WO2004013321A1

WO2004013321A1 - Esterase esta (xc4a) of xanthomonas vesicatoria

Info

Publication number: WO2004013321A1
Application number: PCT/EP2003/007932
Authority: WO
Inventors: Helmut Schwab; Zarko Herzenjak; Apichat Upaichit; Michaela Pressnig
Original assignee: Degussa Ag
Priority date: 2002-07-26
Filing date: 2003-07-21
Publication date: 2004-02-12
Also published as: AU2003281854A1

Abstract

The invention relates to an esterase of Xanthomonas vesicatoria, to proteins which are homologous thereto, and to the expression, purification and use of the same. The invention also relates to nucleic acids coding for said proteins, to antibodies against said proteins, and to host cells and transgenic plants containing the inventive nucleic acids and/or the inventive proteins.

Description

Esterase EstA (XC4a) from Xanthomonas vesicatoria

The present invention relates to an esterase from Xanthomonas vesicatoria, proteins homologous to it, its expression, purification and use and nucleic acids coding for these proteins and host cells containing these nucleic acids

Xanthomonas vesicatoria, previously called Xanthomonas campestris, is a gram-negative bacterium that is widespread in nature. The phylogenetic relationships of all species of Xanthomonas described so far were analyzed by sequencing and comparing the 16S ribosomal DNAs (Hauben, L, 1997). Members of the Xanthomonas genus are known to be plant pathogens. Plant pathogenicity involves overcoming and destroying the cell wall, which is probably the most important protection of the plant against invading microorganisms (Williamson, G., 1998, Jones, J.B., 2000). There are two main reasons to study the hydrolytic enzymes of Xanthomonas vesicatoria, firstly its important role as a phythopathogenic, plant-causing bacterial species (Starr et al., 1975) and secondly the biocatalytic potential of the hydrolytic enzymes with regard to industrial applications ( Van den Mooter, 1990).

Esterases in general represent a group of hydrolytic enzymes with a naturally occurring wide variety with regard to the substrates and the type of reaction. The substrate specificity and the activation of the enzymes differ from those of the lipases (Turner, MK, 1995). The lipases are known to be activated by the lipid / water interface before they hydrolyze water-insoluble substrates with long chain fatty acid esters. Knowledge of bacterial lipolytic enzymes is increasing rapidly. An extensive classification of the bacterial esterases are those described by Arpigny et al. (1999). Three different classes of lipolytic enzymes, namely (i) carboxylesterases (EC 3.1.1.1), (ii) true lipases (EC 3.1.1.3) and (iii) different types of phospholipases (Titball, RW, 1998 and Songer , JG, 1997) are described here. Usually, esterolytic enzymes are characterized by the fact that they have conserved regions that contain the catalytic triad (Drablos, F., 1997) and their ability to catalyze a wide range of reactions. Each hydrolase has a specific stereo preference with respect to a given substrate under certain reaction conditions, which can be referred to as its characteristic fingerprint (Rogalska, E., 1993).

Esterases can be used for the enzymatic hydrolysis of racemic carboxylic esters into their corresponding carboxylic acids and alcohols. Furthermore, they can be used for transesterifications and for the synthesis of esters. The ability of the esterases to be active in both aqueous and non-aqueous systems makes them important tools for organic synthesis (Sheldon, R.A., 1993). Esterases are of particular interest for the synthesis of enantiomerically pure products (Turner, N.J., 1994).

As a prerequisite for the commercial use of esterases, it is desirable to obtain more information about the biocatalytic properties of esterases that catalyze the conversion of organic compounds (Ozaki, E., 1997).

The physiological functions of many esterases are still unclear. Some of these enzymes are known to be involved in metabolic pathways, such as esterases, which break down the cell wall and act as virulent factors (McQueen, DA, 1987). Virulent factors often play an important role in car transporter systems. Fenselau et al. (1992) characterized genes from X. vesicatoria, which are necessary for the induction of the hypersensitive response in resistant plants, the so-called hrp genes. They suspected that these genes are involved in the secretion of molecules that are essential for the Interaction of Xc pv. Vesicatoria with the plant. After the number of identified sequences of virulent factors has increased continuously, the virulent factors can be categorized into families, the categorization either being based on their function or on the basis of the export mechanism through which they reach the bacterial surface (Finlay, BB, 1997).

The object of the present invention was to provide new enzymes with hydrolytic activity, in particular new esterases and / or lipases, for which there is an urgent need in view of the possible uses of these enzymes, in particular in biotechnology and organic chemistry, and / or a method to provide, with which new hydrolytic enzymes, in particular esterases and / or lipases, can be obtained.

The object of the present invention was in particular to provide new hydrolytic enzymes, in particular esterases and / or lipases, which have a different structure and / or different substrate specificity and / or a distinguishable degree of selectivity compared to the enzymes with hydrolytic activity described hitherto, in particular regio- or enantioselectivity, and / or have a distinguishable reaction rate and / or a distinguishable reaction mechanism, preferably at least one of the distinguishable properties being an improved property compared to the prior art.

Another object of the present invention was to find hydrolytic enzymes, in particular esterases or lipases, which have phytopathogenic effects and / or can act as virulent factors.

This object is achieved by the polynucleotides according to the invention, polypeptides and by substances which bind to polypeptides according to the invention, in particular by polynucleotides according to SEQ ID NO: 1 and SEQ ID NO: 3, polypeptides according to SEQ ID NO: 2 and SEQ ID NO: 4 and by Polypeptides according to SEQ ID NO: 2 and SEQ ID NO: 4 binding substances, in particular antibodies. It is obvious to the person skilled in the art how he can obtain nucleic acids and polypeptides of similar structure and the same or similar function starting from nucleic acids according to SEQ ID NO: 1 and SEQ ID NO: 3 or polypeptides according to SEQ ID NO: 2 and SEQ ID NO: 4. In particular, enzymes with improved properties can also be obtained, for example by evolution experiments.

The present invention therefore relates to a polynucleotide selected from the group consisting of: a) polynucleotide with a nucleic acid sequence according to SEQ ID NO: 1 or according to SEQ ID NO: 3, b) polynucleotide with a nucleic acid sequence from positions 586 to 1641 or from position 697 to 1641 according to SEQ ID NO: 1, c) polynucleotides coding for a polypeptide with an amino acid sequence according to SEQ ID NO: 2 or according to SEQ ID NO: 4 or from position 38 to position 351 according to SEQ ID NO: 2, d) naturally occurring or artificially generated mutants or polymorphic forms or alleles of a polynucleotide according to (a), (b) or (c), in particular those which have up to ten, in particular five, especially one, two or three, point mutations in relation to a polynucleotide (a), (b) or (c) possess, e) polynucleotides complementary to a polynucleotide according to (a), (b), (c) or (d), f) under stringent conditions with a polynucleotide according to (a), (b) (c), (d) or (e) hybridizing polynucleotides, where stringent conditions should preferably be understood to mean incubation at 60 ° C. in a solution containing 0.1xSSC and 0.1% sodium dodecyl sulfate (SDS), 20xSSC containing a solution 3 M sodium chloride and 0.3 M sodium citrate (pH 7.0). g) polynucleotides with a sequence homology or identity of at least 50%, preferably at least 60% or 70%, particularly preferably at least 80%, very particularly preferably at least 90% or 95%, in particular at least 98% in relation to a polynucleotide according to (a ), (b), (c), (d) or (e), h) polynucleotides consisting of at least 10 or 15, preferably at least 20 or 25, particularly preferably at least 30 or 40, very particularly preferably at least 50 or 80, in particular at least 100 or 120 successive nucleic acids of a polynucleotide according to (a), (b), (c), (d), (e) or (f), i) polynucleotides with deletions or insertions of up to 50 or 40, in particular up to 30, 20 or 10 nucleotides compared to a polynucleotide according to (a), (b) , (c), (d), (e) or (f), j) polynucleotides, comprising at least one of the polynucleotides mentioned under (a) to (i).

In a further preferred embodiment, the nucleic acids according to the invention comprise one or more non-coding sequences, the non-coding sequences being, for example, naturally occurring intron sequences or regulatory sequences such as promoter or enhancer sequences, in particular those for controlling expression hydrolytic enzymes, especially esterases or lipases.

The nucleic acids according to the invention are preferably ribonucleic acids (RNAs) or deoxyribonucleic acids (DNAs), the nucleic acids preferably being double-stranded nucleic acids.

The nucleic acids according to the invention are preferably nucleic acids which code for a protein with hydrolase activity or for parts thereof, the parts in particular being domains or sequences which can be used as epitopes and which can be used, for example, for antibody production. The protein with hydrolase activity is preferably a lipase or esterase and / or an enzyme which is able to cleave ester, thioester, amide, halide and / or peptide bonds.

According to the invention, cleavage means above all hydrolytic cleavage, that is cleavage with liberation of the carboxylic acid and the corresponding alcohol, thiol, amine or hydrogen halide. Cleavage can be special However, embodiments also take place with the formation of an ester, thioester, amide, peptide or halide bond; in particular, if an ester bond is converted into a new ester bond, this can be a transesterification reaction.

The enzyme with hydrolytic activity is very particularly preferably an esterase, especially a carboxylesterase, and / or an enzyme which is capable of cleaving regioselective or enantioselective bonds, the value for the enantiomeric excess (ee) is preferably greater than or equal to 20%, particularly preferably greater than or equal to 40%, especially greater than or equal to 60%, in particular greater than or equal to 80%.

The esterase is very particularly preferably a hydrolase with an α / β hydrolase fold and / or a serine esterase, in particular a serine esterase which belongs to the GXSXG family or is homologous to these enzymes and / or an enzyme belonging to the family of carboxyl ester hydrolases (EC 3.1.1), in particular to the family of carboxyl esterases (EC 3.1.1.3).

The nucleic acids according to the invention are preferably nucleic acids which are suitable for an esterase, particularly preferably for a microbial esterase, especially a bacterial esterase, in particular for an esterase from Xanthomonas, especially for an esterase from Xanthomonas vesicatoria, in this case in particular for the esterase EstA according to SEQ ID No. 2 or from position 38 to position 351 according to SEQ ID NO: 2.

The present invention furthermore relates to the use of the nucleic acids according to the invention, on the one hand for the production or isolation of nucleic acids according to the invention, on the other hand for the production or isolation of new nucleic acids which are homologous to the nucleic acids according to the invention, in particular those having structural and the same in relation to the nucleic acids according to the invention , similar and / or improved functional properties, with functional properties in particular lipase and / or esterase activity and with improved functional properties for example, higher specificity and / or higher conversion and / or higher regio- or enantioselectivity is to be understood.

The nucleic acids according to the invention can thus be used, for example, as probes for identifying and / or isolating homologous nucleic acids from an artificial, a cDNA or genomic library, preferably for identifying nucleic acids which are used for hydrolases, especially esterases or lipases and / or for parts thereof code, or as antisense nucleic acids or as primers in the polymerase chain reaction (PCR), in particular for the amplification of nucleic acids comprising nucleic acids coding for hydrolases, in particular for esterases and / or lipases or for parts thereof.

However, the nucleic acids according to the invention or homologous to the nucleic acids according to the invention can also be obtained by random mutagenesis or targeted mutagenesis in a manner known to the person skilled in the art.

After incorporation into an expression vector, the nucleic acids according to the invention can be used, for example, for the targeted production of individual domains or epitopes of the protein according to the invention or for the production of fusion proteins which comprise the polypeptides according to the invention.

The present invention therefore also relates to a method for obtaining a nucleic acid which codes for an enzyme with hydrolytic activity, in particular for an esterase and / or lipase, comprising the following steps: a) a nucleic acid library is contacted with a nucleic acid according to the invention, b ) a nucleic acid that hybridizes with the nucleic acid according to the invention according to (a) is identified, c) the nucleic acid identified in step (b) is sequenced. The present invention therefore also relates to a method for isolating a nucleic acid coding for a hydrolytic enzyme, in particular for an esterase and / or lipase, comprising the following steps: a) primers are prepared starting from a nucleic acid according to the invention, b) the primers according to (a) are used to amplify nucleic acids, especially cDNAs, of unknown nucleic acid sequences in the PCR, c) the nucleic acids obtained by amplification according to (b) are sequenced.

Another object of the present invention is therefore also a method for isolating a nucleic acid coding for a hydrolytic enzyme, in particular for an esterase and / or lipase, comprising the following steps: a) nucleic acids of a library are incorporated into suitable vectors and these into suitable host organisms, preferably bacteria, in particular E. coli, are introduced so that the nucleic acids can be expressed, b) the host organisms obtained according to (a) are plated and incubated on a solid support, preferably an agar plate, c) on the solid support an assay, for example a color reaction, is carried out which involves the reaction of a hydrolase substrate, for example naphthylacetate, d) hydrolase-positive clones are identified, for example by visual observation, by automated image analysis or by means of photometric measurement, and purified, e ) the nucleic acids from the in step (d) identified clones are sequenced.

The present invention therefore also relates to a method for isolating a nucleic acid coding for a hydrolytic enzyme, in particular for an esterase and / or lipase, comprising the following steps: a) a nucleic acid according to the invention is subjected to mutagenesis experiments, b) the mutants obtained are incorporated into a suitable vector and expressed in a suitable host organism, c) the expression products are examined for hydrolytic activity, in particular esterase and / or lipase activity, d) the nucleic acids, the expression products of which in step ( c) show hydrolytic activity, are sequenced.

The mutagenesis experiments can be carried out, for example, using the polymerase chain reaction (PCR). The experiments can be carried out, for example, especially when using a Taq polymerase, in such a way that reaction parameters such as the Mg ²⁺ concentration, the pH value, the reaction temperature or the substrate concentrations are varied, or error-prone can be used -PCR techniques, which are based, for example, on the addition of Mn ²⁺ or on the addition of unequal nucleotide concentrations.

The nucleic acid library to be used according to the invention can be, for example, a cDNA, a genomic or an artificial library. It is preferably a microbial, particularly preferably a bacterial library, especially one from Xanthomonas, in particular from Xanthomonas vesicatoria.

The invention further relates to a nucleic acid which can be obtained by one of the methods mentioned above.

The present invention furthermore relates to a method for producing a nucleic acid according to the invention, characterized in that the nucleic acid is chemically synthesized. For example, the nucleic acids according to the invention can be chemically determined using the nucleic acid sequence given in SEQ ID NO: 1 or the SEQ ID NO: 3 or using the amino acid sequence given in SEQ ID NO: 2 or the SEQ ID NO: 4 based on the genetic code the phosphotriester method or in another manner known to the person skilled in the art. The present invention furthermore relates to vectors, in particular cloning and / or expression vectors, comprising one of the aforementioned nucleic acids according to the invention. The vector can be, for example, a prokaryotic or eukaryotic vector. The prokaryotic vectors for incorporating the nucleic acids according to the invention are, for example, the plasmids pBSII, pBS SK-, pGEM3Zf (+/-), pGEM-5Zf (+/-) or pMS470Δ8 or another high copy number plasmid. The available expression vectors for expression in E. coli are, for example, the vectors pBLXC4ΔAccl, pMSXC4a, pBLXC4 and pMStacXC4a described below for the expression of a protein according to SEQ ID No. 2 or around the vector pMStacXv-86 for expression of a protein according to SEQ ID NO: 4.

The expression vectors for expression in E. coli can, for example, also be other commercially available vectors, such as the T7 expression vector pGM10 or pGEX-4T-1 GST (Pharmacia Biotech), which are used for an N-terminal Met- Code Ala-His6 tag, which enables the purification of the expressed protein on a Ni ²⁺ -NTA column. Examples of suitable eukaryotic expression vectors for expression in Saccharomyces cerevisiae are vectors p426Met25 or p426GAL1, for expression in insect cells, for example baculovirus vectors as disclosed in EP-B1-0127839 or EP-B1-0549721, and for expression in mammalian cells, for example SV40 vectors ,

In one embodiment, the nucleic acids according to the invention can be incorporated into a vector with flanking nucleic acids such that when the vector is expressed, the polypeptides encoded by the nucleic acids according to the invention are present as fusion proteins or carry a tag, a labeling amino acid sequence, which, for example, purifies and / or detects that can facilitate polypeptides. The day can be, for example, the strep, flag, myc or his tag.

The expression vectors preferably contain the regulatory sequences suitable for the host cell, preferably the lac or the tac promoter for expression in E. coli, the ADH-2, GAL1 or AOX promoter for expression in yeast, the baculovirus polyhedrin promoter for expression in insect cells or the early SV40 promoter or an LTR promoter for Expression in mammalian cells.

The present invention furthermore relates to a host cell comprising a vector according to the invention, the host cell preferably being Xanthomonas, in particular Xanthomonas vesicatoria, or E. coli, in particular the E. co / Z strain BL21 (DE3).

The nucleic acids according to the invention are preferably introduced into the host cells after incorporation into a suitable vector by the methods of transfection, transformation or electroporation known to the person skilled in the art, particularly preferably according to the SEM method.

The present invention furthermore relates to a polypeptide selected from the group consisting of: a) polypeptide having an amino acid sequence according to SEQ ID NO: 2 or from positions 38 to 351 according to SEQ ID NO: 2 or according to SEQ ID NO: 4, b) naturally occurring mutants, polymorphic forms or alleles of a polypeptide according to (a), especially those which have up to five, in particular one, two or three, point mutations with respect to a polypeptide according to (a) or (b), c) polypeptides, which have a sequence homology or identity of at least 50%, preferably at least 60% or 70%, very particularly preferably at least 80 or 90%, in particular at least 95 or 98% in relation to a polypeptide according to (a) or (b), d ) Polypeptides which are encoded by the aforementioned nucleic acids according to the invention, e) polypeptides consisting of at least 5 or 6, preferably at least 8 or 10, particularly preferably at least 15 or 20, in particular at least 30, 40 or 50 consecutive amino acids of a polypeptide according to (a) or (b), f) polypeptides with insertions and / or deletions of up to 60, 50 or 40, in particular up to 30, 20 or 10 amino acids with respect to a polypeptide according to (a), (b) or (c), g) polypeptides, comprising at least one of the polypeptides mentioned under (a) to (f).

These are preferably polypeptides which catalyze a hydrolysis reaction, in particular the hydrolysis of ester, amide, peptide and / or halide bonds, or parts, in particular epitopes or domains, of such polypeptides. These are preferably enzymes which have a catalytic triad comprising a nucleophile, an aspartate or glutamate and a histidine or a catalytic diad in their reactive center. These are preferably esterases or lipases, particularly preferably a carboxyl ester hydrolase (EC 3.1.1), in particular a carboxyl esterase (EC 3.1.1.1) or a protein with significant homology to carboxyl esterases and / or an esterase belonging to the GXSXG family of serine hydrolases and / or an enzyme which has alpha / beta hydrolase folding.

The compounds which can be cleaved by the polypeptides according to the invention are in particular esters, thioesters, peptides, amides or halides, preferably esters, thioesters, peptides, amides and halides, especially esters, short-chain carboxylic acids.

The polypeptides according to the invention are particularly preferably esterases, preferably microbial, in particular bacterial, esterases. It is very particularly preferably an esterase from Xanthomonas vesicatoria, in particular the esterase EstA according to SEQ ID NO: 2.

In a further preferred embodiment, the polypeptide according to the invention is a water-soluble esterase, in particular a periplasmic esterase, that is to say an esterase which is naturally conveyed into the periplasmic space through a corresponding signal sequence.

In a further preferred embodiment, the polypeptide according to the invention is an esterase according to SEQ ID NO: 4, in which the natural signal sequence has been removed by deleting the amino acids from sequence positions 3 to 37 according to SEQ ID NO: 2.

In a further preferred embodiment, the polypeptide according to the invention is a virulent factor and / or a plant pathogen.

The present invention furthermore relates to mixtures and preparations, in particular bacterial preparations, which contain the nucleic acids and / or polypeptides according to the invention. The mixtures or preparations can be prepared in a manner known to those skilled in the art.

The invention furthermore relates to the use of a polypeptide according to the invention for hydrolytic cleavage and / or for the formation of ester, thioester, amide, peptide or halide bonds.

Substrates or compounds to be prepared according to the invention are generally compounds of the formula R ¹ -C (0) -R ² .

In a preferred embodiment, R ¹ is a hydrocarbon chain, which can preferably comprise up to 5, particularly preferably up to 3 carbon atoms, in particular exactly 1 carbon atom, the hydrocarbon chain preferably being unbranched and saturated, but also branched and / or can be unsaturated and at least one of the hydrogen atoms of the hydrocarbon chain can also be substituted by other groups, preferably selected from the group consisting of halogens, hydrocarbon radicals, in particular comprising 1 to 3 carbon atoms, S0 ₃ , N0 ₂ and other functional groups known to the person skilled in the art. Preferred examples of R ¹ are the methyl, ethyl, propyl and chloro-ethyl radical.

In a further preferred embodiment, R ¹ is a cyclic compound, in particular a heterocyclic compound, especially one having 5 ring atoms. Here too, at least one of the hydrogen atoms of the cyclic compound can be substituted by another group, as mentioned above. An example of such a compound is tetrahydrofuran.

R ² represents one of the halogens F, Cl, Br, I, an amino group NR ³ R ⁴ , a thiol group SR ³ and particularly preferably an alcohol group OR ³ .

R ³ and / or R ⁴ can be an aryl radical with 6 to 14 C atoms or a heteroaryl radical with 5 to 13 C atoms, at least one hydrogen atom of the aryl or heteroaryl radical may also be substituted by a group preferably selected from hydrocarbon radicals, especially comprising from 1 to 6 carbon atoms, halogen atoms and known to those skilled functional groups such as N0 _2, NR _2, S0 _3, OR. The aryl radical can be, for example, a phenyl, o- or p-nitrophenyl radical or a naphthyl radical, in particular a -naphthyl radical.

R ³ and / or R ⁴ can also be a bridge ring system, in particular a norbornane radical, the bridge ring system also being unsaturated and bearing substituents, as mentioned above.

R ³ and / or R ⁴ can furthermore be an alkyl group or a heteroalkyl group, preferably one with up to 10 C atoms, particularly preferably with up to 6 C atoms, the alkyl group or heteroalkyl group also be unsaturated and can carry at least one substituent, for example the phthalimido group or one of the aforementioned substituents. The group can also be epoxidized. The group can also be a cycloalkyl or a cycloheteroalkyl group, particularly preferably with 6 Ring atoms. Examples of such groups are the glycidyl group, the cis-1, 2-dihydroxymethyl-cyclohexenyl group and the 2-phthalimido-butyl group.

R ³ and / or R ⁴ can furthermore be, for example, a group CR ⁵ R ⁶ R ⁷ , the radicals R ⁵ , R ⁶ and R ⁷ independently of one another for H or a hydrocarbon radical with preferably up to 6 C atoms , particularly preferably up to 4 carbon atoms, where the hydrocarbon radical can be saturated or unsaturated, branched or unbranched and at least one of the H atoms of at least one of the hydrocarbon radicals can also be substituted by one of the aforementioned substituents.

In an embodiment which is particularly preferred according to the invention, R ⁵ is an H atom, R ⁶ is an at least monounsaturated hydrocarbon chain and R ⁷ is a saturated hydrocarbon chain. R ⁶ and R ⁷ each comprise, independently of one another, preferably up to 6 C atoms, particularly preferably up to 4 C atoms, especially up to 2 C atoms. This can be branched or unbranched residues. R ⁶ very particularly preferably comprises at least one, especially exactly one triple bond, the triple bond being particularly preferably arranged in the 2 position. In a particularly preferred embodiment, R ⁶ is a prop-2-ynyl radical and R ⁷ is a methyl radical.

In a further preferred embodiment according to the invention, at least one of the radicals R ⁵ , R ^δ and R ⁷ is a multifunctional alcohol, in particular glycerol, it being possible for at least one further OH group of the glycerol to be esterified. An example of this is triacetin.

In a particular embodiment, the substrate is a component of the plant cell wall.

In a preferred embodiment, the enzymes according to the invention are used here to cleave or form enantioselectively bonds, wherein the enantiomeric excess (ee) of the reaction in question is preferably greater than or equal to 20%, particularly preferably greater than or equal to 40%, especially greater than or equal to 60%, in particular greater than or equal to 80%. For example, the polypeptides according to the invention can also be used to isolate or enrich one of the two enantiomers starting from racemic mixtures.

The present invention also relates to a process for cleaving the aforementioned esters, thioesters, amides, peptides or halides, characterized in that these compounds are incubated with at least one polypeptide according to the invention.

The present invention also relates to a process for the preparation of the aforementioned esters, thioesters, amides, peptides or halides, characterized in that carboxylic acids and / or carboxylic acid esters, thioesters, amides or halides with an alcohol, thiol, amine or Hydrogen halide can be incubated in the presence of at least one polypeptide according to the invention.

Possible industrial applications of the polypeptides according to the invention are, for example, the production or selective enrichment of flavor components in the food industry, of detergents in the detergent industry, of fine chemicals in the chemical industry or of therapeutically or diagnostically usable substances in the pharmaceutical industry.

The polypeptides according to the invention can furthermore be used, for example, as epitopes for the production of mono- or polyclonal antibodies by coupling them to a carrier, for example bovine serum albumin, and then using a mammal, preferably a mouse, rabbit or rabbit Epitope, preferably using adjuvants, is immunized. Polypeptides with a length of 5-12, in particular 8, amino acids are preferably suitable for this. Polypeptides with a length of more than 60, in particular more than 75, amino acids can also be used without a carrier for the production of antibodies. The resulting antibodies can then optionally isolated, and starting from the antibodies or the nucleic acids coding for them, antibody fragments, for example Fab or scFv fragments, can optionally be produced.

Peptides binding to a polypeptide according to the invention can alternatively also be obtained by an in vitro method known to the person skilled in the art, such as, for example, phage display, yeast display, bacterial display or, for example, the so-called Fusagen technology, in which the nucleic acid and the polypeptide encoded by it are obtained a puromycin are covalently linked.

The antisera, antibodies and antibody fragments obtainable by immunization with the polypeptides according to the invention and the peptides obtainable by one of the in vitro methods mentioned are suitable, for example, for examining gene expression banks in order to make proteins homologous to the polypeptides according to the invention, in particular those with hydrolytic activity, especially esterolytic and / or lipolytic activity.

The present invention therefore also relates to antisera, antibodies and antibody fragments against a polypeptide according to the invention and other peptides which bind to a peptide according to the invention, in particular obtainable by one of the aforementioned methods. Antiserum, antibodies and antibody fragments as well as other peptides binding to a peptide according to the invention are referred to below as "antibodies" for the sake of simplicity.

The present invention furthermore relates to a method for producing a polypeptide according to the invention, characterized in that a nucleic acid according to the invention in a suitable host cell, particularly preferably in E. coli, in particular in E. coli BL21 (DE3) or E. coli SURE ™, or in Xanthomonas, in particular in Xanthomonas vesicatoria, is expressed. A protein purification can then optionally be carried out.

E. coli is preferably cultivated between 20 and 37 ° C, particularly preferably at about 30 ° C or at about 37 ° C. Harvest and digestion of the Cells are made by methods known to those skilled in the art. The digestion can thus be carried out, for example, by French press, ultrasound, ball mill, but particularly preferably by using a sonifier. Alternatively, the cells can also be chemically permeabilized, for example by EDTA or polymyxin B.

The protein to be purified, if appropriate, is preferably chromatographically. The chromatographic purification of the protein can include, for example, cation and / or anion exchange chromatography, hydrophobic interaction chromatography and / or gel filtration.

The method can be carried out, for example, in the following way: a) a nucleic acid according to the invention is incorporated into a suitable vector and E. coli is transformed with the vector, b) after the expression of the protein, the cells are harvested and disrupted. c) anion exchange chromatography is carried out with the supernatant, d) after the elution, the active fractions are optionally combined and e) hydrophobic interaction chromatography is carried out, then f) the active fractions are optionally combined again and then concentrated.

The anion exchange chromatography is preferably carried out using an anion exchange column, in particular using a Q-Sepharose column, for example using the Q-Sepharose column FF from Pharmacia. Hydrophobic interaction chromatography (HIC) is preferably carried out with a hydrophobic interaction chromatography column, in particular with a butyl-Sepharose column, for example with the HIC-Butyl-Sepharose column from Merck (Darmstadt, Germany).

The application to and elution from the anion exchange column is preferably carried out between pH 6.0 and 8.0, particularly preferably between pH 6.5 and 7.5, in particular approximately at pH 7.0. For example, a Tris-HCI is used for this Buffer with a concentration of, for example, 100 mM or another buffer with a similar ionic strength.

Application to the hydrophobic interaction column is preferably carried out at a pH between 7.0 and 9.0, particularly preferably between pH 7.5 and 8.5, in particular approximately at pH 8.0, and at a (NH ₄ ) ₂ SO ₄ concentration between 0.4 and 0, 8 M, in particular about 0.6 M or using another salt with the setting of a corresponding ionic strength. For elution, the pH is preferably kept constant by applying a decreasing salt gradient. The elution of the polypeptides according to the invention can thus be achieved, for example, at a concentration of about 0.1 M (NH ₄ ) ₂ SO ₄ or when using another salt at a corresponding ionic strength.

In particular, the short-chain polypeptides according to the invention can also be synthesized using classic peptide synthesis (Merrifield technique).

Since in a particular embodiment the polypeptides according to the invention are in particular also plant pathogens, the present invention also relates to a method for controlling plant pathogenic factors, characterized in that a plant is treated with a nucleic acid according to the invention, a polypeptide according to the invention or an antibody according to the invention becomes.

The present invention therefore also relates to a composition for the treatment of plants, comprising a nucleic acid according to the invention, a polypeptide according to the invention and / or an anti-body according to the invention.

The present invention furthermore relates to plant cells and transgenic plants, comprising a nucleic acid according to the invention and / or a polypeptide according to the invention and / or an antibody according to the invention, and a method for producing such transgenic plants, which consists in that a nucleic acid according to the invention or a for a polypeptide according to the invention or nucleic acid coding for an antibody according to the invention in is introduced into a plant cell in a manner known to the person skilled in the art and, if appropriate, a transgenic plant is grown from the transgenic cells, which preferably carries plant pathogens and / or factors which are directed against plant pathogens. The plant cells or the transgenic plant are preferably those which can be infected by Xanthomonas, in particular Xanthomonas vesicatoria, and / or related phytopathogenic bacteria.

The invention furthermore relates to a test system for identifying substrates or functional interactors containing a nucleic acid according to the invention, a polypeptide according to the invention and / or an antibody according to the invention and, if appropriate, suitable auxiliaries and additives. The present invention furthermore relates to the substrates and functional interactors obtainable with the aid of the test system according to the invention, which can have a modulating, inhibiting or activating effect on a polypeptide according to the invention.

According to the invention, one or more nucleotides of the nucleic acid or one or more amino acids of the polypeptides or antibodies can also be modified. The modification can be, for example, a radioactive, fluorogenic or chromogenic group or a post-translational modification.

Particular embodiments of the invention are listed below under "Material and Methods" and as working examples.

Materials and Methods a) Organisms and growth conditions Xanthomonas vesicatoria DSM 50071 was used as a source for the esterase genes and cultivated at 30 ° C. in LB medium.

E. coli HB101 (Boyer and Roulland-Dussoix, 1969): hsd S20 (rB ^" , mB ^" ), supE44, ara14, λ; galK2, / acY1, proA2, rspL20, xyl-5, mf / -1, recA13 (ATCC 33649) and E. coli SURE: hsdR, merk, mer B, mrr, endf \\, sup AA, thi-, λ " , gyrA96, right / A1, lac, recB, recJ, sbcC, umuC, uvrC, [F \ proAB, / aqlqZΔM15, Tn10, (tet ^r )] were used as hosts for the work with the recombinant DNA. Recombinant E. coli HB 101 and recombinant E. coli SURE strains were normally incubated at 37 ° C. on LB petri dishes with LB medium and 100 μg / ml ampicillin overnight. Constructs for overexpression were incubated at 30 ° C. in 100 ml liquid LB medium with 100 μg / ml ampicillin overnight to avoid possible misfolding of the overexpression product.

b) plasmid constructs pBluescript® SK- (Stratagene Cloning Systems, La Jolla, USA); AmpR, lacZ, f1 ori; and pMS470Δ8 (Balzer et al., 1994; Amp ^R , laclQ, Ptac, SD-T7) were used as cloning vectors for standard techniques with the recombinant DNA and for the production of the expression constructs. pMS4K, the insertion-less form of pMS470Δ8 was used for control purposes.

PBLXC4 is the esterase-positive clone of the primary gene library. pBL XC4ΔAccl was prepared starting from pBLXC4 by deleting a 2 kbp yAccI fragment.

PMS XC4a is an expression construct for the expression of EstA, in which the sequence of the native promoter, as shown in FIG. 1, is still present between the strong tac promoter of the expression vector and the structural gene for the esterase EstA. In this construct, expression can also be controlled by the native promoter still present. To produce this expression construct, the vector pMS470Δ8 was cut with Nde I and Hind III. The vector pBLXC4ΔAccl containing the entire estA ORF (open reading frame) was cut with Dralll and Hind III (Dralll cuts within the 5 'region of the esM-ORF). The missing estA 5 'end was obtained using the following 43 bp linker fragment:

5 'TATGGATGTTTTGTTGCACTGCCAATCGACAGCQGCACGGT 3' 3 'ACCTACAAAACAACGTGACGGTTAGCTGTCGCCGTGCCACAC 5 "Ndel Drα III The Nde I and Dra III restriction sites are in bold. An ATG codon that may encode an extended polypeptide is underlined. The linearized vector pMS470Δ8, the partial estA-ORF, and the DNA linker were ligated together in a single reaction. PMStacEstA is a construct for the expression of EstA under the sole control of the tec promoter present on the expression vector. To produce this expression construct, the vector pMSEstA was cut with Nde I and Accl, releasing the esM-ORF. The vector pBLXC4 was cut with Pvul and Accl, resulting in a 5 'deleted esfc4 ORF lacking the native estA promoter. The missing estA 5 'end was obtained from the following 16 bp linker fragment:

5 'T ATG CAA TAG ACC GAT 2 "3' AC GTT ATG TGG C 5 '

The Nde I and Dra III restriction sites are in bold. The ATG start codon is underlined.

The linearized vector pMS470Δ8, the partial esM-ORF and the DNA linker were ligated together in a single reaction. Plasmid DNA was isolated and purified using Promega Wizard ™ MiniPreps.

c) DNA modification and transformation restriction endonucleases and modifying enzymes were obtained from New England BioLabs (Beverly, USA), Röche Diagnostics GmbH (Vienna, Austria), and Promega Corporation (Madison, USA). Restriction digestion and DNA modifications were carried out as recommended by the manufacturer. The E. co / 7 strains were transformed by the SEM method (Inoue et al., 1990).

The cloning experiments and DNA manipulations were normally carried out using standard techniques known to the person skilled in the art, as described, for example, by Sambrook et al. (1989) and Ausubel et al. (1999). d) Creation of the genomic library

Genomic DNA from Xanthomonas vesicatoria DSM 50071 was prepared using the Qiagen Genomic Kit (Qiagen GmbH, Hilden, Germany). After partial digestion with Sau3AI, the genomic DNA fragments with a size of 3-5 kbp were cloned into the vector pBluescript ™ SK according to the "partial fill-in" technique, which had previously been linearized by digestion with Xho \ The ligation products were used to transform E. coli SURE cells using the SEM method, and the transformants were plated onto LB-Amp plates containing IPTG / X-Gal. A total of 13,800 clones were obtained. E) Search for active clones

Fast and simple plate assays were used to identify library clones with esterase activity. For this purpose, the bacterial clones were grown overnight on LB agar plates with 100 mg / l ampicillin at 37 ° C. (approx. 1000 colonies per plate). 70 mm Whatman filter papers (Whatman 541 hardened ashless filter circles) were mixed with 1 ml solution containing 0.1 M sodium phosphate (pH 7.0), 0.1 ml substrate stock solution (σ-naphthylacetate, 1% [w / v] in acetone), and 30 ul Fast Blue BN stock solution (2% [w / v] in H ₂ 0). The excess liquid was drained off. To detect the esterase activity, the filters with the substrate solution were placed on the agar plates. Esterase activity was detectable by the development of a purple spot by the active colony on the agar plate and accordingly on the filter paper within one minute (Schiacher et al., 1998).

f) DNA sequencing and sequence analysis

The Dye-Deoxy Terminator Sequencing Kit (Applied Biosystems Inc., Faster City, CA, USA) and the AmplyTaq DNA polymerase (Perkin-Elmer Corporation, Norwalk, USA) were used for the automated sequencing of double-stranded DNA on an ABI 373A sequencing device. In addition, some subclones and gene-specific primers were used to obtain complete sequence information for both strands of DNA. Sequence analysis and homolog search was performed using the Wisconsin Sequence Analysis Package (Devereux et al., 1984) and the Blast program (Altschul et al., 1990). The expasy proteomics tools server (http://expasy.hcuqe.ch/www/tools.htmn) was used for detailed protein sequence analysis.

g) Gene Expression The esterase gene estA was expressed in E. coli SURE in 250 ml LB medium containing 100 μg / ml ampicillin and 0.1 mM IPTG. A 100 ml preculture was inoculated with a single colony of the corresponding expression clone and allowed to grow overnight at 37 ° C. A second pre-culture was inoculated with 10 ml of this pre-culture, which was grown until the exponential growth phase. The 250 ml main culture was inoculated with 10 ml of the second preculture. The cells were grown at 30 ° C. to an OD595 of 0.2, after which enzyme expression was induced by adding IPTG to a final concentration between 0.005 and 0.5 mM. After further growth to an OD595 of 1.5, the cells were harvested by centrifugation at 10,000 g for 10 minutes. The pellets were resuspended in 10 ml of 100 mM Tris-HCl, pH 7.0. After freezing the cells at -20 ° C., they were thawed, mixed by vortexing and disrupted by sonification with the Branson Sonifier 250 (3x30 seconds on ice; duty cycle 70%). After subsequent ultracentrifugation of the crude lysates at 32,000 g for 60 minutes, the supernatant fractions were collected and the pellets were resuspended in 100 mM Tris-HCl, pH 7.0, adjusting the previous volume. The crude lysate, the supernatant and the pellet fraction were examined for esterase activity.

h) Protein determination, SDS-PAGE The protein concentrations of the cell extracts were determined by the Bradford method (Bradford, 1976). SDS-PAGE was performed using 12% polyacrylamide gels. LMW (low molecular weight) markers from Pharmacia Biotech (Uppsala, Sweden) were used as a reference. The samples were denatured at 94 ° C for 5 minutes. Protein gels were usually stained with Coomassie Brillant Blue. i) Purification of the Esterase EstA The crude lysates of E. coli clones which contain a corresponding EstA expression plasmid were used for the purification of the esterase. For this purpose, the supernatant fraction was placed on an anion exchange chromatography (IEX) column (Pharmacia QFF) and the protein was eluted with the flow-through fractions. A hydrophobic interaction chromatography (HIC) column (butyl Sepharose) from Merck (Darmstadt, Germany) was used for the second purification step. The protein fractions from the lEX step with esterase activity were combined and a concentration of 0.1 M sodium phosphate (pH 8.0) and 0.6 M (NH ₄ ) ₂ SO _{4 was} established. Under these conditions the protein bound to the butyl sepharose column. A decreasing salt gradient was then created. The active protein was eluted from the column at a concentration of 0.1 M (NH ₄ ) S0 ₄ .

j) Esterase Activity Assays Esterase activity assays were performed with purified enzyme and whole cell lysates.

Activity staining Esterase patterns from protein fractions were analyzed after fractionation by native PAGE. The samples were diluted in 2x dissociation buffer (10 mM Tris, pH 7.4, 50% glycerol, 1% Triton X-100, 0.1% bromophenol blue) and incubated for 10 minutes at room temperature. The polyacrylamide gel was then applied (12% separating gel [375 mM Tris-HCl, pH 8.8], 4% stacking gel [125 mM Tris-HCl, pH 6.8], running buffer [49 mM Tris-HCl, 38 mM glycine, pH 8.0]). Alternatively, the samples were separated from one another by means of denaturing SDS gels and testing for activity was carried out after renaturation of the esterase, which was achieved by incubating the gels in water for 60 minutes. The detection of the esterase activity for the protein bands on the gel was carried out by incubating the gel in a solution of 10 ml of 0.1 M phosphate buffer (pH 7.0), 1 ml of substrate stock solution (α-naphthylacetate, 1% [w / v] in acetone) and 250 μl Fast Blue B stock solution (2% [w / v] in H ₂ 0). The reaction was stopped by incubating the gels with 10% acetic acid. Bands with esterase activity were detectable as dark red bands. - Spectrophotometric assay

Esterase activity was measured with o- and p-nitrophenyl fatty acid esters (Sigma) as substrates. The photometric assay was carried out at room temperature in 100 mM Tris-HCl, pH 7.0, with substrate in a concentration of 4 mM. Substrate stock solutions were made up with DMSO as a solvent. The release of o- and p-nitrophenol was monitored spectrophotometrically at 405 nm, the activity being calculated on the basis of the specific absorption coefficients of 2.4 for o-nitrophenol and 9.6 for p-nitrophenol. The absorption coefficients were calculated by linear regression analysis of a standard curve of p- or o-nitrophenol at 405 nm. A unit of enzyme is defined as the amount of enzyme that releases 1 μmol of o- or p-nitrophenol per minute.

- pH shift assay

Ester hydrolysis releases the ester components alcohol and fatty acid. The release of the acid component was examined using a pH indicator. The enzymatic hydrolysis was carried out at room temperature in 100 mM Tris-HCl, pH 7.0, containing 4 mM substrate.

- fluorescence assay

The esterase activity was determined directly with cell crude lysates or after separation of the cell crude lysate with a native polyacrylamide gel. The assays were carried out at room temperature in 100 mM Tris-HCl, pH 7.0. Substrate stock solutions prepared using DMSO as a solvent. The fluorescence was excited using a transiluminator at 315 nm and evaluated visually.

Example 1: Genisolierunα and sequence analysis

About 13800 transformants from a library of genomic fragments of Xanthomonas vesicatoria were tested for esterase activity in a filter assay using α-naphthylacetate as a chromogenic substrate. Ten positive clones were found, which could be divided into five independent groups due to cross hybridization in a Southern hybridization experiment. The Southem hybridization was carried out using the Fluorescing Gene Image Kit from Amersham (USA). Ultimately, the clone pBLXC4 was named highly active clone selected and subjected to further investigation. An insertion with a size of approximately 3.3 kb was determined by digestion with restriction endonucleases. By removing a 1.3 kb fragment, the esterase activity could be assigned to a 2 kb subfragment (FIG. 1). By sequencing this fragment, an ORF (open reading frame) could be determined that codes for a 352 amino acid polypeptide called EstA. A possible ribosome binding region, a putative promoter consensus sequence from the E. coli σ. The o-type and a Shine-Dalgamo sequence (SD) could be found in the 5 'direction from the start codon (FIG. 1).

Analysis of the derived sequence of the esfc4 gene indicated a putative signal sequence with a length of 37 amino acids and furthermore that the protein is a periplasmic protein. The search for proteins with a homologous sequence showed that the EstA has strong homology to the C-terminal region of an endo-1,4-β-xylanase from Butyrivibrio fibrisolves (Linn and Thomson, 1991) (FIG. 3).

Comparison of the C-terminus of the endo-1,4-β-xylanase from Butyrivibrio fibrisolvens with the sequence of the esterase EstA gave a homology of 49% and an identity of 29%. In a more conserved area (EstA residues 185 to 204), a profile for the environment around the serine of the active center was found, which is characteristic of esterases, lipases and thioesterases and also in the C-terminal area of the endo-1, 4-ß-xylanase from Butyrivibrio fibrisolves can be found. Another ruminant bacterium, Ruminococcus flavefaciens, is known to have an enzyme complex that degrades the plant cell wall and also includes a xylanase (XynB) with a C-terminal esterase domain (Kirby et al., 1998).

Examination of the profile revealed that the PROSITE profile, characteristic of esterases, lipases and thioesterases, for the environment of the active site serine is between amino acid residues 108 and 207, Ser ^{192 being} the nucleophilic serine of the active site is. Example 2: Recombinant Expression of Esterase EstA

Only a low degree of hydrolytic activity with p-nitrophenylacetate as substrate was determined when total cell lysate from E. co // 7 pBLXC4ΔAccl was used. However, the hydrolytic activity could be increased by cloning the DNA fragment into the vector pMS470Δ8. The resulting vector was named pMSXC4a (Fig. 4). After incorporation of this vector into E. coli SURE cells, a satisfactory protein expression could be achieved, while at the same time the specific activity of the total lysate compared to p-nitrophenylacetate could be increased tenfold compared to the specific activity using the plasmids pBLXC4 or pBLXC4ΔAccl could be achieved (Tab. 1). Although EstA expression should be inducible using the vector pMS470Δ8 (by adding IPTG), no significant increase in EstA activity could be observed under induced conditions. This suggests that the native promoter still present in this expression construct controls the expression and not the inducible tac promoter present on the vector.

The second expression construct pMStacXC4a was produced by removing the insert sequence in the 5 'direction from the ORF of the esM gene and thus placing the gene directly behind the inducible tac promoter and the highly regulatable SD sequence from T7. When E. coli SURE (pMStacXC4a) was used, a further increase in the expression and activity of the esterase EstA could be achieved by replacing the native promoter from Xanthomonas vesicatoria with the inducible tac promoter, which is located on the vector pMS470Δ8 (FIG. 4). The activity could be increased tenfold again when induction of the E. co / Z cultures was carried out with 0.1 mM IPTG (Table 1). Strong EstA expression in E. coli resulted in a significant decrease in cell growth, as observed after induction of EstA expression. Strong expression of EstA in E. coli also led to a low enzyme solubility, which may be due to problems with the processing of the signal peptide. A further increase in expression could be achieved if the enzyme was expressed in E. coli BL21. The best yields were obtained by culturing at 30 ° C. and by inducing expression from the middle exponential growth phase with 0.25 mM IPTG for 18 hours. Better solubilization of the enzyme was achieved when 0.5% (w / v) Triton X-100 was added to the lysis buffer.

Table 1: Esterase activities related to p-nitrophenylacetate as well

Protein concentrations of different expression constructs

No hydrolytic activity was detectable with nitrophenyl esters of longer-chain fatty acid residues such as valerate, caproat, caprylate, nonaoate and palmitate. Temperature and pH optima for the hydrolytic activity in relation to o-nitrophenylacetate were determined with lysates from pMStacXC4a. The pH optimum was between 6.5 and 7.0 in Tris-HCl buffer. The optimal temperature range was 16 to 38 ° C. The activity decreased rapidly at temperatures above 40 ° C. The enzyme was stable at 25 ° C for one week, losing 25% of the initial activity.

SDS-PAGE analysis of the recombinant esterase (Fig. 5) showed a band with a weight of about 35 kDa, which was not detectable in the control. The expression construct pMStacXC4a leads to a clear overexpression band at 35 kDa with lysates from induced cultures. Expression of EstA using the native Xanf / iomonas promoter resulted in soluble enzyme activity. When expressed using the inducible tac promoter, only 10% of the total lysate after ultracentrifugation enzymatic activity found in the supernatant. There are indications that severe overexpression of EstA in E. coli leads to problems in the processing of the predicted signal peptide. When SDS-PAGE was renatured, it was observed that when the EstA enzyme, which was expressed under the control of the natural Xafinomonas translation initiation elements, was used, there was a strong band at about 33 kDa, after incubation with o-nitrophenylacetate and subsequently Fast Blue BN staining was carried out (FIG. 4, lane 7). Renatured EstA, which was expressed under the control of the tac promoter, leads to a different, rather weak band with the same molecular weight as EstA, which was expressed under the control of the Xanthomonas vesicatoria promoter, which is located somewhat below the strong protein overexpression band ( a weak band was visible on the gel). On the basis of this observation, it can be concluded that overexpression of EstA under the control of the tac promoter mainly leads to unprocessed EstA, which is active but is not able to return to an active structure after denaturation by SDS , For this reason, a construct without a signal sequence was produced in order to improve the expression and folding of the esterase EstA (see example 5).

Example 3: Purification of the Esterase EstA

Purification of the esterase EstA was accomplished by anion exchange chromatography followed by hydrophobic interaction chromatography. A 2.5-fold purification of the enzyme was achieved by placing the soluble fraction of the crude cell lysate on an anion exchange column (QFF from Pharmacia). In a solution of 0.1 M Tris-HCl and pH 7.0, the esterase EstA does not bind to the column and could thus be collected with the first flow-through fractions. The protein pre-purified in this way was analyzed by SDS-PAGE (Fig. 5). The flow-through fractions were combined and buffered while adjusting 0.1 M sodium phosphate, pH 8.0, 0.6 M (NH ₄ ) ₂ SO and placed on a butyl-Sepharose hydrophobic interaction column (Merck, Darmstadt, Germany). In this way, a further 15-fold purification of the enzyme could be achieved. The purified protein could be visualized in the SDS-PAGE as a 33 kDa band (FIG. 5). These purification steps resulted in an enzyme with a purity of approximately 70%. Isoelectric focusing of the purified protein confirmed as p1 of the unprocessed peptide a value of 8.1, as previously calculated based on the sequence.

Example 4: Substrate specificity of the esterase EstA

The clone E. coli SURE pMStacXC4a was used to determine the hydrolytic activity of EstA in relation to various substrates. Here p- and o-nitrophenol fatty acid esters of different chain lengths were used as substrates, whereby a clear preference of the enzyme for ortho-substituted nitrophenols and short-chain fatty acids could be determined (Tab. 2).

Table 2: Hydrolytic activity of the crude lysate of pMS XC4a and the purified enzyme in relation to nitrophenyl esters with different lengths with regard to the fatty acid chains

As for the cell lysate, no hydrolytic activity could be determined for the purified enzyme with nitrophenol fatty acid esters that have a longer fatty acid chain, such as valerate, caproat, caprylate, nonaoate and palmitate.

Esterase EstA was also assayed for hydrolytic activity for triacetin and tributyrin using a plate assay. Here, only by using triacetin activity could be determined by forming a plaque.

These results suggest that preferred substrates of the esterase EstA are small esterified substituents with little steric hindrance. Furthermore, it was found by means of chiral gas chromatography (GC) that the enzyme hydrolytic activity with regard to the substrates 5-endo-norbornen-2-yl acetate (column: Lipodex A), glycidyl acetate (column: Lipodex E), tetra hydrofura n- 3-acetate (column: Chirasil-Dex CB), and has lower activity with regard to the conversion of glycidyl butyrate (column: Lipodex E). It was further determined by HPLC that the enzyme was also 2-chloropropionic acid-2-naphthyl ester (column: Chiracel ODH), cis-1, 2-diacetoxymethyl-4-cyclohexene (column: Chiracel ODH) and 1-acetoxy-2-phthalimido -butane (column: Chirapak AD) catalytically converted.

Example 5: Improvement of Esterase Production in E. Coli

a) Construction of an expression clone for a modified EstA

In order to improve the expression of the esterase in E. coli, the gene coding for the esterase was modified in such a way that the nucleotide sequences coding for the amino acids 3 to 37 were removed. This removed a large part of the naturally occurring signal peptide. Thus, the

Expression a polypeptide which essentially processed after the natural signal peptide had been split off from the native EstA polypeptide

Corresponds to EstA polypeptide. However, there are also the first two here

Amino acids of the signal peptide present at the N-terminal end. An expression clone is thus created which codes for a polypeptide corresponding to SEQ ID NO: 4.

This expression clone was produced as follows:

With the primers

5'-GACATATGCAAGCCACCGACGAGCGCCCCAGTG-3 '(N-terminal end) and

5'-GCAAGCTTGATCAACGCGGTTGGCGCGCGTC-3 '(C-terminal end) was used as template using the DNA of the plasmid pMStacXC4a as the part of the region coding for EstA which corresponds to that after cleavage of the natural

Signal peptide resulting processed EstA polypeptide corresponds, amplified.

The two amino acids Met and Gin additionally introduced at the N-terminus compared to the native processed EstA are contained in the primer for the N-terminal end (marked in bold) The PCR reaction batches were carried out under standard conditions, as recommended by the manufacturer for the TaqHotStar DNA polymerase used, using "Q-solution" (Qiagen, Germany). The reaction conditions for the PCR were 95 ° C. for 15 min, 30 cycles ( 94 ° C for 1 min, 65 ° C for 1 min, 72 ° C for 2 min) and 72 ° C for 10 min The resulting amplified DNA was purified, cut with restriction endonucleases Nde \ and Hind \\\ and cut in with the cloned the same enzyme-cut vector pMS470Δ8, whereby the expression plasmid pMStacXv-86 was formed E. coli SURE (e14 ^~ (McrA ^~ ) Δ (mcrCB- hsdSMR-mrr) 171 endA1 supE44 thi-1 gyrA96 relA1 lac recB recJ TbcCu um (Kan ^r ) uvrC [F ^* proAB lac / ^q ZΔ (M15 Tn ^ O (Tet ^r )]) was used as the host for normal DNA manipulations, while E. coli BL21 (F ^" the ompT hsdS (r _B ^~ m _B ^" ) gal) was used as the host for the esterase production. In addition, the culture conditions and the cleaning pro tokoll modified.

b) Culture conditions and enzyme production In addition to E. coli BL21 (pMStacXv-86), coding for the esterase EstA, E. coli BL21 (pMS4K) was used as negative control.

The bacterial strains were grown under aerobic conditions on Luria-Bertani (LB) medium (1% bactotrypton, 0.5% yeast extract, 0.5% NaCl). Ampicillin (100 mg I ^"1 ) was added if plasmid selection should be performed. The bacterial cells were grown on LB agar plates (15 g I ^{" 1} Bactoagar) at 37 ° C and in liquid LB medium at 30 ° C , For enzyme production, 5 ml LB medium were inoculated with bacterial cells and grown overnight at 30 ° C. The cultures were placed in 100 ml of LB medium and the cultures thus obtained were allowed to grow to the middle exponential phase. 15 ml of the pre-culture thus obtained was used to inoculate 250 ml of LB medium in 11 shake flasks. A final concentration of 0.01 mM IPTG was set to induce protein expression after the cells had reached the exponential growth phase. The cells were then allowed to grow for an additional 6 hours before the cells were harvested by centrifugation at 4 ° C at 5000 g for 10 minutes. The pellet was then washed once with 0.9% NaCl and then in 5 ml solubilization buffer (0.05 M Tris-HCl; 0.01 M EDTA; 0.1 M NaCl; 1 mg / l lysozyme; 0.5% Triton X-100; pH 7.0) added. The pellets were disrupted by ice three times for 30 seconds each on ice (Braun Labsonic 2000, Branson Sonifier 250; duty cycle: 50%; Output control: 5). The supernatant obtained by subsequent ultracentrifugation (30,000 g; 60 min) was used for biocatalytic enzyme studies.

c) Purification of the enzyme In the first purification step of the enzyme, the anion exchange chromatography with a QSepharose ^R Fast Flow Matrix column, the column was first equilibrated with a buffer containing 20 mM Tris-HCl, 50 mM NaCl, pH 7.5. After the sample application, washing was carried out with the same buffer, the enzyme being in the flow-through fraction. In the second purification step, the hydrophobic interaction chromatography with a Pharmacia glass column containing Fractogel TSK Butyl 650 (Merck, Darmstadt, Germany) as the column material, the column was firstly treated with a buffer containing 20 mM Tris-HCl, 1.5 M NaCI, pH 7.5 equilibrated. After the sample application, washing was carried out with the same buffer. Protein elution takes place through a buffer containing 20 mM Tris-HCl, 0.1 M NaCl, pH 7.5.

Example 6: Reaction of the enzyme with 1-methylprop-2-ynyl acetate But-3-yn-2-ol is a very important chiral building block for many materials, for example for the 5-lipoxygenase inhibitor "Fenleuton". Naturally, But -3-in-2-ol is an intermediate in the production of the sex pheromone of the male mountain beetle, Dendroctonus brevicomis, and the pharmaceutical and biological activity of these compounds is due to the steric configuration of the C atom carrying the hydroxyl group.

a) Preparation of the substrate A solution of but-3-yn-2-ol (10 mmol) in CH ₂ Cl ₂ was mixed with an excess of acetic anhydride (20 mmol), pyridine (20 mmol) and a catalytic amount of 4-dimethylamino -pyridine treated at room temperature. Unreacted acid anhydride was then destroyed by adding methanol and the organic phase was washed with 2N HCl and water. The so obtained Product was dried over Na ₂ S0 ₄ and the solvent was evaporated before purification. The 1-methylprop-2-ynyl acetate thus obtained was purified by bulb tube distillation.

NMR data: ¹³ C (CDCI ₃ ): δ = 21.2 (CH ₃ -C = 0); 21.4 (C-4); 60.2 (C-3); 73.0 (C-2); 82.3 (C-1); 170.0 (C = 0); ¹ H (CDCI ₃ ): δ = 1.47 (d, 3H, H-4); 2:04 (s, 3H; CH ₃ -C = 0); 2.43 (d, 1H, H-3); 5.28 (s, 1H, H-1).

b) Enzymatic hydrolysis

Due to the high volatility of the 1-methylprop-2-ynyl acetate and the but-3-yn-2-ol, the hydrolysis of the substrate by the enzyme could not be determined by thin-layer chromatography (TLC) pre-screening as usual. Therefore, the conversion rates and the enantiomeric excesses were determined by gas chromatography and high pressure liquid chromatography (HPLC).

The hydrolysis reactions were carried out by introducing 5 ml of 0.1 M sodium phosphate buffer (pH 7.3) and then adding 250 μl of crude enzyme preparation and 100 l of substrate. The reaction solution was stirred at 150 revolutions per minute at room temperature. Samples were taken after 2 and 5 hours and after one day. After extraction with CH ₂ CI ₂ , centrifugation was carried out and then the organic phase was dried over Na ₂ SO ₄ .

c) Determination of the enantiomeric excess by chiral gas chromatography and determination of turnover by reversed phase HPLC

- Chiral gas chromatography (GC)

The reaction was monitored using a Shimadzu GC-14A gas chromatograph, a C-R5A Chromatopac integrator and an FID detector at 250 ° C. The separation of the enantiomeric acetates and alcohols was carried out using a Chirasil-Dex-CB fused silica capillary column (2,3,6-tri-O-methyl - ^ - cyclodextrin column from Chrompak, 25 mx 0.32 mm, 0, 25 μm coating). Prior to use in the chiral GC, the samples were filtered (filters Needle, 1, 1 mm x 40 mm, 19 G1 ^_1/2 TW Becton Dickinson).

- Reversed phase HPLC -, __ ,, .-,

PCT / EP2003 / 007932

36

A special work-up was necessary to determine the conversion rates of (R, S) - but-3-in-2-ol by means of reversed phase HPLC. The hydrolysis reaction was stopped by adding CH ₃ CN: H ₃ P04 in a 1: 4 ratio and after centrifugation and filtration the aqueous sample was analyzed on a Hewlett Packard Series 1100 HPLC using a LiChrospher®100RP-18e (5 µm) column. The parameters for the dissolution of (R, S) -but-3-in-2-ol were as follows: CH ₃ CN: 0.1% H ₃ PO ₄ = 20:80, flow rate 0.9 ml min ^'1 , 35 ° C and UV detection took place at 210nm and 204nm.

Results

The results of the GC and reversed phase HPLC are shown in Table 3.

Table 3: Results of the hydrolysis of 1-methylprop-2-ynyl acetate catalyzed by Xv_EstA, determined by (a) chiral GC or (b) reversed phase HPLC and (c) by calculation

^" x EstÄ ee% * ee% ^a Konv.% ^b Konv.% ^b Konv.% ^c E ^c Ester alcohol (204nm) (210nm)

2h 90 24 75 76 79 4.2

5h 97 20 81 82 83 4.8 ld 98 19 85 86 84 5.0

It turned out that the esterase XvJΞstA reacts selectively with the (S) -enantiomer of 1-methylprop-2-ynyl acetate, with an enantiomeric excess (ee) of 90% already being detectable after 2 hours on the educt side (FIG . 8th). In contrast, the enantiomeric excess on the part of the corresponding alcohol was rather small with a maximum of 24% ee. After a reaction time of one day, the (R) -acetic acid ester was obtained in 98% ee purity. This indicates a clear preference of the esterase Xv-EstA for the hydrolysis of (S) - 1-methylprop-2-inyl acetate.

The retention times determined by means of reversed phase HPLC were 9.6 minutes for 1-methylprop-2-ynyl acetate and 2.3 minutes for but-3-yn-2-ol (FIG. 8). The conversion rates determined were 75% (at 204 nm) and 76% (at 210 nm) after 2 Hours response time. With longer reaction times, yields of up to 85% could be achieved.

To the best of our knowledge, this process is the first described process for the preparation of enantiomerically enriched 1-methylprop-2-ynyl acetate and but-3-yn-2-ol by an enzymatically catalyzed hydrolysis reaction.

Example 7: Determination of the Kinetic Properties of the Esterase EstA To determine the kinetic parameters of the enzyme against p- / o-nitrophenyl acetate, measurements with the substrate in 100 mM Tris-HCl, pH 7.0 at 25 ° C. were used. One unit (U) is defined as 1 / mol of alcohol released per minute. The values determined for KM were 0.45 (o) and 0.46 (p) mM, for Vmax 188 (o) and 384 (p) mol min ^"1 mg ^{" 1} and for k _ca t 110 (o) and 224 (p) s ^"1. To determine the kinetic parameters of the enzyme compared to 1-methylprop-2-ynyl acetate, measurements were carried out with the substrate in 0.01 M Tris-HCl, 1.2% (w / v) DMSO, 0 , 5% (w / v) Triton X-100, pH 7.0 With the help of an autotitrator the pH was kept constant at pH 7.0 One unit (U) is defined as 1 / mol titrated NaOH per The values determined for K were 360 mM, for Vmax 833 mol min ^"1 mg ^{" 1} and for kcat 485 s ^" .

Example 8: Production of mutants with improved activity in aqueous solution In order to obtain enzymes with improved properties from EstA, random mutagenesis experiments were carried out by means of PCR. The plasmid pMStacXv-86, coding for the modified esterase as described in Example 5, was used as a template and the oligonucleotides according to SEQ ID NO: 9 and 10 were used as primers.

The following reaction solutions were prepared to prepare the library: 30 ng plasmid; 0.4 mM dNTP; 3 mM MgCl2; 0.15 mM MnCl2, 3.5 unit DNA polymerase (Appligene).

The following temperature program was used to carry out the PCR: 95 ° C / 5 min; 25 cycles with 98 ° C / 30s - 62 ° C / 60s - 72 ° C / 90s each; 72 ° C / 10 min; 4 ° C. A mutation rate of 0.51% could be set. The DNA fragments obtained in this way were digested with Λ / ctel and Hind \\\ and cloned into the correspondingly linearized vector pMS470Δ8. The ligated vectors were then electroporated into E. coli SURE cells. The cells thus obtained were plated on LB / ampicillin agar plates and grown overnight at 37 ° C. The colonies were then transferred to a filter paper. This was dried at room temperature and then in a substrate solution containing 0.1 mM 1-methylprop-2-ynyl acetate, 1.2% (w / v) DMSO, 24% (v / v) abs. EtOH, 1% (w / v) litmus, 0.5% (w / v) Triton X-100, 60 mM Tris-HCl, pH 7.0. Hydrolytic activity was demonstrated on the color change from dark blue to red. In this way, the six mutants listed in Tab.

Table 5: Mutants with improved activity in aqueous solution

The information on the position in the protein relates to the modified esterase in the expression plasmid pMStacXv-86

In order to determine the activity of the mutants, the cells were cultivated as described above and, after harvesting and disrupting the cells, the protein was purified by anion exchange chromatography (see FIG. 9).

The activity of the mutants against 1-methylprop-2-ynyl acetate and also against ortho-nitrophenylacetate was then determined in comparison to the wild type. When using ortho-nitrophenylacetate, a concentration of 4 mM substrate was specified. As can be seen in FIG. 10, the determined specific activities of the mutants against 1-methylprop-2-ynyl acetate were above the activity of the wild-type enzyme, in the case of G1, A1 and A6 even by almost up to 100%. With regard to o-nitrophenyl acetate, however, the mutants showed approximately the same activity as the wild type (FIG. 11).

Example 9: Production of mutants with improved activity and stability in organic solvents

The library described in Example 7 was used to screen for improved activity and stability. To screen for activity, 1-methylprop-2-ynyl acetate in a solution of 37.5 ml of 1% (w / v) litmus and 12.5 ml of 25% DMF was used. The following mutants could be identified

Tab. 6: Mutants with improved activity and stability in organic solution. The information on the position in the protein relates to the modified esterase in the expression plasmid pMStacXv-86

The mutant 02 determined in this way is identical to the mutant A5 and the mutation of the mutant DM14 has already been found in the double mutant A1.

pictures

1 shows the structure of the 2 kbp construct pBLXC4Δaccl, comprising the ORF for EstA from Xanthmonas vesicatoria. The insertion is limited by a 5 'X / .o / restriction interface, which is a partial fill-in cloning strategy the gene bank has been changed and is therefore no longer intact. The 3 'limit is an Acc / restriction interface. The estA gene is identified by a black bar and is located at positions 590 to 1640 of the cloned fragment. The ORF is preceded by a putative Shine Dalgamo (SD) sequence (underlined).

FIG. 2 shows part of the DNA sequence of the fragment cloned into the vector pBLXC4Δaccl and the predicted protein sequence from EstA. The underlined areas show the conserved promoter boxes and the double underlined sequences show the Shine Dalgarno sequence. The suspected leader peptide is underlined. The carboxylesterase profile is characterized by a gray background.

Fig. 3: Amino acid alignment of the EstA sequence (top) and the C-terminus of xylanase B from Butyrivibrio fibrisolvens. Identical amino acids are highlighted in black. Areas with a high level of homology are identified by a gray background.

4 shows the functional map and the restriction map of pMSXC4a and pMStac-XC4a.

Fig. 5. 12% SDS-PAGE analysis of EstA after recombinant expression in E. coli

SURE.

A: Protein staining using Coomassie Brillant Blue.

Lane 1: LMW marker; Lane 2: E. coli SURE (pMS4K); Lane 3: E. coli SURE

(PMSXC4a); Lane 4: E. coli SURE (pMSXC4a) induced with 0.1 mM IPTG; Lane 5: E. coli SURE (pMStacXC4a), not induced; Lane 6: E. coli SURE (pMStacXC4a) induced with 0.1 mM IPTG.

B: 12% SDS-PAGE, the protein being renatured and then incubated with naphthyl acetate and Fast Blue BN and Coomassie Brilliant Blue. Lane 7: E. coli SURE (pMSXC4a) induced with 0.1 mM IPTG; Lane 8: E. coli SURE

(PMStacXC4a); Lane 9: E. coli SURE (pMS4K). 6 shows the conversion of a substrate of the esterase EstA, namely 1-methylprop-2-ynyl acetate to the corresponding alcohol. Because of the enantioselective reaction, one of the two enantiomers is preferably reacted, the enantioselective alcohol synthesis being associated with an enantioselective enrichment of the ester.

FIG. 7 shows a chromatogram of the chiral GC of the reaction shown in FIG. 6 and catalyzed by EstA. The assignment of the peaks to the starting materials and products is shown in the figure.

FIG. 8 shows a reversed phase HPLC chromatogram for acetic acid-1-methyl-prop-2-ynyl and the corresponding but-3-yn-2-ol after a reaction time of one day. The assignment of the peaks to the starting materials and products is shown in the figure.

FIG. 9 shows the expression of some mutants of EstA using an SDS-polyacrylamide gel stained with Coomassie Brillant Blue. WT identifies the wild type EstA.

Figure 10 shows a comparison of the activities of some mutants of EstA and the activity of the wild-type enzyme with respect to 1-methylprop-2-ynyl acetate.

Figure 11 shows a comparison of the activities of some mutants of EstA and the activity of the wild-type enzyme with respect to ortho-nitrophenyl acetate.

literature

- Altschul et al. (1990) J. Mol. Biol. 215, 403-410

- Arpigny et al. (1999) Biochem J. 343, 177-83

- Blazer et al. (1992) Nucleic Acids Res. 20, 1851-1858

- Boyer et al. (1969) J. Mol. Biol. 41 (3), 459-472

- Bradford (1976) Anal. Biochem. 72, 248-254

- Brett et al. (1990) Physiology and Biochemistry of Plant Cell Walls. London, Unwin Hyman. - Cygler et al. (1993) Protein Science 2, 366-382.

- Derewenda et al. (1991) Biochem. Cell Biol. 69, 842-851.

- Dekker (1989) in Plant Cell Wall Polymers: Biogenesis and Biodegradation (Lewis, N.G. and Paice, M.G., eds.) ACS Symp. Ser. 399, American Chemical Society, Washington, 1989, pp. 619-629.

- Devereux et al. (1984) Nucl. Acids Res. 12, 387-395

- Drablos et al. (1997) Methods Enymol. 284, 28-61

- Fenselau et al. (1992) Mol Plant Microbe Interact. 5, 390-6

- Ferreira et al. (1993) Biochem. J. 294, 349-335

- Finlay et al. (1997) Microbiol Mol Biol Rev. 61, 136-69

- Hauben et al. (1997) Int J Syst Bacteriol. 47, 328-35

- Hwang et al. (1992) Carbohydr. Polym. 19, 41-50

- Jones et al. (2000) Int J Syst Evol Microbiol. 50, 1211-9

- Kirby. et al. (1998) Biochem.Soc.Transactions 26, 169

- Kirsch (1971) In The Enzymes (Boyer, P.D., ed.), 5, 43-69, Academic Press, New York.

- Kroon et al. (1997) Eur. J. Biochem. 248, 245-251.

- Lin et al. (1991) Cloning, sequencing and expression of a gene encoding a 73 kDa xylanase enzyme from the rumen anaerobic Butyrivibrio fibrisolvens.

- Lisser et al. (1993) Nucleic Acids Res. 21, 1507-1516

- Lüthi et al. (1990) Appl. Biochem. Biotechnol. 45/46, 383-393

- McQueen et al. (1987) J Bacteriol. 169, 1967-71

- Mitchel et al. (1990) J. Wood Chem. Techn. 10, 111-121

- Okuda (1991) Esterases. In A Study of Enzymes, ed. Kuby, S.A., 563-577. Boca Raton FI, CRC Press, USA.

- Petersen et al. (1994) A sequence analysis of lipases, esterases and related proteins. In Wooley, P. and Petersen, S.B. (Ed.). Lipases: their structure, biochemistry and application. 23-48. Press Syndicate of the University of Cambridge, New York.

- Rogalska (1993a) J Biol Chem. 268, 792-4

- Rogalska (1993b) Chirality 5, 24-30

- Sambrook. J., Fritsch. Cold Spring Harbor Laboratory Press a laboratory manual, ^2nd ed, Cold Spring Harbor, NY: EF, and Maniatis, T. 1999. Molecular cloning. - Schlacher et al. (1998) Journal of Biotechnology 62, 47-54

- Shareck et al. (1995) Gene 153, 105-109

- Shevchik et al. (1997) Mol. Microbiol. 24, 1285-1301

- Songer (1997) Trends Microbiol. 5, 156-61

- Starr (1975) J Agric Food Chem. 23, 279-81

- Tsujita et al. (1990) Relationship between lipase and esterase. In Progress in clinical and biological res. 344. Isoenzymes: Structure, function, and use in biology and medicine. 915-933

- Titball (1998) Soc AppI Bacteriol Symp Ser. 27, 127S-137S

- Turner (1995) Trends Biotechnol. 13, 173-7

- Van den Mooter et al. (1990) J Syst Bacteriol. 40, 348-69

- Walker et al. (1983) Biochem. Pharma. 32, 3265-3269

- Williamson et al. (1998) Microbiology 144, 2011-2023

Claims

Claims 201dg08.wo

1. Nucleic acid selected from the group consisting of: a) polynucleotide with a nucleic acid sequence according to SEQ ID NO: 1 or according to SEQ ID NO: 3, b) polynucleotide with a nucleic acid sequence from positions 586 to 1641 or from positions 697 to 1641 according to SEQ ID NO: 1, c) polynucleotides coding for a polypeptide with an amino acid sequence according to SEQ ID NO: 2 or according to SEQ ID NO: 4 or from position 38 to position 351 according to SEQ ID NO: 2, d) naturally occurring or artificially generated mutants or polymorphic forms or alleles of a polynucleotide according to (a), (b) or (c), e) polynucleotides complementary to a polynucleotide according to (a), (b), (c) or (d), f) under stringent conditions with a Polynucleotide according to (a), (b), (c), (d) or (e) hybridizing polynucleotides, whereby stringent conditions are preferably to be understood as meaning incubation at 60 ° C. in a solution containing 0.1xSSC and 0.1% Sodium dodecyl sulfate (SDS), where 20 xSSC denotes a solution containing 3 M sodium chloride and 0.3 M sodium citrate (pH 7.0), g) polynucleotides with a sequence homology or identity of at least 50% with respect to a polynucleotide according to (a), (b), (c), (d) or (e), h) polynucleotides, consisting of at least 10 consecutive nucleotides of a polynucleotide according to (a), (b), (c), (d), (e) or (f), i) polynucleotides with deletions or insertions of up to 50 nucleotides against a polynucleotide according to (a), (b), (c), (d), (e) or (f), j) polynucleotides comprising at least one of the (a) to (i ) called polynucleotides.

2. Nucleic acid according to claim 1 coding for an enzyme with hydrolytic activity.

3. Nucleic acid according to claim 2, wherein the enzyme is a lipase or esterase.

4. Nucleic acid according to claim 3, wherein the esterase is a carboxyl esterase.

5. Nucleic acid according to claim 3 or 4, wherein the esterase is the esterase EstA according to SEQ ID NO: 2.

6. Nucleic acid according to one of claims 1 to 5, wherein the nucleic acid comprises one or more non-coding sequences.

7. A method for producing and / or identifying a nucleic acid according to any one of the preceding claims, characterized in that the nucleic acid is chemically synthesized, isolated from a gene bank using a probe or obtained by a polymerase chain reaction.

8. The method according to claim 7, comprising the following steps: a) a cDNA or genomic library is contacted with a nucleic acid according to claim 1, b) a DNA clone which hybridizes with a nucleic acid according to claim 1 is identified, c) that cDNA or genomic nucleic acid fragment comprising the clone identified in step (b) is sequenced.

9. The method according to claim 7, comprising the following steps: a) starting from a nucleic acid according to SEQ ID No. 1 primers are produced, b) the primers according to (a) are used to amplify cDNAs of unknown nucleic acid sequences in the PCR, c) the nucleic acids obtained according to (b) are sequenced.

10. The method according to claim 7, comprising the following steps: a) Nucleic acids from a library are incorporated into suitable vectors and these are introduced into suitable host organisms so that the expression of the nucleic acids can take place, b) the host organisms obtained according to (a) are plated out and incubated on a solid support, c) on the solid Carrier, an assay is carried out, which involves the implementation of a hydrolase substrate, d) hydrolase-positive clones are identified and purified, e) the nucleic acids from the clones identified in step (d) are sequenced.

11. The method according to claim 7, comprising the following steps: a) a nucleic acid according to claim 1 is subjected to mutagenesis experiments, b) the mutants obtained are sequenced, incorporated into a suitable vector and expressed, c) the expression products are esterase and / or lipase activity.

12. Vector comprising a nucleic acid according to one of claims 1 to 6.

13. Host cell comprising a vector according to claim 12.

14. The host cell according to claim 13, wherein the host cell is Xanthomonas, E. coli or a plant host cell.

15. Polypeptide selected from the group consisting of: a) polypeptide with an amino acid sequence according to SEQ ID NO: 2 or according to SEQ ID NO: 4 or from positions 38 to 351 according to SEQ ID NO: 2, b) naturally occurring mutants, polymorphic forms or alleles of a polypeptide according to (a), c) polypeptides which have a sequence homology or identity of at least 50% with respect to a polypeptide according to (a) or (b), d) polypeptides which are encoded by nucleic acids according to claim 1, e) polypeptides consisting of at least 5 consecutive Amino acids of a polypeptide according to (a) or (b), f) polypeptides with insertions and / or deletions of up to 60 amino acids with respect to a polypeptide according to (a), (b) or (c), g) polypeptides comprising at least one of the polypeptides mentioned under (a) to (f).

16. The polypeptide according to claim 15, wherein the polypeptide is a protein with hydrolytic activity.

17. The polypeptide according to claim 16, wherein the polypeptide is an esterase or lipase.

18. The polypeptide of claim 17, wherein the polypeptide is a carboxyl esterase.

19. Polypeptide according to one of the preceding claims, wherein the polypeptide is the esterase EstA according to SEQ ID No. 2 acts.

20. A polypeptide according to any one of the preceding claims, wherein the polypeptide is a plant pathogen or a virulent factor.

21. The polypeptide according to any one of the preceding claims, wherein the polypeptide is a periplasmic protein.

22. A method for producing a polypeptide according to one of the preceding claims, characterized in that a nucleic acid according to claim 1 is expressed in a suitable host cell.

23. The method according to claim 22, comprising the following steps: a) a nucleic acid according to one of claims 1 to 6 is incorporated into a suitable vector and E. coli is transformed with the vector, b) after the expression of the protein, the cells are harvested and digested, c) the supernatant is subjected to anion exchange chromatography, d) the active fractions of anion exchange chromatography are subjected to hydrophobic interaction chromatography.

24. Antibody against a polypeptide according to claim 15.

25. A method for producing an antibody according to claim 24, characterized in that a non-human mammal is immunized with a polypeptide according to claim 15 and optionally the resulting antibodies are isolated.

26. Test system for the identification of substrates or functional interactors containing a nucleic acid according to claim 1, a polypeptide according to claim 15 or antibodies according to claim 24 and optionally suitable auxiliaries and additives.

27. Use of a polypeptide according to claim 15 or a polypeptide encoded by a polynucleotide according to claim 1 for cleaving ester, amide, halide or peptide bonds.

28. Use according to claim 27, wherein the substrates are triglycerides or carboxylic acid esters of short-chain fatty acids.

29. Use according to claim 28, wherein the short-chain fatty acid is a fatty acid with up to 4 carbon atoms.

30. A plant cell comprising a nucleic acid according to claim 1, a vector according to claim 12, a polypeptide according to claim 15, an antibody according to claim 24, a nucleic acid coding for a polypeptide according to claim 15 or for an antibody according to claim 24.

31. A transgenic plant comprising a nucleic acid according to claim 1, a vector according to claim 12, a polypeptide according to claim 15, an antibody according to claim 24 and / or a nucleic acid coding for a polypeptide according to claim 15 or for an antibody according to claim 24.

32. A method for producing a transgenic cell according to claim 31.

33. A composition for the treatment of plant diseases, comprising a vector according to claim 12, a polypeptide according to claim 15, an antibody according to claim 24 and / or a nucleic acid coding for a polypeptide according to claim 15 or for an antibody according to claim 24.