic acid sequences that do not show a high degree of identity can nevertheless encode similar amino acid sequences, due to the degeneracy ofthe genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Specific binding agent: An agent that binds substantially only to a defined target. Thus an
ABCAl 3 protein-specific binding agent binds substantially only an ABCAl 3 protein. As used herein, the phrase ABCAl 3 protein-specific binding agent includes anti-ABCA13 protein antibodies and other agents (such as soluble receptors) that bind substantially only to an ABCA 13 protein, such as the ABCAl 3 proteins ofthe disclosure, or conservative variants thereof. Anti-ABCA13 protein antibodies can be produced using standard procedures described in a number of texts, including Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). The determination that a particular agent binds substantially only to the ABCA13 protein can readily be made by using or adapting routine procedures. One suitable in vitro assay makes use ofthe Western blotting procedure (described in many standard texts, including Harlow and Lane, Antibodies, A Laboratory Manual, CSHL, New York, 1988). Western blotting can be used to determine that a given ABCA13 protein binding agent, such as an anti-ABCA13 protein monoclonal antibody, binds substantially only to the ABCAl 3 protein.
A phosphor-specific binding agent specifically binds to a peptide containing a phosphorylated residue.
Shorter fragments of antibodies can also serve as specific binding agents. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to ABCA13 would be ABCAl 3-specific binding agents. These antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion ofthe heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment ofthe antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab')2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region ofthe light chain and the variable region ofthe heavy chain expressed as two chains; and (6) single chain antibody (SCA), a genetically engineered molecule containing the variable region ofthe light chain, the variable region ofthe heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine.
Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.
Target sequence: "Target sequence" is a portion of ssDNA, dsDNA or RNA that, upon hybridization to a therapeutically effective oligonucleotide or oligonucleotide analog, results in the inhibition of expression. For example, hybridization of therapeutically effectively oligonucleotide to an ABCA13 target sequence results in inhibition of ABCA13 expression. Either an antisense or a sense molecule can be used to target a portion of dsDNA, as both will interfere with the expression of that portion ofthe dsDNA. The antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand. Thus, target sequences can be ssDNA, dsDNA, and RNA. Transfected: A process by which a nucleic acid molecule is introduced into cell, for instance by molecular biology techniques, resulting in a transfected cell. As used herein, the term transfection encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transduction with viral vectors, transfection with plasmid vectors, and introduction of DNA by electroporation, lipofection, and particle gun acceleration. Treating a disease: Includes inhibiting or preventing the partial or full development or progression of a disease, for example in a person who is known to have a predisposition to a disease. An example of a person with a known predisposition is someone with a history of diabetes in his or her family, or who has been exposed to factors that predispose the subject to a condition, such as lupus or rheumatoid arthritis. Furthermore, treating a disease refers to a therapeutic intervention that ameliorates at least one sign or symptom of a disease or pathological condition, or interferes with a pathophysiological process, after the disease or pathological condition has begun to develop.
Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transfected host cell. Recombinant DNA vectors are vectors having recombinant DNA. A vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector can also include one or more selectable marker genes and other genetic elements known in the art. Viral vectors are recombinant DNA vectors having at least some nucleic acid sequences derived from one or more viruses.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The singular terms "a," "an," and "the" include plural unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Thus "A or B" means "A" or "B" or "A and B." "Comprises" means "includes." It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing ofthe present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
JZ7. Description of Several Specific Embodiments Provided herein are amino acid sequences encoding seven isoforms of human ABCA13, as
SEQ ID NOs: 2, 19, 21, 23, 25, 27, and 29. Specific embodiments include purified proteins having high identity (e.g., 85%, 90%, 95%) to amino acid residues 2278-4942 of ABCAl 3 Isoform 1 (SEQ ID NO: 2). Specific embodiments disclose proteins having high identity to a conserved region shared by all isoform proteins, residues 2278-4942 of SEQ ID NO: 2. The provided ABCA 13 proteins have ABCA13 protein biological activity, for instance in that they can complement an ABCA13 null phenotype. Specific embodiments include ABCAl 3 proteins having biological activity as extra- and/or intracellular membrane transport proteins that can complement A BCA13 null phenotypes by ameliorating the respective transport deficiencies. Also provided are nucleic acid molecules encoding the seven Isoform proteins, having nucleotide sequences as set forth as SEQ ID NOs: 1, 18, 20, 22, 24, 26 and 28. Recombinant polynucleotides encoding these sequences, including polynucleotides encoding the coding regions of SEQ ID NOs: 1, 18, 20, 22, 24, 26 and 28 are provided herein. Methods to diagnose and detect defects or alterations in ABCAl 3 expression are provided, as are methods for screening for specific binding agents of ABCAl 3.
In specific embodiments, the methods are used to detect hypercholesterolemia, drug resistance, retinal degeneration, or neurological disease. Other methods are used to detect chemotherapy resistant cells, or employ primers having sequences identical to at least 10 contiguous nucleotides of disclosed sequences, including SEQ ID NOs: 1, 18, 20, 22, 24, 26 or 28.
Antibodies specific to ABCA13, and the use of such antibodies (e.g., in Western blot to ELISA assays) are disclosed.
Kits for using the ABCAl 3 Isoform proteins are disclosed, including kits for screening defects in ABCAl 3 biological activity, and kits used to assay particular defects in individuals with defective ABCA13, including altered extra- or intracellular transport.
IV. ABCA13 Nucleic Acids and Proteins
The ABCAl 3 gene encodes a protein proposed to be involved in the energy-dependent transport of one or a variety of substances, for example ions, metals, amino acids, lipids, peptides, sugars, vitamins and steroid hormones. In addition, ABCAl 3 is located in a locus genetically linked to the Shwachmann-Diamond syndrome, a disorder ofthe pancreas, and a locus involved in T cell tumorigenesis. Thus, ABCA 13 is a candidate gene for these phenotypes. Furthermore, the gene is also highest expressed in certain tumor cell lines from leukemia, prostate and CNS, suggesting that it may play a role in these cancers. ABCAl 3 cDNA sequences are used to pinpoint the location of ABCAl 3 in the human genome. ABCAl 3 was localized by amplification of monochrome hybrids and radiation hybrids using the Polymerase Chain Reaction (PCR) (see Morten et al., Hum. Genet. 88(2): 200-203, 1991). Subsequently, the position of ABCAl 3 on the draft human map was determined using chromosomal assignment using somatic cell hybrids (CASH) (see Ryu et al., Mol Cells 10(5): 598-600, 2000). RT-PCR analysis shows that ABCA13 is expressed in brain, lung, skeletal muscle and ovary. In a study of sixty tumor cell lines, the expression of ABCAl 3 was detected in SR leukemia, SNB-19 CNS tumor, and DU-145 prostate tumor cell lines. The ABCAl 3 gene maps to chromosome 7pl2.3, a region that contains an inherited disorder affecting the pancreas as well as a locus involved in tumorigenesis. ABCA 13 is therefore a positional candidate for these pathologies. The ABCAl 3 gene is not present in zebrafish, indicated that it is a recently evolved gene specific to mammals.
This disclosure provides ABCAl 3 transporter proteins and isoforms and variants thereof, and nucleic acid molecules encoding these proteins, including cDNA sequences. In specific embodiments, these sequences are used for ameliorating, treating, detecting, prognosing, and diagnosing diseases and conditions believed to be associated with altered ABCAl 3 expression (based on homology to other ABCA family members), such as hypercholesterolemia, drug resistance, retinal degeneration, or neurological disease. In one embodiment, an ABCA 13 nucleic acid has altered expression (e.g., increased or decreased expression, such as altered transcription of ABCAl 3 mRNA, a mutated or deleted expression product, improper subcellular localization of a nucleic acid, etc.) as compared to a control nucleic acid (e.g., a nucleic acid amplified, using positive control sequences, from a subject not suffering from the biological condition). In some embodiments, expression of an ABCAl 3 nucleic acid is more than 50%, more than 75%, more than 100%, more than 200%, or more than 300% different when compared to a suitable control. Suitable controls include a known control, a known sample, or a standard value as assigned by one of ordinary skill in the art as a suitable standard value.
It will be apparent to one skilled in the art that either the cDNAs disclosed herein or sequences derived from these clones may be utilized in applications, including but not limited to, studies ofthe expression of th& ABCAl 3 gene, studies ofthe function ofthe ABCA13 protein, the generation of antibodies to the ABCA13 protein, diagnosis and therapy of ABCA13 deleted or mutated in subjects to prevent or treat the defects in cell and tissue development, such as transporter deficiency. Descriptions of applications describing the use of ABCA13 cDNA, or fragments thereof, are therefore intended to comprehend the use of t z ABCAl 3 nucleic acids and conservative variants thereof. A nucleic acid molecule encoding full-length ABCAl 3 (Isoform 1) is shown in SEQ ID NO:
1 ; the nucleic acid molecule encodes a protein of 5058 amino acids in length (SEQ ID NO: 2). Splice variants ofthe ABCAl 3 gene are also provided (e.g., SEQ ID NOs: 18, 20, 22, 24, 26, and 28); these encode various isoforms of ABCA13 (SEQ ID NOs: 19, 21, 23, 25, 27, and 29, respectively). The full-length ABCA 13 gene is encoded by 62 exons and spans over 450 kb, making ABCAl 3 the largest ABC gene described to date, including the largest number of exons. Exon and intron positions and accompanying data for full-length ABCAl 3 are summarized in Table 1.
In SEQ ID NO: 2, amino acids 20-42, 3571-3793, 3414-3636, 3646-3668, 3677-3697, 3751- 3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654-4675 of SEQ ID NO: 2 are predicted transmembrane domains (see Figure 5). Amino acids 9-15 compose a conserved ABCA family motif. Amino acids 3868-4050 and 4747-4932 are predicted nucleotide binding fold domains. Amino acids 708-2911 compose the large extracellular domain exon. Amino acids 3707-3729 compose a hydrophobic domain, and amino acids 4152-4156 and 5026-5030 are potential phosphorylation sites.
The following sequences homologous to ABCAl 3 Isoform 1 were extracted from GenBank (version 126 and 127): AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPl 1-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RPl 1-12G8, complete sequence, 70416 base pairs; AC073927 (gl3992793), Homo sapiens chromosome 7 BAG, clone RP11-604B16, complete sequence, 185676 base pairs; and AC091770 (gl5638906), Homo sapiens chromosome 7, BAG clone RPl 1-655M5, complete sequence, 93543 base pairs.
Table 1. ABCA13 Isoform 1 Positional Data
Figure imgf000023_0001
Isoform 2A is a protein encoded by a nucleotide sequence of 12,498 base pairs (SEQ ID NO: 18). The protein sequence of Isoform 2A (SEQ ID NO: 19) is 2760 amino acids in length. Isoform 2B is encoded by a nucleotide sequence of 12,498 base pairs (SEQ ID NO: 20) and its predicted amino acid sequence (SEQ ID NO: 21) is 717 amino acids in length. The following sequences homologous to Isoforms 2A and 2B were extracted from GenBank: AC073424
(gl5321569), Homo sapiens chromosome 7, clone RPl 1-653017, complete sequence, 191141 base pairs; AC095039 (gl 6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; AC073927 (gl3992793), Homo sapiens chromosome 7, BAC clone RP11-604B16, complete sequence, 185676 base pairs; and AC091770 (g 15638906), Homo sapiens chromosome 7, BAC clone RPl 1-655M5, complete sequence, 93543 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 2.
Table 2. ABCA13 Isoform 2A Positional Data
Figure imgf000024_0001
Isoform 3 (SEQ ID NO: 23) is 4958 amino acids in length and encoded by a nucleotide sequence of 15,970 base pairs (SEQ ID NO: 22). The following sequences homologous to Isoform 3 were extracted from GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RP11- 653017, complete sequence, 191141 base pairs; AC095039 (gl 6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAC, clone RP11-604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 3. Table 3. ABCA13 Isoform 3 Positional Data
Figure imgf000025_0001
Isoform 4 ofthe ABCAl 3 gene is 11259 base pairs long (SEQ ID NO: 24) with an open reading frame of 8079 base pairs, corresponding to 2660 amino acids (SEQ ID NO: 25). The following sequences homologous to Isoform 4 were extracted from GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPll-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAC clone RP11- 604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 4. Table 4. ABCA13 Isoform 4 Positional Data
Figure imgf000026_0001
Isoform 5 ofthe ABCA13 gene is 15779 base pairs long (SEQ ID NO: 26) with an open reading frame of 14877 base pairs, corresponding to 4952 amino acids (SEQ ID NO: 27). The following sequences homologous to Isoform 5 were extracted from GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPll-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RP11-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAG clone RPl 1- 604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 5. Table 5. ABCA13 Isoform 5 Positional Data
Figure imgf000027_0001
Isoform 6 ofthe ABCA13 gene is 11068 base pairs long (SEQ ID NO: 28) with an open reading frame of 8061 base pairs, corresponding to 2654 amino acids (SEQ ID NO: 29). The following sequences homologous to Isoform 6 were extracted from GenBank: AC073424 (gl5321569), Homo sapiens chromosome 7, clone RPl 1-653017, complete sequence, 191141 base pairs; AC095039 (gl6974283), Homo sapiens chromosome 7, clone RPl 1-12G8, complete sequence, 70416 base pairs; and AC073927 (gl3992793), Homo sapiens chromosome 7, BAC clone RPl 1- 604B16, complete sequence, 185676 base pairs. Relevant exon and intron positions and accompanying data are summarized in Table 6. Table 6. ABCA13 Isoform 6 Positional Data
Figure imgf000028_0001
V. Production ofABCA13 Nucleic Acids
With the provision herein ofthe sequence ofthe full length ABCAl 3 cDNA (SEQ ID NO: 1), as well as the sequences encoding several isoforms, in vitro nucleic acid amplification [such as polymerase chain reaction (PCR)] may be utilized as a simple method for producing ABCA13 encoding sequences. The following provides representative techniques for preparing cDNA in this manner.
Total RNA is extracted from human cells by any one of a variety of methods well known to those of ordinary skill in the art (Sambrook et al., in Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989; and Ausubel et al., in Current Protocols in Molecular Biology, Greene Publ. Assoc. and Wiley-Intersciences, 1992 provide descriptions of methods for RNA isolation). In one embodiment, primary cells are obtained from normal tissues. In another embodiment cells are obtained from tissues from subjects exhibiting the effects of ABCA13 transporter deficiency. In yet another embodiment cell lines, derived from normal or transporter-deficient tissues, are used as a source of such RNA. The extracted RNA is then used, for example, as a template for performing reverse transcription (RT)-PCR amplification of cDNA. Methods and conditions for RT-PCR are described in Kawasaki et al, (In PCR Protocols, A Guide to Methods and Applications, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California, 1990).
The selection of amplification primers will be made according to the portion(s) ofthe cDNA that is to be amplified. In one embodiment, primers may be chosen to amplify a segment of a cDNA or, in another embodiment, the entire cD A molecule. Variations in amplification conditions may be required to accommodate primers and amplicons of differing lengths and composition; such considerations are well known in the art and are discussed for instance in Innis et al. {PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990). By way of example, the coding portion ofthe human ABCA13 cDNA molecule (approximately 15,198 base pairs) and the full-length human ABCA13 Isoform 1 cDNA, as shown in SEQ ID NO: 1, may be amplified using primers, such as SEQ ID NO: 3 through 15 ofthe disclosure.
Similarly, the primers set forth as SEQ ID NO: 3, 4, 6-8, and 10-15 can be used to amplify a human ABCAl 3 Isoform 2A cDNA, as shown in SEQ ID NO: 18; the primers set forth as SEQ ID NO: 3-5, 7-15, and 73 can be used to amplify a human ABCAl 3 Isoform 3 cDNA, as shown in SEQ ID NO: 22; the primers set forth as SEQ ID NO: 3, 4, 7, 8, 10-15 and 73 can be used to amplify a human ABCAl 3 Isoform 4 cDNA, as shown in SEQ ID NO: 24; the primers set forth as SEQ ID NO: 3-5, 7-15, 74, and 75 can be used to amplify a human ABCAl 3 Isoform 5 cDNA, as shown in SEQ ID NO: 26; and the primers set forth as SEQ ID NO: 3, 4, 7, 8, 10-15, 74, 75 can be used to amplify a human ABCAl 3 Isoform 6 cDNA, as shown in SEQ ID NO: 28. These primers are illustrative only; one skilled in the art will appreciate that many different primers may be derived from the provided cDNA or gene sequence in order to amplify particular regions ofthe ABCAl 3 cDNA isoforms, as well as the complete sequence ofthe human ABCAl 3 cDNA (Isoform 1, SEQ ID NO: 1).
Re-sequencing of PCR products obtained by amplification procedures optionally can be performed to facilitate confirmation ofthe amplified sequence and provide information about natural variation of this sequence in different populations or species. Oligonucleotides derived from the provided ABCAl 3 sequences may be used in such sequencing methods.
Orthologs of human ABCA13 can be cloned in a similar manner, where the starting material consists of cells taken from a non-human species. The mouse gene ortholog to human ABCA13 displays 54% amino acid identity and 69% similarity in the large extracellular domain. In one embodiment, orthologs will generally share at least 65% sequence identity with the disclosed human ABCAl 3 cDNA. Where the non-human species is more closely related to humans, the sequence identity will in general be greater. In other embodiments, closely related orthologous ABCAl 3 molecules may share at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 91%, at least 93%, at least 95%, or at least 98% sequence identity with the disclosed human sequences.
Oligonucleotides derived from the human ABCA13 cDNA isoform sequences (e.g., SEQ ID NO: 1, 18, 20, 22, 24, 26, and 28), or fragments of these cDNAs, are encompassed within the scope ofthe present disclosure. In one embodiment, such oligonucleotides may comprise a sequence of at least 10 consecutive nucleotides of the ABCAl 3 nucleic acid sequence. If these oligonucleotides are used with an in vitro amplification procedure (such as PCR), lengthening the oligonucleotides may enhance amplification specificity. Thus, in other embodiments, oligonucleotide primers comprising at least 15, 20, 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these sequences may be used. These primers for instance may be obtained from any region ofthe disclosed sequences. By way of example, the human ABCA 13 cDNA, ORF and gene sequences may be apportioned into about halves, thirds or quarters based on sequence length, and the isolated nucleic acid molecules (e.g., oligonucleotides) may be derived from the first or second halves ofthe molecules, from any ofthe three thirds, or from any ofthe four quarters. For example, the full-length human ABCAl 3 cDNA, shown in SEQ ID NO: 1, can be used to illustrate this. The human ABCA13 cDNA is 17209 nucleotides in length, and the open reading frame begins at position 5 and ends at position 15202. In one specific embodiment, the open reading frame may be hypothetically divided into about halves (nucleotides 5-7600 and 7599-15202), in another specific embodiment, in about thirds (nucleotides 5- 5060, 5061-10120, 10121-15202) or in yet another specific embodiment, in about quarters (nucleotides 5-3800, 3801-7600, 7601-11400 and 11401-15202). In related embodiments, the cDNA sequences ofthe additional Isoforms 2A. 2B, and 3-6, can be similarly divided.
VI. ABCA13 Sequence Variants
With the provision of several human ABCA13 isoform protein (SEQ ID NO: 2, 19, 21, 23, 25, 27, and 29) and corresponding nucleic acid sequences (SEQ ID NO: 1, 18, 20, 22, 24, 26, and 28) herein, the creation of variants of these sequences is now enabled.
In one embodiment, variant ABCAl 3 proteins include proteins that differ in amino acid sequence from the human ABCAl 3 sequences disclosed but that share at least 65% amino acid sequence identity with the provided human ABCAl 3 protein. In other embodiments, other variants will share at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% amino acid sequence identity. A ABCA13 encoding sequence may be isolated by routine procedures, such as those provided in Example 1. For instance, a ABCAl 3 sequence may be isolated by homology screening using the cDNA sequence and the BLAST program. Direct sequencing, using the "longdistance sequence method," of one or more BAG or PAC clones that contain the ABCA13 sequence can be employed. Manipulation ofthe nucleotide sequence ofthe ABCA13 isoforms using standard procedures, including in one specific, non-limiting, embodiment, site-directed mutagenesis or in another specific, non-limiting, embodiment, PCR, can be used to produce such variants. The simplest modifications involve the substitution of one or more amino acids for amino acids having similar biochemical properties. These so-called conservative substitutions are likely to have minimal impact on the activity ofthe resultant protein.
In another embodiment, more substantial changes in transporter function or other protein features may be obtained by selecting amino acid substitutions that are less conservative than conservative substitutions. In one specific, non-limiting, embodiment, such changes include changing residues that differ more significantly in their effect on maintaining polypeptide backbone structure (e.g., sheet or helical conformation) near the substitution, charge or hydrophobicity ofthe molecule at the target site, or bulk of a specific side chain. The following specific, non-limiting, examples are generally expected to produce the greatest changes in protein properties: (a) a hydrophilic residue (e.g., seryl or threonyl) is substituted for (or by) a hydrophobic residue (e.g., leucyl, isoleucyl, phenylalanyl, or valyl); (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain (e.g., lysyl, arginyl, or histadyl) is substituted for (or by) an electronegative residue (e.g., glutamyl or aspartyl); or (d) a residue having a bulky side chain (e.g., phenylalanine) is substituted for (or by) one lacking a side chain (e.g., glycine).
In other embodiments, changes in transporter activity or other protein features may be obtained by mutating, substituting or deleting regions of ABCAl 3 that have a known function, or regions where the function is yet to be determined. For instance, a NBD (nucleotide binding domain) motif of ABCA13 (corresponding to residues 3863 to 4044 or 4742 to 4894 of SEQ ID NO: 2) can be deleted, substituted with the NBD of another protein or a synthetic NBD, or residues within the NBD motif can be mutated. In other embodiments, residues within any ofthe twelve ABCA13 transmembrane domain (TM) (e.g., residues 20-42, 3571-3793, 3414-3636, 3646-3668, 3677-3697, 3751-3773, 4226-4247, 4456-4473, 4508-4530, 4535-4556, 4571-4532, and 4654-4675 of SEQ ID NO: 2, see Figure 4) are mutated or deleted, or the TM is substituted with a transmembrane domain of another protein or a synthetic TM. In related embodiments, mutations may be made within the ABCA13 transmembrane domain or NBD motif of the sequences encoding ABCA 13 Isoforms 2A, 2B, and 3-6. In yet other embodiments, one or more domain from one ABCA13 isoform can be exchanged with the domain of another isoforms.
Variant ABCA 13 encoding sequences may be produced by standard DNA mutagenesis techniques. In one specific, non-limiting, embodiment, M13 primer mutagenesis is performed.
Details of these techniques are provided in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Ch. 15., CSHL, New York, 1989). By the use of such techniques, variants may be created that differ in minor ways from the human ABCAl 3 sequences disclosed. In one embodiment, DNA molecules and nucleotide sequences that are derivatives of those specifically disclosed herein, and which differ from those disclosed by the deletion, addition, or substitution of nucleotides while still encoding a protein that has at least 65% sequence identity with the human ABCA 13 encoding sequence disclosed (SEQ ID NO: 1), are comprehended by this disclosure. In some embodiments, at least one or more, at least 5 or more, at least 10 or more, at least 15 or more, at least 20 or more, or at least 25 or more nucleotides are deleted, added, or substituted while still encoding a protein that has at least 65% sequence identity with the human ABCAl 3 encoding sequence disclosed (SEQ ID NO: 1). In other embodiments, more closely related nucleic acid molecules that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% nucleotide sequence identity with the disclosed ABCAl 3 sequences are comprehended by this disclosure. In one embodiment, such variants may differ from the disclosed sequences by alteration ofthe coding region to fit the codon usage bias ofthe particular organism into which the molecule is to be introduced.
In other embodiments, the coding region may be altered by taking advantage ofthe degeneracy ofthe genetic code to alter the coding sequence such that, while the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to the disclosed human ABCA13 protein sequences. For example, because ofthe degeneracy ofthe genetic code, four nucleotide codon triplets - (GCT, GCG, GCC and GCA) - code for alanine. The coding sequence of any specific alanine residue within the human ABCA13 protein, therefore, could be changed to any of these alternative codons without affecting the amino acid composition or characteristics ofthe encoded protein. Based upon the degeneracy of he genetic code, variant DNA molecules may be derived from the cDNA and gene sequences disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. Thus, this disclosure also encompasses nucleic acid sequences that encode an ABCA 13 protein, but which vary from the disclosed nucleic acid sequences by virtue ofthe degeneracy ofthe genetic code.
In one embodiment, variants ofthe ABCA13 isoform proteins may also be defined in terms of their sequence identity with the prototype human ABCAl 3 protein. As described above, human ABCAl 3 proteins share at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% amino acid sequence identity with the human ABCAl 3 isoform 1 protein (SEQ ID NO: 2). In some embodiments, at least one or more, at least 5 or more, at least 10 or more, at least 15 or more, at least 20 or more, or at least 25 or more amino acids are deleted, added, or substituted while still encoding a protein that has at least 65% sequence identity with the ABCA13 isoform 1 encoding sequence (SEQ ID NO: 2). Nucleic acid sequences that encode such proteins/fragments readily may be determined simply by applying the genetic code to the amino acid sequence of an ABCA 13 protein or fragment, and such nucleic acid molecules may readily be produced by assembling oligonucleotides corresponding to portions ofthe sequence. Nucleic acid molecules that are derived from the human ABCA 13 cDNA nucleic acid sequences include molecules that hybridize under low stringency, high stringency, or very high stringency conditions to the disclosed prototypical ABCAl 3 nucleic acid molecules, and fragments thereof.
Human ABCAl 3 nucleic acid encoding molecules (including the cDNA shown in SEQ ID NOs: 1, 18, 20, 22, 24, 26, 28 and nucleic acids comprising these sequences), and orthologs and homologs of these sequences, may be incorporated into transformation or expression vectors.
It will also be apparent to one skilled in the art that homologs ofthe ABCAl 3 nucleic acid may now be cloned from other species, such as the rat or a monkey, by standard cloning methods. Such homologs will be useful in the production of animal models demonstrating the formation and progression of a variety of tumors. In one embodiment, such orthologous ABCA13 molecules will share at least 65% sequence identity with the human ABCA 13 nucleic acid disclosed herein; and in other embodiments, more closely related orthologous sequences will share at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity with this sequence.
VII. Expression ofABCA13 Protein
With the provision of human ABCA13 encoding sequences (such as the cDNA shown in SEQ ID NOs: 1, 18, 20, 22, 24, 26, and 28), the expression and purification ofthe ABCA13 proteins by standard laboratory techniques is now enabled. Purified human ABCAl 3 protein may be used for functional analyses, antibody production, diagnostics, and patient therapy.
For instance, the DNA sequence ofthe full-length ABCA13 cDNA (e.g., SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28) can be manipulated in studies to understand the expression ofthe gene and the function of its product. In other embodiments, Isoforms 2 A, 2B and 3-6 and/or mutant forms ofthe human ABCAl 3 may be isolated based upon information contained herein, and may be studied in order to detect alteration in expression patterns in terms of relative quantities, cellular localization, tissue specificity and functional properties ofthe encoded mutant ABCAl 3 protein. In yet other embodiments, partial or full-length cDNA sequences, which encode for the subject protein, may be ligated into bacterial expression vectors.
Methods for expressing large amounts of protein from a cloned gene introduced into Escherichia coli (E. coli) may be utilized for the purification, localization and functional analysis of proteins. By way of example, fusion proteins consisting of amino terminal peptides encoded by a portion ofthe E. coli lacZ or trpE gene linked to ABCAl 3 proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins. Thereafter, these antibodies may be used in other embodiments to purify proteins by immunoaffinity chromatography, in diagnostic assays to quantitate the levels of protein and to localize proteins in tissues and individual cells by immunofluorescence. Such antibodies may be specific for epitope tags, which can be added to the expression construct for identification and/or purification purposes.
Intact native protein also may be produced in E. coli or other cell culture systems in large amounts for functional studies. Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Ch. 17, CSHL, New York, 1989). Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response. In one embodiment, native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome binding site upstream ofthe cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy.
Suitable methods are presented in Sambrook et al. and are well known in the art. In one embodiment, proteins expressed at high levels are found in insoluble inclusion bodies. Methods for extracting proteins from these aggregates are described by Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Ch. 17, CSHL, New York, 1989). Vector systems suitable for the expression of lacZ fusion genes include the pUR series of vectors (Ruther and Muller-Hill, EMBO J. 2:1791-1794, 1983), pEXl-3 (Stanley and Luzio, EMBO J. 3(6):1429-1434, 1984) and pMRlOO (Gray et al, Proc. Natl. Acad. Sci. USA 79(21):6598-6602, 1982). Vectors suitable for the production of intact native proteins include pKC30 (Belfort et al., J. Biol. Chem. 258(3):2045-2051, 1983), pKK177-3 (Amann and Brosius, Gene 40(2-3):183-190, 1985) and pET-3 (Srudier and Moffatt, J. Mol. Biol. 189(1):113-130, 1986). In one embodiment, ABCA13 fusion proteins may be isolated from protein gels, lyophilized, ground into a powder and used as an antigen. In other embodiments, the DNA sequence can also be transferred from its existing context to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al, Science 236:806-812, 1987). These vectors may then be introduced into a variety of hosts including, but not limited to, somatic cells, and simple or complex organisms, such as, but not limited to, bacteria, fungi (Timberlake and Marshall, Science 244:1313-1317, 1989), invertebrates, plants, and animals (Pursel etal, Science 244:1281-1288, 1989), which cells or organisms are rendered transgenic by the introduction ofthe heterologous ABCA13 cDNA.
For expression in mammalian cells, the cDNA sequence is ligated to heterologous promoters. In one specific, non-limiting embodiment it may be ligated to the simian virus (SV) 40 promoter in the pSV2 vector (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981), and introduced into cells, such as monkey COS-1 cells (Gluzman, Cell 23:175-182, 1981), to achieve transient or long-term expression. In one embodiment, the stable integration ofthe chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J. Mol. Appl. Genet. 1:327-341, 1982) and mycophenolic acid (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981). In another embodiment, cell lines expressing native ABCA13 are created. In yet another embodiment, cell lines expressing a mutant ABCA13 are created.
DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with nucleic acid amplification. These techniques are known to those of ordinary skill in the art.
The ABCA 13 cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques. These vectors are designed to permit the transcription of he cDNA in eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription ofthe cDNA and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions ofthe SV40 or long terminal repeat (LTR) ofthe Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan et al., Proc. Natl. Acad. Sci. USA 78:1078-2076, 1981; Gorman et al., Proc. Natl. Acad. Sci. USA 78:6777-6781, 1982). The level of expression ofthe cDNA can be manipulated with this type of vector by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S. frugiperda cells (Summers and Smith, in Genetically Altered Viruses and the Environment, Fields et al. (Eds.) 22:319-328, CSHL Press, Cold Spring Harbor, New York, 1985) or by using vectors that contain promoters amenable to modulation, for example, a recombinant adenoviral vector containing a nuclear lacZ gene driven by a human ventricular/slow muscle myosin light chain 1 promoter (Shi et al, Hum Gene Ther. 8(4):403-410, 1997). The expression ofthe cDNA can be monitored in the recipient cells 24 to 72 hours after induction (transient expression).
Some vectors contain selectable markers such as the gpt (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78:2072-2076, 1981) or neomycin (Southern and Berg, J. Mol. Appl. Genet. 1:327- 341, 1982) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression ofthe vectors (and therefore the cDNA). By way of example, the vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses, such as papilloma (Sarver et al, Mol. Cell Biol. 1:486-496, 1981) orEpstein- Barr (Sugden et al, Mol. CellBiol. 5:410-413, 1985). In another embodiment, one can produce cell lines that have integrated the vector into genomic DNA. Both of these types of cell lines produce the gene product on a continuous basis. Alternatively, one can produce cell lines that have amplified the number of copies ofthe vector (and therefore ofthe cDNA as well) to create cell lines that can produce high levels ofthe gene product (Alt et al, J. Biol. Chem. 253: 1357-1370, 1978). The vectors may contain an internal ribosomal entry site (IRES) between the cDNA and a marker gene, such as neomycin or enhanced green fluorescent protein (EGFP). The IRES allows for the simultaneous expression ofthe two elements from a single isoform. Ribosomes bind the isoform at both the 5' end to translate the cDNA and at the IRES to translate, in one specific, non-limiting embodiment, the antibiotic resistance marker, or in another specific, non-limiting embodiment, the fluorescent marker. The bicistronic expression via the IRES sequence provides a high degree of correlation between the antibiotic resistance and stable expression ofthe cDNA. Alternatively, only cells expressing the cDNA will show green fluorescence. Thus, the use of expression vectors containing an IRES is an efficient way to select for cells expressing the cDNA of interest.
The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional technique. Recombinant expression vectors can be introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, Virology 52(2):456-467, 1973) or strontium phosphate (Brash et al, Mol. Cell Biol. 7(5):2031-2035, 1987), electroporation (Neumann etal, EMBOJ \(7): \-M5, 1982), lipofection ' (Feigner etal, Proc. Natl. Acad. Sci USA 84(21):7413-7417, 1987), DEAE dextran (Schenborn etal, Methods Mol Biol 130:147-153, 2000), microinjection (Mueller et al, Cell 15(2):579-585, 1978), protoplast fusion (Schafher, Proc. Natl. Acad. Sci. USA 77:2163-2167, 1980), or gene guns (Nishitani et al, Cancer Gene Ther. 9(2): 156- 163, 2002). In another embodiment, the ABCA 13 isoform cDNA sequences, or fragments thereof, can be introduced by infection with virus vectors. Systems are developed that use, for example, retroviruses (Huszar, et al, Proc. Natl. Acad. Sci. U. S. A. 82(24):8587-8591, 1985), adenoviruses (Schaack et al, Virology. 291(1):101-109, 2001), or Herpes virus (Spaete et al, Cell 30(l):295-304, 1982). Techniques of use in packaging long transcripts can be found in Kochanek et al. (Proc. Natl Acad. Sci. USA 93:5731-5739, 1996), Parks et al (Proc. Natl. Acad. Sci. USA 93:13565-13570, 1996) and Parks and Graham (J. Virol. 71 :3293-3298, 1997). In yet another embodiment, ABCAl 3 encoding sequences can be delivered to target cells in vitro via non-infectious systems, for instance liposomes. ,
These eukaryotic expression systems can be used for studies of ABCAl 3 encoding nucleic acids and mutant forms of these molecules, the ABCAl 3 isoform proteins and mutant forms of these proteins. Regulatory elements located in the 5' region ofthe ABCAl 3 gene on genomic clones can be isolated from human genomic DNA libraries using the information contained herein. In other embodiments, the eukaryotic expression systems also may be used to study the function ofthe normal complete protein, specific portions ofthe protein, or of naturally occurring or artificially produced mutant proteins.
In several embodiments, using the above techniques, expression vectors containing the ABCAl 3 isoform gene sequences or cDNAs, or fragments or variants or mutants thereof, can be introduced into human cells, mammalian cells from other species or non-mammalian cells, as desired. The choice of cell is determined by the purpose ofthe treatment. For example, in one specific, non- limiting embodiment monkey COS cells (Gluzman, Cell 23:175-182, 1981) that produce high levels ofthe SV40 T antigen and permit the replication of vectors containing the SV40 origin of replication are used. In other embodiments, Chinese hamster ovary (CHO), mouse NIH 3T3 fibroblasts, or human fibroblasts or lymphoblasts are used.
Embodiments described herein thus encompass recombinant vectors that comprise all or part of an ABCAl 3 encoding sequence, such as the ABCAl 3 isoform genes or cDNAs or variants thereof, for expression in a suitable host. In one embodiment, an ABCAl 3 DNA is operatively linked in a vector to an expression control sequence in the recombinant DNA molecule so that the ABCAl 3 polypeptide can be expressed. In another embodiment, the expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be specifically selected from the group consisting ofthe lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter ofthe yeast alpha-mating factors and combinations thereof.
In another embodiment, the host cell, which may be transfected with a vector, may be selected from the group consisting of E. coli, Pseudomonas, Bacillus subtilis, Bacillus stearothermophϊlus or other bacilli; other bacteria; yeast; fungi; insect; mouse or other animal; or plant hosts; or human tissue cells. It is appreciated that for mutant or variant ABCAl 3 DNA sequences (e.g., ABCA13 isoforms encoded by SEQ ID NO: 18, 20, 22, 24, 26, or 28), similar systems are employed to express and produce the mutant product.
VIII. Suppression ofABCA13 Protein Expression
A diseased condition is in some instances attributed to overexpression of a protein (e.g., HER-2/neu is overexpressed in breast cancer, see Kaya et al, Pathol. Oncol Res. 7(4): 279-283, 2001). In such instances, reversal ofthe over-expression (e.g., suppression) is a potential method for ameliorating the diseased condition. In one embodiment ofthe disclosure, suppression of ABCA13 is achieved in a subject having a transporter malfunction due to overexpression of ABCAl 3.
Reduction of ABCA13 protein expression in a transgenic cell may be obtained for instance by introducing into cells an antisense construct based on an ABCA 13 encoding sequence, including the human ABCAl 3 cDNAs (SEQ ID NO: 1 18, 20, 22, 24, 26, and 28) or gene sequence or flanking regions thereof. In one specific, non-limiting embodiment, a nucleotide sequence from an ABCAl 3 encoding sequence, e.g. all or a portion of one of UIQ ABCA13 CDNA isoform sequences, is arranged in reverse orientation relative to the promoter sequence in the transformation vector. Other aspects of the vector may be chosen as discussed above (see Section VII).
The introduced sequence need not be the full-length human ABCAl 3 cDNA (SEQ ID NO: 1) or gene, and need not be exactly homologous to the equivalent sequence found in the cell type to be transfected. In one embodiment, portions or fragments ofthe human ABCAl 3 isoform cDNA (SEQ ID NO: 1, 18, 20, 22, 24, 26, and 28) could be used to knock out expression ofthe human ABCA13 gene. Generally, however, where the introduced sequence is of shorter length, a higher degree of identity to the native ABCAl 3 sequence will be needed for effective antisense suppression. In other embodiments, the introduced antisense sequence in the vector may be at least 15 nucleotides in length, and improved antisense suppression typically will be observed as the length ofthe antisense sequence increases. In yet other embodiments, the length ofthe antisense sequence in the vector advantageously may be greater than 100 nucleotides, and can be up to about the full length ofthe human ABCA13 cDNA or gene. In another embodiment, for suppression ofthe ABCA13 gene itself, transcription of an antisense construct results in the production of RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous ABCAl 3 gene in the cell.
Although the exact mechanism by which antisense RNA molecules interfere with gene expression has not been elucidated, it is believed that antisense RNA molecules bind to the endogenous mRNA molecules and thereby inhibit translation ofthe endogenous mRNA.
In another embodiment, suppression of endogenous ABCAl 3 expression can be achieved using ribozymes. Ribozymes are synthetic RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to Cech and U.S. Patent No. 5,543,508 to Haselhoff. In one embodiment, the inclusion of ribozyme sequences within antisense RNAs may be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that bind to the antisense RNA are cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression.
In yet another embodiment, dominant negative mutant forms of ABCAl 3 may be used to block endogenous ABCAl 3 activity.
IX. Production of an Antibody to ABCA13 Protein
Monoclonal or polyclonal antibodies may be produced to either the native ABCAl 3 protein or variant (e.g., isoform) forms of this protein. In one embodiment, antibodies raised against an ABCA13 protein would specifically detect the ABCA13 protein. That is, such antibodies would recognize and bind the ABCA13 protein, or fragments thereof, and would not substantially recognize or bind to other proteins found in human cells. In other embodiments, antibodies against the human ABCA13 protein may recognize ABCA13 from other species (e.g., murine ABCA13), and vice versa.
Monoclonal or polyclonal antibodies to the protein can be prepared as follows:
A. Monoclonal Antibody Production by Hybridoma Fusion
Monoclonal antibodies to epitopes ofthe ABCA 13 isoform proteins can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495-497, 1975) or derivative methods thereof. In one specific, non-limiting embodiment, a mouse is repetitively inoculated with a few micrograms ofthe selected protein over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells ofthe spleen isolated. The spleen cells are fused with mouse myeloma cells using polyethylene glycol, and the excess, non-fused, cells destroyed by growth ofthe system on selective media comprising aminopterin (HAT media). Successfully fused cells are diluted and aliquots ofthe dilution placed in wells of a microtiter plate, where growth ofthe culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid ofthe wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol. 70(A): 419-439, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). B. Polyclonal Antibody Production by Immunization
Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein (for instance, expressed using a method described herein), which, in one specific, non-limiting embodiment, can be modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. In one embodiment, small molecules may tend to be less immunogenic than others and may require the use of carriers and adjuvant, examples of which are known. In another embodiment, host animals may vary in response to site of inoculations and dose, with either inadequate or excessive doses of antigen resulting in low titer antisera. In one specific, non-limiting embodiment, a series of small doses (ng level) of antigen administered at multiple intradermal sites may be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al. J. Clin. Endocrinol. Metab. 33: 988-991, 1971.
In one embodiment, booster injections will be given at regular intervals, and antiserum harvested when antibody titer thereof begins to fall, as determined semi-quantitative ly (for example, by double immunodiffusion in agar against known concentrations ofthe antigen). See, for example, Ouchterlony et al. (In Handbook of Experimental Immunology, Wier, D. (ed.) chapter 19, Blackwell, 1973). In one specific, non-limiting embodiment the plateau concentration of antibody is usually in the range of about 0.1 to 0.2 mg/ml of serum (about 12 μM). Affinity ofthe antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Ch. 42, 1980).
C. Antibodies Raised asainst Synthetic Peptides
A third approach to raising antibodies against ABCA13 proteins is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence ofthe ABCA13 protein. Polyclonal antibodies can be generated by injecting such peptides into, for instance, rabbits.
D. Antibodies Raised by Injection of ABCAl 3 Encoding Sequence
In one embodiment, antibodies may be raised against an ABCAl 3 protein by subcutaneous injection of a recombinant DNA vector that expresses the ABCAl 3 protein into laboratory animals, such as mice. In one specific, non-limiting embodiment, delivery ofthe recombinant vector into the animals may be achieved using a hand-held form ofthe Biolistic system (Sanford et al, Particulate Sci. Technol 5:27-37, 1987), as described by Tang et al. (Nature 356:152-154, 1992). In other embodiments, expression vectors suitable for this purpose may include those that express the ABCA13 encoding sequence under the transcriptional control of either the human β-actin promoter or the cytomegalovirus (CMV) promoter. Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.
X. ABCA13 as a Transporter Protein
The ABCAl 3 isoform proteins and their functional variants are believed to participate in the regulation of energy-dependent transport of a wide variety of substrates, including ions, metals, amino acids, lipids, peptides, sugars, vitamins, and steroid hormones across membranes. In one embodiment, the lack of expression of ABCAl 3 in a cell leads to a defect in transporter activity. In one specific, non-limiting embodiment, the administration of an ABCA13 recombinant nucleotide to a subject suffering from a transporter deficiency ameliorates the effects ofthe deficiency.
The expression of mutant transporter proteins can yield important information about the importance of each amino acid in the protein as well as the details ofthe mechanism of action of these proteins. Cells may have ABCAl 3 null mutations, ABCAl 3 missense mutations, or inactivation of ABCA13. In one embodiment, a mutant ABCA13 is expressed in a cell but is incapable of localizing to the correct subcellular location. In another embodiment, a mutant ABCAl 3 is incapable of binding to its intracellular binding partners. In yet another embodiment, a mutation in the upstream regulatory region ofthe ABCAl 3 gene abrogates the expression ofthe protein. In another embodiment, a mutant ABCAl 3 is incapable of transporting target substances.
It is possible that mutations in the ABCAl 3 gene that may lead to tumor formation or progression are not included in the cDNA but rather are located in other regions of the ABCAl 3 gene. Mutations located outside ofthe ORF that encode the ABCA13 isoform proteins are not likely to affect the functional activity ofthe proteins, but rather are likely to result in altered levels ofthe proteins in the cell. For example, mutations in the promoter region ofthe ABCAl 3 gene may prevent transcription ofthe gene and therefore lead to the complete absence ofthe ABCA13 protein, or absence of certain transcripts ofthe protein, in the cell.
Additionally, mutations within introns in the genomic sequence may also prevent expression ofthe ABCA13 protein. Following transcription of a gene containing introns, the intron sequences are removed from the RNA molecule, in a process termed splicing, prior to translation ofthe RNA molecule that results in production of he encoded protein. When the RNA molecule is spliced to remove the introns, the cellular enzymes that perform the splicing function recognize sequences around the intron/exon border and in this manner recognize the appropriate splice sites. If a mutation exists within the sequence ofthe intron near and exon/intron junction, the enzymes may not recognize the junction and may fail to remove the intron. If this occurs, the encoded protein will likely be defective. Thus, mutations inside the intron sequences within the ABCAl 3 gene (termed "splice site mutations") may also lead to defects in transporter activity. However, knowledge ofthe exon structure and intronic splice site sequences ofthe ABCAl 3 gene is required to define the molecular basis of these abnormalities. The provision herein of ABCAl 3 isoform cDNA sequences enables the cloning ofthe entire ABCA 13 gene (including the promoter and other regulatory regions and the intron sequences) and the determination of its nucleotide sequence. With this information in hand, diagnosis of a genetic predisposition to transporter deficiency based on DNA analysis will comprehend all possible mutagenic events at the ABCAl 3 locus.
Compounds that modulate the expression or activity of ABCA 13 can be used to regulate transporter activity. For instance, in some cases it may be determined that ABCA13 is expressed at low levels in a subject suffering from a transporter deficiency that arose as the result ofthe inefficient expression of ABCA13. Administration, to the subject, of an agent that up-regulates ABCA13 expression can improve transporter activity or ameliorate the transporter deficiency.
Changes in transporter activity can be assessed using a variety of in vitro and in vivo assays. These assays can be used to study the effect of ABCA13 on specific cell types or the effect of particular mutations on ABCAl 3 transporter activity. By systematically introducing mutant ABCA 13 constructs into cells and assessing their ability to transport substances across membranes, the importance of each amino acid for the protein's transporter activity can be determined. In addition, these assays can be used to screen for modulators of ABCAl 3 activity. The modulators identified in this way can then be used to alter ABCAl 3 expression in cells in vitro or in vivo.
In one embodiment, cells expressing wild-type ABCA13 are assessed for their ability to transport substances in vitro, as compared to cells that express a mutant ABCA13. In this embodiment, ABCA13 is transfected into cells, and levels ofthe transported substance in these cells can be assayed and compared between wild-type and transfected cells for potential differences. Methods of analysis include, for instance, immobilization ofthe protein on columns to search for compounds that bind the immobilized protein (see Wainer et al, J. Chromatogr. B. Biomed. Sci. Appl 724(1): 65-72, 1999) and disruption ofthe ABCAl 3 gene by antisense or RNAi technology (see Paddison et al, Proc. Natl Acad. Sci. U S. A. 99(3): 1443-1448, 2002).
In yet another embodiment, samples or assays that are treated with a test compound that potentially modulates ABCAl 3 are compared to control samples that are not treated with the test compound, to examine the extent of modulation. In one embodiment, the compounds to be tested are present in the range from 0.1 nM to 10 mM. Control samples (untreated with modulators) are assigned a relative ABCA13 activity value of 100%. In one embodiment, inhibition of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 90%. In other embodiments, inhibition of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 75%, about 50%, about 25%, or about 5%. In another embodiment, activation of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 110% (e.g. 10% more than the control). In other embodiments, activation of ABCA13 is achieved when the ABCA13 activity value relative to the control is about 150%, about 175% or about 200%.
The effect of test compounds upon ABCAl 3 activity can be assessed using the assays described above. Such assays include, but are not limited to, the ability to transport substances across membranes. In one embodiment, the compounds tested as modulators of ABCAl 3 are any small chemical compound, or biological entity, such as a polypeptide, sugar, nucleic acid or lipid.
Furthermore, the ability of cells transfected with ABCAl 3 to transport fluorescent compounds can be assessed (see Gribar et al, J. Membr. Biol 173(3): 203-214, 2000).
In another embodiment, the modulator is a genetically altered version of ABCAl 3. In other embodiments, the effect of potential modulators on ABCA 13 protein or mRNA levels, transcriptional activation or repression of a reporter gene is measured,
XI. DNA-Based Diagnosis
The ABCA 13 sequence information presented herein can be used in the area of genetic testing for predisposition to transporter deficiency owing to defects in ABCAl 3, such as deletion, duplication or mutation ofthe ABCAl 3 gene, or a portion thereof. The gene sequence ofthe ABCAI3 gene, including intron-exon boundaries is also useful in such diagnostic methods. Whether an individual is carrying mutations in the ABCAl 3 gene (or a portion thereof), or has a duplication(s) or heterozygous or homozygous deletion(s) ofthe ABCAl 3 gene, may be detected at the DNA level with the use of a variety of techniques. For such a diagnostic procedure, a biological sample ofthe subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for a mutated, duplicated or deleted ABCAl 3 gene. Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material. Biological samples can be obtained from normal, healthy subjects or from subjects who are predisposed to or who are suffering from any one of a variety ofthe effects of transporter deficiencies such as, but not limited to, hypercholesterolemia, or defective transport of hydrophobic compounds such as lipids, sterols or fatty acids.
The detection in the biological sample of either a mutant ABCAl 3 gene, a mutant ABCAl 3 RNA, or a duplicated or homozygously or heterozygously deleted ABCAl 3 gene, may be performed by a number of methodologies, examples of which are discussed below.
One embodiment of such detection techniques for the identification of unknown mutations is the amplification (e.g., polymerase chain reaction amplification) of reverse transcribed RNA (RT- PCR) isolated from a subject, followed by direct DNA sequence determination ofthe products. The presence of one or more nucleotide differences between the obtained sequence and the prototypical ABCA13 cDNA sequence, and especially, differences in the open reading frame (ORF) portion ofthe nucleotide sequence, are taken as indicative of a potential ABCAl 3 gene mutation.
Alternatively, DNA extracted from a biological sample may be used directly for amplification. Direct amplification from genomic DNA would be appropriate for analysis ofthe entire ABCAl 3 gene including regulatory sequences located upstream and downstream from the open reading frame, or intron/exon borders. Reviews of direct DNA diagnosis have been presented by Caskey (Science 236:1223-1228, 1989) and by Landegren et al (Science 242:229-237, 1989).
Other mutation scanning techniques appropriate for detecting unknown mutations within amplicons derived from DNA or cDNA could also be performed. These techniques include direct sequencing (without sequencing), single-strand conformational polymorphism analysis (SSCP) (for instance, see Hongyo et al, Nucleic Acids Res. 21 :3637-3642, 1993), chemical cleavage (including HOT cleavage) (Bateman et al, Am. J. Med. Genet. 45:233-240, 1993; reviewed in Ellis et al, Hum. Mutat. 11 :345-353, 1998), denaturing gradient gel electrophoresis (DGGE), ligation amplification mismatch protection (LAMP), and enzymatic mutation scanning (Taylor and Deeble, Genet. Anal. 14:181-186, 1999), followed by direct sequencing of amplicons with putative sequence variations. If studies of ABCA13 genes/coding sequences isolated from biological samples reveal particular mutations, genomic amplifications, or deletions, which occur at a high frequency within a population of individuals, DNA diagnostic methods can be designed to specifically detect the most common, or most closely disease-linked, ABCA13 defects. The detection of specific DNA mutations may be achieved by methods such as hybridization using allele specific oligonucleotides (ASOs) (Wallace etal, CSHL Symp. Quant. Biol. 51:257-261, 1986), direct DNA sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988), the use of restriction enzymes (Flavell et al, Cell 15:25-41, 1978; Geever et al, 1981), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, Cold Spring Harbor Symp. Quant. Biol. 51 :275-284, 1986), RNase protection (Myers et al, Science 230:1242-1246, 1985), chemical cleavage (Cotton et al, Proc. Natl. Acad. Sci. USA 85:4397-4401, 1985), and the ligase-mediated detection procedure (Landegren et al, Science 241:1077-1080, 1988). Oligonucleotides specific to normal or mutant sequences are chemically synthesized using commercially available machines. These oligonucleotides are optionally labeled radioactively with isotopes (such as 32P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl. Acad. Sci. USA 78:6633-6657, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis. These specific sequences are visualized by methods such as autoradiography or fluorometric (Landegren et al, Science 242:229-237, 1989) or colorimetric reactions (Gebeyehu et al, Nucleic Acids Res. 15:4513-4534, 1987). Using an ASO specific for a normal allele, the absence of hybridization would indicate a mutation in the particular region ofthe gene, or deleted ABCAl 3 gene. In contrast, if an ASO specific for a mutant allele hybridizes to a clinical sample, this would indicate the presence of a mutation in the region defined by the ASO.
Sequence differences between normal and mutant forms ofthe ABCA13 gene may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc. Natl. Acad. Sci. USA 81:1991-1995, 1988). Cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with nucleic acid amplification, e.g. , PCR (Wrichnik et al, Nucleic Acids Res. 15 :529-542, 1987; Wong et al, Nature 330:384-386, 1987; Stoflet et al, Science 239:491-494, 1988). In this approach, a sequencing primer that lies within the amplified sequence is used with double-stranded PCR product or single-stranded template generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags.
Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or may eliminate existing restriction sites. Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization (Southern, J. Mol Biol 98:503-517, 1975). DNA fragments carrying the restriction site (either normal or mutant) are detected by their reduction in size or increase in corresponding restriction fragment numbers. Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme; fragments of different sizes are then visualized under UV light in the presence of ethidium bromide after gel electrophoresis.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing reagent. Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8 % non-denaturing polyacrylamide gel (WO 91/10734; Nagamine et al, Am. J. Hum. Genet. 45:337- 339, 1989). DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al, Science 230:1242-1246, 1985). Alternatively, a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR. For example, an invariant primer could be used in addition to a primer specific for a mutation. The PCR products ofthe normal and mutant genes can then be differentially detected in acrylamide gels. Another method, single-strand conformation polymorphism (SSCP), is based on the fact that a single- base substitution alters the conformation of single-stranded DNA under non-denaturing conditions.
Altered conformation affects the migration velocity of single-stranded DNA, which is detected as shifted or new bands on a non-denaturing gel. The mutations underlying the shifted or new bands are then characterized by sequencing.
In addition to conventional gel-electrophoresis and blot-hybridization methods, DNA fragments may also be visualized by methods in which the individual DNA samples are not immobilized on membranes. The probe and target sequences may be both in solution, or the probe sequence may be immobilized (Saiki et al, Proc. Nat. Acad. Sci. USA 86: 6230-6234, 1989). A variety of detection methods, such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of scintillant), spectrophotometry involving calorigenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes. - If multiple mutations are encountered frequently in the ABCA 13 gene, a system capable of detecting such multiple mutations likely will be desirable. For example, a nucleic acid amplification reaction with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al, Nucl Acids Res. 16:1141-1155, 1988). The procedure may involve immobilized sequence-specific oligonucleotide probes (Saiki et al, Proc. Nat. Acad. Sci. USA 86:6230-6234, 1989).
Expression levels ofthe ABCA13 gene can also be determined by methods such as Northern or Southern blot analysis using labeled oligonucleotides specific to normal or mutant sequences. These oligonucleotides are labeled radioactively with isotopes (such as 32P) or non-radioactively, with tags such as biotin (Ward and Langer, Proc. Natl. Acad. Sci. USA 78: 6633-6657, 1981), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis. Quantitative or semi-quantitative PCR can also be used to measure the amount of ABCA13 cDNA in a sample using ABCA13 oligonucleotide primers. Visualization methods such as autoradiography or fluorometric (Landegren et al, Science 242: 229- 237, 1989) or colorimetric reactions (Gebeyehu et al, Nucleic Acids Res. 15: 4513-4534, 1987) can be used to detect a signal and the signals quantitated using, for instance, a spectrophotometer, a scintillation counter, a densitometer or a Phosphorimager (Amersham Biosciences). The Phosphorimager is able to analyze both DNA and protein samples from blots and gels using autoradiographic, direct fluorescence or chemifluorescence detection. Because the Phosphorimager is more sensitive than ordinary x-ray film, exposure times can be reduced up to ten-fold and signal quantitation of both weak and strong signals on the same blot is possible. Images can be visualized and evaluated with the aid of computer programs such as ImageQuant™.
XII. Qualitative and Quantitative Detection ofABCA13 Protein The ABCAl 3 isoform sequence information presented herein is useful in detecting the presence or absence of ABCAl 3 in cultured cells or primary cells. Quantitative and qualitative methods of detection of proteins are well-known in the art, and are discussed herein. Quantitative detection is useful for diagnosing over- or underexpression of ABCA13 proteins in a subject, while qualitative information gives, for example, information regarding tissue types in which ABCAl 3 isoforms may be expressed. For such qualitative or quantitative assessment, a biological sample of the subject, which biological sample contains either DNA or RNA derived from the subject, is assayed for the presence or absence of ABCA13. Suitable biological samples include samples containing genomic DNA or RNA obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material. Biological samples can be obtained from normal, healthy subjects or from subjects who are predisposed to or who are suffering from any one of a variety ofthe effects of transporter deficiencies such as, but not limited to, hypercholesterolemia, or defective transport of hydrophobic compounds such as lipids, sterols or fatty acids.
Antibodies can be used to assess the presence or absence of ABCA13 proteins in cultured cells or primary cells. The determination whether an antibody specifically detects ABCAl 3 proteins is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al, In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989).
In one embodiment, it is determined whether a given antibody preparation (such as one produced in a mouse) specifically detects ABCAl 3 proteins by Western blotting. In one specific, non-limiting embodiment total cellular protein is extracted from human cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel.
In another embodiment, the cellular protein is extracted from a biological sample. The proteins are then transferred to a membrane (for example, nitrocellulose or PVDF) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of (by way of example) an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase. Application of an alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immunolocalized alkaline phosphatase. Antibodies that specifically detect ABCA13 proteins will, by this technique, be shown to bind to ABCA13 protein bands (which will be localized at a given position on the gel determined by its molecular weight, the full-length isoform of which is approximately 28 kDa based on its deduced amino acid sequence). Non-specific binding ofthe antibody to other proteins may occur and may be detectable as a weak signal on the Western blot. The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody- ABCA13 protein binding.
In one embodiment, substantially pure ABCA 13 protein suitable for use as an immunogen is isolated from the transfected cells as described above. In one specific, non-limiting embodiment the concentration of protein in the final preparation is adjusted, for example, by concentration on an
Amicon (Millipore, Bedford, Massachusetts) or similar filter device, to the level of a few micrograms per milliliter.
In other embodiments, antibodies against ABCA13 proteins are used to localize ABCA13 to specific cell types or to specific subcellular locations in immunohistochemical or immunofluorescence assays. In one embodiment, the cells are selected from a variety of cell lines. In other embodiments, primary cells are isolated from a subject and are maintained in culture or the sample is sectioned and the sections are prepared directly for immunohistochemistry or immunofluorescence. In one specific, non-limiting embodiment, the cells are fixed, incubated in a blocking medium, incubated with the antibody directed against ABCA13 followed by a second incubation with a secondary antibody that is conjugated to a fluorescent probe or a colorimetric agent. Cells that express an ABCAl 3 protein that is recognized by the antibody exhibit a color or are fluorescent when viewed under a light or fluorescence microscope, respectively.
An alternative method of diagnosing ABCA13 gene deletion, amplification, or mutation is to quantitate the level of ABCA13 protein in the cells of a subject. In one embodiment, this diagnostic tool would be useful for detecting reduced levels of ABCAl 3 protein that result from, for example, mutations in the promoter regions ofthe ABCAl 3 gene or mutations within the coding region ofthe gene that produce truncated, non-functional or unstable polypeptides, as well as from deletions ofthe entire ABCAl 3 gene. In another embodiment, duplications ofthe ABCAl 3 gene may be detected as an increase in the expression level of this protein. The determination of reduced or increased ABCAl 3 protein levels would be an alternative or supplemental approach to the direct determination of ABCAl 3 deletion, duplication or mutation status, for instance by the methods described herein.
The availability of antibodies specific to ABCAl 3 proteins will facilitate the quantitation of cellular ABCA13 proteins by one of a number of immunoassay methods, which are well known in the art and are presented herein and in, for instance, Harlow and Lane (Antibodies, A Laboratory Manual, CSHL, New York, 1988). Many techniques are commonly known in the art for the detection and quantification of antigen. In one specific, non-limiting embodiment, the purified antigen will be bound to a substrate, the antibody ofthe sample will bind via its Fab portion to this antigen, the substrate will then be washed and a second, labeled antibody will then be added, which will bind to the Fc portion ofthe antibody that is the subject ofthe assay. The second, labeled antibody will be species specific, i.e., if the serum is from a rabbit, the second, labeled antibody will be anti-rabbit-IgG antibody. The specimen will then be washed and the amount ofthe second, labeled antibody that has been bound will be detected and quantified by standard methods.
Examples of methods for the detection of antibodies in biological samples, including methods employing dip strips or other immobilized assay devices, are disclosed for instance in the following patents: U.S. Patents No. 5,965,356 (Herpes simplex virus type specific seroassay); 6,114,179 (Method and test kit for detection of antigens and/or antibodies); 6,077,681 (Diagnosis of motor neuropathy by detection of antibodies); 6,057,097 (Marker for pathologies comprising an autoimmune reaction and/or for inflammatory diseases); and 5,552,285 (Immunoassay methods, compositions and kits for antibodies to oxidized DNA bases).
For the purposes of quantitating the ABCAl 3 protein, a biological sample ofthe subject, which sample includes cellular proteins, can be used. Such a biological sample may be obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, amniocentesis samples, surgical specimens and autopsy material. Biological samples can be obtained from normal, healthy subjects or from subjects who are predisposed to or who are already suffering from any one of a variety of transporter deficiencies, such as, but not limited to, defective transport of cholesterol, fatty acids, or lipids, or the effects of defective steroid hormones derived from the cholesterol of individuals with mutant ABCAl 3.
Quantitation of ABCAl 3 protein can be achieved for instance by immunoassay and compared to levels ofthe protein found in healthy cells (e.g., cells from a subject known not to suffer from a transporter deficiency). In one embodiment, a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50%o or more) reduction in the amount of ABCAl 3 protein in the cells of a subject compared to the amount of ABCAl 3 protein found in normal human cells would be taken as an indication that the subject may have deletions or mutations in the ABCAl 3 locus, whereas in another embodiment, a significant (e.g., 10% or greater, for instance, 20%, 25%, 30%, 50% or more) increase would indicate that a duplication or enhancing mutation had occurred.
XIII. ABCA13 Knockout and Overexpression Transgenic Animals
Mutant organisms that under-express or over-express ABCA 13 proteins are useful for research. Such mutants allow insight into the physiological and/or pathological role of ABCA13 in a healthy and/or pathological organism via study using a mutant model system (e.g., a transgenic ABCA 13 knockout mouse). These mutants are "genetically engineered," meaning that information in the form of nucleotides has been transferred into the mutant's genome at a location, or in a combination, in which it would not normally exist. Nucleotides transferred in this way are said to be "non-native." In one embodiment, a non-ABCA13 promoter inserted upstream of a native ABCAl 3 gene would be non-native. In other embodiments, an extra copy of an ABCAl 3 gene or other encoding sequence on a plasmid, transfected into a cell, would be non-native, whether that extra copy was ABCAl 3 derived from the same, or a different species.
Mutants may be, for example, produced from mammals, such as mice, that either over- express or under-express ABCAl 3 protein, or that do not express ABCAl 3 at all. In one embodiment, over-expression mutants are made by increasing the number of -4£IG4/3-encoding sequences (such as genes) in the organism. In other embodiments, over-expression mutants are made by introducing an ABCAl 3-encod g sequence into the organism under the control of a constitutive or inducible or viral promoter such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter or the metallothionein promoter. In yet other embodiments, mutants that under-express ABCAl 3 may be made by using an inducible or repressible promoter, or by deleting the ABCAl 3 gene, or by destroying or limiting the function ofthe ABCAl 3 gene, for instance by disrupting the gene by transposon insertion. In another embodiment, antisense genes may be engineered into the organism, under a constitutive or inducible promoter, to decrease or prevent ABCAl 3 expression, as discussed above.
A gene is "functionally deleted" when genetic engineering has been used to negate or reduce gene expression to negligible levels. When a mutant is referred to in this application as having the ABCAl 3 gene altered or functionally deleted, this refers to the ABCAl 3 gene and to any ortholog of this gene. When a mutant is referred to as having "more than the normal copy number" of a gene, this means that it has more than the usual number of genes found in the wild-type organism, e.g., in the diploid mouse or human.
In one embodiment, a mutant mouse over-expressing ABCAl 3 may be made by constructing a plasmid having the ABCA 13 gene driven by a promoter, such as the mouse mammary tumor virus (MMTV) promoter or the whey acidic protein (WAP) promoter. In one specific, non- limiting embodiment, this plasmid may be introduced into mouse oocytes by microinjection. The oocytes are implanted into pseudopregnant females, and the litters are assayed for insertion ofthe transgene. Multiple strains containing the transgene are then available for study.
WAP is quite specific for mammary gland expression during lactation, and MMTV is expressed in a variety of tissues including mammary gland, salivary gland and lymphoid tissues. In other embodiments, other promoters might be used to achieve various patterns of expression, e.g., the metallothionein promoter.
In another embodiment, an inducible system may be created in which the subject expression construct is driven by a promoter regulated by an agent that can be fed to the mouse, such as tetracycline. Such techniques are well known in the art.
In yet another embodiment, a mutant knockout animal (e.g., mouse) from which the ABCA 13 gene is deleted or otherwise disabled can be made by removing coding regions ofthe ABCAl 3 gene from embryonic stem cells. The methods of creating deletion mutations by using a targeting vector have been described (see, for instance, Thomas and Capecch, Cell 51: 503-512, 1987).
In one embodiment, knockout mice are used as hosts to test the effects of various ABCA13 constructs on cell growth. In other embodiments, transgenic mice with the endogenous ABCA 13 gene knocked-out can be used in an assay to screen for compounds that modulate the ABCAl 3 activity. A transgenic mouse that is heterozygous or homozygous for integrated transgenes that have functionally disrupted the endogenous ABCAl 3 gene can be used as a sensitive in vivo screening assay for the ABCA13 ligands and modulators of ABCA13 activity. XIV. Nucleic Acid-Based ABCA13 Therapy
Medical genetic approaches for combating ABCA13-mediated defects in subjects, such as a transporter deficiency, are now made possible.
In one embodiment, retroviruses are a preferred vector for experiments in medical genetics, as they yield a high efficiency of infection and stable integration and expression (Orkin et al, Prog. Med. Genet. 7:130-142, 1988). In one specific, non-limiting embodiment, the full-length ABCA 13 gene or cDNA can be cloned into a retroviral vector and driven from either its endogenous promoter or, for instance, from the retroviral LTR (long terminal repeat). In other embodiments, viral transfection systems may also be utilized for this type of approach, including adenovirus, adeno- associated virus (AAV) (McLaughlin et al, J. Virol. 62:1963-1973, 1988), Vaccinia virus (Moss et al, Annu. Rev. Immunol. 5:305-324, 1987), Bovine Papilloma virus (Rasmussen et al, Methods Enzymol. 139:642-654, 1987) or members ofthe herpesvirus group such as Epstein-Barr virus (Margolskee et β/., Mol. Cell Biol 8:2837-2847, 1988).
Medical genetic techniques include the use of RNA-DNA hybrid oligonucleotides, as described by Cole-Strauss, et al. (Science 273:1386-1389, 1996). This technique may allow for site- specific integration of cloned sequences, thereby permitting accurately targeted gene replacement.
In addition to delivery of ABCA13 to cells using viral vectors, it is possible to use non- infectious methods of delivery. In one embodiment, lipidic and liposome-mediated gene delivery will be used for transfection of various genes (for reviews, see Templeton and Lasic, Mol Biotechnol 11:175-180, 1999; Lee and Huang, Crit. Rev. Ther. Drug Carrier Syst. 14:173-206; and Cooper, Semin. Oncol 23:172-187, 1996). In another embodiment, cationic liposomes will be used as a viable alternative to the viral vectors (de Lima et al, Mol. Membr. Biol 16:103-109, 1999). In yet other embodiments, cationic liposomes can be targeted to specific cells through the inclusion of, for instance, monoclonal antibodies or other appropriate targeting ligands (Kao et l, Cancer Gene Ther. 3:250-256, 1996).
XV. Kits
Kits are provided which contain the necessary reagents for determining ABCA 13 gene copy number, for determining altered expression of ABCA13 mRNA or ABCA13 protein, or for detecting polymorphisms in ABCAl 3 alleles. Instructions provided in the diagnostic kits can include calibration curves, diagrams, illustrations, or charts or the like to compare with the determined (e.g., experimentally measured) values or other results.
Kits are also provided that contain cells that serve as either positive or negative controls. These control cells can be compared to experimental samples containing similar cells, for instance cells of unknown gene activity, mutational state, protein expression level, and so forth.
A. Kits for Detection of ABC A13 Genomic Sequences
The nucleotide sequences disclosed herein, and fragments thereof, can be supplied in the form of a kit for use in detection of ABCA13 genomic sequences, for instance in order to diagnose a deficiency in transporter activity. In one embodiment of such a kit, an appropriate amount of one or more ofthe -4.δC47.?-specific oligonucleotide primers is provided in one or more containers. In other embodiments, the oligonucleotide primers may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance. The container(s) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles. In other embodiments, pairs of primers may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers. In one specific, non-limiting embodiment, the sample to be tested for the presence of ABCAl 3 genomic amplification can be added to the individual tubes and in vitro amplification carried out directly.
The amount of each oligonucleotide primer supplied in the kit can be any appropriate amount, depending for instance on the market to which the product is directed. In one embodiment, the kit is adapted for research or clinical use and the amount of each oligonucleotide primer provided is an amount sufficient to prime several in vitro amplification reactions. Those of ordinary skill in the art know the amount of oligonucleotide primer that is appropriate for use in a single amplification reaction. General guidelines may for instance be found in Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990), Sambrook etal. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989), and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). In one embodiment, a kit may include more than two primers, in order to facilitate the PCR in vitro amplification of ABCAl 3 sequences, for instance the ABCAl 3 gene, specific exon(s) or other portions ofthe gene, or the 5' or 3' flanking region thereof.
In some embodiments, kits may also include the reagents necessary to carry out PCR in vitro amplification reactions, including, for instance, DNA sample preparation reagents, appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Instructions may also be included.
In other embodiments, kits may include either labeled or unlabeled oligonucleotide probes for use in detection ofthe in vitro amplified ABCA13 sequences. In one specific, non-limiting embodiment, the appropriate sequences for such a probe will be any sequence that falls between the annealing sites ofthe two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the in vitro amplification reaction.
In yet another embodiment, the kit provides one or more control sequences for use in the amplification reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art. B. Kits for Detection o/ΑBCA13 mRNA Expression
Kits similar to those disclosed above for the detection of ABCAl 3 genomic sequences can be used to detect ABCA 13 mRNA expression levels. One embodiment of such a kit may include an appropriate amount of one or more ofthe oligonucleotide primers for use in reverse transcription amplification reactions, similarly to those provided above, with art-obvious modifications for use with RNA.
In some embodiments, kits for detection of ABCA 13 mRNA expression levels may also include the reagents necessary to carry out RT-PCR in vitro amplification reactions, including, for instance, RNA sample preparation reagents (including e.g., an RNAse inhibitor), appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs). Instructions also may be included.
In other embodiments, kits may include either labeled or unlabeled oligonucleotide probes for use in detection ofthe in vitro amplified target sequences. In one specific, non-limiting embodiment, the. appropriate sequences for such a probe will be any sequence that falls between the annealing sites ofthe two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the PCR reaction.
In another embodiment, the kit provides one or more control sequences for use in the RT- PCR reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
In yet other embodiments, kits may be provided with the necessary reagents to carry out quantitative or semi-quantitative Northern analysis of ABCA 13 mRNA. Such kits include, for instance, at least one ABCA 13-specιfιc oligonucleotide for use as a probe. This oligonucleotide may be labeled in any conventional way, including with a selected radioactive isotope, enzyme substrate, co-factor, ligand, chemiluminescent or fluorescent agent, hapten, or enzyme. C. Kits for Detection of ABCAl 3 Protein or Peptide Expression In some embodiments, kits for the detection of ABCAl 3 protein expression include for instance at least one target protein specific binding agent (e.g., a polyclonal or monoclonal antibody or antibody fragment) and may include at least one control. In another embodiment, the ABCA 13 protein specific binding agent and control may be contained in separate containers. In other embodiments, the kits may also include means for detecting ABCA13:agent complexes, for instance the agent may be detectably labeled. If the detectable agent is not labeled, it may be detected by second antibodies, or protein A for example, which may also be provided in some kits in one or more separate containers. Such techniques are well known. In another embodiment, the kits include instructions for carrying out the assay. Instructions will allow the tester to determine whether ABCA 13 expression levels are altered, for instance in comparison to a control sample. In other embodiments, reaction vessels and auxiliary reagents such as cells, chromogens, buffers, media, enzymes, etc. also may be included in the kits.
In one specific, non-limiting embodiment, an effective and convenient immunoassay kit such as an enzyme-linked immunosorbant assay can be constructed to test anti-ABCA13 antibody in human serum, as reported for detection of non-specific anti-ovarian antibodies (Wheatcroft et al, Clin. Exp. Immunol 96:122-128, 1994; Wheatcroft et al, Hum. Reprod. 12:2617-2622, 1997). In one embodiment, expression vectors can be constructed using the human ABCAl 3 cDNA to produce the recombinant human ABCAl 3 protein in either bacteria or baculovirus (as described herein). In another embodiment, affinity purification is used to generate unlimited amounts of pure recombinant ABCA 13 protein.
In one embodiment, an assay kit could provide the recombinant protein as an antigen and enzyme-conjugated goat anti-human IgG as a second antibody as well as the enzymatic substrates. Such kits can be used to test if the sera from a subject contain antibodies against human ABCA13. D. Kits for Detection of Homozygous versus Heterozygous Allelism Also provided are kits that allow differentiation between individuals who are homozygous versus heterozygous for a polymorphism of ABCAl 3. In one embodiment such kits provide the materials necessary to perform oligonucleotide ligation assays (OLA), for instance as described at Nickerson et al. (Proc. Natl. Acad. Sci. USA 87:8923-8927, 1990). In specific embodiments, these kits contain one or more microtiter plate assays, designed to detect allelism in the ABCAl 3 sequence of a subject, as described herein.
In one embodiment, additional components in some of these kits may include instructions for carrying out the assay. Instructions will allow the tester to determine whether an ABCAl 3 allele is homozygous or heterozygous. In other embodiments, reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits.
In another embodiment, the kit may provide one or more control sequences for use in the OLA reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art. E. Kits for Identifying Modulators of ABCA 13 activity
Also provided are kits that permit the identification of modulators of ABCA13 activity. In one embodiment, such kits provide the materials necessary to assess the activity of ABCA13 in vitro. In one embodiment, this kit contains aliquots of isolated ABCAl 3 and cultured cells. In another embodiment, the kit contains cell lines that express either wildtype or mutant ABCA13. In yet another embodiment, additional components in some of these kits may include instructions for carrying out the assay. In other embodiments, reaction vessels and auxiliary reagents such as chromogens, buffers, media, enzymes, etc. may also be included in the kits.
The disclosure is illustrated by the following non-limiting Examples.
Example 1 Identification of human ABCA13 in genomic databases.
This example provides a description ofthe methods by which the ABCAl 3 genomic sequence was first identified.
EST/ eenomic and protein database searches
To identify new ABCA subfamily genes, public and commercial databases were screening with conserved domains identified from alignments ofthe known ABC genes, and a putative new gene sequence was identified. After a first round of 5' elongation of this fragment a 1296 bp sequence was obtained. The human bacterial artificial chromosome (BAG) clones AC095039, AC021250, AC073424, AC073927, AC011635 were found to be overlapping and to contain exons of a putative ABC gene with a high degree of similarity with other ABCA subfamily transporters. After several rounds of exon prediction and alignment, the complete cDNA sequence was obtained by RT- PCR using primers specific for the gene (see Example 5, below). Sequence analysis of this PCR product revealed that the two NBDs are separated by a putative transmembrane domain. Additional 5' and 3' RACE reactions on human lung cDNA using primers specific to the new cDNA sequence led to the identification of a full-length cDNA, and several isoforms, which we named ABCAl 3. Expressed sequence tags (EST) of ABCAl -like genes as described by Allikmets et al. (Hum.
Mol. Genet. 5: 1649-1655, 1996) were used to search Genbank and UniGene nucleotide sequence databases using BLAST2 (Altschul et al, Nucleic Acids Res., 25: 3389-3402, 1997). The main protein sequences databases screened were GenBank, Incyte, Swissprot, TrEMBL, Genpept and PIR.
Sequence analysis
The genomic DNA analysis was performed by combination of several gene-finding programs such as GENSCAN (Burge and Karlin J. Mol. Biol 268(1): 78-94, 1997), FGENEH/FEXH (Solovyev and Salamov ISMB 5: 294-302, 1997), and XPOUND (Thomas and Skolnick J. Math. Appl. Med. Biol. 11(1): 1-16, 1994). The combination of different tools yield increased sensitivity and specificity. The second step in the genomic DNA analysis was homology searching in the EST and protein databases. Combination of software performing database searching and software for exon/intron prediction gave the most sensitive and specific results. Sequence assembly and analysis were performed using the Genetics Computer Group (GCG) sequence analysis software package, Autoassembler software (ABI Prism, Perkin Elmer Applied Biosystems, Palo Alto, CA), and the LFASTA program (see Pearson and Lipman, Proc. Natl Acad. Sci. USA 85(8):2444-2448, 1988).
For phylogenetic analysis, ATP-binding domains defined by the Pfam signature ABCA tran (PF00005) were aligned using CLUSTALW (BCM Search Launcher, Baylor College of Medicine website). The phylogenetic tree was obtained using MEGA version 2.1 (Kumar et al, Bioinformatics 17(12): 1244-1245, 2001). The GenBank accession numbers ofthe ABCA proteins were: ABCAl, 095477; ABCA2, NP_001597; ABCA3, NP_001080; ABCA4, NP_000341; ABCA5, NP_061142; ABCA6, NP_525023; ABCA7, NP_061985; ABCA8, NP_009099; ABCA9, NP 25022; ABCAIO, NP_525021; ABCA12, NP_056472.
Multiple alignments were generated by GAP software from GCG package and the Dialign2 program (Morgenstern et al, Proc. Natl. Acad. Sci. USA 93(22): 12098-12103, 1996), the FASTA3 package (Pearson and Lipman, Proc. Natl. Acad. Sci USA 85(8): 2444-2448, 1988) and SIM4 (Florea et al, Genome Res. 8(9):967-974, 1998). The specific ABCA motifs used to search the databases were the TMN, TMC, NBF1 and NBF2 described in the literature (Broccardo et al, Biochim. Biophys. Acta 1461(2):395-404, 1999). This corresponds in ABCAl to residues 630-846 for the N terminal (TMN = exon 14-16) and from 1647-1877 for the C terminal set of membrane spanners (TMC = exon 36-40). The NBD corresponds to the extended nucleotide binding domain, i.e. in ABCAl it spans from amino acids 885-1152 for the N-terminal one (NBD1 = exon 18-22) and 1918-2132 for the C-terminal one (NBD2 = exon 42-47).
Expressed sequence tags (EST) of ABCAl-like genes (see Allikmets et al. Hum. Mol. Genet. 5: 1649-1655, 1996) were used to search the GenBank and UniGene nucleotide sequence databases using the BLAST 2 alignment computer program (see Altschul et al, Nucleic Acids Res. 25(17): 3389-3402, 1997). With the known ABCA specific amino acid sequences, four positional matrices based on the specific motif definitions described above were built. Each is specific for NBD1, NBD2, TMN, and TMC, respectively. With the help of these matrices, the major public protein databases (Swissprot, TrEMBL, Genpept and PIR) were screened, and significant hits were extracted.
Example 2 Prediction of ABCA13 Gene Structure. This example provides a description ofthe methods by which the ABCA13 genomic structure was predicted.
Gene structure analysis
Contigs were assembled from the following BAG clones: 0 AC073424 (gl 5321569) Homo sapiens chromosome 7 clone RPl 1-653017, complete sequence, 191141 bp in length; AC095039 (gl6974283) Homo sapiens chromosome 7 clone RPl 1-12G8, complete sequence, 70416 bp in length; AC073927 (gl3992793) Homo sapiens BAG clone RP11-604B16 from chromosome 7, complete sequence, 185676 bp in length; AC091770 (g 15638906) Homo sapiens BAC clone RPl 1- 655M5 from chromosome 7, complete sequence, 93543 bp in length. These contigs from 7pl2.3 were analyzed using the Affy Genes, Ensembl Genes, and Fgenesh++ Genes dropdown combo box on the 'dense' setting at the University of California at Santa Cruz web site.
Genomic DNA analysis was performed using several gene predictors such as Genscan, FGENEH, FEXH on fragment 15 from BAC AC073424/gil 19229 (Dec.2000). This prediction was combined using GENEWISE and PSI-BLAST algorithms and HMMER packages.
Physical mapping
The mouse Abcal3 gene was mapped using the T31 mouse/hamster radiation hybrid panel (Research Genetics). PCR was performed using primers Mal3F2, CAGCACCTCACAAATTGCCACC and Mal3R21, GCATGGGTAGGGTGCTGCCTG with Amplitaq Gold Taq polymerase. Samples were heated at 94°C for 10 minutes followed by 35 cycles at 94°C for 30 seconds, 65°C for 15 seconds, 72°C for 30 seconds, and extended at 72°C for 5 minutes. Reaction products were resolved on a 1.2% TAE agarose gel and data was submitted to The Jackson Laboratory Mouse Radiation Hybrid Database. Results
The ABCAl 3 gene is unusual in that the putative extracellular domain between the first and second predicted transmembrane segments is unusually large (about 3500 amino acids, 70% ofthe protein) and is encoded in part by two very large exons of 4.7 and 1.8 kb. ABCAl 3 is the only described gene encoding a large exon that encodes an extracellular domain.
The mouse ABCAl 3 gene contains two large exons of similar size to human ABCAl 3, which encode an amino acid sequence 54% identical and 69% similar to human ABCAl 3. These sequences have no recognizable homology to any known human proteins and contain no identifiable domains by MOTIF or PFAM searches.
Most eukaryotic exons are between 100-200 bp in length, and very few human exons are larger than 300 bp. There are a small number of human genes with large exons including TTN, BRCA1 and BRCA2. TTN, which encodes a long muscle filament protein titin, has the largest described exon at 17.1 kb (Labeit and Kolmerer, Science 270:293-296, 1995). BRCA1 and BRCA2 contain exons of 3.4 and 4.9 kb, respectively.
Example 3 Isolation of cDNA of Human ABCA13 Isoforms.
This example describes the isolation and identification of cDNA molecules encoding the full-length and additional isoforms ofthe human ABCA 13 protein.
Primers
Primers were designed using Oligo4 primer analysis software (Molecular Biology Insights, Cascade, CO) and ordered from Life Technologies, Invitrogen, Carlsbad, CA). The primers used to amplify regions of SEQ ID NO: 1 are listed in Table 7.
Table 7. Primers used to amplify regions of SEQ ID NO: 1
Figure imgf000055_0001
The primers used to amplify regions of SEQ ID NO: 18 are listed in Table 8.
Table 8. Primers used to amplify regions of SEQ ID NO: 18
The primers used to amplify regions of SEQ ID NO: 22 are listed in Table 9.
Table 9. Primers used to amplify regions of SEQ ID NO: 22
Figure imgf000056_0002
The primers used to amplify regions of SEQ ID NO: 24 are listed in Table 10. Table 10. Primers used to amplify regions of SEQ D3 NO: 24
Figure imgf000057_0001
The primers used to amplify regions of SEQ ID NO: 26 are listed in Table 11.
Table 11. Primers used to amplify regions of SEQ ID NO: 26
Figure imgf000057_0002
The primers used to amplify regions of SEQ ID NO: 28 are listed in Table 12.
Table 12. Primers used to amplify regions of SEQ ID NO: 28
Figure imgf000058_0001
5 ' and 3 ' Rapid Amplification ofcDNA Ends (RACE)
To determine the 5' or 3' ends of the.4.BG4/3 mRNA, 5' and 3' rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA amplification kit from Clontech (Palo Alto, CA). For 5' RACE amplification, ABCA13 specific primers Ll (SEQ ID NO: 42) and L2 (SEQ ID NO: 43) were used to perform the first amplification on human lung polyA+ RNA (Clontech, Palo Alto, CA). A second, specific RACE amplification was performed with nested primers L7 (SEQ ID NO: 44) and L8 (SEQ ID NO: 45). Two others 5' RACE were carried out with specific primers L19 (SEQ ID NO: 46), L21 (SEQ ID NO: 47) and L20n (SEQ ID NO: 3), L22 (SEQ ID NO: 4) respectively. 3' RACE amplification was carried out similarly with U17 (SEQ ID NO: 48) as the first amplification primer, and U18 (SEQ ID NO: 8) as nested primer. The 5' and 3' RACE products were cloned, and the amplified products were analyzed by agarose gel electrophoresis, purified on Sephadex PI 00 columns and sequenced as described below.
Additional 5' and 3' RACE on human lung cDNA using primers specific to the new cDNA sequence led to the identification of a full-length cDNA, which was named ABCAl 3.
As shown in Figure 1, the principal transcript ofthe ABCA13 gene is 17209 base pairs long with an open reading frame of 15195 base pairs (FIG. 1A and IB), corresponding to 5058 amino acids (FIG. IC and ID). The predicted amino acid sequence ofthe protein is provided as SEQ ID NO: 2. Analysis ofthe ABCA13 predicted protein disclosed features that are typical of an ABCA transporter. These include twelve predicted transmembrane domains, with two large extracellular domains and two nucleotide binding fold domains (NBD1 and NBD2) (see Figure 4). The position of the conserved nucleotide binding folds as well as that ofthe predicted transmembrane domains, are indicated in the Table 13. Each of these conserved regions is composed of hydrophobic segments. Table 13. Genomic structure of the human ABCA13 gene.
Exon Intron
Position on
Exon Splice acceptor size Splice donor size cDNA
1 1-94 94 CAGGAACCCG gtgagtgctt n.d.
2 95-188 aattttctag GTCCTTTTCC 94 AGAGACATTT gtaagtttca n.d.
3 189-312 ctatttctag GTTATTTGCA 124 ATCATTTTCG gtaagagaaa 20.9
4 313-464 ctgtttaaag TTTGTCTAGG 152 AACACTCCAG gcaagtaaac 1.8
5 465-493 tttattatag ATTCTTCTTA 29 TTTTTTTACA gtaagtatct 5.9
6 494-657 ttcccatcag ATGGATCTCA 164 CCATTTTGAA gtgagtgaaa 2.4
7 658-788 ttggttctag TTCCTTAATA 131 GCAGTCACCG gtatgggtgc 4.1
8 789-922 attccaacag AGCCAGTTTA 134 ACTGAAGGAG gtacacatgc 5.1
9 923-1087 ttgttgtcag ATTCCCACAG 135 CTACCAACAG gtgctgtccc 1.5
10 1088-1287 gaatttgtag GTGTTTGTTC 200 TTCCAAAGAT gtaagtcgca 3.5
11 1288-1415 ttgccctcag ATTACAGCAT 128 TTTGTCCAAG gtaagctagc 0.8
12 1415-1516 tactttgcag AAGTCCTCAT 101 GCTGAAACAG gtaaagcaca 0.3
13 1517-1684 aatcttttag ATGTTGGCGA 168 AGAGGATGCT gtaagtattc 2.2
14 1685-1890 tcttgttaag GATCGTATTT 206 TCTCCACAGT gtaagtacat 0.8
15 1891-2030 ttgattgcag GATATTTCAT 140 AGACTATTGG gtaagtcagt 19.6
16 2031-2145 ttttatttag CTTTTCCTGA 115 CCATATCCAG gtaagttatc 2.7
17 2146-6924 aatattacag GGCTTTAAAT 4779 CAGAGATGAG gtgagtatac 1.5
18 6925-8751 atatttacag TTTTGTCCCA 1827 CAGATCAAAG gtaattaaaa 1.4
19 8752-8861 ttttgctaag TGTTGTTGAG 110 ATCGTTGCAG gtgggctgct 6.5
20 8862-8980 cctctggcag AAAACCCTTC 119 CCACTTCCAG gtttgtcgtc 7.6
21 8981-9144 tgttttctag GAAATTGAAA 164 ACTTGTACAT gtatgctctg 1.4
22 9145-9224 gccattttag GTTGGCCAAA 80 GTAACTGAGG gtaagtatgt 1.1
23 9225-9346 tactttgcag ATGTAAAAAT 122 CCACTCCAAG gtgtggtgct 11.5
24 9347-9541 tttgaaacag GTTCTCTTCA 195 CATTTACAAG gtatggagag 2.9
25 9542-9706 tgtcctttag ACTCTGATGC 165 CTTTCAACAG gtgtgtgttt 1.0
26 9707-9884 attttctcag GTTTCACAAA 178 GAAGATTCAA gtaagacagt 2.7
27 9885-10024 attgcaacag CACCGTTTTG 140 CATTCAAAAG gtaagttaaa 18.1
28 10025-10138 cattttgcag GCTAATTACA 114 CCAGCTGCAG gtgagtggtt 2.8
29 10139-10229 ttttctttag GAGGCCCTGA 91 CAGACATACG gtaagtgtgc 12.2
30 10230-10406 ctttcctcag GAGGGCTGCT 177 TTCTTGGCCA gtaagtactc 1.4
31 10407-10713 ctgccactag GTATCATTTT 307 CCAGCGACCT gtgagtagcc 15.3
32 10714-10828 ccccttacag ATTCCTGAAC 115 GATAGAAGAG gtaaatatcc 4.3
33 10829-11158 tttttggtag TATATGCGGA 330 GACATTTCTG gtaagtaagt 1.8
34 11159-11228 ctgtgggcag TGCCTTCTTT 70 CAAGAGACAG gtaagagcat 2.0
35 , 11229-11360 ttcctgctag GGATTCAATG 132 TTGATTCCTG gtaagaattt 11.3 36 11361-11498 cattttttag GAACATTTGG 138 GACAATAAAG gtttgtaagg 1.1
37 11499-11679 tctctcacag GGTCATCACT 181 CCACTATCAT gtgggtccca 2.7
38 11680-11898 tctctggcag ATCCATGTTG 219 AAGTCAATCA gttagtaaac 11.5
39 11899-12095 ctaatttcag AACTCTTCAG 197 TACCGAGAAG gtaggcactg 6.6
40 12096-12253 ttggacccag GTCGTACGAT 158 CACGAGGCAG gtaaggagtg 1.7
41 12254-12484 ttatggatag CCTTCTGTTC 231 CTTAGAAGAG gtactgagaa 15.2
42 12485-12590 tctccgaaag GTGTTTTTGA 106 TCTGGCTACT gtaagtacag 27.2
43 12591-12840 cgtcctgcag GTGGCTCCCT 250 ACTTTTTCAG gtaagttgtt 11.7
44 12841-12930 tgaacagcag CAGTGGGGGC 90 ACCCACGCCA gtaagtgtca 4.5
45 12931-13000 tgttttttag GAAGAATTCT 70 TGGCTGCCTG gtaggtttct 9.4 Table 13 (cont.).
Figure imgf000060_0001
46 13001-13119 acaatttcag AAGTGTCCAA 119 AAAAACCAAG gtgtgttcaa 1.9
47 13120-13207 ttgttaacag GCTTGGAGGT 88 TCTGGCAAAG gtaatcatat 6.1
48 13208-13316 ctttttttag GTGTGGTATA 109 AGACAATACG gtaatgttat 17.0
49 13317-13371 tctttcacag GAATAACACT 55 AGGACAAGAT gtgagttgat 1.5
50 13372-13549 ccacccgcag CCTGGAGAGC 178 ATATGACATG gtaggatttg 3.0
51 13550-13665 atcttctcag CTCTTTTACT 116 CACTTTTCGG gtatgtgatg 5.5
52 13666-13822 tacttttcag ATATGCAACT 157 CAAAGCTAAG gtcagtagct 3.2
53 13823-14076 cactgtgcag AATTTACAGA 254 GATGGCCAAG gtgggttctg 3.9
54 14077-14269 atcttcccag GGGTCATTCT 193 AAAAGGAGAG gtaatgaagc 3.8
55 14270-14379 ttcctcttag TGCTTTGGAC 110 CTCCCATGGG gtaagataca 51.9
56 14380-14530 ctctctgcag AGACGCCGTG 151 CATCCCTGAG gtaaatctcc 6.8
57 14531-14665 tctcttccag GTTGCTGGAG 135 TCTTTTATTG gtgagtagaa 7.4
58 14666-14769 tttccttcag GATGAGCCCA 104 CCTCCCACAG gtgagttcca 20.5
59 14770-14862 ttctttacag CATGGAGGAG 93 TCAAAAATAG gtgcgttgaa 27.9
60 14863-14968 taactctcag GTTTGGTGAT 106 TCAGTTCAAG gtagtgctaa 1.2
61 14969-15106 ttgcttttag GGACAGCACC 138 TTTGGAGCAG gtatagtatc 0.7
62 15107- tttttttcag GTATTTATTA >2079 n.d.; not determined because ofthe gaps in the genomic sequence.
The ABCAl 3 gene is encoded by 62 exons and spans over 450 kb, making this the largest ABC gene described to date with the largest number of exons. The most unusual feature is the presence of two large exons of 4779 and 1827 bp (exons 17 and 18). All the remaining coding exons are less than 300 bp.
This principal transcript codes for a 5058 amino acid protein (SEQ ID NO: 2). However, five additional transcripts were characterized (Figure 1 A and IB). Transcript 2 is 12,498 bp long (SEQ ID NO: 18) and codes for a 2760 amino acid protein (SEQ ID NO: 19). Transcript 3 is 15,970 bp long (SEQ ID NO: 22) and encodes a 4958 amino acid protein (SEQ ID NO: 23). Transcript 4 is 11,259 bp long (SEQ ID NO: 24) and codes for a 2660 amino acid protein (SEQ ID NO: 25). Transcript 5 is 15,779 bp long (SEQ ID NO: 26) and encode a 4952 amino acid protein (SEQ ID NO: 27), and transcript 6 is 11,068 bp long (SEQ ID NO: 28) and its putative protein contains 2654 amino acids (SEQ ID NO: 29). These alternative transcripts result in the loss ofthe first transmembrane domain or in alternative C-termini, and can potentially encode functional transporters.
In the ORF coding for transcripts 2, 4 and 6, another putative protein of 717 amino acids is predicted (SEQ ID NO: 21), due to an internal alternative splicing ofthe 4779 bp exon (giving rise to the transcript shown in SEQ ID NO: 20). This putative protein may act as a regulatory factor for ABCAl 3 or other protein.
DNA Sequencing
The PCR product was subjected to DNA cycle sequencing after purification with the Microcon-100 microconcentrators (Amicon, Inc., Charlotte, NC). The sequences were obtained using the ABI Prism BigDye terminator cycle sequencing kit (Perkin Elmer Applied Biosystems, Palo Alto). Sequencing reactions were resolved on an ABI 377 DNA sequencer (Perkin Elmer Applied Biosystems, Palo Alto, USA) according to the manufacturer's instructions.
Results
The complete sequence ofthe human ABCAl 3 cDNA is shown in SEQ ID NO: 1.
Example 4 Reverse Transcriptase PCR (RT-PCR) Analysis of Human ABCA13 cDNA. This example provides a description of how human ABCA13 cDNA was procured and analyzed.
The complete cDNA sequence for human ABCAl 3 was obtained by RT-PCR using primers specific for the gene. cDNA templates for amplification were synthesized by reverse transcribing 500 ng of mRNA poly(A)+ (Clontech, Palo Alto, CA) using 200 units of reverse transcriptase Superscript II (Life Technologies, Invitrogen, Carlsbad, CA) with 500 ng of oligodT primer (Life Technologies, Invitrogen, Carlsbad, CA) The reactions were denatured at 70°C for 10 minutes, and 10 units of RNAsin (Life Technologies, Invitrogen, Carlsbad, CA) were added, followed by incubation for 45 minutes at 42°C.
PCR was performed with AmpliTaq Gold DNA polymerase (Perkin Elmer Applied Biosystems, Palo Alto, CA), using 50 ng of DNA or about 25 ng of cDNA. Reactions were carried out for 30 PCR cycles in a 9700 thermal cycler (Perkin Elmer Applied Biosystems, Palo Alto, CA) in 96-well microtiter plates. After an initial denaturation at 94°C for 10 minutes, each cycle consisted of a denaturation step of 30 seconds (94°C), a hybridization step of 30 seconds (64°C for 2 cycles, 61°C for 2 cycles, 58°C for 2 cycles and 55°C for 28 cycles), and an elongation step of 1 minute/kb (72°C). PCR was concluded with a final 72°C extension, which lasted 7 minutes.
Several primers have been designed to validate electronically predicted sequences or products of RACE. The initial fragment was validated using specific primers E (SEQ ID NO: 15) and F (SEQ ID NO: 49). The second partial sequence derived from analysis of a BAC fragment was analyzed with primers A (SEQ ID NO: 50) and B (SEQ ID NO: 13). The link with the initial fragment was confirmed with primers C (SEQ ID NO: 51), B and E. First RACE was validated with primers U3 (SEQ ID NO: 52), U5 (SEQ ID NO: 53), and Ll. Second 5' RACE was validated with primer U16 (SEQ ID NO: 7) used with B followed by nested PCR with E and B. Third 5' RACE was analyzed with primers U28 (SEQ ID NO: 9) and L20n, U36 (SEQ ID NO: 54) and L20n or L31 (SEQ ID NO: 5), U38 (SEQ ID NO: 55) and L31, U43 (SEQ ID NO: 11) and L41 (SEQ ID NO: 56).
The unique 3' RACE was validated with specific primers L33 (SEQ ID NO: 6), L34 (SEQ ID NO: 75), and L26 (SEQ ID NO: 73), all used with U18. PCR product was subjected to DNA cycle sequencing after purification with the Microcon- 100 microconcentrators (Amicon, Inc., Beverly). Sequences were obtained using the ABI Prism BigDye terminator cycle sequencing kit (Perkin Elmer Applied Biosystems, Palo Alto). Sequencing reactions were resolved on an ABI 377 DNA sequencer (Perkin Elmer Applied Biosystems, Palo Alto, USA). DNA sequences have been submitted to GenBank under accession # AY204751.
Sequence analysis of this PCR product revealed that the two putative NBDs are separated by a putative transmembrane domain. The order and sequence of these 3 putative protein motifs are indeed characteristic of an ABCA gene.
Example 5
Sequence Analysis of Human ABCA13 cDNA.
This example provides a description of how the ABCAl 3 sequence was analyzed.
Sequence assembly and analysis was performed using the Autoassembler software (ABI Prism, Perkin Elmer Applied Biosystems, Palo Alto, CA), the Genetics Computer Group (GCG)
(Accelrys Corp., San Diego, CA) sequence analysis software package (Devereux et al, Nucleic Acids Res. 12:387-395, 1984), and the LFASTA program package (see Pearson and Lipman, Proc. Natl Acad. Sci. U.S.A. 85(8): 2444-2448, 1988). The programs were operated using default parameters, and were used to assemble sequences and generate the consensus sequence of each isoform. Secondary structure ofthe proteins was predicted using the TMHMM on-line server provided by the Center for Biological Sequence Analysis (CBS), Lyngby, Denmark.
Example 6 Localization of ABCA13 to a Chromosome. This example provides a description of how the human and mouse ABCAl 3 genes were localized to their chromosomal locations.
The chromosomal localization of he human ABCAl 3 gene on chromosome 7 at 7pl2.3 was determined by PCR using primers E and F and T31 mouse/hamster radiation hybrid panel (Research Genetics) according to the manufacturer's protocol. Subsequently, the position of ABCAl 3 on the draft human map was determined using chromosomal assignment using somatic cell hybrids (CASH) (see Ryu et al, Mol Cells 10(5): 598-600, 2000).
Mouse Abcal3 was mapped to chromosome 11 between markers Dl lMit226 and DllMit259 using the T31 mouse/hamster radiation hybrid panel (Research Genetics, Huntsville, AL). PCR was performed using primers Mai 3F2 5 '-CAG CAC CTC ACA AAT TGC CAC C-3 ' (SEQ ID NO: 16) and Mal3R21 5'-GCA TGG GTA GGG TGC TGC CTG-3' (SEQ ID NO: 17) with Amplitaq Gold Taq polymerase. Samples were heated at 94°C for 10 minutes followed by 35 cycles at 94°C for 30 seconds, 65°C for 15 seconds, 72°C for 30 seconds, and a final extension at 72°C for 5 minutes. Reaction products were resolved on a 1.2% TAE agarose gel and data was submitted to online Jackson Laboratory Mouse Radiation Hybrid Database (Bar Harbor, Maine). When the assembled mouse genome was analyzed, a sequence closely related to human ABCAl 3 was found at mouse chromosome 11A1, a position syntenic with human chromosome 7ρl2.3. Further analysis revealed the presence of two large exons, similar to those found in the human ABCAl 3.
Example 7 Amino acid sequence comparison of ABC transporters.
This example provides a description of how the human ABCAl 3 homology and identity was determined with respect to other known ABCA proteins.
Comparison ofthe ABCAl 3 protein sequence to sequences of other known ABCA genes was performed by computer analysis searching. The results ofthe analysis are summarized in Table 14.
Figure imgf000063_0001
The overall similarities and identities of ABCA13 with ABCAl, ABCA4, ABCA7, and ABCA12 are 47/37%, 46/35%, 45/36% and 47/38%, respectively. These results indicate that ABCA13 shares the highest level of homology with ABCAl and ABCA12 among the ABCA subfamily members. Comparison of all known members ofthe ABCA subfamily reveals that the highest levels of sequence homology are found in their ATP binding domains (NBD1 and NBD2).
Although the region of highest identity with other ABCA proteins starts around amino acid 3070 of ABCA13, there is a short, 90-amino acid region at the very N-terminus, which shows a high degree of identity with the N-terminal regions of other ABCA proteins (Figure 3). In addition, this N- terminal region contains a putative transmembrane helix found in all ABCA proteins. The enlarged size of ABCA13 is therefore due to a large insertion into the putative extracellular domain after the first N-terminal membrane-spanning helix.
Example 8 Phylogenetic analysis of the relationship between the ABCA13 to other ABCA transporters. This example provides a description of how the evolutionary relationship between human ABCA13 and other ABCA transporters was determined. Phylogenetic analysis was performed using the ATP-binding domain, which is conserved across the species and in different subfamilies without large deletions or insertions (see Bodenmiller et al, DNA Seq. 13(2): 77-83, 2002). Analysis was conducted using both ATP-binding domains, as all twelve human ABCA subfamily members known to date contain two such domains.
Phylogenetic analysis indicated that ABCAl 3 belongs to the subgroup inside the A subfamily, which contains the best-characterized members of this subfamily, ABCAl (see Tanaka et al, Biochem. Biophys. Res. Commun. 25; 283(5): 1019-1025, 2001) and ABCA4 (see Bungert et al, J. Biol. Chem. 276(26): 23539-23546, 2001). The second subgroup includes five genes that form a tandem cluster at chromosome 17q24. When compared to other ABCA proteins, ABCA 13 has a short (about 90 amino acids) region of similarity at the N-terminus, and larger region of similarity starting from amino acid 3070. This suggests that the large size of ABCA13 is due to the large insertion between these positions at the first extracellular domain. A graphic representation ofthe phylogenetic analysis is shown in Figure 2.
Example 9 Reverse Transcription Analysis ofthe Expression Pattern of ABCA13. The profile of expression of ABCAl 3 polynucleotides can be determined using art-known techniques, such as PCR-coupled reverse transcription, which has been described for instance by Sambrook et al. (Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989). This example provides representative methods and results from various tissues.
By way of example, a pair of primers as described herein (e.g., SEQ ID NO: 3 through 15) may be synthesized and used to amplify a human ABCAl 3 cDNA (SEQ ID NO: 1). The expression pattern of ABCA 13 was examined in a variety of human tissues using RT-
PCR. The polymerase chain reaction (PCR) was carried out on commercially provided first-strand cDNA templates (CLONTECH) corresponding to retro-transcribed polyA+ mRNAs. Reverse transcription to cDNA was carried out with the enzyme SUPERSCRIPT II (GibcoBRL, Life Technologies) according to the conditions described by the manufacturer. The polymerase chain reaction was carried out according to standard conditions, in 20 μl of reaction mixture with 25 ng of cDNA preparation. The reaction mixture was composed of 400 μM of each ofthe dNTPs, 2 units of Thermus aquaticus (Taq) DNA polymerase (Ampli Taq Gold; Perkin Elmer), 0.5 μM of each primer, 2.5 mM MgCl , and PCR buffer. Thirty four PCR cycles [denaturing 30 seconds at 94°C, annealing of 30 seconds divided up as follows during the 34 cycles: 64°C (2 cycles), 61°C (2 cycles), 58°C (2 cycles), and 55°C (28 cycles), and an extension of one minute per kilobase at 72°C] were carried out after a first step of denaturing at 94°C for 10 minutes using a Perkin Elmer 9700 thermocycler. The PCR reactions were visualized on agarose gel by electrophoresis, and their relative level quantified. Using RT-PCR, the amount of ABCAl 3 isoforms was measured in various tissues. ABCAl 3 expression was found to be highest in human brain, lung, skeletal muscle and ovary. Thus like other ABCA subfamily genes, ABCA13 presents a restricted tissue distribution. The expression ofthe gene was also examined in a panel of tumor cell lines and was found to be expressed the highest in the SR leukemia, SNB-19 CNS tumor and DU-145 prostate tumor cell lines.
Example 10 Real-Time PCR Analysis ofthe Expression Pattern of ABCA13
The profile of expression of ABCA13 polynucleotides also can be determined using real-time PCR analysis. This example provides representative methods and results from various tissues and cell lines.
Real-time PCR
Real-time PCR (ABI Prism 7700 Sequence Detection System, Applied Biosystems, Foster City, CA) was used to determine the expression profiling ofthe different ABCA 13 transcripts, with β2-microglobulin as a standard reference gene, in commercial total RNA samples extracted from various tissues (Figure 5). Measured RNA levels were normalized to β2-microglobulin. One set of probe and primers was designed for each 3' end: Transcripts 1 and 2 Fwd : SEQ ID NO: 57;
Rev : SEQ ID NO: 58;
Probe (MGB) : SEQ ID NO: 59; Transcripts 3 and 4
Fwd : SEQ ID NO: 60; Rev : SEQ ID NO: 61;
Probe (MGB) : SEQ ID NO: 62; Transcripts 5 and 6
Fwd : SEQ ID NO: 63;
Rev : SEQ ID NO: 64; Probe (TAMRA) : SEQ ID NO: 65).
The probes were labeled at the 5' position with 6-carboxyfluorescein (6-FAM) reporter. The 3' end was coupled to a quencher, either 6-carboxytetramethyIrhodamine (TAMRA) or minor groove binder (MGB).
Reverse transcription of total RNAs was carried out in 5 to 10 different tubes after denaturation of nucleic acid at 65°C for 10 minutes. Two micrograms of denatured total RNA were added into 100 μl of reaction mix containing lx Taqman Buffer, 5.5 M MgCl2, 500 μM each dNTP, 2.5 μM random hexamers, 2.5 μM oligodT, 0.4 U/μl RNAse inhibitor, and 1.25 U/μl MultiScribeRTase. The thermal cycling conditions consisted of 25°C for 10 minutes, 42°C for 50 minutes, and 95°C for 5 minutes. The reaction products ofthe 5 to 10 tubes were pooled.
Real-time PCR was carried out under duplex conditions, using 10 μl of 1:10 diluted cDNA in a total volume of 35μl. The PCR reaction master mix contains lx Master Mix, 900 nM of each primer specific of selected ABCA13 transcript, 50 nM of each primer specific of β2-microglobulin transcript, and 200 nM of ABCA13 and β2-microglobulin probes. The thermal cycling conditions are 40 cycles of PCR amplification (UNG incubation: 50°C, 2 minutes; AmpliTaqGold activation: 95°C, 10 minutes; denaturation: 95°C, 15 seconds; annealing/extension: 60°C, 1 minute).
Real-time PCR analysis of mouse tissue and tumor cell line RNA cDNA was quantitated for expression of the ABCAl 3 gene in each of 60 tumor cell lines from the NCI tumor cell line screening panel (which includes the following cell lines: CCRF-CEM
(leukemia); HL-60(TB) (leukemia); K-562 (leukemia); MOLT-4 (leukemia); RPMI-8226 (leukemia);
SR (leukemia); A549/ATCC (non-small cell lung); EKVX (non-small cell lung); HOP-62 (non-small cell lung); HOP-92 (non-small cell lung); NCI-H226 (non-small cell lung); NCI-H23 (non-small cell lung); NCI-H322M (non-small cell lung); NCI-H460 (non-small cell lung); NCI-H522 (non-small cell lung); COLO 205 (colon); HCC-2998 (colon); HCT-116 (colon); HCT-15 (colon); HT29 (colon);
KM12 (colon); SW-620 (colon); SF-268 (CNS); SF-295 (CNS); SF-539 (CNS); SNB-19 (CNS);
SNB-75 (CNS); U251 (CNS); LOX IMVI (melanoma); MALME-3M (melanoma); Ml 4 (melanoma); SK-MEL-2 (melanoma); SK-MEL-28 (melanoma); SK-MEL-5 (melanoma); UACC-257
(melanoma); UACC-62 (melanoma); IGR-OV1 (ovarian); OVCAR-3 (ovarian); OVCAR-4 (ovarian);
OVCAR-5 (ovarian); OVCAR-8 (ovarian); SK-OV-3 (ovarian); 786-0 (renal); A498 (renal); ACHN
(renal); CAKI-1 (renal); RXF 393 (renal); SN12C (renal); TK-10 (renal); UO-31 (renal); PC-3
(prostate); DU-145 (prostate); MCF7 (breast); NCI/ADR-RES (breast); MDA-MB-231/ATCC (breast); HS 578T (breast); MDA-MB-435 (breast); MDA-N (breast); BT-549 (breast); and T-47D
(breast)).
Expression analyses of ABCAl 3 cDNA in these tumor cell lines was performed using a real time PCR assay on the ABI 7000 apparatus. A multiplex reaction was performed along with primers and probe for β-actin provided by the manufacturer (Applied Biosystems) as the endogenous control. ABCAl 3 mRNA was quantitated with primers -473CΛ73-TAQ-F (SEQ ID NO: 66), .473C.4 -TAQ-R
(SEQ ID NO: 67), and probe ABCAl 3-TAQ-V, fam-CTTGGGCAGCATCTTGGTCAATCTCTCT- tamra (SEQ ID NO: 68).
Expression of mouse Abcal3 was analyzed by PCR on the mouse multiple tissue cDNA panel (Clontech, Palo Alto, CA). Primers MmAbcal3JFl (SEQ ID NO: 69), and MmAbcal3_Rl (SEQ ID NO: 70) were used to amplify a 255 bp fragment spanning exons one, two and three that are encoding the first transmembrane helix. Primers MmAbcal3_F17 (SEQ ID NO: 71), and
MmAbcal3_R18 (SEQ ID NO: 72), were used to amplify a 381 bp fragment from exons 17 and 18.
Thirty cycles of PCR, each cycle consisting of denaturation at 94°C for 30 s, annealing at 58°C for 30 seconds and extension at 68°C for 1 minute, were carried out using Platinum Taq polymerase (Invitrogen, Carlsbad, CA) and buffer conditions suggested by the manufacturer.
Results The ABCAl 3 expression pattern was examined using real-time-PCR. One set of probe and primers was designed for each 3' end. Transcripts 1 and 2 were found to be highest in human trachea, testis, and bone marrow (Figure 5B). The same tissue profiling has been observed with a second probe. However, under these conditions, the four other transcripts were not detected in any of the tested tissues (i.e., no signal was detected before 35 cycles of real-time PCR). Although the cloning was performed using transcripts derived from lung, ABCAl 3 expression was not detected in lung. It is noted, however, that cloning was performed with cDNA derived from polyA÷ RNA, whereas the real-time-PCR experiments used cDNA derived from total RNA.
Initial database mining did not reveal any published EST corresponding to the ABCAl 3 gene. This analysis was repeated in 2002 and revealed a relatively low number of ESTs compared to the expected length ofthe gene transcripts. Almost all ofthe ESTs match with the 3'UTR ofthe major transcript (called Transcript 1) and therefore could not be used to differentiate the expression pattern ofthe other transcripts. Like other ABCA subfamily genes, ABCAl 3 presents a restricted tissue distribution.
The expression ofthe gene was also examined in a panel of tumor cell lines and was found to have the highest expression in the SR leukemia, SNB-19 CNS tumor, and DU-145 prostate tumor cell lines (Table 15).
Table 15. Expression of ABCA13 in tumor cell lines
CELL LINE TUMOR ABCA12 ABCA13
SR Leukemia 87
SNB-19 CNS 7.8 18
U251 CNS 13
SF-539 CNS 9.7
MCF7 Breast 43
T-47D Breast 29
COLO 205 Colon 13
CAKI-1 Renal 6.3
RXF 393 Renal 12
TK-10 Renal 7.8
DU-145 Prostate 28
The majority ofthe samples showed low expression level, and these samples were averaged to determine a background level of expression. Cell lines with at least 5-fold expression over background (an average ofthe sixty assayed) are shown. The expression ofthe closely related ABCA12 gene is shown for comparison. ABCA12 is also highly expressed in the SWB-19 cell line, but not in any ofthe others. To detect the expression of mouse Abcal3, PCR was performed on the panel of tissue- specific cDNAs with two pairs of primers (Figure 5B). One pair of primers was used to amplify the fragment from exons 1, 2 and 3 (which encode the first transmembrane segment ofthe N-terminal membrane-spanning domain). The second pair of primers was designed to amplify the fragment from large exons 17 and 18. Both reactions detected expression in kidney; using primers specific to exons 1 and 3, very weak signal was detected also in the skeletal muscle.
The public databases contain 12 ESTs matching predicted mouse Abcal3 cDNA. They derive only from two tissues: nine from kidney and three from retina. These data provide independent support to our observation that mouse Abcal3 is primarily expressed in kidney. Six ESTs are spliced and originate from regions that are different from those that were used in the research described herein. Six ESTs are unspliced and originate from the 3' end ofthe cDNA. Retina was not included in the current analysis.
The expression level of ABCAl 3 is very low and could be detected by real-time-PCR in a small number of tissues and cell lines. In mouse, expression was detected only in kidney and in very low level also in skeletal muscle. Consistent with this is the observation that there are very few expressed sequence tags that represent portions ofthe ABCA 13 transcript. However it cannot currently be rule out that higher expression of one or more ABCAl 3 transcripts is present in specific cell types that has not yet examined.
The expression pattern of ABCA13 was also studied on a human Multiple Tissue Expression Array that contains polyA+ RNA from 76 different human normal and cancer tissues plus several control DNAs. Although the signal was clearly visible from human control DNA, no signal was detected from any RNAs on the array, even after prolonged exposure. No signal has been observed on human northern blots either, even after prolonged exposure. The tissues tested included kidney, skeletal muscle, lung, trachea, bone marrow, and testis. It is believed that these results are because blotting conditions do not permit good transfer of long transcripts.
Example 11 Northern Blot Analysis of Human ABCA13.
The profile of expression of ABCA13 polynucleotides can be determined using art-known techniques, such as Northern blot analysis, which has been described for instance by Sambrook et al. (1989, Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). This example provides representative methods.
Preparation of probe PCR products are gel-purified using Qiaquick® column (Qiagen). 10-20 ng of purified PCR product are radiolabeled with [γ32P]dCTP (Amersham; 6000 Ci/mmol, 10 mCi/ml) by the random priming method (Rediprime kit; Amersham) according to the manufacturer's protocol. Unincorporated radioactive nucleotides are separated from the labeled probe by filtration on a G50 microcolumn (Pharmacia). The probe is competed with 50 μg of denatured human COT1 DNA for two hours at 65 °C.
Northern blots (MTN blot, Clontech, Palo Alto, USA) containing 2 μg of poly(A+) mRNA per lane from various adult and/or fetal tissues of a subject are hybridized with randomly radiolabeled with U17-L8 specific probe (2xl06 cpm/ml hybridization solution) in 50% formamide hybridization solution overnight at 65°C. The filters were washed in 2x SSC for 30 minutes at room temperature, twice in 2x SSC-0.1% SDS for 10 minutes at 65°C and twice in lx SSC-0.1% SDS for 10 minutes at 65°C. The filters are analyzed using the Storm™ blot imaging system (Molecular Dynamics, Sunnyvale, USA) by overnight exposure.
Example 12 Identification of a Causal Gene for a Disease Linked to ABCA13.
Among mutations identified in ABCAl 3 (for instance, mutations identified according to methods described herein), all those associated with the disease phenotype are capable of being causal. These results are validated by sequencing the gene in the affected individuals and their relations (whose DNA is available).
Moreover, Northern blot or RT-PCR analysis, performed for instance according to the methods described herein, using RNA specific to affected or non-affected individuals makes it possible to detect notable variations in the level of expression ofthe gene studied, in particular the absence of transcription ofthe gene.
Example 13 Validation of the Expression of Human ABCA13 cDNA.
Polyclonal antibodies specific for a human ABCA13 polypeptide may be prepared as described herein in rabbits and chicks by injecting a synthetic polypeptide fragment derived from an ABCAl 3 protein, including all or part of an amino acid sequence as shown in SEQ ID NO: 2. These polyclonal antibodies are used to detect and/or quantify the expression ofthe ABCA13 gene in cells and animal models by immunoblotting and/or immunodetection.
Example 14
Expression in vivo of the ABCA13 Gene in Animal Models.
An appropriate volume (e.g., 100 to 300 μl) of a medium containing the purified recombinant adenovirus (pABCA-AdV or pLucif-AdV) containing from 10s to 109 lysis plaque- forming units (pfu) are infused into the Saphenous vein of mice (C57BL/6, both control mice and models of transgenic or knock-out mice) on day 0 ofthe experiment.
The evaluation ofthe physiological role ofthe ABCA13 protein in the transport of cholesterol or inflammatory lipid substances is carried out by determining the total quantity of cholesterol or appropriate inflammatory lipid substances before (day zero) and after (days 2, 4, 7, 10, 14) the administration ofthe adenovirus. Kinetic studies with the aid of radioactively labeled products are carried out on day 5 after the administration ofthe vectors rLucif-AdV and rABCA-AdV in order to evaluate the effect ofthe expression or function of ABCA 13 on the transport of cholesterol and inflammatory lipid substances.
Furthermore, transgenic mice and rabbits over-expressing gene may be produced, in accordance with the teaching of Vaisman (J. Biol Chem. 270(20): 12269-12275, 1995) and Hoeg (Proc. Nat. Acad. Sci. USA. 93(21):11448-11453, 1996) using constructs containing the human ABCA 13 cDNA under the control of endogenous promoters such as ABCA 13 or CMV or apoE.
The evaluation ofthe long-term effect ofthe expression of ABCA13 on the kinetics ofthe lipids involved in the mediation ofthe inflammation may be carried out as described above.
Embodiments of this disclosure provide several ABCA13 proteins and nucleic acid molecules, and methods of isolating, making, and using these molecules. Further embodiments provide methods for ameliorating, treating, detecting, prognosing and diagnosing diseases related to expression of ABCA13. It will be apparent that the precise details ofthe methods described may be varied or modified without departing from the spirit ofthe described invention. We claim all such modifications and variations that fall within the scope and spirit ofthe claims below.

Claims

1. A substantially purified human ABCA 13 protein, comprising an amino acid sequence having at least 85% sequence identity to amino acid residues 2278 through 4942 of SEQ ID NO: 2.
2. The substantially purified human ABCA13 protein of claim 1, which protein has ABCA13 biological activity.
3. The substantially purified human ABCAl 3 protein ofclaim 1, comprising an amino acid sequence having at least 90% sequence identity to residues 2278 through 4942 of SEQ ID NO: 2.
4. The substantially purified human ABCAl 3 protein ofclaim 1, comprising an amino acid sequence having at least 95% sequence identity to residues 2278 through 4942 of SEQ ID NO: 2.
5. The substantially purified human ABCAl 3 protein ofclaim 1, comprising residues 2278 through 4942 of SEQ ID NO: 2, or a conservative substitution thereof.
6. The substantially purified human ABCAl 3 protein ofclaim 1, consisting essentially ofthe amino acid sequence as set forth in SEQ ID NO: 2, 19, 21, 23, 25, 27, or 29.
7. The substantially purified human ABCAl 3 protein ofclaim 1, having a sequence consisting essentially ofthe amino acid sequence as set forth in SEQ ID NO: 2, 19, 21, 23, 25, 27, or 29.
A substantially purified nucleic acid molecule that encodes the protein ofclaim 1.
9. The substantially purified nucleic acid molecule ofclaim 8, comprising a nucleotide sequence having at least 85% sequence identity to the nucleotide sequence as set forth as SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
10. The substantially purified nucleic acid molecule of claim 8, comprising a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence as set forth as SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
11. The substantially purified nucleic acid molecule of claim 8, comprising a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence as set forth as SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
12. The substantially purified nucleic acid molecule ofclaim 8, consisting essentially ofthe nucleotide sequence as set forth as SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
13. A recombinant polynucleotide encoding the protein of claim 1 , wherein the recombinant polynucleotide has a sequence comprising:
(a) nucleotide residues 26 to 15202 ofthe nucleotide sequence as set forth as SEQ ID NO: l;
(b) nucleotide residues 2209 to 10491 ofthe nucleotide sequence as set forth as SEQ ID NO: 18; (c) nucleotide residues 26 to 2179 ofthe nucleotide sequence as set forth as SEQ ID NO: 20;
(d) nucleotide residues 26 to 14902 ofthe nucleotide sequence as set forth as SEQ ID NO: 22;
(e) nucleotide residues 2209 to 10191 ofthe nucleotide sequence as set forth as SEQ ID NO: 24; (f) nucleotide residues 26 to 14884 ofthe nucleotide sequence as set forth as SEQ ID NO:
26;
(g) nucleotide residues 2209 to 10173 ofthe nucleotide sequence as set forth as SEQ ID NO: 28; or
(h) a nucleotide sequence having 85% sequence identity to any one of (a), (b), (c), (d), (e), (f), or (g).
14. The recombinant polynucleotide of claim 13 , wherein the recombinant polynucleotide has a sequence comprising the nucleotide sequence as set forth as SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
15. A recombinant nucleic acid molecule comprising a promoter sequence operably linked to the nucleic acid molecule ofclaim 7.
16. A recombinant nucleic acid molecule according to claim 14, wherein the recombinant polynucleotide is in antisense orientation relative to the promoter sequence.
17. A recombinant vector comprising the recombinant nucleic acid molecule of claim 14.
18. A cell transformed with the recombinant nucleic acid molecule of claim 14.
19. A transgenic non-human animal, comprising the cell ofclaim 17.
20. A specific binding agent that specifically binds an epitope ofthe protein of claim 1.
21. The binding agent ofclaim 20, wherein the agent specifically binds an epitope of a protein having an amino acid sequence as set forth in SEQ ID NO: 2, 19, 21, 23, 25, 27, 29, or a conservative variation thereof.
22. The specific binding agent ofclaim 20, wherein the agent is an antibody.
23. A method of detecting a biological condition of a subject associated with altered expression of an ABCAl 3 nucleic acid, comprising detecting in a biological sample: a mutation in the ABCA 13 nucleic acid that is associated with disease; altered expression of an ABCA 13 nucleic acid; or expression of a mutant ABCAl 3 nucleic acid, wherein the mutation, altered expression, or expression ofthe mutant ABCAl 3 nucleic acid indicates that the subject has the biological condition.
24. The method ofclaim 23, wherein the method comprises evaluating defective extra- or intra-cellular transport.
25. The method of claim 23, wherein the altered expression ofthe ABCAl 3 nucleic acid comprises an alteration in a cellular level of ABCA13 nucleic acid or ABCA13 protein, in comparison to the level detected in a control sample.
26. The method ofclaim 23, wherein detecting comprises Southern blot analysis, quantitative polymerase chain reaction or semi-quantitative polymerase chain reaction.
27. The method ofclaim 23, wherein detecting comprises sequencing, chemical cleavage, denaturing gradient gel electrophoresis, or hybridization with allele specific oligonucleotides.
28. The method ofclaim 23, wherein the ABCAl 3 nucleic acid is in vitro amplified using at least one oligonucleotide primer having a sequence identical to at least 10 contiguous nucleotides ofthe nucleic acid sequence as set forth in SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
29. The method ofclaim 28, wherein the oligonucleotide primer comprises the nucleotide sequence as set forth in SEQ ID NOs: 3-15, SEQ ID NOs: 73-75, or a conservative substitution of any one thereof.
30. The method ofclaim 23, wherein the biological condition comprises hypercholesterolemia, drug resistance, retinal degeneration, or neurological disease.
31. The method of claim 23 , wherein the biological condition comprises Shwachmann- Diamond syndrome, an inherited disorder ofthe pancreas, or T cell tumorigenesis.
32. The method ofclaim 23, wherein the method is used to detect a chemotherapy resistant cell.
33. The method ofclaim 23, wherein the altered expression ofthe ABCAl 3 nucleic acid comprises an increased or decreased expression of ABCA 13 in a subject as compared to a control.
34. The method ofclaim 23, comprising reacting at least one ABCAl 3 molecule contained in a biological sample from the subject with a reagent comprising an ABCAl 3 specific binding agent to form an ABCA13:agent complex.
35. The method ofclaim 34, wherein the ABCA13 molecule is encoded by a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28.
36. The method ofclaim 34, wherein the ABCA13:agent complex is detected by nucleotide hybridization.
37. The method ofclaim 34, wherein the ABCA13:agent complex is detected by Western blot assay.
38. The method ofclaim 37, wherein the Western blot assay uses an antibody generated against a nucleotide binding or transmembrane domain ofthe protein encoded by the amino acid sequence as shown in SEQ ID NO: 2, 19, 21, 23, 25, 27, 29, or a conservative substitution thereof.
39. The method ofclaim 34, wherein the complexes are detected by ELISA.
40. The method ofclaim 38 or 39, wherein the antibody is a monoclonal antibody.
41. The antibody ofclaim 40, which recognizes an antigenic peptide comprising a sequence within residues 2278 through 4942 of SEQ ID NO: 2.
42. The method ofclaim 41, wherein the sample comprises blood, a blood product, urine, saliva, a tissue biopsy, a surgical specimen, an amniocentesis sample, or autopsy material.
43. A method of screening for an agent that modulates ABCAl 3 transporter activity, the method comprising: transfecting a cell with an expression vector, wherein the expression vector comprises a nucleic acid molecule having a sequence as set forth in SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28, or a conservative substitution thereof, operably linked to a promoter sequence; contacting the cell with a test agent; and detecting a change in the level of expression ofthe ABCA13 protein, wherein a change in the level indicates that the test agent modulates the expression ofthe ABCAl 3 transporter protein.
44. A method of detecting an ABCAl 3 transporter protein in a biological sample, comprising: amplifying in the biological sample nucleotide residues as set forth in SEQ ID NO:
1, 18, 20, 22, 24, 26, or 28, or a conservative substitution thereof, with two or more oligonucleotide primers that specifically bind the nucleotide residues as set forth in SEQ ID NO: 1, 18, 20, 22, 24, 26, or 28; and detecting a level of an amplified product, thereby detecting the ABCAl 3 transporter protein.
45. An in vitro assay kit, comprising: a container comprising an ABCA13 protein specific binding agent; and instructions for using the kit, the instructions indicating steps for performing a method to detect the level of expression of an ABCA13 nucleic acid in the sample; and analyzing data generated by the method, wherein the instructions indicate that altered expression of ABCAl 3 in the sample indicates that the individual has a biological condition associated with ABCAl 3 expression.
46. The kit ofclaim 45, wherein the agent is capable of specifically binding to an epitope within:
(a) the amino acid sequence shown in SEQ ID NO: 2, 19; 21, 23, 25, 27, or 29;
(b) the amino acid sequence shown in amino acid residues 2278 through 4942 of SEQ ID NO: 2; or (c) a conservative variant of (a) or (b).
47. The kit ofclaim 46, wherein the altered ABCA13 expression results in altered extra- or intracellular transport.
48. The kit ofclaim 46, wherein the ABCA13 protein binding agent is an antibody.
49. An in vitro amplification assay kit, comprising: a first container comprising an in vitro amplification primer that specifically amplifies the nucleic acid that encodes ABCAl 3 protein; a second container comprising a size marker, the size marker being the expected size of amplified DNA if the nucleic acid that encodes ABCA13 protein is present in the sample; and instructions for using the kit, wherein the instructions indicate steps for performing a method to detect and/or quantify the nucleic acid that encodes ABCAl 3 protein in the sample; and analyzing data generated by the method, wherein the instructions indicate that an altered level of nucleic acid that encodes ABCAl 3 protein in the sample indicates that the individual has a biological condition associated with ABCA 13 expression.
PCT/US2003/026335 2002-08-20 2003-08-19 Abca13 nucleic acids and proteins, and uses thereof Ceased WO2004018633A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003262789A AU2003262789A1 (en) 2002-08-20 2003-08-19 Abca13 nucleic acids and proteins, and uses thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US40500602P 2002-08-20 2002-08-20
US60/405,006 2002-08-20
US45450203P 2003-03-12 2003-03-12
US60/454,502 2003-03-12

Publications (2)

Publication Number Publication Date
WO2004018633A2 true WO2004018633A2 (en) 2004-03-04
WO2004018633A3 WO2004018633A3 (en) 2005-04-21

Family

ID=31949879

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/026335 Ceased WO2004018633A2 (en) 2002-08-20 2003-08-19 Abca13 nucleic acids and proteins, and uses thereof

Country Status (2)

Country Link
AU (1) AU2003262789A1 (en)
WO (1) WO2004018633A2 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014052855A1 (en) * 2012-09-27 2014-04-03 Population Diagnostics, Inc. Methods and compositions for screening and treating developmental disorders
WO2015018805A1 (en) * 2013-08-05 2015-02-12 Immatics Biotechnologies Gmbh Novel immunotherapy against several tumors, such as lung cancer, including nsclc
US9976180B2 (en) 2012-09-14 2018-05-22 Population Bio, Inc. Methods for detecting a genetic variation in subjects with parkinsonism
US10059997B2 (en) 2010-08-02 2018-08-28 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US10160786B1 (en) 2013-08-05 2018-12-25 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
US10210306B2 (en) 2006-05-03 2019-02-19 Population Bio, Inc. Evaluating genetic disorders
US10221454B2 (en) 2011-10-10 2019-03-05 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
US10724096B2 (en) 2014-09-05 2020-07-28 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US10961585B2 (en) 2018-08-08 2021-03-30 Pml Screening, Llc Methods for assessing risk of developing a viral of disease using a genetic test
US11180807B2 (en) 2011-11-04 2021-11-23 Population Bio, Inc. Methods for detecting a genetic variation in attractin-like 1 (ATRNL1) gene in subject with Parkinson's disease
CN114875148A (en) * 2022-05-11 2022-08-09 中南大学湘雅医院 Familial multiple lipoma detection kit and application of primer group
US11479768B2 (en) * 2015-06-30 2022-10-25 Ethris Gmbh ATP-binding cassette family coding polyribonucleotides and formulations thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6555323B2 (en) * 2000-02-08 2003-04-29 Pfizer Inc. Assay for ABCA1
AU2001251194A1 (en) * 2000-03-31 2001-10-15 Hyseq, Inc. Novel bone marrow nucleic acids and polypeptides
EP1354039A2 (en) * 2000-11-28 2003-10-22 Amgen, Inc. Atp-binding cassette transporter-like molecules and uses thereof

Cited By (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10529441B2 (en) 2006-05-03 2020-01-07 Population Bio, Inc. Evaluating genetic disorders
US10210306B2 (en) 2006-05-03 2019-02-19 Population Bio, Inc. Evaluating genetic disorders
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
US10059997B2 (en) 2010-08-02 2018-08-28 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US11788142B2 (en) 2010-08-02 2023-10-17 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US10221454B2 (en) 2011-10-10 2019-03-05 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11339439B2 (en) 2011-10-10 2022-05-24 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11180807B2 (en) 2011-11-04 2021-11-23 Population Bio, Inc. Methods for detecting a genetic variation in attractin-like 1 (ATRNL1) gene in subject with Parkinson's disease
US11174516B2 (en) 2012-02-09 2021-11-16 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US12012634B2 (en) 2012-09-14 2024-06-18 Population Bio, Inc. Methods for diagnosing, prognosing, and treating parkinson's disease or parkinsonism
US11008614B2 (en) 2012-09-14 2021-05-18 Population Bio, Inc. Methods for diagnosing, prognosing, and treating parkinsonism
US9976180B2 (en) 2012-09-14 2018-05-22 Population Bio, Inc. Methods for detecting a genetic variation in subjects with parkinsonism
US11618925B2 (en) 2012-09-27 2023-04-04 Population Bio, Inc. Methods and compositions for screening and treating developmental disorders
US10597721B2 (en) 2012-09-27 2020-03-24 Population Bio, Inc. Methods and compositions for screening and treating developmental disorders
WO2014052855A1 (en) * 2012-09-27 2014-04-03 Population Diagnostics, Inc. Methods and compositions for screening and treating developmental disorders
US10233495B2 (en) 2012-09-27 2019-03-19 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10316063B1 (en) 2013-08-05 2019-06-11 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
KR20160038889A (en) * 2013-08-05 2016-04-07 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
EP3456339A3 (en) * 2013-08-05 2019-03-27 immatics biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
US10323065B1 (en) 2013-08-05 2019-06-18 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
CN110041403A (en) * 2013-08-05 2019-07-23 伊玛提克斯生物技术有限公司 Novel immune therapy for kinds of tumors for example including the lung cancer including NSCLC
CN110041402A (en) * 2013-08-05 2019-07-23 伊玛提克斯生物技术有限公司 Novel immune therapy for kinds of tumors for example including the lung cancer including NSCLC
WO2015018805A1 (en) * 2013-08-05 2015-02-12 Immatics Biotechnologies Gmbh Novel immunotherapy against several tumors, such as lung cancer, including nsclc
US10479818B2 (en) 2013-08-05 2019-11-19 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
US10487116B2 (en) 2013-08-05 2019-11-26 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
IL262509A (en) * 2013-08-05 2018-12-31 Immatics Biotechnologies Gmbh Novel immunotherapy against several tumors, such as lung cancer, including nsclc
US10160786B1 (en) 2013-08-05 2018-12-25 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
CN110041402B (en) * 2013-08-05 2024-04-16 伊玛提克斯生物技术有限公司 New immunotherapy for various tumors, such as lung cancer including NSCLC
US11939401B2 (en) 2013-08-05 2024-03-26 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
KR20180107295A (en) * 2013-08-05 2018-10-01 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR20200037457A (en) * 2013-08-05 2020-04-08 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR102098329B1 (en) * 2013-08-05 2020-04-09 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
EA035362B1 (en) * 2013-08-05 2020-06-02 Имматикс Байотекнолоджиз Гмбх Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR20200078681A (en) * 2013-08-05 2020-07-01 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
US11939400B2 (en) 2013-08-05 2024-03-26 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
US10793602B2 (en) 2013-08-05 2020-10-06 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
KR20200122418A (en) * 2013-08-05 2020-10-27 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR20200122417A (en) * 2013-08-05 2020-10-27 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR20200122419A (en) * 2013-08-05 2020-10-27 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR20200123266A (en) * 2013-08-05 2020-10-28 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
TWI714869B (en) * 2013-08-05 2021-01-01 德商伊瑪提克斯生物科技有限公司 Novel peptides, cells, and their use against several tumors, methods for production thereof and pharmaceutical composition comprising the same
KR102211542B1 (en) 2013-08-05 2021-02-02 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR102213552B1 (en) 2013-08-05 2021-02-05 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR102213556B1 (en) 2013-08-05 2021-02-05 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR102213551B1 (en) 2013-08-05 2021-02-05 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR102213554B1 (en) 2013-08-05 2021-02-05 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
KR102217680B1 (en) * 2013-08-05 2021-02-18 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
US11866517B2 (en) 2013-08-05 2024-01-09 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
US11859017B2 (en) 2013-08-05 2024-01-02 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
US10071148B2 (en) 2013-08-05 2018-09-11 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
US11161879B2 (en) 2013-08-05 2021-11-02 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
US11161880B2 (en) 2013-08-05 2021-11-02 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
US11161878B2 (en) 2013-08-05 2021-11-02 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
US11161877B2 (en) 2013-08-05 2021-11-02 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
US9943579B2 (en) 2013-08-05 2018-04-17 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
AU2014304544B2 (en) * 2013-08-05 2017-10-26 Immatics Biotechnologies Gmbh Novel immunotherapy against several tumors, such as lung cancer, including NSCLC
KR102383710B1 (en) 2013-08-05 2022-04-08 이매틱스 바이오테크놀로지스 게엠베하 Novel immunotherapy against several tumors, such as lung cancer, including nsclc
JP2016527293A (en) * 2013-08-05 2016-09-08 イマティクス バイオテクノロジーズ ゲーエムベーハー Novel immunotherapy for several types of tumors such as lung cancer including NSCLC
US11814446B2 (en) 2013-08-05 2023-11-14 Immatics Biotechnologies Gmbh Immunotherapy against several tumors including lung cancer
CN105377290A (en) * 2013-08-05 2016-03-02 伊玛提克斯生物技术有限公司 Novel immunotherapy for the treatment of various tumors such as lung cancer including NSCLC
US10316062B1 (en) 2013-08-05 2019-06-11 Immatics Biotechnologies Gmbh Immunotherapy against several tumors, such as lung cancer, including NSCLC
CN110041403B (en) * 2013-08-05 2023-03-10 伊玛提克斯生物技术有限公司 Novel immunotherapy against multiple tumors such as lung cancer including NSCLC
US10724096B2 (en) 2014-09-05 2020-07-28 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US11549145B2 (en) 2014-09-05 2023-01-10 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US11479768B2 (en) * 2015-06-30 2022-10-25 Ethris Gmbh ATP-binding cassette family coding polyribonucleotides and formulations thereof
US10563264B2 (en) 2017-02-03 2020-02-18 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10941448B1 (en) 2017-02-03 2021-03-09 The Universite Paris-Saclay Methods for assessing risk of developing a viral disease using a genetic test
US11913073B2 (en) 2017-02-03 2024-02-27 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10544463B2 (en) 2017-02-03 2020-01-28 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US12331357B2 (en) 2017-02-03 2025-06-17 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US11913074B2 (en) 2018-08-08 2024-02-27 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10961585B2 (en) 2018-08-08 2021-03-30 Pml Screening, Llc Methods for assessing risk of developing a viral of disease using a genetic test
US12054778B2 (en) 2018-08-08 2024-08-06 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US12227807B2 (en) 2018-08-08 2025-02-18 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US12234513B2 (en) 2018-08-08 2025-02-25 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US12241125B2 (en) 2018-08-08 2025-03-04 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
CN114875148A (en) * 2022-05-11 2022-08-09 中南大学湘雅医院 Familial multiple lipoma detection kit and application of primer group

Also Published As

Publication number Publication date
WO2004018633A3 (en) 2005-04-21
AU2003262789A8 (en) 2004-03-11
AU2003262789A1 (en) 2004-03-11

Similar Documents

Publication Publication Date Title
US6897018B1 (en) DLC-1 gene deleted in cancers
JP5328603B2 (en) KCNQ2 and KCNQ3-potassium channel genes mutated in benign familial neonatal convulsions (BFNC) and other epilepsy
US5747282A (en) 17Q-linked breast and ovarian cancer susceptibility gene
US7045675B2 (en) Genes for Niemann-Pick type C disease
NZ291624A (en) Method of diagnosis of a predisposition to breast cancer
WO2004018633A2 (en) Abca13 nucleic acids and proteins, and uses thereof
US5876949A (en) Antibodies specific for fragile X related proteins and method of using the same
JP2004504054A (en) Common polymorphisms in SCN5A associated with drug-induced cardiac arrhythmias
US20150045307A1 (en) Identification of a novel bhd gene
US6075123A (en) Cyclin-C variants, and diagnostic and therapeutic uses thereof
CA2554380C (en) Mecp2e1 gene
JP2002523094A (en) Nucleic acids encoding ataxin-2 binding proteins, products related thereto, and methods of using them
US20030175754A1 (en) RVP-1 variant differentially expressed in crohns disease
US6867017B1 (en) ATP-binding transporter (ABC7) and methods for detection of anemia and ataxia
US6063576A (en) Actin mutations in dilated cardiomyopathy, a heritable form of heart failure
WO2003064591A2 (en) Abca8 nucleic acids and proteins, and uses thereof
WO2000029578A9 (en) Cloning and characterization of two m-rna transcription factors
US20020151030A1 (en) Claspin proteins and methods of use thereof
US20040242468A1 (en) Gene involved in mineral deposition and uses thereof
EP1254231A1 (en) Genes encoding abc1 paralogs and the polypeptides derived therefrom
US20020055622A1 (en) Mammalian non-erythroid Rh type C genes and glycoproteins
WO2003062398A2 (en) NEW TUMOR SUPPRESSOR GENE, p28ING5
WO1999045112A2 (en) Chromosome 11-linked coronary heart disease susceptibility gene chd1
GB2383044A (en) ALMS1 gene
WO1999043812A2 (en) Dlc-1 gene, a putative tumors suppressor gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP