WO2009029235A2 - Peptides and proteins for early liver development and anitibodies thereto, and their use in therapeutic diagnosis and treatment - Google Patents

Peptides and proteins for early liver development and anitibodies thereto, and their use in therapeutic diagnosis and treatment Download PDF

Info

Publication number
WO2009029235A2
WO2009029235A2 PCT/US2008/010035 US2008010035W WO2009029235A2 WO 2009029235 A2 WO2009029235 A2 WO 2009029235A2 US 2008010035 W US2008010035 W US 2008010035W WO 2009029235 A2 WO2009029235 A2 WO 2009029235A2
Authority
WO
WIPO (PCT)
Prior art keywords
elf
bws
patient
tgf
smad3
Prior art date
Application number
PCT/US2008/010035
Other languages
French (fr)
Other versions
WO2009029235A3 (en
Inventor
Lopa Mishra
Yi Tang
Kri Kitisin
Eugene A. Volpe
Jonathan S. Mendelson
Wilma Jogunoori
Cuiling Li
Chu-Xia Deng
Susette Mueller
Habtom Ressom
Asif Rashid
Aiwu Ruthhe
Anton Sidaway
Stephen R.T. Evans
Kirti Shetty
Michael Zasloff
Bibhuti Mishra
E.P. Reddy
Johnson Lynt
Original Assignee
Cernetics, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cernetics, Llc filed Critical Cernetics, Llc
Publication of WO2009029235A2 publication Critical patent/WO2009029235A2/en
Publication of WO2009029235A3 publication Critical patent/WO2009029235A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • This invention relates to peptides and proteins isolated during early liver development, genes coding for these peptides and proteins, and antibodies which recognize these peptides and proteins, and to methods for their use in diagnosing and treating various conditions including hepatocellular cancer, neurodegenerative diseases such as Alzheimer's disease, Beckwith-Wiedemann syndrome (BWS) and other disorders.
  • BWS Beckwith-Wiedemann syndrome
  • liver disease due to infection, genetic defects or alcoholic consumption is a major cause of widespread morbidity and mortality, causing great potential hardship and economic loss to millions of people throughout the world.
  • numerous other diseases are generally associated with disruptions in the many functions carried out by the liver, including iron transport, hepatocyte formation and hematopoiesis.
  • severe problems associated with a breakdown of liver function are practically untreatable, and require a liver transplant as the only cure.
  • transplantation is at the present time not a practical approach to the problem.
  • liver development and the role of early developing liver proteins has not been well understood.
  • no growth factors specific to the liver have been identified or isolated, and the precise molecular mechanisms behind hepatocyte (liver cell) formation remain to be elucidated.
  • hepatocyte liver cell
  • HCC hepatocellular cancer
  • liver proteins of the present invention it is still further an object to use the early developing liver proteins of the present invention to provide liver-specific growth factors for application in diagnosis and treatment of a variety of disorders relating to the TGF- ⁇ pathway.
  • the present invention provides an identification of early developing liver proteins such as the elf and Smad proteins that are involved in the TGF- ⁇ pathway and which have been useful in regulating these pathways and whose absence leads to increased levels of proteins such as ltih-4 which can promote disorders such as hepatocellular cancer, and utilizing this technology to diagnose and/or predict the predilection for pathogenic conditions such as hepatocellular cancer and other disorders associated with an imbalance in the TGF- ⁇ pathway.
  • the present invention thus provides methods of diagnosis using the early-developing liver proteins and peptides of the invention, as well as genes coding for said proteins and peptides, antibodies recognizing these proteins and peptides, and methods for their use in diagnosis and treatment of a variety of disorders associated with the TGF- ⁇ pathway including liver diseases, hepatocellular cancer, neurodegenerative diseases, Beckwith-Wiedemann Syndrome (BWS) and other disorders.
  • liver diseases hepatocellular cancer
  • neurodegenerative diseases Beckwith-Wiedemann Syndrome (BWS) and other disorders.
  • Fig. 1A depicts the profile for the ELF protein including binding domains VA-1 , VA-2 and VA-3 and antibodies thereto, along with ELF QF and QR primers;
  • Fig. 1 B depicts the ELF protein sequence including various regions therein; and
  • Fig. 1C depicts the sequence of the ELF protein.
  • Figure 2 depicts: Wild type vs. elf +/ 7 Smad3 +/ ⁇ BWS like phenotype.
  • RNA was isolated from three pairs of Tumor and Normal tissues. Q-PCRs were performed in triplicate for statistical analysis. Y-axis represents the fold change in RNA levels. All tumor tissues examined show significantly (I) decreased elf and (II) slightly decreased Smad3 RNA levels.
  • D Expression of elf RNA is decreased greater than -50% in all tested human BWS cells in comparison to HepG2 cells identified by Q- PCR analyses.
  • E lmmunohistochemical labeling of ELF in normal and BWS kidney tumor revealed loss of ELF expression in BWS kidney tumor in comparison to normal kidney.
  • G (I, II) Wild type MEFs show increased nuclear translocation of Smad3 upon stimulation with 10OpM TGF-D, (III) Smad3 is predominantly cytoplasmic in human BWS cell lines is predominantly cytoplasmic. All four cell lines were tested. One representative confocal image is shown.
  • IV Smad3 does not translocate to nucleus in response to TGF-D in BWS cells
  • Figure 4 depicts: DNA methylation pattern of elf gene promoter in BWS, HCC and Gl cells.
  • A Schematic outline for the sequence of elf promoter and CpG islands.
  • B Methylation status of EIf promoter in BWS cell lines detected by MSPCR
  • C DNA methylation pattern of elf gene promoter in BWS identified by bisulfite sequencing
  • D the effect of 5-aza-2'-deoxycytidine on the elf gene expression in BWS cell line by IB assay.
  • Figure 5 depicts: ELF-TGF- ⁇ signaling is disrupted in molecular subtypes of
  • BWS Insulin growth factor-2
  • IGF2 Insulin growth factor-2
  • B IGF2-Receptor expression in wild type and elf/Smad3 +/' liver and pancreas. Increased IGF2 expression, and decreased IGF2-Receptor expression in e ⁇ f' ⁇ /Smad3 +/ ⁇ tissues (arrows).
  • C BWS-3 cell line shows a high level of IGF2 RNA by Q-PCR. IGF2 RNA levels decrease in cells transfected with full-length e/f plasmid.
  • D elf RNA expression is not significantly altered by silencing IGF2 expression in the BWS-3 cell line.
  • Figure 6 depicts (A) The p53 RNA expression is not significantly altered in normal and tumor tissues from elf / 7Smad3* / ⁇ mice. (B) Quantification of ELF mediated rescue of Smad3 nuclear translocation in BWS-3 cells. (C) Transfection of full-length of e/f in BWS-3 cells restored p15 gene expression. Figure 7 depicts: Cell proliferation in wild-type, elf, and elf/Smad3 +/ ⁇ liver tissues. (A-B) lmmunohistochemical detection of mitotic cells by labeling with a mitotic marker, p-Histone H3 (Ser 10 ) in normal wild-type, (C-D) elf, (E-F) elf
  • Figure 8 depicts: Apoptosis in wild-type, elf' ' , and elf/Smad3 +/' liver tissues.
  • A-B Identification of apoptotic cells in normal wild-type, (C-D) elf ' , and (E-F) elf /smad3 +/' mouse liver tissues, using anti-active Caspase-3 antibody, an apoptotic marker. Arrows in panel B point to apoptotic cells.
  • Figure 9 depicts: P57 Expression in wild-type and elf/Smad3 +/' liver tissues.
  • A-B lmmunohistochemical detection of cell cycle inhibitor p57 in normal wild-type
  • C-D elf/Smad3 +/ ⁇ mouse liver tissues. P57 expression is not altered in elf /Smad3 +/ ⁇ tissues when compared to wild type.
  • Figure 10 depicts: KCNQ1 expression in wild-type, and elf/Smad3 +/ ⁇ heart tissue.
  • A-C lmmunohistochemical detection of potassium voltage-gated channel, kcnqi in normal wild-type, and
  • D-F elf ⁇ /SmadS ⁇ ' mouse heart tissues.
  • KCNQ1 expression is decreased in elf / 7Smad3 +/' tissues when compared to wild type.
  • Fig. 11 depicts iidentification of liver progenitor/stem cells in posttransplant human liver tissues, lmmunohistochemical labeling of posttransplant human liver tissue taken from living donor liver transplant 4 weeks after transplantation.
  • the tissue is labeled for the presence of ELF (A, arrows) and Oct4 (S, arrows). Sections are taken consecutively to enable identical localization.
  • C-N Confocal images of human liver at 3 months after living-related liver transplantation.
  • C-E The tissue is labeled with stem cell proteins Stat3 and Oct4 and prodifferentiation TGF- ⁇ signaling component ELF.
  • F prodifferentiation TGF- ⁇ signaling component
  • These proteins coexpress in a small cluster of two to four cells.
  • G DAPI represents nuclear labeling.
  • DIC Differential interference chromatography
  • I-K Regenerative liver tissue from another liver transplant is labeled with p-histone H3 (Ser 10 ), Oct4, and ELF.
  • L These proteins coexpress in this cluster of progenitor-like cells.
  • M and N DAPI represents nuclear labeling (M), and DIC represents transmission images (N). Arrows point to the nuclei of the progenitor-like cells. (Scale bars for all figures are in micrometers.)
  • Fig. 12 depicts Identification of liver progenitor/stem cells in posttransplant human liver and HCC tissues, lmmunohistochemical labeling of posttransplant human liver tissues taken from living donor liver transplant recipient 4 weeks after transplantation.
  • A-D The tissue is labeled for the presence of ELF (A and C) and Oct4 (B and D). Sections are taken consecutively to enable identical localization.
  • E- J Equivalent areas are marked by red dotted lines, and green arrows point to the positive labeling, lmmunohistochemical labeling of normal human liver (E and H) and HCC tissues (F, G, /, and J).
  • Fig. 13 depicts decreased incidence of hepatocellular cancer is observed by genetic modulation of IL-6-stat-3 signaling.
  • a and B Heatmap microarray assay illustrating gene expression in mouse liver or HCC tissues. Targeted disruption of the ITIH-4 gene and generation of itih4 -/- mice. Exp1 : elf +/- liver tissue vs. wild-type liver tissue; Exp2: itih4 -/- liver tissue vs. wild-type liver tissue; Exp3: elf *1' /itih4 -/- liver tissue vs. wild-type liver tissue. The signal gradients are located below each image.
  • HCC tissues and cell lines HCC tissues and cell lines.
  • A, C, and D lmmunohistochemical labeling demonstrates low/absent expression of phosphorylated Stat3 in normal (wild-type) mouse liver (A), ITIH4 "7" liver (C), and Elf +/ 7ITIH4 "/" liver (D).
  • ⁇ In contrast, EIf +7" HCC liver tissue shows increased expression of P-Stat3.
  • E and F lmmunohistochemical detection shows increased expression of Stat3 in human HCC tissues (F, arrows) compared with normal liver tissues (E).
  • H and G Phosphorylated-Stat3 is also increased in human HCC tissues (H, arrows) compared with normal liver tissues (G). (Scale bar is in micrometers.)
  • Figure15 depicts: Identification of Liver Progenitor/Stem Cells in Post Transplant Human Liver Tissue.
  • FIG. 16 depicts: Identification of Liver Progenitor/Stem Cells in Human Liver Tissue.
  • Figure 17 depicts: Identification of Liver Progenitor/Stem Cells in Post Transplant Human HCC Tissues.
  • FIG. 18 depicts: Elf' Mutant Mice Develop HCCs.
  • Figure 19 depicts: lmmunohistochemical Analysis of ITIH4 and Stat3 Expression in Mouse Liver and HCC Tissues.
  • Figure 20 depicts: lmmunohistochemical Analysis of Phosphorylated-
  • Figure 21 depicts: lmmunohistochemical Analysis of Stat3 and Phosphorylated-Stat3 Expression in Normal Human Liver and HCC Tissues.
  • Figure 22 (S8) depicts: lmmunohistochemical Analysis of ITIH4 Expression in Human Normal Liver and HCC Tissues.
  • Figure 23 depicts: Increase of Stat2 and Phosphorylated-Stat3 in Human HCC Cell Line SNU-398.
  • Figure 24 depicts: Cell Proliferation and Apoptosis in Wild-type, Itih4 "/” , Elf +/ 7itih4 '/” and in EIf +7' Liver Tissues.
  • Figure 25 depicts: Schematic Diagram to Show TGF- ⁇ /ELF and IL-
  • Figs. 26-29 provide additional information regarding the BWS processes of the present invention.
  • Figure 30 depicts: Increased expression of CDK1 , CDK5, p35 and p25 activity in elf and elf ' /Smad4 +I' frontal cortex.
  • CDK1 and CDK6 levels were also immunoblotted, and CDK1 was found to be highly expressed in elf ' and elf '
  • CDK6 was equally expressed in wildtype, elf ' , Smad4 +/' , elf ' /Smad4 +/' frontal cortex lysates ⁇ - tubulin was used as a loading control.
  • IDV integrated density value
  • Figure 31 depicts: Increased expression of PCNA and p-Tau in elf ⁇ /Smad4 +l ⁇ mouse brain tissues, lmmunohistochemical labeling demonstrates absent expression of PCNA in normal (Wild-type) control mouse brains(A and B) . In contrast e ⁇ f ' /Smad4 +I ⁇ mouse brain sections (C and D; arrows) showed increased expression of PCNA.. lmmunohistochemical detection shows increased expression of p-Tau in e ⁇ f ' /Smad4*' ⁇ mouse brain sections (G and H; arrows) compared with normal (wild-type) mouse brain sections(E and F). (Scale bar is in micrometers). All the left panels (A, C, E and G) correspond to lower power view and the right panels (B, D, F, and H) correspond to the higher power view.
  • Figure 32 depicts: Increased cell-cycle regulatory protein expression (CDK4 and CyclinA) in eif' ⁇ /Smad4 +I ⁇ mouse brains; Increase in CDK4 expression is seen in e ⁇ f' ⁇ /Smad4 +I ⁇ mouse brain sections (B; arrows) as compared with normal(wild- type) mouse brain sections(A). Similarly, increased labeling of Cyclin A are observed in e ⁇ f' ⁇ /Smad4 + ' ⁇ mouse brain sections (D; arrows) as compared with normal(wild- type)(C). (Scale bar is in micrometers.)
  • Figure 33 depicts: Kinase assay using the CDK-inhibitor roscovitine; Frontal cortex and hippocampus sections were used for this assay to determine the kinase activity in CDK5 before and after treatment with roscovitine. For this experiment, elf ' and Smad4 +/ ⁇ as well as wildtype mice were used. Histone was used as a control for this assay.
  • Figure 34 depicts: Quantitative readout of kinase assay; The graph demonstrates the substantial inhibitory effect of roscovitine in both e ⁇ f' ⁇ and Smad4 +I ⁇ frontal cortex as well as elf ' hippocampus. Also of note is the diminished inhibitory effect of this treatment in Smad4 + ' ⁇ which was roughly half that of the wild- type hippocampus.
  • the present application relates generally to the information regarding early developing liver proteins and the mechanisms of their expression and regulation, and many of these proteins are discussed in US patents 7,202,347; 6,642,362, and 5,955,594, and the information regarding ELF deficient mouse models as set forth in US Patent Application Publication 2005/0144660, and other information as set forth in PNAS 105(7):2445-2450, all of said patents and publications incorporated herein by reference.
  • the present invention relates to the use of the ELF protein in a variety of therapeutic and diagnostic methods involving disorders affected by disruption of the TGF- ⁇ pathway.
  • the present inventors have discovered that ELF is lost in stem cells during hepatocellular cancer (HCC), and that ELF can be used for identifying stem cells which may be cancerous.
  • HCC hepatocellular cancer
  • the inventors have discovered that in ELF- deficient mice, there is an increase in ITI H4 levels and a higher prevalence of hepatocellular cancer.
  • an ITIH4 mouse model has shown that if
  • ITIH4 is inhibited when ELF is lose, then cancers decrease markedly in those models.
  • the pathways associated with ITI H4 include the Stat3, IL-6 pathway, and this inhibition of these pathways is contemplated for prevention and/or treatment of hepatocellular cancers and other disorders involving the TGF- ⁇ pathway.
  • the present invention also contemplates the targeting of ITIH4 as a method of prevention and/or treatment of hepatocellular cancer, and one of the aspects of the invention encompasses the administration of an ITIH4 inhibitor to reduce and/or eliminate the risk for the development of hepatocellular cancers, or for the prevention or treatment thereof.
  • the ELF protein appears to be a regulator of the pathways which in the absence of ELF will produce ITIH4 and increase its levels, and thus in appropriate cases, the present invention contemplates a method wherein ELF is administered to reduce the level of ITIH4 and reduce the likelihood or prevent the development of hepatocellular cancers and other disorders associated with the TGF- ⁇ pathway.
  • the present invention contemplates the administration of ITIH4 inhibitors, especially in cases wherein ELF production is minimal or absent, in order to reduce the predilection for hepatocellular cancers in a patient.
  • the present invention contemplates a method of assessing a patients' risk for developing hepatocellular cancer comprising the steps of assaying a biological fluid of a patient to determine the level of a marker selected from the group consisting of ITIH4, CDK4, Stat3, or other marker which promotes IL-6 activation, assessing whether the level of said marker is above the normal level of said marker that would be expected for said patient, and determining if said patient has a level of said marker that is above the normal level of said marker that would be expected for said patient, said higher level of said marker being reflective of a higher risk for developing hepatocellular cancer.
  • a marker selected from the group consisting of ITIH4, CDK4, Stat3, or other marker which promotes IL-6 activation
  • a method of preventing or treating hepatocellular cancer will comprise the steps of administering to a patient in need thereof an effective amount of an inhibitor of a material selected from the group consisting of ITIH4, CDK4, Stat3, and other materials which promotes IL-6 activation.
  • the inhibiting compound may comprise an effective amount of the ELF protein, or other material used to promote the expression of the ELF protein.
  • the praja protein appears to inhibit the ELF protein, and thus the ELF promoting agent may be a substance which will inhibit the role of praja as it relates to ELF.
  • an "effective amount" of a protein, antibody or other pharmaceutical agent to be used in accordance with the invention is intended to mean a nontoxic but sufficient amount of the agent, such that the desired prophylactic or therapeutic effect is produced.
  • the exact amount of said agent that is required will vary from subject to subject, depending on the age and general condition of the subject, the severity of the condition being treated, the particular carrier or adjuvant being used and its mode of administration, and the like. Accordingly, the "effective amount” of any particular compound or composition to be administered in accordance with the present invention will vary based on the particular circumstances, and an appropriate effective amount may be determined in each case of application by one of ordinary skill in the art using only routine experimentation. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual.
  • cancer stem cells which are critical for initiation, propagation and treatment resistance of multiple cancers.
  • CSCs cancer stem cells
  • functional interactions between specific signaling pathways in solid organ "cancer stem cells”, such as those of the liver, have remained elusive.
  • the present inventors utilizing a broad micro- array and proteomic analyses followed by a genetic dissection, have identified such progenitor cells and regulating pathways that can be modulated to alter tumor formation in the liver.
  • HCC human hepatocellular cancer
  • ELF Intra-alpha-trypsin inhibitor-heavy chain-4
  • the method contemplates targeting ITIH4 and reducing the level of ITIH4 so as to prevent or treat HCCs, particularly in those cases wherein ELF is absent.
  • the present invention thus contemplates an important therapeutic role for targeting IL-6 in the TGF-/3 pathway so as to treat or prevent HCCs.
  • the present invention contemplates a method of identifying cancer stem cells comprising the steps of administering to a patient suspected of having cancer stem cells an antibody capable of recognizing a peptide from the ELF protein, and determining if said antibodies have bound to said stem cells.
  • the antibody recognizing such ELF peptide may thus be useful in labeling said cancer cells for removal or further study, and one such suitable antibody for labeling stem cells in accordance with the invention may thus be an antibody recognizing the VA-1 region of the ELF protein.
  • the inventors have determined that early developing liver proteins such as ELF are related to neurodegeneration in conjunction with their function in the TGF- ⁇ pathways.
  • the present invention contemplates monitoring of ELF to show a predilection for neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and ALS (Lou Gehrig's disease), and indeed other proteins such as CDK4 and cyclin D1 whose levels are enhanced in the absence of ELF also appear to be contributing to neurodegenerative disorders.
  • the present invention contemplates monitoring the level of ELF, such as in cerebro-spinal fluid, as a factor in determining a patient's predilection to develop Alzheimer's disease, and it appears that an absence of ELF or its presence at levels reduced from the amount that would normally be present in an average patient, will be indicative of the possibility of developing neurodegenerative conditions such as Alzheimer's disease. It is thus contemplated that the monitoring of levels of ELF may be useful as an early warning sign of Alzheimer's or other neurodegenerative diseases.
  • CDK4 and/or CDK5 protein reaches elevated levels in patients where ELF protein is absent or reduced, and thus another aspect of the invention is the monitoring of the CDK4 or CDK5 level to assess the predilection of an individual of developing a neurodegenerative disease.
  • cyclin D1 which is associated with the CDK proteins may also be a marker for the potential for risk of neurodegenerative disease.
  • the monitoring of levels of CDK4 or CDK5 and cyclin D1 will be useful as indications of the potential for neurodegenerative disease, and that since elevated levels of these proteins are associated with neurodegenerative disease, administration of an inhibitor or CDK4 or CDK5 and/or cyclin D1 is contemplated as a means to treat and/or prevent neurodegenerative diseases such as Alzheimer's.
  • administration of an inhibitor or CDK4 or CDK5 and/or cyclin D1 is contemplated as a means to treat and/or prevent neurodegenerative diseases such as Alzheimer's.
  • testing conducted in accordance with the invention showed that the functioning of the elf protein does modulate the activities of CDK5, and the phosphorylation of CDK5 can be inhibited in addition in the presence of a CDK inhibitor such as roscovitine.
  • a method of assessing a patients' risk for developing a neurodegenerative disorder comprises the steps of assaying a biological fluid of a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and determining if said patient has a level of ELF that is below the normal level of ELF that would be expected for said patient, said lower level of ELF being reflective of a higher risk for developing a neurodegenerative disorder.
  • the neurodegenerative disease may be, for example, a disease selected from the group consisting of Alzheimer's disease, Parkinson's disease and ALS.
  • a method for assessing a patients' risk for developing a neurodegenerative disorder can also be carried out which comprises the steps of assaying a biological fluid of a patient to determine the level of a marker selected from the group consisting of CDK4, CDK5, and cyclin D1 , assessing whether the level of said marker is above the normal level of said marker that would be expected for said patient, and determining if said patient has a level of said marker that is above the normal level of said marker that would be expected for said patient, said higher level of said marker being reflective of a higher risk for developing a neurodegenerative disorder such as Alzheimer's, Parkinson's or ALS.
  • a suitable biological fluid for said tests may be cerebro-spinal fluid.
  • praja may also assist in inhibiting or removing the expression of ELF. Accordingly, it is contemplated that in addition to methods wherein an effective amount of ELF may be administered to a patient to alleviate or prevent the conditions disclosed herein, another method of achieving this result may be to inhibit or modulate the expression of praja so that this protein does not disrupt expression of ELF.
  • the ELF protein may also function so as to prevent Beckwith-Wiedemann Syndrome (BWS), and this condition is particularly associated with a lack of the ELF protein.
  • BWS Beckwith-Wiedemann Syndrome
  • methylation of the ELF protein may also lower its effectiveness and functioning, and thus BWS may be treated and/or prevented through the reversal or prevention of the methylation of the ELF protein.
  • the adaptor protein ELF Embryonic Liver Fodrin, a ⁇ -Spectrin
  • ELF Embryonic Liver Fodrin, a ⁇ -Spectrin
  • Smad3 and Smad4 signaling mice with ELF deficiency, such as the e ⁇ f' ⁇ and e ⁇ f /' /Smad3 Jr/' mice models, develop abnormal ear folds, visceromegaly, adrenal cytomegaly and multiple cancers including liver and gastrointestinal tumors, observed in patients with Beckwith-Wiedemann syndrome (BWS), a hereditary human cancer overgrowth syndrome.
  • BWS Beckwith-Wiedemann syndrome
  • ELF may be useful in the prevention and/or treatment of BWS, and may also be used as a marker to determine the likelihood that this syndrome will be present.
  • epigenetic silencing of ELF through methylation, diet, etc. will be very important.
  • CDK4 may be elevated in those patients whose ELF function is impaired, and thus CDK4 inhibition may be useful in achieving tumor suppression.
  • ELF and the Smad proteins, such as Smad3 can be utilized to suppress levels of CDK proteins such as CDK4 and thus may be useful in methods of achieving tumor suppression.
  • methylation of ELF appears to be associated with loss of the ELF function in the TGF- ⁇ pathway and also can lead to the problems identified above related to loss of ELF.
  • the present inventors have learned that loss of ELF expression is a likely cause of BWS, and such a lack of ELF expression may result from mutation of the ELF gene, methylation of its promoter, transcriptional or post- transcriptional de-regulation.
  • the complete loss of elf mRNA in elf 1' /Smad3 +/ ⁇ heterozygotes without mutation or inactivation of ELF transcription pointed to an epigenetic mechanism of repression potentially by methylation of ELF at its promoter.
  • Previous observations show a deletion of ELF results in a dramatic and spontaneous formation of liver and gastrointestinal cancers .
  • the present invention contemplates the administration of an effective amount of ELF in one method to prevent or treat BWS.
  • ELF may be a marker to determine one's risk of developing BWS, and methods of alleviating this syndrome may involve ways of inhibiting the methylation of ELF so as to maintain ELF expression and allow it to perform its role in ELF-mediated TGF- ⁇ signaling.
  • antibodies to ELF or certain ELF peptides may be useful in recognizing methylated ELF protein.
  • the VA-1 antibody may be useful in diagnosing potential problems associated with loss of ELF expression as set forth herein which may result from ELF methylation.
  • VA-1 antibodies may be useful in targeting methylated ELF so that steps can be taken to reduce the level of methylated ELF that is present and/or otherwise restore ELF expression and function.
  • the adaptor protein ELF Embryonic Liver
  • Fodrin a ⁇ -Spectrin
  • TGF- ⁇ tumor suppressor function specifically Smad3 and Smad4 signaling.
  • the present inventors have shown that elf" ⁇ and elf +"-"Smad3+”- mice develop visceromegaly and multiple cancers with phenotypic characteristics frequently observed in patients with Beckwith-Wiedemann syndrome (BWS), a hereditary human cancer overgrowth syndrome.
  • BWS Beckwith-Wiedemann syndrome
  • a dramatic decrease in ELF RNA and protein but not Smad3 or p53 expression is observed in elf" ⁇ , elf +"-"Smad3+”- tumors as well as BWS cell lines and tumor tissues compared to normal tissues. In BWS cells, Smad3 protein was mislocalized.
  • microRNA is an important therapeutic target for cancers and BWS when ELF is lost.
  • early developing liver proteins such as ELF may be used as markers for a variety of disorders associated with the TGF- ⁇ signaling pathway and the activation of IL-6, and the administration of ELF and/or other compositions for disrupting the IL-6 pathway may be useful to prevent and/or treat the disorders as reflected herein.
  • activation of the IL-6 pathway in the absence of ELF may result in the disorders set forth herein, and elevated levels of CDK proteins such as CDK4 or CDK5, or Stat3, may also be signs that the conditions set forth herein may be present.
  • the present invention contemplates monitoring these proteins as an early indication of conditions associated with the disruption of the TGF- ⁇ pathway, and inhibiting these proteins and/or their activation pathways may be useful in preventing and/or treating the pathogenic conditions associated with such disruption as set forth herein.
  • the present invention encompasses a method of early diagnosis of Beckwith-Wiedemann Syndrome (BWS) via assaying a biological fluid of a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and diagnosing an early risk of BWS when levels of ELF are below the normal level of ELF that would be expected for said patient.
  • a method of preventing or treating Beckwith-Wiedemann Syndrome is provided which comprises the steps of administering to a patient in need thereof an effective amount of the ELF protein. This administration may be accompanied by administration of an effective amount of a Smad protein such as Smad2, Smad3 and Smad4.
  • the present invention encompasses a method of early diagnosis of a disorder associated with disruption of the TGF- ⁇ pathway comprising determining from a suitable biological sample or fluid from a patient the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and determining if said patient has a level of ELF that is below the normal level of ELF that would be expected for said patient, said lower level of ELF being reflective of a higher risk for developing a disorder associated with the disruption of the TGF- ⁇ pathway.
  • the invention allows for a method of early diagnosis of a disorder associated with disruption of the TGF- ⁇ pathway comprising administering to a patient an antibody recognizing a methylated ELF protein, and determining whether said antibody has bound to said methylated ELF protein.
  • the antibody utilized may be an antibody recognizing the VA-1 region of the ELF protein.
  • Still a further aspect of the invention is a method of preventing P25 accumulation in mammalian frontal cortex comprising administering B- spectrin ELF in an amount sufficient to modulate CDK5 activity.
  • Progenitor/stem cells give rise to liver cancer due to aberrant TGF- ⁇ and IL-6 signaling
  • Cancer stem cells are critical for the initiation, propagation, and treatment resistance of multiple cancers. Yet functional interactions between specific signaling pathways in solid organ “cancer stem cells,” such as those of the liver, remain elusive.
  • CSCs cancer stem cells
  • stem cell proteins Stat3, Oct4, and Nanog, along with the prodifferentiation proteins TGF- ⁇ -receptor type Il (TBRII) and embryonic liver fodrin (ELF).
  • TGF- ⁇ -receptor type Il TGF- ⁇ -receptor type Il
  • ELF embryonic liver fodrin
  • elf +/- mice spontaneously develop HCC; expression analysis of these tumors highlighted the marked activation of the genes involved in the IL-6 signaling pathway, including IL-6 and Stat3, suggesting that HCC could arise from an IL-6-driven transformed stem cell with inactivated TGF- ⁇ signaling.
  • suppression of IL-6 signaling through the generation of mouse knockouts involving a positive regulator of IL-6, Inter-alpha-trypsin inhibitor-heavy chain-4 (ITIH4), resulted in reduction in HCC in elf +/- mice.
  • ITIH4 Inter-alpha-trypsin inhibitor-heavy chain-4
  • CSCs cancer stem cells
  • oncogenic mutations that inactivate the constraints on normal stem cell expansion or, alternatively, in a more differentiated cell
  • oncogenic mutations could generate continual proliferation of cells in cell cycle that no longer enter a postmitotic differentiated state, thereby creating a pool of self- renewing cells in which further mutations can accumulate.
  • the plasticity of such cells is reflected by recent studies where pluripotent stem cells could be induced from embryonic or adult fibroblasts by introducing four factors, Oct3/4, Sox2, c-Myc, and Klf4, under embryonic stem cell culture conditions (5).
  • Potentially biologically significant pathways that modulate these stem/progenitor cells in cancer tissues could be identified through dual roles in embryonic stem cell development and tumor activation or suppression (4).
  • TGF- ⁇ family proteins have emerged as key players in the self-renewal and maintenance of stem cells in their undifferentiated state, the selection of a differentiation lineage, and the progression of differentiation along individual lineage (4).
  • TGF- ⁇ -family proteins have emerged as bifunctional regulators of the maturation of cells in each of the lineages mentioned above and as suppressors of carcinogenesis (6).
  • TGF- ⁇ signaling When TGF- ⁇ signaling is disrupted, the imbalance can result in an undifferentiated phenotype, and cancer may ensue (7).
  • TGF- ⁇ -family signals are conveyed through two types (types I and II) of transmembrane receptor serine-threonine kinases, which form a complex at the cell surface. Ligand binding to this complex induces a conformational change that results in phosphorylation and activation of type I receptors by type Il receptors. Activation of Smad transcription factors ensues and results in their nuclear translocation and activation or repression of gene expression.
  • Smad activation is modulated by various receptors or Smad-interacting proteins that include ubiquitin and small ubiquitin-related modifier (SUMO) ligases and multiple adaptor proteins that include Smad anchor for receptor activation (SARA), filamin, and ELF.
  • SUMO small ubiquitin-related modifier
  • SARA Smad anchor for receptor activation
  • ELF a ⁇ -spectrin, first isolated from foregut endodermal stem cell libraries, is crucial for the propagation of TGF- ⁇ signaling (8). Specifically, ELF associates with Smad3 presenting it to the cytoplasmic domain of the TGF- ⁇ Type I receptor complex, followed by heteromeric complex association with Smad4, nuclear translocation, and target gene activation (9).
  • TGF- ⁇ proteins promote or inhibit cell proliferation, apoptosis, and differentiation.
  • TGF- ⁇ -family signaling is most prominent at the interface between development and cancer in gut epithelial cells. Inactivation of at least one of the TGF- ⁇ signaling components (such as the TGF- ⁇ receptors, Smad2 or Smad4) occurs in almost all gastrointestinal tumors (7, 10). Smad2 +/- /smad3 +/- double heterozygous and elf -/- homozygous mice all showed defective liver development, and elf +/- mice are now observed to develop dramatic spontaneous HCCs.
  • HCC liver progenitor cells
  • HPC hepatic progenitor cells
  • Living donor liver transplantation offers a unique opportunity to examine the regeneration of the human liver, a process presumed to involve the recruitment of hepatocytes and later, hepatic progenitor cells (18).
  • the surgical procedure involves resection and transplant of a lobe representing 55-60% liver mass from a donor to a recipient, which, by 3 months, grows to 85% of original mass (19).
  • liver progenitor/stem cells that were long-term label-retaining (20).
  • a broad microarray and protein analysis approach led us to focus on 40 proteins to be further characterized by immunohistochemical and confocal immunofluorescence labeling of living donor liver-transplanted and human HCC tissues.
  • Oct4 (21 ) and Nanog (22) have been shown to be expressed in embryonic and pluripotent stem cells; Stat3 appears to be essential for embryonic visceral endoderm development and for self-renewal of pluripotent embryonic stem cells (23, 24); both TBRII and ELF have been implicated in early embryonic development of the foregut and in endodermal malignancies (9). Serial sections were examined by immunohistochemistry to help determine the local microscopic anatomy of the visualized cells (i.e., relationship to portal structures, etc.) and the number of cells comprising the cluster.
  • Activated IL-6 Signaling Is Found in HCC with Impaired TGF- ⁇ Signaling.
  • TGF- ⁇ signaling To obtain a molecular signature of hepatic cancer that arises when TGF- ⁇ signaling is inactivated and to define the intracellular pathways that are engaged, we performed a series of microarray and proteomic analyses in elf +/- , elf +/- /itih4 -/- , and itih4 -/- tissues. Significantly increased expression of the IL-6/Stat3, WNT, and CDK4 signaling pathways was observed (Fig. 3 A and ⁇ ; SI Figs. 23 ' A-F and 24 B and E and SI Table 1 and data not shown).
  • ITI H4 is a member of a liver-restricted serine protease inhibitor family, expressed in hepatoblasts, and is a biomarker of foregut cancers of uncertain function (30-32). Mice homozygous for the itih4 mutation (itih4 -/- ) are normal and fertile, suggesting that the itih4 mutation does not show dominant effects (Fig. 3 C-E). Surprisingly, however, IL-6/Stat3 signaling is one of the most significantly suppressed pathways we detected in the itih4 -/- liver tissues (Fig. 3 A, B, and E; SI Figs.
  • ITIH4 an acute-phase protein
  • IL-6 33-35
  • Microarray profiles of itih4 -/- and elf +/- /itih4 -/- liver tissues indicated a significant suppression of IL-6 signaling (Fig. 3 A and B and SI Table 1 ).
  • immunoblot and immunohistochemical analyses showed that expression of IL-6/Stat3 is decreased in the itih4 -/- and elf +l ⁇ /itih4 -/- liver tissues (Sl Figs. 9 and 10), whereas, in contrast, IL-6 is activated in elf +/- mice (Sl Table 1 ).
  • Stat3 phosphorylation is also dramatically decreased in the ititi4 -/- and elf +/- /itih4 -/- liver tissues (Fig.
  • hepatocyte proliferation is inhibited in the TGF- ⁇ -inactivated state by the disruption of itih4 and, therefore, that IL-6 by some mechanism increases the proportion of proliferating hepatocytes in the absence of TGF- ⁇ .
  • hepatocyte apoptosis 25, 36.
  • Epithelial apoptosis in the mouse liver tissues was examined by using the apoptotic marker, anti-active Caspase-3.
  • apoptosis was noted in hepatocytes (Sl Fig. 13E), but few apoptotic cells were seen in itih4 -/- and elf +/- mice compared with elf +/- /ititi4 -/- mutant liver tissue (Sl Fig. 13 F-H).
  • HCCs hepatocarcinogenesis arises from dysfunctional liver stem cells, and this is further supported by transformation of p53-null hepatic progenitor cells that give rise to HCC (37).
  • HCCs express one or more HPC markers, and both hepatocyte and biliary cell markers such as albumin, CK7, and CK19 that are not present in normal mature hepatocytes (15, 16).
  • HCCs that express these HPC markers carry a significantly poorer prognosis and higher recurrence after surgical resection and liver transplantation (38).
  • Fifty-five percent of small dysplastic foci are comprised of progenitor cells and intermediate hepatocytes (39). Indeed, progenitor-like side populations of Huh7 and PLC/PRF/5 cells (human HCC cell lines), with hepatocytic and cholangiocytic lineages, give rise to persistent aggressive tumors upon serial transplantation in immunodeficient NOD/SCID mice (40).
  • progenitor/stem cells are generally found localized in the portal tract region surrounded by a "shell" of six to seven cells expressing TBRII, ELF, and albumin, but not Nanog or Oct4, the latter reflecting a more differentiated phenotype, further supporting the role of the progenitor cell in self-renewal and differentiation.
  • a "shell" of six to seven cells expressing TBRII, ELF, and albumin but not Nanog or Oct4
  • TGF- ⁇ signaling components are bona fide tumor suppressors with the ability to constrain cell growth and inhibit cancer development at its early stages. Inactivation of at least one of these components (such as the TGF- ⁇ receptors, Smad2, or the common mediator Smad4) occurs in almost all gastrointestinal tumors (6, 10, 41 ).
  • the early embryonic lethality in smad4 -/- mice is consistent with the role of Smad4 in normal gut endoderm development.
  • the specific roles of the TGF- ⁇ pathway in vivo human progenitor systems are unknown. As illustrated in this study, changes in TGF- ⁇ signaling drive the selection of defined differentiation pathways and their progression of differentiation in liver tissue.
  • TGF- ⁇ signaling may contribute to impaired differentiation and allow for the development of cancers, linking the differentiation of stem cells with suppression of carcinogenesis.
  • development of this cancer appears to require IL-6.
  • ITIH4 an IL-6 target
  • ITIH4 an IL-6 target
  • Targeting vector Recombinant phage-containing genomic DNA of the itih4 locus was isolated from a 129/SvEv mouse library by using PK7R, a piece of itih4 cDNA, as a probe.
  • the finished construct, p-itih4Neo is shown in Fig. 3 C.
  • This targeting strategy deletes a 1.8-kb Smal-Clal fragment that contains the second and third exons of the itih4 gene. Homologous recombination in ES cells and generation of germ-line chimeras.
  • TC1 ES cells were transfected with Notl digested p-itih4Neo and selected with G418 and FIAU.
  • ES cell clones that were resistant to both G418 and FIALJ were picked and analyzed by Southern blotting for homologous recombination events within the itih4 locus (Fig. 3 D). Details are in S/ Text. Confocal Laser-Scanning Immunofluorescence Microscopy.
  • MEFs Mouse Embryo-Derived Fibroblasts harboring the null-allele e/f and itih4 and wild-type were derived as described (9). lmmunoblot Assay.
  • mice exhibiting overt pathological signs were killed and underwent autopsy.
  • Normal liver and HCC tissues were dissected, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and sectioned at 6 ⁇ m. Sections were stained with H&E or subjected to immunohistochemical analysis with antibodies, lmmunohistochemical staining was performed with primary antibodies against ELF, Oct4, ITIH4, Stat3, pStat3, pHistone H3 (Ser 10 ), and Caspase-3 (Santa Cruz Biotechnology, Invitrogen, Promega, and Abeam). Detection of Proliferating Cells.
  • Proliferating cells were labeled with BrdU-labeling and detection kit (Invitrogen). BrdU (1 ml/100 g of body weight) was injected (i.v.) into 18.5-day postcoitum pregnant mice and 4 h later, fetal stomachs were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 6 ⁇ m. The proliferating cells were also identified by anti-pHistone H3 (Ser 10 ) mitotic marker labeling. Detection of Apoptotic Cells.
  • Apoptotic cells were detected by the TUNEL method with a MEB STAIN Apoptosis Kit Direct (MBL, 8445) and with anti-Caspase3 antibody (Promega). Tissues were then fixed and analyzed by using immunofluorescence microscopy. Tumor Cells and Tissues.
  • JAK2 1.000 1.000 1.000 1.000 1.000 tyrosine kinase
  • Wnt3a expression is increased in elf+/- liver tissue while it is decreased in itih4-/- and elf+/- /itih4-/- mouse liver tissues compared with wild type liver tissues.
  • IL- 6 expression is also suppressed in itih4-/- and elf+/- /itih4-/- mouse liver tissues compared with wild-type liver tissues.
  • the adaptor protein ELF Embryonic Liver Fodrin, a ⁇ -Spectrin
  • ELF Embryonic Liver Fodrin, a ⁇ -Spectrin
  • Smad3 and Smad4 signaling we now show that e ⁇ f ' and e ⁇ f VSmad3 +/' mice develop abnormal ear folds, visceromegaly, adrenal cytomegaly and multiple cancers including liver and gastrointestinal tumors, observed in patients with Beckwith-Wiedemann syndrome (BWS), a hereditary human cancer overgrowth syndrome. Loss of ELF but not Smad3 or p53 RNA expression is observed in e ⁇ f' ⁇ , elf /Smad3 +/ ⁇ tumors.
  • Hereditary cancer syndromes provide powerful insights into common forms of cancer. They lead to further understanding of the somatic mutations present in sporadic cancers, as well as the function of cell signaling pathways 1"3 .
  • One clear example is the identification of germline, inactivating mutations in the APC gene, found to encode a 300 kD wnt pathway adaptor protein (White R, PNAS 2000, Massague Cell 2003).
  • germline mutations in APC are responsible for familial adenomatous polyposis (FAP), a rare condition affecting about 1 in 7000 individuals in the United States, somatic mutations in the APC gene are present in more than 70% of all adenomatous polyps and carcinomas of the colon and rectum (Cleyers, Science 2005).
  • Beckwith-Wiedemann syndrome is an overgrowth disorder associated with an 800-fold increased risk of embryonal neoplasms of childhood that include Wilms 1 tumors, hepatoblastomas, pancreatoblastoma, neuroblastoma, rhabdomyosarcoma, as well as adrenocortical carcinomas, and less commonly also lymphomas, hepatocellular carcinoma (HCC), renal cell carcinomas, optic nerve gliomas and others . Fifteen percent of cases are familial with an autosomal dominant pattern of inheritance and 85 percent are sporadic 4 . Reported tumor risk estimates vary between 4% and 21%. BWS has an incidence of 1 per 6,000-10,000 births in the US, and a prevalence of 0.07 per 1000 births 5 ' 6 . A 4- to 9-fold increase in incidence has been recently observed in in vitro fertilization offspring 7 ' 8 .
  • the main clinical and histologic features frequently associated with BWS include macrosomia (gigantism) with enlarged livers, kidneys, hearts, macroglossia, neonatal hypoglycemia, hemihyperplasia, exomphalos, midface microcephaly, and abnormal ear creases.
  • a frequent pathological finding in human BWS is adrenal cytomegaly that is characterized by the presence of large polyhedral cells with eosinophilic granular cytoplasm and enlarged nuclei in the adrenal cortex of affected pre-pubertal BWS individuals.
  • BWS The molecular defects underlying BWS are not well understood but may be associated epigenetic alterations of several genes with increased expression of IGF2 perhaps via alterations in epigenetic regulation, and Loss of imprinting (LOI) at the IGF2 locus on chromosome 11 in 15% of BWS patients "9"11 .
  • LOI Loss of imprinting
  • the Smad3/4 adaptor protein ELF which regulates TGF- ⁇ signaling is a potent regulator of tumorigenesis, but the role of the TGF- ⁇ pathway and ELF in human gastrointestinal 6 tumor syndromes remains unclear 12 ' 13 .
  • elf ' and e ⁇ f /Smad3 +/ ⁇ mice are born with dramatic visceromegaly, macroglossia, abnormal ear folds, and microfacies, followed in later months by the development of multiple cancers, including carcinomas of the gastrointestinal tract (liver, stomach, intestine, and pancreas), as well as renal and adrenal adenocarcinomas.
  • mice also had significant cytomegaly of adrenal cortex, though this was probably not confined to the fetal cortex. While the fetal cortex of the mouse adrenal differs significantly from that of humans, to date adrenal cytomegaly has not been described in any of the other rodent models of BWS 14 .
  • the combined phenotype is strongly suggestive of Beckwith-Wiedemann syndrome (BWS) and elf +/ /-Smad3 +/- mice could offer a valuable animal model for further genetic studies of this disease .
  • Phenotype and Cancer formation with elf and heterozygote mice We began with a detailed study of the phenotype and cancer formation of elf and elf +/ /-Smad3 +/- heterozygote mice. Mice with homozygous deletion of elf (elf ' ) undergo mid-gestational death 15 .
  • BWS postnatal gigantism (height more than 2 standard deviations above normal) is observed in 45% of cases.
  • Macroglossia a major symptom of BWS, is present in 92% of patients.
  • Another characteristic feature is cytomegaly of the fetal cortex of the adrenal glands. Facial abnormalities including those of the ear are present in greater than 50% of cases.
  • Neonatal hypoglycemia is observed in 13% of cases. Visceromegaly due to cellular hyperplasia of livers, kidneys and pancreas, occurs in of the majority of cases, sometimes accompanied by cardiomegaly.
  • hyperplasia of three or more organs is associated with an increased presence of tumors 16 .
  • elf and/or Smad3 may be important in the TGF- ⁇ induction of apoptosis in hepatocytes, and loss of ELF may contribute to the formation of tumors in the e ⁇ f' ⁇ and elf/Smad3 +/ ⁇ livers.
  • mice are mouse models for human BWS, (elf / 7Smad3 +/ ⁇ providing an exacerbated phenotype). Dramatically, ELF expression and ELF-mediated TGF- ⁇ signaling is lost in human BWS. Significantly, in BWS and cancer cells, the pattern of DNA methylation is often altered. Growing evidence suggests that aberrant DNA methylation of CpG islands around promoter regions can have the same effect as mutations in the coding regions on the inactivation of tumor-suppressor genes (Baylin et a!.. 2001 ).
  • 5'-aza-2'-deoxycytidine an inhibitor of DNA methyltransferase, reactivated gene expression when hypermethylation of CpG islands is the cause of reduced gene expression (Cameron et al.. 1999).
  • 5-aza-dC 5'-aza-2'-deoxycytidine
  • Three BWS cell lines were treated with an increasing concentrations of 5-aza-dC for 6 days.
  • expression of ELF was reactivated in three BWS cell lines at 2.5 ⁇ M concentration of 5-aza-dC compared to controls.
  • TGF- ⁇ signaling components are bona fide tumor suppressors with the ability to constrain cell growth and inhibit cancer development at its early stages. Inactivation of at least one of these components (such as the TGF- ⁇ receptors (TBRII, TBRI), Smad2, or the common mediator Smad4) occurs in almost all gastrointestinal tumors 1i 23 ⁇ 25 .
  • TGF- ⁇ receptors TGF- ⁇ receptors (TBRII, TBRI), Smad2, or the common mediator Smad4
  • TBRII is mutated in up to 30% colon cancers and TBRI is mutated in 15% of biliary cancers 23 and Smad4 is deleted in up to 60% of pancreatic cancers, and mutated in hereditary juvenile polyposis coli.
  • Loss of ELF, a Smad3/4 adaptor, is observed in human hepatocellular cancers and results in spontaneous development of hepatocellular cancers in mice.
  • TGF- ⁇ signaling Changes in TGF- ⁇ signaling drive the selection of defined differentiation pathways and the progression of differentiation in multiple tissues through functional regulation of Smad3 by its adaptor ELF.
  • Deregulation of TGF- ⁇ signaling may contribute to impaired differentiation and allow for the development of cancers, linking the differentiation of stem cells with suppression of carcinogenesis ' ' .
  • ELF an essential adaptor protein required for key events in the propagation of TGF- ⁇ signaling in BWS, often considered to be a stem cell disorder 28 . Striking phenotypic as well as mechanistic similarities are observed between human BWS and the e ⁇ f' ⁇ , e ⁇ f' ⁇ /Sma ⁇ 2 ⁇ ' ⁇ mutant mice.
  • the aberrant intracellular distribution of Smad3 and abrogation of TGF- ⁇ signaling in BWS can be re-instated by exogenous ELF.
  • Figure 4E a model for the role of ELF in Smad activation in BWS.
  • ELF/Smad3 interaction site is a major tumor suppressor pathway for multiple cancers and that alterations of ELF/SMAD3 expression at the mRNA level are potentially a major genetic alternation in human BWS.
  • elf ⁇ and elf ⁇ /SmadO ⁇ ' mice will be valuable to determine the underlying molecular mechanism and future treatment modalities for the tumors seen in human BWS.
  • hereditary over-growth syndromes including BWS.
  • Major rearrangements on the short arm of chromosome 11 may be involved in the etiology of BWS, particularly in the region of the insulin like growth factor 2 (IGF-2) gene (11 p15.5).
  • IGF-2 insulin like growth factor 2
  • This gene is thought to be parentally imprinted in the mouse and it has been suggested that in the human, paternal duplication of this paternally expressed imprinted locus in BWS patients leads to over expression of the gene and consequent general hyperplasia.
  • This model predicts that there should be frequent and possibly parental origin-specific increased expression of the IGF2 gene in the patients.
  • the resemblance of this mouse model to human BWS is substantial but not perfect.
  • the tumors in human BWS are mostly of embryonal cell types including nephroblastoma, hepatoblastoma and pancreatoblastoma, while those in the mouse model are largely carcinomas or other "adult" type neoplasms.
  • the predisposition to neoplasia seen in humans with BWS diminishes in later childhood, while this has not been observed in maturing mice.
  • Adrenal cytomegaly in the mutant mice is apparently not localized to the fetal cortex as it is in human BWS.
  • TGF- ⁇ signaling in mesoderm as well as endoderm development as well as in suppression of multiple cancers, not only gastrointestinal cancers 1> 30 ' 31 . It is possible that in BWS, as in sporadic hepatocellular cancer, derangement in TGF- ⁇ signaling in progenitor cells contributes to malignant transformation and eventual cancer development 2l 18 . Future studies on the role of genomic imprinting as an epigenetic mechanism controlling parental-origin-specific gene expression, and their perturbations should yield new therapeutics for cancers that are stem in origin 32 . Indeed insights into the consequences of epigenotype switches at birth and in BWS from ELF and its interactions with Smad3 may be of profound significance.
  • BWS Beckwith-Wiedemann
  • the cell lines used in this study are: UPD+T, hepatoblastoma (referred to as BWS-1 ); tongue tissue derived from a case with UPD-NT (referred to as BWS-2); KvDMR+T, hepatoblastoma (referred as BWS- 3); KvDMR-NT (referred to as BWS-4); CDKN1C-NT (referred to as BWS-5); and tongue tissue derived from a case with UPD-NT (referred to as BWS-6).
  • cDNA sequence of ELF was amplified by gene-specific primer and inserted into either pcDNA3.1/V5-His- TOPO (V5-ELF (Invitrogen) to use in transfection studies.
  • Constructs expressing full- length elf or vector alone were transfected into MEF cells or human gastric cancer cells or human BWS cells by using Amaxa electroporation kit (Amaxa Inc., Gaithersburg, MD) according to the manufacturer's protocols.
  • SiRNA Dharmacon, Lafayette, CO
  • Lipofectamine 2000 Invitrogen, CA
  • Genomic DNA was bisulfite modified with an EpiTect Bisulfiat Kit (Qiagen, Valencia, CA) according to the manufacturer's protocols. Prediction of CpG islands in EIf promoter and Primer design for Methylation -specific PCR use web software (www.urogene.org); DNA methylation analysis by a web tool in website: http://quma.cdb.riken.jp. Materials and Methods
  • Hepatocarcinoma and Gastric cancer cell lines (HepG2, Kato III, SNU 475 and SNU 182) were obtained from ATCC and cultured according to the manufacturer's protocol. BWS patients were diagnosed based on the presence of three major criteria 11 .
  • Human BWS cell lines were developed by Dr. Weksberg (Ontario, Canada). Cells were cultured in MEM-alpha medium with 10% FBS. The cell lines (lymphoblasts and fibroblasts) were named for the molecular abnormality identified (UPD, KvDMR loss of methylation or CDKN1 C mutation.
  • cell lines were given a tumor (T) designation if the patient had a tumor or a "no tumor” designation if no tumor has been detected (NT).
  • T tumor
  • NT no tumor has been detected
  • the cell lines used in this study are: UPD+T, hepatoblastoma (referred to as BWS-1 ); tongue tissue derived from a case with UPD-NT (referred to as BWS-2); KvDMR+T, hepatoblastoma (referred as BWS- 3); KvDMR-NT (referred to as BWS-4); CDKN1C-NT (referred to as BWS-5); and tongue tissue derived from a case with UPD-NT (referred to as BWS-6).
  • DNA was also amplified using the primer 1 and primer 3, which is located in the Neo (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant elf allele.
  • a 620 bp fragment was detected in mice heterozygous or homozygous for the mutant elf allele, while no signal was detected in wild-type mice.
  • the wild type Smad3 allele was detected by using Smad3-7 and Smad3-5 primers giving a fragment of 400bp (5' CCC GAA CAG TTG GAT TCA CAC A 3').
  • primers Smad3-5 and Rin-1 A were used. A fragment of 250bp was observed (5 1 CCA CTT CAT TGC CAT ATG CCC TG 3').
  • mice exhibiting overt pathological signs were sacrificed and underwent autopsy. Liver tissue and HCC identified were dissected, fixed with 10% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 ⁇ m. Sections were stained with hematoxylin and eosin (H&E), or subject to immunohistochemical analysis with antibodies. Immunohistochemical staining was performed with primary antibodies against ELF, Smad3, p57, pHistone H3 (Ser 10 ), KCNQ1 , and Caspase 3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abeam, MA).
  • Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson lmmunoresearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO). Counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO). Proliferating cells were identified by anti-pHistone H3 (Ser 10 ) mitotic marker labeling. Apoptotic cells were detected by with anti-Caspase3 antibody (Promega, OR).
  • Formalin-fixed and paraffin-embedded BWS tumor specimens were obtained from the Department of Pathology, Georgetown University, Washington, DC, USA. These samples were subjected to immunohistochemical analysis for indicated antibodies. Two independent and blinded pathologists evaluated the tumors used in the study. The control samples of normal tissue used in the present investigation were taken from the borders of the surgical specimens.
  • lmmunoblot assay For assaying endogenous TBRII, ELF, Smad3, Smad4, protein expression, lysates of HepG2 and indicated BWS cell lines were prepared in 1 %NP- 40 buffer (150 mM NaCI, 5OmM Tris pH7.4, 1 % NP40) with complete mini protease inhibitors (Roche Molecular Biochemicals). Lysed (50-100 ⁇ g of total protein in 1X Lamaelli buffer was heated to 95°C for 10 minutes and then loaded onto a SDS- PAGE gel for Western blotting, lmmunoblotting was performed with the indicated primary antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and Abeam, MA). The loading control was performed under the same conditions using mouse monoclonal anti-Actin (Sigma, MO).
  • Plasmids, microRNA inhibitors, SiRNA and transient transfection assays Plasmids, microRNA inhibitors, SiRNA and transient transfection assays.
  • the cDNA sequence of ELF was amplified by gene-specific primer and inserted into either pcDNA3.1/V5-His-TOPO (V5-ELF (Invitrogen) to use in transfection studies.
  • Constructs expressing full-length elf or vector alone were transfected into MEF cells or human gastric cancer cells or human BWS cells by using Amaxa electroporation kit (Amaxa Inc., Gaithersburg, MD) according to the manufacturer's protocols.
  • MicroRNA inhibitors or SiRNA was transfected with Lipofectamine 2000 (Invitrogen, CA) as per manufacturer's instructions. Cells were used for confocal analysis and Q-PCR analysis.
  • Exons from each elf cDNA fragment were isolated and used for SSCP analysis. After PCR amplification, the PCR products were diluted 1 :10 in loading buffer that contained 95% formamide (v/v), 50 mM EDTA, 20 mM NaOH, and 0.05% each of xylene cyanol and bromphenol blue. Samples were denatured at 100 0 C for 10 min, quick frozen on dry ice, thawed slowly on wet ice, and fractionated on a MDE (Mutation Detection Enhancement) gel. Point mutations were identified by a shift in the relative mobility of the PCR fragments compared with wild type elf controls. Chromatin-immunoprecopitation (ChIP) assays.
  • ChIP Chromatin-immunoprecopitation
  • the ChIP assay was performed using ChIP assay kit according to manufacturer's instructions (Upstate Biotechnology). Briefly, HepG2 cells were grown to 70-80% confluence, cross-linked with 1 % formaldehyde for 10 min at room temperature after TGF-b stimulation for 1 h, stopped with the addition of glycine, rinsed with PBS and harvested. The resultant cell pellet was lysed and sonicated or enzymatically digested to generate fragments ranging from 200 to 1500bp. Protein-DNA complexes were enriched by immunoprecipitation using antibodies for Smad3 and ELF or preimmune rabbit serum (negative control). Protein G Agarose beads were added and washed.
  • DNA- protein complexes were eluted, reverse cross-linked, treated with proteinase-K. Following DNA purification, DNA fragments were recovered by centrifugation, resuspended in water and used for PCR amplification of IGF2 gene promoter DNA. The primer sequences are available on request.
  • RNA was isolated using TRIzol reagent combined with RNAeasy kit, miRNAeasy kit (Qiagen, Valencia, CA). RNA or miRNA was quantified using NanoDrop-ND-1000 (Wilmington, DE).
  • quantitative real-time PCR quantitative real-time PCR (qPCR) was performed with cDNA generated from 1 ⁇ g total RNA with a Superscript III reverse transcriptase kit (Roche) using either random hexamers, oligo d(T)16 or gene-specific primers. Primers for elf were designed for qPCR using Primer Express software (Applied Biosystems, Foster City, CA), and the sequences are available upon request.
  • qPCRs were carried out using SYBR green PCR master mix (Applied Biosystems). All other qPCRs were carried out with commercially available TaqMan gene expression assay utilizing TaqMan Universal PCR mix. The PCR reactions were carried out in an ABI Prism 7900HT sequence detection system (Applied Biosystems) according to the manufacturer's conditions. Relative values were quantified by generating a standard curve by cDNAs generated from control treated samples and normalization was done by GAPDH or 28S RNA expression.
  • the samples were analyzed with a Bio-Rad MRC- 600 confocal microscope (Bio-Rad, Cambridge, MA), with an ILT model 5470K laser (Ion Laser Technology, Salt Lake City, UT) as the source for the krypton-argon ion laser beam.
  • FITC-stained samples were imaged by excitation at 488 nm and with a 505 to 540 bandpass emission filter, and Rhodamine-stained samples were imaged by excitation at 568 nm with a 598- to 621 bandpass emission filter using a 63x (numerical aperture 1.3) objective.
  • Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.
  • Genomic DNA was bisulfite modified with an EpiTect Bisulfiat Kit (Qiagen, Valencia, CA) according to the manufacturer's protocols. Prediction of CpG islands in EIf promoter and Primer design for Methylation -specific PCR use web software (www.urogene.org); DNA methylation analysis by a web tool in website: http://quma.cdb.riken.jp (Kumaki Y, Oda M. & Okano M, QUMA: quantification tool for methlation analysis. Nucleic Acids. Res.
  • Primer Pairs used for methylation -specific PCR and bisulfite sequencing were methylated forward / 5'-CGG TGT TTT TAT AAA TTT TTT TTG CGT C-3' reverse/ 5'-AAT TCC ATT ATA CCC GAC GTA ACG C-3' and unmethylated forward 5'-TTG GTG TTT TTA TAA ATT TTT TTT GTG TTG A-3' reverse/ 5'-CAA TTC CAT TAT ACC CAA CAT AAC ACC C-3'
  • Adenomatous polyposis coli protein contains two nuclear export signals and shuttles between the nucleus and cytoplasm. Proc Natl Acad Sci U S A 97, 12085-90 (2000) .
  • Kitisin, K. et al Disruption of transforming growth factor-beta signaling through beta-spectrin ELF leads to hepatocellular cancer through cyclin Dl activation. Oncogene 26, 7103-10 (2007) . 18. Tang, Y. et al. Progenitor/stem cells give rise to liver cancer due to aberrant TGF-beta and IL-6 signaling. Proc Natl Acad Sci U S A 105, 2445-50 (2008).
  • the adaptor protein ELF Embryonic Liver Fodrin, a ⁇ -Spectrin
  • ELF Embryonic Liver Fodrin, a ⁇ -Spectrin
  • Smad3 and Smad4 signaling we now show that elf- and elf +--"Smad3+-- mice develop visceromegaly and multiple cancers with phenotypic characteristics frequently observed in patients with Beckwith-Wiedemann syndrome (BWS) 1 a hereditary human cancer overgrowth syndrome.
  • BWS Beckwith-Wiedemann syndrome
  • a dramatic decrease in ELF RNA and protein but not Smad3 or p53 expression is observed in elf", elf +- "Smad3+-- tumors as well as BWS cell lines and tumor tissues compared to normal tissues.
  • BWS Beckwith- Wiedemann syndrome
  • the molecular defects underlying BWS are not well understood but may be associated with increased expression of IGF2 perhaps via alterations in epigenetic regulation at the IGF2 locus on chromosome 11 (11, 12). Although increased IGF2 as well as decreased P57/CDKN1 C have been implicated in this syndrome, to date no clear mouse model with cancer development has emerged for this syndrome ( Figure 1 , Table 1 ).
  • the Smad3/4 adaptor protein ELF which regulates TGF-a signaling is a potent regulator of tumorigenesis, but the role of the TGF-a pathway and ELF in human gastrointestinal (7) tumor syndromes remains unclear (13, 14).
  • BWS postnatal gigantism (height more than 2 standard deviations above normal) is observed in 45% of cases.
  • Macroglossia a major symptom of BWS, is present in 92% of patients.
  • Facial abnormalities including those of the ear are present in greater than 50% of cases.
  • Neonatal hypoglycemia is observed in 13% of cases. Visceromegaly with multilobed livers, cardiomegaly and renal hypertrophy occurs in 50% of cases. Interestingly, involvement of three or more organs is associated with an increased presence of tumors (16). Examination of heterozygous elf- ' mice revealed a 40% increase in incidence of tumors of the liver (17), as well as the kidney and ovaries (Table 2).
  • Tumor tissues from elf' ' and e/Z ⁇ VSmadS ⁇ " mice show a dramatic decrease of ELF mRNA but not p53.
  • To determine whether the tumors in the elf- ' and elf "- "Smad3+-- mice arose from loss of ELF, or Smad3, or secondary events such as p53 mutations in the haploid we examined tumor tissues from elf- ' and elf " "Smad3+-- heterozygote mice for alterations in elf, Smad3 and p53 RNA by quantitative PCR. Significantly, all seven tumor tissues showed a loss of elf mRNA levels without significant decreases in Smad3 compared to non-tumor controls ( Figure 2C I, II). In addition, p53 mRNA levels were not significantly altered in any of the three samples ( Figure s1A).
  • the lung cancer tissue sample had a p53 point mutation substituting the valine 213 for glycine.
  • the small intestine tumor tissue sample had a point mutation substituting leucine 191 for phenylalanine.
  • hepatocyte apoptosis Loss of response to TGF-a signaling in elf" and e/f-"Smad3-cells might be expected to impact hepatocyte apoptosis (1).
  • Epithelial apoptosis in the mouse liver tissues was examined using the apoptotic marker, anti-active caspase3.
  • apoptosis was noted in hepatocytes (Average: 27 per HPF, range 4-36 per HPF) ( Figure s5) but few apoptotic cells were seen in elf- and elf- "- "Smad3*-- mice (Average: 3 per HPF, range 0-8 per HPF) ( Figure s5).
  • elf and/or Smad3 may be important in the TGF-a induction of apoptosis in hepatocytes, and loss of ELF may contribute to the formation of tumors in the elf- and elf " "Smad3+-- livers.
  • ELF and Smad3 in Human BWS cell lines and tissues shows decreased ELF RNA, mislocalized Smad3 protein, and disruption of TGF-a signaling.
  • the phenotype observed in the mouse suggests that elf- and elf- "Smad3- mice could be models of human BWS.
  • TGF-13 pathway members ELF and Smad3 as well as other molecules implicated in BWS: IGF2, IGF2R and P57 in 10 human BWS cancer tissues and 6 BWS cell lines, as well as 12 human gastrointestinal cancer cell lines.
  • ELFTGF-a signaling is required for suppression of IGF2 signaling, and that the increased IGF2 observed in BWS may potentially be a secondary event from loss of ELF, and not the causal event in BWS.
  • miRNA-let7a is a potential regulator of elf mRNA levels in BWS.
  • Our data strongly point to loss of ELF expression as one likely cause of BWS. This could be a result of mutation of the ELF gene, methylation of its promoter, transcriptional or post-transcriptional de-regulation.
  • SSCP Single Strand DNA Polymorphism
  • exon 15 of ELF was not amplified at high stringency condition of PCR from an HCC Line, CRL-2236 (SNU 475).
  • SNU 475 a missense mutation Arg 928 to lsoleucine (G - A) in elf exon 15 in 2 of the human gastrointestinal cancer cell lines demonstrating loss of ELF expression.
  • Figure s6B the SNU 475 cell line was shown to produce decreased ELF protein levels in comparison to SNU182 (no mutation in exon 15 of elf) suggesting a possibility that the mutation could be related to ELF translation or protein stabilization (17).
  • RNA array analyses Utilizing broad microRNA (miRNA) array analyses of elf ' , elf+/JSmad3+/-, and 6 human BWS cell lines, we were able to focus upon a common cluster of miRNAs (miR let-7, miR125b and miRIOO) which are over-expressed in BWS and also increased in the elf , elf+/-/Smad3+/-, tissues ( Figure 4 A). This increase in the common cluster of miRNAs could potentially represent mechanistic similarities between BWS and elf and elf /Smad3 +/ ⁇ in tumor progression.
  • TGF-a signaling components are bona fide tumor suppressors with the ability to constrain cell growth and inhibit cancer development at its early stages. Inactivation of at least one of these components (such as the TGF-a receptors (TBRII, TBRI), Smad2, or the common mediator Smad4) occurs in almost all gastrointestinal tumors (1, 22-24).
  • TGF-a receptors TGF-a receptors (TBRII, TBRI), Smad2, or the common mediator Smad4
  • TBRII is mutated in up to 30% colon cancers and TBRI is mutated in 15% of biliary cancers ⁇ 22) and Smad4 is deleted in up to 60% of pancreatic cancers, and mutated in hereditary juvenile polyposis coli.
  • Loss of ELF, a Smad3/4 adaptor is observed in human hepatocellular cancers and results in spontaneous development of hepatocellular cancers in mice.
  • deletion of ELF results in a dramatic and spontaneous formation of liver and gastrointestinal (7) cancers, and a splice site mutation in elf exon 15 occurs in 11% of human Gl cancer cell lines tested so far.
  • mice are mouse models for human BWS, (elU/-/Smad3+/- providing an exacerbated phenotype). Dramatically, ELF expression and ELF-mediated TGF-a signaling is lost in human BWS.
  • TGF-a signaling Changes in TGF-a signaling drive the selection of defined differentiation pathways and the progression of differentiation in multiple tissues through functional regulation of Smad3 by its adaptor ELF.
  • Deregulation of TGF-a signaling may contribute to impaired differentiation and allow for the development of cancers, linking the differentiation of stem cells with suppression of carcinogenesis (2, 25, 26).
  • ELF an essential adaptor protein required for key events in the propagation of TGF-a signaling in BWS, often considered to be a stem cell disorder (27). Striking phenotypic as well as mechanistic similarities are observed between human BWS and the elf ' , elf /' /Sma ⁇ 3 ir/' mutant mice.
  • the aberrant intracellular distribution of Smad3 and abrogation of TGF-a signaling in BWS can be re-instated by exogenous ELF or by inhibition of Iet7a microRNA mediated repression of endogenous ELF.
  • These studies allow us to propose a model for the role of ELF in Smad activation in BWS ( Figure 4E).
  • aberrant elf microRNA modulation may be a predominant mechanism for loss of ELF protein expression observed in BWS.
  • miRNALet7a may also regulate e/f mRNA accumulation and/or stability.
  • hereditary over-growth syndromes including BWS.
  • Major rearrangements on the short arm of chromosome 11 may be involved in the etiology of BWS, particularly in the region of the insulin like growth factor 2 (IGF- 2) gene (11 p15.5).
  • IGF- 2 insulin like growth factor 2
  • This gene is thought to be parentally imprinted in the mouse and it has been suggested that in the human, paternal duplication of this paternally expressed imprinted locus in BWS patients leads to over expression of the gene and consequent general hyperplasia.
  • This model predicts that there should be frequent and possibly parental origin-specific increased expression of the IGF2 gene in the patients.
  • Hepatocarcinoma and Gastric cancer cell lines were obtained from ATCC and cultured according to the manufacturer's protocol.
  • BWS patients were diagnosed based on the presence of three major criteria (32).
  • Human BWS cell lines were developed by Dr. Weksberg (Ontario, Canada). Cells were cultured in MEM-alpha medium with 10% FBS.
  • the cell lines (lymphoblasts and fibroblasts) were named for the molecular abnormality identified (UPD, KvDMR loss of methylation or CDKN1 C mutation.
  • cell lines were given a tumor (T) designation if the patient had a tumor or a "no tumor” designation if no tumor has been detected (NT).
  • T tumor
  • NT tumor
  • the cell lines used in this study are: UPD+T, hepatoblastoma (referred to as BWS-1 ); tongue tissue derived from a case with UPD-NT (referred to as BWS-2); KvDMR+T, hepatoblastoma (referred as BWS-3); KvDMR-NT (referred to as BWS-4); CDKN1 C-NT (referred to as BWS-5); and tongue tissue derived from a case with UPD-NT (referred to as BWS-6).
  • mice were intercrossed with Smad3 +A mice to obtain e/ ⁇ ' /SmacO ⁇ mice.
  • Genotypes were determined by Southern blotting or PCR.
  • primer 1 5' CTCATACTAGGCAGATCTC 3'
  • primer 2 5' GTAGCTCTACTTGGAAGGTC 3'
  • Primer 1 is located 5' to the deletion and primer 2 is located within the deletion. This primer pair amplifies a fragment of 481 bp from wild-type and elf heterozygous, but not from elf -/ - mutant mice.
  • DNA was also amplified using the primer 1 and primer 3, which is located in the Neo (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant elf allele.
  • a 620 bp fragment was detected in mice heterozygous or homozygous for the mutant elf allele, while no signal was detected in wild-type mice.
  • the wild type Smad3 allele was detected by using Smad3-7 and Smad3-5 primers giving a fragment of 400bp (5' CCC GAA CAG TTG GAT TCA CAC A 3').
  • primers Smad3-5 and Rin-1A were used. A fragment of 250bp was observed (5' CCA CTT CAT TGC CAT ATG CCC TG 3').
  • mice exhibiting overt pathological signs were sacrificed and underwent autopsy. Liver tissue and HCC identified were dissected, fixed with 10% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 ⁇ m. Sections were stained with hematoxylin and eosin (H&E), or subject to immunohistochemical analysis with antibodies. Immunohistochemical staining was performed with primary antibodies against ELF, Smad3, p57, pHistone H3 (Ser 10 ), KCNQ1 , and Caspase 3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abeam, MA).
  • Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson I mmunoresearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO). Counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO). Proliferating cells were identified by anti-pHistone H3 (Ser 10 ) mitotic marker labeling. Apoptotic cells were detected by with anti-Caspase3 antibody (Promega, OR).
  • Formalin-fixed and paraffin-embedded BWS tumor specimens were obtained from the Department of Pathology, Georgetown University, Washington, DC, USA. These samples were subjected to immunohistochemical analysis for indicated antibodies. Two independent and blinded pathologists evaluated the tumors used in the study. The control samples of normal tissue used in the present investigation were taken from the borders of the surgical specimens.
  • 1 %NP-40 buffer 150 mM NaCI, 5OmM Tris pH7.4, 1 % NP40
  • complete mini protease inhibitors (Roche Molecular Biochemicals). Lysed (50-100 ⁇ g of total protein in 1X Lamaelli buffer was heated to 95°C for 10 minutes and then loaded onto a SDS-PAGE gel for Western blotting, lmmunoblotting was performed with the indicated primary antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and
  • the cDNA sequence of ELF was amplified by gene-specific primer and inserted into either pcDNA3.1/V5-
  • His-TOPO V5-ELF (Invitrogen) to use in transfection studies.
  • Constructs expressing full-length elf or vector alone were transfected into MEF cells or human gastric cancer cells or human BWS cells by using Amaxa electroporation kit (Amaxa Inc., Gaithersburg, MD) according to the manufacturer's protocols.
  • MicroRNA inhibitors or SiRNA was transfected with Lipofectamine 2000 (Invitrogen, CA) as per manufacturer's instructions. Cells were used for confocal analysis and Q-PCR analysis.
  • Exons from each elf cDNA fragment were isolated and used for SSCP analysis. After PCR amplification, the PCR products were diluted 1 :10 in loading buffer that contained 95% formamide (v/v), 50 mM EDTA, 20 mM NaOH, and 0.05% each of xylene cyanol and bromphenol blue. Samples were denatured at 100 0 C for 10 min, quick frozen on dry ice, thawed slowly on wet ice, and fractionated on a MDE (Mutation Detection Enhancement) gel. Point mutations were identified by a shift in the relative mobility of the PCR fragments compared with wild type elf controls.
  • MDE Meltation Detection Enhancement
  • Chromatin-immunoprecopitation (ChIP) assays The ChIP assay was performed using ChIP assay kit according to manufacturer's instructions (Upstate Biotechnology). Briefly, HepG2 cells were grown to 70-80% confluence, cross-linked with 1 % formaldehyde for 10 min at room temperature after TGF-b stimulation for 1 h, stopped with the addition of glycine, rinsed with PBS and harvested. The resultant cell pellet was lysed and sonicated or enzymatically digested to generate fragments ranging from 200 to 1500bp. Protein-DNA complexes were enriched by immunoprecipitation using antibodies for Smad3 and ELF or preimmune rabbit serum (negative control).
  • DNA-protein complexes were eluted, reverse cross-linked, treated with proteinase-K. Following DNA purification, DNA fragments were recovered by centrifugation, resuspended in water and used for PCR amplification of IGF2 gene promoter DNA. The primer sequences are available on request.
  • RNA, miRNA analysis, and quantitative real-time PCR were isolated using TRizoi reagent combined with RNAeasy kit, miRNAeasy kit (Qiagen, Valencia, CA). RNA or miRNA was quantified using NanoDrop-ND-1000 (Wilmington, DE).
  • quantitative real-time PCR quantitative real-time PCR (qPCR) was performed with cDNA generated from 1 ⁇ g total RNA with a Superscript III reverse transcriptase kit (Roche) using either random hexamers, oligo d(T)16 or gene- specific primers. Primers for elf were designed for qPCR using Primer Express software (Applied Biosystems, Foster City, CA), and the sequences are available upon request.
  • qPCRs were carried out using SYBR green PCR master mix (Applied Biosystems). All other qPCRs were carried out with commercially available TaqMan gene expression assay utilizing TaqMan Universal PCR mix. The PCR reactions were carried out in an ABI Prism 7900HT sequence detection system (Applied Biosystems) according to the manufacturer's conditions. Relative values were quantified by generating a standard curve by cDNAs generated from control treated samples and normalization was done by GAPDH or 28S RNA expression. For miRNA expression analysis, quantitative real-time PCR (qPCR) was performed with cDNA generated from 10ng purified miRNA with a reverse transcriptase kit (TaqMan) using miRNA specific primers (TaqMan).
  • qPCR quantitative real-time PCR
  • RNA and microRNA Microarray Analysis of RNA and microRNA. Custom designed 44K human 60-mer oligo microarrays (Agilent Technologies, CA) were used for the array experiments. Total RNA was isolated as described above. cDNA synthesis from total RNA and fluorescent cRNA synthesis from the cDNA were prepared utilizing Low RNA Input Linear Amp kit (Agilent Technologies, CA). The microarray slides were hybridized with the fluorescent cRNA, and scanned according to the manufacturer's protocol (Agilent Technologies, CA). The microarray data was analyzed by Feature Extraction and GeneSpring (Agilent Technologies, CA).
  • miRNA arrays isolation was performed as described above and some miRNA arrays were outsourced to Exiqon (Vedbaek Denmark), where miRCURYTM LNA microarray piatform was used for analysis.
  • the samples were analyzed with a Bio-Rad MRC-600 confocal microscope (Bio-Rad, Cambridge, MA), with an ILT model 5470K laser (Ion Laser Technology, Salt Lake City, UT) as the source for the krypton-argon ion laser beam.
  • FITC-stained samples were imaged by excitation at 488 nm and with a 505 to 540 bandpass emission filter, and Rhodamine-stained samples were imaged by excitation at 568 nm with a 598- to 621 bandpass emission filter using a 63x (numerical aperture 1.3) objective.
  • Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.
  • Targeting Vector Recombinant phage containing genomic DNA of the itih4 locus was isolated from a 129/SvEv mouse library by using PK7R, a piece of itih4 cDNA, as a probe.
  • the finished construct, p-itih4Neo is shown in Fig. 3C. This targeting strategy deletes a 1.8 kb Sma ⁇ -Cla I fragment that contains the 2 nd and 3 rd exons of the itih4 gene.
  • TC1 ES cells were transfected with Not I digested p-itih4Neo, and selected with G418 and FIAU.
  • ES cell clones that were resistant to both G418 and FIAU were selected and analyzed by Southern blotting for homologous recombination events within the itih4 locus (Fig. 3D). Details are in the supplemental data.
  • ES cells heterozygous for the targeted mutation were microinjected into C57BL/6 blastocysts to obtain germline transmission.
  • the injected blastocysts were implanted into the uteri of pseudopregnant Swiss Webster (Taconic, NY) foster mothers and allowed to develop to term.
  • Male chimeras (identified by the presence of agouti coat color) were crossed with C57B6 and NIH Black Swiss females (Taconic, NY).
  • Germline transmission was confirmed by agouti coat color in the F1 animals, and all agouti offspring were tested for the presence of the mutated itih4 allele by Southern blot analysis using the same conditions for the detection of the homologous recombination event in the ES cells.
  • Genotype analysis Genotypes were determined by Southern blotting or PCR.
  • the wild-type itih4 allele was detected using primer 1 (5' CTCATACTAGGCAGATCTC 3') and primer 2 (5' GTAGCTCTACTTGGAAGGTC 3').
  • primer 1 is located 5' to the deletion and primer 2 is located within the deletion.
  • This primer pair amplifies a fragment of 481 bp from wild-type and itih4 heterozygous, but not from ⁇ tih4 ⁇ ' ' mutant mice.
  • DNA was also amplified using primer 1 and primer 3, which is located in the Neo locus (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant itih4 allele.
  • a 620 bp fragment was detected in mice heterozygous or homozygous for the mutant itih4 allele, while no signal was detected in wild-type mice.
  • Confocal laser-scanning immunofluorescence microscopy Colocalization studies were performed with anti-ELF and anti-Stat3, and anti-0ct4 utilizing human regenerating liver and HCC tissues. Normal wild-type, e ⁇ f' ⁇ , itih4 'A , and e ⁇ f /itih4 '/' mutant livers and HCC tissues were also used for the confocal microscopy.
  • FITC-stained samples were visualized by excitation at 488 nm and with a 505 to 540 bandpass emission filter, and Rhodamine-stained samples were visualized by excitation at 568 nm with a 598- to 621 bandpass emission filter using a 6Ox (numerical aperture 1.3) objective and 2Ox objective.
  • Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.
  • Mouse embryo-derived fibroblasts harboring the null allele elf and itih4 as well as wild-type were derived as previously described (9). Briefly, embryos E14.5 were triturated in 0.25% trypsin/1 mM EDTA and genotyped. The lines were propogated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 50 ⁇ g/ml streptomycin to establish fibroblasts that were cultured over several passages to obtain enough cells to perform the experiments. The fibroblasts used for the experiments were at passage 3-5.
  • Wild-type and ⁇ tih4 ⁇ ' ⁇ fibroblast lines were used in experiments, and the results obtained were also independent of passage number. Representative data are shown.
  • lmmunoblot assay For assaying endogenous TBRII, ELF, ITIH4, IL-6, Stat3, pStat3, protein lysates of human HCC cells (SNU-182 (CRL-2235), SNU-398 (CRL- 2233), and SNU-449 (CRL-2234) ATCC, VA), MEFs, and normal wild-type, elf A , itih4 '/' , and elf / ⁇ /itih4 ⁇ / ⁇ mutant liver and HCC tissues were immunoblotted with the indicated anti-peptide or anti-phospho-specific antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and Abeam, MA).
  • the loading control was performed under the same conditions using mouse monoclonal anti-Actin (Sigma, MO). MEFs cultured in the presence or absence of IL-6 (5 ng/ml, Sigma, MO) for 24 hrs were washed with PBS and lysed (150 mM NaCI, 5OmM Tris, 1 % NP40, and complete mini protease inhibitors (Roche Molecular Biochemicals)). 50-100 ⁇ g of total protein in 1X Lamaelli buffer was heated to 95 degrees for 10 minutes and then loaded onto a PAGE GEL for Western blotting. Histological analysis and antibody staining. Mice exhibiting overt pathological signs were sacrificed and underwent autopsy.
  • Liver and HCC tissues were dissected, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 ⁇ m. Sections were stained with hematoxylin and eosin (H&E), or subjected to immunohistochemical analysis with antibodies, lmmunohistochemical staining was performed with primary antibodies against ELF, Oct4, ITIH4, Stat3, pStat3, pHistone H3 (Ser 10 ), and Caspase-3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abeam, MA).
  • H&E hematoxylin and eosin
  • Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson lmmunoresearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO) and counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO).
  • Proliferating cells were labeled with BrdU labeling and detection kit (Invitrogen, CA). BrdU (1 ml/100 g body weight) was injected (i.v.) into 18.5 dpc pregnant mice, and 4 hrs later the fetal stomachs were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 6 ⁇ m. The proliferating cell was also identified by anti-pHistone H3 (Ser 10 ) mitotic marker labeling. Detection of Apoptotic Cells.
  • Apoptotic cells were detected by the TUNEL method with a MEB STAIN Apoptosis Kit Direct (MBL, 8445) as well as with anti-Caspase-3 antibody (Promega, OR). Tissues were then fixed and analyzed by using immunofluorescence microscopy.
  • RNeasy kit Qiagen, CA
  • Agilent 2100 Bioanalyzer with a RNA 6000 Nano Chip kit for routine RNA qualification.
  • cDNA synthesis from total RNA and fluorescent cRNA synthesis from the cDNA were prepared utilizing Low RNA Input Linear Amp kit (Agilent Technologies, CA).
  • the microarray slides were hybridized with the fluorescent cRNA, and scanned according to the manufacturer's protocol (Agilent Technologies, CA).
  • CDK5 disruption has been implicated in neurodegeneration, including the development of Alzheimers disease by its association in generation of the hyperphosphorylated tau which is the main component of one of the pathological hallmarks of AD; neurofibrillary tangles. Disruption of the transforming growth factor- ⁇ pathway may contribute to this CDK5 deregulation and subsequent production of p25 and hyperphosphorylated p-Tau..
  • TGF- ⁇ adaptor protein ELF elf 1'
  • Smad4 +I ⁇ co-mediator Smad4
  • elf ' SmadA* 1' harvested the frontal cortex and hippocampus for analysis after 12 months
  • lmmunoblot analysis revealed an excess production of p25, as well as upregulated CDK5 and CDK1 expression
  • immunohistochemical detection revealed hyperphosphorylated Tau, overexpressed CDK4, cyclin A and PCNA.
  • Alzheimer's disease one of the tauopathies, is a progressive neurodegenerative disorder characterized by loss of cognitive function.
  • Studies showed that an estimated 1 to 5 million people in the United States have Alzheimer disease and 26.6 million people worldwide were afflicted by Alzheimer's in 2006 (Brookmeyer et al.,2007; Gao et al., 1998). With around 360,000 new cases diagnosed each year in accordance with the growing of aged population, this number may quadruple by 2050, It is clear that this tremendous public health problem is becoming worse.
  • no effective treatments to delay or halt the progression of the disease are available yet due to our limited understanding of the cause and effect relationships that underlie the neuronal loss that is central to Alzheimer's pathology. But not until the last two decades, we have found out the CDK5 which dysregulation can lead to neuronal demise and implicate a causal element in the neuronal loss of Alzheimer's disease..
  • CDK5 is a unique member of Cyclin-dependent kinases (Cdks) family. Unlike other Cdks, Cdk5 is activated through complex formation with one of several non- cyclin proteins: p35 and p39 (Tsai et al.,1994; Tang et al.,1995), or their proteolytic cleavage products p25 and p29 (patrick et al.,1999; Patzke et al.,2002), respectively.
  • Cdks Cyclin-dependent kinases
  • Cdk5 While several Cdks have prominent roles in cell division, Cdk5 is highly expressed and active in post-mitotic neurons (Tsai et al.,1993;) and plays an essential role in the proper development of the CNS (Dhavan and Tsai, 2001 ). Together with its activator, p35, CDK5 is responsible for neuronal migration and development (Hou et al., 2007). Specifically, CDK5 is able to facilitate neuronal survival by inactivating the JNK3 kinase whose activation normally drives apoptosis (Li et al., 2002). However, CDK5 has been studied with much interest in recent years due to its association with neurodegenerative diseases like Alzheimers disease, a process which involves faulty apoptosis of neurons (Cheung and Slack, 2004).
  • the activating protein for CDK5, p35 may be incorrectly truncated.
  • P35 is the subunit normally required for activation as well as promotion of CDK5 microtubule assembly and microtubule bundle formation (Hou et al., 2007).
  • calpain- mediated cleavage of p35 has been demonstrated to produce the truncated version of this protein, p25, its characteristic differing substantial from the p35 counterpart.
  • p25 causes prolonged activation and mislocalization of CDK5 and has been demonstrated to be neurotoxic (Kim et al., 2007; Weisberger, Neusch, Bahr, 2003).
  • p25 is substantially longer than p35, the latter of which has been shown to be highly unstable.
  • p35 has been shown to be highly unstable.
  • the resulting excessive and mislocalized Cdk5 activity gives rise to neurodegeneration via programmed cell death signals (Kim et al., 2007; Weisberger, Neusch, Bahr, 2003).
  • Tau occurs predominantly in neuronal axons, where it binds to microtubules and regulates their length and dynamics; which is the most well-recognized function of tau. Tight regulation of microtubule activity is critical to cell viability, and so as fine regulation of tau (Bunker et al., 2004). Tau activity is modulated by phosphorylation, and the ability of tau to bind to and stabilize microtubules correlates inversely with its degree of phosphorylation.
  • Hyperphosphorylation of tau occurs when CDK5 is faulty activated, in conjunction with the enzyme glycogen synthase kinase-3 (Yamaguchi et al., 1996; Pei et al., 1997; Pei et al., 1998; Pei et al, 1999). Studies showed that, only these two kinases will phosphorylate tau in a cellular environment (Yamaguchi et al.,1996; Wagner et al.,1996 ; Michel at el., 1998 ). We chose to focus on cdk ⁇ because it is active predominantly in neurons whereas GSK3 ⁇ plays a role in energy metabolism and is active in all cells.
  • the pleiotropic cytokine TGF- ⁇ binds to the type Il receptor which in turn associates with the type I receptor and activates it (Massague, 1998). Subsequently, the type I receptor phosporylates intracellular signaling proteins called receptor-Smads (r-Smads), which ultimately drive the TGF- ⁇ signal internally to the nucleus. This process is facilitated greatly by adaptor proteins including the ⁇ - spectrin ELF.
  • ELF as a spectrin, displays the characteristic properties of support in membrane integrity, stabilization of cell-cell interactions, axonal grow, in addition to its ability to modulate TGF- ⁇ downstream target activation with ligands Smad3 and Smad4.
  • mice have proven an effective tool to elucidate the mechanisms of neurodegeneration.
  • CDK5 "7" mice demonstrate several neurological defects and are in most cases lethal by birth with several disrupted brain structures including cerebral cortex, hippocampus, and olfactory bulb (Oshima et al., 1996; Gilmore et al., 1998; Oshima et al., 1999).
  • p35 "A mice are comparatively more normal, and exhibit a greater predisposition to seizures with only marginal distortions to the hippocampus (Dhavan and Tsai, 2001 ).
  • mice which are embryonic lethal at E11.5, have a disrupted neuronal differentiation pattern, increased CDK4 level, and significantly altered mdm2, p21 , and pRb expression pattern than did wildtype mice (Golestaneha et al,2006).
  • Frontal cortex was collected from wild-type, elf, and Smad4 mutant mice, and was subsequently immunoblotted.
  • CDK1 , CDK5, CDK6, p35, and p25 were all assessed using this method, and ⁇ -tubulin was used as a loading control ( Figure 1 , A and B).
  • CDK5 expression was increase about 25% in elf frontal cortex and and about
  • p35,and p25 expression were also monitored by Western blot analysis and e ⁇ f' ⁇ and elf /' /Smad4 +/' frontal cortices were found to about 30% overexpress these proteins compared with wild-type and about 20-25% overexpress compared with Smad4 +/' frontal cortices.
  • Treatment with roscovitine decreased the phosphorylation density of CDK5 by 24.2% in the wildtype frontal cortex, compared with a decrease after treatment of 56.7% in Smad4 + ' ⁇ frontal cortex and 52.6% in elf 1' frontal cortex.
  • CDK4 is a marker of cell proliferation and is involved in progression through the G1/S checkpoint. Paraffin sections stained with anti-CDK4 showed virtually no nuclear localization in the wildtype forebrain (Figure 3,A), while elf / 7Smad4 +/ ⁇ m ⁇ ce showed elevated CDK4 expression ( Figure 3,B; arrows). Cell proliferation was further characterized using anti-cyclin A, which followed the same trend as CDK4 labeling, with no nuclear staining in the wildtype ( Figure 3,C) and overexpression observed in the elf'VSmad ⁇ ' mouse ( Figure 3, D; arrows).
  • TGF- ⁇ pathway The transforming growth factor-beta(TGF- ⁇ ) pathway with its adaptor proteins play a critical role in diverse cellular functions by act as a negative growth regulator, including inhibition of proliferation in the nervous system (Constam et al., 1994).
  • Embryonic liver fodrin (elf) is a ⁇ -spectrin protein and regulate signal transduction by functioning as an adaptor molecule.
  • Our earlier studies have demonstrated that elf deletion can results in mislocalization of Smad3 and Smad4 and loss of TGF- ⁇ signaling which can lead to deregulated cell growth (Redman et al., 2005; Tang et al., 2003).
  • CDK5 is an essential member of brain development (Dhavan and Tsai, 2001 ). As such, we decided to understand how CDK5 activity could be modulated by disrupting different members of the transforming growth factor-beta (TGF- ⁇ ) pathway. In our study, we are tempted to presume that elf by its ability to propagate TGF- ⁇ signaling, possibly modulates CDK5 activity and prevents p25 accumulation in neuronal cells.
  • TGF- ⁇ transforming growth factor-beta
  • Smad4 ⁇ ' ⁇ mice were previously shown to be embryonic lethal by day 7 (Yang et al., 1998; Angley et al., 2003) indicating the essential nature of this molecule in development, yet it is possible that there are compensatory mechanisms in play for the heterozygously null Smad4 +/ ⁇
  • ELF thus far has been shown to be a substrate for various r- Smads (including Smad3 and Smad4) and to subsequently translocate to the nucleus with these ligands to activate target gene expression, ultimately having the potential to modulate the activity of CDK5.
  • Smad4 +/ ⁇ mice which exhibited no p25 expression
  • mice that were heterzygously null produced a frontal cortex that highly expresses the neurotoxic p25. This results indicates that perhaps another ligand (e.g. Smad3) becomes mislocalized as a result of disrupted ELF expression, and so TGF- ⁇ mediated control of CDK5 is lost.
  • Hyperphosphorylated tau protein is a typical finding in the case of Alzheimer's disease, a process which is derived by glycogene synthase kinase-3 ⁇ (Goedert et al., 1999; Hasegawa et al., 1992; Watanabe et al., 1993). However, the activities of this kinase are dependent upon either CDK5 or MAP Kinase to become activated (Ishiguro et al., 1993; Goedert et al, 1994).
  • excessive p-Tau may be a functional marker for unregulated CDK5 activity which was rooted in disrupted TGF- ⁇ control.
  • the expression of p-Tau from elf 1"7" /Smad4 +/" implies a regulatory role of CDK5 activity, whether directly or indirectly.
  • the frontal cortex was a region susceptible to inhibition by roscovitine in elf* 7' and Smad4 + ⁇ mice ( Figure 4 and 5)
  • CDK5 phosporylation was inhibited by greater than 50% compared with wild-type, indicating that the functioning of elf does modulate the activities of CDK5, at least indirectly, though its synergistic functional ability to inhibit CDK5 phosphorylation in the presence of roscovitine.
  • CDK1 and CDK4 together with their activating cyclins (A or B1 , D1 , respectively) are essential for progression to mitosis (Nigg, 2001 ).
  • elf* 7" and elf+/-Smad4+/- frontal cortex expression of CDK1 is elevated( Figure 1 , A and B).
  • CDK4 expression was upregulated in elf +/ 7Smad4 +/" ( Figure 3, B; arrows) compared to wild- type ( Figure 3, A), which displayed virtually no expression of this protein.
  • CDK5 a major factor in Neurodegeneration
  • TGF- ⁇ signaling pathway especially the critical role of elf in neuroprotective function.
  • further studies are needed to explore the significance of this elf mediated TGF- ⁇ signaling pathway in progression and reversibility of tauopathies like Alzheimer's disease by modulation CDK5/p25 activity and clinical significance of CDK inhibitor, roscovitine.
  • mice were housed in 'shoe box 1 cages with bedding in a room with controlled temperature and humidity, and had unlimited access to a commercial pelleted diet (Teklad, Rodent Diet 8604, Harlan Teklad, Madison, Wl, USA) and tap water. Pups were weaned at age 21 days. The production and identifications of mice with targeted disruption of elf (elf +/" ), Smad4 (Smad4 +/ ⁇ ) and the double heterozygous condition (elf ⁇ /Smad ⁇ ' ) were as previously described (Tang et al., 2003). Mutant mice were maintained on a mixed 129Sv/Black Swiss background. Mice were momitored twice a week to detect any abnormal phenotypic changes. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Washington, DC, Department of Veterans Affairs Medical Center.
  • the sections were incubated overnight at 4°C in a humid chamber with a primary antibody targeted against CDK4 (Thermo Fisher Scientific, Fremont, CA, USA), Cyclin A (add company), p-Tau (Pierce Biotechnology, Rockford, IL, USA), and PCNA (add company) diluted in PBS containing 1 mg/ml BSA and 1 % normal serum. All further steps were done at room temperature. Four 5-min rinses with PBS followed each successive step. The sections were then incubated with peroxidase-conjugated goat anti-rabbit or donkey anti-goat secondary antibody (Jackson lmmunoresearch Laboratories, West Grove, PA, USA) that was diluted in PBS containing 1% normal serum for 30 min at room temperature.
  • CDK4 Thermo Fisher Scientific, Fremont, CA, USA
  • Cyclin A additive company
  • p-Tau Pieris Biotechnology
  • PCNA add company
  • Total cell lysates (containing 50 ⁇ g of total proteins) prepared from the harvested tissues was separated by SDS-PAGE using 4-12% polyacrylamide gradient gels (Novex, San Diego, CA) and transferred to nitrocellulose membranes (Novex). Blots were blocked with a 3% solution of BSA in TBST (Tris-buffered saline containing 0.1 % Tween 20) for 1 h at room temperature. Next, the blots were incubated in buffer containing antisera CDK1 , CDK5, CDK6 (Thermo Fisher Scientific, Fremont, CA, USA), p35, p25, and ⁇ -tubulin respectively for 2h at room temperature.
  • TBST Tris-buffered saline containing 0.1 % Tween 20
  • the blots were incubated in buffer containing the appropriate horseradish peroxidase-conjugated secondary antibodies (Jackson lmmunoresearch laboratories, USA) at a dilution of 1 :10,000 [E5] or 1 h at room temperature.
  • the blots were then developed using an ECL-Plus chemiluminescence kit (Amersham Biosciences, Piscataway, NJ) and exposed to x-ray films. The x-ray films were subsequently scanned (ScanJet 6100C; Hewlett-Packard, Palo Alto, CA).
  • the kinase assay was performed using standard methods. Roscovitine (2-(1-Ethyl-2- hydroxyethylamino)-6-benzylarnino-9-isopropylpurine) is a reversible inhibitor of CDK5 as well as CDK2 and CDK7 (Ljungman and Paulsen, 2001 ). The kinase assay was performed using roscovitine as a treatment using a concentration of 50 ⁇ M.
  • Cyclin-dependent kinase 5 prevents neuronal apoptosis by negative regulation of c-
  • Nigg EA 1 Mitotic kinases as regulators of cell division and its checkpoints, Nat. Rev. MoI.
  • GSK-3beta active glycogen synthase kinase 3beta
  • Alzheimer's disease brains Volume 523, Issues 1-3, 17 July 2002, 58-62.
  • CDK5 Cyclin-dependent kinase 5

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Methods for utilizing early developing liver proteins such as ELF and Smad that are involved in the TGF-β pathway are provided wherein the absence of ELF has been determined to be related to disorders such as hepatocellular cancer, Beckwith- Wiedemann Syndrome (BWS) and neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and ALS. A method of utilizing this technology to diagnose and/or predict the predilection for pathogenic conditions such as hepatocellular cancer and other disorders associated with an imbalance in the TGF-β pathway is thus provided wherein ELF and other proteins involved in the TGF-β pathway can be used as markers for the predilection for these conditions, and the administration of an effective amount of ELF may be utilized for therapeutic purposes against these conditions.

Description

PEPTIDES AND PROTEINS FOR EARLY LIVER DEVELOPMENT AND ANTIBODIES THERETO, AND THEIR USE IN THERAPEUTIC DIAGNOSIS AND
TREATMENT
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims the benefit of U.S. provisional applications
Ser. No. 60/935,663, filed August 24, 2007, U.S. provisional application Ser. No.
60/985,739, filed November 6, 2007, and U.S. provisional application Ser. No.
61/071 ,245, filed April 18, 2008, all of said applications incorporated herein by reference.
FIELD OF THE INVENTION
This invention relates to peptides and proteins isolated during early liver development, genes coding for these peptides and proteins, and antibodies which recognize these peptides and proteins, and to methods for their use in diagnosing and treating various conditions including hepatocellular cancer, neurodegenerative diseases such as Alzheimer's disease, Beckwith-Wiedemann syndrome (BWS) and other disorders.
BACKGROUND OF THE INVENTION
In the United States and other countries, end stage liver disease due to infection, genetic defects or alcoholic consumption is a major cause of widespread morbidity and mortality, causing great potential hardship and economic loss to millions of people throughout the world. In addition, numerous other diseases are generally associated with disruptions in the many functions carried out by the liver, including iron transport, hepatocyte formation and hematopoiesis. In general, severe problems associated with a breakdown of liver function are practically untreatable, and require a liver transplant as the only cure. However, in light of the great disparity between the number of patients needing liver transplants and the number of donors, thousands upon thousands of people are denied this operation, and transplantation is at the present time not a practical approach to the problem.
At the same time, the precise nature of liver development and the role of early developing liver proteins has not been well understood. To date, no growth factors specific to the liver have been identified or isolated, and the precise molecular mechanisms behind hepatocyte (liver cell) formation remain to be elucidated. There thus has been a long felt need to identify and understand the changes in gene regulation and expression in the developing liver, including the determination as to which genes are switched on and off as a hepatocyte forms and a liver develops. In addition, to the extent that these changes in gene regulation and expression affect other conditions, such as neurodegeneration, it will be very important to isolate and identify genes and proteins which play critical roles in early liver development, and such information will be useful in diagnosing and treating many conditions ranging from hepatocellular cancer to Beckwith-Wiedemann Syndrome and neurodegenerative disorders such as Alzheimer's disease.
SUMMARY OF THE INVENTION
Accordingly, it is thus an object of the present invention to provide genes, proteins, peptides, and antibodies thereto which are related to early liver developmental proteins, including the liver protein known as elf.
It is still further an object to provide proteins which are characteristic of early liver development and peptides from said proteins and peptides, and to raise antibodies from said proteins and peptides which will be useful as markers, and will be useful in methods of identifying such peptides and proteins, tracing hepatocyte lineage, determining one's predilection for development certain pathological conditions such as hepatocellular cancer (HCC) and other disorders involving similar genetic pathways, such as neurodegeneration, and providing means for preventing and/or treating these conditions.
It is still further an object to use the early developing liver proteins of the present invention to provide liver-specific growth factors for application in diagnosis and treatment of a variety of disorders relating to the TGF-β pathway.
It is still further an object to provide methods of diagnosing and treating conditions such as hepatocellular cancer, end-stage liver disease, and neurodegenerative diseases such as Alzheimer's disease using the early developing liver proteins and other proteins that affect the TGF-β pathway in accordance with the present invention
It is even further an object to provide methods of targeting stem cells such as cancer-causing stem cells by means of labeling such stem cells through the elf protein or antibodies thereto, and to target proteins such as ltih-4 whose levels increase in the absence of elf and which is associated with an increased predilection for liver disorders and other diseases, including hepatocellular carcinoma, degenerative neurological disorders, anemia, and ataxia, and administering the early developing liver proteins such as elf in order to achieve a therapeutic benefit including prevention and/or treatment of such conditions.
These and other objects are achieved by virtue of the present invention which provides an identification of early developing liver proteins such as the elf and Smad proteins that are involved in the TGF-β pathway and which have been useful in regulating these pathways and whose absence leads to increased levels of proteins such as ltih-4 which can promote disorders such as hepatocellular cancer, and utilizing this technology to diagnose and/or predict the predilection for pathogenic conditions such as hepatocellular cancer and other disorders associated with an imbalance in the TGF-β pathway. The present invention thus provides methods of diagnosis using the early-developing liver proteins and peptides of the invention, as well as genes coding for said proteins and peptides, antibodies recognizing these proteins and peptides, and methods for their use in diagnosis and treatment of a variety of disorders associated with the TGF-β pathway including liver diseases, hepatocellular cancer, neurodegenerative diseases, Beckwith-Wiedemann Syndrome (BWS) and other disorders.
BRIEF DESCRIPTION OF THE DRAWINGS
The present invention will now be described in detail with respect to preferred embodiments thereof, which are to be taken together with the accompanying drawings, wherein:
Fig. 1A depicts the profile for the ELF protein including binding domains VA-1 , VA-2 and VA-3 and antibodies thereto, along with ELF QF and QR primers; Fig. 1 B depicts the ELF protein sequence including various regions therein; and Fig. 1C depicts the sequence of the ELF protein. Figure 2 depicts: Wild type vs. elf +/7 Smad3 +/~ BWS like phenotype. Gross
Comparison of (A) Wild Type (left) vs. elf +/'/Smad3+/' (right) Mouse, (B) Beckwith- Wiedemann syndrome microfacies and Metopic Ridge, (C) Wild Type (left) vs. elf+/~ /Smad3+/~ (right) Tongue, (D) Beckwith-Wiedemann syndrome associated macroglossia, (E) Wild Type (left) vs. elf +//Smad3+/- (right) Kidney, (F) Beckwith- Wiedemann syndrome associated nephroblastoma. (G) Comparison of Wild Type (left) vs. elf +//Smad3+/- (right) Ear 34, (H) Beckwith- Wiedemann syndrome associated multiple Ear lobe creases, (I) Wild Type (left) vs. elf +//Smad3+/- (right) Liver, (J) Beckwith-Wiedemann syndrome associated multilobulated liver with hepatomegaly, (K) Wild Type (left) vs. elf +/7Smad3+/~ (right) Brain, (L) Beckwith- Wiedemann syndrome associated brain (microcephaly), (M) Wild Type (left) vs. elf+/~ /Smad3+/~ (right) Heart, (N) Beckwith-Wiedemann syndrome associated Cardiomegaly. Figure 3 depicts: (A) elf +//Smad3+/- mice develop multiple primary cancers by
12 months of age including (I) colon adenocarcinoma, (II) hepatocellular carcinoma,
(III) small bowel adenocarcinoma, (IV) lung adenocarcinoma. (B) Kaplan-Meier survival analysis of tumor development in elf wild type, elf', and elf +//Smad3+/- mice.
(C) Marked (I) decrease of elf RNA in elf +//Smad3+/- tumor tissues. RNA was isolated from three pairs of Tumor and Normal tissues. Q-PCRs were performed in triplicate for statistical analysis. Y-axis represents the fold change in RNA levels. All tumor tissues examined show significantly (I) decreased elf and (II) slightly decreased Smad3 RNA levels. (D) Expression of elf RNA is decreased greater than -50% in all tested human BWS cells in comparison to HepG2 cells identified by Q- PCR analyses. (E) lmmunohistochemical labeling of ELF in normal and BWS kidney tumor revealed loss of ELF expression in BWS kidney tumor in comparison to normal kidney. (F) Western blot analysis of TGF-D signaling members in human BWS show a loss of ELF expression but not Smad3. (G) (I, II) Wild type MEFs show increased nuclear translocation of Smad3 upon stimulation with 10OpM TGF-D, (III) Smad3 is predominantly cytoplasmic in human BWS cell lines is predominantly cytoplasmic. All four cell lines were tested. One representative confocal image is shown. (IV) Smad3 does not translocate to nucleus in response to TGF-D in BWS cells, (V) Over-expression of full length elf (V5-tag) restores Smad3 translocation to nucleus upon TGF-D treatment. Merge is shown in the bottom panel. The ELF labeling was performed using V5-tag, to identify the transfected cells. Scale bar is 20 μm.
Figure 4 depicts: DNA methylation pattern of elf gene promoter in BWS, HCC and Gl cells. (A) Schematic outline for the sequence of elf promoter and CpG islands. (B) Methylation status of EIf promoter in BWS cell lines detected by MSPCR (C) DNA methylation pattern of elf gene promoter in BWS identified by bisulfite sequencing; (D) the effect of 5-aza-2'-deoxycytidine on the elf gene expression in BWS cell line by IB assay. Figure 5 depicts: ELF-TGF-β signaling is disrupted in molecular subtypes of
BWS. (A) lmmunohistochemical analysis examining Insulin growth factor-2 (IGF2). (B) IGF2-Receptor expression in wild type and elf/Smad3+/' liver and pancreas. Increased IGF2 expression, and decreased IGF2-Receptor expression in e\f'~ /Smad3+/~ tissues (arrows). (C) BWS-3 cell line shows a high level of IGF2 RNA by Q-PCR. IGF2 RNA levels decrease in cells transfected with full-length e/f plasmid. (D) elf RNA expression is not significantly altered by silencing IGF2 expression in the BWS-3 cell line. (E) Expression of IGF2 is reduced -80% when BWS cells were treated with IGF2 SiRNA. (G) CHIP assay shows that EIf negative BWS cell lost regulation of IGF2 gene expression by TGFβ-Elf pathway comparing with EIf positive HepG2 cell.
Figure 6 depicts (A) The p53 RNA expression is not significantly altered in normal and tumor tissues from elf/7Smad3*/~ mice. (B) Quantification of ELF mediated rescue of Smad3 nuclear translocation in BWS-3 cells. (C) Transfection of full-length of e/f in BWS-3 cells restored p15 gene expression. Figure 7 depicts: Cell proliferation in wild-type, elf, and elf/Smad3+/~ liver tissues. (A-B) lmmunohistochemical detection of mitotic cells by labeling with a mitotic marker, p-Histone H3 (Ser10) in normal wild-type, (C-D) elf, (E-F) elf
/Smad3+/' mouse liver tissues. Arrows in panels D and F indicate proliferating cells.
Figure 8 depicts: Apoptosis in wild-type, elf'', and elf/Smad3+/' liver tissues. (A-B) Identification of apoptotic cells in normal wild-type, (C-D) elf', and (E-F) elf /smad3+/' mouse liver tissues, using anti-active Caspase-3 antibody, an apoptotic marker. Arrows in panel B point to apoptotic cells.
Figure 9 depicts: P57 Expression in wild-type and elf/Smad3+/' liver tissues. (A-B) lmmunohistochemical detection of cell cycle inhibitor p57 in normal wild-type, and (C-D) elf/Smad3+/~ mouse liver tissues. P57 expression is not altered in elf /Smad3+/~ tissues when compared to wild type.
Figure 10 depicts: KCNQ1 expression in wild-type, and elf/Smad3+/~ heart tissue. (A-C) lmmunohistochemical detection of potassium voltage-gated channel, kcnqi in normal wild-type, and (D-F) elf^/SmadS^' mouse heart tissues. KCNQ1 expression is decreased in elf/7Smad3+/' tissues when compared to wild type.
Fig. 11 depicts iidentification of liver progenitor/stem cells in posttransplant human liver tissues, lmmunohistochemical labeling of posttransplant human liver tissue taken from living donor liver transplant 4 weeks after transplantation. The tissue is labeled for the presence of ELF (A, arrows) and Oct4 (S, arrows). Sections are taken consecutively to enable identical localization. (C-N) Confocal images of human liver at 3 months after living-related liver transplantation. (C-E) The tissue is labeled with stem cell proteins Stat3 and Oct4 and prodifferentiation TGF-β signaling component ELF. (F) These proteins coexpress in a small cluster of two to four cells. (G) DAPI represents nuclear labeling. (H) Differential interference chromatography (DIC) represents a transmission image of this cluster of cells. (I-K) Regenerative liver tissue from another liver transplant is labeled with p-histone H3 (Ser10), Oct4, and ELF. (L) These proteins coexpress in this cluster of progenitor-like cells. (M and N) DAPI represents nuclear labeling (M), and DIC represents transmission images (N). Arrows point to the nuclei of the progenitor-like cells. (Scale bars for all figures are in micrometers.)
Fig. 12 depicts Identification of liver progenitor/stem cells in posttransplant human liver and HCC tissues, lmmunohistochemical labeling of posttransplant human liver tissues taken from living donor liver transplant recipient 4 weeks after transplantation. (A-D) The tissue is labeled for the presence of ELF (A and C) and Oct4 (B and D). Sections are taken consecutively to enable identical localization. (E- J) Equivalent areas are marked by red dotted lines, and green arrows point to the positive labeling, lmmunohistochemical labeling of normal human liver (E and H) and HCC tissues (F, G, /, and J). The loss of ELF is evident when comparing the immunohistochemical labeling of normal (E and H) and HCC samples (F and /). Strikingly, there are small pockets of three to four Oct4 positively stained cells present in the midst of transformed hepatocellular cells (G and J, arrows). These Oct4-positive cells are stained negatively for ELF (/, area marked by blue dotted line). (K-M) Confocal images of human HCC labeled to highlight prodifferentiation TGF-β signaling component ELF (K) and progenitor cell proteins Stat3 and Oct4 (L and M). (N, white arrow) The overlay image demonstrates a cell that labeled positively for Stat3 and Oct4 but lacks nuclear expression of ELF. (O) DIC represents transmission image of this cluster of cells. (P) DAPI represents nuclear labeling. The white arrow points to the nucleus of the HCC progenitor/stem cell lacking ELF. PT represents portal tract.
Fig. 13 depicts decreased incidence of hepatocellular cancer is observed by genetic modulation of IL-6-stat-3 signaling. (A and B) Heatmap microarray assay illustrating gene expression in mouse liver or HCC tissues. Targeted disruption of the ITIH-4 gene and generation of itih4 -/- mice. Exp1 : elf +/- liver tissue vs. wild-type liver tissue; Exp2: itih4 -/- liver tissue vs. wild-type liver tissue; Exp3: elf *1' /itih4 -/- liver tissue vs. wild-type liver tissue. The signal gradients are located below each image. (C) The targeting vector for itih4 gene; the targeting strategy deletes a 1.8-kb Smal-Clal fragment that contains second and third exons of the itih4 gene. (D) Southern blot analysis shows ES cells heterozygous (M 51 , i155, and i160) with correct homologous recombination events within the itih4 locus. Genomic DNA from these clones was digested with EcoRV, followed by Southern blot using a 1.8-kb fragment 3' to the targeting vector. (E) lmmunoblot analysis using the antibody specific for ITIH4 shows loss of ITIH4 expression in itih4 -/- and elf *1' /itih4 -/- liver tissue lysates compared with the wild-type and elf +/- samples. (F) Kaplan-Meier tumor-free survival curves of wild-type (control), elf +/-, itih4 -/-, and elf +/- /itih4 -/- (experimental) animals. Fig. 14 depicts analysis of gene expression in mouse liver tissues and human
HCC tissues and cell lines. (A, C, and D) lmmunohistochemical labeling demonstrates low/absent expression of phosphorylated Stat3 in normal (wild-type) mouse liver (A), ITIH4"7" liver (C), and Elf+/7ITIH4"/" liver (D). (β) In contrast, EIf+7" HCC liver tissue shows increased expression of P-Stat3. (E and F) lmmunohistochemical detection shows increased expression of Stat3 in human HCC tissues (F, arrows) compared with normal liver tissues (E). (H and G) Phosphorylated-Stat3 is also increased in human HCC tissues (H, arrows) compared with normal liver tissues (G). (Scale bar is in micrometers.)
Figure15 (S1 ) depicts: Identification of Liver Progenitor/Stem Cells in Post Transplant Human Liver Tissue.
Figure 16 (S2) depicts: Identification of Liver Progenitor/Stem Cells in Human Liver Tissue.
Figure 17 (S3) depicts: Identification of Liver Progenitor/Stem Cells in Post Transplant Human HCC Tissues.
Figure 18 (S4) depicts: Elf' Mutant Mice Develop HCCs.
Figure 19 (S5) depicts: lmmunohistochemical Analysis of ITIH4 and Stat3 Expression in Mouse Liver and HCC Tissues. Figure 20 (S6) depicts: lmmunohistochemical Analysis of Phosphorylated-
Stat3 Expression in Mouse Liver and HCC Tissues.
Figure 21 (S7) depicts: lmmunohistochemical Analysis of Stat3 and Phosphorylated-Stat3 Expression in Normal Human Liver and HCC Tissues.
Figure 22 (S8) depicts: lmmunohistochemical Analysis of ITIH4 Expression in Human Normal Liver and HCC Tissues.
Figure 23 (S9) depicts: Increase of Stat2 and Phosphorylated-Stat3 in Human HCC Cell Line SNU-398.
Figure 24 (S10) depicts: Cell Proliferation and Apoptosis in Wild-type, Itih4"/", Elf+/7itih4'/" and in EIf+7' Liver Tissues. Figure 25 (S11 ) depicts: Schematic Diagram to Show TGF-β/ELF and IL-
6/Stat3/ITIH4 Signaling in Hepatic Stem Cell Renewal and Differentiation.
Figs. 26-29 provide additional information regarding the BWS processes of the present invention.
Figure 30 depicts: Increased expression of CDK1 , CDK5, p35 and p25 activity in elf and elf' /Smad4+I' frontal cortex. (A) lmmunoblot for brain lysates indicates increased CDK5 activity in the frontal cortex of elf' and elf' /Smad4+I~ tissue compared with wild type or Smad4+I' frontal cortex. There is a correspondingly high level of p35 and p25 observed in elf' and elf' /Smad4+I' frontal cortex as well compared with wild type and Smad4+I'. CDK1 and CDK6 levels were also immunoblotted, and CDK1 was found to be highly expressed in elf' and elf'
/Smad4+I' tissue compared with wild type or Smad4+I' frontal cortex. CDK6 was equally expressed in wildtype, elf', Smad4+/', elf'/Smad4+/' frontal cortex lysates α- tubulin was used as a loading control. (B) integrated density value (IDV) analysis showing approximately 20-30% increase expression of CDK5, p35 and p25 in elf+/-, and elf+/-/smad4+/- frontal cortex compared to the wild type control and smad4+/- frontal cortex.
Figure 31 depicts: Increased expression of PCNA and p-Tau in elf~ /Smad4+l~ mouse brain tissues, lmmunohistochemical labeling demonstrates absent expression of PCNA in normal (Wild-type) control mouse brains(A and B) . In contrast e\f' /Smad4+I~ mouse brain sections (C and D; arrows) showed increased expression of PCNA.. lmmunohistochemical detection shows increased expression of p-Tau in e\f' /Smad4*'~ mouse brain sections (G and H; arrows) compared with normal (wild-type) mouse brain sections(E and F). (Scale bar is in micrometers). All the left panels (A, C, E and G) correspond to lower power view and the right panels (B, D, F, and H) correspond to the higher power view.
Figure 32 depicts: Increased cell-cycle regulatory protein expression (CDK4 and CyclinA) in eif'~ /Smad4+I~ mouse brains; Increase in CDK4 expression is seen in e\f'~ /Smad4+I~ mouse brain sections (B; arrows) as compared with normal(wild- type) mouse brain sections(A). Similarly, increased labeling of Cyclin A are observed in e\f'~ /Smad4+'~ mouse brain sections (D; arrows) as compared with normal(wild- type)(C). (Scale bar is in micrometers.)
Figure 33 depicts: Kinase assay using the CDK-inhibitor roscovitine; Frontal cortex and hippocampus sections were used for this assay to determine the kinase activity in CDK5 before and after treatment with roscovitine. For this experiment, elf' and Smad4+/~ as well as wildtype mice were used. Histone was used as a control for this assay.
Figure 34 depicts: Quantitative readout of kinase assay; The graph demonstrates the substantial inhibitory effect of roscovitine in both e\f'~ and Smad4+I~ frontal cortex as well as elf' hippocampus. Also of note is the diminished inhibitory effect of this treatment in Smad4+'~ which was roughly half that of the wild- type hippocampus.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present application relates generally to the information regarding early developing liver proteins and the mechanisms of their expression and regulation, and many of these proteins are discussed in US patents 7,202,347; 6,642,362, and 5,955,594, and the information regarding ELF deficient mouse models as set forth in US Patent Application Publication 2005/0144660, and other information as set forth in PNAS 105(7):2445-2450, all of said patents and publications incorporated herein by reference.
In general, the present invention relates to the use of the ELF protein in a variety of therapeutic and diagnostic methods involving disorders affected by disruption of the TGF-β pathway. In one aspect of the invention, the present inventors have discovered that ELF is lost in stem cells during hepatocellular cancer (HCC), and that ELF can be used for identifying stem cells which may be cancerous. In another aspect of the invention, the inventors have discovered that in ELF- deficient mice, there is an increase in ITI H4 levels and a higher prevalence of hepatocellular cancer. At the same time, an ITIH4 mouse model has shown that if
ITIH4 is inhibited when ELF is lose, then cancers decrease markedly in those models.
It is presently contemplated that the pathways associated with ITI H4 include the Stat3, IL-6 pathway, and this inhibition of these pathways is contemplated for prevention and/or treatment of hepatocellular cancers and other disorders involving the TGF-β pathway. The present invention also contemplates the targeting of ITIH4 as a method of prevention and/or treatment of hepatocellular cancer, and one of the aspects of the invention encompasses the administration of an ITIH4 inhibitor to reduce and/or eliminate the risk for the development of hepatocellular cancers, or for the prevention or treatment thereof. As the present inventors have learned, the ELF protein appears to be a regulator of the pathways which in the absence of ELF will produce ITIH4 and increase its levels, and thus in appropriate cases, the present invention contemplates a method wherein ELF is administered to reduce the level of ITIH4 and reduce the likelihood or prevent the development of hepatocellular cancers and other disorders associated with the TGF-β pathway. In general, the present invention contemplates the administration of ITIH4 inhibitors, especially in cases wherein ELF production is minimal or absent, in order to reduce the predilection for hepatocellular cancers in a patient. Accordingly, the present invention contemplates a method of assessing a patients' risk for developing hepatocellular cancer comprising the steps of assaying a biological fluid of a patient to determine the level of a marker selected from the group consisting of ITIH4, CDK4, Stat3, or other marker which promotes IL-6 activation, assessing whether the level of said marker is above the normal level of said marker that would be expected for said patient, and determining if said patient has a level of said marker that is above the normal level of said marker that would be expected for said patient, said higher level of said marker being reflective of a higher risk for developing hepatocellular cancer. In addition, it is contemplated that a method of preventing or treating hepatocellular cancer will comprise the steps of administering to a patient in need thereof an effective amount of an inhibitor of a material selected from the group consisting of ITIH4, CDK4, Stat3, and other materials which promotes IL-6 activation. In certain cases, the inhibiting compound may comprise an effective amount of the ELF protein, or other material used to promote the expression of the ELF protein. For example, inventors have discovered that the praja protein appears to inhibit the ELF protein, and thus the ELF promoting agent may be a substance which will inhibit the role of praja as it relates to ELF. As used herein, an "effective amount" of a protein, antibody or other pharmaceutical agent to be used in accordance with the invention is intended to mean a nontoxic but sufficient amount of the agent, such that the desired prophylactic or therapeutic effect is produced. As would be understood to one of ordinary skill in this art, the exact amount of said agent that is required will vary from subject to subject, depending on the age and general condition of the subject, the severity of the condition being treated, the particular carrier or adjuvant being used and its mode of administration, and the like. Accordingly, the "effective amount" of any particular compound or composition to be administered in accordance with the present invention will vary based on the particular circumstances, and an appropriate effective amount may be determined in each case of application by one of ordinary skill in the art using only routine experimentation. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual.
In conjunction with this invention, the present inventors have investigated cancer stem cells (CSCs) which are critical for initiation, propagation and treatment resistance of multiple cancers. Previously, functional interactions between specific signaling pathways in solid organ "cancer stem cells", such as those of the liver, have remained elusive. In accordance with the invention, utilizing a broad micro- array and proteomic analyses followed by a genetic dissection, the present inventors have identified such progenitor cells and regulating pathways that can be modulated to alter tumor formation in the liver. For example, in the regenerating human liver, 2- 4 in 30,000-50,000 cells express stem cell proteins Stat3, Oct4, and Nanog, along with the pro-differentiation proteins TGF-jβ-receptor type Il (TBRII) and embryonic liver fodrin (ELF). Examination of human hepatocellular cancer (HCC) reveals cells which label with stem cell markers that have unexpectedly lost TBRII and ELF. E\f!~ mice spontaneously develop HCC; expression analysis of these tumors highlighted the marked activation of the genes involved in the IL-6 signaling pathway, including IL-6 and Stat3, and this has led to the conclusion that HCC could arise from an IL-6 driven transformed stem cell with inactivated TGF-/3 signaling, such as arising from a loss of ELF. In these cases, it is contemplated that administration of ELF will be useful in therapeutic methods to combat or prevent HCCs in patients. Similarly, the inventors have noted that suppression of IL-6 signaling, e.g., through the generation of mouse knockouts involving a positive regulator of IL-6, Inter-alpha-trypsin inhibitor-heavy chain-4 (ITIH4), has resulted in reduction in HCC in e\f'~ mice. Accordingly, the present inventors have discovered an unexpected functional link between IL-6, a major stem cell signaling pathway and the TGF-/3 signaling pathway in the modulation of mammalian HCC, a lethal cancer of the foregut. In one aspect of the invention, the method contemplates targeting ITIH4 and reducing the level of ITIH4 so as to prevent or treat HCCs, particularly in those cases wherein ELF is absent. The present invention thus contemplates an important therapeutic role for targeting IL-6 in the TGF-/3 pathway so as to treat or prevent HCCs.
Accordingly, the present invention contemplates a method of identifying cancer stem cells comprising the steps of administering to a patient suspected of having cancer stem cells an antibody capable of recognizing a peptide from the ELF protein, and determining if said antibodies have bound to said stem cells. The antibody recognizing such ELF peptide may thus be useful in labeling said cancer cells for removal or further study, and one such suitable antibody for labeling stem cells in accordance with the invention may thus be an antibody recognizing the VA-1 region of the ELF protein.
In another aspect of the invention, the inventors have determined that early developing liver proteins such as ELF are related to neurodegeneration in conjunction with their function in the TGF-β pathways. In this regard, the present invention contemplates monitoring of ELF to show a predilection for neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and ALS (Lou Gehrig's disease), and indeed other proteins such as CDK4 and cyclin D1 whose levels are enhanced in the absence of ELF also appear to be contributing to neurodegenerative disorders. Accordingly, the present invention contemplates monitoring the level of ELF, such as in cerebro-spinal fluid, as a factor in determining a patient's predilection to develop Alzheimer's disease, and it appears that an absence of ELF or its presence at levels reduced from the amount that would normally be present in an average patient, will be indicative of the possibility of developing neurodegenerative conditions such as Alzheimer's disease. It is thus contemplated that the monitoring of levels of ELF may be useful as an early warning sign of Alzheimer's or other neurodegenerative diseases.
Similarly, it appears that the CDK4 and/or CDK5 protein reaches elevated levels in patients where ELF protein is absent or reduced, and thus another aspect of the invention is the monitoring of the CDK4 or CDK5 level to assess the predilection of an individual of developing a neurodegenerative disease. In addition, cyclin D1 which is associated with the CDK proteins may also be a marker for the potential for risk of neurodegenerative disease. In this regard, it is contemplated that the monitoring of levels of CDK4 or CDK5 and cyclin D1 will be useful as indications of the potential for neurodegenerative disease, and that since elevated levels of these proteins are associated with neurodegenerative disease, administration of an inhibitor or CDK4 or CDK5 and/or cyclin D1 is contemplated as a means to treat and/or prevent neurodegenerative diseases such as Alzheimer's. As indicated below, testing conducted in accordance with the invention showed that the functioning of the elf protein does modulate the activities of CDK5, and the phosphorylation of CDK5 can be inhibited in addition in the presence of a CDK inhibitor such as roscovitine.
Accordingly, a method of assessing a patients' risk for developing a neurodegenerative disorder is provided which comprises the steps of assaying a biological fluid of a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and determining if said patient has a level of ELF that is below the normal level of ELF that would be expected for said patient, said lower level of ELF being reflective of a higher risk for developing a neurodegenerative disorder. The neurodegenerative disease may be, for example, a disease selected from the group consisting of Alzheimer's disease, Parkinson's disease and ALS. In addition, it is contemplated that a method for assessing a patients' risk for developing a neurodegenerative disorder can also be carried out which comprises the steps of assaying a biological fluid of a patient to determine the level of a marker selected from the group consisting of CDK4, CDK5, and cyclin D1 , assessing whether the level of said marker is above the normal level of said marker that would be expected for said patient, and determining if said patient has a level of said marker that is above the normal level of said marker that would be expected for said patient, said higher level of said marker being reflective of a higher risk for developing a neurodegenerative disorder such as Alzheimer's, Parkinson's or ALS. In this method, a suitable biological fluid for said tests may be cerebro-spinal fluid.
Even further, it appears that other developing liver proteins, such as a protein called praja, may also assist in inhibiting or removing the expression of ELF. Accordingly, it is contemplated that in addition to methods wherein an effective amount of ELF may be administered to a patient to alleviate or prevent the conditions disclosed herein, another method of achieving this result may be to inhibit or modulate the expression of praja so that this protein does not disrupt expression of ELF.
In another aspect of the invention, it has been discovered that the ELF protein may also function so as to prevent Beckwith-Wiedemann Syndrome (BWS), and this condition is particularly associated with a lack of the ELF protein. In addition, the present inventors have discovered that methylation of the ELF protein may also lower its effectiveness and functioning, and thus BWS may be treated and/or prevented through the reversal or prevention of the methylation of the ELF protein.
Accordingly, in this aspect of the invention, the adaptor protein ELF (Embryonic Liver Fodrin, a β-Spectrin) is a potent regulator of tumorigenesis through its ability to affect TGF-β tumor suppressor function, specifically Smad3 and Smad4 signaling. The present inventors have now learned that mice with ELF deficiency, such as the e\f'~ and e\f/'/Smad3Jr/' mice models, develop abnormal ear folds, visceromegaly, adrenal cytomegaly and multiple cancers including liver and gastrointestinal tumors, observed in patients with Beckwith-Wiedemann syndrome (BWS), a hereditary human cancer overgrowth syndrome. Loss of ELF but not Smad3 or p53 RNA expression is observed in e\f'~, e\f /Smad3+/~ tumors. Between 30-90% of human gastrointestinal cell lines and human BWS cell lines do not significantly express ELF due to epigenetic errors (aberrant DNA methylation at the ELF promoter). In human BWS cells, Smad3 protein was mislocalized. Exogenous ELF expression rescued TGF-β signaling and Smad3 localization in BWS cells. As a result of this discovery, the present inventors have determined that epigenetic regulation of the TGF-D pathway resulting in a lack of ELF and its crucial Smad3 adaptor function is causally related to the genesis and progression of human BWS, and that e\f'~ and elf /Smad3+/~ mice may provide an important animal model for Beckwith-Wiedemann syndrome (BWS). Accordingly, it is contemplated that ELF may be useful in the prevention and/or treatment of BWS, and may also be used as a marker to determine the likelihood that this syndrome will be present. Moreover, epigenetic silencing of ELF through methylation, diet, etc., will be very important. Accordingly, in this aspect of the invention, the inventors have discovered that particular proteins such as CDK4 may be elevated in those patients whose ELF function is impaired, and thus CDK4 inhibition may be useful in achieving tumor suppression. In this regard, ELF and the Smad proteins, such as Smad3, can be utilized to suppress levels of CDK proteins such as CDK4 and thus may be useful in methods of achieving tumor suppression.
In addition, methylation of ELF appears to be associated with loss of the ELF function in the TGF-β pathway and also can lead to the problems identified above related to loss of ELF. The present inventors have learned that loss of ELF expression is a likely cause of BWS, and such a lack of ELF expression may result from mutation of the ELF gene, methylation of its promoter, transcriptional or post- transcriptional de-regulation. Similarly the complete loss of elf mRNA in elf1' /Smad3+/~ heterozygotes without mutation or inactivation of ELF transcription pointed to an epigenetic mechanism of repression potentially by methylation of ELF at its promoter. Previous observations show a deletion of ELF results in a dramatic and spontaneous formation of liver and gastrointestinal cancers . As indicated herein, data provided by the inventors now shows that the elf' and elf'/Smad3+/~ mutant mice are mouse models for human BWS, (elf/Smad3+/' providing an exacerbated phenotype), and that ELF expression and ELF-mediated TGF-β signaling is lost in human BWS. Accordingly, the present invention contemplates the administration of an effective amount of ELF in one method to prevent or treat BWS. In addition, ELF may be a marker to determine one's risk of developing BWS, and methods of alleviating this syndrome may involve ways of inhibiting the methylation of ELF so as to maintain ELF expression and allow it to perform its role in ELF-mediated TGF-β signaling.
In another aspect of the invention, antibodies to ELF or certain ELF peptides, such as the VA-1 antibody as reflected in the drawing figures, may be useful in recognizing methylated ELF protein. As such, the VA-1 antibody may be useful in diagnosing potential problems associated with loss of ELF expression as set forth herein which may result from ELF methylation. In addition, VA-1 antibodies may be useful in targeting methylated ELF so that steps can be taken to reduce the level of methylated ELF that is present and/or otherwise restore ELF expression and function. In another aspect of the invention, the adaptor protein ELF (Embryonic Liver
Fodrin, a β-Spectrin) is a potent regulator of tumorigenesis through its ability to affect TGF-β tumor suppressor function, specifically Smad3 and Smad4 signaling. The present inventors have shown that elf"~ and elf +"-"Smad3+"- mice develop visceromegaly and multiple cancers with phenotypic characteristics frequently observed in patients with Beckwith-Wiedemann syndrome (BWS), a hereditary human cancer overgrowth syndrome. A dramatic decrease in ELF RNA and protein but not Smad3 or p53 expression is observed in elf"~, elf +"-"Smad3+"- tumors as well as BWS cell lines and tumor tissues compared to normal tissues. In BWS cells, Smad3 protein was mislocalized. Exogenous ELF expression partially rescued TGF-β signaling and Smad3 localization. Significantly, complete rescue was achieved by inhibition of microRNA Let7a which targets ELF and is elevated in BWS cells. Our results also suggest that alteration of elf expression at the mRNA level is a major defect of human BWS, resulting in an inability to provide crucial Smad3 adaptor function. Epigenetic regulation may also be a significant factor in the phenotype observed in BWS — the tumors arising from a convergence of the TGF-β pathway and microRNAs which target ELF. These results suggest that elf"~ and elf +"-"Smad3+"- mice provide an important animal model for Beckwith-Wiedemann syndrome (BWS). The results also indicate that the microRNA is an important therapeutic target for cancers and BWS when ELF is lost. In accordance with the present invention, as indicated above, early developing liver proteins such as ELF may be used as markers for a variety of disorders associated with the TGF-β signaling pathway and the activation of IL-6, and the administration of ELF and/or other compositions for disrupting the IL-6 pathway may be useful to prevent and/or treat the disorders as reflected herein. In particular, activation of the IL-6 pathway in the absence of ELF may result in the disorders set forth herein, and elevated levels of CDK proteins such as CDK4 or CDK5, or Stat3, may also be signs that the conditions set forth herein may be present. Accordingly, the present invention contemplates monitoring these proteins as an early indication of conditions associated with the disruption of the TGF-β pathway, and inhibiting these proteins and/or their activation pathways may be useful in preventing and/or treating the pathogenic conditions associated with such disruption as set forth herein.
Accordingly, the present invention encompasses a method of early diagnosis of Beckwith-Wiedemann Syndrome (BWS) via assaying a biological fluid of a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and diagnosing an early risk of BWS when levels of ELF are below the normal level of ELF that would be expected for said patient. In a related method, a method of preventing or treating Beckwith-Wiedemann Syndrome is provided which comprises the steps of administering to a patient in need thereof an effective amount of the ELF protein. This administration may be accompanied by administration of an effective amount of a Smad protein such as Smad2, Smad3 and Smad4.
In general, the present invention encompasses a method of early diagnosis of a disorder associated with disruption of the TGF-β pathway comprising determining from a suitable biological sample or fluid from a patient the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and determining if said patient has a level of ELF that is below the normal level of ELF that would be expected for said patient, said lower level of ELF being reflective of a higher risk for developing a disorder associated with the disruption of the TGF-β pathway. In addition, the invention allows for a method of early diagnosis of a disorder associated with disruption of the TGF-β pathway comprising administering to a patient an antibody recognizing a methylated ELF protein, and determining whether said antibody has bound to said methylated ELF protein. In these methods, the antibody utilized may be an antibody recognizing the VA-1 region of the ELF protein. Still a further aspect of the invention is a method of preventing P25 accumulation in mammalian frontal cortex comprising administering B- spectrin ELF in an amount sufficient to modulate CDK5 activity. In addition to the foregoing disclosure, Applicants also incorporate by reference the specification and drawings included in US patents 7,202,347; 6,642,362 and related applications including US patent application Serial No. 11/783,459, filed April 10, 2007, which was a divisional application of U.S. patent application serial no.
10/695,944, filed October 30, 2003, which was a divisional application of U.S. patent application serial no. 09/431 ,184, filed November 1 , 1999, which was a continuation- in-part of PCT application PCT/US98/08656, which was a continuation-in-part of U.S. patent application Serial No. 08/841 ,349, filed April 30, 1997. In addition, information regarding the mouse models of the invention has been disclosed in US Patent
Publication 2005/0144660, said publication incorporated herein by reference.
It is thus submitted that the foregoing embodiments are only illustrative of the claimed invention, and alternative embodiments well known or obvious to one skilled in the art not specifically set forth above also fall within the claimed scope.
In addition, the following examples are presented as illustrative of the claimed invention, and are not deemed to be limiting of the scope of the invention in any manner.
EXAMPLE 1
Progenitor/stem cells give rise to liver cancer due to aberrant TGF-β and IL-6 signaling
Overview
Cancer stem cells (CSCs) are critical for the initiation, propagation, and treatment resistance of multiple cancers. Yet functional interactions between specific signaling pathways in solid organ "cancer stem cells," such as those of the liver, remain elusive. We report that in regenerating human liver, two to four cells per 30,000- 50,000 cells express stem cell proteins Stat3, Oct4, and Nanog, along with the prodifferentiation proteins TGF-β-receptor type Il (TBRII) and embryonic liver fodrin (ELF). Examination of human hepatocellular cancer (HCC) reveals cells that label with stem cell markers that have unexpectedly lost TBRII and ELF. elf +/- mice spontaneously develop HCC; expression analysis of these tumors highlighted the marked activation of the genes involved in the IL-6 signaling pathway, including IL-6 and Stat3, suggesting that HCC could arise from an IL-6-driven transformed stem cell with inactivated TGF-β signaling. Similarly, suppression of IL-6 signaling, through the generation of mouse knockouts involving a positive regulator of IL-6, Inter-alpha-trypsin inhibitor-heavy chain-4 (ITIH4), resulted in reduction in HCC in elf +/- mice. This study reveals an unexpected functional link between IL-6, a major stem cell signaling pathway, and the TGF-β signaling pathway in the modulation of mammalian HCC, a lethal cancer of the foregut. These experiments suggest an important therapeutic role for targeting IL-6 in HCCs lacking a functional TGF-β pathway. i
Figure imgf000020_0001
Although the existence of cancer stem cells (CSCs) was first proposed >40 years ago (1 , 2), only in the past decade have these cells been identified in hematological malignancies and, more recently, in solid tumors that include breast, prostate, brain, and colon (3). Exploration of the difference between CSCs and normal stem cells is crucial not only for the understanding of tumor biology but also for the development of specific therapies that effectively target these cells in patients (4). Yet, the origin of CSCs and the mechanisms by which they arise remain elusive. For tumors containing a subpopulation of CSCs, there are at least two proposed mechanisms for how the CSCs could have arisen: oncogenic mutations that inactivate the constraints on normal stem cell expansion or, alternatively, in a more differentiated cell, oncogenic mutations could generate continual proliferation of cells in cell cycle that no longer enter a postmitotic differentiated state, thereby creating a pool of self- renewing cells in which further mutations can accumulate. The plasticity of such cells is reflected by recent studies where pluripotent stem cells could be induced from embryonic or adult fibroblasts by introducing four factors, Oct3/4, Sox2, c-Myc, and Klf4, under embryonic stem cell culture conditions (5). Potentially biologically significant pathways that modulate these stem/progenitor cells in cancer tissues could be identified through dual roles in embryonic stem cell development and tumor activation or suppression (4).
Multiple signaling networks orchestrate the development and differentiation of embryonic stem (ES) and somatic stem cells into functional neuronal, hematopoietic, mesenchymal, and epithelial lineages. Among these, the signaling mechanisms activated by TGF-β family proteins have emerged as key players in the self-renewal and maintenance of stem cells in their undifferentiated state, the selection of a differentiation lineage, and the progression of differentiation along individual lineage (4). Through gene knockout experiments and observation of ES cells, TGF-β-family proteins have emerged as bifunctional regulators of the maturation of cells in each of the lineages mentioned above and as suppressors of carcinogenesis (6). When TGF-β signaling is disrupted, the imbalance can result in an undifferentiated phenotype, and cancer may ensue (7). TGF-β-family signals are conveyed through two types (types I and II) of transmembrane receptor serine-threonine kinases, which form a complex at the cell surface. Ligand binding to this complex induces a conformational change that results in phosphorylation and activation of type I receptors by type Il receptors. Activation of Smad transcription factors ensues and results in their nuclear translocation and activation or repression of gene expression. Smad activation is modulated by various receptors or Smad-interacting proteins that include ubiquitin and small ubiquitin-related modifier (SUMO) ligases and multiple adaptor proteins that include Smad anchor for receptor activation (SARA), filamin, and ELF. ELF, a β-spectrin, first isolated from foregut endodermal stem cell libraries, is crucial for the propagation of TGF-β signaling (8). Specifically, ELF associates with Smad3 presenting it to the cytoplasmic domain of the TGF-β Type I receptor complex, followed by heteromeric complex association with Smad4, nuclear translocation, and target gene activation (9). Depending on the differentiated state of the target cell, the local environment, and the identity and dosage of the ligand, TGF-β proteins promote or inhibit cell proliferation, apoptosis, and differentiation. TGF-β-family signaling is most prominent at the interface between development and cancer in gut epithelial cells. Inactivation of at least one of the TGF-β signaling components (such as the TGF-β receptors, Smad2 or Smad4) occurs in almost all gastrointestinal tumors (7, 10). Smad2 +/- /smad3 +/- double heterozygous and elf -/- homozygous mice all showed defective liver development, and elf +/- mice are now observed to develop dramatic spontaneous HCCs. Genetic studies thus identify TBRII and ELF as functional suppressors of HCC formation (11 ). Development of HCC occurs through progression of liver injury initiated by chronic hepatitis, extensive alcohol intake, or toxins, sequentially resulting in liver cirrhosis, dysplastic lesions, and finally, invasive liver carcinoma (12). Recent studies suggest these agents can target liver progenitor cells [oval cells in rodents and hepatic progenitor cells (HPC) in humans], leading to their expansion and transformation (13, 14). A considerable proportion of HCCs express one or more HPC marker not present in normal, mature hepatocytes (15, 16). Similarly, HPCs occur in HCC precursors such as small cell dysplastic foci and hepatocellular adenoma (17). These findings suggest that human liver tumors can be derived from hepatic stem cells rather than from mature cell types.
In this report, evidence suggests that human HCC could arise as a direct consequence of dysregulated proliferation of hepatic progenitor cells in a setting where TGF-β has been disrupted. Using human HCC and mouse genetic models, we show that lesions in the TGF-β pathway normally result in a "homeostatic" activation of the IL-6 pathway, that appears to be critical to the "development of hepatic cancer. Results Hepatic Stem Cells Are Found in Normal Liver and HCCs. To search for hepatic stem cells, we studied five patients with monthly posttransplantation liver biopsies. Living donor liver transplantation offers a unique opportunity to examine the regeneration of the human liver, a process presumed to involve the recruitment of hepatocytes and later, hepatic progenitor cells (18). The surgical procedure involves resection and transplant of a lobe representing 55-60% liver mass from a donor to a recipient, which, by 3 months, grows to 85% of original mass (19). We hypothesized that, at the end of liver regeneration, there would be an expanded population of liver progenitor/stem cells that were long-term label-retaining (20). A broad microarray and protein analysis approach led us to focus on 40 proteins to be further characterized by immunohistochemical and confocal immunofluorescence labeling of living donor liver-transplanted and human HCC tissues. We ultimately directed our search for cells expressing five of these proteins: Oct4, Nanog, Stat3, TBRII, and ELF. Both Oct4 (21 ) and Nanog (22) have been shown to be expressed in embryonic and pluripotent stem cells; Stat3 appears to be essential for embryonic visceral endoderm development and for self-renewal of pluripotent embryonic stem cells (23, 24); both TBRII and ELF have been implicated in early embryonic development of the foregut and in endodermal malignancies (9). Serial sections were examined by immunohistochemistry to help determine the local microscopic anatomy of the visualized cells (i.e., relationship to portal structures, etc.) and the number of cells comprising the cluster. We identified a cluster of two to four cells out of the entire 30,000- to 50,000-cell population of living donor liver- transplanted specimens that expressed Stat3, Oct4, and Nanog and TGF-β signaling proteins, TBRII and ELF. These cells, in supplemental models, also stained positively for both a hepatocytic cell lineage marker, albumin, and a cholangiocytic cell lineage marker, cytokeratin-19 (CK19), along with phosphorylated histone H3, a marker for active proliferation [Figs. 11 and 12 A-D; supporting information in supplemental figures included herein as Figs 15-25 (20). These putative progenitor/stem cells were generally found localized in the portal tract region surrounded by a "shell" of six to seven cells expressing TBRII, ELF, and albumin, but not Nanog or Oct4, reflecting a more differentiated phenotype (Fig. 12 A-D and other figures). These findings, together with the known role of the TGF-β signaling pathway in liver development, led us to hypothesize that: (/) these Stat3+, Oct4+, Nanog+, TBRN+, and ELF+ cells represent the progenitor/stem cell pool that becomes activated during the regenerative process; and (H) TBRII and ELF may be involved in the initiation of hepatocyte differentiation of Stat3+/Oct4+ progenitor/stem cells. To our knowledge, the demonstration of a hepatic progenitor/stem cell in postembryonic human liver is previously undescribed. Ablating TGF-β Signaling Results in Spontaneous HCCs. Our observations demonstrating the presence of TGF-β signaling components TBRII and ELF in human hepatic stem cells led us to explore the impact of these components of the TGF-β pathway on liver development and tumorigenesis. As we have reported, mice homozygous for elf (elf h) undergo midgestational death with hypoplastic livers (9). Heterozygous elf +/- mice, however, spontaneously developed tumors of the liver with an incidence of 40% (Fig. 21 ). Liver lesions included early centrilobular steatosis and dysplasia in most sections, with nuclear disarray and stratification, mitosis and apoptosis, proceeding to poorly differentiated carcinoma (Fig. 21 A and E-H). We hypothesized that the interruption of the TGF-β pathway resulted in hepatocellular carcinoma through disruption of a normal pattern of cellular differentiation by hepatic progenitor/stem cells.
We examined human HCC tissue specimens from 10 individuals. In 9 of the 10 HCC tissues, we observed a small strongly positive cluster of three to four Oct4+ cells that was negative for TBRII and ELF (Fig. 12 E-J and Fig. 22). Cells with this phenotype were never observed during our surveys of either normal liver or of biopsies from regenerating organs. We speculate that these Stat3+/Oct4+-positive human HCC cells that have lost TGF-β signaling proteins have the potential to give rise to HCCs (Fig. 12 K-P).
Activated IL-6 Signaling Is Found in HCC with Impaired TGF-β Signaling. To obtain a molecular signature of hepatic cancer that arises when TGF-β signaling is inactivated and to define the intracellular pathways that are engaged, we performed a series of microarray and proteomic analyses in elf +/-, elf +/- /itih4 -/-, and itih4 -/- tissues. Significantly increased expression of the IL-6/Stat3, WNT, and CDK4 signaling pathways was observed (Fig. 3 A and β; SI Figs. 23' A-F and 24 B and E and SI Table 1 and data not shown). The previously described association of increased IL-6 signaling activity in hepatic tumorigenesis (25, 26) led us to focus our attention on the IL-6 pathway. Down-Regulation of the IL-6 Pathway by itih4-/- Ablation Inhibits HCC Formation.
How might the increased activity of the IL-6 pathway in HCC associated with impaired TGF-β signaling be linked to the cancer phenotype? We hypothesized that the increased activity of the IL-6 pathway, occurring in hepatic progenitor/stem cells lacking competent TGF-β circuitry, directly resulted in disturbed growth and differentiation of these liver precursors. To test the hypothesis that the increased activity of the IL-6 pathway was a critical step in tumorigenesis and not a consequence, we attempted construction of a mouse defective in IL-6 signaling on a heterozygous elf background. However, stat3-null mice are embryonic lethal, and IL- 6 null mice were similarly too fragile to intercross to obtain a homozygous IL-6-null on a heterozygous elf background (27, 28).
We recently engineered a mouse in which the gene for IL-6 regulated protein, itih4, has been deleted (29). ITI H4 is a member of a liver-restricted serine protease inhibitor family, expressed in hepatoblasts, and is a biomarker of foregut cancers of uncertain function (30-32). Mice homozygous for the itih4 mutation (itih4 -/-) are normal and fertile, suggesting that the itih4 mutation does not show dominant effects (Fig. 3 C-E). Surprisingly, however, IL-6/Stat3 signaling is one of the most significantly suppressed pathways we detected in the itih4 -/- liver tissues (Fig. 3 A, B, and E; SI Figs. 5 and 6 and SI Table 1 ). far more than the WNT or CKD4 pathways. Interestingly, hepatocytes remained well differentiated in the itih4 -/- mice. We suspect that ITIH4, an acute-phase protein, might be associated in a positive- feedback loop with IL-6 (33-35), a regulatory property that characterizes several acute-phase gene products.
To explore the role of IL-6 activation in HCC associated with ELF deficiency, we generated mouse intercrosses between elf +/- mice and itih4 -/- mice (Fig. 3 C and D). An examination of elf +/- /itih4 -/- mice for tumor development revealed that only 1 of 25 (4%) elf +/- /itih4 -/- mice developed HCC, compared with 10 of 25 (40%) elf +/- mice that developed HCC (Fig. 3 F). The tumor that developed in the elf +/- /itih4 -/- mouse was 0.4 cm3 in size, small compared with the larger 3- to 4-cm3 tumors seen in the elf +/- mice (Fig. 3 F).
Microarray profiles of itih4 -/- and elf +/- /itih4 -/- liver tissues indicated a significant suppression of IL-6 signaling (Fig. 3 A and B and SI Table 1 ). Similarly, immunoblot and immunohistochemical analyses showed that expression of IL-6/Stat3 is decreased in the itih4 -/- and elf +l~ /itih4 -/- liver tissues (Sl Figs. 9 and 10), whereas, in contrast, IL-6 is activated in elf +/- mice (Sl Table 1 ). Stat3 phosphorylation is also dramatically decreased in the ititi4 -/- and elf +/- /itih4 -/- liver tissues (Fig. 4 A-D and SI Fig. 9). The disruption of IL-6/Stat3 signaling in the liver tissues of elf +/- /itih4 -/- mutant liver tissue was similar to that seen in the itih4 -/- liver tissues.
Consistent with the results obtained in mice, we demonstrated marked elevation of expression of Stat3, p-Stat3, and ITIH4 by immunohistochemistry in human HCC tissues (Fig. 4 E-H; SI Fig. 11 and SI Table 1 ). In addition, markedly increased Stat3 and p-Stat3 expression was observed in SNU-398 cells derived from a human HCC cell line that does not express TBRII and ELF (Sl Fig. 12). These data support our hypothesis that increased IL-6 signaling characterizes human HCC.
Increased Liver Cell Proliferation and Decreased Apoptosis Are Observed with Inactivation of TGF-β Signaling in elf1' Mice.
How does increased IL-6 signaling result in HCC in the setting where the TGF-β pathway is disrupted? lmmunohistochemical analysis of epithelial proliferation by labeling the mouse liver tissues with antibody specific to p-histone H3 (Ser10) showed a significant decrease in the mitotic labeling in itih4 -/- (Sl Fig. 135) and elf +/- /itih4 -/- (Sl Fig. 13C) mutant liver tissues compared with normal wild-type and elf +/- epithelium (Sl Fig. 13 A and D). This suggests that hepatocyte proliferation is inhibited in the TGF-β-inactivated state by the disruption of itih4 and, therefore, that IL-6 by some mechanism increases the proportion of proliferating hepatocytes in the absence of TGF-β.
Suppression of the IL-6/Stat3 pathway and TGF-β signaling in elf +/- /itih4 -/- cells might be expected to impact on hepatocyte apoptosis (25, 36). Epithelial apoptosis in the mouse liver tissues was examined by using the apoptotic marker, anti-active Caspase-3. In wild-type control mice, apoptosis was noted in hepatocytes (Sl Fig. 13E), but few apoptotic cells were seen in itih4 -/- and elf +/- mice compared with elf +/- /ititi4 -/- mutant liver tissue (Sl Fig. 13 F-H). We conclude that impairment of TGF-β signaling in liver results in suppression of apoptosis, which can partially be restored by an increase in the IL-6 pathway. In a setting where both the IL-6 and TGF-β circuits are defective, normal apoptosis is physiologically depressed.
Discussion
Clonal studies indicate that hepatocarcinogenesis arises from dysfunctional liver stem cells, and this is further supported by transformation of p53-null hepatic progenitor cells that give rise to HCC (37). A considerable proportion of HCCs express one or more HPC markers, and both hepatocyte and biliary cell markers such as albumin, CK7, and CK19 that are not present in normal mature hepatocytes (15, 16). HCCs that express these HPC markers carry a significantly poorer prognosis and higher recurrence after surgical resection and liver transplantation (38). Fifty-five percent of small dysplastic foci (<1 mm in size), early premalignant lesions, are comprised of progenitor cells and intermediate hepatocytes (39). Indeed, progenitor-like side populations of Huh7 and PLC/PRF/5 cells (human HCC cell lines), with hepatocytic and cholangiocytic lineages, give rise to persistent aggressive tumors upon serial transplantation in immunodeficient NOD/SCID mice (40). In this study, we demonstrate the cluster of two to four putative progenitor/stem cells per 30,000-50,000 cells in regenerating liver; expressing stem cell markers Stat3, Oct4, and Nanog; and TGF-β signaling proteins TBRII and Smad adaptor protein, ELF, and progenitor cell markers by labeling for both hepatocytic cell lineage markers (albumin) and cholangiocytic cell lineage markers (CK19), along with phosphorylated histone H3, a marker for active proliferation. These putative progenitor/stem cells are generally found localized in the portal tract region surrounded by a "shell" of six to seven cells expressing TBRII, ELF, and albumin, but not Nanog or Oct4, the latter reflecting a more differentiated phenotype, further supporting the role of the progenitor cell in self-renewal and differentiation. We observed small strongly positive clusters of Oct4+ cells that were negative for TBRII and ELF in HCCs (Fig. 2 E-J and SI Fig. 8). Given the important role of TGF-β signaling in liver development and in suppression of hepatocarcinogenesis supported by genetic studies, the Stat3+/Oct4+-positive human HCC cells that have lost TGF-β signaling proteins are likely the HCC progenitor/stem cells that give rise to HCCs. We suggest that these "tumorigenic" progenitor cells might potentially be attractive targets for therapeutic intervention in HCC.
Several TGF-β signaling components are bona fide tumor suppressors with the ability to constrain cell growth and inhibit cancer development at its early stages. Inactivation of at least one of these components (such as the TGF-β receptors, Smad2, or the common mediator Smad4) occurs in almost all gastrointestinal tumors (6, 10, 41 ). For example, the early embryonic lethality in smad4 -/- mice is consistent with the role of Smad4 in normal gut endoderm development. However, the specific roles of the TGF-β pathway in vivo human progenitor systems are unknown. As illustrated in this study, changes in TGF-β signaling drive the selection of defined differentiation pathways and their progression of differentiation in liver tissue.
Deregulation of TGF-β signaling may contribute to impaired differentiation and allow for the development of cancers, linking the differentiation of stem cells with suppression of carcinogenesis. In addition to the loss of TGF-β signaling that occurs in HCC, development of this cancer appears to require IL-6. In turn, increased ITIH4, an IL-6 target, appears to be a critical mediator of hepatocarcinogenesis (see schematic in SI Fig. 14). Therefore, this study reveals a surprising and important functional role of the serine protease inhibitor ITIH4 in hepatocellular transformation, previously identified as an IL-6 regulated biomarker for cancers of the foregut with no known function. Further support comes from current therapeutics in cancer that involve successful strategies at blocking IL-6 signaling (42). Modulation of IL-6 signaling in cancer progenitor cells may provide an important approach for new therapeutics in cancers with poor prognosis such as HCC.
Experimental Procedures
Construction of the Targeting Vector and Generation of Mice Carrying
Mutations.
Targeting vector. Recombinant phage-containing genomic DNA of the itih4 locus was isolated from a 129/SvEv mouse library by using PK7R, a piece of itih4 cDNA, as a probe. The finished construct, p-itih4Neo, is shown in Fig. 3 C. This targeting strategy deletes a 1.8-kb Smal-Clal fragment that contains the second and third exons of the itih4 gene. Homologous recombination in ES cells and generation of germ-line chimeras. TC1 ES cells were transfected with Notl digested p-itih4Neo and selected with G418 and FIAU. ES cell clones that were resistant to both G418 and FIALJ were picked and analyzed by Southern blotting for homologous recombination events within the itih4 locus (Fig. 3 D). Details are in S/ Text. Confocal Laser-Scanning Immunofluorescence Microscopy.
Colocalization studies were performed with anti-ELF, -Stat3, and -Oct4 by using human regenerating liver and HCC tissues. Normal wild-type, elf +/-, itih4 -/-, and elf +/- /itih4 -/- mutant livers and HCC tissues were also used for the confocal microscopy. Peptide-specific monoclonal mouse and rabbit polyclonal primary antibodies were visualized with tetramethyl rhodamine isothiocyanate (TRITC)- conjugated goat anti-rabbit IgG or FITC-conjugated goat anti-mouse IgG. Samples were analyzed with a Bio-Rad MRC-600 confocal microscope (Bio-Rad), with an ILT model 5470K laser (Ion Laser Technology) as the source for the crypton-argon ion laser beam.
Generation of Mouse Embryo-Derived Fibroblasts (MEFs). MEFs harboring the null-allele e/f and itih4 and wild-type were derived as described (9). lmmunoblot Assay.
For assaying endogenous TBRII, ELF, ITIH4, IL-6, Stat3, pStat3, protein lysates of human HCC cells (SNU-182 (CRL-2235), SNU-398 (CRL-2233), and SNU-449 (CRL-2234) (American Type Culture Collection), MEFs, and normal wild-type, elf +/-, itih4 -/-, and elf +/- /itih4 -/- mutant liver and HCC tissues were immunoblotted with the indicated antipeptide or antiphospho-specific antibodies (Santa Cruz Biotechnology, Invitrogen, and Abeam). Histological Analysis and Antibody Staining.
Mice exhibiting overt pathological signs were killed and underwent autopsy. Normal liver and HCC tissues were dissected, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and sectioned at 6 μm. Sections were stained with H&E or subjected to immunohistochemical analysis with antibodies, lmmunohistochemical staining was performed with primary antibodies against ELF, Oct4, ITIH4, Stat3, pStat3, pHistone H3 (Ser10), and Caspase-3 (Santa Cruz Biotechnology, Invitrogen, Promega, and Abeam). Detection of Proliferating Cells.
Proliferating cells were labeled with BrdU-labeling and detection kit (Invitrogen). BrdU (1 ml/100 g of body weight) was injected (i.v.) into 18.5-day postcoitum pregnant mice and 4 h later, fetal stomachs were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 6 μm. The proliferating cells were also identified by anti-pHistone H3 (Ser10) mitotic marker labeling. Detection of Apoptotic Cells.
Apoptotic cells were detected by the TUNEL method with a MEB STAIN Apoptosis Kit Direct (MBL, 8445) and with anti-Caspase3 antibody (Promega). Tissues were then fixed and analyzed by using immunofluorescence microscopy. Tumor Cells and Tissues.
EIf +/- mice were intercrossed with itih4 -/- mice to obtain elf +/" /itih4 "'"mice. Liver and HCC tissues were collected and cultured as described (43). Two different elf +/- HCC cancer cell lines were tested in different experiments, and the results obtained were also independent of passage number. Representative data are shown. The diagnosis of paraffin-mounted tissue biopsies from human HCC and normal liver were microscopically confirmed by pathologists, and an indirect immunoperoxidase procedure was used for immunohistochemical localization of Oct4, TBRII, and ELF protein as described above. Microarray.
Custom-designed 44K human 60-mer oligo microarrays (Agilent Technologies) were used for the array experiments. Total RNA was extracted from mouse liver and HCC tissues and MEFs by using RNeasy kit (Qiagen). References
Bergsagel DE, et al., (1968) Cancer Res 28:2187-2196.
Salsbury AJ , (1975) Cancer Treat Rev 2:55-72.
Morrison SJ, et al., (2006) Nature 441:1068-1074.
Mishra L, et al., (2005) Science 310:68-71 Takahashi, K. (2006) Cell 126:663-676.
Massague J, (2000) Cell 103:295-309.
Mishra L, (2005) Oncogene 24:5775-5789.
Mishra L, (1999)_Oncogene 18:353-364.
Tang Y, (2003) Science 299:574-577. Weinstein M, (2000) Cytokine Growth Factor Rev 11:49-58.
Kanzler S1 (2001) Oncogene 20:5015-5024.
Farazi PA, (2006) Nat Rev Cancer 6:674-687.
Alison MR (2005) Stem Cell Rev 1:253-260.
Zender L, (2006) Cell 125:1253-1267. Durnez A, (2006) Histopathology 49:138-151.
Van Eyken P, (1988) Hum Pathol 19:562-568.
Lee JS, (2004) Hepatology 40:667-676.
Fausto N, (2006) Hepatology 43:S45-S53.
Akamatsu N, (2006) Surgery 139:765-772. Tumbar T, (2004) Science 303:359-363.
Tai MH, (2005) Carcinogenesis 26:495-502.
Chambers I1 (2003) Cell 113:643-655.
Takeda K, (1997) Proc Natl Acad Sci USA 94:3801-3804.
Niwa H, (1998) Genes Dev 12:2048-2060. Maione D, (1998) EMBO J 17:5588-5597.
Schirmacher P, (1998) Am J Pathol 153:639-648.
Hirano T, (2000) Oncogene 19:2548-2556. Levy DE, (2002) J CHn Invest 109:1143-1148.
Bhanumathy CD, (2002) Dev Dyn 223:59-69.
Koomen JM, (2005) CHn Cancer Res 11:1110-1118.
Ogata H, (2006) Oncogene 25:2520-2530. Song J, (2006) CHn Chem 52:1045-1053.
Brasier AR, (2002) Arterioscler Thromb Vase Biol 22:1257-1266.
Popa C, (2005) Ann Rheum Dis 64:1195-1198.
Ray S, (2005) Gastroenterology 129:1616-1632.
Massague J, (2000) Genes Dev 14:627-644. Braun L, (1989) Cancer Res 49:1554-1561.
Wu PC, (1999) J Hepatol 31:965-966.
Roskams T (2006) Oncogene 25:3818-3822.
Chiba T, (2006) Hematology 44:240-251.
Roberts A, (2005) Oncogene 24:5667. Wallner L, (2006) Cancer Res 66:3087-3095.
Katuri V, (2006) Oncogene 25:1871-1886.
Figure imgf000032_0001
Wingless-type
MMTV integration
NM_003392 WNT5A -2.258 0.128 -1.175 0.700 -1.176 0.673 site family, member 5A,
WNT5A
Wingless-type
MMTV integration
NM.030775 WNT5B 1.204 0.818 -1.366 0.816 1.002 0.997 site family, member 5B,
WNT5B
Wingless-type
MMTV integration
NM.006522 WNT6 1.552 0.000 -1.205 0.104 1.887 0.000 site family, member 6,
WNT6
Catenin
(cadherin associated
AK095242 CTNNBl 1.000 1.000 2.614 0.627 -1 455 0.789 protein), beta
1, 88kDa,
Ctnnbl
Catenin
(cadheπn- associated
NM.001904 CTNNBl -1.067 0.567 1.032 0.781 -1.332 0.013 protein), beta
1 , 88kDa,
CTNNBl
lnterleukin 1 family,
NM.012275 ILl F5 -1.679 0.504 1.238 0.746 1.411 0.515 member 5
(delta), ILl F5
lnterleukin 1 family,
NM.014440 ILl F6 member 6 -1.312 0.021 -7.335 0.000 -4.794 0.000
(epsilon),
ILl F6
NM.000586 IL2 -1.098 0.958 1.000 1.000 1.323 0.765 lnterleukin 2,
Figure imgf000034_0001
STAT2
Signal transducer and activator of
AKO24535 STAT3 transcription -1.461 0.568 1.087 0.865 1.502 0.287 3 (acute- phase response factor), STAT3
Signal transducer and activator
NM.OO3151 STAT4 -1 005 0997 -1.131 0.919 1.000 1.000 of transcription 4, STAT4
Signal transducer and activator
NM_OO3152 STAT5A 1 379 0.811 1.000 1.000 1.000 1.000 of transcription 5A, STAT5A
Signal transducer and activator
NM.O 12448 STAT5B -1.377 0.328 -1.039 0.906 -1264 0.581 of transcription 5 B, STAT5B
Signal transducer and activator of
NM.003153 STAT6 transcription -1.006 0.989 1.089 0.902 1.211 0.632
6, ιnterleukιn-4 induced,
STAT6
Janus kinase 1
(a protein
NNL002227 JAKl 1.532 0.848 1.000 1.000 1.162 0.911 tyrosine kinase), JAKl Janus kinase 2
(a protein
NM.004972 JAK2 1.000 1.000 1.000 1.000 1.000 1.000 tyrosine kinase), JAK2
Janus kinase 3
(a protein tyrosine
NM.OOO215 JAK3 1.397 0.005 -1.227 0.084 -1.107 0.380 kinase, leukocyte),
JAK3
Wnt3a expression is increased in elf+/- liver tissue while it is decreased in itih4-/- and elf+/- /itih4-/- mouse liver tissues compared with wild type liver tissues. IL- 6 expression is also suppressed in itih4-/- and elf+/- /itih4-/- mouse liver tissues compared with wild-type liver tissues.
Figure imgf000037_0001
EXAMPLE 2
Causal Relationship between Loss of ELF, its TGF-β Smad3 Adaptor Function and Human Beckwith-Wiedemann Syndrome
ABSTRACT
The adaptor protein ELF (Embryonic Liver Fodrin, a β-Spectrin) is a potent regulator of tumorigenesis through its ability to affect TGF-β tumor suppressor function, specifically Smad3 and Smad4 signaling. We now show that e\f' and e\f VSmad3+/' mice develop abnormal ear folds, visceromegaly, adrenal cytomegaly and multiple cancers including liver and gastrointestinal tumors, observed in patients with Beckwith-Wiedemann syndrome (BWS), a hereditary human cancer overgrowth syndrome. Loss of ELF but not Smad3 or p53 RNA expression is observed in e\f'~, elf /Smad3+/~ tumors. Between 30-90% of human gastrointestinal cell lines and human BWS cell lines do not significantly express ELF due to epigenetic errors (aberrant DNA methylation at the ELF promoter). In human BWS cells, Smad3 protein was mislocalized. Exogenous ELF expression rescued TGF-β signaling and Smad3 localization in BWS cells. Our results suggest that epigenetic regulation of the TGF-D pathway resulting in a lack of ELF and its crucial Smad3 adaptor function is causally related to the genesis and progression of human BWS, and that e\f'~ and e\f /Smad3+/~ mice may provide an important animal model for Beckwith- Wiedemann syndrome (BWS).
Introduction Hereditary cancer syndromes provide powerful insights into common forms of cancer. They lead to further understanding of the somatic mutations present in sporadic cancers, as well as the function of cell signaling pathways 1"3. One clear example is the identification of germline, inactivating mutations in the APC gene, found to encode a 300 kD wnt pathway adaptor protein (White R, PNAS 2000, Massague Cell 2003). Although germline mutations in APC are responsible for familial adenomatous polyposis (FAP), a rare condition affecting about 1 in 7000 individuals in the United States, somatic mutations in the APC gene are present in more than 70% of all adenomatous polyps and carcinomas of the colon and rectum (Cleyers, Science 2005). Beckwith-Wiedemann syndrome (BWS) is an overgrowth disorder associated with an 800-fold increased risk of embryonal neoplasms of childhood that include Wilms1 tumors, hepatoblastomas, pancreatoblastoma, neuroblastoma, rhabdomyosarcoma, as well as adrenocortical carcinomas, and less commonly also lymphomas, hepatocellular carcinoma (HCC), renal cell carcinomas, optic nerve gliomas and others . Fifteen percent of cases are familial with an autosomal dominant pattern of inheritance and 85 percent are sporadic 4. Reported tumor risk estimates vary between 4% and 21%. BWS has an incidence of 1 per 6,000-10,000 births in the US, and a prevalence of 0.07 per 1000 births 5' 6. A 4- to 9-fold increase in incidence has been recently observed in in vitro fertilization offspring 7' 8.
The main clinical and histologic features frequently associated with BWS include macrosomia (gigantism) with enlarged livers, kidneys, hearts, macroglossia, neonatal hypoglycemia, hemihyperplasia, exomphalos, midface microcephaly, and abnormal ear creases. A frequent pathological finding in human BWS is adrenal cytomegaly that is characterized by the presence of large polyhedral cells with eosinophilic granular cytoplasm and enlarged nuclei in the adrenal cortex of affected pre-pubertal BWS individuals. The molecular defects underlying BWS are not well understood but may be associated epigenetic alterations of several genes with increased expression of IGF2 perhaps via alterations in epigenetic regulation, and Loss of imprinting (LOI) at the IGF2 locus on chromosome 11 in 15% of BWS patients"9"11. Although increased IGF2 as well as decreased P57/CDKN1 C, with LOI of LIT1 an antisense RNA that regulates P57 have been implicated in this syndrome, to date no clear mouse model with cancer development has emerged for this syndrome.
The Smad3/4 adaptor protein ELF which regulates TGF-β signaling is a potent regulator of tumorigenesis, but the role of the TGF-β pathway and ELF in human gastrointestinal 6 tumor syndromes remains unclear 12' 13. In the present study, we show that elf' and e\f /Smad3+/~ mice are born with dramatic visceromegaly, macroglossia, abnormal ear folds, and microfacies, followed in later months by the development of multiple cancers, including carcinomas of the gastrointestinal tract (liver, stomach, intestine, and pancreas), as well as renal and adrenal adenocarcinomas. Some mice also had significant cytomegaly of adrenal cortex, though this was probably not confined to the fetal cortex. While the fetal cortex of the mouse adrenal differs significantly from that of humans, to date adrenal cytomegaly has not been described in any of the other rodent models of BWS 14. The combined phenotype is strongly suggestive of Beckwith-Wiedemann syndrome (BWS) and elf+//-Smad3+/- mice could offer a valuable animal model for further genetic studies of this disease .
Phenotype and Cancer formation with elf and
Figure imgf000040_0001
heterozygote mice. We began with a detailed study of the phenotype and cancer formation of elf and elf+//-Smad3+/- heterozygote mice. Mice with homozygous deletion of elf (elf') undergo mid-gestational death 15. Analysis of elf and elf+//-Smad3+/- heterozygote mice revealed an average body size and mass 25% larger than wild type mice (44.55 g and 34.03 g, respectively; p<0.01 ), macroglossia, hemi-hypertrophy, multiple ear folds, frontal balding, increased incidence of sudden death in the male mutant mice, visceromegaly with multilobed livers, cardiomegaly, renal hypertrophy and testicular enlargement, (Figure 1 , Figure 2 A). The phenotypic resemblance between the elf and elf+//-Smad3+/- heterozygote mice and BWS patients is considerable (Tables 1 , 2, 3). In BWS, postnatal gigantism (height more than 2 standard deviations above normal) is observed in 45% of cases. Macroglossia, a major symptom of BWS, is present in 92% of patients. Another characteristic feature is cytomegaly of the fetal cortex of the adrenal glands. Facial abnormalities including those of the ear are present in greater than 50% of cases. Neonatal hypoglycemia is observed in 13% of cases. Visceromegaly due to cellular hyperplasia of livers, kidneys and pancreas, occurs in of the majority of cases, sometimes accompanied by cardiomegaly. Interestingly, hyperplasia of three or more organs is associated with an increased presence of tumors 16. Examination of heterozygous elf mice revealed a 40% increase in incidence of tumors of the liver 17, as well as the kidney and ovaries (Table 2). Eighty percent (12 out of 15) of the elf/Smad3+/~ mice at 12 months spontaneously developed the following tumors: hepatocellular carcinoma, pancreatic adenocarcinoma, lung adenocarcinoma, thymoma, small bowel lymphomas, squamous skin cancers, breast adenomas, lung adenocarcinomas, renal clear cell cancers, optic nerve gliomas and ovarian cancers with a marked reduction in survival (Tables 2, 3 and Figure 2A l-l V, 2B). These studies suggest that the ELF/Smad3 interaction site is crucial for a major tumor suppressor pathway for multiple cancers. Loss of this interaction in the whole animal leads to multiple tumors suggesting either a universal role for this tumor suppressor pathway at key regulatory steps or in a specific cell subtype such as a stem or progenitor cell 18.
Tumor tissues from elf' and elf'ISmadZ*'' mice show a dramatic decrease of ELF mRNA but not p53.
To determine whether the tumors in the elf and elf~/Smad3+/~ mice arose from loss of ELF, or Smad3, in the haploid, we examined tumor tissues from e\f'~ and elf /Smad3+/' heterozygote mice for alterations in elf and Smad3 by quantitative PCR. Significantly, all seven tumor tissues showed a loss of elf mRNA levels without significant decreases in Smad3 compared to non-tumor controls (Figure 3C I, II) and P53 levels are also not changed in elf/Smad3+/' tumors (Figure 6A). The phenotype observed in the mouse suggests that elf' and elf/Smad3+/' mice could be models of human BWS. To test our hypothesis that dysregulation of the ELF gene or protein may be an important effector of human BWS, we proceeded to analyze the role of the TGF-β pathway members ELF and Smad3 as well as other molecules implicated in BWS: IGF2, IGF2R and P57 in 10 human BWS cancer tissues and 6 BWS cell lines. The tested human BWS patient tissues displayed a significant decrease (p< 0.001 ) in ELF mRNA with a 64-98% reduction (Figure 2D), and a complete loss of ELF protein expression compared to normal control tissues (Figure 3E and 3F). Smad3 expression was not significantly altered in BWS tissues (Figure 3F, 3G III, IV). However, intracellular localization of Smad3 was markedly aberrant and was localized in both cytoplasmic as well as nuclear compartments in the BWS cells (Figure 3G III). Normal cells showed a cytoplasmic localization of Smad3 with a robust nuclear localization following TGF-β stimulation. Interestingly, nuclear localization of Smad3 was not significantly altered in BWS cells following TGF-β stimulation. (Figure 3G III, and 3G IV).
Cell proliferation is increased and apoptosis is decreased in the elf /Smad3+/' mutants. Further lmmunohistochemical analysis of epithelial proliferation by labeling the mouse liver tissues with antibody specific to p-histone H3 (Ser10) showed a significant increase in the mitotic labeling in e\f'~ and elf /Smad3+/~ mutant liver tissues (Average: 50 per high power field (HPF), range 24-68 per HPF) compared to normal wild type epithelium (Average: 9 per HPF, range 0-20 per HPF) (Figure s2). This indicates that hepatocyte proliferation is increased in the TGF-β inactivated state by the disruption of ELF and Smad3.
Loss of response to TGF-β signaling in e\f'~ and elf +//Smad3+/c-ells might be expected to impact hepatocyte apoptosis \ Epithelial apoptosis in the mouse liver tissues was examined using the apoptotic marker, anti-active caspase3. In wild type control mice, apoptosis was noted in hepatocytes (Average: 27 per HPF1 range 4-36 per HPF) (Figure s5) but few apoptotic cells were seen in e\f'~ and elf VSmad3+/' mice (Average: 3 per HPF, range 0-8 per HPF) (Figure s3). The suppression of apoptosis indicates that elf and/or Smad3 may be important in the TGF-β induction of apoptosis in hepatocytes, and loss of ELF may contribute to the formation of tumors in the e\f'~ and elf/Smad3+/~ livers.
Rescue of Smad3 localization in Human BWS cells is observed by ectopic expression of ELF with TGF-β treatment.
To explore the role of ELF and TGF-β signaling in BWS and investigate the possibility of rescuing Smad3 localization and TGF-β signaling in BWS cells, we utilized "a full-length ELF cDNA construct with a V5 tag at its C-terminal end 15' 20. Transient transfection of full-length elf plasmid rescued Smad3 nuclear localization in 60% of BWS cells treated with TGF-β (Figure 3G V), compared to persisting Smad3 mal-localization in vector transfected, TGF-βtreated BWS cells (Figure 6B). To confirm that TGF-β induced transactivation of target genes requires ELF, p15 expression was examined in the BWS cells transfected with elf cDNA constructs. As expected, p15 mRNA expression was increased in BWS cells transfected with full- length elf (Figure 6C).
DNA methylation of the promoter region of ELF in human BWS cell lines
Our data strongly point to loss of ELF expression as one likely cause of BWS. This could be a result of mutation of the ELF gene, methylation of its promoter, transcriptional or post-transcriptional de-regulation. Similarly the complete loss of elf mRNA in elf'/Smadβ*'' heterozygotes without mutation or inactivation of ELF transcription pointed to an epigenetic mechanism of repression potentially by methylation of ELF at its promoter. Previous observations show a deletion of ELF results in a dramatic and spontaneous formation of liver and gastrointestinal cancers 6. We now provide data that e\f'~ and elf1' /Smad3+/~ mutant mice are mouse models for human BWS, (elf/7Smad3+/~ providing an exacerbated phenotype). Dramatically, ELF expression and ELF-mediated TGF-β signaling is lost in human BWS. Significantly, in BWS and cancer cells, the pattern of DNA methylation is often altered. Growing evidence suggests that aberrant DNA methylation of CpG islands around promoter regions can have the same effect as mutations in the coding regions on the inactivation of tumor-suppressor genes (Baylin et a!.. 2001 ). Since the promoter region of ELF contains four typical CpG islands (Figure 3A), we examined the methylation state of this region by genomic DNA isolated from 8 cell lines (7 BWS cell lines and EIf positive HepG2 cell) and normal human liver tissue utilizing methylation-specific PCR (Figure 4B) and Bisulfite sequencing. (Figure 4C). The results showed a positive correlation between a low-level or lack of expression of ELF and methylation in the vicinity of the ELF promoter in human BWS cells (Fig 4). In six BWS cell lines showing either loss or markedly decreased expression of ELF, (CDKNIc, KvDMR-, KvDMR+, UPD- Tongue-1 and Tongue-2), the C residues of the CpG dinucleotide in the ELF promoter region (-957 to -687) were completely methylated, whereas those in two cell lines (HepG2 and UPD+) and normal human liver expressing ELF were entirely methylation free (Figure 4C). Hypermethylation of CpG islands appears responsible for the transcription silencing of critical genes including tumor suppressor genes (reviewed by Baylin et al.. 2001 ). 5'-aza-2'-deoxycytidine (5-aza-dC), an inhibitor of DNA methyltransferase, reactivated gene expression when hypermethylation of CpG islands is the cause of reduced gene expression (Cameron et al.. 1999). To confirm that regulation of ELF expression is due to DNA methylation, Three BWS cell lines were treated with an increasing concentrations of 5-aza-dC for 6 days. As shown in Figure 4D, expression of ELF was reactivated in three BWS cell lines at 2.5 μM concentration of 5-aza-dC compared to controls.
Analysis of elf' and elf'/Smadβ*'' mice reveals increased IGF2 expression similar to that observed in human BWS.
Increased IGF2 has been implicated in BWS. We therefore performed broad microarray and proteomic analyses on e\f'~ and elf ~/Smad3+/~ liver tissues to determine alterations in the pathways involved in BWS. Microarray profiles of elf and elf1' /Smad3+/~ liver tissues indicated a marked activation of IGF2, but not IGF2R or CDKN1C (P57) which led us to further confirm these findings, lmmunohistochemical analysis confirmed that expression of IGF2 is increased in the elf' and elf'/Smad3+/' liver tumor tissues (Figure 4A), while, in contrast, IGF2 receptor is not activated in elf' and elf/Smad3+/~ mice (Figure 4B). P57 expression is not altered in the elf1' and elf'/Smad3+/' liver tissues (Figure s4A-D). However, KCNQ1 appears to be decreased in elf' and elf'/Smad3+/~ cardiac tissue (Figure s5A-F). We next investigated whether the increased IGF2 levels in the BWS cells could be secondary to a loss of repression by ELF/Smad3. Ectopic expression of ELF in the ELF negative BWS cell lines markedly reduced the elevated IGF2 mRNA (greater than 5-fold (Figure 4C). SiRNA to IGF2 slightly increased ELF RNA (1.7 fold) perhaps indicating an autocrine loop of ELF-IGF2 regulation (Figure 4D, E). ChIP assays show that ELF negative BWS cell lose regulation of IGF2 gene expression by ELF-mediated TGF-β signaling compared with ELF positive HepG2 cells (Figure 4G). These results indicate that ELF-TGF-βsignaling is required for suppression of IGF2 signaling, and that the increased IGF2 observed in BWS may potentially be a secondary event from loss of ELF, and not the causal event in BWS.
Conclusions
Several TGF-β signaling components are bona fide tumor suppressors with the ability to constrain cell growth and inhibit cancer development at its early stages. Inactivation of at least one of these components (such as the TGF-β receptors (TBRII, TBRI), Smad2, or the common mediator Smad4) occurs in almost all gastrointestinal tumors 1i 23~25. However, the specific roles of the TGF-β pathway through the adaptor ELF in in vivo human cancer syndromes are unknown. A clear delineation of the role of this important tumor suppressor pathway could lead to powerful new therapeutics targeted at difficult to treat cancers such as pancreatic, gastric and hepatocellular. For instance, TBRII is mutated in up to 30% colon cancers and TBRI is mutated in 15% of biliary cancers 23 and Smad4 is deleted in up to 60% of pancreatic cancers, and mutated in hereditary juvenile polyposis coli. Loss of ELF, a Smad3/4 adaptor, is observed in human hepatocellular cancers and results in spontaneous development of hepatocellular cancers in mice.
Changes in TGF-β signaling drive the selection of defined differentiation pathways and the progression of differentiation in multiple tissues through functional regulation of Smad3 by its adaptor ELF. Deregulation of TGF-β signaling may contribute to impaired differentiation and allow for the development of cancers, linking the differentiation of stem cells with suppression of carcinogenesis ' ' . The present work also points to ELF as an essential adaptor protein required for key events in the propagation of TGF-β signaling in BWS, often considered to be a stem cell disorder 28. Striking phenotypic as well as mechanistic similarities are observed between human BWS and the e\f'~, e\f'~/Smaό2Ϊ'~ mutant mice. For example, the aberrant intracellular distribution of Smad3 and abrogation of TGF-β signaling in BWS can be re-instated by exogenous ELF. These studies allow us to propose a model for the role of ELF in Smad activation in BWS (Figure 4E). In BWS patient samples, aberrant elf methylation may be a predominant mechanism for loss of ELF protein expression observed in BWS. Our studies suggest that the ELF/Smad3 interaction site is a major tumor suppressor pathway for multiple cancers and that alterations of ELF/SMAD3 expression at the mRNA level are potentially a major genetic alternation in human BWS. Thus, elf^and elf^/SmadO^' mice will be valuable to determine the underlying molecular mechanism and future treatment modalities for the tumors seen in human BWS.
Although genetic and biochemical data support the proposed ELF/Smad3 protein functions and interactions depicted in Figure 1 in human BWS, the situation in vivo is undoubtedly far more complex. Mis-regulation of imprinted gene expression (loss of imprinting [LOI]) is seen frequently and precociously in a large variety of human tumors 29. Imprinting is defined as the parental allele-specific expression of a very limited set of genes (about 50-80). This regulation depends upon an epigenetic marking of parental alleles during gametogenesis. Monoallelic expression ensures that the levels of the proteins encoded by imprinted genes, important factors of embryonic growth, placental growth or adult metabolism, are assured. Without precise control of their expression, developmental abnormalities result, as is shown by a number of hereditary over-growth syndromes, including BWS. Major rearrangements on the short arm of chromosome 11 may be involved in the etiology of BWS, particularly in the region of the insulin like growth factor 2 (IGF-2) gene (11 p15.5). This gene is thought to be parentally imprinted in the mouse and it has been suggested that in the human, paternal duplication of this paternally expressed imprinted locus in BWS patients leads to over expression of the gene and consequent general hyperplasia. This model predicts that there should be frequent and possibly parental origin-specific increased expression of the IGF2 gene in the patients. Our data point to an additional or perhaps related mechanism for deregulation of IGF2, in this case ELF/Smad mediated regulation of IGF2 expression.
The resemblance of this mouse model to human BWS is substantial but not perfect. The tumors in human BWS are mostly of embryonal cell types including nephroblastoma, hepatoblastoma and pancreatoblastoma, while those in the mouse model are largely carcinomas or other "adult" type neoplasms. The predisposition to neoplasia seen in humans with BWS diminishes in later childhood, while this has not been observed in maturing mice. Adrenal cytomegaly in the mutant mice is apparently not localized to the fetal cortex as it is in human BWS. These distinctions may at least in part reflect species differences, possibly they may reflect the difficulties in discerning between embryonal and adult tumors in rodents, such as hepatoblastomas and hepatocellular carcinomas, and in part from the surprising discovery of the syndrome through tumors in surviving older mice in our colony.
Genetic studies have shown the importance of TGF-β signaling in mesoderm as well as endoderm development as well as in suppression of multiple cancers, not only gastrointestinal cancers 1> 30' 31. It is possible that in BWS, as in sporadic hepatocellular cancer, derangement in TGF-β signaling in progenitor cells contributes to malignant transformation and eventual cancer development 2l 18. Future studies on the role of genomic imprinting as an epigenetic mechanism controlling parental-origin-specific gene expression, and their perturbations should yield new therapeutics for cancers that are stem in origin 32. Indeed insights into the consequences of epigenotype switches at birth and in BWS from ELF and its interactions with Smad3 may be of profound significance.
METHODS SUMMARY
Cell Culture of Hepatic and primary human Beckwith-Wiedemann (BWS) cell lines. HepG2 was obtained from ATCC and cultured according to the manufacturer's protocol. BWS patients were diagnosed based on the presence of three major criteria 11. Human BWS cell lines were developed by Dr. Weksberg (Ontario, Canada). Cells were cultured in MEM-alpha medium with 10% FBS. The cell lines (lymphoblasts and fibroblasts) were named for the molecular abnormality identified (UPD, KvDMR loss of methylation or CDKN1C mutation. In addition cell lines were given a tumor (T) designation if the patient had a tumor or a "no tumor" designation if no tumor has been detected (NT). The cell lines used in this study are: UPD+T, hepatoblastoma (referred to as BWS-1 ); tongue tissue derived from a case with UPD-NT (referred to as BWS-2); KvDMR+T, hepatoblastoma (referred as BWS- 3); KvDMR-NT (referred to as BWS-4); CDKN1C-NT (referred to as BWS-5); and tongue tissue derived from a case with UPD-NT (referred to as BWS-6).
Generation of
Figure imgf000047_0001
and genotype analysis. Elf1' mice were intercrossed with Smad3+/~ mice to obtain elf^/SmadS^'xmce. Genotypes were determined by Southern blotting or PCR. For PCR analysis - - - .
Plasmids, SiRNA and transient transfection assays. The cDNA sequence of ELF was amplified by gene-specific primer and inserted into either pcDNA3.1/V5-His- TOPO (V5-ELF (Invitrogen) to use in transfection studies. Constructs expressing full- length elf or vector alone were transfected into MEF cells or human gastric cancer cells or human BWS cells by using Amaxa electroporation kit (Amaxa Inc., Gaithersburg, MD) according to the manufacturer's protocols. SiRNA (Dharmacon, Lafayette, CO) was transfected with Lipofectamine 2000 (Invitrogen, CA) as per manufacturer's instructions. Bisulfite Sequencing and DNA Methylation Analysis. Genomic DNA was bisulfite modified with an EpiTect Bisulfiat Kit (Qiagen, Valencia, CA) according to the manufacturer's protocols. Prediction of CpG islands in EIf promoter and Primer design for Methylation -specific PCR use web software (www.urogene.org); DNA methylation analysis by a web tool in website: http://quma.cdb.riken.jp. Materials and Methods
Ceil Culture of Hepatic, Gastric, and primary human Beckwith-Wiedemann (BWS) cell lines. Hepatocarcinoma and Gastric cancer cell lines (HepG2, Kato III, SNU 475 and SNU 182) were obtained from ATCC and cultured according to the manufacturer's protocol. BWS patients were diagnosed based on the presence of three major criteria 11. Human BWS cell lines were developed by Dr. Weksberg (Ontario, Canada). Cells were cultured in MEM-alpha medium with 10% FBS. The cell lines (lymphoblasts and fibroblasts) were named for the molecular abnormality identified (UPD, KvDMR loss of methylation or CDKN1 C mutation. In addition cell lines were given a tumor (T) designation if the patient had a tumor or a "no tumor" designation if no tumor has been detected (NT). The cell lines used in this study are: UPD+T, hepatoblastoma (referred to as BWS-1 ); tongue tissue derived from a case with UPD-NT (referred to as BWS-2); KvDMR+T, hepatoblastoma (referred as BWS- 3); KvDMR-NT (referred to as BWS-4); CDKN1C-NT (referred to as BWS-5); and tongue tissue derived from a case with UPD-NT (referred to as BWS-6).
Generation of
Figure imgf000048_0001
and genotype analysis. Elf1' mice were intercrossed with Smad3+/~ mice to obtain e//+/7Smad3+Λmice. Genotypes were determined by Southern blotting or PCR. For PCR analysis, the wild type elf allele was detected using primer 1 (5' CTCATACTAG G CAGATCTC 3') and primer 2 (5' GTAGCTCTACTTGGAAGGTC 3'). Primer 1 is located 5' to the deletion and primer 2 is located within the deletion. This primer pair amplifies a fragment of 481 bp from wild-type and elf heterozygous, but not from elf ~'~ mutant mice. DNA was also amplified using the primer 1 and primer 3, which is located in the Neo (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant elf allele. In this case, a 620 bp fragment was detected in mice heterozygous or homozygous for the mutant elf allele, while no signal was detected in wild-type mice. The wild type Smad3 allele was detected by using Smad3-7 and Smad3-5 primers giving a fragment of 400bp (5' CCC GAA CAG TTG GAT TCA CAC A 3'). To detect the Smad3 mutant allele, primers Smad3-5 and Rin-1 A were used. A fragment of 250bp was observed (51 CCA CTT CAT TGC CAT ATG CCC TG 3'). Tissue samples and immunohistochemical analysis. Mice exhibiting overt pathological signs were sacrificed and underwent autopsy. Liver tissue and HCC identified were dissected, fixed with 10% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 μm. Sections were stained with hematoxylin and eosin (H&E), or subject to immunohistochemical analysis with antibodies. Immunohistochemical staining was performed with primary antibodies against ELF, Smad3, p57, pHistone H3 (Ser10), KCNQ1 , and Caspase 3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abeam, MA). Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson lmmunoresearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO). Counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO). Proliferating cells were identified by anti-pHistone H3 (Ser10) mitotic marker labeling. Apoptotic cells were detected by with anti-Caspase3 antibody (Promega, OR).
Formalin-fixed and paraffin-embedded BWS tumor specimens were obtained from the Department of Pathology, Georgetown University, Washington, DC, USA. These samples were subjected to immunohistochemical analysis for indicated antibodies. Two independent and blinded pathologists evaluated the tumors used in the study. The control samples of normal tissue used in the present investigation were taken from the borders of the surgical specimens.
All tissue was collected in accordance with Institutional Review Board (IRB) specifications and with Georgetown University IRB approval.
All animal procedures were approved by the Institutional Animal Care and Use Committee of Georgetown University Medical Center, Washington, DC.
lmmunoblot assay. For assaying endogenous TBRII, ELF, Smad3, Smad4, protein expression, lysates of HepG2 and indicated BWS cell lines were prepared in 1 %NP- 40 buffer (150 mM NaCI, 5OmM Tris pH7.4, 1 % NP40) with complete mini protease inhibitors (Roche Molecular Biochemicals). Lysed (50-100 μg of total protein in 1X Lamaelli buffer was heated to 95°C for 10 minutes and then loaded onto a SDS- PAGE gel for Western blotting, lmmunoblotting was performed with the indicated primary antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and Abeam, MA). The loading control was performed under the same conditions using mouse monoclonal anti-Actin (Sigma, MO).
Plasmids, microRNA inhibitors, SiRNA and transient transfection assays. The cDNA sequence of ELF was amplified by gene-specific primer and inserted into either pcDNA3.1/V5-His-TOPO (V5-ELF (Invitrogen) to use in transfection studies. Constructs expressing full-length elf or vector alone were transfected into MEF cells or human gastric cancer cells or human BWS cells by using Amaxa electroporation kit (Amaxa Inc., Gaithersburg, MD) according to the manufacturer's protocols. MicroRNA inhibitors or SiRNA (Dharmacon, Lafayette, CO) was transfected with Lipofectamine 2000 (Invitrogen, CA) as per manufacturer's instructions. Cells were used for confocal analysis and Q-PCR analysis.
Single Stranded Conformation Polymorphism (SSCP) analysis. Total RNA was isolated from tumor tissues by the RNeasy Kit. Reverse transcription-PCR was performed according to manufacturer's specifications. Briefly, 1 μg of RNA was reverse transcribed for 1 h at 37°C using 300 ng of oligo i2-iβ primers (Amersham Pharmacia Biotech) and 200 units of AMV reverse transcriptase (Life Technologies, Inc.) in a 20-μl reaction containing 1 * first strand buffer (Life Technologies, Inc.), a 500 μM concentration of each of the four deoxyribonucleotide triphosphates (Life Technologies, Inc.), 1 mM dithiothreitol (Life Technologies, Inc.), and 40 units of RNase inhibitor (Roche Molecular Biochemicals, Indianapolis, IN). Exons from each elf cDNA fragment were isolated and used for SSCP analysis. After PCR amplification, the PCR products were diluted 1 :10 in loading buffer that contained 95% formamide (v/v), 50 mM EDTA, 20 mM NaOH, and 0.05% each of xylene cyanol and bromphenol blue. Samples were denatured at 100 0C for 10 min, quick frozen on dry ice, thawed slowly on wet ice, and fractionated on a MDE (Mutation Detection Enhancement) gel. Point mutations were identified by a shift in the relative mobility of the PCR fragments compared with wild type elf controls. Chromatin-immunoprecopitation (ChIP) assays. The ChIP assay was performed using ChIP assay kit according to manufacturer's instructions (Upstate Biotechnology). Briefly, HepG2 cells were grown to 70-80% confluence, cross-linked with 1 % formaldehyde for 10 min at room temperature after TGF-b stimulation for 1 h, stopped with the addition of glycine, rinsed with PBS and harvested. The resultant cell pellet was lysed and sonicated or enzymatically digested to generate fragments ranging from 200 to 1500bp. Protein-DNA complexes were enriched by immunoprecipitation using antibodies for Smad3 and ELF or preimmune rabbit serum (negative control). Protein G Agarose beads were added and washed. DNA- protein complexes were eluted, reverse cross-linked, treated with proteinase-K. Following DNA purification, DNA fragments were recovered by centrifugation, resuspended in water and used for PCR amplification of IGF2 gene promoter DNA. The primer sequences are available on request.
RNA, and quantitative real-time PCR. RNA was isolated using TRIzol reagent combined with RNAeasy kit, miRNAeasy kit (Qiagen, Valencia, CA). RNA or miRNA was quantified using NanoDrop-ND-1000 (Wilmington, DE). For RNA expression, quantitative real-time PCR (qPCR) was performed with cDNA generated from 1 μg total RNA with a Superscript III reverse transcriptase kit (Roche) using either random hexamers, oligo d(T)16 or gene-specific primers. Primers for elf were designed for qPCR using Primer Express software (Applied Biosystems, Foster City, CA), and the sequences are available upon request. qPCRs were carried out using SYBR green PCR master mix (Applied Biosystems). All other qPCRs were carried out with commercially available TaqMan gene expression assay utilizing TaqMan Universal PCR mix. The PCR reactions were carried out in an ABI Prism 7900HT sequence detection system (Applied Biosystems) according to the manufacturer's conditions. Relative values were quantified by generating a standard curve by cDNAs generated from control treated samples and normalization was done by GAPDH or 28S RNA expression.
Confocal laser-scanning immunofluorescence microscopy. Co-localization studies were performed with anti-ELF and anti-V5, and anti-Smad3 utilizing indicated BWS cell lines or MEFs. Monoclonal mouse and rabbit polyclonal primary antibodies were visualized with Tetramethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-rabbit immunoglobulin G or Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G. The samples were analyzed with a Bio-Rad MRC- 600 confocal microscope (Bio-Rad, Cambridge, MA), with an ILT model 5470K laser (Ion Laser Technology, Salt Lake City, UT) as the source for the krypton-argon ion laser beam. FITC-stained samples were imaged by excitation at 488 nm and with a 505 to 540 bandpass emission filter, and Rhodamine-stained samples were imaged by excitation at 568 nm with a 598- to 621 bandpass emission filter using a 63x (numerical aperture 1.3) objective. Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.
Bisulfite Sequencing and DNA Methylation Analysis. Genomic DNA was bisulfite modified with an EpiTect Bisulfiat Kit (Qiagen, Valencia, CA) according to the manufacturer's protocols. Prediction of CpG islands in EIf promoter and Primer design for Methylation -specific PCR use web software (www.urogene.org); DNA methylation analysis by a web tool in website: http://quma.cdb.riken.jp (Kumaki Y, Oda M. & Okano M, QUMA: quantification tool for methlation analysis. Nucleic Acids. Res. 36, W170-5 (2008).) Primer Pairs used for methylation -specific PCR and bisulfite sequencing were methylated forward / 5'-CGG TGT TTT TAT AAA TTT TTT TTG CGT C-3' reverse/ 5'-AAT TCC ATT ATA CCC GAC GTA ACG C-3' and unmethylated forward 5'-TTG GTG TTT TTA TAA ATT TTT TTT GTG TTG A-3' reverse/ 5'-CAA TTC CAT TAT ACC CAA CAT AAC ACC C-3'
Table 1. Comparison of mouse phenotypes with BWS.
Figure imgf000053_0001
Table 2. Classification of Tumors in elf+/- Mice.
Pathology Site
Hepatocellular Carcinoma Liver
Adenocarcinoma (1) Small Bowel
Lymphoma ( 3 )
Sarcoma Abdominal
Clear Cell Carcinoma Kidney
Lymphoma Spleen
Adenoma Breast
Adenocarcinoma Lung
Sarcoma Mesenchymal
Carcinoma Testis
Epithelial Tumor Ovary Table 3. Classification of Tumors in elf+/-/Smad3+/- Mice.
Table 3 : Classification of Tumors in elfh/~/Sma.d3+/' Mice
Pathology Site
Hepatocellular Carcinoma Liver
Adenocarcinoma (1) Small Bowel
Lymphoma (3 )
Adenocarcinoma Pancreas
(Metastatic)
Sarcoma Abdominal
Clear Cell Carcinoma Kidney
Lymphoma Spleen
Adenoma Breast
Adenocarcinoma Lung
Sarcoma Mediastinal
Squamous Cell Carcinoma Head & Neck
Thymoma Thymus
Carcinoma Adrenal
Squamous Cell Carcinoma Skin
Adenocarcinoma Lacrimal Gland
Glioma Optic Nerve
"Carcinoma Testis
Epithelial Tumor Ovary
References :
1. Massague, J., Blain, S. W. & Lo, R. S. TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103, 295-309 (2000) .
2. Mishra, L., Derynck, R. & Mishra, B. Transforming growth factor-beta signaling in stem cells and cancer. Science 310, 68-71 (2005) .
3. Neufeld, K. L. et al . Adenomatous polyposis coli protein contains two nuclear export signals and shuttles between the nucleus and cytoplasm. Proc Natl Acad Sci U S A 97, 12085-90 (2000) .
4. Enklaar, T., Zabel, B. U. & Prawitt, D. Beckwith- Wiedemann syndrome: multiple molecular mechanisms. Expert Rev MoI Med 8, 1-19 (2006) .
5. Thorburn, M. J., Wright, E. S., Miller, C. G. & Smith- Read, E. H. Exomphalos-macroglossia-gigantism syndrome in Jamaican infants. Am J Dis Child 119, 316-21 (1970).
6. Pettenati, M. J. et al. Wiedemann-Beckwith syndrome: presentation of clinical and cytogenetic data on 22 new cases and review of the literature. Hum Genet 74, 143-54 (1986) .
7. Halliday, J., Oke, K., Breheny, S., Algar, E. & D, J. A. Beckwith-Wiedemann syndrome and IVF: a case-control study. Am J Hum Genet 75, 526-8 (2004) .
8. Allen, C. & Reardon, W. Assisted reproduction technology and defects of genomic imprinting. Bjog 112, 1589-94
(2005) .
9. Sun, F. L., Dean, W. L., Kelsey, G., Allen, N. D. & Reik, W. Transactivation of Igf2 in a mouse model of Beckwith- Wiedemann syndrome. Nature 389, 809-15 (1997) .
10. Murrell, A. et al. An association between variants in the IGF2 gene and Beckwith-Wiedemann syndrome: interaction between genotype and epigenotype. Hum MoI Genet 13, 247- 55 (2004).
11 . Weksberg, R., Shuman, C. & Smith, A. C. Beckwith- Wiedemann syndrome. Am J Med Genet C Semin Med Genet 137, 12-23 (2005) .
12 . Tang, Y. et al. Transforming growth factor-beta suppresses nonmetastatic colon cancer through Smad4 and adaptor protein ELF at an early stage of tumorigenesis . Cancer Res 65, 4228-37 (2.005) .
13 . Katuri, V. et al . Inactivation of ELF/TGF-beta signaling in human gastrointestinal cancer. Oncogene 24, 8012-24 (2005) .
14 . Sucheston, M. & Cannon, M. The transient-zone in the human and mouse adrenal gland. Ohio J Sci 120, 120-6 (1972) .
15 . Tang, Y. et al. Disruption of transforming growth factor- beta signaling in ELF beta-spectrin-deficient mice. Science 299, 574-7 (2003) .
16 . Schneid, H. et al. The Beckwith-Wiedemann syndrome phenotype and the risk of cancer. Med Pediatr Oncol 28, 411-5 (1997) .
17 . Kitisin, K. et al . Disruption of transforming growth factor-beta signaling through beta-spectrin ELF leads to hepatocellular cancer through cyclin Dl activation. Oncogene 26, 7103-10 (2007) . 18. Tang, Y. et al. Progenitor/stem cells give rise to liver cancer due to aberrant TGF-beta and IL-6 signaling. Proc Natl Acad Sci U S A 105, 2445-50 (2008).
19. Katuri, V. et al. Critical interactions between TGF-beta signaling/ELF, and E-cadherin/beta-catenin mediated tumor suppression. Oncogene 25, 1871-86 (2006) .
20. Hu, R. J., Moorthy, S. & Bennett, V. Expression of functional domains of beta G-spectrin disrupts epithelial morphology in cultured cells. J Cell Biol 128, 1069-80 (1995) .
21. Betel, D., Wilson, M., Gabow, A., Marks, D. S. & Sander, C. The microRNA.org resource: targets and expression. Nucleic Acids Res 36, D149-53 (2008) .
22. John, B. et al . Human MicroRNA targets. PLoS Biol 2, e363 (2004) .
23. Markowitz, S. et al. Inactivation of the type II TGF-beta receptor in colon cancer cells with microsatellite instability. Science 268, 1336-8 (1995) .
24. Roberts, A. & Mishra, L. Role of TGF-beta in stem cells and cancer. Oncogene 24, 5667. (2005).
25. Bhowmick, N. A. et al. TGF-beta signaling in fibroblasts modulates the oncogenic potential of adjacent epithelia. Science 303, 848-51 (2004).
26. Reya, T., Morrison, S. J., Clarke, M. F. & Weissman, I. L. Stem cells, cancer, and cancer stem cells. Nature 414,
105-11 (2001) .
27. Wicha, M. S., Liu, S. & Dontu, G. Cancer stem cells: an old idea--a paradigm shift. Cancer Res 66, 1883-90; discussion 1895-6 (2006) . 28. Weksberg, R. et al. Tumor development in the Beckwith- Wiedemann syndrome is associated with a variety of constitutional molecular Ilpl5 alterations including imprinting defects of KCNQlOTl. Hum MoI Genet 10, 2989- 3000 (2001) .
29 Jones, P. A. & Baylin, S. B. The fundamental role of epigenetic events in cancer. Nat Rev Genet 3, 415-28 (2002) .
30 Derynck, R. & Zhang, Y. E. Smad-dependent and Smad- independent pathways in TGF-beta family signalling. Nature 425, 577-84 (2003) .
31 Sporn, M. B. TGF-beta: 20 years and counting. Microbes Infect 1, 1251-3 (1999) .
32 Makeyev, E. V. & Maniatis, T. Multilevel regulation of gene expression by microRNAs. Science 319, 1789-90 (2008) .
33 Radtke, F. & Clevers, H. Self-renewal and cancer of the gut: two sides of a coin. Science 307, 1904-9 (2005).
34 Hughes-Benzie, R. M. et al. Simpson-Golabi-Behmel syndrome: genotype/phenotype analysis of 18 affected males from 7 unrelated families. Am J Med Genet 66, 227- 34 (1996) .
35 Neri, T. M. et al. Missense mutations in the COL4A5 gene in patients with X-linked Alport syndrome. Hum Mutat Suppl 1, S106-9 (1998) . EXAMPLE 3
Human Beckwith-Wiedemann Syndrome Arises from MicroRNA modulation of the TGF-β signaling molecule ELF
ABSTRACT
The adaptor protein ELF (Embryonic Liver Fodrin, a β-Spectrin) is a potent regulator of tumorigenesis through its ability to affect TGF-β tumor suppressor function, specifically Smad3 and Smad4 signaling. We now show that elf- and elf +--"Smad3+-- mice develop visceromegaly and multiple cancers with phenotypic characteristics frequently observed in patients with Beckwith-Wiedemann syndrome (BWS)1 a hereditary human cancer overgrowth syndrome. A dramatic decrease in ELF RNA and protein but not Smad3 or p53 expression is observed in elf", elf +- "Smad3+-- tumors as well as BWS cell lines and tumor tissues compared to normal tissues. In BWS cells, Smad3 protein was mislocalized. Exogenous ELF expression partially rescued TGF-β signaling and Smad3 localization. Significantly, complete rescue was achieved by inhibition of microRNA Let7a which targets ELF and is elevated in BWS cells. Our results also suggest that alteration of elf expression at the mRNA level is a major defect of human BWS, resulting in an inability to provide crucial Smad3 adaptor function. Epigenetic regulation may also be a significant factor in the phenotype observed in BWS — the tumors arising from a convergence of the TGF-a pathway and microRNAs which target ELF. These results suggest that elf- and elf +- "Smad3+-- mice provide an important animal model for Beckwith- Wiedemann syndrome (BWS).
Introduction
Hereditary cancer syndromes provide powerful insights into common forms of cancer. They lead to further understanding of the somatic mutations present in sporadic cancers, as well as the function of cell signaling pathways (1-3). Beckwith- Wiedemann syndrome (BWS) is an overgrowth disorder associated with an increased concurrent risk for development of a defined group of childhood neoplasms that include Wilms' tumors, hepatoblastomas, pancreatic tumors, adrenocortical carcinomas, and rarely also lymphomas, hepatocellular carcinoma (HCC), renal cell carcinomas, optic nerve gliomas as well as others (Figure 1 , Table 1 ). Reported tumor risk estimates vary between 4% and 21 %. Initially described by Beckwith in 1963 (4) and Wiedemann in 1964 (5), it has an incidence of 1 per 6,000-10,000 births in the US, and a prevalence of 0.07 per 1000 births (6, 7). A 4- to 9-fold increase in incidence has been recently observed in in vitro fertilization offspring (8, 9). Fifteen percent of cases are familial with an autosomal dominant pattern of inheritance and 85 percent are sporadic ( 10). Other clinical and histologic features frequently associated with BWS include neonatal hypoglycemia, renal abnormalities, visceromegaly, hemihyperplasia, exomphalos, macroglossia, and gigantism (thus its previous name of EMG syndrome). The molecular defects underlying BWS are not well understood but may be associated with increased expression of IGF2 perhaps via alterations in epigenetic regulation at the IGF2 locus on chromosome 11 (11, 12). Although increased IGF2 as well as decreased P57/CDKN1 C have been implicated in this syndrome, to date no clear mouse model with cancer development has emerged for this syndrome (Figure 1 , Table 1 ). The Smad3/4 adaptor protein ELF which regulates TGF-a signaling is a potent regulator of tumorigenesis, but the role of the TGF-a pathway and ELF in human gastrointestinal (7) tumor syndromes remains unclear (13, 14). In the present study, we show that elf- and elf +--"Smad3+"- mice are born with dramatic visceromegaly, abnormal ear folds, microfacies followed in later months by the development of multiple cancers, including those of the gastrointestinal tract (liver, intestine, and metastatic pancreatic), as well as renal and adrenal adenocarcinomas. This phenotype is strongly suggestive of Beckwith-Wiedemann syndrome (BWS) and elfιr"Smad3*-r mice could offer a valuable animal model for further genetic studies of this disease (Figure 1 , Figure 2 A, Tables 1 , 2, 3). Phenotype and Cancer formation with elf' and elf'/SmaύZ*'' heterozygote mice. We began with a detailed study of the phenotype and cancer formation of elf - and elf'r /Smad3+" heterozygote mice. Mice with homozygous deletion of elf (elf") undergo mid-gestational death ( 15). Analysis of elf- and e/f^"Smad3+" heterozygote mice revealed an average body size and mass 25% larger than wild type mice (44.55 g and 34.03 g, respectively; p<0.01 ), macroglossia, hemi-hypertrophy, multiple ear folds, frontal balding, increased incidence of sudden death in the male mutant mice, visceromegaly with multilobed livers, cardiomegaly, renal hypertrophy and testicular enlargement, (Figure 1 , Figure 2 A). The phenotypic resemblance between the elf ' and elf' /Smad3" heterozygote mice and BWS patients is dramatic (Tables 1 , 2, 3). In BWS, postnatal gigantism (height more than 2 standard deviations above normal) is observed in 45% of cases. Macroglossia, a major symptom of BWS, is present in 92% of patients. Facial abnormalities including those of the ear are present in greater than 50% of cases.
Neonatal hypoglycemia is observed in 13% of cases. Visceromegaly with multilobed livers, cardiomegaly and renal hypertrophy occurs in 50% of cases. Interestingly, involvement of three or more organs is associated with an increased presence of tumors (16). Examination of heterozygous elf-' mice revealed a 40% increase in incidence of tumors of the liver (17), as well as the kidney and ovaries (Table 2). Eighty percent (12 out of 15) of the elf-'"Smad3+-' mice at 12 months spontaneously developed the following tumors: hepatocellular cancer, pancreatic adenocarcinoma, lung adenocarcinoma, thymoma, small bowel lymphomas, squamous skin cancers, breast adenomas, lung adenocarcinomas, renal clear cell cancers, optic nerve gliomas and ovarian cancers with a marked reduction in survival (Tables 2, 3 and Figure 2A I-IV, 2B). These studies suggest that the ELF/Smad3 interaction site is crucial for a major tumor suppressor pathway for multiple cancers. Loss of this interaction in the whole animal leads to multiple tumors suggesting either a universal role for this tumor suppressor pathway at key regulatory steps or in a specific cell subtype such as a stem or progenitor cell (18).
Tumor tissues from elf'' and e/Z^VSmadS^" mice show a dramatic decrease of ELF mRNA but not p53. To determine whether the tumors in the elf-' and elf "- "Smad3+-- mice arose from loss of ELF, or Smad3, or secondary events such as p53 mutations in the haploid, we examined tumor tissues from elf-' and elf " "Smad3+-- heterozygote mice for alterations in elf, Smad3 and p53 RNA by quantitative PCR. Significantly, all seven tumor tissues showed a loss of elf mRNA levels without significant decreases in Smad3 compared to non-tumor controls (Figure 2C I, II). In addition, p53 mRNA levels were not significantly altered in any of the three samples (Figure s1A).
Twenty-four tissue samples (7 control non-tumor tissues and 17 tumor tissues of multiple origin) and 7 mouse embryonic fibroblast (MEF) samples from elf- (5), elf-' (1 ), and elf " "Smad3+-- (1 ) animals were analyzed for p53 mutations. RNA was isolated from a total of 31 samples, used as a template for RT-PCR thereby amplifying the entire p53 DNA binding domain — the frequent site for observed point mutations, and sequenced. No mutations were observed in MEFs or non-tumoral control tissues. Point mutations were observed in only two tumor tissues one from the lung and the other from small intestine tumor tissue (Figure s1 B). The lung cancer tissue sample had a p53 point mutation substituting the valine 213 for glycine. The small intestine tumor tissue sample had a point mutation substituting leucine 191 for phenylalanine. These results demonstrate a very low frequency of p53 mutations in the tumor samples from elf-' heterozygote compared to other reported cases of gastric and hepatocellular cancers. Therefore, this result strongly suggests that p53 mutations are not the crucial secondary event in tumorigenesis induced from the loss of elf. These results strongly suggest that loss of ELF is causal to the tumorigenesis induced in elf-' and elf " "Smad3*-- heterozygotes. As complete loss of ELF mRNA occurred without loss of the remaining ELF allele in heterozygous animals, either ELF transcription or mRNA degradation may account for the absence of ELF expression in tumors from these animals.
Cell proliferation is increased and apoptosis is decreased in the elf' /Smad3+/~ mutants. Further lmmunohistochemical analysis of epithelial proliferation by labeling the mouse liver tissues with antibody specific to p- histone H3 (Ser10) showed a significant increase in the mitotic labeling in elf" and elf-"Smad3- mutant liver tissues (Average: 50 per high power field (HPF), range 24- 68 per HPF) compared to normal wild type epithelium (Average: 9 per HPF, range 0-20 per HPF) (Figure s4). This indicates that hepatocyte proliferation is increased in the TGF-a inactivated state by the disruption of ELF and Smad3.
Loss of response to TGF-a signaling in elf" and e/f-"Smad3-cells might be expected to impact hepatocyte apoptosis (1). Epithelial apoptosis in the mouse liver tissues was examined using the apoptotic marker, anti-active caspase3. In wild type control mice, apoptosis was noted in hepatocytes (Average: 27 per HPF, range 4-36 per HPF) (Figure s5) but few apoptotic cells were seen in elf- and elf- "- "Smad3*-- mice (Average: 3 per HPF, range 0-8 per HPF) (Figure s5). The suppression of apoptosis indicates that elf and/or Smad3 may be important in the TGF-a induction of apoptosis in hepatocytes, and loss of ELF may contribute to the formation of tumors in the elf- and elf " "Smad3+-- livers.
Analysis of ELF and Smad3 in Human BWS cell lines and tissues shows decreased ELF RNA, mislocalized Smad3 protein, and disruption of TGF-a signaling. The phenotype observed in the mouse suggests that elf- and elf- "Smad3- mice could be models of human BWS. To test our hypothesis that dysregulation of the ELF gene or protein may be an important effector of human BWS, we proceeded to analyze the role of the TGF-13 pathway members ELF and Smad3 as well as other molecules implicated in BWS: IGF2, IGF2R and P57 in 10 human BWS cancer tissues and 6 BWS cell lines, as well as 12 human gastrointestinal cancer cell lines. The tested human BWS patient tissues displayed a significant decrease (p< 0.001 ) in ELF mRNA with a 64-98% reduction (Figure 2D), and a complete loss of ELF protein expression compared to normal control tissues (Figure 2E and 2F). Smad3 expression was not significantly altered in BWS tissues (Figure 2F, 2G III, IV). However, intracellular localization of Smad3 was markedly aberrant and was localized in both cytoplasmic as well as nuclear compartments in the BWS cells (Figure 2G III). Normal cells showed a cytoplasmic localization of Smad3 with a robust nuclear localization following TGF-13 stimulation. Interestingly, nuclear localization of Smad3 was not significantly altered in BWS cells following TGF-13 stimulation. (Figure 2G III, and 2G IV). We observed a similar loss of the 200 kD ELF protein expression in 4 out of 12 human cancer cell lines (HCC and gastric) by western blot analysis (19). Thus, it is possible that BWS may result directly from ELF dysregulation, and that the elf', elf' /Smad3*'' mutant mice represent a novel pathway for BWS, as well as sporadic gastrointestinal cancers. Rescue of TGF-13 induced changes in Smad3 localization in BWS cells by ectopic expression of ELF. To explore the role of ELF and TGF-13 signaling in BWS and investigate the possibility of rescuing Smad3 localization and TGF-13 signaling in BWS cells, we utilized a full-length ELF cDNA construct with a V5 tag at its C- terminal end Tang, 2003; Hu, 1995). Transient transfection of full-length e/f plasmid rescued Smad3 nuclear localization in 60% of BWS cells treated with TGF-a (Figure 2G V), compared to persisting Smad3 mal-localization in vector transfected, TGF-a treated BWS cells (Figure s6C). To confirm that TGF-a induced transactivation of target genes requires ELF, p15 expression was examined in the BWS cells transfected with elf cDNA constructs. As expected, p15 mRNA expression was increased in BWS cells transfected with full-length elf (Figure s6D). Analysis of e\f'~ and e\f 7Smad3+/' mice reveals increased IGF2 expression similar to that observed in BWS. Increased IGF2 has been implicated in BWS. We therefore performed broad microarray and proteomic analyses on elf' and elf' /Smad3+/~ liver tissues to determine alterations in the pathways involved in BWS. Microarray profiles of elf and elf'/Smad3+/' liver tissues indicated a marked activation of IGF2, but not IGF2R or CDKN1 C (P57) which led us to further confirm these findings, lmmunohistochemical analysis confirmed that expression of IGF2 is increased in the elf and elf/Smad3+/~ liver tumor tissues (Figure 3A), while, in contrast, IGF2 receptor is not activated in elf' and elf~/Smad3+/' mice (Figure 3B). P57 expression is not altered in the elf' and elf/Smad3+/' liver tissues (Figure s2A-D). However, KCNQ1 appears to be decreased in elf and elf /- /Smad3+/- cardiac tissue (Figure s3A-F). We next investigated whether the increased IGF2 levels in the BWS cells could be secondary to a loss of repression by ELF/Smad3. Ectopic expression of ELF in the ELF negative BWS cell lines markedly reduced the elevated IGF2 mRNA (greater than 5-fold (Figure 3C). SiRNA to IGF2 slightly increased ELF RNA (1.7 fold) perhaps indicating an autocrine loop of ELF-IGF2 regulation (Figure 3D, E). These results indicate that ELFTGF-a signaling is required for suppression of IGF2 signaling, and that the increased IGF2 observed in BWS may potentially be a secondary event from loss of ELF, and not the causal event in BWS. miRNA-let7a is a potential regulator of elf mRNA levels in BWS. Our data strongly point to loss of ELF expression as one likely cause of BWS. This could be a result of mutation of the ELF gene, methylation of its promoter, transcriptional or post-transcriptional de-regulation. As the first line of investigation we analyzed 31 exons of ELF by Single Strand DNA Polymorphism (SSCP) in human cancer and BWS cell lines. We tested gastrointestinal (7) cell lines including 9 gastric and 3 hepatocellular cancer cell lines. Surprisingly, exon 15 of ELF was not amplified at high stringency condition of PCR from an HCC Line, CRL-2236 (SNU 475). We then identified a missense mutation Arg 928 to lsoleucine (G - A) in elf exon 15 in 2 of the human gastrointestinal cancer cell lines demonstrating loss of ELF expression (Figure s6B). In addition, on western blot analysis, the SNU 475 cell line was shown to produce decreased ELF protein levels in comparison to SNU182 (no mutation in exon 15 of elf) suggesting a possibility that the mutation could be related to ELF translation or protein stabilization (17). Although we did not observe any mutations in the coding region of the BWS cell lines, we could not rule out the possibility of a mutation in the non-coding sequence of this large gene spanning 67kb. We have no evidence that ELF methylation or transcriptional deregulation occurs in BWS. Similarly the complete loss of elf mRNA in elf /VSmad3+/- heterozygotes without mutation or inactivation of ELF transcription pointed to a post-transcriptional mechanism of repression potentially by microRNAs. At least 500-1000 vertebrate microRNAs have been recently identified as regulators of messenger RNA (mRNA), that bind to the 3' untranslated region of target genes mostly to decrease the levels of target gene expression. Our bioinformatic prediction is that a total of 132 miRNA binding sites are present on the 3' untranslated region of elf (20, 21). We therefore investigated miRNA mediated regulation of elf mRNA in normal and human BWS cases, as well as elf', elf WSmad3+/- tissues.
Utilizing broad microRNA (miRNA) array analyses of elf', elf+/JSmad3+/-, and 6 human BWS cell lines, we were able to focus upon a common cluster of miRNAs (miR let-7, miR125b and miRIOO) which are over-expressed in BWS and also increased in the elf , elf+/-/Smad3+/-, tissues (Figure 4 A). This increase in the common cluster of miRNAs could potentially represent mechanistic similarities between BWS and elf and elf /Smad3+/~ in tumor progression. Interestingly, miR-let7a and miR125b are localized to chromosome 11 and also showed binding sites on elf RNA suggesting that reduced elf RNA in BWS could be due to increased levels of these miRNAs. A greater than four-fold increase (p< 0.0001 ) in ELF RNA occurred upon specific inhibition of miR-let7a in BWS cells (Figure 4B). In contrast as noted earlier, inhibition of IGF2 by siRNA does not affect elf RNA expression in BWS significantly (Figure 3E). These experiments suggest that elf mRNA is regulated by miRNA-let7a in BWS. We next determined whether miRlet7a modulation of ELF expression was functional in BWS cells. Transfection with inhibitors of miR-let7a increased ELF expression and ELF mediated Smad3 translocation to the nucleus in over 90% of the two TGF-a treated BWS cell lines (Figure 4D Vl, VIII). These data indicate that miRNA mediated regulation of ELF occurs in and may be the cause of BWS. Conclusions
Several TGF-a signaling components are bona fide tumor suppressors with the ability to constrain cell growth and inhibit cancer development at its early stages. Inactivation of at least one of these components (such as the TGF-a receptors (TBRII, TBRI), Smad2, or the common mediator Smad4) occurs in almost all gastrointestinal tumors (1, 22-24). However, the specific roles of the TGF-a pathway through the adaptor ELF in in vivo human cancer syndromes are unknown. A clear delineation of the role of this important tumor suppressor pathway could lead to powerful new therapeutics targeted at difficult to treat cancers such as pancreatic, gastric and hepatocellular. For instance, TBRII is mutated in up to 30% colon cancers and TBRI is mutated in 15% of biliary cancers {22) and Smad4 is deleted in up to 60% of pancreatic cancers, and mutated in hereditary juvenile polyposis coli. Loss of ELF, a Smad3/4 adaptor, is observed in human hepatocellular cancers and results in spontaneous development of hepatocellular cancers in mice. We have found that deletion of ELF results in a dramatic and spontaneous formation of liver and gastrointestinal (7) cancers, and a splice site mutation in elf exon 15 occurs in 11% of human Gl cancer cell lines tested so far. We now provide data that eif'~ and elf /-/Smad3+/- mutant mice are mouse models for human BWS, (elU/-/Smad3+/- providing an exacerbated phenotype). Dramatically, ELF expression and ELF-mediated TGF-a signaling is lost in human BWS.
Changes in TGF-a signaling drive the selection of defined differentiation pathways and the progression of differentiation in multiple tissues through functional regulation of Smad3 by its adaptor ELF. Deregulation of TGF-a signaling may contribute to impaired differentiation and allow for the development of cancers, linking the differentiation of stem cells with suppression of carcinogenesis (2, 25, 26). The present work also points to ELF as an essential adaptor protein required for key events in the propagation of TGF-a signaling in BWS, often considered to be a stem cell disorder (27). Striking phenotypic as well as mechanistic similarities are observed between human BWS and the elf', elf/'/Smaό3ir/' mutant mice. For example, the aberrant intracellular distribution of Smad3 and abrogation of TGF-a signaling in BWS can be re-instated by exogenous ELF or by inhibition of Iet7a microRNA mediated repression of endogenous ELF. These studies allow us to propose a model for the role of ELF in Smad activation in BWS (Figure 4E). In BWS patient samples, aberrant elf microRNA modulation may be a predominant mechanism for loss of ELF protein expression observed in BWS. miRNALet7a may also regulate e/f mRNA accumulation and/or stability. Our studies suggest that the ELF/Smad3 interaction site is a major tumor suppressor pathway for multiple cancers and that alterations of ELF/SMAD3 expression at the mRNA level are potentially a major genetic alternation in human BWS. Thus, e/f^'and e\f'~ /Smad3+/' mice will be valuable to determine the underlying molecular mechanism and future treatment modalities for the tumors seen in human BWS.
Although genetic and biochemical data support the proposed ELF/Smad3 protein functions and interactions depicted in Figure 1 in human BWS, the situation in vivo is undoubtedly far more complex. Mis-regulation of imprinted gene expression (loss of imprinting [LOI]) is seen frequently and precociously in a large variety of human tumors (28). Imprinting is defined as the parental allele-specific expression of a very limited set of genes (about 50-80). This regulation depends upon an epigenetic marking of parental alleles during gametogenesis. Monoallelic expression ensures that the levels of the proteins encoded by imprinted genes, important factors of embryonic growth, placental growth or adult metabolism, are assured. Without precise control of their expression, developmental abnormalities result, as is shown by a number of hereditary over-growth syndromes, including BWS. Major rearrangements on the short arm of chromosome 11 may be involved in the etiology of BWS, particularly in the region of the insulin like growth factor 2 (IGF- 2) gene (11 p15.5). This gene is thought to be parentally imprinted in the mouse and it has been suggested that in the human, paternal duplication of this paternally expressed imprinted locus in BWS patients leads to over expression of the gene and consequent general hyperplasia. This model predicts that there should be frequent and possibly parental origin-specific increased expression of the IGF2 gene in the patients. Our data points to an additional or perhaps related mechanism for de- regulation of IGF2, in this case ELF/Smad mediated regulation of IGF2 expression. Genetic studies have shown the importance of TGF-a signaling in mesoderm as well as endoderm development as well as in suppression of multiple cancers, not only gastrointestinal cancers ( 1, 29, 30). It is possible that in BWS, as in sporadic hepatocellular cancer, derangement in TGF-a signaling in progenitor cells contributes to malignant transformation and eventual cancer development (2, 18). Future studies on the role of genomic imprinting as an epigenetic mechanism controlling parental- originspecific non-coding RNA genes, including snoRNAs and microRNAs expression, and their perturbations should yield new therapeutics for cancers that are stem in origin {31). Indeed insights into the consequences of epigenotype switches at birth and in BWS from ELF and its interactions with Smad3 may be of profound significance.
Materials and Methods
Cell Culture of Hepatic, Gastric, and primary human Beckwith-Wiedemann (BWS) cell lines. Hepatocarcinoma and Gastric cancer cell lines (HepG2, Kato III, SNU 475 and SNU 182) were obtained from ATCC and cultured according to the manufacturer's protocol. BWS patients were diagnosed based on the presence of three major criteria (32). Human BWS cell lines were developed by Dr. Weksberg (Ontario, Canada). Cells were cultured in MEM-alpha medium with 10% FBS. The cell lines (lymphoblasts and fibroblasts) were named for the molecular abnormality identified (UPD, KvDMR loss of methylation or CDKN1 C mutation. In addition cell lines were given a tumor (T) designation if the patient had a tumor or a "no tumor" designation if no tumor has been detected (NT). The cell lines used in this study are: UPD+T, hepatoblastoma (referred to as BWS-1 ); tongue tissue derived from a case with UPD-NT (referred to as BWS-2); KvDMR+T, hepatoblastoma (referred as BWS-3); KvDMR-NT (referred to as BWS-4); CDKN1 C-NT (referred to as BWS-5); and tongue tissue derived from a case with UPD-NT (referred to as BWS-6).
Generation of
Figure imgf000066_0001
mice were intercrossed with Smad3+A mice to obtain e/^'/SmacO^mice. Genotypes were determined by Southern blotting or PCR. For PCR analysis, the wild type elf allele was detected using primer 1 (5' CTCATACTAGGCAGATCTC 3') and primer 2 (5' GTAGCTCTACTTGGAAGGTC 3'). Primer 1 is located 5' to the deletion and primer 2 is located within the deletion. This primer pair amplifies a fragment of 481 bp from wild-type and elf heterozygous, but not from elf -/ - mutant mice. DNA was also amplified using the primer 1 and primer 3, which is located in the Neo (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant elf allele. In this case, a 620 bp fragment was detected in mice heterozygous or homozygous for the mutant elf allele, while no signal was detected in wild-type mice. The wild type Smad3 allele was detected by using Smad3-7 and Smad3-5 primers giving a fragment of 400bp (5' CCC GAA CAG TTG GAT TCA CAC A 3'). To detect the Smad3 mutant allele, primers Smad3-5 and Rin-1A were used. A fragment of 250bp was observed (5' CCA CTT CAT TGC CAT ATG CCC TG 3').
Tissue samples and immunohistochemical analysis. Mice exhibiting overt pathological signs were sacrificed and underwent autopsy. Liver tissue and HCC identified were dissected, fixed with 10% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 μm. Sections were stained with hematoxylin and eosin (H&E), or subject to immunohistochemical analysis with antibodies. Immunohistochemical staining was performed with primary antibodies against ELF, Smad3, p57, pHistone H3 (Ser10), KCNQ1 , and Caspase 3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abeam, MA). Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson I mmunoresearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO). Counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO). Proliferating cells were identified by anti-pHistone H3 (Ser10) mitotic marker labeling. Apoptotic cells were detected by with anti-Caspase3 antibody (Promega, OR).
Formalin-fixed and paraffin-embedded BWS tumor specimens were obtained from the Department of Pathology, Georgetown University, Washington, DC, USA. These samples were subjected to immunohistochemical analysis for indicated antibodies. Two independent and blinded pathologists evaluated the tumors used in the study. The control samples of normal tissue used in the present investigation were taken from the borders of the surgical specimens.
All tissue was collected in accordance with Institutional Review Board (IRB) specifications and with Georgetown University IRB approval.
All animal procedures were approved by the Institutional Animal Care and Use Committee of Georgetown University Medical Center, Washington, DC.
lmmunoblot assay. For assaying endogenous TBRII, ELF, Smad3, Smad4, protein expression, lysates of HepG2 and indicated BWS cell lines were prepared in
1 %NP-40 buffer (150 mM NaCI, 5OmM Tris pH7.4, 1 % NP40) with complete mini protease inhibitors (Roche Molecular Biochemicals). Lysed (50-100 μg of total protein in 1X Lamaelli buffer was heated to 95°C for 10 minutes and then loaded onto a SDS-PAGE gel for Western blotting, lmmunoblotting was performed with the indicated primary antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and
Abeam, MA). The loading control was performed under the same conditions using mouse monoclonal anti-Actin (Sigma, MO).
Plasmids, microRNA inhibitors, SiRNA and transient transfection assays.
The cDNA sequence of ELF was amplified by gene-specific primer and inserted into either pcDNA3.1/V5-
His-TOPO (V5-ELF (Invitrogen) to use in transfection studies. Constructs expressing full-length elf or vector alone were transfected into MEF cells or human gastric cancer cells or human BWS cells by using Amaxa electroporation kit (Amaxa Inc., Gaithersburg, MD) according to the manufacturer's protocols. MicroRNA inhibitors or SiRNA (Dharmacon, Lafayette, CO) was transfected with Lipofectamine 2000 (Invitrogen, CA) as per manufacturer's instructions. Cells were used for confocal analysis and Q-PCR analysis.
Single Stranded Conformation Polymorphism (SSCP) analysis. Total RNA was isolated from tumor tissues by the RNeasy Kit. Reverse transcription-PCR was performed according to manufacturer's specifications. Briefly, 1 μg of RNA was reverse transcribed for 1 h at 37°C using 300 ng of Oiigo(33)i2-i8 primers (Amersham Pharmacia Biotech) and 200 units of AMV reverse transcriptase (Life Technologies, Inc.) in a 20- μl reaction containing 1 * first strand buffer (Life Technologies, Inc.), a 500 μM concentration of each of the four deoxyribonucleotide triphosphates (Life Technologies, Inc.), 1 mM dithiothreitol (Life Technologies, Inc.), and 40 units of RNase inhibitor (Roche Molecular Biochemicals, Indianapolis, IN). Exons from each elf cDNA fragment were isolated and used for SSCP analysis. After PCR amplification, the PCR products were diluted 1 :10 in loading buffer that contained 95% formamide (v/v), 50 mM EDTA, 20 mM NaOH, and 0.05% each of xylene cyanol and bromphenol blue. Samples were denatured at 100 0C for 10 min, quick frozen on dry ice, thawed slowly on wet ice, and fractionated on a MDE (Mutation Detection Enhancement) gel. Point mutations were identified by a shift in the relative mobility of the PCR fragments compared with wild type elf controls.
Chromatin-immunoprecopitation (ChIP) assays. The ChIP assay was performed using ChIP assay kit according to manufacturer's instructions (Upstate Biotechnology). Briefly, HepG2 cells were grown to 70-80% confluence, cross-linked with 1 % formaldehyde for 10 min at room temperature after TGF-b stimulation for 1 h, stopped with the addition of glycine, rinsed with PBS and harvested. The resultant cell pellet was lysed and sonicated or enzymatically digested to generate fragments ranging from 200 to 1500bp. Protein-DNA complexes were enriched by immunoprecipitation using antibodies for Smad3 and ELF or preimmune rabbit serum (negative control). Protein G Agarose beads were added and washed. DNA-protein complexes were eluted, reverse cross-linked, treated with proteinase-K. Following DNA purification, DNA fragments were recovered by centrifugation, resuspended in water and used for PCR amplification of IGF2 gene promoter DNA. The primer sequences are available on request.
RNA, miRNA analysis, and quantitative real-time PCR. RNA and miRNA was isolated using TRizoi reagent combined with RNAeasy kit, miRNAeasy kit (Qiagen, Valencia, CA). RNA or miRNA was quantified using NanoDrop-ND-1000 (Wilmington, DE). For RNA expression, quantitative real-time PCR (qPCR) was performed with cDNA generated from 1 μg total RNA with a Superscript III reverse transcriptase kit (Roche) using either random hexamers, oligo d(T)16 or gene- specific primers. Primers for elf were designed for qPCR using Primer Express software (Applied Biosystems, Foster City, CA), and the sequences are available upon request. qPCRs were carried out using SYBR green PCR master mix (Applied Biosystems). All other qPCRs were carried out with commercially available TaqMan gene expression assay utilizing TaqMan Universal PCR mix. The PCR reactions were carried out in an ABI Prism 7900HT sequence detection system (Applied Biosystems) according to the manufacturer's conditions. Relative values were quantified by generating a standard curve by cDNAs generated from control treated samples and normalization was done by GAPDH or 28S RNA expression. For miRNA expression analysis, quantitative real-time PCR (qPCR) was performed with cDNA generated from 10ng purified miRNA with a reverse transcriptase kit (TaqMan) using miRNA specific primers (TaqMan). The procedure was performed by using TaqMan MicroRNA Assay kit. qPCR was performed by TaqMan Universal PCR mix with no AmpErase (TaqMan). Reactions were carried out as described above for RNA. Values were normalized with has-miR374 microRNA expression.
Microarray Analysis of RNA and microRNA. Custom designed 44K human 60-mer oligo microarrays (Agilent Technologies, CA) were used for the array experiments. Total RNA was isolated as described above. cDNA synthesis from total RNA and fluorescent cRNA synthesis from the cDNA were prepared utilizing Low RNA Input Linear Amp kit (Agilent Technologies, CA). The microarray slides were hybridized with the fluorescent cRNA, and scanned according to the manufacturer's protocol (Agilent Technologies, CA). The microarray data was analyzed by Feature Extraction and GeneSpring (Agilent Technologies, CA).
For miRNA arrays, isolation was performed as described above and some miRNA arrays were outsourced to Exiqon (Vedbaek Denmark), where miRCURY™ LNA microarray piatform was used for analysis.
Confocal laser-scanning immunofluorescence microscopy. Co-localization studies were performed with anti-ELF and anti-V5, and anti-Smad3 utilizing indicated BWS cell lines or MEFs. Monoclonal mouse and rabbit polyclonal primary antibodies were visualized with Tetramethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-rabbit immunoglobulin G or Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G. The samples were analyzed with a Bio-Rad MRC-600 confocal microscope (Bio-Rad, Cambridge, MA), with an ILT model 5470K laser (Ion Laser Technology, Salt Lake City, UT) as the source for the krypton-argon ion laser beam. FITC-stained samples were imaged by excitation at 488 nm and with a 505 to 540 bandpass emission filter, and Rhodamine-stained samples were imaged by excitation at 568 nm with a 598- to 621 bandpass emission filter using a 63x (numerical aperture 1.3) objective. Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.
Figure imgf000072_0001
Table 2: Classification of Tumors in elf* Mice
Pathology Site
Hepatocellular Carcinoma Liver
Adenocarcinoma (1) Lymphoma (3) Small Bowel
Sarcoma Abdominal
Clear Cell Carcinoma Kidney
Lymphoma Spleen
Adenoma Breast
Adenocarcinoma Lung
Sarcoma Mesenchymal
Carcinoma Testis
Epithelial Tumor Ovary
Table 3 : Classification of Tumors in elf+//Sma.d3+/ Mice Pathology Site
Hepatocellular Carcinoma Liver
Adenocarcinoma (1) Lymphoma (3) Small Bowel
Adenocarcinoma (Metastatic) Pancreas
Sarcoma Abdominal
Clear Cell Carcinoma Kidney
Lymphoma Spleen
Adenoma Breast
Adenocarcinoma Lung
Sarcoma Mediastinal
Squamous Cell Carcinoma Head & Neck
Thymoma Thymus
Carcinoma Adrenal
Squamous Cell Carcinoma Skin
Adenocarcinoma Lacrimal Gland
Glioma Optic Nerve
Carcinoma Testis
Epithelial Tumor Ovary
References
1. J. Massague, S. W. Blain, R. S. Lo, CeH 103, 295 (Oct 13, 2000).
2. L. Mishra, R. Derynck, B. Mishra, Science 310, 68 (Oct 7, 2005).
3. K. L. Neufeld et a!., Proc Nat! Acad Sci U S A 97, 12085 (Oct 24, 2000). 4. J. B. Beckwith, E. V. Perrin, Am J Pathol 43, 1089 (Dec, 1963).
5. H. R. Wiedemann, J Genet Hum 13, 223 (Sep, 1964).
6. M. J. Thorburn, E. S. Wright, C. G. Miller, E. H. Smith-Read, Am J Dis Child 119, 316 (Apr, 1970).
7. M. J. Pettenati et a!., Hum Genet 74, 143 (Oct, 1986). 8. J. Halliday, K. Oke, S. Breheny, E. Algar, J. A. D, Am J Hum Genet 75, 526 (Sep, 2004).
9. C. Allen, W. Reardon, Bjog 112, 1589 (Dec, 2005).
10. T. Enklaar, B. U. Zabel, D. Prawitt, Expert Rev Mo! Med 8, 1 (2006).
11. F. L. Sun, W. L. Dean, G. Kelsey, N. D. Allen, W. Reik, Nature 389, 809 (Oct 23, 1997).
12. A. Murrell et a!., Hum Mo! Genet 13, 247 (Jan 15, 2004).
13. Y. Tang et a!., Cancer Res 65, 4228 (May 15, 2005).
14. V. Katuri et a!., Oncogene 24, 8012 (Dec 1 , 2005).
15. Y. Tang et a!., Science 299, 574 (Jan 24, 2003). 16. H. Schneid et a!., Med Pediatr Onco! 28, 411 (Jun, 1997).
17. K. Kitisin et a!., Oncogene 26, 7103 (Nov 1 , 2007).
18. Y. Tang et a!., Proc Nat! Acad Sci U S A 105, 2445 (Feb 19, 2008).
19. V. Katuri et a!., Oncogene 25, 1871 (Mar 23, 2006).
20. D. Betel, M. Wilson, A. Gabow, D. S. Marks, C. Sander, Nucleic Acids Res 36, D149 (Jan, 2008).
21. B. John et a!., PLoS Bio! 2, e363 (Nov, 2004).
22. S. Markowitz et a!., Science 268, 1336 (Jun 2, 1995).
23. A. Roberts, L. Mishra, Onco gene 24, 5667. (2005).
24. N. A. Bhowmick et a!., Science 303, 848 (Feb 6, 2004). 25. T. Reya, S. J. Morrison, M. F. Clarke, I. L. Weissman, Nature 414, 105 (Nov 1 , 2001 ).
26. M. S. Wicha, S. Liu, G. Dontu, Cancer Res 66, 1883 (Feb 15, 2006).
27. R. Weksberg et a!., Hum Mo! Genet 10, 2989 (Dec 15, 2001 ).
28. P. A. Jones, S. B. Baylin, Nat Rev Genet 3, 415 (Jun, 2002). 29. R. Derynck, Y. E. Zhang, Nature 425, 577 (Oct 9, 2003).
30. M. B. Sporn, Microbes Infect 1 , 1251 (Dec, 1999).
31. E. V. Makeyev, T. Maniatis, Science 319, 1789 (Mar 28, 2008).
32. R. Weksberg, C. Shuman, A. C. Smith, Am J Med Genet C Semin Med Genet 137, 12 (Aug 15, 2005). 33. F. Radtke, H. Clevers, Science 307, 1904 (Mar 25, 2005).
34. R. M. Hughes-Benzie et a!., Am J Med Genet 66, 227 (Dec 11 , 1996). 35.T. M. Neri et a!., Hum Mutat Suppl 1 , S106 (1998). EXAMPLE 4
Supplemental Materials: Experimental procedures: Construction of the targeting vector and generation of mice carrying mutations. Targeting Vector. Recombinant phage containing genomic DNA of the itih4 locus was isolated from a 129/SvEv mouse library by using PK7R, a piece of itih4 cDNA, as a probe. The finished construct, p-itih4Neo, is shown in Fig. 3C. This targeting strategy deletes a 1.8 kb Sma \-Cla I fragment that contains the 2nd and 3rd exons of the itih4 gene. Homologous Recombination in ES Cells and Generation of Germline Chimeras: TC1 ES cells were transfected with Not I digested p-itih4Neo, and selected with G418 and FIAU. ES cell clones that were resistant to both G418 and FIAU were selected and analyzed by Southern blotting for homologous recombination events within the itih4 locus (Fig. 3D). Details are in the supplemental data. ES cells heterozygous for the targeted mutation were microinjected into C57BL/6 blastocysts to obtain germline transmission. The injected blastocysts were implanted into the uteri of pseudopregnant Swiss Webster (Taconic, NY) foster mothers and allowed to develop to term. Male chimeras (identified by the presence of agouti coat color) were crossed with C57B6 and NIH Black Swiss females (Taconic, NY). Germline transmission was confirmed by agouti coat color in the F1 animals, and all agouti offspring were tested for the presence of the mutated itih4 allele by Southern blot analysis using the same conditions for the detection of the homologous recombination event in the ES cells. Genotype analysis. Genotypes were determined by Southern blotting or PCR. For PCR analysis, the wild-type itih4 allele was detected using primer 1 (5' CTCATACTAGGCAGATCTC 3') and primer 2 (5' GTAGCTCTACTTGGAAGGTC 3'). Primer 1 is located 5' to the deletion and primer 2 is located within the deletion. This primer pair amplifies a fragment of 481 bp from wild-type and itih4 heterozygous, but not from \tih4~'' mutant mice. DNA was also amplified using primer 1 and primer 3, which is located in the Neo locus (5' CAGCTCATTCCTCCCACTCATGAT 3') to detect the mutant itih4 allele. In this case, a 620 bp fragment was detected in mice heterozygous or homozygous for the mutant itih4 allele, while no signal was detected in wild-type mice. Confocal laser-scanning immunofluorescence microscopy. Colocalization studies were performed with anti-ELF and anti-Stat3, and anti-0ct4 utilizing human regenerating liver and HCC tissues. Normal wild-type, e\f'~, itih4'A, and e\f /itih4'/' mutant livers and HCC tissues were also used for the confocal microscopy. Peptide specific monoclonal mouse and rabbit polyclonal primary antibodies were visualized with Tetramethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-rabbit immunoglobulin G or Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G. The samples were analyzed with a Bio-Rad MRC-600 confocal microscope (Bio-Rad, Cambridge, MA), with an ILT model 5470K laser (Ion Laser Technology, Salt Lake City, UT) as the source for the crypton-argon ion laser beam. FITC-stained samples were visualized by excitation at 488 nm and with a 505 to 540 bandpass emission filter, and Rhodamine-stained samples were visualized by excitation at 568 nm with a 598- to 621 bandpass emission filter using a 6Ox (numerical aperture 1.3) objective and 2Ox objective. Digital images were analyzed using Metamorph (Universal Imaging) and figures were prepared using Adobe Photoshop.
Generation of mouse embryo-derived fibroblasts. Mouse embryo-derived fibroblasts (MEFs) harboring the null allele elf and itih4 as well as wild-type were derived as previously described (9). Briefly, embryos E14.5 were triturated in 0.25% trypsin/1 mM EDTA and genotyped. The lines were propogated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 50 μg/ml streptomycin to establish fibroblasts that were cultured over several passages to obtain enough cells to perform the experiments. The fibroblasts used for the experiments were at passage 3-5. Wild-type and \tih4~'~ fibroblast lines were used in experiments, and the results obtained were also independent of passage number. Representative data are shown. lmmunoblot assay. For assaying endogenous TBRII, ELF, ITIH4, IL-6, Stat3, pStat3, protein lysates of human HCC cells (SNU-182 (CRL-2235), SNU-398 (CRL- 2233), and SNU-449 (CRL-2234) ATCC, VA), MEFs, and normal wild-type, elfA, itih4'/', and elf/~/itih4~/~ mutant liver and HCC tissues were immunoblotted with the indicated anti-peptide or anti-phospho-specific antibodies (Santa Cruz Biotechnology, CA; Invitrogen, CA, and Abeam, MA). The loading control was performed under the same conditions using mouse monoclonal anti-Actin (Sigma, MO). MEFs cultured in the presence or absence of IL-6 (5 ng/ml, Sigma, MO) for 24 hrs were washed with PBS and lysed (150 mM NaCI, 5OmM Tris, 1 % NP40, and complete mini protease inhibitors (Roche Molecular Biochemicals)). 50-100 μg of total protein in 1X Lamaelli buffer was heated to 95 degrees for 10 minutes and then loaded onto a PAGE GEL for Western blotting. Histological analysis and antibody staining. Mice exhibiting overt pathological signs were sacrificed and underwent autopsy. Liver and HCC tissues were dissected, fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 μm. Sections were stained with hematoxylin and eosin (H&E), or subjected to immunohistochemical analysis with antibodies, lmmunohistochemical staining was performed with primary antibodies against ELF, Oct4, ITIH4, Stat3, pStat3, pHistone H3 (Ser10), and Caspase-3 (Santa Cruz Biotechnology, CA; Invitrogen, CA, Promega, OR, and Abeam, MA). Sections were then incubated with peroxidase-conjugated secondary antibodies (Jackson lmmunoresearch Laboratories, PA) of appropriate specificity and processed for immunostain using diaminobenzidine (Sigma, MO) and counterstaining was performed with modified Harris hematoxylin solution (Sigma, MO).
Detection of proliferating cells. Proliferating cells were labeled with BrdU labeling and detection kit (Invitrogen, CA). BrdU (1 ml/100 g body weight) was injected (i.v.) into 18.5 dpc pregnant mice, and 4 hrs later the fetal stomachs were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned at 6 μm. The proliferating cell was also identified by anti-pHistone H3 (Ser10) mitotic marker labeling. Detection of Apoptotic Cells. Apoptotic cells were detected by the TUNEL method with a MEB STAIN Apoptosis Kit Direct (MBL, 8445) as well as with anti-Caspase-3 antibody (Promega, OR). Tissues were then fixed and analyzed by using immunofluorescence microscopy.
Tumor cells and tissues. E\f'~ mice were intercrossed with itih4'Λ mice to obtain elf'Vitih^'mice. Liver and HCC tissues were collected and cultured as previously described (36). Two different e\f'~ HCC cancer cell lines were tested in different experiments, and the results obtained were also independent of passage number. Representative data are shown. The diagnosis of paraffin mounted tissue biopsies from human HCC and normal liver were microscopically confirmed by pathologists and an indirect immunoperoxidase procedure was used for immunohistochemical localization of Oct4, TBRII and ELF protein as described above. Microarray. Custom designed 44K human 60-mer oligo microarrays (Agilent Technologies, CA) were used for the array experiments. Total RNA was extracted from mouse liver and HCC tissues and MEFs utilizing RNeasy kit (Qiagen, CA). We used Agilent 2100 Bioanalyzer with a RNA 6000 Nano Chip kit for routine RNA qualification. cDNA synthesis from total RNA and fluorescent cRNA synthesis from the cDNA were prepared utilizing Low RNA Input Linear Amp kit (Agilent Technologies, CA). The microarray slides were hybridized with the fluorescent cRNA, and scanned according to the manufacturer's protocol (Agilent Technologies, CA). The microarray data was analyzed by Feature Extraction and GeneSpring (Agilent Technologies, CA).
EXAMPLE 5
B-SPECTRIN ELF MEDIATED TGF-B SIGNALING MODULATES CDK5 ACTIVITY AND PREVENTS P25 ACCUMULATION IN MURINE FRONTAL CORTEX
CDK5 disruption has been implicated in neurodegeneration, including the development of Alzheimers disease by its association in generation of the hyperphosphorylated tau which is the main component of one of the pathological hallmarks of AD; neurofibrillary tangles. Disruption of the transforming growth factor- β pathway may contribute to this CDK5 deregulation and subsequent production of p25 and hyperphosphorylated p-Tau..To test this hypothesis, we developed several transgenic mice, including those heterozygous for the TGF-β adaptor protein ELF (elf1') , the co-mediator Smad4 (Smad4+I~), as well as elf'SmadA*1' and harvested the frontal cortex and hippocampus for analysis after 12 months, lmmunoblot analysis revealed an excess production of p25, as well as upregulated CDK5 and CDK1 expression, and immunohistochemical detection revealed hyperphosphorylated Tau, overexpressed CDK4, cyclin A and PCNA. Moreover, the kinase activity of CDK5 in elf 'and elf'~Smad4+'~ I- frontal cortex was robustly inhibited using the CDK inhibitor roscovitine. This study elucidates the importance of intracellular-Smad signaling in the modulation of CDK5 activity, and provides a useful model to study neurodegeneration. INTRODUCTION
Alzheimer's disease, one of the tauopathies, is a progressive neurodegenerative disorder characterized by loss of cognitive function. Studies showed that an estimated 1 to 5 million people in the United States have Alzheimer disease and 26.6 million people worldwide were afflicted by Alzheimer's in 2006 (Brookmeyer et al.,2007; Gao et al., 1998). With around 360,000 new cases diagnosed each year in accordance with the growing of aged population, this number may quadruple by 2050, It is clear that this tremendous public health problem is becoming worse. However, apart from availability of a small symptomatic benefit, no effective treatments to delay or halt the progression of the disease are available yet due to our limited understanding of the cause and effect relationships that underlie the neuronal loss that is central to Alzheimer's pathology. But not until the last two decades, we have found out the CDK5 which dysregulation can lead to neuronal demise and implicate a causal element in the neuronal loss of Alzheimer's disease..
CDK5 is a unique member of Cyclin-dependent kinases (Cdks) family. Unlike other Cdks, Cdk5 is activated through complex formation with one of several non- cyclin proteins: p35 and p39 (Tsai et al.,1994; Tang et al.,1995), or their proteolytic cleavage products p25 and p29 (patrick et al.,1999; Patzke et al.,2002), respectively. While several Cdks have prominent roles in cell division, Cdk5 is highly expressed and active in post-mitotic neurons (Tsai et al.,1993;) and plays an essential role in the proper development of the CNS (Dhavan and Tsai, 2001 ). Together with its activator, p35, CDK5 is responsible for neuronal migration and development (Hou et al., 2007). Specifically, CDK5 is able to facilitate neuronal survival by inactivating the JNK3 kinase whose activation normally drives apoptosis (Li et al., 2002). However, CDK5 has been studied with much interest in recent years due to its association with neurodegenerative diseases like Alzheimers disease, a process which involves faulty apoptosis of neurons (Cheung and Slack, 2004).
There are several consequences of faulty CDK5 regulation. For example, the activating protein for CDK5, p35, may be incorrectly truncated. P35 is the subunit normally required for activation as well as promotion of CDK5 microtubule assembly and microtubule bundle formation (Hou et al., 2007). Yet in contrast, calpain- mediated cleavage of p35 has been demonstrated to produce the truncated version of this protein, p25, its characteristic differing substantial from the p35 counterpart. In fact, p25 causes prolonged activation and mislocalization of CDK5 and has been demonstrated to be neurotoxic (Kim et al., 2007; Weishaupt, Neusch, Bahr, 2003). Moreover, the half-life of p25 is substantially longer than p35, the latter of which has been shown to be highly unstable. The resulting excessive and mislocalized Cdk5 activity gives rise to neurodegeneration via programmed cell death signals (Kim et al., 2007; Weishaupt, Neusch, Bahr, 2003).
Another consequence of faulty CDK5 activation is hyperphosphorylation of tau (Sengupta et al., 2006). Tau occurs predominantly in neuronal axons, where it binds to microtubules and regulates their length and dynamics; which is the most well-recognized function of tau. Tight regulation of microtubule activity is critical to cell viability, and so as fine regulation of tau (Bunker et al., 2004). Tau activity is modulated by phosphorylation, and the ability of tau to bind to and stabilize microtubules correlates inversely with its degree of phosphorylation. Hyperphosphorylation of tau occurs when CDK5 is faulty activated, in conjunction with the enzyme glycogen synthase kinase-3 (Yamaguchi et al., 1996; Pei et al., 1997; Pei et al., 1998; Pei et al, 1999). Studies showed that, only these two kinases will phosphorylate tau in a cellular environment (Yamaguchi et al.,1996; Wagner et al.,1996 ; Michel at el., 1998 ). We chose to focus on cdkδ because it is active predominantly in neurons whereas GSK3β plays a role in energy metabolism and is active in all cells. This disordered phosphorylation of tau by CDK5 disrupts the normal colocalization of tau with microtubules, leading to further phosphorylation at fibrillogenic sites and/or cleavage by caspases. This process increases the probability of tau-tau interactions leading to the formation of paired helical filaments (PHF), highly ordered filamentous structures that accumulate within neurons and contribute to the formation of neurofibrillary tangles (Hisanaga and Saito, 2003; Cruz et al., 2003; Noble et al., 2003; Stoothoff et al., 2005), which is the pathological hallmark of Alzheimer's disease.
Due to the neurotoxic effect of highly expressed p25 in relation to aberrant CDK5 activation, we tested this hypothesis using various strains of heterozygously mutated mice to determine the contribution of ELF and Smad4 proteins, members of TGF- β signaling pathway importance in inhibition of proliferation in the nervous system (Constam et al., 1994), in stabilizing CDK5.
Briefly, the pleiotropic cytokine TGF-β binds to the type Il receptor which in turn associates with the type I receptor and activates it (Massague, 1998). Subsequently, the type I receptor phosporylates intracellular signaling proteins called receptor-Smads (r-Smads), which ultimately drive the TGF-β signal internally to the nucleus. This process is facilitated greatly by adaptor proteins including the β- spectrin ELF. ELF, as a spectrin, displays the characteristic properties of support in membrane integrity, stabilization of cell-cell interactions, axonal grow, in addition to its ability to modulate TGF-β downstream target activation with ligands Smad3 and Smad4.
Already, investigations implicating CDK5/p25 accumulation in a region specific manner have been performed for Alzheimer's patients, with significantly more p25 activity being detected in the frontal cortex of Alzheimer's patients compared to normal frontal cortex (Tseng HC, Zhou Y, Shen Y, Tsai LH, 2002).
Transgenic mice have proven an effective tool to elucidate the mechanisms of neurodegeneration. To date, CDK5"7" mice demonstrate several neurological defects and are in most cases lethal by birth with several disrupted brain structures including cerebral cortex, hippocampus, and olfactory bulb (Oshima et al., 1996; Gilmore et al., 1998; Oshima et al., 1999). Moreover, p35"A mice are comparatively more normal, and exhibit a greater predisposition to seizures with only marginal distortions to the hippocampus (Dhavan and Tsai, 2001 ). We have demonstrated that elf1' mice, which are embryonic lethal at E11.5, have a disrupted neuronal differentiation pattern, increased CDK4 level, and significantly altered mdm2, p21 , and pRb expression pattern than did wildtype mice (Golestaneha et al,2006).
Our aim in this current investigation is to better elucidate the effects of elf', Smad4+I', and elf'/Smad4+/' mice in terms of modulating CDK5/p35 or p25 activity. Here, we demonstrate the change in cell proliferation and expression pattern of proteins involved in cell cycle regulation, such as CDK4, PCNA, p-Tau and cyclin A in elf/Smad4+/~ mice and increase activity of CDK5, CDK1 , p35 and p25 in elf' and elf/Smad4+/' mice. Therefore, with disrupted CDK5 expression coupled to accumulated p25 expression as a key expression pattern in Alzheimers, elf' and elf/Smad4+/' may prove to be a prudent model to study the progression and reversibility of Alzheimer's disease.
RESULTS
EIf*'' and E If17VS mad4+Λ mice frontal cortex showing increase expression of CDK1 ,CDK5, p35 and p25
Frontal cortex was collected from wild-type, elf, and Smad4 mutant mice, and was subsequently immunoblotted. CDK1 , CDK5, CDK6, p35, and p25 were all assessed using this method, and α-tubulin was used as a loading control (Figure 1 , A and B). CDK5 expression was increase about 25% in elf frontal cortex and and about
30% overexpress in elf/Smad4*/' frontal cortex compared to wild-type and Smad4+/' frontal cortex lysates which were only weakly present. CDK6 expression was equally expressed in wild-type, elf, Smad4+/~, elf/Smad4+/~ frontal cortex lysates. CDK1 expression was most intense in e\f'~ and elf/'/Smad4+/~ frontal cortex lysates and was moderately expressed in Smad4+/~ and wild-type frontal cortex lysates. p35,and p25 expression were also monitored by Western blot analysis and e\f'~ and elf/'/Smad4+/' frontal cortices were found to about 30% overexpress these proteins compared with wild-type and about 20-25% overexpress compared with Smad4+/' frontal cortices.
Inhibition of CDK5 phosphorylation activity with Riscovitine,a eye I independent kinase inhibitor (Figure 4 and 5) Hippocampus
Treatment with 50μM roscovitine decreased the phosphorylation density of CDK5 in the wildtype hippocampus by 27.3%, compared with a decrease after treatment in the Smad4+I~ hippocampus by 12.5% and a robust reduction of 51.5% in elf' hippocampus. Histone was used as a loading control for this experiment.
Frontal Cortex
Treatment with roscovitine decreased the phosphorylation density of CDK5 by 24.2% in the wildtype frontal cortex, compared with a decrease after treatment of 56.7% in Smad4+'~ frontal cortex and 52.6% in elf1' frontal cortex.
PCNA, p-Tau, CDK4 and cyclin A expression markedly increase in elf /Smad4+/'m\ce brain sections lmmunohistochemical localization of PCNA, a marker of cell proliferation, was found to be virtually absent in wild-type forebrain (Figures 30-34) while anti-PCNA labeling reveals nuclear localization in e/fl'/7S/τjad4+Amice(Figure 2.C and D; arrows). Phosphorylated Tau (p-Tau) was not expressed in the wild-type brain (Figure 2, E and F)) but prominent localization was observed in elf'/Smad4+/'m\ce (Figure 2, G and H; arrows).
CDK4 is a marker of cell proliferation and is involved in progression through the G1/S checkpoint. Paraffin sections stained with anti-CDK4 showed virtually no nuclear localization in the wildtype forebrain (Figure 3,A), while elf/7Smad4+/~m\ce showed elevated CDK4 expression (Figure 3,B; arrows). Cell proliferation was further characterized using anti-cyclin A, which followed the same trend as CDK4 labeling, with no nuclear staining in the wildtype (Figure 3,C) and overexpression observed in the elf'VSmad^'mouse (Figure 3, D; arrows).
DISCUSSION The transforming growth factor-beta(TGF- β) pathway with its adaptor proteins play a critical role in diverse cellular functions by act as a negative growth regulator, including inhibition of proliferation in the nervous system (Constam et al., 1994). Embryonic liver fodrin (elf) is a β-spectrin protein and regulate signal transduction by functioning as an adaptor molecule. Our earlier studies have demonstrated that elf deletion can results in mislocalization of Smad3 and Smad4 and loss of TGF- β signaling which can lead to deregulated cell growth (Redman et al., 2005; Tang et al., 2003).
Meanwhile, CDK5 is an essential member of brain development (Dhavan and Tsai, 2001 ). As such, we decided to understand how CDK5 activity could be modulated by disrupting different members of the transforming growth factor-beta (TGF-β) pathway. In our study, we are tempted to presume that elf by its ability to propagate TGF-β signaling, possibly modulates CDK5 activity and prevents p25 accumulation in neuronal cells.
p25 activity of elf+/- and elf+/-/Smad4+/- expression in the frontal cortex (Figure 1,A and B)
Interestingly, p25 expression was highest in the frontal cortex of both elf17" and elf7" /Smad4+/~, but not highly expressed in Smad4+/" frontal cortex. Smad4~'~ mice were previously shown to be embryonic lethal by day 7 (Yang et al., 1998; Angley et al., 2003) indicating the essential nature of this molecule in development, yet it is possible that there are compensatory mechanisms in play for the heterozygously null Smad4+/\
The role of ELF thus far has been shown to be a substrate for various r- Smads (including Smad3 and Smad4) and to subsequently translocate to the nucleus with these ligands to activate target gene expression, ultimately having the potential to modulate the activity of CDK5. Unlike Smad4+/~ mice, which exhibited no p25 expression, mice that were heterzygously null (elf7") produced a frontal cortex that highly expresses the neurotoxic p25. This results indicates that perhaps another ligand (e.g. Smad3) becomes mislocalized as a result of disrupted ELF expression, and so TGF-β mediated control of CDK5 is lost. elf*'" /Smad4+/~ mice (Figure 2, G and H; arrows), in addition to strongly expressing p25, are shown to express p-Tau strongly in the frontal cortex using immunohistochemical localization. Hyperphosphorylated tau protein is a typical finding in the case of Alzheimer's disease, a process which is derived by glycogene synthase kinase-3β (Goedert et al., 1999; Hasegawa et al., 1992; Watanabe et al., 1993). However, the activities of this kinase are dependent upon either CDK5 or MAP Kinase to become activated (Ishiguro et al., 1993; Goedert et al, 1994). Therefore excessive p-Tau may be a functional marker for unregulated CDK5 activity which was rooted in disrupted TGF-β control. The expression of p-Tau from elf1"7" /Smad4+/" implies a regulatory role of CDK5 activity, whether directly or indirectly.
The frontal cortex was a region susceptible to inhibition by roscovitine in elf*7' and Smad4+Λ mice (Figure 4 and 5)
Treatment with roscovitine was highly effective in decreasing the activity of CDK5 in both elf17" and Smad4+/" frontal cortex. This result is interesting in light of the fact that p25 expression in Smad4+/~ frontal cortex was virtually absent. Moreover, elf mislocalization, but not Smad4, seems to contribute to the transformation of p35 to p25 in this system, where only elf and not Smad4 seemingly act in a neuroprotective fashion.
Disrupted ELF is more succesptible to CDK5 inhibition with roscovitine than is Smad4 in the hippocampus (Figure 4 and 5)
The results of the kinase assay in the hippocampus were also of note, with Smad4+/" CDK5 phosphorylation density after treatment with roscovitine descreasing about half as much as was observed in the wild-type mouse. This result is not surprising, because it had previously been reported that, despite the high expression of Smad4 in the normal hippocampus, conditional deletion of this gene did not interfere with hippocampal development (Zhou et al., 2003). Alternatively, with elf1"7" hippocampus, CDK5 phosporylation was inhibited by greater than 50% compared with wild-type, indicating that the functioning of elf does modulate the activities of CDK5, at least indirectly, though its synergistic functional ability to inhibit CDK5 phosphorylation in the presence of roscovitine.
Elevated of expression of CDK1 and CDK4 indicate a highly proliferative state in elf+/7Smad4+/" and elf*'" mice
CDK1 and CDK4, together with their activating cyclins (A or B1 , D1 , respectively) are essential for progression to mitosis (Nigg, 2001 ). We have demonstrated that in elf*7" and elf+/-Smad4+/- frontal cortex, expression of CDK1 is elevated(Figure 1 , A and B). Moreover, using immunohistochemistry, CDK4 expression was upregulated in elf+/7Smad4+/" (Figure 3, B; arrows) compared to wild- type (Figure 3, A), which displayed virtually no expression of this protein. Thus, in addition to disrupting TGF-β mediated control of CDK5, there appears to be a general inability to control CDK1 and CDK4 as well. This observation was confirmed with PCNA, a marker for proliferation that illustrates a population of cells (Figure 2, A-D; arrows) who are actively proliferating. Cyclin A immunohistochemical labeling confirms this finding (Figure 3, C and D; arrows).
Conclusion
Our study has demonstrated elevated levels of CDK5, p53 and p25 in elf7" /Smad4+/" and elf17" mice brain that indicate there is a reciprocal relation between
CDK5, a major factor in Neurodegeneration, and TGF-β signaling pathway especially the critical role of elf in neuroprotective function. Though further studies are needed to explore the significance of this elf mediated TGF-β signaling pathway in progression and reversibility of tauopathies like Alzheimer's disease by modulation CDK5/p25 activity and clinical significance of CDK inhibitor, roscovitine.
1. MATERIALS AND METHODS 5.1. Experimental animals
Animals were housed in 'shoe box1 cages with bedding in a room with controlled temperature and humidity, and had unlimited access to a commercial pelleted diet (Teklad, Rodent Diet 8604, Harlan Teklad, Madison, Wl, USA) and tap water. Pups were weaned at age 21 days. The production and identifications of mice with targeted disruption of elf (elf +/"), Smad4 (Smad4+/~) and the double heterozygous condition (elf^/Smad^') were as previously described (Tang et al., 2003). Mutant mice were maintained on a mixed 129Sv/Black Swiss background. Mice were momitored twice a week to detect any abnormal phenotypic changes. All animal procedures were approved by the Institutional Animal Care and Use Committee of the Washington, DC, Department of Veterans Affairs Medical Center.
5.2. Surgical procedures
Mouse frontal cortex were cleansed and fixed for 14 h in 4.0% formaldehyde
(prepared fresh from paraformaldehyde) in 0.1 M NaH2PO4, pH 7.4, with 2.5% dimethylsulfoxide and 0.001 M CaCI2, and processed and embedded in paraffin
(melting point 56°C). Representative 6μm sections were stained for histologic examination.
5.3.lmmunohistochemical staining An indirect immunoperoxidase procedure was used for immunohistochemical localization of elf protein in developing mouse nervous system. Serial, 8 μm thick sagittal sections of mouse frontal cortex were immersed in xylene to remove paraffin, then dehydrated in graded alcohol, and rinsed in PBS. Endogenous peroxide was quenched using 3% hydrogen peroxide (Sigma -Aldrich, SAINT LOUIS, MO). Non-specific binding sites were blocked using 1 ml PBS containing 5% goat serum and 1 mg/ml BSA. The sections were incubated overnight at 4°C in a humid chamber with a primary antibody targeted against CDK4 (Thermo Fisher Scientific, Fremont, CA, USA), Cyclin A (add company), p-Tau (Pierce Biotechnology, Rockford, IL, USA), and PCNA (add company) diluted in PBS containing 1 mg/ml BSA and 1 % normal serum. All further steps were done at room temperature. Four 5-min rinses with PBS followed each successive step. The sections were then incubated with peroxidase-conjugated goat anti-rabbit or donkey anti-goat secondary antibody (Jackson lmmunoresearch Laboratories, West Grove, PA, USA) that was diluted in PBS containing 1% normal serum for 30 min at room temperature. After rinses, 200-500 μl of the insoluble peroxidase substrate DAB (Sigma -Aldrich, SAINT LOUIS, MO) was added to cover the entire tissue on the slide, and color development was monitored under the microscope. After rinsing in distilled water for 2 min, counterstaining was performed with modified Harris hematoxylin (Sigma-AIdrich, SAINT LOUIS, MO) for 1 min followed by a rinse in distilled water for 3 min. Sections were dehydrated by passage through graded alcohol concentrations and finally Xylene. Cover slips were mounted using DPX (Fluka Labs, St. Louis, MO) before observation. PBS-serum only was used for negative controls.
5.4.SDS-PAGE and lmmunoblot Analysis
Total cell lysates (containing 50 μg of total proteins) prepared from the harvested tissues was separated by SDS-PAGE using 4-12% polyacrylamide gradient gels (Novex, San Diego, CA) and transferred to nitrocellulose membranes (Novex). Blots were blocked with a 3% solution of BSA in TBST (Tris-buffered saline containing 0.1 % Tween 20) for 1 h at room temperature. Next, the blots were incubated in buffer containing antisera CDK1 , CDK5, CDK6 (Thermo Fisher Scientific, Fremont, CA, USA), p35, p25, and α-tubulin respectively for 2h at room temperature. After washing, the blots were incubated in buffer containing the appropriate horseradish peroxidase-conjugated secondary antibodies (Jackson lmmunoresearch laboratories, USA) at a dilution of 1 :10,000 [E5] or 1 h at room temperature. The blots were then developed using an ECL-Plus chemiluminescence kit (Amersham Biosciences, Piscataway, NJ) and exposed to x-ray films. The x-ray films were subsequently scanned (ScanJet 6100C; Hewlett-Packard, Palo Alto, CA).
5.5. Kinase Assay and treatment
The kinase assay was performed using standard methods. Roscovitine (2-(1-Ethyl-2- hydroxyethylamino)-6-benzylarnino-9-isopropylpurine) is a reversible inhibitor of CDK5 as well as CDK2 and CDK7 (Ljungman and Paulsen, 2001 ). The kinase assay was performed using roscovitine as a treatment using a concentration of 50μM.
REFERENCES
All of the following citations are incorporated herein by reference: Cheung, E. C. and Slack, R. S. (2004). Emerging role for ERK as a key regulator of neuronal apoptosis. Sci. STKE 2004, PE45 Constam DB, Schmid P, Aguzzi A, Schachner M, Fontana A. Transient production of TGF- beta 2 by postnatal cerebellar neurons and its effect on neuroblast proliferation, 1994.
Cruz JC, Tseng HC, Goldman JA, Shih H, Tsai LH. Aberrant Cdk5 Activation by p25 Triggers Pathological Events Leading to Neurodegeneration and Neurofibrillary Tangles. Neuron, 40, 3 (2003) 471-483. Dhavan, R. Tsai LH. A Decade of CDK5. 2001 Nature Reviews Molecular Cell Biology 2,
10, 749-759 (2001 ).
Gilmore EC1 Ohshima T, Goffinet AM, Kulkami AB, and Karl Herrup. Cyclin-Dependent 5 Kinase 5-Deficient Mice Demonstrate Novel Developmental Arrest in Cerebral
Cortex. The Journal of Neuroscience, 1998.
Goedert, M. et al. Biochem. J. 301 , 871-877
Hasegawa, M. et al. J. Biol. Chem. 267, 17047-17054 (1992)
Hisanaga S1 Saito T. The regulation of cyclin-dependent kinase 5 activity through the n metabolism of p35 or p39 Cdk5 activator. Neurosignals, 2003.
Hou Z, Li Q, He L, Lim H, Fu X , Cheung NS, Qi DX, and Qi RZ. Microtubule Association of the Neuronal p35 Activator of Cdk5. J. Biol. Chem., (2007) 282, 26, 18666-18670.
Ishiguro, K. et al. FEBS Lett. 325, 167-172 (1993).
Kim HS , Lee JH1 Lee SJ, Kim KT. Stabilization and activation of p53 induced by Cdk5
15 contributes to neuronal cell death. Journal of Cell Science 120, 2259-2271 (2007).
Li, B. S., Zhang, L., Takahashi, S., Ma1 W., Jaffe, H., Kulkami, A. B., Pant, H. C. (2002).
Cyclin-dependent kinase 5 prevents neuronal apoptosis by negative regulation of c-
Jun N-terminal kinase 3. EMBO J 21 , 324-333. Massague J. TGF-β SIGNAL TRANSDUCTION. Annual Review of Biochemistry. Vol. 67:
20 753-791 , 1998.
Nigg EA1 Mitotic kinases as regulators of cell division and its checkpoints, Nat. Rev. MoI.
Cell Biol. 2 (2001 ), pp. 21-32. Noble W1 Olm V1 Takata K, Casey E, Mary O, Meyerson J, Gaynor K, LaFrancois J, Wang
L, Kondo T, Davies P1 Burns M1 Veeranna , Nixon R, Dickson D1 Matsuoka Y1 ? £- Ahlijanian M, Lau LF, Duff K. Cdk5 Is a Key Factor in Tau Aggregation and Tangle
Formation In Vivo. Neuron. Volume 38, Issue 4, 22 May 2003, 555-565.
J.J. Pei, T. Tanaka, Y.C. Tung, E. Braak, K. Iqbal and I. Grundke-lqbal, Distribution, levels, and activity of glycogen synthase kinase-3 in the Alzheimer disease brain, J. Neuropathol. Exp. Neurol. 56 (1997), 70-78.
30 JJ. Pei, I. Grundke-lqbal, K. Iqbal, N. Bogdanovic, B. Winblad and R.F. Cowburn, Accumulation of cyclin-dependent kinase 5 (cdkδ) in neurons with early stages of Alzheimer's disease neurofibrillary degeneration, Brain Res. 797 (1998), pp. 267-
277. J.J. Pei, E. Braak, H. Braak, I. Grundke-lqbal, K. Iqbal, B. Winblad and R.F. Cowburn,
Distribution of active glycogen synthase kinase 3beta (GSK-3beta) in brains staged for Alzheimer disease neurofibrillary changes, J. Neuropathol. Exp. Neurol. 58
(1999), pp. 1010-1019. Sengupta A, Novak M, Grundke-lqbal I, and Iqbal K. Regulation of phosphorylation of tau by cyclin-dependent kinase 5 and glycogen synthase kinase-3 at substrate level,
Nature, Volume 580, Issue 25, 30 October 2006, 5925-5933. Tseng HC, Zhou Y, Shen Y, Tsai LH. A survey of Cdk5 activator p35 and p25 levels in
Alzheimer's disease brains. Volume 523, Issues 1-3, 17 July 2002, 58-62.
H. Yamaguchi, K. Ishiguro, T. Uchida, A. Takashima, CA. Lemere and K. Imahori, Preferential labeling of Alzheimer neurofibrillary tangles with antisera for tau protein kinase (TPK) l/glycogen synthase kinase-3 beta and cyclin-dependent kinase 5, a component of TPK II, Acta Neuropathol. (Berl). 92 (1996), 232-241.
Watanabe, A. et al. J. Biol. Chem. 268, 25712-25717 (1993)
Weishaupt JH, Neusch C, Bahr M. Cyclin-dependent kinase 5 (CDK5) and neuronal cell death. Cell and Tissue Research. 312, 1 , 2003.
Brookmeyer R, Johnson E, Ziegler-Graham K, MH Arrighi (July 2007). "Forecasting the global burden of Alzheimer's disease". Alzheimer's and Dementia 3 (3): 186-91. doi:10.1016/i.ialz.2007.04.381. Retrieved on 2008-06-18.
Nady Golestaneha, Yi Tanga, Varalakshmi Katuria, Wilma Jogunooria, Lopa Mishra, Bibhuti Mishra. Cell cycle deregulation and loss of stem cell phenotype in the subventricular zone of TGF- adaptor elf-/- mouse brain. Brain research 1108(2006)45-53.

Claims

WHAT IS CLAIMED IS:
1. A method of identifying cancer stem cells comprising the steps of administering to a patient suspected of having cancer stem cells an antibody capable of recognizing a peptide from the ELF protein, and determining if said antibodies have bound to said stem cells.
2. The method of Claim 1 wherein the antibody is an antibody recognizing the VA-1 region of the ELF protein.
3. A method of assessing a patients' risk for developing hepatocellular cancer comprising the steps of assaying a biological fluid of a patient to determine the level of a marker selected from the group consisting of ITIH4, CDK4, Stat3, or other marker which promotes IL-6 activation, assessing whether the level of said marker is above the normal level of said marker that would be expected for said patient, and determining if said patient has a level of said marker that is above the normal level of said marker that would be expected for said patient, said higher level of said marker being reflective of a higher risk for developing hepatocellular cancer.
4. A method of preventing or treating hepatocellular cancer comprising the steps of administering to a patient in need thereof an effective amount of an inhibitor of a material selected from the group consisting of ITI H4, CDK4, Stat3, and other materials which promotes IL-6 activation.
5. The method of Claim 4 wherein the inhibiting compound comprises the ELF protein.
6. The method of Claim 4 wherein the inhibiting compound comprises a material which promotes the expression of the ELF protein.
7. A method of assessing a patients' risk for developing a neurodegenerative disorder comprising the steps of assaying a biological fluid of a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and determining if said patient has a level of ELF that is below the normal level of ELF that would be expected for said patient, said lower level of ELF being reflective of a higher risk for developing a neurodegenerative disorder.
8. The method of Claim 7 wherein the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease and ALS.
9. A method of assessing a patients' risk for developing a neurodegenerative disorder comprising the steps of assaying a biological fluid of a patient to determine the level of a marker selected from the group consisting of CDK4, CDK5, and cyclin D1 , assessing whether the level of said marker is above the normal level of said marker that would be expected for said patient, and determining if said patient has a level of said marker that is above the normal level of said marker that would be expected for said patient, said higher level of said marker being reflective of a higher risk for developing a neurodegenerative disorder.
10. The method of Claim 9 wherein the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease and ALS.
11. A method of early diagnosis of Beckwith-Wiedemann Syndrome (BWS) comprising assaying a biological fluid of a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and diagnosing an early risk of BWS when levels of ELF are below the normal level of ELF that would be expected for said patient.
12. A method of preventing or treating Beckwith-Wiedemann Syndrome comprising the steps of administering to a patient in need thereof an effective amount of the ELF protein.
13. The method of Claim 12 further comprising the administration of a Smad protein.
14. The method of Claim 12 wherein the Smad protein is selected from the group consisting of Smad2, Smad3 and Smad4.
15. A method of early diagnosis of a disorder associated with disruption of the
TGF-β pathway comprising administering to a patient an antibody recognizing a methylated ELF protein, and determining whether said antibody has bound to said methylated ELF protein.
16. The method of Claim 15 wherein the antibody is an antibody recognizing the VA-1 region of the ELF protein.
17. A method of assessing a patients' risk for developing a disorder associated with the disruption of the TGF-β pathway comprising the steps of assaying a biological sample from a patient to determine the level of the ELF protein, assessing whether the level of ELF is below the normal level of ELF that would be expected for said patient, and determining if said patient has a level of ELF that is below the normal level of ELF that would be expected for said patient, said lower level of ELF being reflective of a higher risk for developing a disorder associated with the disruption of the TGF-β pathway.
18. A method of preventing P25 accumulation in mammalian frontal cortex comprising administering B-spectrin ELF in an amount effective to modulate CDK5 activity.
PCT/US2008/010035 2007-08-24 2008-08-25 Peptides and proteins for early liver development and anitibodies thereto, and their use in therapeutic diagnosis and treatment WO2009029235A2 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US93566307P 2007-08-24 2007-08-24
US60/935,663 2007-08-24
US98573907P 2007-11-06 2007-11-06
US60/985,739 2007-11-06
US7124508P 2008-04-18 2008-04-18
US61/071,245 2008-04-18

Publications (2)

Publication Number Publication Date
WO2009029235A2 true WO2009029235A2 (en) 2009-03-05
WO2009029235A3 WO2009029235A3 (en) 2009-04-23

Family

ID=40388074

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/010035 WO2009029235A2 (en) 2007-08-24 2008-08-25 Peptides and proteins for early liver development and anitibodies thereto, and their use in therapeutic diagnosis and treatment

Country Status (1)

Country Link
WO (1) WO2009029235A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102628087A (en) * 2012-04-25 2012-08-08 四川大学 Early warning and screening reagent for liver cancer
WO2016059453A1 (en) * 2014-10-16 2016-04-21 Fundacion Fraunhofer Chile Research Biomarkers and therapeutic targets for alzheimer's disease
WO2019014153A1 (en) * 2017-07-10 2019-01-17 Massachusetts Institute Of Technology Methods of modulating protein expression from the mena-ribonucleoprotein complex in cells

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6642362B1 (en) * 1997-04-30 2003-11-04 Lopa Mishra Genes coding proteins for early liver development and their use in diagnosing and treating liver disease
US6960444B2 (en) * 2000-11-28 2005-11-01 Beth Israel Deaconess Medical Center Transcriptional mediators of blood vessel development and endothelial differentiation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6642362B1 (en) * 1997-04-30 2003-11-04 Lopa Mishra Genes coding proteins for early liver development and their use in diagnosing and treating liver disease
US6960444B2 (en) * 2000-11-28 2005-11-01 Beth Israel Deaconess Medical Center Transcriptional mediators of blood vessel development and endothelial differentiation

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BAEK HJ ET AL.: 'Inactivation of TGF-beta signaling in lung cancer results in increased CDK4 activity that can be rescued by ELF.' BIOCHEM BIOPHYS RES COMMUN. vol. 346, no. 4, 11 August 2006, pages 1150 - 7. *
BASSUK AG ET AL.: 'Expression pattern of the Ets-related transcription factor Elf1-1.' MOL MED. vol. 4, no. 6, June 1998, pages 392 - 401 *
NGUYEN MD ET AL.: 'Cell cycle regulators in the neuronal death pathway of amyotrophic lateral sclerosis caused by mutant superoxide dismutase 1.' JNEUROSCI. vol. 23, no. 6, 15 March 2003, pages 2131 - 40 *
PARK DS ET AL.: 'Cell cycle regulators in neuronal death evoked by excitotoxic stress: implications for neurodegeneration and its treatment.' NEUROBIOL AGING. vol. 21, no. 6, November 2000, pages 771 - 81 *
PINEIRO M ET AL.: 'ITIH4 serum concentration increases during acute-phase processes in human patients and is up-regulated by interleukin-6 in hepatocarcinoma HepG2 cells.' BIOCHEM. BIOPHYS. RES. COMMUN. vol. 263, no. 1, 16 September 1999, pages 224 - 9 *
RAO HV ET AL.: 'Cyclin D1, cdk4, and Bim are involved in thrombin-induced apoptosis in cultured cortical neurons.' J NEUROCHEM. vol. 101, no. 2, April 2007, pages 498 - 505. *
TANG Y ET AL.: 'Disruption of transforming growth factor-beta signaling in ELF beta-spectrin- deficient mice.' SCIENCE. vol. 299, no. 5606, 24 January 2003, pages 574 - 7 *
TANG Y ET AL.: 'Progenitor/stem cells give rise to liver cancer due to aberrant TGF-beta and IL-6 signaling.' PROC NATL ACAD SCI USA. vol. 105, no. 7, 19 February 2008, pages 2445 - 50 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102628087A (en) * 2012-04-25 2012-08-08 四川大学 Early warning and screening reagent for liver cancer
CN102628087B (en) * 2012-04-25 2013-12-25 四川大学 Early warning and screening reagent for liver cancer
WO2016059453A1 (en) * 2014-10-16 2016-04-21 Fundacion Fraunhofer Chile Research Biomarkers and therapeutic targets for alzheimer's disease
WO2019014153A1 (en) * 2017-07-10 2019-01-17 Massachusetts Institute Of Technology Methods of modulating protein expression from the mena-ribonucleoprotein complex in cells

Also Published As

Publication number Publication date
WO2009029235A3 (en) 2009-04-23

Similar Documents

Publication Publication Date Title
Oh et al. Crucial role for Mst1 and Mst2 kinases in early embryonic development of the mouse
Buchert et al. Genetic dissection of differential signaling threshold requirements for the Wnt/β-catenin pathway in vivo
Mrowka et al. Wilms' tumor suppressor gene WT1: from structure to renal pathophysiologic features
Wodarczyk et al. A novel mouse model reveals that polycystin-1 deficiency in ependyma and choroid plexus results in dysfunctional cilia and hydrocephalus
Takeda et al. HGF-MET signals via the MLL-ETS2 complex in hepatocellular carcinoma
Yousaf et al. Modifier variant of METTL13 suppresses human GAB1–associated profound deafness
KR101057116B1 (en) Differentiation regulators and differentiation control methods in mammals
JP4733644B2 (en) Animal model of pancreatic adenocarcinoma and use thereof
Delavallée et al. Mitochondrial AIF loss causes metabolic reprogramming, caspase-independent cell death blockade, embryonic lethality, and perinatal hydrocephalus
Lee et al. Congenital hydrocephalus and abnormal subcommissural organ development in Sox3 transgenic mice
MX2014001063A (en) Pik3ca h1047r knock-in non-human animal breast cancer model.
Prickett et al. Imprinted gene expression and function of the dopa decarboxylase gene in the developing heart
WO2009029235A2 (en) Peptides and proteins for early liver development and anitibodies thereto, and their use in therapeutic diagnosis and treatment
Yoo et al. A gene trap knockout of the Tiam-1 protein results in malformation of the early embryonic brain
Hager et al. Genetic ablation of Bcl-x attenuates invasiveness without affecting apoptosis or tumor growth in a mouse model of pancreatic neuroendocrine cancer
US8178302B2 (en) Mouse models for studying and treating hepatocellular and gastrointestinal tumors
JP2012503978A (en) A rodent cancer model for the human FGFR4ARG388 polymorphism
US8030286B2 (en) Methods and means for increasing resistance to cell damage
Regeling et al. Mice defective in p53 nuclear localization signal 1 exhibit exencephaly
Selemenakis Functional redundancy between the RAD51 accessory proteins RAD51AP1 and RAD54 in homologous recombination DNA repair
Chiremba Functional Characterization of Musashi1 in Mouse Postnatal Development and Intestinal Homeostasis
Brunelle-Navas et al. Mitochondrial AIF loss causes metabolic reprogramming, caspase-independent cell death blockade, embryonic lethality, and perinatal hydrocephalus
US6603057B1 (en) Heterogenous and homogeneous mouse variants lacking sno gene
Hager et al. Genetic Ablation of Bcl-x Attenuates Invasiveness without Affecting Apoptosis or Tumor
Liang Identifying Novel Genetic Modifiers of P53 Involved in Embryonic Lethality

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08795552

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08795552

Country of ref document: EP

Kind code of ref document: A2