WO2004016776A1 - Use of cdx2 +/- heterozygous animals for the screening of carcinogenic or anti-cancerous factors - Google Patents

Use of cdx2 +/- heterozygous animals for the screening of carcinogenic or anti-cancerous factors Download PDF

Info

Publication number
WO2004016776A1
WO2004016776A1 PCT/FR2003/002523 FR0302523W WO2004016776A1 WO 2004016776 A1 WO2004016776 A1 WO 2004016776A1 FR 0302523 W FR0302523 W FR 0302523W WO 2004016776 A1 WO2004016776 A1 WO 2004016776A1
Authority
WO
WIPO (PCT)
Prior art keywords
cdx2
mice
tumors
gene
mammal
Prior art date
Application number
PCT/FR2003/002523
Other languages
French (fr)
Inventor
Jean-Noël FREUND
Isabelle Duluc
Claire Domon-Dell
Felix Beck
Céline BONHOMME
Original Assignee
Institut National De La Sante Et De La Recherche Medicale
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National De La Sante Et De La Recherche Medicale filed Critical Institut National De La Sante Et De La Recherche Medicale
Priority to AU2003274251A priority Critical patent/AU2003274251A1/en
Publication of WO2004016776A1 publication Critical patent/WO2004016776A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases

Definitions

  • the invention relates to the prevention and treatment of colorectal cancers, and in particular to new means of detecting substances having carcinogenic properties, or on the contrary, anti-cancerous substances.
  • cancers of the digestive system represent a major public health problem, particularly in Western countries (cf. The White Book of Gastroenterology, Editions Masson, 2001).
  • the annual number of new cases is estimated at 55,000, or 25% of all cancers, and the number of deaths at 40,000, or 30% of cancer deaths and 8% of all deaths.
  • Colorectal cancers occupy a prominent place among cancers of the digestive system.
  • around 200,000 people have or have had colorectal cancer, including 50,000 in the past five years.
  • the incidence of these cancers is increasing since they increased from 24,900 in 1975 to 33,400 in 1995.
  • the intestinal epithelium is a system in permanent cellular renewal, from stem cells located in the crypts.
  • the alteration of the proliferation and differentiation process of the epithelium can lead to the appearance of colorectal cancers.
  • the appearance of colorectal tumors obeys characteristic histopathological sequences leading to carcinoma.
  • the initiation and progression of colorectal cancers result from the appearance and accumulation of mutations in tumor suppressor genes, and / or oncogenes such as APC r K-ras, TP53, Bcl2, and / or mutations at the level of DNA repair genes such as Msh2 and ' Mlhl (CHUNG, Gastroenterology, 119, 854-865, 2000).
  • the above mentioned genes are involved not only in colorectal cancers, but also in cancers affecting many other tissues or organs such as the hematopoietic system, liver, bladder, breast etc. So far, no gene specifically expressed in the intestinal epithelium has been identified for its involvement in colorectal cancers.
  • mice have been established in mice in order to reproduce the genetic alterations described in colorectal cancers in humans, and to study the molecular mechanisms involved in the initiation and / or progression of colorectal tumors. Examples include: - mice with mutations in the APC gene.
  • the loss of function of the APC tumor suppressor gene is considered to be the main initiating event in the vast majority of sporadic colorectal cancers in humans and in familial adenomatous polyposis.
  • Mice deficient in the APC gene develop intestinal adenomas.
  • transgenic mice expressing an oncogenic form of K-ras In humans, the mutation leading to the constitutive activation of the proto-oncogene K-ras is a frequent and early event during the tumor process.
  • Transgenic mice expressing an oncogenic form of K-ras have adenocarcinomas in the small intestine (JANSSEN et al. Gastroenterology, 123: 492-504, 2002.
  • mice disabled for the Smad3 gene, a gene involved in the TGF ⁇ signaling pathway, spontaneously develop invasive colic adenocarcinomas (ZHU et al., Cell f 94, 703-714, 1998). However, there is currently no evidence that this gene is implicated in colorectal carcinogenesis in humans;
  • mice invalidated for the msh2 gene, which is an important element of the DNA repair system, frequently mutated in colon cancers presenting the phenotype of micro-satellite instability. These mice develop only small intestinal tumors, but lymphomas (DE WIND et al., Cancer Res, 58, 248-255, 1998);
  • mice disabled for the mucin muc2 gene, which develop spontaneously and at a low frequency of intestinal tumors. Some tumors are located in the colon, but the majority of them develop in the small intestine (VELCICH et al., Science, 295, 1726-1729, 2002).
  • the Cdx2 gene codes for a homeo-domain transcription factor, which is involved in the development of many organs in the embryo. Its expression is then restricted to the endoderm in the fetus and to the intestinal epithelium in adults. In the fetus, it exercises an important homeotic function which consists in defining the region of the endoderm which generates the intestine (small intestine and colon). This is demonstrated by the gastric hetero-differentiation which results from Cdx2 haplo-insufficiency in the intestinal epithelium
  • the level of expression of Cdx2 increases from the duodenum to the proximal part of the colon, then decreases in the distal colon.
  • the CDX2 protein presents an increasing gradient along the proliferation-cell differentiation axis, from the proliferative cells located in the bottom of the crypts to the differentiated cells of the surface epithelium (SILBERG et al.,
  • CDX2 exercises a regulatory function of
  • Cdx2 Mutations in the Cdx2 gene are rare in intestinal tumor cell lines, and the frequency of genomic rearrangements at the Cdx2 locus is low (YAGI et al., Bri t J Cancer, 79, 440-444, 1999; SIVAGNANASUNDARAM et al. , Brit J Cancer, 84, 218-225, 2002). It has also been observed that the expression of Cdx2 in colon cancer cells is inhibited by the activation of oncogenic pathways, such as Ras (LORENTZ et al., Oncogene, 18, 87-92, 1999).
  • CDX2 is stimulated by butyrate, a pro-apoptotic and differentiating agent considered to be protective against colon carcinogenesis (DOMON-DELL et al., Gut, 50, 525-529, 2002) , and by the APC tumor suppressor (DACOSTA et al. Oncogene, 18, 5010-5014, 1999; PCT application WO 00/70089). All of these observations suggest that the drop in expression of Cdx2 in colorectal cancers results mainly from negative regulation phenomena by oncogenic and signaling pathways. no mutations and / or genomic recombinations at the Cdx2 locus.
  • PCT Application WO 98/09510 thus proposes the use of animals carrying a mutation in an allele of the Cdx2 gene as a model for studying colon cancer; the detection of mutations in the Cdx2 gene for the diagnosis of a predisposition to colon cancer,; the treatment of colon cancer by overexpression of the Cdx2 gene.
  • PCT application WO 00/70089 proposes the use of Cdx2 in the context of the treatment of cancers involving mutant alleles of the APC gene.
  • the Inventors used heterozygous Cdx2 +/- mice, under-expressing this gene. They looked for the appearance of spontaneous tumors in these mice. Monitoring of several generations of mice over a period of 3 years did not reveal any spontaneous formation of adenoma or adenocarcinoma in the small intestine or in the colon, including in elderly animals.
  • the inventors have found that when heterozygous mice Cdx2 +/- and wild animals of the same siblings (Cdx2 + / +) were subjected to carcinogenic treatment with azoxymethane (AOM), the appearance of tumors was observed. in all animals Cdx2 +/- after 12 weeks after the end of treatment, whereas none of the wild animals presented tumors under these conditions.
  • AOM azoxymethane
  • tumors are located in the distal half of the colon. They do not derive from the pathological transformation of heteroplasic gastric structures located at the level of the ileum and the proximal colon.
  • the smallest tumors correspond to adenomatous structures, in which the expression of the CDX2 protein is greatly reduced, while the largest are invasive intra-mucosal adenocarcinomas where the expression of CDX2 is reduced, or even absent.
  • the localization of the tumor evolution of the tumors present in the Cdx2 +/- mice treated with AOM reproduce those conventionally described in the majority of sporadic colorectal cancers in humans.
  • Cdx2 is therefore a suppressor gene for intestinal tumors in the sense that the reduction of its expression facilitates colorectal tumor progression. It is the first gene specifically expressed in the intestinal epithelium in adults which is identified as having this function.
  • Cdx2 +/- heterozygous mice in which only one copy of the Cdx2 gene is disabled represent a good model for studying the effects of the reduction in the level of expression of this gene, on colorectal carcinogenesis involving exogenous factors, for example chemo-induced carcinogenesis.
  • the present invention therefore relates to the use of a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated (heterozygous Cdx2 +/-), to test the carcinogenic power of a factor or a combination of exogenous factors.
  • the present invention also relates to the use of a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated, treated with a carcinogenic agent, to test the anticancer activity of an exogenous factor or combination of factors.
  • said mammal is a mouse.
  • the exogenous factor tested can be a molecule or a mixture of molecules, a food or diet, or a physical treatment, for example irradiation.
  • the present invention more particularly relates to: - according to a first variant, a method for testing a factor or a combination of potentially carcinogenic factors, characterized in that it comprises the administration of said factor or of said combination to a non-mammalian human in which one of the two alleles of the Cdx2 gene is inactivated, and detecting the presence or absence of tumors in the colon of said mammal;
  • a method for testing a factor or a combination of potentially anti-cancer factors characterized in that it comprises: a) the administration of a carcinogenic agent to a non-human mammal in which the one of the two alleles of the Cdx2 gene is inactivated; b) the administration to said mammal of the factor or of the combination of factors to be tested; c) detecting the presence or absence of tumors in the colon of said mammal.
  • Steps a) and b) of this second variant can be implemented consecutively in any order, or simultaneously.
  • the mammal used is sacrificed at the end of the experiment.
  • the presence or absence of tumors can be detected after the animal has been sacrificed, or during the experiment, by biopsy or by non-invasive exploration, for example by ultrasound.
  • These tumors are adenocarcinomas, which can be at different stages of their development.
  • said mammal is a mouse.
  • the carcinogenic agent used in step a) is azoxymethane; other carcinogens can also be used; by way of nonlimiting examples, mention will be made of dimethylhydrazine
  • DSH sodium dextran sulfate
  • DSS sodium dextran sulfate
  • the quantity of carcinogenic agent to be administered in step a) must of course be sufficient to induce the formation of tumors in the absence of any other treatment; this quantity can also be determined by implementing the first variant of the process according to the invention.
  • the present invention also relates to a non-human mammal, in particular a mouse, in which one of the two alleles of the Cdx2 gene is inactivated, and to which a carcinogenic agent has been administered.
  • EXAMPLE 1 TUMOR INDUCTION IN CDX2 +/- MOUSE TREATED WITH AZOXYMETHANE.
  • the heterozygous Cdx2 +/- mice used in these experiments are described in the publications of CHAWENGSAKSOPHAK et al., (1998, cited above) and BECK et al., (1999, cited above) as well as in PCT Application WO 98/09510. These mice are housed under standard conditions, with a 12-hour day / night cycle, and receive a normal diet.
  • mice have characteristic heteroplastic structures of the gastric type, located in the ileum, the coecum, and in the proximal colon.
  • AOM azoxymethane
  • the level of sensitivity of animals to the appearance of tumors depends on the genetic background (PAPANIKOLAOU et al., Carcinogenesis, 21, 1567-1572, 2000).
  • the products of the metabolism of AOM form adducts with DNA which lead to mutations at the level of important oncogenes in colon carcinogenesis such as the genes of ⁇ -catenin and of K-ras, as well as micro-satellite instabilities.
  • TAKAHASHI et al. Carcinogenesis, 21, 1319-1327 2000
  • LUCERI et al. Carcinogenesis, 21, 1753-1756, 2000.
  • the AOM was injected intraperitoneally (10 mg / kg) as a weekly injection for five weeks. The animals were sacrificed 12 weeks after the last injection.
  • Macroscopic analysis of the heteroplastic structures present in Cdx2 +/- animals does not show any difference between Cdx2 +/- animals treated with AOM and Cdx2 +/- animals not treated.
  • histopathological analysis does not show any evolution of these heteroplastic structures towards tumor transformation in Cdx2 +/- mice treated with AOM.
  • the size of these tumors varies from 1 to 4 mm in diameter. They are exclusively located in the distal portion of the colon. No tumors were detected in the proximal colon, the coecum or the small intestine.
  • adenomatous structures are associated with areas totally disorganized, corresponding to carcinomatous regions. The crossing of the mucous muscular layer and the invasion of the submucosa by epithelial formations are sometimes observed, testifying to the invasive nature of these tumors.
  • EXAMPLE 2 IMMUNO-HISTOLOGICAL CHARACTERIZATION OF HETEROPLASTIC STRUCTURES AND TUMORS OF CDX2 +/- MICE
  • the heteroplastic structures and the adenomatous and carcinomatous tumor formations observed in the Cdx2 +/- mice treated with AOM were analyzed by immunohistology, using the Ki67 antigen. as a marker of cell proliferation, and the intra-cellular localization of ⁇ -catenin as a marker of tumor transformation.
  • the immunohistological analysis was carried out:
  • VECTASTAIN ABC using 3.3'- tetrachloride diaminobenzidine (DAKO).
  • the anti-Ki67 antibody marks groups of cells located at an intermediate position between the surface epithelium and the depth of the gland, comparable to the normal location of proliferating cells in the gastric epithelium; the anti- ⁇ -catenin antibody exclusively marks the periphery of the epithelial cells, in heteroplastic structures as in the colonic epithelium adjacent to these structures. This indicates a strictly membrane localization of ⁇ -catenin in these structures, which shows that the treatment with AOM does not induce any oncogenic activation of the ⁇ -catenin pathway.
  • ⁇ -catenin remains membrane in the adenomatous areas; on the other hand, in the carcinomatous zones, a localization is observed in the cytoplasm and / or in the nucleus, characteristic of the activation of this oncogenic pathway during the tumor process.
  • RNA extracted from the c ⁇ c of wild mice treated or not with AOM was carried out on RNA extracted from the c ⁇ c of wild mice treated or not with AOM, as well as on RNA extracted from heteroplasic structures of gastric type present in the cecum of Cdx2 +/- mice treated or not by the AOM, and on the RNA extracted from the adenocarcinomas developed by three Cdx2 +/- mice treated with the AOM, and from the adjacent normal mucosa.
  • RNA is extracted using TRI-REAGENT (MRC), and analyzed by semi-quantitative RT-PCR, according to the protocol described by LORENTZ et al. (J " . Cell Biol., 139,
  • the amplification of the Cdx2 transcript is carried out using the following primers:
  • Lane 1 cecal mucosa of untreated wild mice
  • Lane 2 cecal mucosa of wild mice treated with AOM
  • Lane 3 heteroplasic structures of untreated Cdx2 +/- mice
  • Lane 4 heteroplastic structures of Cdx2 +/- mice treated with AOM
  • Lanes 1, 2, 3 adenocarcinomas of Cdx2 +/- mice treated with AOM;
  • Lane 4, 5, 6 normal mucous membranes of Cdx2 +/- mice treated with AOM;
  • Immunohistological analysis This analysis was carried out using a primary anti-CDX2 antibody (BIOGENEX, dilution 1: 100), and a secondary anti-rabbit antibody coupled to biotin. The reaction is visualized as indicated in Example 2 for ⁇ -catenin.
  • the anti-CDX2 antibody does not reveal any labeling; on the other hand, in the adjacent epithelium, a localized marking is clearly observed in the cell nuclei.
  • the absence of expression of Cdx2 in the heteroplastic structures of Cdx2 +/- mice treated or not treated with AOM confirms the observations previously made (BECK et al., 1999, cited above) in these untreated mice.
  • the anti-CDX2 antibody marks only a small proportion of the glands, which varies according to the samples; in carcinomatous areas, no labeling is demonstrated by the anti-CDX2 antibody.
  • the genomic DNA of cells isolated from the adenomatous zone, from the carcinomatous zone, and from the adjacent normal mucosa of 3 different animals was analyzed by PCR, using primers allowing the amplification of the 3 exons of the Cdx2 gene.
  • identical amplification fragments were obtained, whatever the origin of the genomic DNA sample (adenomatous zone, carcinomatous zone, normal mucosa). This shows that the tumor progression and the loss of Cdx2 expression do not result from the loss of the Cdx2 allele remaining in Cdx2 +/- mice.
  • the PCR fragments obtained from DNA samples of carcinomatous origin were sequenced and their sequences compared to those of the fragments obtained from samples from the adjacent normal mucosa. No difference between the sequences was observed, which shows that the tumor progression is not the consequence of a mutation in the coding sequence of Cdx2.
  • the fact that the loss of expression of the CDX2 protein does not result from the loss or alteration of the Cdx2 gene confirms the interest of the model associating Cdx2 +/- mice and the AOM treatment for the study of human colorectal tumors, in which the reduction of expression of Cdx2 also occurs without alteration at the genomic level.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Environmental Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the use of a non-human mammal, in which one of the two alleles of gene Cdx2 is inactivated (heterozygote Cdx2+/-), in order to test potentially carcinogenic or anti-cancerous agents.

Description

ANIMAUX HETEROZYGOTES CDX2 +/- POUR LE CRIBLAGE DE FACTEURS CANCEROGENES OU ANTI-CANCEREUXHETEROZYGOT ANIMALS CDX2 +/- FOR THE SCREENING OF CANCEROGENIC OR ANTI-CANCER FACTORS
L'invention est relative à la prévention et au traitement des cancers colorectaux, et notamment à de nouveaux moyens de détection de substances possédant des propriétés cancérigènes, ou au contraire, de substances anti-cancéreuses .The invention relates to the prevention and treatment of colorectal cancers, and in particular to new means of detecting substances having carcinogenic properties, or on the contrary, anti-cancerous substances.
De par leur fréquence et leur gravité, les cancers du système digestif représentent un problème majeur en santé publique, notamment dans les pays occidentaux (cf. Le Livre Blanc de Gastroentérologie, Editions Masson, 2001) . En France, le nombre annuel de nouveaux cas est estimé à 55.000, soit 25% de l'ensemble des cancers, et le nombre de décès à 40000, soit 30% des décès par cancer et 8% de l'ensemble des décès. Les cancers colorectaux occupent une place prépondérante parmi les cancers du système digestif. En France, environ 200.000 personnes sont atteintes ou ont été atteintes d'un cancer colorectal, dont 50.000 au cours des cinq dernières années. De plus, l'incidence de ces cancers augmente puisqu'ils sont passés de 24.900 en 1975 à 33.400 en 1995.Due to their frequency and severity, cancers of the digestive system represent a major public health problem, particularly in Western countries (cf. The White Book of Gastroenterology, Editions Masson, 2001). In France, the annual number of new cases is estimated at 55,000, or 25% of all cancers, and the number of deaths at 40,000, or 30% of cancer deaths and 8% of all deaths. Colorectal cancers occupy a prominent place among cancers of the digestive system. In France, around 200,000 people have or have had colorectal cancer, including 50,000 in the past five years. In addition, the incidence of these cancers is increasing since they increased from 24,900 in 1975 to 33,400 in 1995.
L'épithélium intestinal est un système en renouvellement cellulaire permanent, à partir de cellules souches localisées dans les cryptes. L'altération du processus de prolifération et de différenciation de l'épithélium peut conduire à l'apparition de cancers colorectaux. L'apparition des tumeurs colorectales obéit à des séquences histo-pathologiques caractéristiques aboutissant au carcinome.The intestinal epithelium is a system in permanent cellular renewal, from stem cells located in the crypts. The alteration of the proliferation and differentiation process of the epithelium can lead to the appearance of colorectal cancers. The appearance of colorectal tumors obeys characteristic histopathological sequences leading to carcinoma.
L'initiation et la progression des cancers colorectaux résultent de l'apparition et de l'accumulation de mutations de gènes suppresseurs de tumeurs, et/ou d'oncogènes tels que APCr K-ras, TP53, Bcl2, et/ou de mutations au niveau des gènes de réparation de l'ADN comme Msh2 et ' Mlhl (CHUNG, Gastroenterology, 119, 854-865, 2000) . Les gènes mentionnés ci-dessus sont impliqués non seulement dans les cancers colorectaux, mais également dans des cancers affectant de nombreux autres tissus ou organes comme le système hématopoïétique, le foie, la vessie, le sein etc. Jusqu'à présent, aucun gène exprimé spécifiquement dans l'épithélium intestinal n'a été identifié pour son implication dans les cancers colorectaux.The initiation and progression of colorectal cancers result from the appearance and accumulation of mutations in tumor suppressor genes, and / or oncogenes such as APC r K-ras, TP53, Bcl2, and / or mutations at the level of DNA repair genes such as Msh2 and ' Mlhl (CHUNG, Gastroenterology, 119, 854-865, 2000). The above mentioned genes are involved not only in colorectal cancers, but also in cancers affecting many other tissues or organs such as the hematopoietic system, liver, bladder, breast etc. So far, no gene specifically expressed in the intestinal epithelium has been identified for its involvement in colorectal cancers.
Plusieurs modèles ont été établis chez la souris afin de reproduire les altérations génétiques décrites dans les cancers colorectaux chez l'homme, et d'étudier les mécanismes moléculaires impliqués dans l'initiation et/ou la progression des tumeurs colorectales . A titre d'exemples, on citera : - les souris présentant des mutations au niveau du gène APC. La perte de fonction du gène suppresseur de tumeurs APC est considérée comme l'événement principal et initiateur dans la grande majorité des cancers colorectaux sporadiques chez l'homme et dans la polypose adenomateuse familiale. Les souris déficientes pour le gène APC développent des adénomes intestinaux. Cependant, ces adénomes apparaissent presque exclusivement dans l'intestin grêle, alors que les tumeurs humaines sont essentiellement colo-rectales (SHOEMACKER et al., BBΛ-Reviews on Cancer, 1332, F25- F48, , 1997) .Several models have been established in mice in order to reproduce the genetic alterations described in colorectal cancers in humans, and to study the molecular mechanisms involved in the initiation and / or progression of colorectal tumors. Examples include: - mice with mutations in the APC gene. The loss of function of the APC tumor suppressor gene is considered to be the main initiating event in the vast majority of sporadic colorectal cancers in humans and in familial adenomatous polyposis. Mice deficient in the APC gene develop intestinal adenomas. However, these adenomas appear almost exclusively in the small intestine, whereas human tumors are essentially colorectal (SHOEMACKER et al., BBΛ-Reviews on Cancer, 1332, F25- F48,, 1997).
- les souris transgéniques exprimant une forme oncogénique de K-ras . Chez l'homme, la mutation conduisant à l'activation constitutive du proto-oncogène K-ras est un événement fréquent et précoce au cours du processus tumoral. Les souris transgéniques exprimant une forme oncogénique de K-ras présentent des adénocarcinomes au niveau de l'intestin grêle (JANSSEN et al. Gastroenterology, 123 : 492-504 , 2002. - les souris invalidées pour le gène suppresseur de tumeur TP53. Bien que la perte de fonction de p53 soit un événement majeur de la progression des cancers colorectaux chez l'homme, ces souris ne développent pas spontanément de carcinomes mais des lymphomes (HARVEY et al., Na t . Genêt , 9, 305-311, 1995) ;- transgenic mice expressing an oncogenic form of K-ras. In humans, the mutation leading to the constitutive activation of the proto-oncogene K-ras is a frequent and early event during the tumor process. Transgenic mice expressing an oncogenic form of K-ras have adenocarcinomas in the small intestine (JANSSEN et al. Gastroenterology, 123: 492-504, 2002. - mice disabled for the tumor suppressor gene TP53. loss of p53 function is a major event in the progression of colorectal cancers in humans, these mice do not spontaneously develop carcinomas but lymphomas (HARVEY et al., Na t. Genêt, 9, 305-311, 1995);
- les souris invalidées pour le gène Smad3, un gène impliqué dans la voie de signalisation du TGFβ, développent spontanément des adénocarcinomes coliques invasifs (ZHU et al., Cell f 94, 703-714, 1998). Cependant, il n'existe pas de preuves actuellement que ce gène soit impliqué dans la cancérogenèse colorectale chez l'homme ;- mice disabled for the Smad3 gene, a gene involved in the TGFβ signaling pathway, spontaneously develop invasive colic adenocarcinomas (ZHU et al., Cell f 94, 703-714, 1998). However, there is currently no evidence that this gene is implicated in colorectal carcinogenesis in humans;
- les souris invalidées pour le gène msh2, qui est un élément important du système de réparation de l'ADN, fréquemment muté dans les cancers du côlon présentant le phénotype d'instabilité micro-satellitaire. Ces souris ne développent que peu de tumeurs intestinales, mais des lymphomes (DE WIND et al., Cancer Res, 58, 248-255, 1998) ;- mice invalidated for the msh2 gene, which is an important element of the DNA repair system, frequently mutated in colon cancers presenting the phenotype of micro-satellite instability. These mice develop only small intestinal tumors, but lymphomas (DE WIND et al., Cancer Res, 58, 248-255, 1998);
- les souris invalidées pour le gène de mucine muc2 , qui développent spontanément' et à une faible fréquence des tumeurs intestinales. Certaines tumeurs sont localisées dans le côlon, mais la majorité d'entre elles se développe dans l'intestin grêle (VELCICH et al., Science, 295, 1726-1729, 2002) .- mice disabled for the mucin muc2 gene, which develop spontaneously and at a low frequency of intestinal tumors. Some tumors are located in the colon, but the majority of them develop in the small intestine (VELCICH et al., Science, 295, 1726-1729, 2002).
Il apparaît donc que ces modèles reproduisent imparfaitement le processus tumoral qui se déroule principalement dans le côlon distal chez l'homme, puisque les souris mutantes présentent principalement des tumeurs dans l'intestin grêle ou des lymphomes.It therefore appears that these models imperfectly reproduce the tumor process which takes place mainly in the distal colon in humans, since the mutant mice present mainly tumors in the small intestine or lymphomas.
Le gène Cdx2 code pour un facteur de transcription à homéo-domaine, qui intervient dans le développement de nombreux organes chez l'embryon. Son expression est ensuite restreinte à l'endoderme chez le fœtus et à l'épithélium intestinal chez l'adulte. Chez le fœtus, il exerce une fonction homéotique importante qui consiste à définir la région de l'endoderme qui génère l'intestin (intestin grêle et côlon). Ceci est démontré par l' hétéro-différenciation gastrique qui résulte de l'haplo-insuffisance de Cdx2 dans l'épithélium intestinalThe Cdx2 gene codes for a homeo-domain transcription factor, which is involved in the development of many organs in the embryo. Its expression is then restricted to the endoderm in the fetus and to the intestinal epithelium in adults. In the fetus, it exercises an important homeotic function which consists in defining the region of the endoderm which generates the intestine (small intestine and colon). This is demonstrated by the gastric hetero-differentiation which results from Cdx2 haplo-insufficiency in the intestinal epithelium
(BECK et al., Proc . Na tl . Acad. Sci . USA, 96, 7318-7323,(BECK et al., Proc. Na tl. Acad. Sci. USA, 96, 7318-7323,
1999 ; TAMAI et al., Cancer Res, 59, 2965-2970, 1999) et par l' hétéro-différenciation de l'épithélium gastrique en épithélium intestinal provoquée par l'expression ectopique de Cdx2 dans l'estomac (MUTOH et al., BBRC,1999; TAMAI et al., Cancer Res, 59, 2965-2970, 1999) and by the hetero-differentiation of the gastric epithelium into intestinal epithelium caused by the ectopic expression of Cdx2 in the stomach (MUTOH et al., BBRC ,
294, 470-479, 2002 ; SILBERG et al., Gastroenterology,294, 470-479, 2002; SILBERG et al., Gastroenterology,
122, 689-696, 2002). Dans l'intestin adulte, le niveau d'expression de Cdx2 augmente du duodénum à la partie proximale du côlon, puis diminue dans le côlon distal. En outre, la protéine CDX2 présente un gradient croissant le long de l'axe de prolifération-différenciation cellulaire, depuis les cellules prolifératives situées dans le fond des cryptes vers les cellules différenciées de l'épithélium de surface (SILBERG et al.,122, 689-696, 2002). In the adult intestine, the level of expression of Cdx2 increases from the duodenum to the proximal part of the colon, then decreases in the distal colon. In addition, the CDX2 protein presents an increasing gradient along the proliferation-cell differentiation axis, from the proliferative cells located in the bottom of the crypts to the differentiated cells of the surface epithelium (SILBERG et al.,
Gastroenterology, 2002, précité) . En accord avec cette distribution, CDX2 exerce une fonction régulatrice deGastroenterology, 2002, supra). In accordance with this distribution, CDX2 exercises a regulatory function of
1' homéostasie intestinale en réduisant la prolifération et en stimulant la différenciation cellulaire (SUH et al., Mol Cell Biol , 16, 619-625, 1996 ; LORENTZ et al., JIntestinal homeostasis by reducing proliferation and stimulating cell differentiation (SUH et al., Mol Cell Biol, 16, 619-625, 1996; LORENTZ et al., J
Cell Biol , 139, 1553-1565, 1997 ; MALLO et al., J BiolCell Biol, 139, 1553-1565, 1997; MALLO et al., J Biol
Chem, 273, 14030-14036, 1998).Chem, 273, 14030-14036, 1998).
Chez la souris, la déficience complèteIn mice, complete impairment
(homozygote) en Cdx2 entraîne une létalité embryonnaire précoce. En revanche, les souris hétérozygotes Cdx2 +/- sont viables et fertiles (CHA ENGSAKSOPHAK et al.,(homozygous) at Cdx2 leads to early embryonic lethality. In contrast, heterozygous Cdx2 +/- mice are viable and fertile (CHA ENGSAKSOPHAK et al.,
Na ture, 385, 84-87, 1998). Elles présentent des anomalies du développement, qui, au niveau du tube digestif, se manifestent principalement par l'apparition, dès la naissance, de structures initialement décrites comme de nature adenomateuse (CHAWENGSAKSOPHAK et al., 1998, précité ; Demande PCT WO 98/09510) , puis réévaluées et identifiées par la suite (BECK et al., 1999, précité) comme des structures hétéroplasiques de type gastrique. Ces structures sont principalement localisées dans l'iléon, le cœcum et le côlon, c'est-à-dire dans la zone où l'expression normale de CDX2 est maximale. Parallèlement, il a été observé' que l'expression de Cdx2 diminuait dans les cancers colorectaux chez l'homme ainsi que dans les cancers chimio-induits chez le rat (EE et al., Am J Pa thol , 147, 586-592, 1995), et était totalement abolie dans les carcinomes colorectaux à grandes cellules (HINOI et al., Am J Pathol , 159, 2239-2248, 2001) . La baisse progressive d'expression observée dans les cancers colorectaux est corrélée au grade de la tumeur (EE et al., Am J Pa thol , 1995, précité) .Na ture, 385, 84-87, 1998). They present developmental anomalies, which, in the digestive tract, are mainly manifested by the appearance, from birth, of structures initially described as of adenomatous nature (CHAWENGSAKSOPHAK et al., 1998, cited above; PCT application WO 98 / 09510), then reassessed and subsequently identified (BECK et al., 1999, cited above) as heteroplastic structures of the gastric type. These structures are mainly located in the ileum, the cecum and the colon, i.e. in the area where the normal expression of CDX2 is maximum. Meanwhile, it has been found 'that the expression of Cdx2 decreased in colorectal cancers in humans as well as in cancer chemotherapy-induced rats (EE et al., Am J Pa thol, 147, 586-592, 1995), and was completely abolished in large cell colorectal carcinomas (HINOI et al., Am J Pathol, 159, 2239-2248, 2001). The progressive drop in expression observed in colorectal cancers is correlated with the grade of the tumor (EE et al., Am J Pa thol, 1995, cited above).
Les mutations dans le gène Cdx2 sont rares dans les lignées de cellules tumorales intestinales, et la fréquence des réarrangements génomiques au locus Cdx2 est faible (YAGI et al., Bri t J Cancer, 79, 440-444, 1999 ; SIVAGNANASUNDARAM et al., Brit J Cancer, 84, 218- 225, 2002) . Il a par ailleurs été observé que l'expression de Cdx2 dans les cellules cancéreuses coliques était inhibée par l'activation de voies oncogeniques, telles que Ras (LORENTZ et al., Oncogene, 18, 87-92, 1999). Inversement, l'expression de CDX2 est stimulée par le butyrate, un agent pro-apoptotique et différenciant considéré comme protecteur vis-à-vis de la cancérogenèse colique (DOMON-DELL et al., Gut , 50, 525- 529, 2002), et par le suppresseur de tumeurs APC (DACOSTA et al. Oncogene, 18, 5010-5014, 1999 ; Demande PCT WO 00/70089). L'ensemble de ces observations suggère que la chute d'expression de Cdx2 dans les cancers colorectaux résulte principalement de phénomènes de régulation négative par des voies de signalisation oncogeniques et. non de mutations et/ou de recombinaisons génomiques au niveau du locus Cdx2.Mutations in the Cdx2 gene are rare in intestinal tumor cell lines, and the frequency of genomic rearrangements at the Cdx2 locus is low (YAGI et al., Bri t J Cancer, 79, 440-444, 1999; SIVAGNANASUNDARAM et al. , Brit J Cancer, 84, 218-225, 2002). It has also been observed that the expression of Cdx2 in colon cancer cells is inhibited by the activation of oncogenic pathways, such as Ras (LORENTZ et al., Oncogene, 18, 87-92, 1999). Conversely, the expression of CDX2 is stimulated by butyrate, a pro-apoptotic and differentiating agent considered to be protective against colon carcinogenesis (DOMON-DELL et al., Gut, 50, 525-529, 2002) , and by the APC tumor suppressor (DACOSTA et al. Oncogene, 18, 5010-5014, 1999; PCT application WO 00/70089). All of these observations suggest that the drop in expression of Cdx2 in colorectal cancers results mainly from negative regulation phenomena by oncogenic and signaling pathways. no mutations and / or genomic recombinations at the Cdx2 locus.
Le rôle joué par la protéine CDX2 dans le contrôle de l'équilibre entre la prolifération et la différenciation cellulaire, le fait que le niveau d'expression de Cdx2 chute dans les cancers colorectaux, et le fait qu'il soit la cible de voies de signalisation pro-oncogéniques ont conduit différentes équipes à émettre l'hypothèse selon laquelle Cdx2 exercerait une fonction de gène suppresseur de tumeurs dans l'épithélium intestinal, et à proposer son utilisation dans le cadre du dépistage ou du traitement des tumeurs colorectales . La Demande PCT WO 98/09510 propose ainsi l'utilisation d'animaux portant une mutation dans un allèle du gène Cdx2 comme modèle d' étude du cancer du colon ; la détection de mutations dans le gène Cdx2 pour le diagnostic d'une prédisposition au cancer du colon, ; le traitement du cancer du colon par surexpression du gène Cdx2. La demande PCT WO 00/70089 propose l'utilisation de Cdx2 dans le cadre du traitement de cancers impliquant des allèles mutants du gène APC.The role played by the CDX2 protein in controlling the balance between proliferation and cell differentiation, the fact that the level of expression of Cdx2 falls in colorectal cancers, and the fact that it is the target of pathways of pro-oncogenic signaling led different teams to hypothesize that Cdx2 exerts a tumor suppressor gene function in the intestinal epithelium, and to propose its use in the context of the detection or treatment of colorectal tumors. PCT Application WO 98/09510 thus proposes the use of animals carrying a mutation in an allele of the Cdx2 gene as a model for studying colon cancer; the detection of mutations in the Cdx2 gene for the diagnosis of a predisposition to colon cancer,; the treatment of colon cancer by overexpression of the Cdx2 gene. PCT application WO 00/70089 proposes the use of Cdx2 in the context of the treatment of cancers involving mutant alleles of the APC gene.
Bien que la fonction suppresseur de tumeurs du gène Cdx2 apparaisse probable au vu des différentes observations rapportées, elle était cependant considérée par certains auteurs comme d' importance mineure au regard du faible taux de mutation de ce gène dans les cancers colorectaux (YAGI et al. précité). En outre, elle n'avait jusqu'à présent pas été démontrée in vivo, et les conditions dans lesquelles pouvait s'exercer cette fonction étaient inconnues.Although the tumor suppressor function of the Cdx2 gene appears probable in the light of the various observations reported, it was nevertheless considered by certain authors to be of minor importance in view of the low mutation rate of this gene in colorectal cancers (YAGI et al. supra). Furthermore, it had so far not been demonstrated in vivo, and the conditions under which this function could be exercised were unknown.
Afin d'étudier le rôle joué par le gène Cdx2 dans la suppression tumorale in vivo, les Inventeurs ont utilisé des souris hétérozygotes Cdx2 +/-, sous-exprimant ce gène. Ils ont recherché l'apparition de tumeurs spontanées -chez ces souris. La surveillance de plusieurs générations de souris sur une période de 3 ans n'a révélé aucune formation spontanée d'adénome ou d' adénocarcinome dans l'intestin grêle ou dans le côlon, y compris chez les animaux âgés.In order to study the role played by the Cdx2 gene in tumor suppression in vivo, the Inventors used heterozygous Cdx2 +/- mice, under-expressing this gene. They looked for the appearance of spontaneous tumors in these mice. Monitoring of several generations of mice over a period of 3 years did not reveal any spontaneous formation of adenoma or adenocarcinoma in the small intestine or in the colon, including in elderly animals.
En revanche, les Inventeurs ont constaté que lorsque les souris hétérozygotes Cdx2 +/- et les animaux sauvages des mêmes fratries (Cdx2 +/+) étaient soumis à un traitement cancérogène à l' azoxyméthane (AOM) , on observait l'apparition de tumeurs chez la totalité des animaux Cdx2 +/- au bout de 12 semaines après la fin du traitement, alors qu'aucun des animaux sauvages ne présentait de tumeurs dans ces conditions.On the other hand, the inventors have found that when heterozygous mice Cdx2 +/- and wild animals of the same siblings (Cdx2 + / +) were subjected to carcinogenic treatment with azoxymethane (AOM), the appearance of tumors was observed. in all animals Cdx2 +/- after 12 weeks after the end of treatment, whereas none of the wild animals presented tumors under these conditions.
Ces tumeurs sont localisées dans la moitié distale du côlon. Elles ne dérivent pas de la transformation pathologique des structures hétéroplasiques gastriques situées au niveau de l'iléon et du côlon proximal. Les tumeurs les plus petites correspondent à des structures adénomateuses, dans lesquelles l'expression de la protéine CDX2 est fortement réduite, tandis que les plus grandes sont des adénocarcinomes intra-muqueux invasifs où l'expression de CDX2 est réduite, voire absente. La localisation l'évolution tumorale des tumeurs présentes chez les souris Cdx2 +/- traitées à l'AOM reproduisent celles classiquement décrites dans la majorité des cancers colorectaux sporadiques chez l'homme.These tumors are located in the distal half of the colon. They do not derive from the pathological transformation of heteroplasic gastric structures located at the level of the ileum and the proximal colon. The smallest tumors correspond to adenomatous structures, in which the expression of the CDX2 protein is greatly reduced, while the largest are invasive intra-mucosal adenocarcinomas where the expression of CDX2 is reduced, or even absent. The localization of the tumor evolution of the tumors present in the Cdx2 +/- mice treated with AOM reproduce those conventionally described in the majority of sporadic colorectal cancers in humans.
Ces résultats mettent en évidence une nouvelle propriété résultant de l' haplo-insuffisance du gène Cdx2 chez la souris : la sensibilité accrue vis-à-vis de la cancerogenese colorectale. Cdx2 est donc un gène suppresseur des tumeurs intestinales dans le sens où la réduction de son expression facilite la progression tumorale colorectale. Il s'agit du premier gène exprimé spécifiquement dans l'épithélium intestinal chez l'adulte qui est identifié comme exerçant cette fonction.These results highlight a new property resulting from the haplo-insufficiency of the Cdx2 gene in mice: the increased sensitivity towards colorectal carcinogenesis. Cdx2 is therefore a suppressor gene for intestinal tumors in the sense that the reduction of its expression facilitates colorectal tumor progression. It is the first gene specifically expressed in the intestinal epithelium in adults which is identified as having this function.
Les souris hétérozygotes Cdx2 +/- dans lesquelles une seule copie du gène Cdx2 est invalidée représentent un bon modèle permettant d'étudier les effets de la réduction du niveau d'expression de ce gène, sur la cancerogenese colorectale impliquant des facteurs exogènes, par exemple la cancerogenese chimio-induite .Cdx2 +/- heterozygous mice in which only one copy of the Cdx2 gene is disabled represent a good model for studying the effects of the reduction in the level of expression of this gene, on colorectal carcinogenesis involving exogenous factors, for example chemo-induced carcinogenesis.
La présente invention a en conséquence pour objet l'utilisation d'un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé (hétérozygote Cdx2+/-) , pour tester le pouvoir cancérogène d'un facteur ou d'une combinaison de facteurs exogène (s) . La présente invention a également pour objet l'utilisation d'un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé, traité à l'aide d'un agent cancérogène, pour tester l'activité anticancéreuse d'un facteur ou d'une combinaison de facteurs exogène (s).The present invention therefore relates to the use of a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated (heterozygous Cdx2 +/-), to test the carcinogenic power of a factor or a combination of exogenous factors. The present invention also relates to the use of a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated, treated with a carcinogenic agent, to test the anticancer activity of an exogenous factor or combination of factors.
Avantageusement ledit mammifère est une souris .Advantageously, said mammal is a mouse.
Le facteur exogène testé peut être une molécule ou un mélange de molécules, un aliment ou régime alimentaire, ou un traitement physique, par exemple une irradiation.The exogenous factor tested can be a molecule or a mixture of molecules, a food or diet, or a physical treatment, for example irradiation.
La présente invention a plus particulièrement pour objet : - selon une première variante, un procédé pour tester un facteur ou une combinaison de facteurs potentiellement cancérogène, caractérisé en ce qu'il comprend l'administration dudit facteur ou de ladite combinaison à un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé, et la détection de la présence ou de l'absence de tumeurs dans le colon dudit mammifère ;The present invention more particularly relates to: - according to a first variant, a method for testing a factor or a combination of potentially carcinogenic factors, characterized in that it comprises the administration of said factor or of said combination to a non-mammalian human in which one of the two alleles of the Cdx2 gene is inactivated, and detecting the presence or absence of tumors in the colon of said mammal;
- selon une seconde variante, un procédé pour tester un facteur ou une combinaison de facteurs potentiellement anti-cancéreux, caractérisé en ce qu'il comprend : a) l'administration d'un agent cancérogène à un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé ; b) l'administration audit mammifère du facteur ou de la combinaison de facteurs à tester ; c) la détection de la présence ou de l'absence de tumeurs dans le colon dudit mammifère.- According to a second variant, a method for testing a factor or a combination of potentially anti-cancer factors, characterized in that it comprises: a) the administration of a carcinogenic agent to a non-human mammal in which the one of the two alleles of the Cdx2 gene is inactivated; b) the administration to said mammal of the factor or of the combination of factors to be tested; c) detecting the presence or absence of tumors in the colon of said mammal.
Les étapes a) et b) de cette seconde variante peuvent être mises en œuvre consécutivement dans un ordre quelconque, ou simultanément. Généralement, dans le cadre de la mise en œuvre de la présente invention, le mammifère utilisé est sacrifié à la fin de l'expérimentation. La détection de la présence ou de l'absence de tumeurs peut s'effectuer après le sacrifice de l'animal, ou en cours d'expérimentation, par biopsie ou par exploration non- invasive, par exemple par échographie. Ces tumeurs sont des adénocarcinomes, qui peuvent être à différents stades de leur évolution. Selon un mode de mise en œuvre préféré de l'une ou l'autre des variantes d'un procédé conforme à l'invention, ledit mammifère est une souris.Steps a) and b) of this second variant can be implemented consecutively in any order, or simultaneously. Generally, in the context of the implementation of the present invention, the mammal used is sacrificed at the end of the experiment. The presence or absence of tumors can be detected after the animal has been sacrificed, or during the experiment, by biopsy or by non-invasive exploration, for example by ultrasound. These tumors are adenocarcinomas, which can be at different stages of their development. According to a preferred embodiment of one or other of the variants of a method according to the invention, said mammal is a mouse.
Selon un mode de mise en œuvre préféré de la seconde variante, l'agent cancérogène mis en œuvre à l'étape a) est l' azoxyméthane ; on peut également utiliser d' autres agents cancérogènes ; à titre d'exemples non-limitatifs, on citera le diméthylhydrazineAccording to a preferred embodiment of the second variant, the carcinogenic agent used in step a) is azoxymethane; other carcinogens can also be used; by way of nonlimiting examples, mention will be made of dimethylhydrazine
(DMH) et le dextrane sulfate de sodium (DSS) . On peut de manière plus générale utiliser tout agent identifié comme capable d'induire la formation de tumeurs par mise en œuvre de la première variante du procédé conforme à(DMH) and sodium dextran sulfate (DSS). More generally, any agent identified as capable of inducing the formation of tumors can be used by implementing the first variant of the process in accordance with
1 ' invention.1 invention.
La quantité d'agent cancérogène à administrer à l'étape a) doit bien entendu être suffisante pour induire la formation de tumeurs en l'absence de tout autre traitement ; cette quantité peut également être déterminée par mise en œuvre de la première variante du procédé conforme à l'invention.The quantity of carcinogenic agent to be administered in step a) must of course be sufficient to induce the formation of tumors in the absence of any other treatment; this quantity can also be determined by implementing the first variant of the process according to the invention.
La présente invention a également pour objet un mammifère non-humain, en particulier une souris, dans lequel l'un des deux allèles du gène Cdx2 est inactivé, et auquel un agent cancérogène a été administré.The present invention also relates to a non-human mammal, in particular a mouse, in which one of the two alleles of the Cdx2 gene is inactivated, and to which a carcinogenic agent has been administered.
La présente invention sera mieux comprise à l'aide du complément de description qui va suivre, qui se réfère à des exemples illustrant l'induction chez des souris hétérozygotes Cdx2 +/-, de tumeurs colorectales par administration d' azoxyméthane, et la caractérisation des tumeurs induites.The present invention will be better understood using the additional description which follows, which refers to examples illustrating the induction in heterozygous mice Cdx2 +/-, of colorectal tumors by administration of azoxymethane, and the characterization of induced tumors.
EXEMPLE 1 : INDUCTION TUMORALE CHEZ DES SOURIS CDX2 +/- TRAITEES A L'AZOXYMETHANE . Les souris hétérozygotes Cdx2 +/- utilisées dans ces expérimentations sont décrites dans les publications de CHAWENGSAKSOPHAK et al., (1998, précité) et BECK et al., (1999, précité) ainsi que dans la Demande PCT WO 98/09510. Ces souris sont hébergées dans des conditions standard, avec un cycle jour/nuit de 12 heures, et reçoivent une alimentation normale.EXAMPLE 1 TUMOR INDUCTION IN CDX2 +/- MOUSE TREATED WITH AZOXYMETHANE. The heterozygous Cdx2 +/- mice used in these experiments are described in the publications of CHAWENGSAKSOPHAK et al., (1998, cited above) and BECK et al., (1999, cited above) as well as in PCT Application WO 98/09510. These mice are housed under standard conditions, with a 12-hour day / night cycle, and receive a normal diet.
Ces souris présentent des structures hétéroplasiques de type gastrique caractéristiques, localisées dans l'iléon, le cœcum, et dans le côlon proximal.These mice have characteristic heteroplastic structures of the gastric type, located in the ileum, the coecum, and in the proximal colon.
La surveillance de générations consécutives de souris hétérozygotes Cdx2 +/- sur une période de 3 ans n'a révélé aucune évolution pathologique de ces hétéroplasies, et aucune formation spontanée d'adénomes ou d' adénocarcinomes à d'autres endroits de l'intestin grêle ou du côlon. L' haplo-insuffisance de Cdx2 ne semble donc pas en soi induire l'initiation du processus tumoral dans le côlon.Monitoring of consecutive generations of heterozygous Cdx2 +/- mice over a period of 3 years revealed no pathological evolution of these heteroplasias, and no spontaneous formation of adenomas or adenocarcinomas in other places of the small intestine or colon. The haplo-insufficiency of Cdx2 does not therefore seem in itself to induce the initiation of the tumor process in the colon.
Afin d'étudier si l' haplo-insuffisance de Cdx2 pouvait jouer un rôle dans la progression d'un processus tumoral initié par des facteurs exogènes, des souris hétérozygotes Cdx2 +/- et des animaux sauvages des mêmes fratries (Cdx2 +/+) , âgés de 2 à 3 mois, ont été soumis à un traitement cancérogène à l' azoxyméthane (AOM) . L'AOM est un agent pro-cancérogène couramment utilisé pour l'induction expérimentale de tumeurs chez le rat ou la souris. Son administration provoque l'apparition de cryptes aberrantes dans le côlon, qui sont considérées comme les signes initiateurs du processus tumoral. Le niveau de sensibilité des animaux vis-à-vis de l'apparition des tumeurs dépend du fond génétique (PAPANIKOLAOU et al., Carcinogenesis , 21, 1567-1572, 2000) . Les produits du métabolisme de l'AOM forment des adduits avec l'ADN qui entraînent des mutations au niveau d'oncogènes importants dans la cancerogenese colique comme les gènes de la β-caténine et de K-ras, ainsi que des instabilités micro-satellitaires (TAKAHASHI et al., Carcinogenesis, 21, 1319-1327 2000 ; LUCERI et al., Carcinogenesis , 21, 1753-1756, 2000) .In order to study whether the haplo-insufficiency of Cdx2 could play a role in the progression of a tumor process initiated by exogenous factors, heterozygous mice Cdx2 +/- and wild animals of the same siblings (Cdx2 + / +) , aged 2 to 3 months, were subjected to a carcinogenic treatment with azoxymethane (AOM). AOM is a pro-carcinogenic agent commonly used for the experimental induction of tumors in rats or mice. Its administration causes the appearance of aberrant crypts in the colon, which are considered to be the initiating signs of the tumor process. The level of sensitivity of animals to the appearance of tumors depends on the genetic background (PAPANIKOLAOU et al., Carcinogenesis, 21, 1567-1572, 2000). The products of the metabolism of AOM form adducts with DNA which lead to mutations at the level of important oncogenes in colon carcinogenesis such as the genes of β-catenin and of K-ras, as well as micro-satellite instabilities. (TAKAHASHI et al., Carcinogenesis, 21, 1319-1327 2000; LUCERI et al., Carcinogenesis, 21, 1753-1756, 2000).
L'AOM a été injecté par voie intrapéritonéale (10 mg/kg) à raison d'une injection hebdomadaire pendant cinq semaines. Les animaux ont été sacrifiés 12 semaines après la dernière injection.The AOM was injected intraperitoneally (10 mg / kg) as a weekly injection for five weeks. The animals were sacrificed 12 weeks after the last injection.
L' analyse macroscopique des structures hétéroplasiques présentes chez les animaux Cdx2 +/- ne fait apparaître aucune différence entre les animaux Cdx2 +/- traités par l'AOM et des animaux Cdx2 +/- témoins non-traités. De plus, l'analyse histo- pathologique ne montre aucune évolution de ces structures hétéroplasiques vers une transformation tumorale chez les souris Cdx2 +/- traitées par l'AOM.Macroscopic analysis of the heteroplastic structures present in Cdx2 +/- animals does not show any difference between Cdx2 +/- animals treated with AOM and Cdx2 +/- animals not treated. In addition, histopathological analysis does not show any evolution of these heteroplastic structures towards tumor transformation in Cdx2 +/- mice treated with AOM.
L'analyse systématique de l'intestin grêle et du côlon des animaux hétérozygotes Cdx2 +/- et des animaux sauvages (Cdx2 +/+) traités par l'AOM montre la présence de tumeurs exclusivement chez les animaux hétérozygotes Cdx2 +/-. Cent pour cent (n=9) des souris Cdx2 +/- présentent 3 à 12 tumeurs par animal, tandis qu'aucune des souris sauvages (n =9) ne présente de tumeur .Systematic analysis of the small intestine and colon of heterozygous animals Cdx2 +/- and wild animals (Cdx2 + / +) treated with AOM shows the presence of tumors exclusively in heterozygous animals Cdx2 +/-. One hundred percent (n = 9) of Cdx2 +/- mice have 3 to 12 tumors per animal, while none of the wild mice (n = 9) have tumors.
La taille de ces tumeurs varie de 1 à 4 mm de diamètre. Elles sont exclusivement localisées dans la portion distale du côlon. Aucune tumeur n'a été détectée dans le côlon proximal, le cœcum ou l'intestin grêle.The size of these tumors varies from 1 to 4 mm in diameter. They are exclusively located in the distal portion of the colon. No tumors were detected in the proximal colon, the coecum or the small intestine.
L' analyse histo-pathologique de ces tumeurs montre des structures tubulaires et glandulaires, tapissées par un épithelium simple polarisé, qui sont typiques des adénomes. Dans les tumeurs les plus grosses, les structures adénomateuses sont associées à des zones totalement désorganisées, correspondant à des régions carcinomateuses . Le franchissement de la couche musculaire muqueuse et l'envahissement de la sous- muqueuse par des formations épithéliales sont parfois observés, témoignant du caractère invasif de ces tumeurs.Histopathological analysis of these tumors shows tubular and glandular structures, lined by a simple polarized epithelium, which are typical of adenomas. In larger tumors, adenomatous structures are associated with areas totally disorganized, corresponding to carcinomatous regions. The crossing of the mucous muscular layer and the invasion of the submucosa by epithelial formations are sometimes observed, testifying to the invasive nature of these tumors.
La localisation de ces tumeurs dans la partie distale du côlon correspond à la localisation observée dans la majorité des cancers sporadiques de l'intestin chez l'homme. En outre, leur évolution, depuis l'adénome jusqu'à l' adénocarcinome et l'envahissement tumoral sous- muqueux, récapitule l'évolution tumorale classiquement décrite dans la majorité des cancers colorectaux sporadiques chez l'homme.The location of these tumors in the distal part of the colon corresponds to the location observed in the majority of sporadic intestinal cancers in humans. In addition, their evolution, from adenoma to adenocarcinoma and submucosal tumor invasion, recapitulates the tumor evolution classically described in the majority of sporadic colorectal cancers in humans.
EXEMPLE 2 : CARACTERISATION IMMUNO-HISTOLOGIQUE DES STRUCTURES HETEROPLASIQUES ET DES TUMEURS DES SOURIS CDX2 +/-EXAMPLE 2: IMMUNO-HISTOLOGICAL CHARACTERIZATION OF HETEROPLASTIC STRUCTURES AND TUMORS OF CDX2 +/- MICE
Afin de vérifier les résultats rapportés à l'Exemple 1, les structures hétéroplasiques et les formations tumorales adénomateuses et carcinomateuses observées chez les souris Cdx2 +/- traitées à l'AOM, ont été analysées par immuno-histologie, en utilisant l'antigène Ki67 comme marqueur de prolifération cellulaire, et la localisation intra-cellulaire de la β- caténine comme marqueur de transformation tumorale. L'analyse immunohistologique a été effectuée :In order to verify the results reported in Example 1, the heteroplastic structures and the adenomatous and carcinomatous tumor formations observed in the Cdx2 +/- mice treated with AOM, were analyzed by immunohistology, using the Ki67 antigen. as a marker of cell proliferation, and the intra-cellular localization of β-catenin as a marker of tumor transformation. The immunohistological analysis was carried out:
- pour l'antigène Ki67 à l'aide d'un anticorps monoclonal anti-Ki67 (NOVOCASTRA) , et du kit HISTOMOUSE (ZYMED LABORATORIES) ; pour la β-caténine, en utilisant un anticorps primaire anti-β-caténine (UPSTATE BIOTECHNOLOGY, dilution 1:150).- for the Ki67 antigen using a monoclonal anti-Ki67 antibody (NOVOCASTRA), and the HISTOMOUSE kit (ZYMED LABORATORIES); for β-catenin, using a primary anti-β-catenin antibody (UPSTATE BIOTECHNOLOGY, dilution 1: 150).
Les anticorps primaires sont révélés à l'aide d'anticorps secondaires appropriés (anti-souris ou antilapin) couplés à la biotine. La réaction est visualisée à l'aide du kitPrimary antibodies are revealed using appropriate secondary antibodies (anti-mouse or anti-rabbit) coupled with biotin. The reaction is visualized using the kit
VECTASTAIN ABC, utilisant le tétrachlorure de 3,3'- diaminobenzidine (DAKO) .VECTASTAIN ABC, using 3.3'- tetrachloride diaminobenzidine (DAKO).
Dans les structures hétéroplasiques de type gastrique :In gastric type heteroplastic structures:
- l'anticorps anti-Ki67 marque des groupes de cellules localisées à une position intermédiaire entre l'épithélium de surface et la profondeur de la glande, comparable à la localisation normale des cellules en prolifération dans l'épithélium gastrique ; l'anticorps anti-β-caténine marque exclusivement la périphérie des cellules épithéliales, dans les structures hétéroplasiques comme dans l'épithélium colique adjacent à ces structures. Ceci dénote une localisation strictement membranaire de la β- caténine dans ces structures, ce qui montre que le traitement à l'AOM n'induit aucune activation oncogénique de la voie de la β-caténine.- the anti-Ki67 antibody marks groups of cells located at an intermediate position between the surface epithelium and the depth of the gland, comparable to the normal location of proliferating cells in the gastric epithelium; the anti-β-catenin antibody exclusively marks the periphery of the epithelial cells, in heteroplastic structures as in the colonic epithelium adjacent to these structures. This indicates a strictly membrane localization of β-catenin in these structures, which shows that the treatment with AOM does not induce any oncogenic activation of the β-catenin pathway.
Dans les adénocarcinomes :In adenocarcinomas:
- le marquage par l'anticorps anti-Ki67 révèle une activité proliférative intense dans les zones adénomateuses et carcinomateuses ;- the labeling with the anti-Ki67 antibody reveals an intense proliferative activity in the adenomatous and carcinomatous areas;
- la localisation de la β-caténine demeure membranaire dans les zones adénomateuses ; en revanche, dans les zones carcinomateuses, on observe une localisation dans le cytoplasme et/ou dans le noyau, caractéristique de l'activation de cette voie oncogénique au cours du processus tumoral.- the localization of β-catenin remains membrane in the adenomatous areas; on the other hand, in the carcinomatous zones, a localization is observed in the cytoplasm and / or in the nucleus, characteristic of the activation of this oncogenic pathway during the tumor process.
Ces résultats confirment les observations macroscopique et histo-pathologiques rapportées à l'Exemple 1. II apparaît donc que le traitement par l'AOM des animaux Cdx2 +/- induit chez ceux-ci le développement d' adénocarcinomes invasifs, et que ce développement tumoral s'opère indépendamment de toute évolution maligne des structures hétéroplasiques de type gastrique observées chez ces souris. EXEMPLE 3 : EXPRESSION DE CDX2 DANS LES STRUCTURES HETEROPLASIQUES ET LES TUMEURS DES SOURIS CDX2 +/-These results confirm the macroscopic and histopathological observations reported in Example 1. It therefore appears that the treatment with AOM of the animals Cdx2 +/- induces in them the development of invasive adenocarcinomas, and that this tumor development operates independently of any malignant evolution of heteroplastic gastric type structures observed in these mice. EXAMPLE 3: EXPRESSION OF CDX2 IN HETEROPLASTIC STRUCTURES AND TUMORS OF CDX2 +/- MICE
L'expression de Cdx2 dans les structures et les formations tumorales adénomateuses et carcinomateuses observées chez les souris Cdx2 +/- traitées à l'AOM a été analysée par RT-PCR et immuno-histologie . Analyse par RT-PCRThe expression of Cdx2 in adenomatous and carcinomatous tumor structures and formations observed in Cdx2 +/- mice treated with AOM was analyzed by RT-PCR and immunohistology. RT-PCR analysis
Cette analyse a été effectuée sur de l'ARN extrait du cœcu de souris sauvages traitées ou non par l'AOM, ainsi que sur l'ARN extrait des structures hétéroplasiques de type gastrique présentes au niveau du cœcum des souris Cdx2 +/- traitées ou non par l'AOM, et sur l'ARN extrait des adénocarcinomes développés par trois souris Cdx2 +/- traitées par l'AOM, et de la muqueuse normale adjacente.This analysis was carried out on RNA extracted from the cœc of wild mice treated or not with AOM, as well as on RNA extracted from heteroplasic structures of gastric type present in the cecum of Cdx2 +/- mice treated or not by the AOM, and on the RNA extracted from the adenocarcinomas developed by three Cdx2 +/- mice treated with the AOM, and from the adjacent normal mucosa.
L'ARN est extrait en utilisant le TRI-REAGENT (MRC) , et analysé par RT-PCR semi-quantitative, selon le protocole décrit par LORENTZ et al. (J". Cell Biol . , 139,The RNA is extracted using TRI-REAGENT (MRC), and analyzed by semi-quantitative RT-PCR, according to the protocol described by LORENTZ et al. (J " . Cell Biol., 139,
1553-1565, 1997). L'amplification du transcrit Cdx2 est effectuée à l'aide des amorces suivantes:1553-1565, 1997). The amplification of the Cdx2 transcript is carried out using the following primers:
AAAGTGAGCTGGCTGCCACACTTG (SEQ ID NO: 1)AAAGTGAGCTGGCTGCCACACTTG (SEQ ID NO: 1)
TCCATCAGTAGATGCTGTTCGTGG (SEQ ID NO: 2)TCCATCAGTAGATGCTGTTCGTGG (SEQ ID NO: 2)
Les résultats sont illustrés par la Figure 1 (A et B) .The results are illustrated in Figure 1 (A and B).
Légende de la Figure 1 :Figure 1 legend:
1 A :1 A:
Piste 1 : muqueuse cœcale de souris sauvages non- traitées ; Piste 2 : muqueuse cœcale de souris sauvages traitées par l'AOM ;Lane 1: cecal mucosa of untreated wild mice; Lane 2: cecal mucosa of wild mice treated with AOM;
Piste 3 : structures hétéroplasiques de souris Cdx2 +/- non-traitées ;Lane 3: heteroplasic structures of untreated Cdx2 +/- mice;
Piste 4 : structures hétéroplasiques de souris Cdx2 +/- traitées par l'AOM ;Lane 4: heteroplastic structures of Cdx2 +/- mice treated with AOM;
1 B : Pistes 1, 2, 3 : adénocarcinomes de souris Cdx2 +/- traitées par l'AOM ;1 B: Lanes 1, 2, 3: adenocarcinomas of Cdx2 +/- mice treated with AOM;
Piste 4, 5, 6 : muqueuses normales de souris Cdx2 +/- traitées par l'AOM ; Ces résultats montrent que le gène Cdx2 est exprimé dans la muqueuse cœcale des souris de type sauvage, mais non dans les structures hétéroplasiques des souris Cdx2 +/- ; cette expression est indépendante du traitement par l'AOM (Figure 1 A) ; dans la muqueuse normale adjacente aux adénocarcinomes des souris Cdx2 +/- traitées par l'AOM, l'expression du gène Cdx2 est clairement détectable alors qu'elle est fortement réduite dans les adénocarcinomes (Figure 1 B) . Analyse immunohistologique Cette analyse a été effectuée en utilisant un anticorps primaire anti-CDX2 (BIOGENEX, dilution 1:100), et un anticorps secondaire anti-lapin couplé à la biotine. La réaction est visualisée comme indiqué à l'exemple 2 pour la β-caténine. Dans les structures hétéroplasiques de type gastrique, l'anticorps anti-CDX2 ne révèle aucun marquage ; en revanche, dans l'épithélium adjacent, on observe clairement un marquage localisé au niveau des noyaux cellulaires. L'absence d'expression de Cdx2 dans les structures hétéroplasiques des souris Cdx2 +/- traitées ou non par l'AOM confirme les observations précédemment effectuées (BECK et al., 1999, précité) chez ces souris non-traitées . Dans les zones adénomateuses, l'anticorps anti-CDX2 marque seulement une proportion faible des glandes, variable selon les échantillons ; dans les zones carcinomateuses, aucun marquage n'est mis en évidence par l'anticorps anti-CDX2. Ces résultats confirment l'analyse par RT-PCR, et montrent que l'expression de la protéine CDX2 est fortement réduite et irrégulière dans les zones adénomateuses, et absente dans les zones carcinomateuses.Lane 4, 5, 6: normal mucous membranes of Cdx2 +/- mice treated with AOM; These results show that the Cdx2 gene is expressed in the cecal mucosa of wild-type mice, but not in the heteroplasic structures of Cdx2 +/- mice; this expression is independent of treatment with AOM (Figure 1 A); in the normal mucosa adjacent to the adenocarcinomas of Cdx2 +/- mice treated with AOM, the expression of the Cdx2 gene is clearly detectable while it is greatly reduced in adenocarcinomas (Figure 1B). Immunohistological analysis This analysis was carried out using a primary anti-CDX2 antibody (BIOGENEX, dilution 1: 100), and a secondary anti-rabbit antibody coupled to biotin. The reaction is visualized as indicated in Example 2 for β-catenin. In heteroplastic structures of the gastric type, the anti-CDX2 antibody does not reveal any labeling; on the other hand, in the adjacent epithelium, a localized marking is clearly observed in the cell nuclei. The absence of expression of Cdx2 in the heteroplastic structures of Cdx2 +/- mice treated or not treated with AOM confirms the observations previously made (BECK et al., 1999, cited above) in these untreated mice. In the adenomatous zones, the anti-CDX2 antibody marks only a small proportion of the glands, which varies according to the samples; in carcinomatous areas, no labeling is demonstrated by the anti-CDX2 antibody. These results confirm the analysis by RT-PCR, and show that the expression of the CDX2 protein is strongly reduced and irregular in the adenomatous areas, and absent in the carcinomatous areas.
Afin de déterminer si la perte d'expression de Cdx2 dans les zones adénomateuses et carcinomateuses résulte d'une perte du gène ou d'une régulation négative, l'ADN génomique de cellules isolées de la zone adenomateuse, de la zone carcinomateuse, et de la muqueuse normale adjacente de 3 animaux différents a été analysé par PCR, en utilisant des amorces permettant l'amplification des 3 exons du gène Cdx2. Chez les trois animaux, des fragments d'amplification identiques ont été obtenus, quelle que soit l'origine de l'échantillon d'ADN génomique (zone adenomateuse, zone carcinomateuse, muqueuse normale) . Ceci montre que la progression tumorale et la perte de l'expression de Cdx2 ne découlent pas de la perte de l'allèle Cdx2 restant dans les souris Cdx2 +/-. En outre, les fragments de PCR obtenus à partir des échantillons d'ADN d'origine carcinomateuse ont été séquences et leurs séquences comparées à celles des fragments obtenus à partir des échantillons issus de la muqueuse normale adjacente. Aucune différence entre les séquences n'a été observée, ce qui montre que la progression tumorale n'est pas la conséquence d'une mutation dans la séquence codante de Cdx2. Le fait que la perte de l'expression de la protéine CDX2 ne résulte pas de la perte ou de l'altération du gène Cdx2 confirme l'intérêt du modèle associant des souris Cdx2 +/- et le traitement à l'AOM pour l'étude des tumeurs colorectales humaines, dans lesquelles la réduction d'expression de Cdx2 se produit également sans altération au niveau génomique.In order to determine whether the loss of expression of Cdx2 in the adenomatous and carcinomatous zones results from a loss of the gene or from negative regulation, the genomic DNA of cells isolated from the adenomatous zone, from the carcinomatous zone, and from the adjacent normal mucosa of 3 different animals was analyzed by PCR, using primers allowing the amplification of the 3 exons of the Cdx2 gene. In the three animals, identical amplification fragments were obtained, whatever the origin of the genomic DNA sample (adenomatous zone, carcinomatous zone, normal mucosa). This shows that the tumor progression and the loss of Cdx2 expression do not result from the loss of the Cdx2 allele remaining in Cdx2 +/- mice. In addition, the PCR fragments obtained from DNA samples of carcinomatous origin were sequenced and their sequences compared to those of the fragments obtained from samples from the adjacent normal mucosa. No difference between the sequences was observed, which shows that the tumor progression is not the consequence of a mutation in the coding sequence of Cdx2. The fact that the loss of expression of the CDX2 protein does not result from the loss or alteration of the Cdx2 gene confirms the interest of the model associating Cdx2 +/- mice and the AOM treatment for the study of human colorectal tumors, in which the reduction of expression of Cdx2 also occurs without alteration at the genomic level.
L'ensemble des résultats ci-dessus permet de mettre en évidence deux fonctions distinctes de Cdx2 dans l'intestin : d'une part, une fonction homéotique au cours du développement intestinal, révélée par la formation des structures hétéroplasiques, et d'autre part, une fonction homéostatique dans le côlon adulte révélée par l'augmentation de la sensibilité à un agent pro- cancérogène. All of the above results make it possible to highlight two distinct functions of Cdx2 in the intestine: on the one hand, a homeotic function during intestinal development, revealed by the formation of heteroplastic structures, and on the other hand , a homeostatic function in the adult colon revealed by increased sensitivity to a carcinogenic agent.

Claims

REVENDICATIONS
1) Utilisation d'un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé (hétérozygote Cdx2+/-) , pour tester le pouvoir cancérogène d'un facteur ou d'une combinaison de facteurs exogène (s) .1) Use of a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated (heterozygote Cdx2 +/-), to test the carcinogenic power of an exogenous factor or combination of factors .
2) Utilisation d'un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé, traité à l'aide d'un agent cancérogène, pour tester l'activité anticancéreuse d'un facteur ou d'une combinaison de facteurs exogène (s).2) Use of a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated, treated with a carcinogenic agent, to test the anticancer activity of a factor or a combination exogenous factors.
3) Utilisation selon une quelconque des revendications 1 ou 2 caractérisée en ce que ledit mammifère est une souris. 4) Procédé pour tester un facteur ou une combinaison de facteurs potentiellement cancérogène, caractérisé en ce qu'il comprend l'administration dudit facteur ou de ladite combinaison à un mammifère non- humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé, et la détection de la présence ou de l'absence de tumeurs dans le colon dudit mammifère.3) Use according to any one of claims 1 or 2 characterized in that said mammal is a mouse. 4) Method for testing a factor or a combination of potentially carcinogenic factors, characterized in that it comprises the administration of said factor or of said combination to a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated , and detecting the presence or absence of tumors in the colon of said mammal.
5) Procédé pour tester un facteur ou une combinaison de facteurs potentiellement anti-cancéreux, caractérisé en ce qu' il comprend : a) l'administration d'un agent cancérogène à un mammifère non-humain dans lequel l'un des deux allèles du gène Cdx2 est inactivé ; b) l'administration audit mammifère du facteur ou de la combinaison de facteurs à tester ; c) la détection de la présence ou de l'absence de tumeurs dans le colon dudit mammifère.5) Method for testing a factor or a combination of potentially anti-cancer factors, characterized in that it comprises: a) the administration of a carcinogenic agent to a non-human mammal in which one of the two alleles of the Cdx2 gene is inactivated; b) the administration to said mammal of the factor or of the combination of factors to be tested; c) detecting the presence or absence of tumors in the colon of said mammal.
6) Procédé selon une quelconque des revendications 4 ou 5, caractérisé en ce que ledit mammifère est une souris. 7) Mammifère non-humain, dans lequel l'un des deux allèles du gène Cdx2 est inactivé, et auquel un agent cancérogène a été administré. 8) Mammifère selon la revendication 7, caractérisé en ce qu'il s'agit d'une souris. 6) Method according to any one of claims 4 or 5, characterized in that said mammal is a mouse. 7) Non-human mammal, in which one of the two alleles of the Cdx2 gene is inactivated, and to which a carcinogenic agent has been administered. 8) A mammal according to claim 7, characterized in that it is a mouse.
PCT/FR2003/002523 2002-08-16 2003-08-13 Use of cdx2 +/- heterozygous animals for the screening of carcinogenic or anti-cancerous factors WO2004016776A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003274251A AU2003274251A1 (en) 2002-08-16 2003-08-13 Use of cdx2 +/- heterozygous animals for the screening of carcinogenic or anti-cancerous factors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0210362A FR2843526A1 (en) 2002-08-16 2002-08-16 Testing agents for carcinogenic and anticancer activity, uses mammal with one inactive Cdx2 allele
FR02/10362 2002-08-16

Publications (1)

Publication Number Publication Date
WO2004016776A1 true WO2004016776A1 (en) 2004-02-26

Family

ID=30776026

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2003/002523 WO2004016776A1 (en) 2002-08-16 2003-08-13 Use of cdx2 +/- heterozygous animals for the screening of carcinogenic or anti-cancerous factors

Country Status (3)

Country Link
AU (1) AU2003274251A1 (en)
FR (1) FR2843526A1 (en)
WO (1) WO2004016776A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005180A1 (en) * 1988-10-31 1990-05-17 The Regents Of The University Of California Products and methods for controlling the suppression of the neoplastic phenotype
WO1998009510A1 (en) * 1996-09-04 1998-03-12 Howard Florey Institute Of Experimental Physiology And Medicine Methods of diagnosing and treating cancer
WO2000070089A1 (en) * 1999-05-14 2000-11-23 The Johns Hopkins University Cdx2 is downstream mediator of apc tumor suppressor activity

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005180A1 (en) * 1988-10-31 1990-05-17 The Regents Of The University Of California Products and methods for controlling the suppression of the neoplastic phenotype
WO1998009510A1 (en) * 1996-09-04 1998-03-12 Howard Florey Institute Of Experimental Physiology And Medicine Methods of diagnosing and treating cancer
WO2000070089A1 (en) * 1999-05-14 2000-11-23 The Johns Hopkins University Cdx2 is downstream mediator of apc tumor suppressor activity

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BECK F. ET AL: "Reprogramming of intestinal differentiation and intercalary regeneration in Cdx2 mutant mice", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA., vol. 96, June 1999 (1999-06-01), NATIONAL ACADEMY OF SCIENCE. WASHINGTON., US, pages 7318 - 7323, XP002238001, ISSN: 0027-8424 *
BONHOMME C; DULUC I; MARTIN E; CHAWENGSAKSOPHAK K; CHENARD M -P; KEDINGER M; BECK F; -FREUND J -N ; DOMON-DELL C: "The Cdx2 homeobox gene has a tumour suppressor function in the distal colon in addition to a homeotic role during gut development", GUT, vol. 52, no. 10, October 2003 (2003-10-01), pages 1465 - 1471, XP008026333 *
CHAWENGSAKSOPHAK K ET AL: "Homeosis and intestinal tumours in Cdx2 mutant mice", NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 386, 6 March 1997 (1997-03-06), pages 84 - 87, XP002238000, ISSN: 0028-0836 *
DOMON-DELL C ET AL: "Stimulation of Cdx1 by oncogenic beta-catenin/Tcf4 in colon cancer cells;opposite effect of the CDX2 homeoprotein", FEBS LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 518, no. 1-3, 8 May 2002 (2002-05-08), pages 83 - 87, XP004353644, ISSN: 0014-5793 *
LORENTZ O ET AL: "DOWNREGULATION OF THE COLON TUMOUR-SUPPRESSOR HOMEOBOX GENE CDX-2 BY ONCOGENIC RAS", ONCOGENE, BASINGSTOKE, HANTS, GB, vol. 18, no. 1, 1999, pages 87 - 92, XP000946437, ISSN: 0950-9232 *

Also Published As

Publication number Publication date
AU2003274251A1 (en) 2004-03-03
FR2843526A1 (en) 2004-02-20

Similar Documents

Publication Publication Date Title
De Robertis et al. The AOM/DSS murine model for the study of colon carcinogenesis: From pathways to diagnosis and therapy studies
Tanaka Colorectal carcinogenesis: Review of human and experimental animal studies
Boivin et al. Pathology of mouse models of intestinal cancer: consensus report and recommendations
Bennecke et al. Ink4a/Arf and oncogene-induced senescence prevent tumor progression during alternative colorectal tumorigenesis
CA2903597C (en) Methods of treating colorectal cancer
US10006029B2 (en) Methods of treating colorectal cancer
Taketo et al. Gastro-intestinal tumorigenesis in Smad4 mutant mice
WO2004016776A1 (en) Use of cdx2 +/- heterozygous animals for the screening of carcinogenic or anti-cancerous factors
Fernando et al. Photoreceptor survival is regulated by GSTO1-1 in the degenerating retina
ES2861516T3 (en) IL-34 antisense oligonucleotides and methods of using the same
Clouston et al. Polyps and tumour‐like lesions of the large intestine
Shimoyama et al. CASE REPORT: Early Gastric Cancer Development in a Familial Adenomatous Polyposis Patient
EP1102530B1 (en) Use of an animal model deficient in p53 and having memory deficiency and/or behavioural disorders for therapeutic purposes
WO2009029235A2 (en) Peptides and proteins for early liver development and anitibodies thereto, and their use in therapeutic diagnosis and treatment
Sonoda et al. Intragastric ethanol reduces sphincter of Oddi function in the anaesthetised Australian possum
WO2015155490A1 (en) Animal model having a function knockout of the gene coding for the membrane receptor patched or ptc
TWI602572B (en) Use of an antimicrobial peptide tp4 in treating ?a cancer
Mitra et al. Preneoplastic Lesions and Polyps of the Gastrointestinal Tract
Anand et al. KRas, in addition to Tp53 is a driver for early carcinogenesis and a molecular target in a mouse model of invasive gastro-esophageal adenocarcinoma
Ross Evaluation of Podocalyxin-Like Protein in Zebrafish Liver Development and Liver Cancer
Chen Using Micro-CT scanning to identify structural changes in Craniofacial, Neural, and Cardiovascular systems of spotting-lethal rat, a model of Hirschsprung disease
Polyps Colon and Rectum
Sødring The novel A/J Min/+ mouse as a model for colorectal cancer, and the effects of hemin on intestinal tumorigenesis
van der Sluis et al. Mucin 2 is Critical for Colonic Protection
LAZENBY et al. Polyps of the GI Tract

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP