WO2003018789A1 - Esterase est4b1 obtained from bacillus subtilis - Google Patents

Abstract

The invention relates to a thioesterase obtained from Bacillus subtilis, to homologous proteins of said thioesterase, to nucleic acids that code for the proteins and to antibodies against said proteins. The invention also relates to the production and use of said proteins, nucleic acids and antibodies.

Description

description

Esterase Est4B1 from Bacillus subtilis

The present invention relates to an esterase from Bacillus subtilis, proteins homologous to it, nucleic acids coding for these proteins and antibodies against these proteins, and the production and use of these proteins,

Nucleic acids and antibodies.

Hydrolytic enzymes play an important role in the field of biocatalysis, especially for the production of enantiomerically pure substances [1, 2]. The enzymatic hydrolysis and synthesis of esters takes place in technical

Applications mainly through three groups of enzymes: lipases, esterases and proteases.

Lipases in particular have been successfully used industrially for various reasons [3]. The reasons for this are that lipases can be provided in large quantities, that they are very stable under the reaction conditions and that very high enantioselectivity can be achieved in the hydrolysis and transesterification [4].

However, the resolution of racemates is usually difficult if there is no clear steric difference between the two stereoisomers. In addition, many substrates are known that can hardly be converted at all or only very slowly using esterases [5-9].

For the reasons mentioned, there is an urgent need for hydrolytic

Enzymes, in particular esterolytic or lipolytic enzymes, for industrial use, in particular for separating racemic mixtures into their components. The object of the present invention was therefore to provide a new enzyme with hydrolytic activity, in particular esterolytic and / or lipolytic activity, for which there is an urgent need in view of the possible uses of such enzymes, in particular in biotechnology and organic chemistry, and / or to provide a method with which new hydrolytic enzymes, especially esterolytic and / or lipolytic enzymes, can be obtained.

The object of the present invention was, in particular, to provide a hydrolytic enzyme, in particular an esterolytic and / or iipolytic enzyme, which has a different substrate specificity than the esterolytic and lipolytic enzymes described hitherto, a distinguishable degree of selectivity, a distinguishable reaction rate and a distinguishable structure and / or has a distinguishable reaction mechanism.

Another object of the present invention was to provide esterolytic and / or lipolytic enzymes which are capable of cleaving ester and / or thioester bonds.

This object is achieved by the polynucleotides, polypeptides and antibodies according to the invention, in particular by a polynucleotide according to SEQ ID No. 1, a polypeptide according to SEQ ID No. 2 and one against a polypeptide according to SEQ ID No. 2 directed antibodies.

It is obvious to the person skilled in the art how he starts from a nucleic acid according to SEQ ID No. 1 or a polypeptide according to SEQ ID No. 2 nucleic acids and polypeptides of similar structure and the same or similar function can be obtained. In particular, enzymes with improved properties can also be obtained, for example through evolution experiments [10, 11].

The present invention therefore relates to a polynucleotide selected from the group consisting of: a) polynucleotide with a nucleic acid sequence from positions 556 to 1287 according to SEQ ID No. 1, b) Polynucleotides coding for a polypeptide with an amino acid sequence according to SEQ ID No. 2, c) naturally occurring or artificially generated mutants or polymorphic forms or alleles of a polynucleotide according to (a) or (b), in particular those which have up to ten, in particular five, in particular one, two or three, point mutations in relation to a polypeptide possess according to (a) or (b), d) complementary to a polynucleotide according to (a), (b) or (c)

Polynucleotides, e) polynucleotides hybridizing under stringent conditions with a polynucleotide according to (a), (b), (c) or (d), stringent conditions being understood to mean the conditions known to the person skilled in the art for hybridization experiments, preferably incubation at 60 ° C. in a solution containing 0.1xSSC and 0.1% sodium dodecyl sulfate (SDS), where 20xSSC denotes a solution containing 3 M NaCI and 0.3 M sodium citrate (pH 7.0), f) polynucleotides with a sequence homology or identity of at least 50%, preferably at least 60% or 70%, particularly preferably at least 80%, very particularly preferably at least 90% or 95%, in particular at least 98% in relation to a polynucleotide according to (a), (b), (c), ( d) or (e), g) polynucleotides consisting of at least 10 or 15, preferably at least 20 or 25, particularly preferably at least 30 or 40, very particularly preferably at least 50 or 80, in particular at least 100 or 120, in succession nucleic acids of a polynucleotide according to (a), (b), (c),

(d) or (e), h) polynucleotides with one or more deletions and / or insertions of up to 50 or 40, in particular up to 30, 20 or 10 nucleic acids with respect to a polynucleotide according to (a), (b), (c ), (d) or (e), i) polynucleotides comprising at least one of those mentioned under (a) to (h)

Polynucleotides. In a further preferred embodiment, the nucleic acids according to the invention comprise one or more non-coding sequences, the non-coding sequences being, for example, naturally occurring intron sequences or regulatory sequences such as promoter or enhancer sequences, in particular those for controlling expression hydrolytic enzymes, in particular esterolytic or lipolytic enzymes.

The nucleic acids according to the invention are preferably ribonucleic acids (RNAs) or deoxyribonucleic acids (DNAs), the

Nucleic acids are preferably present as double-stranded nucleic acids.

In a preferred embodiment, the nucleic acids according to the invention are nucleic acids which code for a protein with hydrolase activity or parts thereof. The protein with hydrolase activity is, for example, a halogen peroxidase, haloalkane dehalogenase, epoxy hydrolase, thioesterase, lipase or esterase and / or an enzyme which is capable of haloalkane, ester, thioester, amide - cleave, halide, epoxy or peptide bonds, particularly preferably ester or thioester bonds. It is very particularly preferably an enzyme which is able to cleave bonds regioselectively and / or enantioselectively.

According to the invention, cleavage means above all hydrolytic cleavage, that is to say cleavage with liberation of the carboxylic acid and the corresponding alcohol, thiol, amine or hydrogen halide. Cleavage can, however, occur in particular

Embodiments also take place with formation of a new ester, thioester, amide, peptide or halide bond, in particular it can be a transesterification reaction, for example, if an ester bond is converted into a new ester bond. Cleavage also includes those catalyzed by halogen peroxidases and haloalkane dehalogenases

Cleavage reactions of haloalkanes meant that lead to the release of the corresponding alcohols and alkanes. In a preferred embodiment, the enzyme according to the invention is a hydrolase with an α / β hydrolase fold and / or an independent esterase or thioesterase as a component of non-ribosomal peptide synthetases (Schneider et al., Arch. Microbiol. (1998) 169: 404-410).

The nucleic acids according to the invention are preferably nucleic acids which are suitable for a microbial enzyme, particularly preferably a bacterial enzyme, in particular for an enzyme from Bacillus, especially for an enzyme from Bacillus subtilis, in this case in particular for the esterase Est4B1 according to SEQ ID No. 2 and / or one of the polypeptides according to the invention described below.

The present invention furthermore relates to the use of the nucleic acids according to the invention, on the one hand for the production or isolation of nucleic acids according to the invention, on the other hand for the production or isolation of new nucleic acids which are homologous to the nucleic acids according to the invention, in particular those having structural and the same in relation to the nucleic acids according to the invention , similar and / or improved functional properties, functional properties in particular hydrolytic activity, especially lipolytic and / or esterolytic activity, and improved functional properties, for example, higher specificity, higher conversion and / or higher regio- or enantioselectivity.

The nucleic acids according to the invention can thus be used, for example, as probes for identifying and / or isolating homologous nucleic acids from an artificial, cDNA or genomic gene bank, preferably for identifying nucleic acids that are used for esterolytic enzymes, lipolytic enzymes and / or for one of the polypeptides according to the invention encode or parts thereof, or as antisense nucleic acids or as primers in the polymerase chain reaction (PCR), in particular for the amplification of nucleic acids comprising nucleic acids coding for enzymes with hydrolytic activity, in particular esterolytic and / or lipolytic activity, or parts thereof. However, the nucleic acids according to the invention or homologous to the nucleic acids according to the invention can also be obtained by random mutagenesis or targeted mutagenesis in a manner known to the person skilled in the art.

After incorporation into an expression vector, the inventive

Nucleic acids are used, for example, for the targeted production of individual domains or epitopes of a polypeptide according to the invention or of fusion proteins which comprise the polypeptides according to the invention.

The present invention therefore also relates to a method for

Obtaining nucleic acid which codes for a hydrolytic enzyme, in particular for an esterolytic and / or iipolytic enzyme, comprising the following steps: a) a nucleic acid library is contacted with a nucleic acid according to the invention, b) a nucleic acid which hybridizes with a nucleic acid according to the invention identified, c) the nucleic acid identified in step (b) is sequenced.

The present invention therefore also relates to a method for isolating a nucleic acid coding for a hydrolytic enzyme, in particular for an esterolytic and / or iipolytic enzyme, comprising the following steps: a) primers are prepared starting from a nucleic acid according to the invention, b) the primers (a) are used to amplify nucleic acids, especially cDNAs, of unknown nucleic acid sequences in the PCR, c) the nucleic acids obtained in (b) are sequenced.

Another object of the present invention is therefore also a method for isolating a nucleic acid coding for a hydrolytic enzyme, in particular for an esterolytic and / or iipolytic enzyme, comprising the following steps: a) nucleic acids from a library are incorporated into suitable vectors and these are introduced into suitable host organisms, preferably bacteria, in particular E. coli, so that the nucleic acids can be expressed, b) the host organisms obtained according to (a) are on a solid support, preferably an agar plate, plated out and incubated, c) an assay, for example a color reaction, is carried out on the solid support, which involves the reaction of a hydrolase substrate, for example naphthylacetate, d) hydrolase-positive clones are identified, for example by visual observation, by automated image analysis or by means of photometric measurement, and purified, e) the nucleic acids from the clones identified in step (d) are sequenced.

The present invention therefore also relates to a method for isolating a nucleic acid coding for a hydrolytic enzyme, in particular for an esterolytic and / or iipolytic enzyme, comprising the following steps: a) a nucleic acid according to the invention is subjected to mutagenesis experiments, b) the results obtained Mutants are incorporated into a suitable vector and expressed using a suitable host organism, c) the expression products are examined for hydrolytic activity, in particular esterase and / or lipase activity, d) the nucleic acids, the expression products of which in step (c) are hydrolytic

Show activity, are sequenced if necessary.

For example, the polymerase chain reaction (PCR) can be used to carry out the mutagenesis experiments. The PCR experiments can be carried out, for example, in particular when using a Taq polymerase, in such a way that reaction parameters such as the Mg ²⁺ concentration, the pH value, the reaction temperature or the substrate concentrations are varied, or error can be used -prone-PCR techniques come that for example, based on the addition of Mn ²⁺ or on the addition of unequal nucleotide concentrations.

The nucleic acid library is preferably a cDNA, genomic or artificial library, in particular a microbial, especially bacterial library, in particular one from Bacillus, particularly preferably from Bacillus subtilis.

The invention further relates to a nucleic acid which can be obtained by one of the aforementioned methods.

Another object of the present invention is a method for producing a nucleic acid according to the invention, characterized in that the nucleic acid is chemically synthesized. The nucleic acids according to the invention can be chemically described, for example, in SEQ ID no. 1 specified

Nucleic acid sequence or using the in SEQ ID No. 2 given amino acid sequence based on the genetic code e.g. can be synthesized according to the phosphotriester method.

The present invention also relates to a vector, in particular a

Cloning and / or expression vector, comprising one of the aforementioned nucleic acids. The vector can be, for example, a prokaryotic or eukaryotic expression vector. The prokaryotic vectors for incorporating the nucleic acids according to the invention are, for example, the plasmids pGEM-5Zf (+/-), pBluescript SK (-) or pMS470 or another high copy number plasmid. The available expression vectors for expression in E. coli are, for example, the vectors pTB3 or pMS470BS1 for expressing a protein according to SEQ ID No. Second

The expression vectors for expression in E. coli can, for example, also be other commercially available vectors, such as the T7 expression vector pGM10 or pGEX-4T-1 GST (Pharmacia Biotech), which are used for an N-terminal Met- Encode Ala-His6 tag, which is the purification of the expressed protein on a Ni ²⁺ -NTA column. Examples of suitable eukaryotic expression vectors for expression in Saccharomyces cerevisiae are the vectors p426Met25 or p426GALT, for expression in insect cells, for example baculovirus vectors as disclosed in EP-B1-0127839 or EP-B1-0549721, and for expression in mammalian cells, for example SV40 vectors ,

In one embodiment, the nucleic acids according to the invention can be incorporated into a vector with flanking nucleic acids in such a way that when the vector is expressed, the polypeptides encoded by the nucleic acids according to the invention are present as fusion proteins or carry a tag, a labeling amino acid sequence, which, for example, purifies or detects the polypeptides can ease. The day can be, for example, the strep, flag, myc or his day.

The expression vectors preferably contain the regulatory sequences suitable for the host cell, in this case preferably the lac or tac promoter for expression in E. coli, the ADH-2, GAL1 or AOX promoter for expression in yeast, the baculovirus -Polyhedrin promoter for expression in insect cells or the early SV40 promoter or LTR promoters for expression in mammalian cells.

The present invention furthermore relates to a host cell comprising an expression vector according to the invention, the host cell preferably being Bacillus, in particular Bacillus subtilis, or E coli, in particular the E. co // strain BL21 (DE3) or the strain E coli SURE.

The nucleic acids according to the invention are preferably introduced into the host cells after incorporation into a suitable vector by the methods of transfection, transformation or electroporation known to the person skilled in the art.

In a further preferred embodiment, the 5'-terminal portion of nucleic acids, in particular those which code for enzymes with hydrolytic activity, is completely or partially by a portion of one of the Nucleic acids according to the invention replaced in order to improve the expression of these enzymes, in particular the expression in E. coli, by producing these heterologous constructs. Especially the nucleic acid from position 556 to 1287 according to SEQ ID No. 1, and above all the range of the first 150 nucleic acids, is characterized by a codon use which makes this nucleic acid particularly suitable for expression in E. coli, since it has a very low GC content and therefore after transcription there are less difficult melting RNA structures. The 5'-terminal partial area can therefore primarily by a nucleic acid from position 556 to position 706 according to SEQ ID No. 1 or at least a part thereof, the at least one part preferably comprising at least 10 nucleic acids, particularly preferably at least 20 nucleic acids, in particular comprising at least 50 nucleic acids.

The present invention furthermore relates to a polypeptide selected from the group consisting of: a) polypeptide with an amino acid sequence according to SEQ ID No. 2, b) naturally occurring or artificially generated mutants, polymorphic forms or alleles of a polypeptide according to (a), especially those which have up to five, in particular one, two or three, point mutations with respect to a polypeptide according to (a), c ) Polypeptides which have a sequence homology or identity of at least 50%, preferably at least 60% or 70%, very particularly preferably at least 80 or 90%, in particular at least 95 or 98% in relation to a polypeptide according to (a) or (b) have, d) polypeptides which are encoded by the aforementioned nucleic acids according to the invention, e) polypeptides consisting of at least 5 or 6, preferably at least 8 or 10, particularly preferably at least 12 or 15, in particular at least 20, 25 or 40 consecutive

Amino acids of a polypeptide according to (a) or (b), f) polypeptides with one or more insertions and / or deletions of up to 60, 50 or 40, in particular up to 30, 20 or 10 amino acids with respect to a polypeptide according to (a), (b) or (c), g) Polypeptides comprising at least one of the polypeptides mentioned under (a) to (f).

The polypeptide is preferably a hydrolytic enzyme, particularly preferably an esterolytic or Iipolytic enzyme, or parts thereof. By this we mean enzymes that can catalyze a hydrolysis reaction, such as the hydrolysis of haloalkane, ester, thioester,

Amide, epoxy, peptide or halide bonds, or parts, in particular epitopes or domains, of such polypeptides. In particular, the hydrolytic enzyme can be an esterase, lipase, thioesterase, haloalkane dehalogenase, halogen peroxidase or epoxy hydrolase and / or an enzyme which has alpha / beta-hydroIase folding and / or an enzyme which according to

Classification of Arpigny is assigned to the V family, act.

In a preferred embodiment, these are enzymes which have a catalytic triad comprising a nucleophile, an aspartate or glutamate and a histidine, or a catalytic diad in their reactive center.

In addition to a hydrolysis reaction, the cleavage reaction which is catalyzed by a polypeptide according to the invention can also be a reaction analogous to this, such as the formation, in particular new formation, of an ester, thioester or amide bond.

In a preferred embodiment, the polypeptide according to the invention is a microbial, in particular bacterial, enzyme. It is very particularly preferably an enzyme from Bacillus subtilis, in particular the esterase Est4B1 according to SEQ ID No. Second

The polypeptide according to the invention is particularly preferably a water-soluble enzyme. In a further preferred embodiment, the polypeptide according to the invention is an esterase or thioesterase which is or can be contained in a non-ribosomal peptide synthetase. This can in particular be a thioesterase according to the publication by Schneider et al. (Arch. Microbiol. 1998, 169: 404-410), here in particular a distinct thioesterase like protein.

Another object of the invention is the use of a polypeptide according to the invention for the cleavage of haloalkane, ester, thioester, peptide, amide, epoxy or halide bonds, the cleavage reaction being both a hydrolysis reaction with liberation of the corresponding carboxylic acid or the corresponding alcohol or alkane, as well as the new formation of an ester, thioester, peptide, amide or halide bond or the new formation of a haloalkane bond.

Substrates or compounds to be prepared according to the invention are, in particular, compounds of the formula R ¹ -C (O) -OR ² , where R ^{1 is} an alkyl radical having preferably up to 7, especially up to 5, carbon atoms, in particular methyl, ethyl, propyl or Butyl, or a cycloalkyl or heterocycloalkyl radical preferably having 5 ring atoms, the

Heterocycloalkyl radical preferably carries exactly one hetero atom, particularly preferably oxygen, and wherein R ² for an alkyl radical with preferably up to 6, especially up to 4 carbon atoms, in particular methyl, ethyl, propyl or butyl, or for an aryl radical preferably 6 to 14 carbon atoms, in particular phenyl or naphthyl, or represents a cycloalkyl or heterocycloalkyl radical with preferably 5 ring atoms, where the alkyl radical can also comprise an epoxy group, and the heterocycloalkyl radical preferably exactly one hetero atom, particularly preferably carries oxygen, and the radicals mentioned for R ¹ and R ² , independently of one another, can also carry at least one, particularly preferably one or two substituents known to the person skilled in the art, for example selected from the group consisting from halogen atoms, especially Cl or Br, N0 ₂ , NH ₂ , S0 ₃ H, S0 ₂ H, phthalimido, OH, OR, NR ₂ .

In a preferred embodiment, the enzymes according to the invention are able to split carboxylic acid esters in which the alcohol component is selected from the group consisting of 0- and p-nitrophenol, naphthol, phthalimidobutanol, methanol, ethanol, propanol, butanol, glycerol, glycidol and Hydroxy-tetrahydrofuran and the carboxylic acid component is selected from the group consisting of 3-hydroxybutyric acid, tetrahydrofuran-2-carboxylic acid, butyric acid, valeric acid, acetic acid, propionic acid, caproic acid and 2-

Chloropropionic acid, where the individual components also, independently of one another, bear substituents or can be modified in some other way.

In a preferred embodiment, the cleavage reaction is carried out at a pH greater than or equal to 6.5, preferably at a pH between 7.0 and 10.0, particularly preferably at a pH between 7.5 and 8.5, especially at a pH of around 8.0.

In a further preferred embodiment, the polypeptides according to the invention are used as a constituent of non-ribosomal peptide synthetases, in particular for the production of antibiotics, the reaction which is catalyzed by the polypeptide according to the invention, for example the cyclization of cyclic peptide antibiotics in the form of an ester, Can be thioester or amide bond.

In a further preferred embodiment, the enzymes according to the invention are used in order to isolate or enrich one of the two enantiomers starting from racemic mixtures.

Possible applications of the polypeptides according to the invention are, for example

Production or selective enrichment, for example of taste components in the food industry, of detergents in the Detergent industry, fine chemicals in the chemical industry or therapeutically or diagnostically usable substances in the pharmaceutical industry.

The polypeptides according to the invention can furthermore be used, for example, as epitopes for the production of mono- or polyclonal antibodies by coupling them to a carrier, for example bovine serum albumin, and then using a mammal, preferably a mouse, rabbit or rabbit Epitope, preferably using adjuvants, is immunized. Polypeptides with a length of 5-12, in particular 8, amino acids are preferably suitable for this. Polypeptides with a length of more than 60, in particular more than

75 amino acids can also be used without a carrier for the production of antibodies. The resulting antibodies can then optionally be isolated, and antibody fragments, for example Fab or scFv fragments, can optionally be prepared starting from the antibodies or the nucleic acids coding for them.

Peptides binding to a polypeptide according to the invention can alternatively also be obtained by an in vitro method known to the person skilled in the art, such as, for example, phage display, yeast display, bacterial display or the so-called Fusagen technology, in which the nucleic acid and the coding thereof

Polypeptide are covalently linked to one another via a puromycin.

The antisera, antibodies and antibody fragments obtainable by immunization with the polypeptides according to the invention and the peptides obtainable by one of the in vitro methods mentioned are suitable, for example, for examining gene expression banks in order to make proteins homologous to the polypeptides according to the invention, especially those with hydrolytic activity, especially esterolytic and / or lipolytic activity.

The present invention therefore also relates to antisera, antibodies and

Antibody fragments against a polypeptide according to the invention and other peptides binding to a polypeptide according to the invention, in particular obtainable by one of the aforementioned methods. Antiserum, Antibody and Antibody Fragment as well as other peptides binding to a polypeptide according to the invention are called “antibodies” for the sake of simplicity.

The present invention furthermore relates to a method for producing a polypeptide according to the invention, characterized in that a nucleic acid according to the invention in a suitable host cell, in particular in Bacillus, in particular Bacillus subtilis, or in E. coli, in particular E. coli BL21 (DE3) , is expressed.

The method can be carried out, for example, in the following manner: a) a nucleic acid according to the invention is incorporated into a suitable vector and E. coli is transformed with the vector, b) after the expression of the protein, the cells are harvested and disrupted. c) the protein is optionally purified from the supernatant thus obtained.

E. coli is preferably cultivated between 15 and 40 ° C., particularly preferably at about 37 ° C. Expression is preferably induced in the logarithmic growth phase. When using, for example, a pMS470 vector which comprises a nucleic acid coding for a peptide according to the invention, expression can be induced by adding lactose, for example by setting a final concentration between 1 and 30 mM, in particular between 5 and 20 mM, in particular of about 10 mM, and / or by adding IPTG, for example by setting a final concentration between 0.01 and 10 mM, especially between 1 and 5 mM. After the induction of expression, the cells are preferably allowed to grow for a further 8-18 hours, in particular a further 12-14 hours. Alternatively, induction of expression can also be dispensed with.

The harvested cells can be disrupted by a method known to the person skilled in the art, for example French press, ultrasound, ball mill or by using a sonifier and / or enzymatically. Alternatively, the Cells can also be chemically permeabilized, for example by EDTA or Polymyxin B.

The protein to be purified, if appropriate, is preferably chromatographically. Chromatographic purification of the protein can include, for example, anion or cation exchange chromatography, hydrophobic interaction chromatography and / or gel filtration.

In a particular embodiment, the protein is purified using anion exchange chromatography and a subsequent gel filtration step. In particular the protein Est4B1 according to SEQ ID No. 2 can be cleaned in an advantageous manner.

The anion exchange column is preferably a QFF column (Amersham Pharmacia, Uppsala, Sweden), and the gel filtration column is a Pharmacia Sephacryl S-100 HR in XK 26/70 column.

Application to and elution from the anion exchange column is preferably carried out in the neutral to slightly alkaline range, preferably between pH 6.5 and pH 8.5, very particularly preferably at about pH 7.5. A 10 mM Tris-HCl buffer is preferably used for this. Elution of the protein is preferably achieved by slowly increasing the ionic strength of the elution buffer. This can be achieved, for example, by adding NaCl in a step gradient. Elution of the protein is preferably carried out at a NaCl concentration between 150 mM and 300 mM or when using a different salt with the same ionic strength.

After elution of the protein, the active fractions are preferably combined and concentrated. The application to the gel filtration column is preferably carried out under the same conditions as the application to the anion exchange column. The protein is eluted, for example, with a flow rate between 2 and 6 ml min ^"1 , in particular with a flow rate of about 4 ml min ^{" 1} .

In particular, the short-chain polypeptides according to the invention can also be synthesized using classic peptide synthesis (Merrifield technique). The present invention furthermore relates to a process for the production of crystals containing at least one of the polypeptides according to the invention, and to the crystals obtainable by this process. The crystallization is preferably carried out at a pH between 6.0 and 9.0, particularly preferably between 7.0 and 8.0, especially at a pH of about 7.5 and / or using PEG, especially PEG 4000, as a precipitant, the proportion of PEG preferably being between 10 and 50%, particularly preferably between 20 and 36%, especially about 28%, and / or in the presence of sodium acetate, the concentration of sodium acetate preferably being between 0.1 and 0.3 M, especially about 0.2 M.

The invention further relates to a test system for identifying substrates or functional interactors containing a nucleic acid according to the invention, a polypeptide according to the invention and / or an antibody according to the invention and, if appropriate, suitable auxiliaries and additives.

Bacillus subtilis is known to ward off plant pathogens and to treat symptoms of plant pests such as Erwinia, relieves. This positive effect is due not least to enzymes with hydrolytic activity, especially esterases and thioesterases. The present invention therefore furthermore relates to the use of at least one polynucleotide according to the invention and / or of at least one polypeptide according to the invention and / or of at least one antibody according to the invention for defense against plant pathogens and / or plant pests and a composition for the treatment of plant pathogens and / or plant pests, comprising at least one polynucleotide according to the invention and / or at least one polypeptide according to the invention and / or at least one antibody according to the invention.

In addition, a polynucleotide according to the invention can also be introduced into a plant in a manner known to the person skilled in the art in order to produce a polypeptide according to the invention in the plant and thus resistance to it To confer plant pathogens. The polynucleotide according to the invention can in particular be introduced into a single plant cell and a plant can be obtained therefrom by multiplication and differentiation, which comprises a polynucleotide and / or polypeptide according to the invention.

The present invention therefore also relates to a method for introducing a polynucleotide according to the invention into a plant cell and a plant and / or plant cell, comprising at least one polynucleotide according to the invention and / or at least one polypeptide according to the invention.

According to the invention, one or more nucleotides of the nucleic acids according to the invention or one or more amino acids of the polypeptides according to the invention or the antibodies according to the invention can also be modified. The modification can be a radioactive, fluorogenic or chromogenic group or a post-translational modification.

In the following, certain embodiments of the invention are explained by way of example with reference to illustrations and exemplary embodiments.

pictures

1 shows a nucleic acid sequence according to the invention of genomic DNA from Bacillus subtilis. This B. subtilis genomic DNA fragment comprises a full open reading frame (ORF) (esWßl) and two partial ORFs (ot 1 and otτ3). The putative Shine-Dalgamo sequence of the est4B gene is underlined. Sequences of the cloning vector pBluescript SK (-) are identified by bold italics.

FIG. 2 shows the cloned DNA fragment from FIG. 1 again schematically. In addition to the ORF for Est4B1 (BS1) and the two partial ORFs (ORF1, ORF3), some restriction interfaces were identified. The Amino acid sequence shows great similarity to putative proteins from ß. subtilis A13.

3 shows results of studies on the expression of Est4B1 by means of E. coli

BL21 (pMS470BS1) shown at 37 ° C. Expression was induced by adding lactose to a final concentration of 10 mM at different times: (A) induction took place immediately after inoculation, (B) 4 hours, (C) 6 hours, (D) 8 hours, (E ) 10 hours, (F) 12 hours after inoculation. (G) E. coli BL21 (pBluescript SK-) was used as a negative control. Protein crude lysates were applied.

4 shows the crystals of Est4B1 obtained according to the invention.

EXEMPLARY EMBODIMENTS

Example 1: Isolation and characterization of the Est4 bacterial strain

Large halos were observed on contaminated tributyrin emulsion agar plates. An insufficiently cleaned one was used in the manufacture of the agar plates

Ultrathurax homogenizer used, which had previously been used for the homogenization of plant material. A large halo bacterial culture was isolated and replated several times to ensure that there was a single colony. Halo formation was observed at room temperature as well as at 30, 37 and 50 ° C. The strain thus obtained was

Called Est4 and sent to the German Master Collection for Microorganisms and Cell Cultures (DSMZ) in Braunschweig (Germany) for characterization. There 4 different variants of this strain could be identified, which were called Est4A, Est4B, Est4C and Est4D. Est4A and Est4B were further characterized below. Both strains are ß. subtilis

Strains and the only difference between the two is that Est4A produces lecithinase but not Est4B. After receiving the separate strains from the DSMZ, the ß. subW / s strain Est4A was cultivated on LB agar plates, several morphological variants again being observed. It seems so that these variants represent different morphological forms of one and the same strain, and that these are not contaminating strains. Under the light microscope, the different variants showed the same shape, but different mobility. It has also been shown that Est4A, B, C and D have different esterase and lipase profiles. Esterase activity could be found in all 4 variants, but the variants Est4A and C additionally showed lipase activities with different stereo preferences. Est4B was subsequently used to clone the esterase.

Example 2: Bacterial strains and growth media

The Bacillus subtilis strains Est4A, Est4B, Est4C and Est4D were isolated from tributyrin emulsion agar plates and then cultivated on Luria Broth (LB) agar plates. E. coli SURE and the cloning vector pBluescript SK (-) from Stratagene (La Jolla, CA, USA) were used for the standard cloning experiments. E. coli BL21 (DE3) (Stratagene) was used as a host for enzyme production.

The vector pMS470Δ8 used for heterologous enzyme expression was a gift from E. Lanka (18).

E. co / 7 cells were normally grown at 37 ° C in LB medium containing 100 mg / l ampicillin. To prepare the tributyrin emulsion agar plates, 5-7 g / l tributyrin was added to the melted agar and then emulsified by sonification with an ultrathurax homogenizer before the agar was poured into the dishes.

Example 3: Preparation and Screening of a Genomic Library of β. subtilis Est4B

Genomic DNA from ß. subtilis Est4B was isolated using the Qiagen (Qiagen, Hilden, Germany) Genomic Kit (Tip 500) from cells that had grown overnight in LB medium at 37 ° C. 10 μg of the genomic DNA was partially digested with Sau3AI (Röche, Mannheim, Germany). The fragments were separated by size using agarose gel electrophoresis and

Fragments between 4-8 kb in size were excised from the gel and purified using the Qiaex DNA Elution Kit (Qiagen). The genomic DNA fragments were inserted into the ßamHI restriction site of the Vector pBluescript SK (-) ligated. The transformation of E. coli SURE cells was carried out directly with this ligation approach, without prior amplification of the library.

Active clones were identified using an agar plate filter paper esterase assay [13, 14]. 2-Chloropropionic acid-2-naphthyl ester was used as the substrate for screening the library. A clone called E. coli (pTB3) was isolated and the insert of the plasmid pTB3 was sequenced. The sequence is shown in Fig. 1. It shows that the insert is unusually ligated to the Bluescript vector SK (-) at one end.

Example 4: Sequence analysis of the ORF (open readinq frames) of pTB3 plasmid DNA was purified using a plasmid DNA isolation kit (Qiagen) and the insert was analyzed using an automated sequencer (ABI 373A Automated Sequencer) and using the Dye Deoxy Terminator Sequencing kits sequenced by Perkin Elmer Biosystems (California, USA). DNA and protein sequences were analyzed using the GCG Program Package (Genetics Computer Group, Madison, Wisconsin, USA).

The sequence analysis showed that the Bacillus subtilis DNA fragment contained in the vector pTB3 completely encoded one protein and two proteins partially (FIG. 2). The partially contained ORF1, which codes for the C-terminus of a protein, shows great amino acid sequence homology to integrated thioesterases from surfactin synthetase gene clusters. 98% amino acid sequence homology was found for the putative surfactin synthetase protein SrfC from Bacillus subtilis A13. The gene sequence of this highly homologous protein has Accession No. in the NCBI database. AF233756.

The ORF2 encoded a protein with 243 amino acids and was named Est4B1. This protein is homologous to a putative independent and non-C-terminally fused thioesterase from Bacillus subtilis A13 (Accession No. AAF87217) and to subunit 4 of a surfactin synthetase from Bacillus subtilis ATCC 21332, which is also known as cold shock protein CSI16 (Accession No. Q08788 ) is known. The

The function of surfactin synthetase has so far not been clarified. However, there are assumptions that it is involved in the termination of peptide synthesis or in the release of incorrectly charged molecules [28]. Interestingly, the predicted structure of Est4B1 showed greater homology to other enzymes in the alpha / beta-folded hydrolase family than to the esterases and lipases of this family. The strongest homology was found for the following enzymes: Haloperoxidase L (Streptomyces lividans), Chlorperoxidase F (Pseudomonas fluorescens), Bromperoxidase A2 (Streptomyces aureofaciens), Proline-Iminopeptidase (Seratia marescens), Haloalkane-Dehalogenase (Xanthobacter Autotrophic) (Hevea brasiliensis). For this reason it can be assumed that halogenated ester compounds and esters can also be reacted with nitrogen-containing groups of Est4B1.

Example 5: Preparation of the expression clone pMS47QBS1

PCR primers with restriction sites for Λ / ctel and Sph \ were produced

(B3ADstart: 5'GAACACACATATGGTCCAGCTC3 '. B3ADend: 5ΑGCGCATGCTGTCTGTCATATC3'). These primers were prepared in order to be able to introduce suitable restriction sites at the 5 'and 3' ends of the gene coding for the protein Est4B1 by means of PCR. The reaction was carried out in a total volume of 50 ul, using 10 ng template DNA (pTB3), 5 ul dNTPs (1 mM each), 200 ng of each primer, 5 ul PCR buffer (10 x Dynazyme) and 2 Units Dynazyme DNA polymerase (Finnzyme, Espoo, Finland). 6 cycles of 94 ° C (1 min), 38 ° C (2 min) and 72 ° C (2 min) were carried out, followed by 23 cycles of 94 ° C (1 min), 65 ° C (2 min) and 72 ° C (2 min). The PCR product was purified using the Qiaquick PCR Purification Kit (Qiagen) and then digested with Λ / el and Sph \. This was followed by ligation into the expression plasmid pMS470, replacing the insert of the vector pMS470Δ8. This vector contains the highly regulated fac promoter and enables the gene to be incorporated into an ATG start codon in the 3 'direction from a highly efficient Shine Dalgarno sequence which is derived from the T7 gene 10. The construct thus obtained was named pMS470BS1. E. coli was transformed with the plasmid thus obtained. Clones showing esterase activity were identified by the agar plate filter paper assay described above. The plasmid DNA of a positive clone was isolated after isolation sequenced to determine if the sequence matches the native sequence.

Example 6: Preparation of the esterase Est4B1 A preculture of E. coli BL21 (pMS470BS1) was prepared by culturing the cells in LB medium with 100 mg / l ampicillin overnight at 37 ° C. with shaking. This overnight culture was used to inoculate 100 ml LB medium in a 300 ml Erlenmeyer flask. With shaking, the cells were grown at 37 ° C until the culture was in the middle of the logarithmic growth phase. Finally, the main culture (300 ml in 1 l flask) was inoculated with 10 ml of the second preculture. To induce expression, a 1 M lactose stock solution was added immediately after inoculation in order to set a final concentration of 10 mM. The cells were cultivated for a further 12-14 hours at 37 ° C. and then harvested by centrifugation. The Zeil sediment was resuspended in 20 ml Tris-HCl buffer (0.1 M, pH 7.5) and after

Add 1 unit benzonase per flask frozen. The cell suspension was thawed and lysed by sonification (Branson Sonifier 250, pulsed sonification for 6 min). The cell residues were separated by centrifugation at 100,000 g for 1 hour. The supernatant with the soluble Est4B1 protein was aliquoted and frozen at -18 ° C.

In this way, the esterase Est4B1 could be obtained in very high yield. The expression of the esterase was very strong compared to the expression of other esterases that were produced under the same conditions. This indicated that the codon use in this Bacillus subtilis gene is very well suited for expression in E. coli. The first 150 codons in particular have a lower GC content compared to the corresponding codons from esterases from other organisms, so that there are fewer melting RNA structures and thus the expression in E. coli is facilitated.

Example 7: Purification of the esterase Est4B1

The protein was purified by a two step process. The supernatant was placed on a 15 ml QFF column (Amersham Pharmacia, Uppsala, Sweden) and using a step gradient, starting with buffer A (10 mM Tris-HCl, pH 7.5) and increasing the proportion of buffer B (10 mM Tris-HCl, pH 7.5, 2M NaCl). The majority of Est4B1 was eluted by passing 15 ml of buffer containing 8.5% of buffer B over the column and then passing a further 30 ml of buffer over the column, with a flat one

Gradient was applied so that the proportion of buffer B increased from 8.5% to 13%. The fractions with the enzyme were then combined and concentrated to 5-8 ml by ultrafiltration using the Centricon YM-10 centrifugation columns (Millipore, Bedford, USA). For further purification, gel filtration was carried out with a Pharmacia Sephacryl S-100 HR in an XK 26/70 column at a flow rate of 4 ml min ^"1. Est4B1 was obtained in a very clean form in this way. MALDI was used to determine the molecular weight of the Enzyme determined a value of 27445 Da, however, the calculated average molecular weight was 27760 Da This small difference may be due to a post-translational N-terminal modification of the first amino acids or else

Inaccuracies in mass spectrometry.

Example 8: Crystallization of the Est4B1 protein

An enzyme solution with a protein concentration of 6.5 mg / ml was used for the crystallization experiments. The vapor pressure

Diffusion method of hanging drop (hangig drop) applied. For this purpose, siliconized glass plates and Linbro culture plates with 24 wells were used in a manner known to the person skilled in the art. The glass plates with the drops were applied to the wells and then sealed using high vacuum grease. To prepare the drops, 5 μl of protein solution and 5 μl of the precipitant-containing solution, which was taken from the 750 μl reservoir applied in the well, were mixed together. The experiments were preferably carried out at 20 ° C. Hampton's Coarse Matrix Crystallization Screen was used as the standard. Plate-shaped crystals were observed under the following conditions: 28%

PEG 4000, 0.2 M NaAc, 0.1 M Tris-HCl, pH 7.5. The crystals obtained represent an important step in solving the 3D structure of this class of hydrolytic enzymes. Example 9: Enzvm Assavs for Determining the Hydrolytic Activity of Est4B1

Aqarplatten filter paper assay

Positive signals with the agar plate filter paper assay regarding the hydrolysis of 2-naphthyl 2-chloropropionate showed that Est4B1 has esterase activity. Crude lysates from E. coli BL21 (DE3) or purified enzyme were used for further analysis of the esterase activity of this enzyme.

Photometric assay Esterase activity was measured photometrically in Tris-HCl buffer (100 mM, pH 7.0) using ortho- and para-nitrophenyl butyrate (4 mM in DMSO) as substrates. The amount of nitrophenol released in the enzymatic reaction was determined photometrically at 405 nm and room temperature. An activity unit is defined as the amount of enzyme which releases 1 μmol alcohol min ⁻¹ under the assay conditions. Under the given conditions, the extinction coefficients of ortho- and para-nitrophenol are 2.42 and 9.6 ml μmol / 1, respectively In the photometric assay with 4-nitrophenyl butyrate, a specific activity of 0.3 U / mg was determined, while with 2-nitrophenyl butyrate as the substrate, a value of less than 0.01 U / mg was determined Assays are summarized in Table 1.

Enzyme preparations that had been purified by anion exchange chromatography were used in the alkali titration.

Alkalimetric titration

Esterase activity of Est4B1 with respect to tributyrin, ethyl 3-hydroxybutyrate and methyl 2-chloropropionate was determined by alkali titration using the Mettler DL 21 autotitrator from Mettler Toledo (Switzerland). For this purpose, 50 ml of 20 mM NaH ₂ PO ₄ solution with 100 μl of substrate and 0.75 ml of BS1 lysate (corresponding to 56 U esterase, determined using para-nitrophenyl butyrate) at pH 7.5 and 30 ° C. were used. An activity of Est4B1 with regard to methyl 2-chloropropionate of 0.5 U / mg protein was determined. As the optimum pH for the Hydrolysis was found to be 8. The activity was greatly reduced at a pH of less than 6.5. The protein already precipitated in the slightly acidic range. The hydrolytic activity for 3-hydroxybutyric acid ethyl ester was less than 0.01 U / mg. No activity was observed with tributyrin as the substrate.

Tab. 1: Substrates that were examined for hydrolysis by Est4B1 photometrically or alkalimetrically

+ = strong activity, +/- = weak activity, - = no activity, nd = not determined

Thin layer chromatography (TLC)

The thin-layer chromatographic (TLC) experiments were carried out by suspending 100 μl of crude bacteria lysate from the cultures overexpressing Est4B1 in 0.5 ml of buffer (0.1 NaH ₂ PO, pH 7.3). Crude lysate from cells without a vector was used as a negative control. After the addition of the substrate (20 μl), the mixture was shaken on a rotary shaker (150 rpm) at room temperature (25 ° C.). Samples were taken after 2 and 4 hours and after 1 day (20-24 hours) and analyzed directly by TLC using Merck Silicagel 60 F ₂₅₄ . As far as technically feasible, the substrates specified in Table 4 were used in the TLC.

The composition of the eluent (cyclohexane / ethyl acetate) and the visualization method (spraying with vanillin / H ₂ SO conc. Or cerammonium molybdate as well as heat treatment and / or UV detection) were selected depending on the substrate. For example, a mixture of petrol / ethyl acetate (3: 1) was used for the substrates octanyl-2-acetate and 2-chloropropionic acid-2-naphthyl ester for elution and the products were made visible by vanilla / H ₂ SO _{4 conc} . were sprayed. A mixture of petrol / ethyl acetate (1: 1) was used for the elution for the substrates mandelic acid ethyl ester and 3-hydroxybutanoic acid ethyl ester. The resulting compounds were made visible by UV detection in the case of the mandelic acid ethyl ester and by spraying with cerammonium molybdate in the case of the hydroxybutanoic acid ethyl ester. The substrates mentioned were obtained from Sigma (St. Louis, MO, USA), with the exception of the 2-chloropropionic acid-2-naphthyl ester and the 2-octanylacetate, which were given by Michael Schmidt from the Institute of Organic Chemistry (Graz University of Technology) were obtained.

The hydrolytic activity of the esterase with respect to the substrates could be determined by the conversion rate of the acetate into the corresponding alcohol or of the ester into the corresponding acid. The conversion rate was determined in the TLC on the basis of the color intensities of the starting material and the products. Tab. 2 gives an overview of the results of the TLC.

Tab. 2: Results of the TLC analysis (+ weak activity (<20% conversion); ++ high activity (~ 20-50% conversion): - no detectable activity: for numbering the substrates see Tab. 4)

Est4B

1 -

3 +

4 ++

5 -

6 ++

7 -

8th -

9 ++

10 -

11 ++

13 ++

15 -

16 - It was observed, for example, that after 20 hours the majority of the 2-chloropropionic acid 2-naphthyl ester had been hydrolyzed by Est4B1, while hydrolysis of ethyl mandelate (15, 16) or octanoyl-2-acetate was not observed. A total of 5 substrates could be found, which are sufficiently converted by the esterase Est4B1 (marked with ++ in Table 2) with regard to industrial applications and which could then be examined for selectivity of the conversion. All substrates with up to about 50% conversion were used in further investigations to investigate the enantioselectivity of the conversion.

The activity of the esterase with regard to the compounds 2 and 12 had to be examined by means of gas chromatography, since compound 12 cannot be visualized by TLC and compound 2 is very volatile. Furthermore, the acid (R, S) - 3-hydroxy-2-methy! -Propionic acid formed in the reaction of compound 14 is not a stable product, so that the investigation of this reaction by means of TLC was also not possible.

Chiral gas chromatography (GC) and high pressure liquid chromatograph (HPLC) The activity analysis was carried out in aqueous sodium phosphate buffer (0.1 M; pH 7.3). Usually 5 ml buffer was mixed with 250 μl enzyme

(Bacterial crude lysate) and 100 μl of substrate are added. The mixture thus obtained was shaken on a stirred shaker at 150 rpm at room temperature (approx. 25 ° C.). Samples were taken after 2, 5 and about 20 hours and the reaction was stopped by adding 0.5 ml CH ₂ Cl ₂ . After extraction,

Centrifugation and separation of the aqueous phase, the organic phase was dried over sodium sulfate. A 1 µl aliquot was used for the GC after being filtered through a filter membrane (nylon, 03 mm, 0.2 µm, Roth).

The enantiomeric purity of the product was determined on a 2,3,6-tri-O-methyl-β-cyclodextrin column (Chrompack Chirasil-Dex-CB, 25 mx 0.32 mm, 0.25 μm film, H ₂ ). 2-Chloropropionic acid 2-naphthyl ester 11 and 1-acetoxy-2-phthalimido-butane 6 were thus subjected to HPLC analysis. In the first case, however, only the ester could be observed by UV, while in relation to compound 6 only the corresponding alcohol could be determined on a Chiralcel OD-H column (Daicel 25 cm x 0.46 cm).

The following reaction conditions were specified: Analysis parameters for the 6-alcohol: heptane: isopropanol = 90: 10; Flow rate 0.5 ml min ^"1 , 10 ° C, UV detection at 230 nm. Analysis parameters for compound 11: heptane: isopropanol = 95: 5, flow rate 0.5 ml min ^{" 1} , 10 ° C, UV Detection at 254nm.

Tab. 3: Results of chiral gas chromatography and HPLC for substrate 6 (values after 2, 5 and 24 hours)

Est-4B

Ester alcohol conversion

I / acids ee [% ee [%] [% f

2h ^t 31 24

6 5h ^b 50 40

1d ^b 56 63 the conversion was calculated in relation to the amount of alcohol formed or in terms of the amount of acid ^{b formed,} the ester could not be resolved by HPLC

Although the library from B. subtilis Est4B was examined for clones, the (R, S) - 2-chloropropionic acid 11 hydrolysed and the results of the TLC analysis with regard to compound 11 gave no hope (Table 1) enantioselective hydrolysis of this compound by the esterase Est4B1 can be observed.

With regard to substrate 6 (+) - N-phthaloyl-2-amino-1-butyl acetate, the esterase Est4B1 (56% ee, 63% conversion) showed selectivity with respect to the alcohol (Tab. 2). The enantiomeric purity of the corresponding acetate has not yet been determined. Interestingly, the esterase Est4B1 showed an opposite enantio preference compared to three other esterases tested. Est4B1 showed almost no activity and selectivity with regard to the acetate of (R, SJ-3-butyn-2-ol (2), tetrahydrofuran-3-acetate (4), tetrahydrofuran-2-methyl ester in GC / HPLC (9), 3-hydroxybutyric acid ethyl ester (13) and 4-hydroxyisobutyric acid methyl ester (14).

Production of the substrates:

Acetates 1, 2, 4, and 7 and butyrate 3, as well as methyl esters 8 and 9, were prepared according to the following protocol:

A solution of alcohol (10 mmol) in CH ₂ CI ₂ (10 ml) was treated with acid anhydride (20 mmol) at room temperature, then pyridine (20 mmol) and a catalytic amount of 4- (dimethylamino) pyridine (Merck- Schuchardt) added. All compounds were purified using silica gel chromatography or Kugelrohr distillation.

The carboxylic acid (10 mmol) was carried out with a catalytic amount of H ₂ SO ₄ (conc.) And a 10-fold excess of methanol in the reflux process. All esters were purified using silica gel chromatography or Kugelrohr distillation.

Substrate 6

The amino group (±) -2-phthalimido-1-butanol (6) (Kumar et al. 1997) was protected by standard protective group procedures:

Phthalic anhydride (50 mmol; 7.4 g) and 2-amino-1-butanol (45.5 mmol; 4.05 g) were melted at a temperature of 140 ° C. The reaction mixture was diluted with 200 ml CH ₂ CI ₂ and with NaHCO ₃ (4 x 100 ml) and water (4 x

500 ml) washed. After drying over Na ₂ SO ₄ , the crude product was acetylated and then purified. The acetate was prepared by the following procedure: A solution of alcohol (28.5 mmol; 6.26 g) in CH ₂ Cl ₂ (10 ml) was treated with acid anhydride (57.1 mmol; 4.52 g), then with pyridine (57.1 mmol;

4.52 g) and with a catalytic amount of 4- (dimethylamino) pyridine (Merck-Schuchardt) at room temperature for 5 hours. In addition, a stoichiometric amount of methanol was added to destroy the excess of acid anhydride, and the mixture thus obtained was kept for 4 hours touched. The reaction mixture was washed with HCl 0.5 N (2 x 40 ml), NaHCO ₃ (2 x 50 ml) and water (1 x 50 ml). After drying over Na ₂ SO ₄ , the acetate obtained was purified by means of silica gel chromatography (gasoline: ethyl acetate = 2: 1).

Table 4: Overview of some of the substrates tested

literature

[I] UT Bornscheuer, RJ Kazlauskas, Hydrolases in OrganicSynthesis - Regio- and Stereoselective Biotransformations, Wiley-VCH: Weinheim (1999) [2] K. Faber, Biotransformations in Organic Chemistry, 4 ^th ed .; Springer: Berlin (2000)

[3] Pandey A, Benjamin S, Soccol CR, Nigam P, Krieger N, Soccol VT, Biotechnol. App.l Biochem. 29 (1999) 119

[4] R.J. Kazlauskas, A.N.E. Weissfloch, A.T. Rappaport, L.A. Cuccia, J. Org. Chem. 56 (1991) 2656 [5] K. Takahashi, T. Yoshimoto, A. Ajima, Y. Tamaura, Y. Inada, Enzyme 32 (1984) 235

[6] T. Nishio, M. Kamimura, M. Murata, Y. Terao, K. Achiwa, J. Biochem. (Tokyo) 104 (1988)

81

[7] X.F. Kou, J.N. Xia, J.L Xu, Sheng Wu Gong Cheng Xue Bao. 16 (2000) 116

[8] M. Pogorevc, K. Faber, J. Mol. Catal. B: enzyme. 10 (2000) 357 [9] M. Baumann, B.H. Hauer, U.T. Bornscheuer, Tetrahedron Asymetry 11 (2000) 4781

[10] F.H. Arnold, Acc. Chem. Res. 31 (1998) 125

[I I] J. Minshull, W.P. Stemmer, curr. Opin. Chem. Biol. 3 (1999) 284

[12] E.L. Petersen, G. Valinger, B. Soelkner, G. Stubenrauch, H. Schwab, J. Biotech. (2001) in press [13] B. Reiter, A. Glieder, D. Talker, H. Schwab, Appl. Microbiol. Biotechnol 54 (2000) 778

[14] A. Schlacher, T. Stanzer, I. Osprian, M. Mischitz, E. Klingsbichel, K. Faber, H. Schwab,

J. Biotechnol. 1998 Jun 11; 62 (1): 47-54.

[15] A. Schlacher, T. Stanzer, B. Soelkner, E. Klingsbichel, E. Petersen, M. Schmidt, N.

Kiempier, H. Schwab, J. Mol. Catal. B: enzyme. 3 (1997) 25 [16] M. Gudelj, G. Valinger, K. Faber, H. Schwab, J. Mol. Catal. B: enzyme. 5 (1998) 261

[17] A. Hermetter, F. Paltauf, E. Zenzmaier, A. Schlacher, H. Schwab, K. Faber, in: New Frontiers for Microbial Catalysts (K. Kieslich, CP van der Beek, JAM de Bont and WJJ van den Tweel, eds.) Elsevier, Amsterdam, (1997) 53 [18] D. Balzer, P. Bucher, K. Hofmann, Nucleic Acids Res 20 (1992) 1851 [19] H. Cho, JE Cronan Jr, J. Biol. Chem. 268 13 (1993) 9238 [20] P. Cosmina, F. Rodriguez, F. de Ferra, G. Grandi, M. Perego, G. Venema, D van

Sinderen, Mol. Microbiol. 8 (1993) 821

[21] F. Peypoux, J.M. Bonmatin, J. Wallach, Appl. Microbiol. Biotechnol. 51 (1999) 553

[22] D. Konz, S. Doekel, M.A. Marahiel, J. Bacteriol. 181 (1999) 133 [23] H.D. Mootz, M.A. Marahiel, J. Bacteriol. 179 (1997) 6843

[24] D. Konz, A. Kiens, K. Schorgendorfer, M.A. Marahiel, Chem Biol. 4 (1997) 927

[25] J.W. Trauger, R.M. Kohli, H.D. Mootz, M.A. Marahiel, CT. Walsh, Nature 407 (2000)

215

[26] R.S. Gokhale, D. Hunziker, D.E. Cane, C. Koshla, Chem. Biol. 6 (1998) 117 [27] R. Aggarwal, P. Caffrey, P.F. Leadlay, C.J. Smith, J. Staunton, J. Chem. Soc. Chem.

Comm. 15 (1995) 1519

[28] A. Schneider, M.A. Marahiel, Arch. Microbiol. 169 (1998) 404

[29] P. Cosmina, F. Rodriguez, F. de Ferra, G. Grandi, M. Perego, G. Venema, D. van

Sinderen, Mol. Microbiol. 8 (1993) 821 [30] LA Kelley, R.M. MacCallum, M.J.E. Stemberg, J. Mol. Biol. 299 (2000) 501

[31] N. Battchikova, M. Koivulehto, A. Denesyuk, L. Ptitsyn, Y. Boretsky, J. Hellman, T.

Korpela, J. Biochem. 120 (1996) 425

Claims

claims

1. Polynucleotide selected from the group consisting of: a) polynucleotide with a nucleic acid sequence from position 556 to 1287 according to SEQ ID No. 1, b) Polynucleotides coding for a polypeptide with an amino acid sequence according to SEQ ID No. 2, c) naturally occurring or artificially produced mutants or polymorphic forms or alleles of a polynucleotide according to (a) or (b), d) complementary to a polynucleotide according to (a), (b) or (c)

Polynucleotides, e) polynucleotides that hybridize under stringent conditions with a polynucleotide according to (a), (b), (c) or (d), f) polynucleotides with a sequence homology or identity of at least 50% with respect to a polynucleotide according to (a), (b), (c), (d) or (e), g) polynucleotides which consist of at least 10 successive nucleic acids of a nucleic acid according to (a), (b), (c), (d) or ( e) exist, h) polynucleotides with deletions or insertions of up to 50 nucleic acids compared to a nucleic acid according to (a), (b), (c), (d) or (e), i) polynucleotides which contain at least one of the ( a) to (h)

Include nucleic acids.

2. Polynucleotide according to claim 1, coding for an enzyme with hydrolytic activity.

3. Polynucleotide according to claim 2, coding for an enzyme with esterolytic or lipolytic activity.

4. The polynucleotide according to claim 1, wherein the enzyme is an enzyme with alpha / beta hydrolase folding.

5. The polynucleotide according to claim 1, wherein the enzyme is an esterase, thioesterase, dehalogenase, halogen peroxidase, epoxy hydrolase or lipase.

6. Polynucleotide according to claim 1, wherein the enzyme is the esterase Est4B1 according to SEQ ID No. 2 acts.

7. The nucleic acid of claim 1, wherein the nucleic acid comprises one or more non-coding sequences.

8. A method for producing and / or identifying a nucleic acid according to any one of the preceding claims, characterized in that the nucleic acid is chemically synthesized, isolated from a gene bank using a probe, obtained by polymerase chain reaction and / or by mutagenesis experiments.

9. The method according to claim 8, comprising the following steps: a) a nucleic acid library is contacted with a nucleic acid according to claim 1, b) a nucleic acid which hybridizes with a nucleic acid according to claim 1 is identified, c) the step (b ) identified nucleic acid is sequenced.

10. The method according to claim 8, comprising the following steps: a) starting from a nucleic acid according to SEQ ID No. 1 will be

Primers produced, b) the primers according to (a) are used to amplify nucleic acids of unknown nucleic acid sequence in the PCR, c) the nucleic acids obtained according to (b) are sequenced.

11. The method according to claim 8, comprising the following steps: a) a nucleic acid according to claim 1 is subjected to mutagenesis experiments, b) the mutants obtained are sequenced, incorporated into a suitable vector and expressed, c) the expression products according to (b) are examined for hydrolytic activity.

12. The method according to claim 8, comprising the following steps: a) nucleic acids from a library are incorporated into suitable vectors and these are introduced into suitable host organisms, preferably bacteria, in particular E. coli, so that the nucleic acids can be expressed, b) according to (a) the host organisms obtained are plated out and incubated on a solid support, preferably an agar plate, c) an assay, for example a color reaction, which involves the reaction of a hydrolase substrate, for example naphthylacetate, is carried out on the solid support, d) hydrolase-positive clones are identified, for example by visual observation, by automated image analysis or by means of photometric measurement, and purified, e) the nucleic acids from the clones identified in step (d) are sequenced.

13. A vector comprising a nucleic acid according to claim 1.

14. The host cell comprising a vector according to claim 13.

15. The host cell of claim 14, wherein the host cell is Bacillus subtilis or E. coli.

16. Polypeptide selected from the group consisting of: a) polypeptide with an amino acid sequence according to SEQ ID No. 2, b) naturally occurring or artificially generated mutants, polymorphic forms or alleles of a polypeptide according to (a), c) polypeptides which have a sequence homology or identity of at least 50% with respect to a polypeptide according to (a) or (b), d) polypeptides which are encoded by nucleic acids according to claim 1, ⁵ e) polypeptides consisting of at least 5 consecutive

Amino acids of a polypeptide according to (a) or (b), f) polypeptides with insertions and / or deletions of up to 60 amino acids in relation to a polypeptide according to (a), (b) or (c), g) polypeptides which at least comprise one of the ° polypeptides mentioned under (a) to (f).

17. The polypeptide according to claim 16, wherein the polypeptide is a protein with hydrolytic activity.

⁵ 18. The polypeptide of claim 17, wherein it is the polypeptide is a Iipolytisches or esterolytisches enzyme.

19. The polypeptide according to claim 16, wherein the polypeptide is an esterase, thioesterase, dehalogenase, halogen peroxidase, epoxy hydrolase ⁰ or lipase.

20. The polypeptide of claim 16, wherein the polypeptide is an enzyme with alpha / beta hydrolase folding.

⁵ 21. The polypeptide of claim 16, wherein the polypeptide is the esterase Est4B1 according to SEQ ID No. 2 acts.

22. The polypeptide of claim 16, which is a water-soluble protein. 0

23. A method for producing a polypeptide according to claim 16, characterized in that a nucleic acid according to claim 1 is expressed in a suitable host cell.

24. The method of claim 23, wherein the host cell is Bacillus subtilis or E. coli.

25. The method according to claim 24, comprising the following steps: a) a nucleic acid according to claim 1 is incorporated into a suitable vector and E. coli is transformed with the vector, b) after the expression of the protein, the cells are harvested and disrupted, c) the protein is purified from the supernatant thus obtained.

26. Antibody against a polypeptide according to claim 16.

27. A method for producing an antibody according to claim 26, characterized in that a mammal is immunized with a polypeptide according to claim 16 and optionally the resulting antibodies are isolated.

28. Test system for identifying substrates or functional interactors containing a nucleic acid according to claim 1, a polypeptide according to claim 16 and / or an antibody according to claim 26 and optionally suitable auxiliaries and additives.

29. Use of a polypeptide according to claim 16 for the cleavage or preparation of compounds having haloalkane, ester, thioester, amide, halide or peptide bonds.

30. Use of a polynucleotide according to claim 1 for the production of heterologous nucleic acids with improved expression properties.

31. A method for producing heterologous expression constructs coding for an enzyme with hydrolytic activity, comprising the following steps: a) a nucleic acid comprising a polynucleotide coding for an enzyme with hydrolytic activity is presented, b) the 5'-terminal portion of the polynucleotide according to (a) is completely or partially replaced by a polynucleotide according to claim 1.

32. Use of a polynucleotide according to claim 1, a polypeptide according to claim 16 and / or an antibody according to claim 26 for controlling plant pathogens and / or plant pests.

33. A composition for controlling plant pathogens and / or plant pests, containing at least one polynucleotide according to claim 1 and / or at least one polypeptide according to claim 16 and / or at least one antibody according to claim 26 and suitable auxiliaries and / or additives.

34. Plant and / or plant cell containing at least one polynucleotide according to claim 1 and / or at least one polypeptide according to claim 16 and / or at least one antibody according to claim 26.

35. Crystals containing at least one polypeptide according to claim 16.