WO2004010106A2 - METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY - Google Patents

METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY Download PDF

Info

Publication number
WO2004010106A2
WO2004010106A2 PCT/US2003/023075 US0323075W WO2004010106A2 WO 2004010106 A2 WO2004010106 A2 WO 2004010106A2 US 0323075 W US0323075 W US 0323075W WO 2004010106 A2 WO2004010106 A2 WO 2004010106A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
compounds
target rna
rna
library
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/023075
Other languages
French (fr)
Other versions
WO2004010106A3 (en
Inventor
Ellen M. Welch
Neil Gregory Almstead
Robert F. Rando
Mathew C. Pellegrini
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
PTC Therapeutics Inc
Original Assignee
PTC Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by PTC Therapeutics Inc filed Critical PTC Therapeutics Inc
Priority to CA002493808A priority Critical patent/CA2493808A1/en
Priority to US10/521,775 priority patent/US7927791B2/en
Priority to AU2003252136A priority patent/AU2003252136A1/en
Priority to EP03765998A priority patent/EP1543157A4/en
Publication of WO2004010106A2 publication Critical patent/WO2004010106A2/en
Publication of WO2004010106A3 publication Critical patent/WO2004010106A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00Nanotechnology for materials or surface science, e.g. nanocomposites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to a method for screening and identifying compounds that modulate premature translation termination and/or nonsense-mediated messenger ribonucleic acid (“mRNA”) decay by interacting with a preselected target ribonucleic acid (“RNA").
  • mRNA messenger ribonucleic acid
  • RNA target ribonucleic acid
  • the present invention relates to methods of identifying compounds that bind to regions of the 28S ribosomal RNA ("rRNA”) and analogs thereof.
  • Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular compound is detected using any physical method that measures the altered physical property of the target RNA bound to a compound.
  • the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.
  • Protein synthesis encompasses the processes of translation initiation, elongation, and termination, each of which has evolved to occur with great accuracy and has the capacity to be a regulated step in the pathway of gene expression.
  • the RNA triplets UAA, UAG, and UGA are non- coding and promote translational termination. Termination starts when one of the three termination codons enters the A site of the ribosome, thereby signaling the polypeptide chain release factors to bind and recognize the termination signal.
  • Nonsense-mediated mRNA decay is a surveillance mechanism that minimizes the translation and regulates the stability of RNAs that contain chain termination nonsense mutations (see, e.g., Hentze & Kulozik, 1999, Cell 96:307-310; Culbertson, 1999, Trends in Genetics 15:74-80; Li & Wilkinson, 1998, Immunity 8:135-141; and Ruiz- Echevarria et al, 1996, Trends in Biological Sciences, 21 :433-438).
  • Chain termination nonsense mutations are caused when a base substitution or frameshift mutation changes a codon into a termination codon, i.e., a premature stop codon that causes translational termination.
  • nonsense-mediated mRNA decay mRNAs with premature stop codons are frequently subjected to degradation. A truncated protein is produced as a result of the translation apparatus prematurely terminating at the stop codon.
  • Nonsense mutations cause approximately 10 to 30 percent of the individual cases of virtually all inherited diseases. Although nonsense mutations inhibit the synthesis of a full-length protein to one percent or less of wild-type levels, minimally boosting the expression levels of the full-length protein to between five and fifteen percent of normal levels can eliminate or greatly reduce the severity of disease. Nonsense suppression causes the read-through of a termination codon and the generation of full-length protein. Certain ammoglycosides have been found to promote nonsense suppression (see, e.g., Bedwell et al, 1997, Nat. Med. 3:1280-1284 and Howard et al, 1996, Nat. Med. 2:467-469).
  • gentamicin is an aminoglycoside antibiotic that causes translational misreading and allows the insertion of an amino acid at the site of the nonsense codon in models of cystic fibrosis, Hurlers Syndrome, and muscular dystrophy (see, e.g., Barton-Davis et al, 1999, J. Clin. Invest. 104:375-381).
  • RNA ribosomal RNA
  • the antibiotic thiostrepton binds tightly to a 60-mer from ribosomal RNA (Cundliffe et al, 1990, in The Ribosome: Structure, Function & Evolution (Schlessinger et al, eds.) American Society for Microbiology, Washington, D.C. pp. 479- 490)
  • bacterial resistance to various antibiotics often involves methylation at specific rRNA sites (Cundliffe, 1989, Ann. Rev. Microbiol. 43:207-233).
  • ammoglycosides and other protein synthesis inhibitors have been found to interact with specific bases in 16S rRNA (Woodcock et al, 1991, EMBO J. 10:3099-3103); moreover, an oligonucleotide analog of the 16S rRNA has been shown to interact with certain ammoglycosides (Purohit et al, 1994, Nature 370:659-662).
  • Aminoglycosidic aminocyclitol (aminoglycoside) antibiotics and peptide antibiotics are known to inhibit group I intron splicing by binding to specific regions of the RNA (von Ahsen et al, 1991, Nature (London) 353:368-370).
  • ammoglycosides have also been found to inhibit hammerhead ribozyme function (Stage et al, 1995, RNA 1 :95-101). A molecular basis for hypersensitivity to ammoglycosides has been found to be located in a single base change in mitochondrial rRNA (Hutchin et al, 1993, Nucleic Acids Res. 21:4174-4179). Ammoglycosides have also been shown to inhibit the interaction between specific structural RNA motifs and the corresponding RNA binding protein. Zapp et al.
  • the present invention provides methods for identifying compounds that modulate translation termination and/or nonsense-mediated mRNA decay by identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements, hi particular, the present invention provides methods of identifying compounds that bind to regions of the 28S rRNA and analogs thereof.
  • the specific target RNA sequences, RNA structural motifs, and or RNA structural elements are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements.
  • a preselected target RNA having a detectable label or method of detection is used to screen a library of compounds, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the target RNA bound to a compound.
  • methods are described in which a preselected target RNA is used to screen a library of compounds, with each compound in the library having a detectable label or method of detection, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the compound bound to target RNA.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, in, e.g., labeled tubes or microtiter plate, and detecting the formation of a target RNAxompound complex, hi particular, the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of the 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, in, e.g., labeled tubes or a microtiter plate, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA, or RNA
  • detectably labeled complex Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex.
  • the detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, labeled target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA.
  • Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships (“SARS”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds bound, wherein each compound in the library is attached to a solid support, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions of 28S rRNA or RNA containing a premature stop codon
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds wherein each compound is attached to a solid support, (e.g., a bead-based library of compounds or a microarray of compounds), and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon
  • a target RNA e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon
  • a target RNA e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon
  • a target RNA e.g., regions or fragments of 28S rRNA, or
  • Solid support detectably labeled complex e.g., a bead- based-detectably labeles complex
  • unbound solid support e.g., beads
  • unbound target RNA in the liquid phase
  • physical means including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds free in solution, in e.g., labeled tubes or a microtiter plate, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon
  • the detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA.
  • methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships (“SARS”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA attached or conjugated to a solid support with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex.
  • Target RNA molecules that bind to labeled compounds will form a detectable labeled complex.
  • Target RNA molecules that bind to labeled compounds will form solid support- detectably labeled complex, which can be separated from unbound solid support-target
  • RNA and unbound labeled compounds in the liquid phase by a number of means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex.
  • the invention provides a method for identifying a compound that binds to a target RNA, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon; and (b) detecting the formation of a labeled target RNAxompound complex,
  • the invention provides a method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a detectably labeled target RNAxompound complex formed from contacting a detectably labeled RNA with a member of a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a label
  • each compound in the library may be attached to a solid support.
  • solid supports include a silica gel, a resin, a derivatized plastic film, a glass bead, cotton, a plastic bead, a polystyrene bead, an aluminum gel, a glass slide or a polysaccharide.
  • the invention provides a method for identifying a compound that binds to a target RNA, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectable target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon; and (b) detecting the formation of a target RNAxompound complex.
  • the invention provides a method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a target RNAxompound complex formed from contacting a RNA with a member of a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon.
  • the target RNA may be attached to a solid support.
  • Non-limiting examples of solid supports include a silica gel, a resin, a derivatized plastic film, a glass bead, cotton, a plastic bead, a polystyrene bead, an aluminum gel, a glass slide or a polysaccharide.
  • the invention provides a method for identifying a compound that binds to a target RNA, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of labeled and the formation of a detectable target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon; and (b) detecting the formation of a target RNAxompound complex.
  • the invention provides a method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a target RNAxompound complex formed from contacting a labeled RNA with a member of a library of detectably labeled compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of labeled compounds and the formation of a target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA or contains a premature stop codon.
  • the target RNA may be attached to a solid support. Non-limiting examples of solid supports are provided infra.
  • FRET fluorescence resonance energy transfer
  • Examples of FRET assays are known in the art and are also provided herein (see, e.g., Section 5.6.2).
  • the methods described herein for the identification of compounds that directly bind to 28S rRNA or a RNA containing a premature stop codon are well suited for high-throughput screening.
  • the direct binding method of the invention offers advantages over drug screening systems for competitors that inhibit the formation of naturally- occurring RNA binding protein.'target RNA complexes; i.e., competitive assays.
  • the direct binding method of the invention is rapid and can be set up to be readily performed, e.g., by a technician, making it amenable to high-throughput screening.
  • the methods of the invention also eliminate the bias inherent in the competitive drug screening systems, which require the use of a preselected host cell factor that may not have physiological relevance to the activity of the target RNA. Instead, the methods of the invention are used to identify any compound that can directly bind to a target RNA, (e.g., 28S rRNA or a RNA containing a premature stop codon), preferably under physiologic conditions. As a result, the compounds so identified can inhibit the interaction of the target RNA with any one or more of the native host cell factors (whether known or unknown) required for activity of the RNA in vivo.
  • a target RNA e.g., 28S rRNA or a RNA containing a premature stop codon
  • the compounds utilized in the assays described herein may be members of a library of compounds.
  • the compound is selected from a combinatorial library of compounds comprising peptides; random biooligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; ohgocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries.
  • the small organic molecule libraries are libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones.
  • the compounds are screened in pools. Once a positive pool has been identified, the individual compounds of that pool are tested separately, hi certain embodiments, the pool size is at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 150, at least 200, at least 250, or at least 500 compounds.
  • the structure of the compound may be determined utilizing well-known techniques or by referring to a predetermined code.
  • assays of microarrays of compounds may be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays.
  • Another method for identifying compounds includes de novo structure determination of the compounds using, for example, mass spectrometry or nuclear magnetic resonance ("NMR").
  • NMR nuclear magnetic resonance
  • the compounds identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and the like.
  • small organic molecules which interact specifically with target RNA molecules may be useful as lead compounds for the development of therapeutic agents.
  • a compound identified in accordance with the methods of the invention may bind to a premature stop codon.
  • a compound identified in accordance with the methods of invention may also disrupt an interaction between a premature stop codon and the mRNA translation machinery.
  • a compound identified in accordance with the methods of the invention binds to RNA and suppresses premature translation termination and/or nonsense-mediated mRNA decay of a gene encoding a protein, polypeptide or peptide whose expression is beneficial to a subject.
  • a compound identified in accordance with the methods of the invention binds to RNA and increases premature translation termination and/or nonsense-mediated mRNA decay of a gene encoding a protein, polypeptide or peptide whose expression is detrimental to a subject.
  • a compound identified in accordance with the methods of the invention preferentially or differentially modulates premature translation termination and/or nonsense-mediated mRNA decay of a specific nucleotide sequence of interest relative to another nucleotide sequence.
  • the compound identified using the assays described herein is a small molecule.
  • the compound identified using the assays described herein is not known to affect premature translation termination and/or nonsense-mediated mRNA decay of a nucleic acid sequence, in particular a nucleic acid sequence of interest.
  • the compound identified using the assays described herein has not been used as or suggested to be used in the prevention, treatment, management and/or amelioration of a disorder associated with, characterized by or caused by a premature stop codon.
  • the compound identified using the assays described herein has not been used as or suggested to be used in the prevention, treatment, management and/or amelioration of a particular disorder described herein.
  • a compound identified in accordance with the methods of the invention may be tested in in vitro and/or in vivo assays well-known to one of skill in the art or described herein to determine the prophylactic or therapeutic effect of a particular compound for a particular disorder.
  • a compound identified utilizing the assays described herein may be tested in an animal model to determine the efficacy of the compound in the prevention, treatment or amelioration of a disorder associated with, characterized by or caused by a premature stop codon, or a disorder described herein, or a symptom thereof.
  • a compound identified utilizing the assays described herein may be tested for its toxicity in in vitro and/or in vivo assays well-known to one of skill in the art.
  • the invention provides a method for identifying a compound to test for its ability to modulate premature translation termination or nonsense- mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA or contains a premature stop codon; and (b) detecting a detectably labeled target RNAxompound complex formed in step(a), so that if a target RNAxompound complex is detected then the compound identified is tested for its ability to modulate premature translation or nonsense-mediated m
  • the invention provides a method for identifying a compound to test for its ability to modulate premature translation termination or nonsense- mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA or contains a premature stop codon; and (b) detecting a detectably labeled target RNAxompound complex fonned in step(a), so that if a target RNAxompound complex is detected then the compound identified is tested for its ability to modulate premature translation or nonsense-mediated mRNA decay.
  • the invention provides cell-based and cell-free assays to test the ability of a compound identified in accordance with the methods of the invention to modulate premature translation termination and/or nonsense-mediated mRNA decay, hi particular, the invention provides cell-based and cell-free reporter assays for the identification of a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay.
  • the level of expression and/or activity of a reporter gene product in the reporter gene based-assays described herein is indicative of the effect of the compound on premature translation termination and/or nonsense-mediated mRNA decay.
  • the reporter gene-based assays described herein for the identification of compounds that modulate premature translation termination and/or nonsense-mediated mRNA decay are well suited for high-throughput screening.
  • the reporter gene cell-based assays may be conducted by contacting a compound with a cell containing a nucleic acid sequence comprising a reporter gene, wherein the reporter gene contains a premature stop codon or nonsense mutation, and measuring the expression of the reporter gene.
  • the reporter gene cell-free assays may be conducted by contacting a compound with a cell-free extract and a nucleic acid sequence comprising a reporter gene, wherein the reporter gene contains a premature stop codon or nonsense mutation, and measuring the expression of the reporter gene.
  • the alteration in reporter gene expression or activity relative to a previously determined reference range, or to the expression or activity of the reporter gene in the absence of the compound or the presence of an appropriate control indicates that a particular compound modulates premature translation termination and/or nonsense-mediated mRNA decay.
  • an increase in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate control may, depending upon the parameters of the reporter gene assay, indicate that a particular compound reduces or suppresses premature translation termination and/or nonsense-mediated mRNA decay (i.e., increases nonsense suppression).
  • a decrease in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate control may, depending upon the parameters of the reporter gene-based assay, indicate that a particular compound enhances premature translation termination and/or nonsense-mediated mRNA decay (i.e., decreases nonsense suppression).
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNA compound complex is detected, then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA
  • the target RNA may be attached or conjugated to a solid support, or detectably labeled.
  • the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the
  • the invention provides methods for preventing, treating, managing or ameliorating a disorder associated with, characterized by or caused by a premature translation termination and/or nonsense-mediated mRNA decay or a symptom thereof, said method comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of a compound, or a pharmaceutically acceptable salt thereof, identified according to the methods described herein.
  • the term "compound” refers to any agent or complex that is being tested for its ability to interact with a target nucleic acid (in particular, a target RNA) or has been identified as interacting with a target nucleic acid (in particular, a target RNA).
  • disorder and “disease” are to refer to a condition in a subject.
  • a “dye” refers to a molecule that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional specfroscopic means.
  • a "visible dye” refers to a molecule having a chromophore that absorbs radiation in the visible region of the spectrum (i.e., having a wavelength of between about 400 nm and about 700 nm) such that the transmitted radiation is in the visible region and can be detected either visually or by conventional specfroscopic means.
  • an "ultraviolet dye” refers to a molecule having a chromophore that absorbs radiation in the ultraviolet region of the spectrum (i.e., having a wavelength of between about 30 nm and about 400 nm).
  • an "infrared dye” refers to a molecule having a chromophore that absorbs radiation in the infrared region of the spectrum (i.e., having a wavelength between about 700 nm and about 3,000 nm).
  • a "chromophore” is the network of atoms of the dye that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional specfroscopic means.
  • a dye absorbs radiation in one region of the spectrum, it may emit radiation in another region of the spectrum.
  • an ultraviolet dye may emit radiation in the visible region of the spectrum.
  • a dye can transmit radiation or can emit radiation via fluorescence or phosphorescence.
  • the term "effective amount” refers to the amount of a compound which is sufficient to (i) reduce or ameliorate the progression, severity and/or duration of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, (ii) prevent the development, recurrence or onset of a disorder (e.g:, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, (iii) prevent the advancement of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, or (iv) enhance or improve the therapeutic effect(s) of another therapy.
  • a disorder e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay
  • fragment in the context of a protein or polypeptide refers to a peptide sequence of at least 5 contiguous residues, at least 10 contiguous residues, at least 15 contiguous residues, at least 20 contiguous residues, at least 25 contiguous residues, at least 40 contiguous residues, at least 50 contiguous residues, at least 60 contiguous residues, at least 70 contiguous residues, at least 80 contiguous residues, at least 90 contiguous residues, at least 100 contiguous residues, at least 125 contiguous residues, at least 150 contiguous residues, at least 175 contiguous residues, at least 200 contiguous residues, or at least 250 contiguous residues of the sequence of another protein or polypeptide.
  • a fragment of a protein or polypeptide retains at least one function of the protein or polypeptide.
  • fragment in the context of a nucleic acid sequence refers to a nucleotide sequence of at least 5 contiguous bases, at least 10 contiguous bases, at least 15 contiguous bases, at least 20 contiguous bases, at least 25 contiguous bases, at least 40 contiguous bases, at least 50 contiguous bases, at least 60 contiguous bases, at least 70 contiguous bases, at least 80 contiguous bases, at least 90 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, or at least 250 contiguous bases of the sequence of another nucleic acid sequence.
  • a fragment of a nucleic acid sequence retains at least one domain of the nucleic acid sequence.
  • the term "in combination” refers to the use of more than one therapy (e.g., prophylactic and/or therapeutic agents).
  • the use of the term “in combination” does not restrict the order in which therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject with a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay).
  • a first therapy e.g., a prophylactic or therapeutic agent such as a compound identified in accordance with the methods of the invention
  • a first therapy can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy (e.g., a prophylactic or therapeutic agent such as a chemotherapeutic agent or a TNF- ⁇ antagonist) to a subject with a disorder (e.g., a disorder
  • a “label” or “detectable label” is a composition that is detectable, either directly or indirectly, by specfroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • useful labels include radioactive isotopes (e.g., 32 P, 35 S, and 3 H), dyes, fluorescent dyes, electron-dense reagents, enzymes and their substrates (e.g., as commonly used in enzyme-linked immunoassays, e.g., alkaline phosphatase and horse radish peroxidase), biotin, streptavidin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available.
  • radioactive isotopes e.g., 32 P, 35 S, and 3 H
  • dyes e.g., 32 P, 35 S, and 3 H
  • dyes e.g., fluorescent dyes
  • electron-dense reagents e.g., enzyme-linked immunoas
  • a label or detectable moiety can include an "affinity tag" that, when coupled with the target nucleic acid and incubated with a compound or compound library, allows for the affinity capture of the target nucleic acid along with molecules bound to the target nucleic acid.
  • an affinity tag bound to the target nucleic acids has, by definition, a complimentary ligand coupled to a solid support that allows for its capture.
  • useful affinity tags and complimentary ligands or partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer complexes, aptamers, or haptens and proteins for which antisera or monoclonal antibodies are available.
  • the label or detectable moiety is typically bound, either covalently, through a linker or chemical bound, or through ionic, van der Waals or hydrogen bonds to the molecule to be detected.
  • a "library” in the context of compounds refers to a plurality of compounds with which a target nucleic acid molecule is contacted.
  • a library can be a combinatorial library, e.g., a collection of compounds synthesized using combinatorial chemistry techniques, or a collection of unique chemicals of low molecular weight (less than 1000 daltons) that each occupy a unique three-dimensional space.
  • the terms “manage”, “managing” and “management” refer to the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent) which does not result in a cure of the disorder, (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense- mediated mRNA decay).
  • a subject is administered one or more therapies to "manage” a disease or disorder so as to prevent the progression or worsening of the disease or disorder.
  • modulation of premature translation termination and/or nonsense-mediated mRNA decay refers to the regulation of gene expression by altering the level of nonsense suppression. For example, if it is desirable to increase production of a defective protem encoded by a gene with a premature stop codon, i. e. , to permit read through of the premature stop codon of the disease gene so translation of the gene can occur, then modulation of premature franslation termination and/or nonsense- mediated mRNA decay entails up-regulation of nonsense suppression.
  • non-responsive and “refractory” describe patients treated with a currently available therapy (e.g., prophylactic or therapeutic agent) for a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay such as, e.g., cancer), which is not clinically adequate to relieve one or more symptoms associated with such disorder.
  • a currently available therapy e.g., prophylactic or therapeutic agent
  • a disorder e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay such as, e.g., cancer
  • a disorder e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay such as, e.g., cancer
  • Such patients suffer from severe, persistently active disease and require additional therapy to ameliorate the symptoms associated with their disorder.
  • nonsense-mediated mRNA decay refers to any mechanism that mediates the decay of mRNAs containing a premature franslation termination codon.
  • a "nonsense mutation” is a point mutation changing a codon corresponding to an amino acid to a stop codon.
  • nonsense suppression refers to the inhibition or suppression of premature franslation termination and/or nonsense-mediated mRNA decay.
  • salt(s) includes but is not limited to salts of acidic or basic groups that may be present in compounds identified using the methods of the present invention.
  • Compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids.
  • the acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tarfrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and
  • Compounds that include an amino moiety may form pharmaceutically or cosmetically acceptable salts with various amino acids, in addition to the acids mentioned above.
  • Compounds that are acidic in nature are capable of forming base salts with various pharmacologically or cosmetically acceptable cations.
  • Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts.
  • the term "previously determined reference range" refers to a reference range for the readout of a particular assay. Each laboratory will establish its own reference range for each particular assay. In a preferred embodiment, at least one positive control and at least one negative confrol are included in each batch of compounds analyzed.
  • a "premature termination codon” or “premature stop codon” refers to the occurrence of a stop codon instead of a codon corresponding to an amino acid.
  • premature franslation termination refers to the result of a mutation that changes a codon corresponding to an amino acid to a stop codon.
  • the terms "prevent”, “preventing” and “prevention” refer to the prevention of the development, recurrence or onset of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof resulting from the administration of one or more compounds identified in accordance the methods of the invention or the administration of a combination of such a compound and a known therapy for such a disorder.
  • a disorder e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay
  • prophylactic agent and “prophylactic agents” refer to any agent(s) which can be used in the prevention of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay).
  • a disorder e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay.
  • prophylactic agent refers to a compound identified in the screening assays described herein.
  • prophylactic agent refers to an agent other than a compound identified in the screening assays described herein which is known to be useful for, or has been or is cunently being used to prevent or impede the onset, development and/or progression of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof.
  • a disorder e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay
  • prophylactically effective amount refers to the amount of a therapy (e.g., a prophylactic agent) which is sufficient to result in the prevention of the development, recurrence or onset of one or more symptoms associated with a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay).
  • a therapy e.g., a prophylactic agent
  • a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay.
  • the term "purified,” in the context of a compound, e.g., a compound identified in accordance with the method of the invention, refers to a compound that is substantially free of chemical precursors or other chemicals when chemically synthesized, hi a specific embodiment, the compound is 60%, preferably 65%, 70%, 75%, 80%, 85%, 90%, or 99% free of other, different compounds.
  • a compound identified in accordance with the methods of the invention is purified.
  • reporter gene refers to a nucleotide sequence encoding a protein, polypeptide or peptide that is readily detectable either by its presence or activity. Any reporter gene well-known to one of skill in the art may be used in reporter gene constructs to ascertain the effect of a compound on premature franslation termination.
  • small molecule and analogous terms include, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heterorganic and/or ganometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
  • organic or inorganic compounds i.e., including heterorganic and/or ganometallic compounds
  • the terms “subject” and “patient” are used interchangeably herein.
  • the terms “subject” and “subjects” refer to an animal, preferably a mammal including a non-primate (e.g., a cow, pig, horse, cat, dog, rat, and mouse) and a primate (e.g., a chimpanzee, a monkey such as a cynomolgous monkey and a human), and more preferably a human.
  • the subject is refractory or non-responsive to current therapies for a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay).
  • the subject is a farm animal (e.g., a horse, a cow, a pig, etc.) or a pet (e.g., a dog or a cat).
  • the subject is a human.
  • the term "synergistic” refers to a combination of a compound identified using one of the methods described herein, and another therapy (e.g., a prophylactic or therapeutic agent), which combination is more effective than the additive effects of the therapies.
  • a synergistic effect of a combination of therapies permits the use of lower dosages of one or more of the therapies and/or less frequent administration of said therapies to a subject with disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay).
  • disorder e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay.
  • the ability to utilize lower dosages of a therapy e.g.
  • a prophylactic or therapeutic agent and/or to administer said therapy less frequently reduces the toxicity associated with the administration of said therapy to a subject without reducing the efficacy of said therapies in the prevention, freatment, management or amelioration of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay).
  • a synergistic effect can result in improved efficacy of therapies (e.g., prophylactic or therapeutic agents) in the prevention, freatment, management or amelioration of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay).
  • a synergistic effect of a combination of therapies may avoid or reduce adverse or unwanted side effects associated with the use of either therapy alone.
  • the term "substantially one type of compound” means that the assay can be performed in such a fashion that at some point, only one compound need be used in each reaction so that, if the result is indicative of a binding event occurring between the target RNA molecule and the compound, the compound can be easily identified.
  • a target nucleic acid refers to RNA, DNA, or a chemically modified variant thereof.
  • the target nucleic acid is RNA.
  • a target nucleic acid also refers to tertiary structures of the nucleic acids, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns.
  • a target nucleic acid also refers to RNA elements such as, but not limited to, 28S rRNA and structural analogs thereof, which are described in Sections 5.1 and 5.2. Non-limiting examples of target nucleic acids are presented in Sections 5.1 and 5.2.
  • a target RNA refers to RNA or a chemically modified variant thereof.
  • a target RNA also refers to tertiary structures of RNA, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns.
  • a target RNA also refers to RNA elements such as, but not limited to, 28S rRNA and structural analogs thereof, which are described in Sections 5.1 and 5.2. Non-limiting examples of target RNAs are presented in Sections 5.1 and 5.2.
  • a target RNA is at least 25 nucleotides, preferably at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150 nucleotides, at least 175 nucleotides or at least 200 nucleotides in length.
  • the terms “therapeutic agent” and “therapeutic agents” refer to any agent(s) which can be used in the prevention, treatment, management or amelioration of one or more symptoms of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay).
  • a disorder e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay.
  • the term “therapeutic agent” refers to a compound identified in the screening assays described herein.
  • the term "therapeutic agent” refers to an agent other than a compound identified in the screening assays described herein which is known to be useful for, or has been or is currently being used to prevent, treat, manage or ameliorate a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof.
  • a disorder e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay
  • the term "therapeutically effective amount” refers to that amount of a therapy (e.g., a therapeutic agent) sufficient to result in (i) the amelioration of one or more symptoms of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), (ii) prevent advancement of a disorder (e.g.
  • a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay causes regression of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or (iv) to enhance or improve the therapeutic effect(s) of another therapy (e.g., therapeutic agent).
  • a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay cause regression of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or (iv) to enhance or improve the therapeutic effect(s) of another therapy (e.g., therapeutic agent).
  • the terms “treat”, “freatment” and “treating” refer to the reduction or amelioration of the progression, severity and/or duration of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof resulting from the administration of one or more compounds identified in accordance the methods of the invention, or a combination of one or more compounds identified in accordance with the invention and another therapy.
  • a disorder e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay
  • the terms “therapy” and “therapies” refer to any method, protocol and/or agent that can be used in the prevention, freatment, management or amelioration of a disesase or disorder or one or more symptoms thereof.
  • such terms refer to chemotherapy, radiation therapy, surgery, supportive therapy and or other therapies useful in the prevention, treatment, management or amelioration of a disease or disorder or one or more symptoms thereof known to skilled medical personnel.
  • FIG. 1 The human 28S rRNA. Domains II and V are circled.
  • FIG. 2 Gel retardation analysis to detect peptide-RNA interactions.
  • increasing concentrations of Tat 47-58 peptide 0.1 uM, 0.2 uM, 0.4 uM, 0.8 uM, 1.6 uM
  • the reaction mixture was then heated at 90°C for 2 min and allowed to cool slowly to 24°C.
  • 10 ⁇ l of 30% glycerol was added to each sample and applied to a 12% non-denaturing polyacrylamide gel. The gel was elecfrophoresed using 1200 volt-hours at 4°C in TBE Buffer.
  • 16S rRNA 20 ⁇ l reactions containing increasing concentrations of gentamicin (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 ⁇ g/ml, 10 ⁇ g /ml, 50 ⁇ g /ml, 500 ⁇ g /ml) were added to 50 pmole end-labeled RNA oligonucleotide in TKM buffer, heated at 90°C for 2 min and allowed to cool slowly to 24°C. 10 ⁇ l of 30% glycerol was added to each sample and the samples were applied to a 13.5% non-denaturing polyacrylamide gel. The gel was elecfrophoresed using 1200 volt-hours at 4°C in TBE Buffer. Following electrophoresis, the gel was dried and the radioactivity was quantitated using a phosphorimager. The concentration of gentamicin added is indicated above each lane.
  • FIG. 4 The presence of 10 pg/ml gentamicin produces a gel mobility shift in the presence of the 16S rRNA oligonucleotide.
  • 20 ⁇ l reactions containing increasing concenfrations of gentamicin 100 ng/ml, 10 ng/ml, 1 ng/ml, 100 pg/ml, and 10 pg/ml were added to 50 pmole end-labeled RNA oligonucleotide in TKM buffer were treated as described for Figure 3.
  • FIG. 5 Gentamicin binding to the 16S rRNA oligonucleotide is weak in the absence of MgCl 2 .
  • Reaction mixtures containing gentamicin (1 ⁇ g /ml, 100 ⁇ g /ml, 10 ⁇ g /mil ⁇ g /ml, 0.1 ⁇ g /ml, and 10 ng/ml) were freated as described in Figure 3 except that the TKM buffer does not contain MgCl .
  • FIG. 6 Gel retardation analysis to detect peptide-RNA interactions.
  • Tat 4 -58 peptide 0.1 mM, 0.2 mM, 0.4 mM, 0.8 mM, 1.6 mM
  • 50 pmole TAR RNA oligonucleotide was added in TK buffer.
  • the reaction mixture was then heated at 90°C for 2 min and allowed to cool slowly to 24°C.
  • the reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pennsylvania). The peaks conespond to the amount of free TAR RNA ("TAR") or the Tat-TAR complex ("Tat-TAR").
  • the concentration of peptide added is indicated below each lane.
  • RNA Small molecules involved in nonsense suppression alter the chemical footprinting pattern in Domain V of the 28S rRNA.
  • 100 pmol of ribosomes were incubated with 100 ⁇ M compound, followed by treatment with the chemical modifying agents kethoxal (KE) and dimethyl sulfate (DMS, not shown).
  • KE kethoxal
  • DMS dimethyl sulfate
  • rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
  • FIG. 8 Small molecules involved in nonsense suppression alter the chemical footprinting pattern in Domain V of the 28S rRNA. 100 pmol of ribosomes were incubated with 100 ⁇ M compound, followed by treatment with the chemical modifying agents kethoxal (KE) and dimethyl sulfate (DMS, not shown). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
  • KE kethoxal
  • DMS dimethyl sulfate
  • FIG. 9 Small molecules involved in nonsense suppression alter the chemical footprinting pattern in Domain II (GTPase Center) of the 28S rRNA. 100 pmol of ribosomes were incubated with 100 ⁇ M compound, followed by freatment with the chemical modifying agents kethoxal (KE) and dimethyl sulfate (DMS, not shown). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
  • FIG. 10 Small molecules involved in nonsense suppression alter the chemical footprinting pattern of domain II of the 28S rRNA.
  • ribosomes 100 pmol of ribosomes were incubated with 100 ⁇ M compound, followed by treatment with chemical modifying agents dimethyl sulfate (DMS) and kethoxal (KE). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
  • DMS dimethyl sulfate
  • KE kethoxal
  • FIG. 11 A specific region of Domain II can compete for compound binding and prevents nonsense suppression in vitro.
  • the in vitro nonsense suppression assay was performed using a luciferase construct with a UGA nonsense mutation. 0.1 mM compound was present in the reaction to induce nonsense suppression. Competitor RNA corresponding to Domain II was added at the indicated concenfrations (0, 1, 2.5, 5, 7.5, 10 pM) to titrate the small molecule and prevent nonsense suppression.
  • the present invention provides methods for identifying compounds that modulate translation termination and/or nonsense-mediated mRNA decay by identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements.
  • the present invention provides methods of identifying compounds that bind to regions of the 28S rRNA and analogs thereof.
  • the specific target RNA sequences, RNA structural motifs, and or RNA structural elements are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements.
  • a preselected target RNA having a detectable label or method of detection is used to screen a library of compounds, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the target RNA bound to a compound.
  • methods are described in which a preselected target RNA is used to screen a library of compounds, with each compound in the library having a detectable label or method of detection, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the compound bound to target RNA.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, in, e.g., labeled tubes or a microtiter plate, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon
  • the detectably labled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, labeled target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA.
  • methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships (“SARS”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds free in solution, in, e.g., labeled tubes or a microtiter plate, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon
  • the detectably labled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA.
  • methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships (“SARS”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds bound, wherein each compound in the library is attached to a solid support; and detecting the formation of a target RNAxompound complex.
  • a target RNA e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon
  • the present invention provides methods for identifying compounds that bind to a target RNA (in particular, regions of 28S rRNA or RNA containing a premature stop codon), said method comprising contacting a target RNA having a detectable label with a library of compounds, wherein each compound is attached to a solid support (e.g., a bead- based library of compounds or a microarray of compounds), and detecting the formation of a target RNAxompound complex.
  • a solid support e.g., a bead- based library of compounds or a microarray of compounds
  • a solid support e.g., a bead-based
  • detectably labeled complex which can be separated from the unbound beads and unbound target RNA in the liquid phase by a number of physical means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex.
  • the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA attached or conjugated to a solid support with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex.
  • Target RNA molecules that bind to labeled compounds will form a detectable labeled complex.
  • Target RNA molecules that bind to labeled compounds will form a solid support-based detectably labeled complex, which can be separated from the unbound solid support-target RNA and unbound compounds in the liquid phase by a number of means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex.
  • the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds, in which the compounds of the library that specifically bind a preselected target nucleic acid are easily distinguished from non-binding members of the library.
  • the structures of the binding molecules are deciphered from the input library by methods depending on the type of library that is used.
  • the structures of the binding molecules are ascertained by de novo structure determination of the compounds using, for example, mass spectrometry or nuclear magnetic resonance (“NMR").
  • the compounds so identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and lead compounds for development of therapeutics, and the like.
  • Small organic compounds that are identified to interact specifically with the target RNA molecules are particularly attractive candidates as lead compounds for the development of therapeutic agents.
  • the assays of the invention reduce bias introduced by competitive binding assays which require the identification and use of a host cell factor (presumably essential for modulating RNA function) as a binding partner for the target RNA.
  • the assays of the present invention are designed to detect any compound or agent that binds to 28S rRNA, preferably under physiologic conditions. Such agents can then be tested for biological activity, without establishing or guessing which host cell factor or factors is required for modulating the function and/or activity of 28S rRNA.
  • the ribosome is a 2.5-MDa ribonucleoprotein complex involved in the decoding of genetic material from mRNA to proteins.
  • a combination of biophysical and biochemical analysis have provided three dimensional models of the ribosome as well as detailed analyses into the mechanism of the individual steps in translation (see, e.g., Green & Noller, 1997, Annu. Rev. Biochem. 66:679-716; Cate et al, 1999, Science 285(5436):2095-2104; and Ban et al, 2000, Science.289(5481): 905-920.).
  • the 28S rRNA is one of the ribosomal RNA components of the 60S subunit of eukaryotic ribosomes.
  • the 28S rRNA sequences are conserved when expressed as mature rRNAs, although the 28S rRNA contains variable sequence tracts that are interspersed among conserved core sequences and lacking in the counterpart bacterial 23 S rRNA (see, e.g., Hancock & Dover, 1988, Mol. Biol. Evol. 5:377-391).
  • a diagram of the 28S rRNA is presented in Figure 1, with domains II and V circled. As indicated in Figure 1, a GTPase center has been mapped to domain II and the peptidyl fransferase center has been mapped to domain V.
  • Regions of the 28S rRNA involved in frameshifting, nonsense mutation suppression, GTPase activity, or peptidyl fransferase are atfractive target RNAs to identify compounds that modulate premature translation termination and/or nonsense mediated decay.
  • the interference of a compound with one or more of these functions could potentially mediate translation termination by interfering with premature translation termination.
  • a compound could potentially mediate franslation termination by causing read through of a premature translation codon, therefore allowing the synthesis of the full-length protein.
  • the target RNA comprises a region of 28S rRNA corresponding to domain II (see, e.g., nucleotides 1310 to 2333 of accession number Ml 1167) or domain V of 28S rRNA (see, e.g., nucleotides 3859 to 4425 of accession number Ml 1167) or an analog thereof. It will become apparent to one of skill in the art that an analog of the 28S rRNA has an analogous structure and function to native 28S rRNA.
  • an analog of human 28S rRNA includes, but is not limited to, a human 28S rRNA retropseudogene (see, e.g., Wang et al, 1997, Gene 196:105-111, Accession Number L20636). Regions corresponding to domain II or domain V of the 28S rRNA pseudogene could be used as target RNAs in the present invention.
  • the 28S rRNA is a human 28S rRNA, although the teachings of the present invention are applicable to mammals.
  • the target RNAs i.e., regions of 28S rRNA
  • the target RNAs are cloned as DNAs downstream of a promoter, such as but not limited to T7, T3, or Sp6 promoters, and in vitro transcribed with the corresponding polymerase.
  • a promoter such as but not limited to T7, T3, or Sp6 promoters
  • a detectable label can be incorporated into the in vitro transcribed RNA or alternatively, the target RNA is end-labeled (see Section 5.3 infra).
  • the target RNA can be amplified by polymerase chain reaction with a primer containing an RNA promoter and subsequently in vitro transcribed, as described in U.S. Patent No. 6,271, 002, which is incorporated by reference in its entirety.
  • a target RNA may be engineered to contain a premature stop codon or, alternatively, a target RNA may naturally contain a premature stop codon.
  • the premature stop codon may any one of the stop codons known in the art including UAG, UAA and UGA.
  • the stop codons are UAG, UAA, and UGA, i.e., signals to the ribosome to terminate protein synthesis, presumably through protein release factors. Even though the use of these stop codons is widespread, they are not universal.
  • UGA specifies tryptophan in the mitochondria of mammals, yeast, Neurospora crassa, Drosophila, protozoa, and plants (see, e.g., Why New & RajBhandary, 1985, Trends Biochem Sci 10:481).
  • UGA for tryptophan in Mycoplasma and, in ciliated protozoa
  • UAA and UAG for glutamine
  • UGA for cysteine in the ciliate Euplotes aediculatus
  • Kervestin et al., 2001, EMBO Rep 2001 Aug;2(8):680-684 the use of UGA for tryptophan in Blepharisma americanum and the use of UAR for glutamine in Tetrahymena
  • three spirotrichs Stylonychia lemnae, S.
  • the readthrough of stop codons also occurs in positive-sense ssRNA viruses by a variety of naturally occurring suppressor tRNAs.
  • Such naturally-occurring suppressor tRNAs include, but are not limited to, cytoplasmic tRNATyr, which reads through the UAG stop codon; cytoplasmic tRNAsGln, which read through UAG and UAA; cytoplasmic fRNAsLeu, which read through UAG; chloroplast and cytoplasmic tRNAsTrp, which read through UGA; chloroplast and cytoplasmic tRNAsCys, which read through UGA; cytoplasmic tRNAsArg, which read through UGA (see, e.g., Beier & Grimm, 2001, Nucl Acids Res 29(23):4767-4782 for a review); and the use of selenocysteine to suppress UGA in E.
  • the stop codons are not necessarily universal, with considerable variation amongst organelles (e.g., mitochondria and chloroplasts), viruses (e.g., single strand viruses), and protozoa (e.g., ciliated protozoa) as to whether the codons UAG, UAA, and UGA signal translation termination or encode amino acids. Even though a single release factor most probably recognizes all of the stop codons in eukaryotes, it appears that all of the stop codons are not suppressed in a similar matter.
  • organelles e.g., mitochondria and chloroplasts
  • viruses e.g., single strand viruses
  • protozoa e.g., ciliated protozoa
  • nonsense suppression has to be strictly codon specific (see, e.g., Hottinger et al., 1984, EMBO J 3:423-428).
  • significant differences were found in the degree of suppression amongst three UAG codons and two UAA codons in different mRNA contexts in Escherichia coli and in human 293 cells, although data suggested that the context effects of nonsense suppression operated differently in E. coli and human cells (see, e.g., Martin et al., 1989, Mol Gen Genet 217(2 3):411 8).
  • a target RNA contains or is engineered to contain the premature stop codon UAG.
  • a target RNA contains or is engineered to contain the premature stop codon UGA.
  • a target RNA contains or is engineered to contain two or more stop codons.
  • the stop codons are preferably at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 75 nucleotides or at least 100 nucleotides apart from each other.
  • at least one of the stop codons is preferably UAG or UGA.
  • a target RNA contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides from the start codon in the coding sequence.
  • a target RNA contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides from the native stop codon in the coding sequence of the full-length protein, polypeptide or peptide.
  • a target RNA contains or is engineered to contain a premature stop codon at least 15 nucleotides (preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides) from the start codon in the coding sequence and at least 15 nucleotides (preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides) from the native stop codon in the coding sequence of the full-length protein, polypeptide or peptide.
  • the premature stop codon is preferably UAG or UGA.
  • the premature franslation stop codon can be produced by in vitro mutagenesis techniques such as, but not limited to, polymerase chain reaction ("PCR"), linker insertion, oligonucleotide-mediated mutagenesis, and random chemical mutagenesis.
  • PCR polymerase chain reaction
  • Target RNAs (Detectably Labeled or Attached to a Solid Support)
  • Target nucleic acids including but not limited to RNA and DNA, useful in the methods of the present invention have a label that is detectable via conventional specfroscopic means or radiographic means.
  • target nucleic acids are labeled with a covalently attached dye molecule.
  • Useful dye-molecule labels include, but are not limited to, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes.
  • the dye is a visible dye.
  • Useful labels in the present invention can include, but are not limited to, specfroscopic labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon GreenTM, rhodamine and derivatives (e.g., Texas red, teframethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDyeTM, and the like), radiolabels (e.g., H, I, S, C, P, P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), specfroscopic colorimetric labels such as colloidal gold or colored glass or plastic (e.g.
  • fluorescent dyes e.
  • affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer-sfreptavidin, or haptens and proteins for which antisera or monoclonal antibodies are available.
  • the label may be coupled directly or indirectly to a component of the detection assay (e.g.
  • nucleic acids that are labeled at one or more specific locations are chemically synthesized using phosphoramidite or other solution or solid-phase methods. Detailed descriptions of the chemistry used to form polynucleotides by the phosphoramidite method are well known (see, e.g., Caruthers et al, U.S. Pat. Nos.
  • the synthesis is performed with the growing polynucleotide chain attached to a solid support, such that excess reagents, which are generally in the liquid phase, can be easily removed by washing, decanting, and/or filtration, thereby eliminating the need for purification steps between synthesis cycles.
  • a solid support to which is attached a protected nucleoside monomer at its 3' terminus is freated with acid, e.g., trichloroacetic acid, to remove the 5 '-hydroxyl protecting group, freeing the hydroxyl group for a subsequent coupling reaction.
  • acid e.g., trichloroacetic acid
  • an activated intermediate is formed by contacting the support-bound nucleoside with a protected nucleoside phosphoramidite monomer and a weak acid, e.g., tetrazole.
  • the weak acid protonates the nitrogen atom of the phosphoramidite forming a reactive intermediate.
  • Nucleoside addition is generally complete within 30 seconds.
  • a capping step is performed, which terminates any polynucleotide chains that did not undergo nucleoside addition.
  • Capping is preferably performed using acetic anhydride and 1-methylimidazole.
  • the phosphite group of the internucleotide linkage is then converted to the more stable phosphotriester by oxidation using iodine as the prefened oxidizing agent and water as the oxygen donor.
  • the hydroxyl protecting group of the newly added nucleoside is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated one or more times until chain elongation is complete.
  • a protic acid e.g., trichloroacetic acid or dichloroacetic acid
  • the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine.
  • a base e.g., ammonium hydroxide or t-butyl amine.
  • the cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl.
  • the protecting groups on the exocyclic amines of the bases and any protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., at about 55°C.
  • the various protecting groups are removed using ammonium hydroxide or t-butyl amine.
  • any of the nucleoside phosphoramidite monomers can be labeled using standard phosphoramidite chemistry methods (Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et al, 1997, Biochemistry. 36:6033-6045 and references cited therein).
  • Dye molecules useful for covalently coupling to phosphoramidites preferably comprise a primary hydroxyl group that is not part of the dye's chromophore.
  • Illustrative dye molecules include, but are not limited to, disperse dye CAS 4439-31-0, disperse dye CAS 6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St.
  • dyes useful for coupling to phosphoramidites will be apparent to those of skill in the art, such as fluoroscein, cy3, and cy5 fluorescent dyes, and may be purchased from, e.g., Sigma-Aldrich, St. Louis, MO or Molecular Probes, Inc., Eugene, OR.
  • dye-labeled target molecules are synthesized enzymatically using in vitro transcription (Hwang et al, 1999, Proc. Natl. Acad. Sci.
  • a mixture of ribonucleoside-5 ' -triphosphates capable of supporting template-directed enzymatic extension e.g., a mixture including GTP, ATP, CTP, and UTP, including one or more dye- labeled ribonucleotides; Sigma-Aldrich, St. Louis, MO
  • a polymerase enzyme is added to the mixture under conditions where the polymerase enzyme is active, which are well-known to those skilled in the art.
  • a labeled polynucleotide is formed by the incorporation of the labeled ribonucleotides during polymerase-mediated strand synthesis.
  • nucleic acid molecules are end- labeled after their synthesis.
  • Methods for labeling the 5 '-end of an oligonucleotide include but are by no means limited to: (i) periodate oxidation of a 5 '-to-5' -coupled ribonucleotide, followed by reaction with an amine-reactive label (Heller & Morisson, 1985, in Rapid
  • a detectable label should not be incorporated into a target nucleic acid at the specific binding site at which compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the compounds at this site. Accordingly, if the region of the target nucleic acid that binds to a host cell factor is known, a detectable label is preferably incorporated into the nucleic acid molecule at one or more positions that are spatially or sequentially remote from the binding region.
  • the labeled target nucleic acid can be purified using standard techniques known to those skilled in the art (see Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96(23): 12997-13002 and references cited therein).
  • purification techniques include, but are not limited to, reverse-phase high-performance liquid chromatography ("reverse-phase HPLC”), fast performance liquid chromatography (“FPLC”), and gel purification.
  • the target RNA is refolded into its native conformation, preferably by heating to approximately 85-95°C and slowly cooling to room temperature in a buffer, e.g., a buffer comprising about 50 mM Tris-HCl, pH 8 and 100 mM NaCI.
  • a buffer e.g., a buffer comprising about 50 mM Tris-HCl, pH 8 and 100 mM NaCI.
  • the target nucleic acid can also be radiolabeled.
  • a radiolabel such as, but not limited to, an isotope of phosphorus, sulfur, or hydrogen, may be incorporated into a nucleotide, which is added either after or during the synthesis of the target nucleic acid.
  • Methods for the synthesis and purification of radiolabeled nucleic acids are well known to one of skill in the art. See, e.g., Sambrook et al, 1989, in Molecular Cloning: A Laboratory Manual, pp 10.2-10.70, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties.
  • the target nucleic acid can be attached to an inorganic nanoparticle.
  • a nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag 2 S, ZnS, CdS, CdTe, Au, or TiO 2 . Nanoparticles have unique optical, electronic and catalytic properties relative to bulk materials which can be adjusted according to the size of the particle. Methods for the attachment of nucleic acids are well known to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem. hit. Ed. 40: 4129-4158, International Patent Publication WO/0218643, and the references cited therein, the disclosures of which are hereby incorporated by reference in their entireties).
  • target nucleic acids can be attached or conjugated to a solid support for use in the assays of the invention.
  • methods known in the art, that can be used to immobilize nucleic acids on a solid support.
  • modified DNA has been covalently immobilized to a variety of surfaces using amino acids (see, e.g., Running, J. A., and Urdea, M. S. (1990) Biotechniques, 8, 276-277), (Newton, C. R., et al., (1993) Nucl. Acids. Res., 21 1155- 1162.), (Nikiforov, T. T., and Rogers, Y. H. (1995) Anal.
  • carboxyl groups (Zhang, Y., et al., (1991) Nucl. Acids Res., 19, 3929-3933), epoxy groups (Lamture, J. B., et al., (1994) Nucl. Acids Res. 22, 2121-2125), (Eggers, M. D., et al., (1994) BioTechniques, 17, 516-524) or amino groups (Rasmussen, S. R., et al., (1991) Anal. Biochem., 198, 138-142), can be used to attach nucleic acids to solid surfaces.
  • target RNA molecules are attached or conjugated to a solid support, e.g., a slide or a bead, using an appropriate molecule that does not interfere with its binding to compounds of the invention and then subsequently screened with a library of compounds.
  • a solid support e.g., a slide or a bead
  • Members of a library of compounds are preferably detectably labeled so that compounds that bind to target RNAs can be identified. Suitable detectable labels that can be used to label compounds are known in the art and also described herein.
  • target RNA molecules are immobilized on a surface suitable for preforming microarray assays. Any technique known in the art can be used to immobilize nucleic acid molecules on a solid support surface.
  • the nucleic acid is preferably, for example, covalently attached to the solid support.
  • Libraries screened using the methods of the present invention can comprise a variety of types of compounds.
  • the libraries screened using the methods of the present invention can comprise a variety of types of compounds on solid supports.
  • the libraries can be synthesized on solid supports or the compounds of the library can be attached to solid supports by linkers.
  • the compounds are nucleic acid or peptide molecules.
  • peptide molecules can exist in a phage display library.
  • types of compounds include, but are not limited to, peptide analogs including peptides comprising non-naturally occurring amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as o;-amino phosphoric acids and ⁇ -amino phosphoric acids, or amino acids having non-peptide linkages, nucleic acid analogs such as phosphorothioates and PNAs, hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose.
  • the combinatorial libraries are small organic molecule libraries, such as, but not limited to, benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pynolidines, morpholino compounds, and diazepindiones.
  • the combinatorial libraries comprise peptoids; random bio-oligomers; benzodiazepines; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; ohgocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; or carbohydrate libraries.
  • Combinatorial libraries are themselves commercially available (see, e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX, Moscow Russia; BioFocus pic, Sittingboume, UK; Bionet Research (A division of Key Organics Limited ), Camelford, UK; ChemBridge Corporation, San Diego, California; ChemDiv Inc, San Diego, California.; ChemRx Advanced Technologies, South San Francisco, California; ComGenex Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd., Kiev, Ukraine; Maybridge pic, Cornwall, UK; PharmaCore, Inc., North Carolina; SIDDCO hie, Arlington, Arizona; TimTec Inc, Newark, Delaware; Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg, Russia), hi a specific embodiment, the combinatorial libaries are small molecules.
  • combinatorial libraries useful in the present invention are combinatorial libraries of labeled compounds with each compound in the library having a label that is detectable via conventional specfroscopic means or radiographic means.
  • compounds are labeled with a covalently attached and detectable isotope.
  • useful labels in the present invention include, but are not limited to, fluorescent tags or dye molecules.
  • Useful dye molecules include, for example, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes.
  • Useful fluorescent tags include, for example, fluoresein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon GreenTM, rhodamine and derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDyeTM, and the like), radiolabels (e.g., 3 H, 125 1, 35 S, 14 C, 32 P, 33 P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), specfroscopic colorimetric labels such as colloidal gold or colored glass or plastic (e.g.
  • fluoresein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon GreenTM,
  • the label may be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art.
  • a component of the detection assay e.g., the detection reagent
  • a wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
  • the combinatorial compound library for the methods of the present invention may be synthesized.
  • Combinatorial compound libraries of the present invention may be synthesized using apparatuses described in US Patent No. 6,358,479 to Frisina et al, U.S. Patent No. 6,190,619 to Kilcoin et al, US Patent No. 6,132,686 to Gallup et al, US Patent No. 6,126,904 to Zuellig et al, US Patent No. 6,074,613 to Harness et al, US Patent No. 6,054,100 to Stanchfield et al, and US Patent No. 5,746,982 to Saneii et al. which are hereby incorporated by reference in their entirety. These patents describe synthesis apparatuses capable of holding a plurality of reaction vessels for parallel synthesis of multiple discrete compounds or for combinatorial libraries of compounds.
  • the combinatorial compound library can be synthesized in solution.
  • the method disclosed in U.S. Patent No. 6,194,612 to Boger et al, which is hereby incorporated by reference in its entirety, features compounds useful as templates for solution phase synthesis of combinatorial libraries.
  • the template is designed to permit reaction products to be easily purified from unreacted reactants using liquid/liquid or solid/liquid extractions.
  • the compounds produced by combinatorial synthesis using the template will preferably be small organic molecules. Some compounds in the library may mimic the effects of non-peptides or peptides.
  • liquid-phase synthesis does not require the use of specialized protocols for monitoring the individual steps of a multistep solid-phase synthesis (Egner et al, 1995, J.Org. Chem. 60:2652; Anderson et al, 1995, J. Org. Chem. 60:2650; Fitch et al, 1994, J. Org. Chem. 59:7955; Look et al, 1994, J. Org. Chem. 49:7588; Metzger et al, 1993, Angew. Chem., hit. Ed. Engl. 32:894; Youngquist et al, 1994, Rapid Commun. Mass Spect.
  • Combinatorial compound libraries useful for the methods of the present invention can be synthesized on solid supports, h one embodiment, a split synthesis method, a protocol of separating and mixing solid supports during the synthesis, is used to synthesize a library of compounds on solid supports (see Lam et al, 1997, Chem. Rev. 97:41-448; Ohlmeyer et al, 1993, Proc. Natl. Acad. Sci. USA 90: 10922-10926 and references cited therein). Each solid support in the final library has substantially one type of compound attached to its surface.
  • solid supports are known to those of skill in the art (see, e.g., Nefzi et al, 1997, Chem. Rev. 97:449-472 and US Patent No. 6,087, 186 to Cargill et al. which are hereby incorporated by reference in their entirety).
  • solid support is not limited to a specific type of solid support. Rather a large number of supports are available and are known to one skilled in the art.
  • Solid supports that can be used in the assays of the invention include, for example, any surface to which compounds, either natively or via a linker, can be attached.
  • Solid supports include silica gels, resins, derivatized plastic films, glass beads, glass slides (e.g, Hergenrother et al, 2000, J. Am. Chem. Soc. 122:7849-7850 and Kuruvilla et al, 2002, Nature 416:653-657) and cotton, plastic beads, polystyrene beads, doped polystyrene beads (as described by Fenniri et al, 2000, J. Am. Chem. Soc. 123:8151-8152), polystyrene macrobeads (as described by Blackwell et al, 2001, Chemistry & Biology 8:1167-1182), alumina gels, and polysaccharides.
  • the solid support is a glass slide.
  • the solid support is a glass microscope slide.
  • a suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols.
  • a solid support can be a resin such as p-methylbenzhydrylamine (pMBHA) resin (Peptides International, Louisville, KY), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly (dimethylacrylamide)- grafted styrene co-divinyl-benzene (e.g., POLYHIPE resin, obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California
  • the solid phase support is suitable for in vivo use, i.e., it can serve as a carrier or support for administration of the compound to a patient (e.g., TENTAGEL, Bayer, Tubingen, Germany).
  • the solid support is palatable and/or orally ingestable.
  • Linksers can be integral and part of the solid support, or they may be nonintegral that are either synthesized on the solid support or attached thereto after synthesis. Linkers are useful not only for providing points of compound attachment to the solid support, but also for allowing different groups of molecules to be cleaved from the solid support under different conditions, depending on the nature of the linker.
  • linkers can be, inter alia, electrophilically cleaved, nucleophilically cleaved, photocleavable, enzymatically cleaved, cleaved by metals, cleaved under reductive conditions or cleaved under oxidative conditions.
  • each compound contains a common functional group that mediates covalent attachment to a solid support
  • the functional group that mediates covalent attachment to a solid support varies between the compounds.
  • Compounds can be attached on a solid support in any orientation and distribution that is suitable for the assays of the invention, hi a further embodiment, compounds are attached or spotted on a solid support such as, e.g., a glass slide, with high spatial density and uniform distance between each spot so that an array is formed. Each surface is subsequently probed with a compound of interest.
  • compounds are applied directly to a surface, such as, e.g., a glass slide, using a manual transfer technique, hi a particular embodiment, the compounds are fransfened or spotted on a surface from a microtiter plate using a robotic arrayer.
  • the compounds are attached to beads that are subsequently fransfened to wells in a microtiter plate where the compounds are released before being anayed on a surface using any of the means described above. Any type and size of bead can be used to attach compounds of the invention.
  • the bead material is polystyrene.
  • the combinatorial compound libraries can be assembled in situ using dynamic combinatorial chemistry as described in European Patent Application 1,118,359 Al to Lehn; Hue & Nguyen, 2001, Comb. Chem. High Throughput. Screen. 4:53-74; Lehn and Eliseev, 2001, Science 291:2331-2332; Cousins et al 2000, Cu . Opin. Chem. Biol. 4: 270-279; and Karan & Miller, 2000, Drug. Disc. Today 5:67-75 which are incorporated by reference in their entirety.
  • Dynamic combinatorial chemistry uses non-covalent interaction with a target biomolecule, including but not limited to a protein, RNA, or DNA, to favor assembly of the most tightly binding molecule that is a combination of constituent subunits present as a mixture in the presence of the biomolecule.
  • a target biomolecule including but not limited to a protein, RNA, or DNA
  • molecules, preferably one molecule, that bind most tightly to a templating biomolecule will be present in greater amount than all other possible combinations.
  • the reversible chemical reactions include, but are not limited to, imine, acyl-hydrazone, amide, acetal, or ester formation between carbonyl-containing compounds and amines, hydrazines, or alcohols; thiol exchange between disulfides; alcohol exchange in borate esters; Diels-Alder reactions; thermal- or photoinduced sigmafropic or elecfrocyclic reanangements; or Michael reactions.
  • the constituent components of the dynamic combinatorial compound library are allowed to combine and reach equilibrium in the absence of the target RNA and then incubated in the presence of the target RNA, preferably at physiological conditions, until a second equilibrium is reached.
  • the second, perturbed, equilibrium (the so-called “templated mixture”) can, but need not necessarily, be fixed by a further chemical transformation, including but not limited to reduction, oxidation, hydrolysis, acidification, or basification, to prevent restoration of the original equilibrium when the dynamical combinatorial compound library is separated from the target RNA.
  • a further chemical transformation including but not limited to reduction, oxidation, hydrolysis, acidification, or basification, to prevent restoration of the original equilibrium when the dynamical combinatorial compound library is separated from the target RNA.
  • the predominant product or products of the templated dynamic combinatorial library can separated from the minor products and directly identified.
  • the identity of the predominant product or products can be identified by a deconvolution strategy involving preparation of derivative dynamic combinatorial libraries, as described in European Patent Application 1 , 118,359 Al , which is incorporated by reference in its entirety, whereby each component of the mixture is, preferably one-by-one but possibly group-wise, left out of the mixture and the ability of the derivative library mixture at chemical equilibrium to bind the target RNA is measured.
  • the components whose removal most greatly reduces the ability of the derivative dynamic combinatorial library to bind the target RNA are likely the components of the predominant product or products in the original dynamic combinatorial library.
  • a target nucleic acid such as but not limited to RNA or DNA
  • a compound library is synthesized or purchased or both
  • the labeled target nucleic acid is used to screen the library to identify compounds that bind to the nucleic acid.
  • Screening comprises contacting a labeled target nucleic acid with an individual, or small group, of the compounds of the compound library.
  • the contacting occurs in an aqueous solution, and most preferably, under physiologic conditions.
  • the aqueous solution preferably stabilizes the labeled target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the compounds.
  • the aqueous solution can be similar to the solution in which a complex between the target RNA and its conesponding host cell factor (if known) is formed in vitro.
  • TK buffer which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of compounds for RNA binding compounds.
  • RNA molecules are used to screen the library of labeled compounds.
  • target nucleic acids are used to screen the library of labeled compounds to identify those nucleic acids that bind to the labeled compounds.
  • Screening comprises contacting a target nucleic acid with an individual, or small group, of the compounds of the labeled compound library.
  • the contacting occurs in an aqueous solution, and most preferably under physiologic conditions.
  • the aqueous solution preferably stabilizes the target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the compounds.
  • the aqueous solution can be similar to the solution in which a complex between the target RNA and its conesponding host cell factor (if known) is formed in vitro.
  • TK buffer which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of compounds for RNA binding compounds.
  • the methods of the present invention for screening a library of compounds preferably comprise contacting a compound with a target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions.
  • the aqueous solution optionally further comprises non-specific nucleic acids, such as, but not limited to, DNA; yeast tRNA; salmon sperm DNA; homoribopolymers such as, but not limited to, poly IC, polyA, polyU, and polyC; and non-specific RNA.
  • the non-specific RNA may be an unlabeled target nucleic acid having a mutation at the binding site, which renders the unlabeled nucleic acid incapable of interacting with a compound at that site.
  • unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24 bulge region may also be present in the aqueous solution.
  • the addition of unlabeled RNA that is essentially identical to the dye-labeled target RNA except for a mutation at the binding site might minimize interactions of other regions of the dye-labeled target RNA with compounds or with the solid support and prevent false positive results.
  • the solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant.
  • the pH of the aqueous solution typically ranges from about 5 to about 8, preferably from about 6 to about 8, most preferably from about 6.5 to about 8.
  • a variety of buffers may be used to achieve the desired pH. Suitable buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada, Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso, Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly, Bicine, and sodium-potassium phosphate.
  • the buffering agent comprises from about 10 mM to about 100 mM, preferably from about 25 mM to about 75 mM, most preferably from about 40 mM to about 60 mM buffering agent.
  • the pH of the aqeuous solution can be optimized for different screening reactions, depending on the target RNA used and the types of compounds in the library, and therefore, the type and amount of the buffer used in the solution can vary from screen to screen, hi a prefened embodiment, the aqueous solution has a pH of about 7.4, which can be achieved using about 50 mM Tris buffer.
  • the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KC1, from about 0 mM to about 1 M NaCI, and from about 0 mM to about 200 mM MgCl 2 .
  • the combination of salts is about 100 mM KC1, 500 mM NaCI, and 10 mM MgCl 2 .
  • Applicant has found that a combination of KC1, NaCI, and MgCl 2 stabilizes the target RNA such that most of the RNA is not denatured or digested over the course of the screening reaction.
  • the optional concentration of each salt used in the aqueous solution is dependent on the particular target RNA used and can be determined using routine experimentation.
  • the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
  • a small amount of detergent or surfactant in the solution might reduce non-specific binding of the target RNA to the solid support and confrol aggregation and increase stability of target RNA molecules.
  • Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N- laurylsarcosine, lauryl sulfate, 1 -octane sulfonic acid and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alkyl amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-l- propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D- glucopyranoside, n-decyl ⁇ -D-maltopyranoside,
  • the detergent if present, is a nonionic detergent.
  • Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol. More preferably, the detergent, if present, is Triton X-100 and present in an amount of about 0.1% (w/v).
  • Non-specific binding of a labeled target nucleic acid to compounds can be further mimmized by treating the binding reaction with one or more blocking agents.
  • Nonspecific binding of a unlabeled target nucleic acid to labeled compounds can be further minimized by treating the binding reaction with one or more blocking agents.
  • the binding reactions are treated with a blocking agent, e.g., bovine serum albumin ("BSA"), before contacting with to the labeled target nucleic acid, hi another embodiment, the binding reactions are treated sequentially with at least two different blocking agents. This blocking step is preferably performed at room temperature for from about 0.5 to about 3 hours. In a subsequent step, the reaction mixture is further treated with unlabeled RNA having a mutation at the binding site.
  • BSA bovine serum albumin
  • This blocking step is preferably performed at about 4°C for from about 12 hours to about 36 hours before addition of the dye-labeled target RNA.
  • the solution used in the one or more blocking steps is substantially similar to the aqueous solution used to screen the library with the dye-labeled target RNA, e.g., in pH and salt concentration.
  • the mixture of labeled target nucleic acid and the compound is preferably maintained at 4°C for from about 1 day to about 5 days, preferably from about
  • the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i.e., spectrometry) that diferentiates between bound and unbound target nucleic acids is used.
  • a technique i.e., spectrometry
  • the mixture of target nucleic acid and the labeled compound is preferably maintained at 4°C for from about 1 day to about 5 days, preferably from about 2 days to about 3 days with constant agitation.
  • bound from free compounds are determined using any of the methods disclosed in Section 5.5 infra.
  • the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i. e. , spectrometry) that diferentiates between bound and unbound target nucleic acids is used.
  • the methods for identifying small molecules bound to labeled nucleic acid will vary with the type of label on the target nucleic acid.
  • the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions.
  • the reactions conesponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction.
  • complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass specfrometric technique.
  • the bound small molecule can be identified on the basis of its molecular weight, hi this reaction a priori knowledge of the exact molecular weights of all compounds within the library is known.
  • the compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a technique such as, but not limited to, spectrometry is used.
  • the methods for identifying labeled small molecules bound to unlabeled nucleic acid will vary with the type of label on the compound.
  • the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions.
  • the reactions conesponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction.
  • complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass specfrometric technique.
  • the bound small molecule can be identified on the basis of its molecular weight, hi this reaction a priori knowledge of the exact molecular weights of all compounds within the library is known, h another embodiment, the compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a techmque such as, but not limited to, spectrometry is used.
  • a techmque such as, but not limited to, spectrometry
  • Any method that detects an altered physical property of a target nucleic acid complexed to a compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids.
  • Methods that can be utilized for the physical separation of complexed target RNA from unbound target RNA include, but are not limited to, electrophoresis, fluorescence specfroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships ("SAR") by NMR specfroscopy, size exclusion chromatography, affinity chromatography, nanoparticle aggregation, flow cytometry, manual batch, and suspension of beads in electric fields.
  • SAR structure-activity relationships
  • the solid support e.g., beads
  • the solid support must then be separated from the unbound target RNA or unbound compounds, respectively, in the liquid phase. This can be accomplished by any number of physical means; e.g., sedimentation, centrifugation. Thereafter, a number of methods can be used to separate the solid support- based library that is complexed with the labeled target RNA from uncomplexed beads in order to isolate the compound on the bead. Alternatively, mass specfroscopy and NMR spectroscopy can be used to simultaneously identify and separate beads complexed to the labeled target RNA from uncomplexed beads.
  • Methods for separation of the complex of a target RNA bound to a compound from the unbound RNA comprises any method of electrophoretic separation, including but not limited to, denaturing and non-denaturing polyacrylamide gel electrophoresis, urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, agarose gel electrophoresis, and capillary electrophoresis.
  • an automated electrophoretic system comprising a capillary cartridge having a plurality of capillary tubes is used for high-throughput screening of compounds bound to target RNA.
  • U.S. Patent No. 5,885,430 which is incorporated by reference in its entirety, allows one to simultaneously introduce samples into a plurality of capillary tubes directly from microtiter frays having a standard size.
  • U.S. Patent No. 5,885,430 discloses a disposable capillary cartridge which can be cleaned between electrophoresis runs, the cartridge having a plurality of capillary tubes. A first end of each capillary tube is retained in a mounting plate, the first ends collectively forming an array in the mounting plate. The spacing between the first ends corresponds to the spacing between the centers of the wells of a microtiter tray having a standard size.
  • the first ends of the capillary tubes can simultaneously be dipped into the samples present in the fray's wells.
  • the cartridge is provided with a second mounting plate in which the second ends of the capillary tubes are retained.
  • the second ends of the capillary tubes are ananged in an anay which conesponds to the wells in the microtiter fray, which allows for each capillary tube to be isolated from its neighbors and therefore free from cross-contamination, as each end is dipped into an individual well.
  • Plate holes may be provided in each mounting plate and the capillary tubes inserted through these plate holes.
  • the plate holes are sealed airtight so that the side of the mounting plate having the exposed capillary ends can be pressurized.
  • Application of a positive pressure in the vicinity of the capillary openings in this mounting plate allows for the infroduction of air and fluids during elecfrophoretic operations and also can be used to force out gel and other materials from the capillary tubes during reconditioning.
  • the capillary tubes may be protected from damage using a needle comprising a cannula and/or plastic tubes, and the like when they are placed in these plate holes. When metallic cannula or the like are used, they can serve as electrical contacts for current flow during electrophoresis.
  • the second mounting plate In the presence of a second mounting plate, the second mounting plate is provided with plate holes through which the second ends of the capillary tubes project, hi this instance, the second mounting plate serves as a pressure containment member of a pressure cell and the second ends of the capillary tubes communicate with an internal cavity of the pressure cell.
  • the pressure cell is also formed with an inlet and an outlet. Gels, buffer solutions, cleaning agents, and the like may be introduced into the internal cavity through the inlet, and each of these can simultaneously enter the second ends of the capillaries.
  • the automated elecfrophoretic system can comprise a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while elecfrophoretic separation of the products of another sample is taking place in a different part of the chip.
  • a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while elecfrophoretic separation of the products of another sample is taking place in a different part of the chip.
  • the system disclosed in U.S. Patent No. 5,699,157 which is hereby inco ⁇ orated by reference in its entirety, provides for a micro fluidic system for high-speed elecfrophoretic analysis of subject materials for applications in the fields of chemistry, biochemistry, biotechnology, molecular biology and numerous other areas.
  • the system has a channel in a substrate, a light source and a photoreceptor.
  • the channel holds subject materials in solution in an electric field so that the materials move through the channel and separate into bands according to species.
  • the light source excites fluorescent light in the species bands and the photoreceptor is ananged to receive the fluorescent light from the bands.
  • the system further has a means for masking the channel so that the photoreceptor can receive the fluorescent light only at periodically spaced regions along the channel.
  • the system also has an unit connected to analyze the modulation frequencies of light intensity received by the photoreceptor so that velocities of the bands along the channel are determined, which allows the materials to be analyzed.
  • the system disclosed in U.S. Patent No. 5,699,157 also provides for a method of performing high-speed elecfrophoretic analysis of subject materials, which comprises the steps of holding the subject materials in solution in a channel of a micro fluidic system; subjecting the materials to an electric field so that the subject materials move through the channel and separate into species bands; directing light toward the channel; receiving light from periodically spaced regions along the channel simultaneously; and analyzing the frequencies of light intensity of the received light so that velocities of the bands along the channel can be determined for analysis of said materials.
  • the determination of the velocity of a species band determines the elecfrophoretic mobility of the species and its identification.
  • U.S. Patent No. 5,842,787 which is hereby inco ⁇ orated by reference in its entirety, is generally directed to devices and systems employ channels having, at least in part, depths that are varied over those which have been previously described (such as the device disclosed in U.S. Patent No. 5,699,157), wherein said channel depths provide numerous beneficial and unexpected results such as but not limited to, a reduction in sample perturbation, reduced non-specific sample mixture by diffusion, and increased resolution
  • the electrophoretic method of separation comprises polyacrylamide gel electrophoresis.
  • the polyacrylamide gel electrophoresis is non-denaturing, so as to differentiate the mobilities of the target RNA bound to a compound from free target RNA.
  • the target RNAxompound complex must be cross-linked prior to electrophoresis to prevent the disassociation of the target RNA from the compound during electrophoresis.
  • the binding of compounds to target nucleic acid can be detected, preferably in an automated fashion, by gel electrophoretic analysis of interference footprinting.
  • RNA can be degraded at specific base sites by enzymatic methods such as ribonucleases A, U 2 , CL 3 , T ls Phy M, and B.
  • the specific pattern of cleavage sites is determined by the accessibility of particular bases to the reagent employed to initiate cleavage and, as such, is therefore is determined by the three-dimensional structure of the RNA.
  • the interaction of small molecules with a target nucleic acid can change the accessibility of bases to these cleavage reagents both by causing conformational changes in the target nucleic acid or by covering a base at the binding interface.
  • a compound binds to the nucleic acid and changes the accessibility of bases to cleavage reagents, the observed cleavage pattern will change.
  • This method can be used to identify and characterize the binding of small molecules to RNA as described, for example, by Prudent et al, 1995, J. Am. Chem. Soc.
  • the detectably labeled target nucleic acid is incubated with an individual compound and then subjected to treatment with a cleavage reagent, either enzymatic or chemical.
  • the reaction mixture can be preferably be examined directly, or freated further to isolate and concentrate the nucleic acid.
  • the fragments produced are separated by electrophoresis and the pattern of cleavage can be compared to a cleavage reaction performed in the absence of compound. A change in the cleavage pattern directly indicates that the compound binds to the target nucleic acid. Multiple compounds can be examined both in parallel and serially.
  • elecfrophoretic separation include, but are not limited to urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, and agarose gel electrophoresis.
  • Fluorescence Spectroscopy h a prefened embodiment, fluorescence polarization specfroscopy, an optical detection method that can differentiate the proportion of a fluorescent molecule that is either bound or unbound in solution (e.g., the labeled target nucleic acid of the present invention), can be used to read reaction results without electrophoretic separation of the samples. Fluorescence polarization specfroscopy can be used to read the reaction results in the chip system disclosed in U.S. Patent Nos.
  • a compound that has an affinity for the target nucleic acid of interest can be labeled with a fluorophore to screen for compounds that bind to the target nucleic acid.
  • a fluorophore for example, a pyrene-containing aminoglycoside analog was used to accurately monitor antagonist binding to a prokaryotic 16S rRNA A site (which comprises the natural target for aminoglycoside antibiotics) in a screen using a fluorescence quenching technique in a 96-well plate format (Hamasaki & Rando, 1998, Anal. Biochem. 261(2): 183-90).
  • fluorescence resonance energy transfer FRET
  • FRET fluorescence resonance energy transfer
  • FRET a characteristic change in fluorescence, occurs when two fluorophores with overlapping emission and excitation wavelength bands are held together in close proximity, such as by a binding event.
  • the fluorophore on the target nucleic acid and the fluorophore on the compounds will have overlapping excitation and emission spectra such that one fluorophore (the donor) transfers its emission energy to excite the other fluorophore (the acceptor).
  • the acceptor preferably emits light of a different wavelength upon relaxing to the ground state, or relaxes non-radiatively to quench fluorescence.
  • FRET is very sensitive to the distance between the two fluorophores, and allows measurement of molecular distances less than 10 nm.
  • both the target nucleic acid and a compound that has an affinity for the target nucleic acid of interest are labeled with fluorophores with overlapping emission and excitation spectra (donor and acceptor), including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules.
  • fluorophores with overlapping emission and excitation spectra including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules.
  • fluorophores with overlapping emission and excitation spectra including but not limited
  • the compounds are labeled with the acceptor fluorophore. Conversely, if the target nucleic acid is labeled with the acceptor fluorophore, then the compounds are labeled with the donor fluorophore.
  • labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
  • the fluorophore on the target nucleic acid must be in close proximity to the binding site of the compounds, but should not be inco ⁇ orated into a target nucleic acid at the specific binding site at which compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the compounds at this site.
  • HTRF time-resolved fluorescence
  • the target RNA may be labeled with a fluorophore and the compounds in the library labeled with a quencher of the fluorophore, or alternatively, the target RNA labeled with a quencher of the fluorophore and the compounds in the library labeled with a fluorophore, so that when a compound and target RNA bind, the fluorescent signal of the fluorophore is quenched.
  • Fluorescence specfroscopy has traditionally been used to characterize DNA- protein and protein-protein interactions, but fluorescence specfroscopy has not been widely used to characterize RNA-protein interactions because of an interfering abso ⁇ tion of RNA nucleotides with the intrinsic tryptophan fluorescence of proteins (Xavier et al. , 2000,
  • fluorescence spectroscopy has been used in studying the single tryptophan residue within the arginine-rich RNA-binding domain of Rev protein and its interaction with the RRE in a time-resolved fluorescence study (Kwon & Carson, 1998, Anal. Biochem. 264:133-140).
  • fluorescence specfroscopy is less prefened if the compounds or peptides or proteins possess intrinsic tryptophan fluorescence.
  • fluorescence specfroscopy can be used for compounds that do not possess intrinsic fluorescence.
  • SPR Surface plasmon resonance
  • the evanescent wave profile depends astonishingly on the refractive index of the medium it probes. Thus, the angle at which abso ⁇ tion occurs is very sensitive to the refractive changes in the external medium. All proteins and nucleic acids are known to change the refractive index of water by a similar amount per unit mass, inespective of their amino acid or nucleotide composition (the refractive index change is different for proteins and nucleic acids). When the protein or nucleic acid content of the layer at the sensor changes, the refractive index also changes.
  • one member of a complex is immobilized in a dextran layer and then the other member is introduced into the solution, either in a flow cell (Biacore AB, Uppsala, Sweden) or a stined cuvette (Affinity Sensors, Santa Fe, New Mexico). It has been determined that there is a linear conelation between the surface concentration of protein or nucleic acid and the shift in resonance angle, which can be used to quantitate kinetic rate constants and/or the equilibrium constants.
  • the target RNA may be immobilized to the sensor surface through a sfreptavidin-biotin linkage, the linkage of which is disclosed by Crouch et al. (Methods Mol.
  • RNA is biotinylated either during synthesis or post-synthetically via the conversion of the 3' terminal ribonucleoside of the RNA into a reactive free amino group or using a T7 polymerase inco ⁇ orated guanosine monophosphorothioate at the 5' end.
  • SPR has been used to determine the stoichiometry and affinity of the interaction between the HIV Rev protein and the RRE (Van Ryk & Venkatesan, 1999, J. Biol. Chem.
  • the target nucleic acid can be immobilized to a sensor surface (e.g., by a sfreptavidin-biotin linkage) and SPR can be used to (a) determine whether the target RNA binds a compound and (b) further characterize the binding of the target nucleic acids of the present invention to a compound.
  • a mass spectrometer operation on a material to be analyzed is performed and the peak height and width values at each m/z ratio versus time are stored in a second memory location.
  • the mass spectrometer operation on the material to be analyzed is repeated a fixed number of times and the stored confrol sample values at each m/z ratio level at each time increment are subtracted from each conesponding one from the operational runs, thus producing a difference value at each mass ratio for each of the multiple runs at each time increment. If the MS value minus the background noise does not exceed a preset value, the m/z ratio data point is not recorded, thus eliminating background noise, chemical noise and false positive peaks from the mass spectrometer data.
  • the stored data for each of the multiple runs is then compared to a predetermined value at each m/z ratio and the resultant series of peaks, which are now determined to be above the background, is stored in the m/z points in which the peaks are of significance.
  • One possibility for the utilization of mass spectrometry in high throughput screening is the integration of SPR with mass spectrometry. Approaches that have been tried are direct analysis of the analyte retained on the sensor chip and mass spectrometry with the eluted analyte (Sonksen et al, 1998, Anal. Chem. 70:2731-2736; Nelson & Krone,
  • the target nucleic acid complexed to a compound can be determined by any of the mass spectrometry processed described supra. Furthermore, mass spectrometry can also be used to elucidate the structure of the compound.
  • SPA Scintillation proximity assay
  • SPA is a method that can be used for screening small molecules that bind to the target RNAs. SPA would involve radiolabeling either the target RNA or the compound and then quantitating its binding to the other member to a bead or a surface impregnated with a scintillant (Cook, 1996, Drug Discov. Today 1 :287-294). Cunently, fluorescence-based techniques are prefened for high- throughput screening (Pope et al, 1999, Drug Discov. Today 4:350-362).
  • one embodiment of the present invention comprises (a) labeling of the target nucleic acid with a radioactive or fluorescent label; (b) contacted the labeled nucleic acid with compounds, wherein each compound is in a microtiter well coated with scintillant and is tethered to the microtiter well; and (c) identifying and quantifying the compounds bound to the target nucleic acid with SPA, wherein the compound is identified by virtue of its location in the microplate.
  • NMR spectroscopy is a valuable technique for identifying complexed target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects, and NMR-based approaches have been used in the identification of small molecule binders of protein drug targets (Xavier et al. , 2000, Trends Biotechnol. 18(8):349-356).
  • SAR structure-activity relationships
  • the signal from the bound molecule is monitored by employing line broadening, fransfened NOEs and pulsed field gradient diffusion measurements (Moore, 1999, Curr. Opin. Biotechnol. 10:54-58).
  • a strategy for lead generation by NMR using a library of small molecules has been recently described (Fejzo et al, 1999, Chem. Biol. 6:755-769).
  • the target nucleic acid complexed to a compound can be determined by SAR by NMR. Furthermore, SAR by NMR can also be used to elucidate the structure of the compound.
  • size-exclusion chromatography is used to purify compounds that are bound to a target nucleic from a complex mixture of compounds. Size-exclusion chromatography separates molecules based on their size and uses gel-based media comprised of beads with specific size distributions. When applied to a column, this media settles into a tightly packed matrix and forms a complex array of pores. Separation is accomplished by the inclusion or exclusion of molecules by these pores based on molecular size. Small molecules are included into the pores and, consequently, their migration through the matrix is retarded due to the added distance they must travel before elution.
  • a target nucleic acid is incubated with a mixture of compounds while free in solution and allowed to reach equilibrium.
  • compounds free in solution are retained by the column, and compounds bound to the target nucleic acid are passed through the column.
  • spin columns commonly used for "desalting" of nucleic acids will be employed to separate bound from unbound compounds (e.g. , Bio-Spin columns manufactured by BIO-RAD).
  • the size exclusion matrix is packed into multiwell plates to allow high throughput separation of mixtures (e.g., PLASMID 96-well SEC plates manufactured by Millipore).
  • affinity capture is used to purify compounds that are bound to a target nucleic acid labeled with an affinity tag from a complex mixture of compounds.
  • a target nucleic acid labeled with an affinity tag is incubated with a mixture of compounds while free in solution and then captured to a solid support once equilibrium has been established; alternatively, target nucleic acids labeled with an affinity tag can be captured to a solid support first and then allowed to reach equilibrium with a mixture of compounds.
  • the solid support is typically comprised of, but not limited to, cross-linked agarose beads that are coupled with a ligand for the affinity tag.
  • the solid support may be a glass, silicon, metal, or carbon, plastic (polystyrene, polypropylene) surface with or without a self-assembled monolayer (SAM) either with a covalently attached ligand for the affinity tag, or with inherent affinity for the tag on the target nucleic acid.
  • SAM self-assembled monolayer
  • retention of bound compounds and removal of unbound compounds is facilitated by washing the solid support with large excesses of binding reaction buffer.
  • retention of high affinity compounds and removal of low affinity compounds can be accomplished by a number of means that increase the stringency of washing; these means include, but are not limited to, increasing the number and duration of washes, raising the salt concentration of the wash buffer, addition of detergent or surfactant to the wash buffer, and addition of non-specific competitor to the wash buffer.
  • the compounds themselves are detectably labeled with fluorescent dyes, radioactive isotopes, or nanoparticles.
  • fluorescent dyes e.g., fluorescent dyes, radioactive isotopes, or nanoparticles.
  • binding between the compounds and the target nucleic acid can be determined by the presence of the detectable label on the compound using fluorescence.
  • bound compounds with high affinity for the target nucleic acid can be eluted from the immobilized target nucleic acids and analyzed.
  • the elution of compounds can be accomplished by any means that break the non-covalent interactions between the target nucleic acid and compound.
  • Means for elution include, but are not limited to, changing the pH, changing the salt concentration, the application of organic solvents, and the application of molecules that compete with the bound ligand.
  • the means employed for elution will release the compound from the target RNA, but will not effect the interaction between the affinity tag and the solid support, thereby achieving selective elution of compound.
  • a prefened embodiment will employ an elution buffer that is volatile to allow for subsequent concentration by lyophilization of the eluted compound (e.g., 0 M to 5 M ammonium acetate).
  • the target RNA can be labeled with biotin, an antigen, or a ligand.
  • Library beads complexed to the target RNA can be separated from uncomplexed beads using affinity techniques designed to capture the labeled moiety on the target RNA.
  • a solid support such as but not limited to, a column or a well in a microwell plate coated with avidin/streptavidin, an antibody to the antigen, or a receptor for the ligand can be used to capture or immobilize the labeled beads.
  • Complexed RNA may or may not be irreversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead.
  • linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an elecfrophile and a nucleophile, or alkylating reagents. See, e.g., International Patent Publication WO/0146461, the contents of which are hereby inco ⁇ orated by reference.
  • the unbound library beads can be removed after the binding reaction by washing the solid phase.
  • RNA is ineversibly bound to the bead
  • compounds can be isolated from the bead following destruction of the bound RNA by preferably, but not limited to, enzymatic or chemical (e.g., alkaline hydrolysis) degradation.
  • the library beads bound to the solid phase can then be eluted with any solution that disrupts the binding between the labeled target RNA and the solid phase.
  • solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art.
  • the compounds can be eluted from the solid phase by heat.
  • the library of compounds can be prepared on magnetic beads, such as Dynabeads Streptavidin (Dynal Biotech, Oslo, Norway).
  • the magnetic bead library can then be mixed with the labeled target RNA under conditions that allow binding to occur.
  • the separation of the beads from unbound target RNA in the liquid phase can be accomplished using a magnet.
  • the bead complexed to the labeled RNA may be separated from uncomplexed library beads via the label used on the target RNA; e.g., biotinylated target RNA can be captured by avidin/sfreptavidin; target RNA labeled with antigen can be captured by the appropriate antibody; target RNA labeled with ligand can be captured using the appropriate immobilized receptor.
  • the captured library bead can then be eluted with any solution that disrupts the binding between the labeled target RNA and the immobilized surface.
  • solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art.
  • RNA may or may not be ineversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead.
  • linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an electrophile and a nucleophile, or alkylating reagents. See, e.g., International Patent Publication WO/0146461, the contents of which are hereby inco ⁇ orated by reference.
  • RNA is ineversibly bound to the bead
  • compounds can be isolated from the bead following destruction of the bound RNA by enzymatic degradation including, but not limited to, ribonucleases A, U 2 , CL 3 , T ls Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following freatment with sodium hydroxide, hydrazine, piperidine formate, or dimethyl sulfate), or metal-assisted (e.g. nickel( ⁇ ), cobalt(II), or iron(II)) oxidative cleavage.
  • enzymatic degradation including, but not limited to, ribonucleases A, U 2 , CL 3 , T ls Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following freatment with sodium
  • the preselected target RNA can be labeled with a heavy metal tag and incubated with the library beads to allow binding of the compounds to the target RNA.
  • the separation of the labeled beads from unlabeled beads can be accomplished using a magnetic field. After removal of the magnetic field, the compound can be eluted with any solution that disrupts the binding between the preselected target RNA and the compound.
  • solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art.
  • the compounds can be eluted from the solid phase by heat.
  • Nanoparticle Aggregation hi one embodiment of the present invention, both the target nucleic acid and the compounds are labeled with nanoparticles.
  • a nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag 2 S, ZnS, CdS, CdTe, Au, or TiO 2 .
  • Methods for the attachment of nucleic acids and small molecules to nanoparticles are well know to one of skill in the art (reviewed in Niemeyer, 2001, Angew. Chem. Int. Ed. 40:4129-4158. The references cited therein are hereby inco ⁇ orated by reference in their entireties).
  • the complexed and non-complexed target nucleic acids are separated by flow cytometry methods.
  • Flow cytometers for sorting and examining biological cells are well known in the art; this technology can be applied to separate the labeled library beads from unlabeled beads.
  • Known flow cytometers are described, for example, in U.S. Patent Nos. 4,347,935; 5,464,581; 5,483,469; 5,602,039; 5,643,796; and 6,211,477; the entire contents of which are inco ⁇ orated by reference herein.
  • Other known flow cytometers are the FACS VantageTM system manufactured by Becton Dickinson and Company, and the COP ASTM system manufactured by Union Biometrica.
  • a flow cytometer typically includes a sample reservoir for receiving a biological sample.
  • the biological sample contains particles (hereinafter refened to as "beads") that are to be analyzed and sorted by the flow cytometer.
  • Beads are transported from the sample reservoir at high speed (>100 beads/second) to a flow cell in a stream of liquid "sheath" fluid.
  • High-frequency vibrations of a nozzle that directs the stream to the flow cell causes the stream to partition and form ordered droplets, with each droplet containing a single bead. Physical properties of beads can be measured as they intersect a laser beam within the cytometer flow cell.
  • beads move one by one through the intenogation point, they cause the laser light to scatter and fluorescent molecules on the labeled beads (i.e., beads complexed with labeled target RNA) become excited.
  • the target nucleic acid is labeled with an inorganic nanoparticle
  • the beads complexed with bound target nucleic acid can be distinguished not only by unique fluorescent properties but also on the basis of specfrometric properties (e.g. including but not limited to increased optical density due to the reduction of Ag + ions in the presence of gold nanoparticles (see, e.g., Taton et al. Science 2000, 289: 1757-1760)).
  • a for separating complexed beads To explore a bead-based library within a reasonable time period, the primary screens should be operated with sufficient throughput. To do this, the target nucleic acid is labeled with a dye and then incubated with the combinatorial library.
  • An advantage of such an assay is the fast identification of active library beads by color change. In the lower concenfrations of the dye-labeled target molecule, only those library beads that bind the target molecules most tightly are detected because of higher local concentration of the dye. When washed and plated into a liquid monolayer, colored beads are easily separated from non-colored beads with the aid of a dissecting microscope.
  • One of the problems associated with this method could be the interaction between the red dye and library substrates. Control experiments using the dye alone and dye attached to mutant RNA sequences with the libraries are performed to eliminate this possibility.
  • RNA can be separated from unbound beads on the basis of the altered charge properties due to RNA binding, hi a prefened embodiment of this technique, beads are separated from unbound nucleic acid and suspended, preferably but not only, in the presence of an electric field where the bound RNA causes the beads bound to the target RNA to migrate toward the anode, or positive, end of the field.
  • Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1 -octane sulfonic acid, carboxymethylcellulose, canageenan, and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alky amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-l-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as
  • the detergent if present, is a nonionic detergent.
  • Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol.
  • RNA may or may not be ineversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead.
  • linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an elecfrophile and a nucleophile, or alkylating reagents.
  • RNA is ineversibly bound to the bead
  • compounds can be isolated from the bead following destruction of the bound RNA by enzymatic degradation including, but not limited to, ribonucleases A, U 2 , CL 3 , T ls Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following treatment with sodium hydroxide, hydrazine, piperidine formate, or dimethyl sulfate), or metal-assisted (e.g. nickel(I ⁇ ), cobalt(H), or iron(II)) oxidative cleavage.
  • enzymatic degradation including, but not limited to, ribonucleases A, U 2 , CL 3 , T ls Phy M, B. cereus
  • chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following treatment with sodium hydroxide
  • the complexed beads are separated from uncomplexed beads by microwave specfroscopy.
  • microwave specfroscopy For example, as described in U.S. Patent Nos. 6,395,480; 6,376,258; 6,368,795; 6,340,568; 6,338,968; 6,287,874; and 6,287,776 to Hefti, the disclosures of which are hereby inco ⁇ orated by reference, the unique dielectric properties of molecules and binding complexes, such as hybridization complexes formed between a nucleic acid probe and a nucleic acid target, molecular binding events, and protein/ligand complexes, result in varying microwave spectra which can be measured.
  • the molecule's dielectric properties can be observed by coupling a test signal to the molecule and observing the resulting signal.
  • the test signal excites the molecule at a frequency within the molecule's dispersion regime, especially at a resonant frequency, the molecule will interact strongly with the signal, and the resulting signal will exhibit dramatic variations in its measured amplitude and phase, thereby generating a unique signal response.
  • This response can be used to detect and identify the bound molecular structure, hi addition, because most molecules will exhibit different dispersion properties over the same or different frequency bands, each generates a unique signal response which can be used to identify the molecular structure.
  • the library comprises anays or microarrays of compounds, wherein each compound has an address or identifier
  • the compound can be deconvoluted, e.g., by cross- referencing the positive sample to original compound list that was applied to the individual test assays.
  • the sequence of the compound can be determined by direct sequencing of the peptide or nucleic acid. Such methods are well known to one of skill in the art. A number of physico-chemical techniques can be used for the de novo characterization of compounds bound to the target.
  • Mass spectrometry e.g., electrospray ionization (“ESI”) and matrix-assisted laser deso ⁇ tion-ionization (“MALDI”), Fourier-transform ion cyclofron resonance (“FT- ICR”)
  • ESI electrospray ionization
  • MALDI matrix-assisted laser deso ⁇ tion-ionization
  • FT- ICR Fourier-transform ion cyclofron resonance
  • mass spectroscopy is that separation of a bound and unbound complex and compound structure elucidation can be carried out in a single step.
  • MALDI uses a pulsed laser for deso ⁇ tion of the ions and a time-of- flight analyzer, and has been used for the detection of noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj et al, 1997, J. Biol. Chem. 272:32084-32091).
  • covalent cross-linking between the target nucleic acid and the compound is required for detection, since a non-covalently bound complex may dissociate during the MALDI process.
  • ESI mass spectrometry (“ESI-MS”) has been of greater utility for studying non-covalent molecular interactions because, unlike the MALDI process, ESI-MS generates molecular ions with little to no fragmentation (Xavier et al, 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been used to study the complexes formed by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et al, 1997, Anal. Chem. 69:5130-5135).
  • FT-ICR Fourier-transform ion cyclofron resonance
  • An advantage of mass specfroscopy is not only the elucidation of the structure of the compound, but also the determination of the structure of the compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a compound that specifically binds to a preselected target RNA.
  • the structure of the compound is determined by time of flight mass spectroscopy ("TOF-MS"). hi time of flight methods of mass spectrometry, charged (ionized) molecules are produced in a vacuum and accelerated by an electric field into a time of flight tube or drift tube.
  • the velocity to which the molecules may be accelerated is proportional to the accelerating potential, proportional to the charge of the molecule, and inversely proportional to the square of the mass of the molecule.
  • the charged molecules travel, i.e., "drift" down the TOF tube to a detector.
  • the time taken for the molecules to travel down the tube may be inte ⁇ reted as a measure of their molecular weight.
  • Time-of-flight mass spectrometers have been developed for all of the major ionization techniques such as, but limited to, elecfron impact (“El”), infrared laser deso ⁇ tion (“IRLD”), plasma deso ⁇ tion (“PD”), fast atom bombardment (“FAB”), secondary ion mass spectrometry (“SIMS”), matrix-assisted laser deso ⁇ tion/ionization (“MALDI”), and electrospray ionization (“ESI”).
  • El elecfron impact
  • IRLD infrared laser deso ⁇ tion
  • PD plasma deso ⁇ tion
  • FAB fast atom bombardment
  • SIMS secondary ion mass spectrometry
  • MALDI matrix-assisted laser deso ⁇ tion/ionization
  • ESI electrospray ionization
  • Edman degradation can be used to determine the structure of the compound.
  • a modified Edman degradation process is used to obtain compositional tags for proteins, which is described in U.S. Patent No. 6,277,644 to Farnsworth et al, which is hereby inco ⁇ orated by reference in its entirety.
  • the Edman degradation chemistry is separated from amino acid analysis, circumventing the serial requirement of the conventional Edman process. Multiple cycles of coupling and cleavage are performed prior to extraction and compositional analysis of amino acids. The amino acid composition information is then used to search a database of known protein or DNA sequences to identify the sample protein.
  • An apparatus for performing this method comprises a sample holder for holding the sample, a coupling agent supplier for supplying at least one coupling agent, a cleavage agent supplier for supplying a cleavage agent, a controller for directing the sequential supply of the coupling agents, cleavage agents, and other reagents necessary for performing the modified Edman degradation reactions, and an analyzer for analyzing amino acids.
  • the method can be automated as described in U.S.
  • the apparatus includes a continuous capillary connected between two valves that confrol fluid flow in the capillary.
  • One part of the capillary forms a reaction chamber where the sample may be immobilized for subsequent reaction with reagents supplied through the valves.
  • Another part of the capillary passes through or terminates in the detector portion of an analyzer such as an electrophoresis apparatus, liquid chromatographic apparatus or mass spectrometer.
  • the apparatus may form a peptide or protein sequencer for carrying out the Edman degradation reaction and analyzing the reaction product produced by the reaction.
  • the protein or peptide sequencer includes a reaction chamber for canying out coupling and cleavage on a peptide or protein to produce derivatized amino acid residue, a conversion chamber for carrying out conversion and producing a converted amino acid residue and an analyzer for identifying the converted amino acid residue.
  • the reaction chamber may be contained within one arm of a capillary and the conversion chamber is located in another arm of the capillary.
  • An electrophoresis length of capillary is directly capillary coupled to the conversion chamber to allow electrophoresis separation of the converted amino acid residue as it leaves the conversion chamber. Identification of the converted amino acid residue takes place at one end of the electrophoresis length of the capillary.
  • NMR specfroscopy is a technique for identifying binding sites in target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects.
  • Examples of NMR that can be used for the invention include, but are not limited to, one-dimentional NMR, two- dimentional NMR, conelation specfroscopy ("COSY”), and nuclear Overhauser effect (“NOE”) spectroscopy.
  • COSY conelation specfroscopy
  • NOE nuclear Overhauser effect
  • an advantage of NMR is the not only the elucidation of the structure of the compound, but also the determination of the structure of the compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a compound that specifically binds to a preselected target RNA.
  • Vibrational specfroscopy e.g. infrared (IR) specfroscopy or Raman specfroscopy
  • IR infrared
  • Raman specfroscopy can be used for elucidating the structure of the compound on the isolated bead.
  • Infrared specfroscopy measures the frequencies of infrared light (wavelengths from 100 to 10,000 nm) absorbed by the compound as a result of excitation of vibrational modes according to quantum mechanical selection rules which require that abso ⁇ tion of light cause a change in the electric dipole moment of the molecule.
  • the infrared spectrum of any molecule is a unique pattern of abso ⁇ tion wavelengths of varying intensity that can be considered as a molecular fmge ⁇ rint to identify any compound.
  • Infrared spectra can be measured in a scanning mode by measuring the abso ⁇ tion of individual frequencies of light, produced by a grating which separates frequencies from a mixed-frequency infrared light source, by the compound relative to a standard intensity (double-beam instrument) or pre-measured ('blank') intensity (single-beam instrument), hi a prefened embodiment, infrared spectra are measured in a pulsed mode (FT-IR) where a mixed beam, produced by an interferometer, of all infrared light frequencies is passed through or reflected off the compound.
  • FT-IR pulsed mode
  • the resulting interferogram which may or may not be added with the resulting interferograms from subsequent pulses to increase the signal strength while averaging random noise in the electronic signal, is mathematically transformed into a spectrum using Fourier Transform or Fast Fourier Transform algorithms.
  • Raman specfroscopy measures the difference in frequency due to abso ⁇ tion of infrared frequencies of scattered visible or ultraviolet light relative to the incident beam.
  • the incident monochromatic light beam usually a single laser frequency, is not truly absorbed by the compound but interacts with the electric field transiently. Most of the light scattered off the sample with be unchanged (Rayleigh scattering) but a portion of the scatter light will have frequencies that are the sum or difference of the incident and molecular vibrational frequencies.
  • the selection rules for Raman (inelastic) scattering require a change in polarizability of the molecule. While some vibrational transitions are observable in both infrared and Raman spectrometry, must are observable only with one or the other technique.
  • the Raman spectrum of any molecule is a unique pattern of abso ⁇ tion wavelengths of varying intensity that can be considered as a molecular finge ⁇ rint to identify any compound.
  • Raman spectra are measured by submitting monochromatic light to the sample, either passed through or preferably reflected off, filtering the Rayleigh scattered light, and detecting the frequency of the Raman scattered light.
  • An improved Raman specfrometer is described in US Patent No. 5,786,893 to Fink et al. , which is hereby inco ⁇ orated by reference.
  • Vibrational microscopy can be measured in a spatially resolved fashion to address single beads by integration of a visible microscope and spectrometer.
  • a microscopic infrared spectrometer is described in U.S. Patent No. 5,581,085 to Reffher et al , which is hereby inco ⁇ orated by reference in its entirety.
  • An instrument that simultaneously performs a microscopic infrared and microscopic Raman analysis on a sample is described in U.S. Patent No. 5,841,139 to Sostek et al, which is hereby inco ⁇ orated by reference in its entirety.
  • compounds are synthesized on polystyrene beads doped with chemically modified styrene monomers such that each resulting bead has a characteristic pattern of abso ⁇ tion lines in the vibrational (IR or Raman) spectrum, by methods including but not limited to those described by Fer iri et al, 2000, J. Am. Chem. Soc. 123:8151-8152.
  • the library of compounds is prepared so that the specfroscopic pattern of the bead identifies one of the components of the compound on the bead. Beads that have been separated according to their ability to bind target RNA can be identified by their vibrational spectrum.
  • appropriate sorting and binning of the beads during synthesis then allows identification of one or more further components of the compound on any one bead.
  • partial identification of the compound on a bead is possible through use of the specfroscopic pattern of the bead with or without the aid of further sorting during synthesis, followed by partial resynthesis of the possible compounds aided by doped beads and appropriate sorting during synthesis.
  • the JJ . or Raman spectra of compounds are examined while the compound is still on a bead, preferably, or after cleavage from bead, using methods including but not limited to photochemical, acid, or heat freatment.
  • the compound can be identified by comparison of the IR or Raman spectral pattern to spectra previously acquired for each compound in the combinatorial library.
  • compounds can be identified by matching the IR or Raman spectra of a compound to a dataset of vibrational (IR or Raman) spectra previously acquired for each compound in the combinatorial library. By this method, the spectra of compounds with known structure are recorded so that comparison with these spectra can identify compounds again when isolated from RNA binding experiments. 5.7.5 Microwave Spectroscopy
  • the microwave spectra of a compound can be used to elucidate the structure of the compound.
  • the unique dielectric properties of molecules and binding complexes such as hybridization complexes formed between a nucleic acid probe and a nucleic acid target, molecular binding events, and protein/ligand complexes, result in varying microwave spectra which can be measured.
  • the molecule's dielectric properties can be observed by coupling a test signal to the molecule and observing the resulting signal.
  • the test signal excites the molecule at a frequency within the molecule's dispersion regime, especially at a resonant frequency, the molecule will interact strongly with the signal, and the resulting signal will exhibit dramatic variations in its measured amplitude and phase, thereby generating a unique signal response.
  • This response can be used to detect and identify the bound molecular structure.
  • most molecules will exhibit different dispersion properties over the same or different frequency bands, each generates a unique signal response which can be used to identify the molecular structure.
  • X-ray crystallography can be used to elucidate the structure of a compound.
  • the first step in x-ray crystallography is the formation of crystals.
  • the formation of crystals begins with the preparation of highly purified and soluble samples.
  • the conditions for crystallization is then determined by optimizing several solution variables known to induce nucleation, such as pH, ionic strength, temperature, and specific concenfrations of organic additives, salts and detergent.
  • Techniques for automating the crystallization process have been developed to automate the production of high-quality protein crystals.
  • crystals are harvested and prepared for data collection.
  • the crystals are then analyzed by diffraction (such as multi-circle diffractometers, high-speed CCD detectors, and detector off-set). Generally, multiple crystals must be screened for structure determinations.
  • an X-ray source is provided, for example, by a rotating anode generator producing an X-ray beam of a characteristic wavelength.
  • sources of X-ray radiation that may be used in the methods of the invention, including low and high intensity radiation.
  • the tunable X-ray radiation is produced by a Synchrotron.
  • the primary X-ray beam is monochromated by either crystal monochromators or focusing minors and the beam is passed through a helium flushed collimator.
  • the crystal is mounted on a pin on a goniometer head, that is mounted to a goniometer which allows to position the crystal in different orientations in the beam.
  • the diffracted X-rays can be recorded using a number of techniques, including, but not limited to image plates, multiwire detectors or CCD cameras.
  • flash cooling for example, of protein crystals, to cryogenic temperatures ( ⁇ 100 K) offers many advantages, the most significant of which is the elimination of radiation damage.
  • the invention provides for naturally occurring genes with premature stop codons to ascertain the effects of compounds on premature translation termination and/or nonsense-mediated mRNA decay.
  • the expression of the gene product in particular, a full-length gene product, is indicative of the effect of the compounds on premature franslation termination and/or nonsense-mediated mRNA decay.
  • the naturally occurring genes with premature stop codons are genes that cause diseases which are due, in part, to the lack of expression of the gene resulting from the premature stop codon.
  • Such diseases include, but are not limited to, cystic fibrosis, muscular dystrophy, heart disease (e.g., familial hypercholesterolemia), p53-associated cancers (e.g., lung, breast, colon, pancreatic, non- Hodgkin's lymphoma, ovarian, and esophageal cancer), colorectal carcinomas, neurofibromatosis, retinoblastoma, Wilm's tumor, retinitis pigmentosa, collagen disorders (e.g., osteogenesis imperfecta and cinhosis), Tay Sachs disease, blood disorders (e.g., hemophilia, von Willebrand disease, b-Thalassemia), kidney stones, ataxia-telangiectasia, lysosomal storage diseases, and tuberous sclerosis. Genes involved in the etiology of these diseases are discussed below.
  • franslation termination signals is not necessarily limited to a simple trinucleotide stop codon, but is instead recognized by the sequences sunounding the stop codon in addition to the stop codon itself (see, e.g., Manuvakhova et al, 2000, RNA 6(7): 1044- 1055, which is hereby inco ⁇ orated by reference in its entirety).
  • any genes containing particular tetranucleotide sequences at the stop codon such as, but not limited to, UGAC, UAGU, UAGC, UAGG, UAAC, UAAU, UAAG, and UAAA, are candidates of naturally occurring genes with premature stop codons that are useful in the present invention.
  • Human disease genes that contain these particular sequence motifs are sorted by chromosome is presented as an Example in Section 8.
  • Cystic Fibrosis is caused by mutations in the cystic fibrosis conductance regulator ("CFTR") gene. Such mutations vary between populations and depend on a multitude of factors such as, but not limited to, ethnic background and geographic location. Nonsense mutations in the CFTR gene are expected to produce little or not CFTR chloride channels. Several nonsense mutations in the CFTR gene have been identified (see, e.g., Tzetis et al, 2001, Hum Genet. 109(6):592-601. Sfrandvik et al, 2001, Genet Test. 5(3):235-42; Feldmann et al, 2001, Hum Mutat.
  • Muscular dystrophy is a genetic disease characterized by severe, progressive muscle wasting and weakness.
  • Duchenne muscular dystrophy and Becker muscular dystrophy are generally caused by nonsense mutations of the dystrophin gene (see, e.g., Ken et al., 2001, Hum Genet. 109(4):402-7 and Wagner et al, 2001, Ann Neurol. 49(6):706-l 1).
  • Nonsense mutations in other genes have also been implicated in other types of muscular dystrophy, such as, but not limited to, collagen genes in Ullrich congenital muscular dystrophy (see, e.g., Demir et al, 2002, Am J Hum Genet.
  • the emerin gene and lamins genes in Emery-Dreifuss muscular dystrophy see, e.g., Holt et al., 2001, Biochem Biophys Res Comniun. 287(5):1129-33; Becane et al., 2000, Pacing Clin Elecfrophysiol. 23(11 Pt l):1661-6; and Bonne et al, 2000, Ann Neurol. 48(2):170-80.
  • the dysferlin gene in Miyoshi myopathy see, e.g., Nakagawa et al., 2001, J Neurol Sci.
  • the plectin gene in late onset muscular dystrophy see, e.g., Bauer et al., 2001, Am J Pathol. 158(2):617-25
  • the delta-sarcoglycan gene in recessive limb-girdle muscular dystrophy see, e.g., Duggan et al, 1997, Neurogenetics. l(l):49-58
  • the laminina2-chain gene in congenital muscular dystrophy see, e.g., Mendell et al., 1998, Hum Mutat.
  • Hypercholesterolemia or high blood cholesterol, results from either the ove ⁇ roduction or the underutilization of low density lipoprotein ("LDL").
  • LDL low density lipoprotein
  • Hypercholesterolemia is caused by either the genetic disease familial hypercholesterolemia or the consumption of a high cholesterol diet.
  • Nonsense mutations in the LDL receptor gene have been implicated in familial hypercholesterolemia.
  • Several nonsense mutations in the LDL receptor gene have been identified (see, e.g., Lind et al, 2002, Atherosclerosis 163(2):399-407; Salazar et al, 2002, Hum Mutat. 19(4):462-3; Kuhrova et al, 2002, Hum Mutat. 19(1):80; Zakharova et al, 2001, Bioorg Khim. 27(5):393-6; Kuhrova et al, 2001, Hum Mutat.
  • Any LDL receptor gene encoding a premature translation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
  • Mutant forms of the p53 protein which is thought to act as a negative regulator of cell proliferation, transformation, and tumorigenesis, have been implicated as a common genetic change characteristic of human cancer (see, e.g., Levine et al, 1991, Nature 351:453-456 and Hollstein et al, 1991, Science 253:49-53).
  • p53 mutations have been implicated in cancers such as, but not limited to, lung cancer, breast cancer, colon cancer, pancreatic cancer, non-Hodgkin's lymphoma, ovarian cancer, and esophageal cancer.
  • Nonsense mutations have been identified in the p53 gene and have been implicated in cancer.
  • Several nonsense mutations in the p53 gene have been identified (see, e.g, Masuda et al, 2000, Tokai J Exp Clin Med. 25(2):69-77; Oh et al, 2000, Mol Cells 10(3):275-80; Li et al, 2000, Lab Invest. 80(4):493-9; Yang et al, 1999, Zhonghua Zhong Liu Za Zhi 21(2):114-8; Finkelstein et al, 1998, Mol Diagn. 3(1):37-41; Kajiyama et al, 1998, Dis Esophagus.
  • Colorectal Carcinomas Molecular genetic abnormalities resulting in colorectal carcinoma involve tumor-suppressor genes that undergo inactivation (such as, but not limited to, ape, mcc, dec, p53, and possibly genes on chromosomes 8p, lp, and 22q) and dominant-acting oncogenes (such, but not limited to, ras, src, and myc) (see, e.g., Hamilton, 1992, Cancer 70(5 Suppl):1216-21).
  • tumor-suppressor genes that undergo inactivation (such as, but not limited to, ape, mcc, dec, p53, and possibly genes on chromosomes 8p, lp, and 22q) and dominant-acting oncogenes (such, but not limited to, ras, src, and myc) (see, e.g., Hamilton, 1992, Cancer 70(5 Suppl):1216-21).
  • Nonsense mutations have been implicated in colorectal carcinomas (see, e.g., Learn et al, 1997, Genes Chromosomes Cancer. 18(1):8-18; Akiyama et al, 1996, Cancer 78(12):2478-84; Itoh & Imai , 1996, Hokkaido Igaku Zasshi 71(1):9-14; Kolodner et al, 1994, Genomics. 24(3):516-26; Ohue t ⁇ /., 1994, Cancer Res. 54(17):4798-804; and Yin et al, 1993, Gasfroenterology. 104(6): 1633-9; the disclosures of which are hereby inco ⁇ orated by reference in their entireties).
  • Neurofibromatosis is an inherited disorder, which is commonly caused caused by mutations in the NF1 and NF2 tumor suppressor genes. It is characterized by multiple infracranial tumors including schwannomas, memngiomas, and ependymomas. Nonsense mutations in the NF1 and NF2 genes have been described. Nonsense mutations have been implicated in neurofibromatosis (see, e.g., Lamszus et al, 2001, hit J Cancer 91(6):803-8; Sestini et al, 2000, Hum Genet. 107(4): 366-71; Fukasawa et al, 2000, Jpn J Cancer Res.
  • Any gene encoding a premature translation codon implicated in neurofibromatosis including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
  • the retinoblastoma gene plays important roles in the genesis of human cancers.
  • Several pieces of evidence have shown that the retinoblastoma protein has dual roles in gating cell cycle progression and promoting cellular differentiation (see, e.g., Lee & Lee, 1997, Gan To Kagaku Ryoho 24(11): 1368-80 for a review).
  • Nonsense mutations in the RBI gene have been described.
  • Nonsense mutations have been implicated in retinoblastoma (see, e.g., Klutz et al, 2002, Am J Hum Genet. 71(1): 174-9; Alonso et al., 2001, Hum Mutat.
  • Wilm's tumor or nephroblastoma
  • Wilm's tumor is an embryonal malignancy of the kidney that affects children.
  • Nonsense mutations in the WT1 gene have been implicated in Wilm's tumor.
  • Several nonsense mutations in the WT1 have been identified (see, e.g., Nakadate et al, 1999, Genes Chromosomes Cancer 25(l):26-32; Diller et al, 1998, J Clin Oncol.
  • Any WT1 gene encoding a premature translation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
  • Retimtis pigmentosa is a genetic disease in which affected individuals develop progressive degeneration of the rod and cone photoreceptors. Retinitis pigmentosa cannot be explained by a single genetic defect but instead the hereditary abenation responsible for triggering the onset of the disease is localized in different genes and at different sites within these genes (reviewed in, e.g., Kohler et al, 1997, Klin Monatsbl Augenheilkd 211(2):84-93).
  • Nonsense mutations have been implicated in retinitis pigmentosa (see, e.g., Ching et al, 2002, Neurology 58(ll):1673-4; Zhang et al, 2002, Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 19(3):194-7; Zhang et al, 2002, Hum Mol Genet. 1;11(9):993-1003; Dietrich et al, 2002, Br J Ophthalmol. 86(3):328-32; Grayson et al, 2002, J Med Genet.
  • Osteogenesis imperfecta is a heterogeneous disorder of type I collagen resulting in varying degrees of severity and results from mutations the genes that encode the proalpha chains of type I collagen.
  • Nonsense mutations have been implicated in the genes that encode the proalpha chains of type I collagen ("COLA1" genes) (see, e.g., Slayton et al, 2000, Matrix Biol. 19(l):l-9; Bateman et al, 1999, Hum Mutat. 13(4):311-7; and Willing et al, 1996, Am J Hum Genet. 59(4):799-809; the disclosures of which are hereby inco ⁇ orated by reference in their entireties).
  • COLA1 gene encoding a premature translation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay. 5.8.11 Cirrhosis
  • Cinhosis generally refers to a chronic liver disease that is marked by replacement of normal tissue with fibrous tissue.
  • the multidrug resistance 3 gene has been implicated in cinhosis, and nonsense mutations have been identified in this gene (see, e.g.,
  • Tay Sachs disease is an autosomal recessive disorder affecting the central nervous system.
  • the disorder results from mutations in the gene encoding the alpha-subunit of beta-hexosaminidase A, a lysosomal enzyme composed of alpha and beta polypeptides.
  • beta-hexosaminidase A a lysosomal enzyme composed of alpha and beta polypeptides.
  • Several nonsense mutations have been implicated in Tay Sachs disease (see, e.g., Rajavel & Neufeld, 2001, Mol Cell Biol. 21(16):5512-9; Myerowitz, 1997, Hum
  • Any hexosaminidase gene encoding a premature franslation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense- mediated mRNA decay.
  • Hemophilia is caused by a deficiency in blood coagulation factors. Affected individuals are at risk for spontaneous bleeding into organs and treatment usually consists of administration of clotting factors. Hemophilia A is caused by a deficiency of blood coagulation factor VIII and hemophilia B is caused by a deficiency in blood coagulation factor IX. Nonsense mutations in the genes encoding coagulation factors have been implicated in hemophilia (see, e.g., Dansako et al, 2001, Ann Hematol. 80(5):292-4; Moller-Morlang et al, 1999, Hum Mutat.
  • Any gene encoding a premature translation codon implicated in hemophilia including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
  • Von Willebrand disease is a single-locus disorder resulting from a deficiency of von Willebrand factor: a multimeric multifunctional protein involved in platelet adhesion and platelet-to-platelet cohesion in high shear stress vessels, and in protecting from proteolysis and directing circulating factor VIII to the site of injury (reviewed in Rodeghiero, 2002, Haemophilia. 8(3):292-300).
  • Nonsense mutations have implicated in von Willehbrand disease (see, e.g., Rodeghiero, 2002, Haemophilia.
  • ⁇ thalassemia is caused by a deficiency in beta globin polypeptides which in turn causes a deficiency in hemoglobin production.
  • Nonsense mutations have been implicated in b thalassemia (see, e.g., El-Latif et al, 2002, Hemoglobin 26(l):33-40; Sanguansermsri et al, 2001, Hemoglobin 25(l):19-27; Romao 2000, Blood 96(8):2895-901; Perea et al, 1999, Hemoglobin 23(3):231-7; Rhodes et al, 1999, Am J Med Sci.
  • Kidney Stones Any gene encoding a premature translation codon implicated in b thalassemia including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
  • Kidney stones (nephrolithiasis), which affect 12% of males and 5% of females in the western world, are familial in 45% of patients and are most commonly associated with hypercalciuria (see, e.g., Lloyd et al, Nature 1996 Feb l;379(6564):445-9). Mutations of the renal-specific chloride channel gene are associated with hypercalciuric nephrolithiasis (kidney stones). Nonsense mutations have been implicated in kidney stones (see, e.g., Hoopes et al, 1998, Kidney hit. 54(3):698-705; Lloyd et al, 1997, Hum Mol Genet.
  • Any gene encoding a premature translation codon implicated in kidney stones including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature tianslation termination and/or nonsense-mediated mRNA decay.
  • Ataxia-telangiectasia is characterized by increased sensitivity to ionizing radiation, increased incidence of cancer, and neurodegeneration and is generally caused by mutations in the ataxia-telangiectasia gene (see, e.g., Barlow et al, 1999, Proc Natl Acad Sci USA 96(17):9915-9).
  • Nonsense mutations have been implicated in ataxia-telangiectasia (see, e.g., Camacho et al, 2002, Blood 99(l):238-44; Pitts et al, 2001, Hum Mol Genet. 10(11):1155-62; Laake et al, 2000, Hum Mutat.
  • lysosomal storage disorders There are more than 40 individually recognized lysosomal storage disorders. Each disorder results from a deficiency in the activity of a specific enzyme, which impedes the lysosome from carrying out its normal degradative role. These include but are not limited to the diseases listed subsequently. Aspartylglucosaminuria is caused by a deficiency of N-aspartyl-beta-glucosaminidase (Fisher et al., 1990, FEBS Lett. 269:440-
  • cholesterol ester storage disease is caused by mutations in the LIP A gene (Fujiyama et al., 1996, Hum. Mutat. 8:377-380); mutations in the CTNS gene are associated with cystinosis (Town et al., 1998, Nature Genet. 18:319-324); mutations in a- galactosidase A are associated with Fabry disease (Eng et al.,1993, Pediat. Res. 33:128A; Sakuraba et al., 1990, Am. J. Hum. Genet. 47:784-789; Davies et al., 1993, Hum. Molec. Genet.
  • mucolipidosis type IV results from mutations in theMCOLNl gene (Bargal et al., 2000, Nature Genet. 26: 120-123; Sun et al., 2000,Hum. Molec. Genet. 9:2471-2478); Mucopolysaccharidosis type I (Hurler syndrome) is caused by mutations in the IDUA gene (Scott et al., 1992, Genomics 13:1311- 1313;Bach et al., 1993, Am. J. Hum. Genet. 53:330-338); Mucopolysaccharidosis type II (Hunter syndrome) is caused by mutations in the IDS gene (Sukegawa et al., 1992, Biochem.
  • mucopolysaccharidosis type ITTD is caused by mutations in the glucosamine-6-sulfatase (G6S) gene (Robertson et al., 1988, Hum. Genet. 79:175-178); mucopolysaccharidosis type IVA (Morquio syndrome) is caused by mutations in the GALNS gene (Tomatsu et al., 1995, Am. J. Hum. Genet. 57:556-563; Tomatsu et al.,1995, Hum. Mutat. 6:195-196); mucopolysaccharidosis type VI (Maroteaux- Lamysyndrome) is caused by mutations in the ARSB gene (Litjens et al., 1992, Hum.
  • GUSB beta-glucuronidase
  • CLN1 PPT1
  • late infantile type ceroid lipofuscinosis is caused by mutations in the CLN2 gene (Sleat et al., 1997, Science 277:1802-1805); juvenile neuronal ceroid lipofuscinosis (Batten disease) is caused bymutations in the CLN3 gene (Mole et al., 1999, Hum. Mutat. 14: 199-215); late infantileneuronal ceroid lipofuscinosis, Finnish variant, is caused by mutations in the CLN5 gene(Savukoski et al., 1998, Nature Genet.
  • GBA GBA gene
  • Glycogen storage disease II is the prototypic lysosomal storage disease and is caused by mutations in the GAA gene(Becker et al., 1998, Am. J. Hum. Genet. 62:991-994)
  • Krabbe disease is caused by mutations in the GALC gene (Sakai et al., 1994, Biochem. Biophys. Res. Commun.
  • Tay-Sachs disease is caused by mutations in the HEXA gene (Akli et al., 1991, Genomics 11:124-134; Mules et al., 1992, Am. J. Hum. Genet. 50: 834-841 ;Triggs-Raine et al., 1991, Am. J. Hum. Genet. 49:1041- 1054; Drucker et al., 1993, Hum. Mutat. 2:415-417; Shore et al., 1992, Hum. Mutat. 1:486- 490); mutations in the GM2Agene causes Tay-Sachs variant AB (Schepers et al., 1996, Am. J. Hum. Genet.
  • Tuberous sclerosis complex is a dominantly inherited disease characterized by the presence of hamartomata in multiple organ systems.
  • the disease is caused bymutations in TSC1 (van S strengenhorst et al, 1997 Science 277:805-808; Sato et al, 2002, J. Hum. Genet. 47:20-28) and/or TSC2 (Vrtel et al, 1996, J. Med. Genet. 33:47- 51; Wilson et al, 1996, Hum. Molec. Genet. 5:249-256; Au et al, 1998, Am. J.Hum.
  • Any gene containing a premature translation codon implicated in tuberous sclerosis including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
  • the compounds identified in the nonsense suppression assay can be tested for biological activity using host cells containing or engineered to contain the target RNA element coupled to a functional readout system.
  • the lead compound can be tested in a host cell engineered to contain the
  • RNA with a premature translation termination codon controlling the expression of a reporter gene.
  • the lead compounds are assayed in the presence or absence of the RNA with the premature franslation termination codon.
  • Compounds that modulate premature franslation termination and/or nonsense-mediated mRNA decay will result in increased expression of the full-length gene, i. e. , past the premature termination codon.
  • a phenotypic or physiological readout can be used to assess activity of the target RNA with the premature franslation termination codon in the presence and absence of the lead compound
  • the compounds identified in the nonsense suppression assay can also be tested for biological activity using an in vitro transcribed RNA from the gene with a premature franslation termination codon and subsequent in vitro translation of that RNA in a cell-free franslation extract.
  • the activity of the lead compound in the in vitro translation mixture can be determined by any method that measures increased expression of the full-length gene, i.e., past the premature termination codon.
  • expression of a functional protein from the full-length gene can be measured to determine the effect of the lead compound on premature franslation termination and/or nonsense-mediated mRNA decay in an in vitro system.
  • a functional protein from the full-length gene e.g. , a reporter gene
  • expression of a functional protein from the full-length gene can be measured to determine the effect of the lead compound on premature franslation termination and/or nonsense-mediated mRNA decay in an in vitro system.
  • the invention provides for reporter genes to ascertain the effects of a compound on premature franslation termination and/or nonsense-mediated mRNA decay.
  • the level of expression and/or activity of a reporter gene product is indicative of the effect of the compound on premature franslation termination and/or nonsense-mediated mRNA decay.
  • the invention provides for specific vectors comprising a reporter gene operably linked to one or more regulatory elements and host cells transfected with the vectors.
  • the invention also provides for the in vitro franslation of a reporter gene flanked by one or more regulatory elements.
  • a reporter gene may or may not contain a premature stop codon depending on the assay conducted.
  • Techniques for practicing this specific aspect of this invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, and recombinant DNA manipulation and production, which are routinely practiced by one of skill in the art. See, e.g., Sambrook, 1989, Molecular Cloning, A Laboratory Manual, Second Edition; DNA Cloning, Volumes I and II (Glover, Ed.
  • reporter genes refer to a nucleotide sequence encoding a protein, polypeptide or peptide that is readily detectable either by its presence or activity. Reporter genes may be obtained and the nucleotide sequence of the elements determined by any method well- known to one of skill in the art.
  • the nucleotide sequence of a reporter gene can be obtained, e.g., from the literature or a database such as GenBank. Alternatively, a polynucleotide encoding a reporter gene may be generated from nucleic acid from a suitable source.
  • a nucleic acid encoding the reporter gene may be chemically synthesized or obtained from a suitable source (e.g., a cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the reporter gene) by PCR amplification.
  • a suitable source e.g., a cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the reporter gene
  • nucleotide sequence of a reporter gene may be manipulated using methods well-known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc.
  • reporter genes having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
  • a reporter gene is any naturally-occurring gene with a premature stop codon.
  • Genes with premature stop codons that are useful in the present invention include, but are not limited to, the genes described below, hi an alternative embodiment, a reporter gene is any gene that is not known in nature to contain a premature stop codon.
  • reporter genes include, but are not limited to, luciferase (e.g., firefly luciferase, renilla luciferase, and click beetle luciferase), green fluorescent protein (“GFP”) (e.g., green fluorescent protein, yellow fluorescent protein, red fluorescent protein, cyan fluorescent protein, and blue fluorescent protein), beta-galactosidase (“beta- gal”), beta-glucoronidase, beta-lactamase, chloramphemcol acetylfransferase (“CAT”), and alkaline phosphatase (“AP”).
  • luciferase e.g., firefly luciferase, renilla luciferase, and click beetle luciferase
  • GFP green fluorescent protein
  • beta-galactosidase beta-galactosidase
  • beta-lactamase beta-lactamase
  • CAT chloramphemcol acet
  • a reporter gene can also be a protein tag, such as, but not limited to, myc, His, FLAG, or GST, so that nonsense suppression will produce the peptide and the protein can be monitored by an ELISA, a western blot, or any other immunoassay to detect the protein tag.
  • a reporter gene utilized in the reporter constructs is easily assayed and has an activity which is not normally found in the cell or organism of interest.
  • CAT chloramphemcol acetylfransferase Transfers radioactive acetyl groups to chloramphemcol or detection by thin layer chromatography and autoradiography Reporter Gene Jfrotein Activity & Measurement
  • GAL beta-galactosidase Hydrolyzes colorless galactosides to yield colored products.
  • GUS beta-glucuronidase Hydrolyzes colorless glucuronides to yield colored products.
  • LUC luciferase Oxidizes luciferin, emitting photons
  • GFP green fluorescent protein Fluorescent protein without substrate
  • SEAP secreted alkaline phosphatase
  • HRP horseradish peroxidase
  • Luciferases are enzymes that emit light in the presence of oxygen and a substrate (luciferin) and which have been used for real-time, low-light imaging of gene expression in cell cultures, individual cells, whole organisms, and transgenic organisms
  • luciferase is intended to embrace all luciferases, or recombinant enzymes derived from luciferases which have luciferase activity.
  • the luciferase genes from fireflies have been well characterized, for example, from the Photinus and Luciola species (see, e.g., International Patent Publication No. WO 95/25798 for
  • eucaryotic luciferase genes include, but are not limited to, the click beetle (Photinus plagiophthalamus, see, e.g., Wood et al., 1989, Science 244:700-
  • Bacterial luciferin-luciferase systems include, but are not limited to, the bacterial lux genes of tenestrial Photorhabdus luminescens (see, e.g., Manukhov et al., 2000, Genetika 36(3):322-30) and marine bacteria Vibrio fischeri and Vibrio harveyi (see, e.g., Miyamoto et al., 1988, J Biol Chem.
  • the luciferases encompassed by the present invention also includes the mutant luciferases described in U.S. Patent No. 6,265,177 to Squinell et al, which is hereby inco ⁇ orated by reference in its entirety.
  • the luciferase is a firefly luciferase, a renilla luciferase, or a click beetle luciferase, as described in any one of the references listed supra, the disclosures of which are inco ⁇ orated by reference in their entireties.
  • Green fluorescent protein is a 238 amino acid protein with amino acid residues 65 to 67 involved in the formation of the chromophore which does not require additional substrates or cofactors to fluoresce (see, e.g., Prasher et al., 1992, Gene 111:229- 233; Yang et al., 1996, Nature Biotechnol. 14:1252-1256; and Cody et al., 1993, Biochemistry 32:1212-1218).
  • GFP green fluorescent protein
  • GFP includes green fluorescent protein, yellow fluorescent protein, red fluorescent protein, cyan fluorescent protein, and blue fluorescent protein.
  • the native gene for GFP was cloned from the bioluminescent jellyfish Aequorea victoria (see, e.g., Morin et al., 1972, J. Cell Physiol. 77:313-318). Wild type GFP has a major excitation peak at 395 nm and a minor excitation peak at 470 nm.
  • the abso ⁇ tion peak at 470 nm allows the monitoring of GFP levels using standard fluorescein isothiocyanate (FITC) filter sets.
  • Mutants of the GFP gene have been found useful to enhance expression and to modify excitation and fluorescence.
  • mutant GFPs with alanine, glycine, isoleucine, or threonine substituted for serine at position 65 result in mutant GFPs with shifts in excitation maxima and greater fluorescence than wild type protein when excited at 488 nm (see, e.g., Heim et al., 1995, Nature 373:663-664; U.S. Patent No.
  • GFPs are isolated from organisms other than the jellyfish, such as, but not limited to, the sea pansy, Renilla reriformis. Techniques for labeling cells with GFP in general are described in U.S. Patent Nos.
  • Beta galactosidase is an enzyme that catalyzes the hydrolysis of beta-galactosides, including lactose, and the galactoside analogs o-nifrophenyl-beta-D- galactopyranoside (“ONPG”) and chlorophenol red-beta-D-galactopyranoside (“CPRG”) (see, e.g., Nielsen et al, 1983 Proc Natl Acad Sci USA 80(17):5198-5202; ⁇ ustice et al, 1991, Biotechniques 11:739-742; and Henderson et al., 1986, Clin. Chem. 32:1637-1641).
  • ONPG o-nifrophenyl-beta-D- galactopyranoside
  • CPRG chlorophenol red-beta-D-galactopyranoside
  • beta-gal gene functions well as a reporter gene because the protein product is extremely stable, resistant to proteolytic degradation in cellular lysates, and easily assayed.
  • ONPG is used as the substrate, beta-gal activity can be quantitated with a spectrophotometer or microplate reader.
  • beta galactosidase or "beta-gal” is intended to embrace all beta-gals, including lacZ gene products, or recombinant enzymes derived from beta-gals which have beta-gal activity.
  • the beta-gal gene functions well as a reporter gene because the protein product is extremely stable, resistant to proteolytic degradation in cellular lysates, and easily assayed.
  • ONPG is the substrate
  • beta- gal activity can be quantitated with a spectrophotometer or microplate reader to determine the amount of ONPG converted at 420 nm.
  • beta-gal activity can be quantitated with a spectrophotometer or microplate reader to determine the amount of CPRG converted at 570 to 595 nm.
  • the beta-gal activity can be visually ascertained by plating bacterial cells transformed with a beta-gal construct onto plates containing Xgal and TPTG. Bacterial colonies that are dark blue indicate the presence of high beta-gal activity and colonies that are varying shades of blue indicate varying levels of beta-gal activity. Beta-Glucuronidase
  • Beta-glucuronidase catalyzes the hydrolysis of a very wide variety of beta-glucuronides, and, with much lower efficiency, hydrolyzes some beta- galacturonides. GUS is very stable, will tolerate many detergents and widely varying ionic conditions, has no cofactors, nor any ionic requirements, can be assayed at any physiological pH, with an optimum between 5.0 and 7.8, and is reasonably resistant to thermal inactivation (see, e.g., U.S. Patent No. 5,268,463, which is inco ⁇ orated by reference in its entirety).
  • the GUS is derived from the Esherichia coli beta- glucuronidase gene.
  • the beta-glucuronidase encoding nucleic acid is homologous to the E. coli beta-glucuronidase gene and/or may be derived from another organism or species.
  • GUS activity can be assayed either by fluorescence or spectrometry, or any other method described in U.S. Patent No. 5,268,463, the disclosure of which is inco ⁇ orated by reference in its entirety.
  • 4- trifluoromethylumbelliferyl beta-D-glucuronide is a very sensitive substrate for GUS. The fluorescence maximum is close to 500 nm ⁇ bluish green, where very few plant compounds fluoresce or absorb. 4-trifluoromethylumbelliferyl beta-D-glucuronide also fluoresces much more strongly near neutral pH, allowing continuous assays to be performed more readily than with MUG.
  • 4-trifluoromethylumbelliferyl beta-D-glucuronide can be used as a fluorescent indicator in vivo.
  • the spectrophotometric assay is very straightforward and moderately sensitive (Jefferson et al., 1986, Proc. Natl. Acad. Sci. USA 86:8447-8451).
  • a prefened substrate for spectrophotometric measurement is p-nifrophenyl beta-D- glucuronide, which when cleaved by GUS releases the chromophore p-nifrophenol.
  • the ionized chromophore absorbs light at 400-420 nm, giving a yellow color.
  • Beta-lactamases are nearly optimal enzymes in respect to their almost diffusion-controlled catalysis of beta-lactam hydrolysis, making them suited to the task of an intracellular reporter enzyme (see, e.g., Christensen et al., 1990, Biochem. J. 266: 853- 861). They cleave the beta-lactam ring of beta-lactam antibiotics, such as penicillins and cephalosporins, generating new charged moieties in the process (see, e.g., O'Callaghan et al., 1968, Antimicrob. Agents. Chemother. 8: 57-63 and Sfratton, 1988, J. Antimicrob. Chemother. 22, Suppl. A: 23-35).
  • beta-lactamases have been isolated and characterized, all of which would be suitable for use in accordance with the present invention (see, e.g., Richmond & Sykes, 1978, Adv.Microb.Physiol. 9:31-88 and Ambler, 1980, Phil. Trans. R. Soc. Lond. [Ser.B.] 289: 321-331, the disclosures of which are inco ⁇ orated by reference in their entireties).
  • the coding region of an exemplary beta-lactamase employed has been described in U.S. Patent No. 6,472,205, Kadonaga et al., 1984, J.Biol.Chem. 259: 2149- 2154, and Sutcliffe, 1978, Proc. Natl. Acad.
  • Chloramphemcol acetyl fransferase is commonly used as a reporter gene in mammalian cell systems because mammalian cells do not have detectable levels of CAT activity.
  • the assay for CAT involves incubating cellular extracts with radiolabeled chloramphenicol and appropriate co-factors, separating the starting materials from the product by, for example, thin layer chromatography ("TLC”), followed by scintillation counting (see, e.g., U.S. Patent No. 5,726,041, which is hereby inco ⁇ orated by reference in its entirety).
  • chloramphenicol acetyltransferase or "CAT” is intended to embrace all CATs, or recombinant enzymes derived from CAT which have CAT activity. While it is preferable that a reporter system which does not require cell processing, radioisotopes, and chromatographic separations would be more amenable to high through-put screening, CAT as a reporter gene may be preferable in situations when stability of the reporter gene is important. For example, the CAT reporter protein has an in vivo half life of about 50 hours, which is advantageous when an accumulative versus a dynamic change type of result is desired.
  • the secreted alkaline phosphatase (“SEAP”) enzyme is a truncated form of alkaline phosphatase, in which the cleavage of the transmembrane domain of the protein allows it to be secreted from the cells into the sunounding media.
  • the alkaline phosphatase is isolated from human placenta.
  • secreted alkaline phosphatase or "SEAP” is intended to embrace all SEAP or recombinant enzymes derived from SEAP which have alkaline phosphatase activity.
  • SEAP activity can be detected by a variety of methods including, but not limited to, measurement of catalysis of a fluorescent substrate, immunoprecipitation, HPLC, and radiometric detection.
  • the luminescent method is prefened due to its increased sensitivity over calorimetric detection methods.
  • the advantages of using SEAP is that a cell lysis step is not required since the SEAP protein is secreted out of the cell, which facilitates the automation of sampling and assay procedures.
  • a cell-based assay using SEAP for use in cell-based assessment of inhibitors of the Hepatitis C virus protease is described in U.S. Patent No. 6,280,940 to Potts et al. which is hereby inco ⁇ orated by reference in its entirety.
  • a reporter gene may be engineered to contain a premature stop codon or may naturally contain a premature stop codon.
  • a protein, polypeptide or peptide that regulates (directly or indirectly) the expression of a reporter gene may be engineered to contain or may naturally contain a premature stop codon.
  • the premature stop codon may any one of the stop codons known in the art including UAG, UAA and UGA.
  • a reporter gene contains or is engineered to contain the premature stop codon UAG.
  • a reporter gene contains or is engineered to contain the premature stop codon UGA.
  • a reporter gene contains or is engineered to contain two or more stop codons.
  • the stop codons are preferably at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 75 nucleotides or at least 100 nucleotides apart from each other.
  • at least one of the stop codons is preferably UAG or UGA.
  • a reporter gene contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides from the start codon in the coding sequence.
  • a reporter gene contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides from the native stop codon in the coding sequence of the full-length reporter gene product or protein, polypeptide or peptide.
  • a reporter gene contains or is engineered to contain a premature stop codon at least 15 nucleotides (preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides) from the start codon in the coding sequence and at least 15 nucleotides (preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides) from the native stop codon in the coding sequence of the full-length reporter gene product or protein, polypeptide or peptide.
  • a premature stop codon at least 15 nucleotides (preferably at least 20 nucleotides, at least 25 nucleotides
  • the premature stop codon is preferably UAG or UGA.
  • the premature translation stop codon can be produced by in vitro mutagenesis techniques such as, but not limited to, polymerase chain reaction ("PCR"), linker insertion, oligonucleotide-mediated mutagenesis, and random chemical mutagenesis.
  • PCR polymerase chain reaction
  • the nucleotide sequence encoding for a protein, polypeptide or peptide can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and franslation of the inserted protein- coding sequence.
  • an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and franslation of the inserted protein- coding sequence.
  • the necessary transcriptional and translational elements can also be supplied by the protein, polypeptide or peptide.
  • the regulatory regions and enhancer elements can be of a variety of origins, both natural and synthetic.
  • a reporter gene is operably linked to regulatory element that is responsive to a regulatory protein whose expression is dependent upon the suppression of a premature stop codon.
  • a variety of host-vector systems may be utilized to express a protein, polypeptide or peptide. These include, but are not limited to, mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA; and stable cell lines generated by transformation using a selectable marker.
  • the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable tianscription and translation elements may be used.
  • any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric nucleic acid consisting of appropriate transcriptional/translational confrol signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of a first nucleic acid sequence encoding a protein, polypeptide or peptide, such as a reporter gene, may be regulated by a second nucleic acid sequence so that the first nucleic acid sequence is expressed in a host transformed with the second nucleic acid sequence.
  • expression of a nucleic acid sequence encoding a protein, polypeptide or peptide, such as a reporter gene may be controlled by any promoter/enhancer element known in the art, such as a constitutive promoter, a tissue-specific promoter, or an inducible promoter.
  • promoters which may be used to control gene expression include, but are not limited to, the SV40 early promoter region (Bernoist & Chambon, 1981, Nature 290:304- 310), the promoter contained in the 3 ' long terminal repeat of Rous sarcoma virus
  • promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol.
  • mouse mammary tumor virus confrol region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al., 1987, Genes and Devel. 1:268-276), alpha-fetoprotein gene confrol region which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58; alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al., 1987, Genes and Devel.
  • beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94; myelin basic protein gene confrol region which is active in ohgodendrocyte cells in the brain (Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene confrol region which is active in skeletal muscle (Sani, 1985, Nature 314:283- 286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al., 1986, Science 234:1372-1378).
  • a vector is used that comprises a promoter operably linked to a reporter gene, one or more origins of replication, and, optionally, one or more selectable markers (e.g., an antibiotic resistance gene),
  • the vectors are CMV vectors, T7 vectors, lac vectors, pCEP4 vectors, 5.0/F vectors, or vectors with a tetracycline-regulated promoter (e.g., pcDNATM5/FRT/TO from Invitrogen).
  • Some vectors may be obtained commercially. Non-limiting examples of useful vectors are described in Appendix 5 of Cunent Protocols in Molecular Biology, 1988, ed. Ausubel et al., Greene Publish. Assoc. & Wiley friterscience, which is inco ⁇ orated herein by reference; and the catalogs of commercial suppliers such as Clonteeh Laboratories, Stratagene Inc., and Invitrogen, Inc.
  • Expression vectors containing a construct of the present invention can be identified by the following general approaches: (a) nucleic acid hybridization, (b) presence or absence of "marker" nucleic acid functions, (c) expression of inserted sequences, and (d) sequencing.
  • the presence of a particular nucleic acid sequence inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to the inserted nucleic acid sequence.
  • the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "marker" nucleic acid functions (e.g., thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of the nucleic acid sequence of interest in the vector.
  • certain "marker" nucleic acid functions e.g., thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.
  • recombinant expression vectors can be identified by assaying the product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the particular nucleic acid sequence.
  • nucleic acid sequences encoding proteins, polypeptides or peptides are cloned into stable cell line expression vectors.
  • the stable cell line expression vector contains a site specific genomic integration site.
  • the reporter gene construct is cloned into an episomal mammalian expression vector.
  • a host cell is transformed or transfected with the vector of interest.
  • the use of stable fransformants is prefened.
  • the host cell is a mammalian cell, hi a more prefened embodiment, the host cell is a human cell.
  • the host cells are primary cells isolated from a tissue or other biological sample of interest.
  • Host cells that can be used in the methods of the present invention include, but are not limited to, hybridomas, pre-B cells, 293 cells, 293T cells, HeLa cells, HepG2 cells, K562 cells, 3T3 cells, hi another prefened embodiment, the host cells are derived from tissue specific to the nucleic acid sequence encoding a protein, polypeptide or peptide. hi another preferred embodiment, the host cells are immortalized cell lines derived from a source, e.g., a tissue. Other host cells that can be used in the present invention include, but are not limited to, bacterial cells, yeast cells, virally-infected cells, or plant cells.
  • Prefened mammalian host cells include but are not limited to those derived from humans, monkeys and rodents, (see, for example, Kriegler M. in “Gene Transfer and Expression: A Laboratory Manual", New York, Freeman & Co. 1990), such as monkey kidney cell line transformed by SV40 (COS-7, ATCC Accession No. CRL 1651); human embryonic kidney cell lines (293, 293-EBNA, or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol., 36:59, 1977; baby hamster kidney cells (BHK, ATCC Accession No. CCL 10); Chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chasin. Proc. Natl. Acad.
  • COS-7 monkey kidney cell line transformed by SV40
  • human embryonic kidney cell lines (293, 293-EBNA, or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol., 36:
  • mice sertoli cells (Mather, Biol. Reprod. 23:243-251, 1980); mouse fibroblast cells (NTH-3T3), monkey kidney cells (CVI ATCC Accession No. CCL 70); african green monkey kidney cells (VERO-76, ATCC Accession No. CRL-1587); human cervical carcinoma cells (HELA, ATCC Accession No. CCL 2); canine kidney cells (MDCK, ATCC Accession No. CCL 34); buffalo rat liver cells (BRL 3A, ATCC Accession No. CRL 1442); human lung cells (W138, ATCC Accession No. CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor cells (MMT 060562, ATCC Accession No.
  • yeast a number of vectors containing constitutive or inducible promoters may be used with Saccharomyces cerevisiae (baker's yeast), Schizosaccharomyces pombe (fission yeast), Pichia pastoris, and Hansenula polymorpha (methylotropic yeasts).
  • Saccharomyces cerevisiae bakeer's yeast
  • Schizosaccharomyces pombe Schizosaccharomyces pombe
  • Pichia pastoris Pichia pastoris
  • Hansenula polymorpha methylotropic yeasts
  • Transformation may be by any known method for introducing polynucleotides into a host cell, including, for example packaging the polynucleotide in a virus and transducing a host cell with the virus, and by direct uptake of the polynucleotide.
  • the transformation procedure used depends upon the host to be transformed. Mammalian transformations (i.e., transfections) by direct uptake may be conducted using the calcium phosphate precipitation method of Graham & Van der Eb, 1978, Virol. 52:546, or the various known modifications thereof.
  • recombinant polynucleotides include dexfran-mediated transfection, calcium phosphate mediated transfection, polybrene mediated transfection, protoplast fusion, electioporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the polynucleotides into nuclei.
  • dexfran-mediated transfection calcium phosphate mediated transfection
  • polybrene mediated transfection protoplast fusion
  • electioporation encapsulation of the polynucleotide(s) in liposomes
  • direct microinjection of the polynucleotides into nuclei are well-known to one of skill in the art.
  • stable cell lines containing the constructs of interest are generated for high throughput screening.
  • Such stable cells lines may be generated by introducing a construct comprising a selectable marker, allowing the cells to grow for 1-2 days in an enriched medium, and then growing the cells on a selective medium.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • a number of selection systems may be used, including but not limited to the he ⁇ es simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine- guanine phosphoribosyltiansferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltiansferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt- cells, respectively.
  • anti-metabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methofrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colbene-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygromycin (Santene, et al., 1984, Gene 30:147) genes. 5.9.1.1.1.5 Cell-Free Extracts
  • the invention provides for the franslation of a nucleic acid sequence encoding a protein, polypeptide or peptide (with or without a premature translation stop codon) in a cell-free system.
  • Techniques for practicing the specific aspect of this invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, and recombinant DNA manipulation and production, which are routinely practiced by one of skill in the art. See, e.g., Sambrook, 1989, Molecular Cloning, A Laboratory Manual, Second Edition; DNA Cloning, Volumes I and II (Glover, Ed. 1985); and Transcription and Translation (Hames & Higgins, Eds. 1984).
  • the cell-free exfracts can be generated by centrifuging cells and clarifying the supernatant.
  • the cells are incubated on ice during the preparation of the cell-free extract.
  • the cells are incubated on ice at least 12 hours, at least 24 hours, at least two days, at least five days, at least one week, at least longer than one week.
  • the cells are incubated on ice at least long enough so as to improve the franslation activity of the cell exfract in comparison to cell extracts that are not incubated on ice.
  • the cells are incubated at a temperature between about 0 °C and 10 °C. hi a prefened embodiment, the cells are incubated at about 4 °C.
  • the cells are centrifuged at a low speed to isolate the cell-free exfract for in vitro translation reactions.
  • the cell extract is the supernatant from cells that are centrifuged at about 2 x g to 20,000 x g. In a more prefened embodiment, the cell extract is the supernatant from cells that are centrifuged at about 5 x g to 15,000 x g.
  • the cell extiact is the supernatant from cells that are centrifuged at about 10,000 x g.
  • the cell-free exfract is about the SI to S50 extract.
  • the cell exfract is about the S5 to S25 exfract.
  • the cell extract is about the S10 extiact.
  • the cell-free franslation extract may be isolated from cells of any species origin.
  • the cell-free translation extract is isolated from yeast, cultured mouse or rat cells, Chinese hamster ovary (CHO) cells, Xenopus oocytes, reticulocytes, wheat germ, or rye embryo (see, e.g., Krieg & Melton, 1984, Nature 308:203 and Dignam et al, 1990 Methods Enzymol. 182:194-203).
  • the cell-free franslation extract e.g., rabbit reticulocyte lysates and wheat germ extract, can be purchased from, e.g., Promega, (Madison, WT).
  • the cell-free translation extiact is prepared as described in International Patent Publication No. WO 01/44516 and U.S. Patent No. 4,668,625 to Roberts, the disclosures of which are inco ⁇ orated by reference in their entireties.
  • the cell-free exfract is an exfract isolated from human cells.
  • the human cells are HeLa cells. It is prefened that the endogenous expression of the genes with the premature translation codons is minimal, and preferably absent, in the cells from which the cell-free translation exfract is prepared.
  • RNAs with the gene of interest cloned in an expression vectors using promoters such as, but not limited to, Sp6, T3, or T7 promoters (see, e.g., expression vectors from Invitrogen, Carlesbad, CA; Promega,
  • the gene encoding the premature stop codon can be PCR-amplified with the appropriate primers, with the sequence of a promoter, such as but not limited to, Sp6, T3, or T7 promoters, inco ⁇ orated into the upstream primer, so that the resulting amplified PCR product can be in vitro transcribed with the appropriate polymerase.
  • a promoter such as but not limited to, Sp6, T3, or T7 promoters
  • a coupled transcription-translation system can be used for the expression of a gene encoding a premature stop codon in a cell free extract, such as the TnT® Coupled Transcription/Translation System (Promega, Madison, WI) or the system described in U.S. Patent No. 5,895,753 to Mierendorf et al, which is inco ⁇ orated by reference in its entirety.
  • Various in vitro assays can be used to identify and verify the ability of a compound to modulate premature franslation termination and/or nonsense-mediated mRNA decay. Multiple in vitro assays can be performed simultaneously or sequentially to assess the affect of a compound on premature franslation termination and/or nonsense-mediated mRNA decay. In a prefened embodiment, the in vitro assays described herein are performed in a high throughput format (e.g. , in microtiter plates).
  • the invention provides a method for identifying a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay, said method comprising: (a) contacting a member of a library of compounds with a cell containing a nucleic acid sequence comprising a reporter gene, wherein the reporter gene comprises a premature stop codon; and (b) detecting the expression of said reporter gene, wherein a compound that modulates premature franslation termination and/or nonsense-mediated mRNA decay is identified if the expression of said reporter gene in the presence of a compound is altered relative to a previously determined reference range, or the expression of said reporter gene in the absence of said compound or the presence of an appropriate control (e.g., a negative contiol).
  • an appropriate control e.g., a negative contiol
  • the invention provides a method for identifying a compound that modulates premature translation termination and/or nonsense- mediated mRNA decay, said method comprising: (a) contacting a member of a library of compounds with a cell-free extract and a nucleic acid sequence comprising a reporter gene, wherein the reporter gene comprises a premature stop codon; and (b) detecting the expression of said reporter gene, wherein a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay is identified if the expression of said reporter gene in the presence of a compound is altered relative to a previously determined reference range, or the expression of said reporter gene in the absence of said compound or the presence of an appropriate control (e.g., a negative control).
  • the cell-extract is preferably isolated from cells that have been incubated at about 0°C to about 10°C and/or an S10 to S30 cell-free exfract.
  • the alteration in reporter gene expression and/or activity in the reporter gene assays relative to a previously determined reference range, or to the expression or activity of the reporter gene in the absence of the compound or the presence of an appropriate control indicates that a particular compound modulates premature franslation termination and/or nonsense-mediated mRNA decay.
  • an increase in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate control may, depending upon the parameters of the reporter gene assay, indicate that a particular compound reduces or suppresses premature franslation termination and/or nonsense-mediated mRNA decay.
  • a decrease in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate confrol may, depending upon the parameters of the reporter gene-based assay, indicate that a particular compound enhances premature translation termination and/or nonsense-mediated mRNA decay.
  • the step of contacting a compound or a member of a library of compounds with cell in the reporter gene-based assays described herein is preferably conducted under physiologic conditions.
  • a compound or a member of a library of compounds is added to the cells in the presence of an aqueous solution
  • the aqueous solution may comprise a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions.
  • the aqueous solution may comprise a buffer, a combination of salts, and a detergent or a surfactant.
  • salts which may be used in the aqueous solution include, but not limited to, KC1, NaCI, and/or MgCl 2 .
  • the optimal concentration of each salt used in the aqueous solution is dependent on the cells and compounds used and can be determined using routine experimentation.
  • the step of contacting a compound or a member of a library of compounds with a cell containing a reporter gene construct and in some circumstances, a nucleic acid sequence encoding a regulatory protein may be performed for at least 0.2 hours, 0.25 hours, 0.5 hours, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 8 hours, 10 hours, 12 hours, 18 hours, at least 1 day, at least 2 days or at least 3 days.
  • the expression of a reporter gene and/or activity of the protein encoded by the reporter gene in the reporter-gene assays may be detected by any technique well-known to one of skill in the art.
  • a reporter gene can be readily detected, e.g., by quantifying the protein and/or RNA encoded by said gene.
  • Compounds that modulate premature translation termination and/or nonsense-mediated mRNA decay may be identified by changes in the gene encoding the premature translation stop codon, i.e., there is readthrough of the premature franslation stop codon and a longer gene product is detected. If a gene encoding a naturally-occurring premature franslation stop codon is used, a longer gene product in the presence of a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay can be detected by any method in the art that permits the detection of the longer polypeptide, such as, but not limited to, immunological methods.
  • immunoassays to detect and/or visualize gene expression
  • the antibody is specific to the C-terminal portion of the polypeptide used in an immunoassay.
  • immunoassays are routine and well known in the art (see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is inco ⁇ orated by reference herein in its entirety). Exemplary immunoassays are described briefly below (but are not intended by way of limitation).
  • Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody which recognizes the antigen to the cell lysate, incubating for a period of time (e.g., 1 to 4 hours) at 40° C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 40° C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer.
  • a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100,
  • the ability of the antibody to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis.
  • One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre-clearing the cell lysate with sepharose beads).
  • immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
  • Western blot analysis generally comprises preparing protein samples, elecfrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody which recognizes the antigen) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 3 P or 125 I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the
  • ELIS comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding a primary antibody (which recognizes the antigen) conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen.
  • a primary antibody which recognizes the antigen conjugated to a detectable compound
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well.
  • ELIS electrospray senor
  • One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected as well as other variations of ELIS As known in the art. For further discussion regarding ELIS As see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1. Methods for detecting the activity of a protein encoded by a reporter gene will vary with the reporter gene used. Assays for the various reporter genes are well-known to one of skill in the art.
  • luciferase beta- galactosidase
  • beta-glucoronidase GUS
  • beta-lactamase beta-lactamase
  • CAT chloramphemcol acetylfransferase
  • AP alkaline phosphatase
  • reaction products of luciferase, beta-galactosidase (“beta-gal”), and alkaline phosphatase (“AP”) are assayed by changes in light imaging (e.g., luciferase), spectrophotometric absorbance (e.g., beta-gal), or fluorescence (e.g., AP).
  • Assays for changes in light output, absorbance, and/or fluorescence are easily adapted for high throughput screening.
  • beta-gal activity can be measured with a microplate reader.
  • Green fluorescent protein (“GFP”) activity can be measured by changes in fluorescence.
  • FACS fluorescence activated cell sorting
  • Methods of measuring changes in steady state levels of mRNA are well-known to one of skill in the art. Such methods include, but are not limited to, Northern blots, dot blots, solution hybridization, RNase protection assays, and SI nuclease protection assays, wherein the steady state levels of the mRNA of interest are measured with an appropriately labeled nucleic acid probe. Alternatively, methods such as semi-quantitative polymerase chain reaction (“PCR”) can be used to measure changes in steady state levels of the mRNA of interest using the appropriate primers for amplification.
  • PCR semi-quantitative polymerase chain reaction
  • Alterations in the expression of a reporter gene may be determined by comparing the level of expression and/or activity of the reporter gene to a negative contiol (e.g., PBS or another agent that is known to have no effect on the expression of the reporter gene) and optionally, a positive confrol (e.g., an agent that is known to have an effect on the expression of the reporter gene, preferably an agent that effects premature franslation termination and/or nonsense-mediated mRNA decay).
  • alterations in the expression and/or activity of a reporter gene may be determined by comparing the level of expression and/or activity of the reporter gene to a previously determined reference range.
  • the in vivo effect of the lead compound can be assayed by measuring the cell growth or viability of the target cell.
  • Such assays can be carried out with representative cells of cell types involved in a particular disease or disorder (e.g., leukocytes such as T cells, B cells, natural killer cells, macrophages, neutrophils and eosinophils).
  • leukocytes such as T cells, B cells, natural killer cells, macrophages, neutrophils and eosinophils.
  • a lower level of proliferation or survival of the contacted cells indicates that the lead compound is effective to treat a condition in the patient characterized by uncontrolled cell growth.
  • a lead compound may be screened using cells of a tumor or malignant cell line or an endothelial cell line.
  • cell culture models include, but are not limited to, for lung cancer, primary rat lung tumor cells (see, e.g., Swafford et al., 1997, Mol. Cell. Biol., 17:1366-13 '4) and large-cell undifferentiated cancer cell lines (see, e.g., Mabry et al., 1991, Cancer Cells, 3:53-58); colorectal cell lines for colon cancer (see, e.g., Park & Gazdar, 1996, J. Cell Biochem. Suppl. 24:131-141); multiple established cell lines for breast cancer (see, e.g., Hambly et al., 1997, Breast Cancer Res. Treat.
  • RNA and mRNA and activity can be determined by any method well known in the art.
  • protein can be quantitated by known immunodiagnostic methods such as western blotting or immunoprecipitation using commercially available antibodies.
  • mRNA can be quantitated using methods that are well known and routine in the art, for example, using northern analysis, RNase protection, the polymerase chain reaction in connection with reverse transcription ("RT-PCR").
  • Cell viability can be assessed by using trypan-blue staining or other cell death or viability markers known in the art. hi a specific embodiment, the level of cellular ATP is measured to determined cell viability. Differentiation can be assessed, for example, visually based on changes in mo ⁇ hology.
  • the lead compound can also be assessed for its ability to inhibit cell transformation (or progression to malignant phenotype) in vitro, h this embodiment, cells with a transformed cell phenotype are contacted with a lead compound, and examined for change in characteristics associated with a transformed phenotype (a set of in vitro characteristics associated with a tumorigenic ability in vivo), for example, but not limited to, colony formation in soft agar, a more rounded cell mo ⁇ hology, looser substratum attachment, loss of contact inhibition, loss of anchorage dependence, release of proteases such as plasminogen activator, increased sugar transport, decreased serum requirement, or expression of fetal antigens, etc. (see, e.g., Luria et al., 1978, General Virology, 3d Ed., John Wiley & Sons, New York, pp. 436-446).
  • Loss of invasiveness or decreased adhesion can also be assessed to demonstrate the anti-cancer effects of a lead compound.
  • an aspect of the formation of a metastatic cancer is the ability of a precancerous or cancerous cell to detach from primary site of disease and establish a novel colony of growth at a secondary site. The ability of a cell to invade peripheral sites reflects its potential for a cancerous state. Loss of invasiveness can be measured by a variety of techniques known in the art including, for example, induction of E-cadherin-mediated cell-cell adhesion.
  • E-cadherin-mediated adhesion can result in phenotypic reversion and loss of invasiveness (see, e.g., Hordijk et al., 1997, Science 278:1464-66). Loss of invasiveness can further be examined by inhibition of cell migration.
  • a variety of 2-dimensional and 3-dimensional cellular matrices are commercially available (Calbiochem-Novabiochem Co ⁇ . San Diego, CA). Cell migration across or into a matrix can be examined using microscopy, time-lapsed photography or videography, or by any method in the art allowing measurement of cellular migration.
  • loss of invasiveness is examined by response to hepatocyte growth factor ("HGF").
  • HGF- induced cell scattering is conelated with invasiveness of cells such as Madin-Darby canine kidney (“MDCK”) cells.
  • MDCK Madin-Darby canine kidney
  • This assay identifies a cell population that has lost cell scattering activity in response to HGF (see, e.g., Hordijk et al., 1997, Science 278:1464-66).
  • loss of invasiveness can be measured by cell migration through a chemotaxis chamber (Neuroprobe/ Precision Biochemicals Inc. Vancouver, BC).
  • a chemo-attractant agent is incubated on one side of the chamber (e.g., the bottom chamber) and cells are plated on a filter separating the opposite side (e.g., the top chamber).
  • a lead compound can also be assessed for its ability to alter the expression of a secondary protein (as determined, e.g. by western blot analysis) or RNA, whose expression and/or activation is regulated directly or indirectly by the gene product of a gene of interest containing a premature stop codon or a nonsense mutation (as determined, e.g., by RT-PCR or northern blot analysis) in cultured cells in vitro using methods which are well known in the art. Further, chemical footprinting analysis can be conducted and is well- known in the art.
  • the lead compound can be tested in a host cell. In such an embodiment, the host cell can enode a nucleic acid with a premature translation termination sequence or stop codon.
  • nucleic acids can be encoded by a number of vehicles, including, but not limited to, recombinant or chimeric vectors, viruses or the genome of the host cell.
  • the presence of the gene, containing a premature stop codon or translation termination sequence causes a detectable phenotype in the host cell.
  • the effect of lead compounds on the phenotype of the cell can be examined in order to determine suitable candidates that modulate premature translation termination from a pool of compounds, hi one embodiment, a host cell containing a gene encoding a premature translation termination sequence or stop codon, exhibits an abnormal phenotype relative to the wild type cell that does not encode a gene with a premature stop codon.
  • the effect of a compound on the host cell phenotype can be examined in order to determine the effect of a lead compound on premature translation termination or nonsense mediate mRNA decay.
  • host cells expressing mutations in a gene that controls cell cycle or proliferation, e.g., p53, can be exposed to various lead compounds in order to determine their effect on cell proliferation.
  • Any lead compound that affects the proliferative activity of the host cell is identified as a compound that modulates premature translation termination or nonsense mediated mRNA decay.
  • Animal model systems can be used to demonstrate the safety and efficacy of the lead compounds identified in the nonsense suppression assays described above.
  • the lead compounds identified in the nonsense suppression assay can then be tested for biological activity using animal models for a disease, condition, or syndrome of interest. These include animals engineered to contain the target RNA element coupled to a functional readout system, such as a transgenic mouse.
  • a compound identified in accordance with the methods of the invention is introduced into an animal model so that the effect of the compound on the manifestation of disease can be determined.
  • the prevention or reduction in the severity, duration or onset of a symptom associated with the disease or disorder of the animal model that is associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay would indicate that the compound adminstered to the animal model had a prophylactic or therapeutic effect.
  • Any method can be used to introduce the compound into the animal model, including, but not limited to, injection, intravenous infusion, oral ingestion, or inhalation.
  • transgenic hosts are constructed so that the animal genome encodes a gene of interest with a premature franslation termination sequence or stop codon.
  • the gene containg a premature translation termination sequence or stop codon, would not encode a full length peptide from a transcribed mRNA.
  • the adminsitiation of a compound to the animal model, and the expression of a full length protein, polypeptide or peptide, for example, conesponding to the gene containing a premature stop codon would indicate that the compound modulates premature translation termination. Any method known in the art, or described herein, can be used to determine if the stop codon was modulated by the compound.
  • the animal host genome encodes a native gene containing a premature stop codon.
  • the animal host is a natural mutant, i.e., natively encoding a gene with a premature stop codon.
  • the animal can be a model for cystic fibrosis wherein the animal genome contains a natural mutation that inco ⁇ orates a premature stop codon or translation termination sequence.
  • Examples of animal models for cystic fibrosis include, but are not limited to, cftr(-/-) mice (see, e.g., Freedman et al, 2001, Gasfroenterology 121(4):950-7), cftr(tmlHGU/tmlHGU) mice (see, e.g., Bernhard et al, 2001, Exp Lung Res 27(4):349- 66), CFTR-deficient mice with defective cAMP-mediated Cl(-) conductance (see, e.g., Stotland et al, 2000, Pediati Pulmonol 30(5):413-24), and C57BL/6- Cftr(mlUNC)/Cftr(mlUNC) knockout mice (see, e.g., Stotland et al, 2000, Pediafr Pulmonol 30(5):413-24).
  • Examples of animal models for muscular dysfrophy include, but are not limited to, mouse, hamster, cat, dog, and C. elegans.
  • Examples of mouse models for muscular dysfrophy include, but are not limited to, the dy-/- mouse (see, e.g., Connolly et al, 2002, J Neuroimmunol 127(l-2):80-7), a muscular dysfrophy with myositis (mdm) mouse mutation (see, e.g., Garvey et al, 2002, Genomics 79(2): 146-9), the mdx mouse (see, e.g., Nakamura et al, 2001, Neuromuscul Disord 11(3):251-9), the utiophin- dystrophin knockout (dko) mouse (see, e.g., Nakamura et al, 2001, Neuromuscul Disord 11(3):251-9), the dy/dy mouse (see, e.g.
  • Examples of hamster models for muscular dystrophy include, but are not limited to, sarcoglycan-deficient hamsters (see, e.g., Nakamura et al, 2001, Am J Physiol Cell Physiol 281(2):C690-9) and the BIO 14.6 dystrophic hamster (see, e.g., Schlenker & Burbach, 1991, J Appl Physiol 71(5):1655-62).
  • An example of a feline model for muscular dysfrophy includes, but is not limited to, the hyperfrophic feline muscular dystrophy model (see, e.g., Gaschen & Burgunder, 2001, Acta Neuropathol (Berl) 101(6):591-600).
  • Canine models for muscular dysfrophy include, but are not limited to, golden retriever muscular dystrophy (see, e.g., Fletcher et al, 2001, Neuromuscul Disord 11(3):239-43) and canine X-linked muscular dystrophy (see, e.g., Valentine et al, 1992, Am J Med Genet 42(3): 352-6).
  • golden retriever muscular dystrophy see, e.g., Fletcher et al, 2001, Neuromuscul Disord 11(3):239-43
  • canine X-linked muscular dystrophy see, e.g., Valentine et al, 1992, Am J Med Genet 42(3): 352-6).
  • Examples of C. elegans models for muscular dysfrophy are described in Chamberlain & Benian, 2000, Cun Biol 10(21):R795-7 and Culette & Sattelle,
  • mice lacking functional LDL receptor genes see, e.g., Aji et al, 1997, Circulation 95(2):430-7
  • Yoshida rats see, e.g., Fantappie et al, 1992, Life Sci
  • an animal model for human cancer in general includes, but is not limited to, spontaneously occurring tumors of companion animals (see, e.g., Vail & MacEwen, 2000, Cancer Invest 18(8):781-92).
  • animal models for lung cancer include, but are not limited to, lung cancer animal models described by Zhang & Roth (1994, In Vivo 8(5):755-69) and a transgenic mouse model with disrupted p53 function (see, e.g., Morris et al, 1998, J La State Med Soc 150(4):179-85).
  • An example of an animal model for breast cancer includes, but is not limited to, a transgenic mouse that overexpresses cyclin Dl (see, e.g., Hosokawa et al, 2001, Transgenic Res 10(5):471-8).
  • An example of an animal model for colon cancer includes, but is not limited to, a TCRbeta and p53 double knockout mouse (see, e.g., Kado et al, 2001, Cancer Res 61(6):2395-8).
  • Examples of animal models for pancreatic cancer include, but are not limited to, a metastatic model of Panc02 murine pancreatic adenocarcinoma (see, e.g., Wang et al,
  • non-Hodgkin's lymphoma examples include, but are not limited to, a severe combined immunodeficiency ("SCID") mouse (see, e.g., Bryant et al, 2000, Lab Invest 80(4):553-73) and an IgHmu-HOXll transgenic mouse (see, e.g., Hough et al, 1998, Proc Natl Acad Sci USA 95(23): 13853-8).
  • SCID severe combined immunodeficiency
  • an animal model for esophageal cancer includes, but is not limited to, a mouse transgenic for the human papillomavirus type 16 E7 oncogene (see, e.g., Herber et al, 1996, J Virol 70(3): 1873-81).
  • animal models for colorectal carcinomas include, but are not limited to, Ape mouse models (see, e.g., Fodde & Smits, 2001, Trends Mol Med 7(8):369-73 and Kuraguchi et al, 2000, Oncogene 19(50):5755-63).
  • an animal model for neurofibromatosis includes, but is not limited to, mutant NF1 mice (see, e.g., Cichowski et al, 1996, Semin Cancer Biol 7(5):291 -8).
  • animal models for retinoblastoma include, but are not limited to, transgenic mice that expression the simian virus 40 T antigen in the retina (see, e.g., Howes et al, 1994, Invest Ophthalmol Vis Sci 35(2):342-51 and Windle et al, 1990, Nature 343(6259):665-9) and inbred rats (see, e.g., Nishida et al, 1981, Curr Eye Res l(l):53-5 and Kobayashi et al, 1982, Acta Neuropathol (Berl) 57(2-3):203-8).
  • Examples of animal models for Wilm's tumor include, but are not limited to, a WT1 knockout mice (see, e.g., Scharnhorst et al, 1997, Cell Growth Differ 8(2): 133-43), a rat subline with a high incidence of neuphroblastoma (see, e.g., Mesfin & Breech, 1996, Lab Anim Sci 46(3):321- 6), and a Wistar/Furth rat with Wilms' tumor (see, e.g., Mu ⁇ hy et al, 1987, Anticancer Res 7(4B):717-9).
  • a WT1 knockout mice see, e.g., Scharnhorst et al, 1997, Cell Growth Differ 8(2): 133-43
  • a rat subline with a high incidence of neuphroblastoma see, e.g., Mesfin & Breech, 1996, Lab Anim Sci 46(3):321- 6
  • Examples of animal models for retinitis pigmentosa include, but are not limited to, the Royal College of Surgeons ("RCS") rat (see, e.g., Vollrath et al, 2001, Proc Natl Acad Sci USA 98(22); 12584-9 and Hanitzsch et al, 1998, Acta Anat (Basel) 162(2- 3):119-26), a rhodopsin knockout mouse (see, e.g., Jaissle et al, 2001, Invest Ophthalmol Vis Sci 42(2):506-13), and Wag/Rij rats (see, e.g., Lai et al, 1980, Am J Pathol 98(1):281- 4).
  • RCS Royal College of Surgeons
  • animal models for cinhosis include, but are not limited to, CC -exposed rats (see, e.g., Kloehn et al, 2001, Horm Metab Res 33(7):394-401) and rodent models instigated by bacterial cell components or colitis (see, e.g., Vierling, 2001, Best Pract Res Clin Gastroenterol 15(4):591-610).
  • animal models for hemophilia include, but are not limited to, rodent models for hemophilia A (see, e.g., Reipert et al, 2000, Thromb Haemost 84(5): 826- 32; Jarvis et al,.
  • Examples of animal models for von Willebrand disease include, but are not limited to, an inbred mouse strain RIIIS/J (see, e.g., Nichols et al, 1994, 83(11):3225-31 and Sweeney et al, 1990, 76(ll):2258-65), rats injected with bofrocetin (see, e.g., Sanders et al, 1988, Lab Invest 59(4):443-52), and porcine models for von Willebrand disease (see, e.g., Nichols et al, 1995, Proc Natl Acad Sci USA 92(7):2455-9; Johnson & Bowie, 1992, J Lab Clin Med 120(4):553-8); and Brinkhous et al, 1991, Mayo Clin Proc 66(7):733-42).
  • animal models for ⁇ -thalassemia include, but are not limited to, murine models with mutations in globin genes (see, e.g., Lewis et al, 1998, Blood
  • kidney stones examples include, but are not limited to, genetic hypercalciuric rats (see, e.g., Bushinsky et al, 1999, Kidney hit 55(l):234-43 and Bushinsky et al, 1995, Kidney hit 48(6): 1705-13), chemically freated rats (see, e.g., Grases et al, 1998, Scand J Urol Nephrol 32(4):261-5; Burgess et al, 1995, Urol Res 23(4):239- 42; Kumar et al, 1991, J Urol 146(5):1384-9; Okada et al, 1985, Hinyokika Kiyo 31(4):565-77; and Bluestone et al, 1975, Lab Invest 33(3):273-9), hyperoxaluric rats (see, e.g., Jones et al, 1991, J Urol 145(4):868-74), pigs with unilateral retrograde flexible nephroscopy (see, e.g., genetic
  • animal models for ataxia-telangiectasia include, but are not limited to, murine models of ataxia-telangiectasia (see, e.g., Barlow et al, 1999, Proc Natl Acad Sci USA 96(17):9915-9 and frioue et al, 1986, Cancer Res 46(8):3979-82).
  • a mouse model was generated for ataxia-telangiectasia using gene targeting to generate mice that did not express the Arm protein (see, e.g., Elson et al, 1996, Proc. Nat. Acad. Sci. 93: 13084- 13089).
  • animal models for lysosomal storage diseases include, but are not limited to, mouse models for mucopolysaccharidosis type VII (see, e.g., Brooks et al, 2002, Proc Natl Acad Sci U S A. 99(9):6216-21; Monroy et al, 2002, Bone 30(2):352-9; Vogler et al, 2001, Pediati Dev Pathol. 4(5):421-33; Vogler et al, 2001, Pediafr Res. 49(3):342-8; and Wolfe et al, 2000, Mol Ther.
  • mice model for metachromatic leukodystrophy see, e.g., Matzner et al, 2002, Gene Ther. 9(l):53-63
  • a mouse model of Sandhoff disease see, e.g., Sango et al, 2002, Neuropathol Appl Neurobiol.
  • mice for mucopolysaccharidosis type III A (see, e.g., Bhattacharyya et al, 2001, Glycobiology 11(1):99-10 and Bhaumik et al, 1999, Glycobiology 9(12):1389-96.), arylsulfatase A (ASA)-deficient mice (see, e.g., D'Hooge et al, 1999, Brain Res. 847(2):352-6 and D'Hooge et al, 1999, Neurosci Lett.
  • ASA arylsulfatase A
  • mice with an aspartylglucosaminuria mutation see, e.g., Jalanko et al., 1998, Hum Mol Genet. 7(2):265-72
  • feline models of mucopolysaccharidosis type VI see, e.g., Crawley et al, 1998, J Clin Invest. 101(1):109-19 andNondin et al., 1995, Bone 17(5):485-9
  • a feline model of Niemann-Pick disease type C see, e.g., March et al, 1997, Acta Neuropathol (Berl).
  • TSC tuberous sclerosis
  • a mouse model of TSC 1 see, e.g., Kwiatkowski et al, 2002, Hum Mol Genet. ll(5):525-34
  • Tscl TSC1 homologue
  • TSC2 gene mutant(Eker) rat model see, e.g., Hino 2000, Nippon Rinsho 58(6):1255-61; Mizuguchi et al, 2000, J Neuropathol Exp Neurol.
  • the toxicity and/or efficacy of a compound identified in accordance with the invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • Cells and cell lines that can be used to assess the cytotoxicity of a compound identified in accordance with the invention include, but are not limited to, peripheral blood mononuclear cells (PBMCs), Caco-2 cells, and Huh7 cells.
  • PBMCs peripheral blood mononuclear cells
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
  • a compound identified in accordance with the invention that exhibits large therapeutic indices is prefened. While a compound identified in accordance with the invention that exhibits toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to unin
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage of a compound identified in accordance with the invention for use in humans.
  • the dosage of such agents lies preferably within a range of circulating concenfrations that include the ED 50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i.e., the concentration of the compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC 50 i.e., the concentration of the compound that achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • the compounds which display the desired biological activity can be used as lead compounds for the development or design of congeners or analogs having useful pharmacological activity.
  • molecular modeling techniques can be used to design variants of the compound that can be more effective.
  • molecular modeling systems are the CHARM and QUANTA programs (Polygen Co ⁇ oration, Waltham, MA).
  • CHARM performs the energy minimization and molecular dynamics functions.
  • QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
  • the present invention provides methods of preventing, freating, managing or ameliorating a disorder or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof.
  • the present invention provides methods of preventing, treating, managing or ameliorating a disorder associated with premature tianslation termination and/or nonsense- mediated mRNA decay, or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof.
  • diseases associated with, characterized by or caused by associated with premature translation termination and/or nonsense-mediated mRNA decay include, but are not limited to, cystic fibrosis, muscular dystrophy, heart disease, lung cancer, breast cancer, colon cancer, pancreatic cancer, non-Hodgkin's lymphoma, ovarian cancer, esophageal cancer, colorectal carcinomas, neurofibromatosis, retinoblastoma, Wilm's tumor, retinitis pigmentosa, collagen disorders, cinhosis, Tay-Sachs disease, blood disorders, kidney stones, ataxia-telangiectasia, lysosomal storage diseases, and tuberous sclerosis.
  • Tax a prefened embodiment it is first determined that the patient is suffering from a disease associated with premature translation termination and/or nonsense-mediated mRNA decay before administering a compound identified in accordance with the invention or a combination therapy described herein.
  • the DNA of the patient can be sequenced or subject to Southern Blot, polymerase chain reaction (PCR), use of the Short Tandem Repeat (STR), or polymo ⁇ hic length restriction fragments (RFLP) analysis to determine if a nonsense mutation is present in the DNA of the patient.
  • PCR polymerase chain reaction
  • STR Short Tandem Repeat
  • RFLP polymo ⁇ hic length restriction fragments
  • the invention provides a method of preventing, treating, managing or ameliorating a disorder or one or more symptoms thereof, said method comprising administering to a subject in need thereof a dose of a prophylactically or therapeutically effective amount of one or more compounds identified in accordance with the methods of the invention.
  • a compound identified in accordance with the methods of the invention is not administered to prevent, treat, or ameliorate a disorder or one or more symptoms thereof, if such compound has been used previously to prevent, treat, manage or ameliorate said disorder.
  • disorders that can be prevented, managed and/or treated with the compounds of the invention include, but are not limited to, disorders that are associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay.
  • the invention provides methods of preventing, treating, managing or ameliorating a disorder or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more of the compounds identified utilizing the screening methods described herein or a pharmaceutically acceptable salt thereof, and one or more other therapies (e.g., prophylactic or therapeutic agents).
  • the invention provides methods of preventing, treating, managing or ameliorating a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense mediate mRNA decay, or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more of the compounds identified utilizing the screening methods described herein or a pharmaceutically acceptable salt thereof, and one or more other therapies (e.g., prophylactic or therapeutic agents).
  • the other therapies are currently being used, have been used or are known to be useful in the prevention, treatment, management or amelioration of said disorder or a symptom thereof.
  • Non-limiting examples of such therapies are in Section 5.11.1 infra.
  • the therapies (e.g., prophylactic or therapeutic agents) or the combination therapies of the invention can be administered sequentially or concunently.
  • the combination therapies of the invention comprise a compound identified in accordance with the invention and at least one other therapy that has the same mechanism of action as said compound.
  • the combination therapies of the invention comprise a compound identified in accordance with the methods of the invention and at least one other therapy (e.g., prophylactic or therapeutic agent) which has a different mechanism of action than said compound.
  • the combination therapies of the present invention improve the prophylactic or therapeutic effect of a compound of the invention by functioning together with the compound to have an additive or synergistic effect.
  • the combination therapies of the present invention reduce the side effects associated with the therapies (e.g., prophylactic or therapeutic agents).
  • the prophylactic or therapeutic agents of the combination therapies can be administered to a subject in the same pharmaceutical composition.
  • the prophylactic or therapeutic agents of the combination therapies can be administered concunently to a subject in separate pharmaceutical compositions.
  • the prophylactic or therapeutic agents may be administered to a subject by the same or different routes of administration.
  • a pharmaceutical composition comprising one or more compounds identified in a screening assay described herein is administered to a subject, preferably a human, to prevent, treat, manage or ameliorate a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense mediated mRNA decay) or one or more symptoms thereof, hi accordance with the invention, the pharmaceutical composition may also comprise one or more other prophylactic or therapeutic agents.
  • a disorder in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense mediated mRNA decay
  • the pharmaceutical composition may also comprise one or more other prophylactic or therapeutic agents.
  • prophylactic or theapeutic agents are cunently being used, have been used or are known to be useful in the prevention, treatment, management or amelioration of a disorder (in particular, a disorder associated with, characterized by, or caused by premature translation termination or nonsense- mediated mRNA decay) or one or more symptoms thereof.
  • a compound identified in accordance with the methods of the invention may be used as a first, second, third, fourth or fifth line of therapy for a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay).
  • the invention provides methods for treating, managing or ameliorating a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof in a subject refractory to conventional therapies for such disorder, said methods comprising administering to said subject a dose of a prophylactically or therapeutically effective amount of a compound identified in accordance with the methods of the invention.
  • a disorder may be determined to be refractory to a therapy when at least some significant portion of the disorder is not resolved in response to the therapy.
  • a determination can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of a therapy on a subject, using the art- accepted meanings of "refractory" in such a context.
  • a disorder is refractory where the number of symptoms of the disorder has not been significantly reduced, or has increased.
  • the invention provides methods for freating, managing or ameliorating one or more symptoms of a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) in a subject refractory to existing single agent therapies for such disorder, said methods comprising administering to said subject a dose of a prophylactically or therapeutically effective amount of a compound identified in accordance with the methods of the invention and a dose of a prophylactically or therapeutically effective amount of one or more other therapies (e.g., prophylactic or therapeutic agents).
  • a disorder in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay
  • the invention also provides methods for treating or managing a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) by administering a compound identified in accordance with the methods of the invention in combination with any other therapy (e.g., radiation therapy, chemotherapy or surgery) to patients who have proven refractory to other therapies but are no longer on these therapies.
  • a disorder in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay
  • any other therapy e.g., radiation therapy, chemotherapy or surgery
  • the invention also provides methods for the treatment or management of a patient having disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) and said patient is immunosuppressed or immunocompromised by reason of having previously undergone other therapies.
  • the invention provides methods for preventing the recunence of a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) such as, e.g., cancer in patients that have been undergone therapy and have no disease activity by administering a compound identified in accordance with the methods of the invention.
  • a disorder in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay
  • the compounds identified in accordance with the invention for the prevention, treatment, management or amelioration of a disorder or a symptom thereof
  • the compounds may be used in vitro to modulate the expression of particular genes of interest, for example, the compounds may be used to increase or decrease the expression of a particular gene of interest when conducting in vitro studies.
  • the present invention provides methods of preventing, freating, managing or ameliorating a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof, and one or more other therapies (e.g., prophylactic or therapeutic agents).
  • a disorder in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay
  • other therapies e.g., prophylactic or therapeutic agents
  • Any therapy e.g., chemotherapies, radiation therapies, hormonal therapies, and/or biological therapies/immunotherapies
  • chemotherapies e.g., radiation therapies, hormonal therapies, and/or biological therapies/immunotherapies
  • a disorder in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay
  • one or more symptoms thereof can be used in combination with a compound identified in accordance with the methods of the invention.
  • therapeutic or prophylactic agents which can be used in combination with a compound identified in accordance with the invention include, but are not limited to, peptides, polypeptides, fusion proteins, nucleic acid molecules, small molecules, mimetic agents, synthetic drugs, inorganic molecules, and organic molecules.
  • Proliferative disorders associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay can be prevented, treated, managed or ameliorated by administering to a subject in need thereof one or more of the compounds identified in accordance with the methods of the invention, and one or more other therapies for prevention, treatment, management or amelioration of said disorders or a symptom thereof.
  • therapies include, but are not limited to, angiogenesis inhibitors, topoisomerase inhibitors, immunomodulatory agents
  • Angiogenesis inhibitors include, but are not limited to, angiostatin (plasminogen fragment); antiangiogenic antithrombin III; angiozyme; ABT-627; Bay 12-9566; Benefin; Bevacizumab; BMS-275291; cartilage-derived inhibitor (GDI); CAI; CD59 complement fragment; CEP-7055; Col 3; combretastatin A-4; endostatin (collagen XVIII fragment); fibronectin fragment; Gro-beta; Halofuginone; Heparinases; Heparin hexasaccharide fragment; HMV833; human chorionic gonadotropin (hCG); IM-862; Interferon alpha/beta/gamma; Interferon inducible protein (IP- 10); Interleukin-12; Kringle 5 (plasminogen fragment); Marimastat; Metalloprotein
  • anti-angiogenic agents do not include antibodies or fragments thereof that immunospecifically bind to integrin ov/3 3 .
  • propylactic or therapeutic agents which can be used in accordance with the methods of the invention to prevent, treat, manage or ameliorate a proliferative disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay, or a symptom thereof include, but not limited to: acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantione acetate; ammoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisanfrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine
  • anti-cancer drugs include, but are not limited to: 20-epi-l,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; alfretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing mo ⁇ ho genetic protein- 1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL
  • B betulinic acid; bFGF inhibitor; bicalutamide; bisanfrene; bisaziridinylspermine; bisnafide; bisfratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorlns; chloroquinoxaline sulfonamide; cicaprost; cis-po ⁇ hyrin; cladribine; clomifene analogues; clotrimazole; coll
  • propylactic or therapeutic agents which can be used in accordance with the methods of the invention to prevent, treat, manage and/or ameliorate a central nervous system disorders associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay, or a symptom thereof include, but are not limited to: Levodopa, L-DOPA, cocaine, ⁇ -methyl-tyrosine, rese ⁇ ine, tefrabenazine, benzotropine, pargyline, fenodolpam mesylate, cabergoline, pramipexole dihydrochloride, ropinorole, amantadine hydrochloride, selegiline hydrochloride, carbidopa, pergolide mesylate, Sinemet CR, or Symmefrel.
  • propylactic or therapeutic agents which can be used in accordance with the methods of the invention to prevent, treat, manage and/or ameliorate a metabolic disorders associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay, or a symptom thereof include, but are not limited to: a monoamine oxidase inhibitor (MAO), for example, but not limited to, iproniazid, clorgyline, phenelzine and isocarboxazid; an acetylcholinesterase inhibitor, for example, but not limited to, physostigmine saliclate, physostigmine sulfate, physostigmine bromide, meostigmine bromide, neostigmine methylsulfate, ambenonim chloride, edrophonium chloride, tacrine, pralidoxime chloride, obidoxime chloride, trimedoxime bromide, diacetyl monoxim
  • Biologically active compounds identified using the methods of the invention or a pharmaceutically acceptable salt thereof can be administered to a patient, preferably a mammal, more preferably a human, suffering from a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay).
  • a compound or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay).
  • the compound or a pharmaceutically acceptable salt thereof is administered as a preventative measure to a patient.
  • the patient can have a genetic predisposition to a disease, such as a family history of the disease, or a non-genetic predisposition to the disease.
  • the compound and pharmaceutically acceptable salts thereof can be used for the treatment of one manifestation of a disease and prevention of another.
  • a compound identified in accordance with the invention, or a pharmaceutically acceptable salt thereof may be a component of a composition optionally comprising a carrier, diluent or excipient.
  • the compound or a pharmaceutically acceptable salt thereof is preferably administered as component of a composition that optionally comprises a pharmaceutically acceptable vehicle.
  • the composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by abso ⁇ tion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and may be administered together with another biologically active agent. Admimstration can be systemic or local.
  • Various delivery systems are known, e.g. , encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the compound and pharmaceutically acceptable salts thereof.
  • Methods of administration include but are not limited to intiadermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intianasal, epidural, oral, sublingual, intianasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin.
  • the mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the compound or a pharmaceutically acceptable salt thereof into the bloodstream. In specific embodiments, it may be desirable to administer the compound or a pharmaceutically acceptable salt thereof locally.
  • This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
  • Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant.
  • the compound and pharmaceutically acceptable salts thereof can be formulated as a suppository, with traditional binders and vehicles such as triglycerides.
  • the compound and pharmaceutically acceptable salts thereof can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).
  • a liposome see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).
  • the compound and pharmaceutically acceptable salts thereof can be delivered in a controlled release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
  • a controlled release system discussed in the review by Langer, 1990, Science 249: 1527-1533 may be used, hi one embodiment, a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321 :574).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and
  • a controlled-release system can be placed in proximity of a target RNA of the compound or a pharmaceutically acceptable salt thereof, thus requiring only a fraction of the systemic dose.
  • compositions comprising the compound or a pharmaceutically acceptable salt thereof
  • vehicle compositions can additionally comprise a suitable amount of a pharmaceutically acceptable vehicle so as to provide the form for proper administration to the patient.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in ammals, mammals, and more particularly in humans.
  • vehicle refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is administered.
  • Such pharmaceutical vehicles can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • the pharmaceutical vehicles can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like.
  • auxiliary, stabilizing, thickening, lubricating and coloring agents may be used.
  • the pharmaceutically acceptable vehicles are preferably sterile. Water is a prefened vehicle when the compound of the invention is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions.
  • Suitable pharmaceutical vehicles also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • Compound compositions if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • Compound compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained- release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use.
  • the pharmaceutically acceptable vehicle is a capsule (see e.g., U.S. Patent No. 5,698,155).
  • suitable pharmaceutical vehicles are described in Remington's Pharmaceutical Sciences, Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, PA, 19th ed., 1995, pp. 1447 to 1676, inco ⁇ orated herein by reference.
  • compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example.
  • Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation.
  • compositions can be coated to delay disintegration and abso ⁇ tion in the gastrointestinal tract thereby providing a sustained action over an extended period of time.
  • Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions.
  • fluid from the environment sunounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture.
  • delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations.
  • a time delay material such as glycerol monostearate or glycerol stearate may also be used.
  • compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Such vehicles are preferably of pharmaceutical grade.
  • compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions may also include a solubilizing agent.
  • the compound or a pharmaceutically acceptable salt thereof can be formulated for intravenous administration.
  • Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the compound or a pharmaceutically acceptable salt thereof is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the amount of a compound or a pharmaceutically acceptable salt thereof that will be effective in the treatment of a particular disease will depend on the nature of the disease, and can be determined by standard clinical techniques, hi addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances.
  • suitable dosage ranges for oral administration are generally about 0.001 milligram to about 500 milligrams of a compound or a pharmaceutically acceptable salt thereof per kilogram body weight per day.
  • the oral dose is about 0.01 milligram to about 100 milligrams per kilogram body weight per day, more preferably about 0.1 milligram to about 75 milligrams per kilogram body weight per day, more preferably about 0.5 milligram to 5 milligrams per kilogram body weight per day.
  • the dosage amounts described herein refer to total amounts administered; that is, if more than one compound is administered, or if a compound is administered with a therapeutic agent, then the prefened dosages conespond to the total amount administered.
  • Oral compositions preferably contain about 10% to about 95% active ingredient by weight.
  • Suitable dosage ranges for intravenous (i.v.) admimstiation are about 0.01 milligram to about 100 milligrams per kilogram body weight per day, about 0.1 milligram to about 35 milligrams per kilogram body weight per day, and about 1 milligram to about 10 milligrams per kilogram body weight per day.
  • Suitable dosage ranges for intianasal administration are generally about 0.01 pg/kg body weight per day to about 1 mg/kg body weight per day.
  • Suppositories generally contain about 0.01 milligram to about 50 milligrams of a compound of the invention per kilogram body weight per day and comprise active ingredient in the range of about 0.5% to about 10% by weight.
  • the compound and pharmaceutically acceptable salts thereof are preferably assayed in vitro and in vivo, for the desired therapeutic or prophylactic activity, prior to use in humans.
  • in vitro assays can be used to determine whether it is preferable to administer the compound, a pharmaceutically acceptable salt thereof, and/or another therapeutic agent.
  • Animal model systems can be used to demonstrate safety and efficacy.
  • Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KC1, 0.1%Triton X-100, and 0.5mM MgCl 2 .
  • Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA.
  • Tris-Potassium chloride- magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KC1, 0.1%Triton X-100 and 5mM MgCl 2 .
  • RNA oligonucleotides were purchased from Dharmacon, Inc, Lafayette, CO). 500 pmole of either a 5' fluorescein labeled oligonucleotide conesponding to the 16S rRNA A site (5'-GGCGUCACACCUUCGGGUGAAGUCGCC-3' (SEQ ID NO: 1); Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al, 1991, EMBO J. 10:3099- 3103; Yoshizawa et al, 1998, EMBO J.
  • the labeled oligonucleotides were purified using G-25 Sephadex columns (Boehringer Mannheim).
  • Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27: 1084-1093) was utilized with TK buffer containing 0.5mM MgCl 2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 3; single letter amino acid code).
  • YGRKKRRQRRRP SEQ ID NO: 3; single letter amino acid code
  • the method of Huq et al. was used with TKM buffer.
  • reaction volumes 50 pmoles of 32 P cytidine-labeled oligonucleotide and either gentamicin sulfate (Sigma) or the short Tat peptide (Tat 47-58 ) in TK or TKM buffer were heated at 90°C for 2 minutes and allow to cool to room temperature (approximately 24°C) over 2 hours. Then 10 ⁇ l of 30% glycerol was added to each reaction tube and the entire sample was loaded onto a TBE non-denaturing polyacrylamide gel and elecfrophoresed at 1200-1600 volt-hours at 4°C. The gel was exposed to an intensifying screen and radioactivity was quantitated using a Typhoon phosporimager (Molecular Dynamics).
  • Typhoon phosporimager Molecular Dynamics
  • RNA structures such as ribosomes
  • chemical footprinting or toe printing Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al, 1991, EMBO J. 10:3099-3103; Yoshizawa et al, 1998, EMBO J. 17:6437-6448.
  • gel mobility shift assays to monitor RNA-small molecule interactions are described. This approach allows for rapid visualization of small molecule-RNA interactions based on the difference between mobility of RNA alone versus RNA in a complex with a small molecule.
  • RNA oligonucleotide conesponding to the well- characterized gentamicin binding site on the 16S rRNA Moazed & Noller, 1987, Nature 327:389-394
  • HJV-1 TAT protein binding site on the HIV-1 TAR element Huq et al, 1999, Nucleic Acids Res. 27: 1084-1093
  • the pu ⁇ ose of these experiments is to lay the groundwork for the use of chromatographic techniques in a high throughput fashion, such as microcapillary electrophoresis, for drug discovery.
  • a gel retardation assay was performed using the Tat 4 -58 peptide and the TAR RNA oligonucleotide. As shown in Figure 2, in the presence of the Tat peptide, a clear shift is visible when the products are separated on a 12% non-denaturing polyacrylamide gel. In the reaction that lacks peptide, only the free RNA is visible. These observations confirm previous reports made using other Tat peptides (Hamy et al, 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al, 1999, Nucleic Acids Res. 27: 1084- 1093). Based on the results of Figure 2, it was hypothesized that RNA interactions with small organic molecules could also be visualized using this method.
  • gel mobility shifts are produced when the gentamicin concentration is as low as 10 pg/ml. Further, the results shown in Figure 4 demonstrate that the shift is specific to the 16S rRNA oligonucleotide as the use of an unrelated oligonucleotide, conesponding to the HIV TAR RNA element, does not result in a gel mobility shift when incubated with 10 mg/ml gentamicin. In addition, if a concentration as low as 10 pg/ml gentamicin produces a gel mobility shift then it should be possible to detect changes to RNA structural motifs when small amounts of compound from a library of diverse compounds is screened in this fashion.
  • gentamicin-RNA interaction indicates that the interaction is Mg- and temperature dependent.
  • MgCl 2 is not present (TK buffer)
  • lmg/ml of gentamicin must be added to the reaction to produce a gel shift.
  • the temperature of the reaction when gentamicin is added is also important.
  • gentamicin is present in the reaction during the entire denaturation/renaturation cycle, that is, when gentamicin is added at 90C°C or 85°C, a gel shift is visualized (data not shown).
  • gentamicin is added after the renaturation step has proceeded to 75°C, a mobility shift is not produced.
  • results presented in this Example indicate that interactions between a peptide and its target RNA, such as the Tat peptide and TAR RNA, can be monitored by gel retardation assays in an automated capillary electrophoresis system.
  • Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1%Triton X-100, and 0.5mM MgCl 2 .
  • Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA.
  • Tris-Potassium chloride- magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1 %Triton X-100 and 5mM MgCl 2 .
  • RNA oligonucleotides were purchased from Dharmacon, hie, Lafayette, CO). 500 pmole of a 5' fluorescein labeled oligonucleotide conesponding to the HIV-1 TAR element TAR RNA (5 '-GGCAGAUCUGAGCCUGGGAGCUCUCUGCC-3 ' (SEQ ID NO: 2); Huq et al, 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was used. For Tat-TAR gel retardation reactions the method of Huq et al.
  • TK buffer containing 0.5mM MgCl 2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 3); single letter amino acid code).
  • YGRKKRRQRRRP SEQ ID NO: 3
  • Tat 47-58 short Tat peptide
  • TKM buffer 20 ⁇ l reaction volumes 50 pmoles of labeled oligonucleotide and the short Tat peptide (Tat 47-58 ) in TK or TKM buffer were heated at 90°C for 2 minutes and allow to cool to room temperature (approximately 24°C) over 2 hours.
  • the reactions were loaded onto a SCE9610 automated capillary electiophoresis apparatus (SpectruMedix; State College, Pennsylvania). Results
  • HeLa S3 cells were grown to a density of 10 6 cells/ml in DMEM; 5%CO 2 , 10%FBS, IX P/S in a spinner flask. Cells were harvested by spinning at lOOOXg. Cells were washed twice with phosphate buffered saline. The cell pellet was on ice for 12-24 hours before proceeding. By letting the cells sit on ice, the activity of the exfract is increased up to twenty-fold. The length of time on ice can range from 0 hours to 1 week.
  • the cells were resuspended in 1.5 volumes (packed cell volume) of hypotonic buffer (10 mM HEPES (KOH) pH 7.4; 15 mM KCl; 1.5 mM Mg(OAc)2; 0.5 mM Pefabloc (Roche); 2 mM DTT).
  • hypotonic buffer 10 mM HEPES (KOH) pH 7.4; 15 mM KCl; 1.5 mM Mg(OAc)2; 0.5 mM Pefabloc (Roche); 2 mM DTT.
  • the cells were allowed to swell for 5 minutes on ice, dounce homogenized with 10 to 100 strokes using a tight-fitting pestle, and spun for 10 minutes at 12000Xg at 4°C in a Sorvall SS-34 rotor.
  • the supernatant was collected with a Pasteur pipet without disturbing the lipid layer, fransfened into Eppendorf tubes (50 to 200 ml aliquots), and immediately frozen in liquid
  • Ribosomes prepared from HeLa cells were incubated with the small molecules (at a concentration of 100 ⁇ M), followed by treatment with chemical modifying agents (dimethyl sulfate [DMS] and kethoxal [KE]). Following chemical modification, rRNA was phenol-chloroform extracted, ethanol precipitated, analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to different regions of the rRNAs and resolved on 6% polyacrylamide gels.
  • DMS dimethyl sulfate
  • KE kethoxal
  • the probes used for primer extension cover the entire 18S (7 oligonucleotide primers), 28S (24 oligonucleotide primers), and 5S (one primer) rRNAs are presented in Table 1 (also see, e.g., Gonzalez et al., 1985 Proc Natl Acad Sci U S A. 82(22):7666-70 and McCallum & Maden, 1985, Biochem. J. 232 (3): 725-733).
  • Controls in these experiments include DMSO (a control for changes in rRNA accessibility induced by DMSO), paromomycin (a marker for 18S rRNA binding), and anisomycin (a marker for 28S rRNA binding).
  • the regions protected by the small molecules include a conserved region in the vicinity of the peptidyl fransferase center (domain V, see, e.g., Figures 7 and 8) implicated in peptide bond formation and a conserved region in domain II (see, e.g., Figures 9, 10, and 11) that may interact with the peptidyl fransferase center based on binding of vernamycin B to both these areas (Vannuffel et al., 1994, Nucleic Acids Res. 22(21):4449-53).
  • synthesis beads with compounds of the invention attached, are distributed into micro titer plates at a density of one bead per well.
  • Compounds of the invention that are attached to the beads are then released from the beads and dissolved in a small amount of solvent in each microtiter well.
  • a high precision technique such as a robotic anayer, is then used to transfer small volumes of solution containing dissolved compounds of the invention from each microtiter well, delivering the compounds to defined locations on glass slides.
  • the glass slides are derivatized so that the compounds of the invention are immobilized on the surface of the slide.
  • Each compound contains a functional group that allows for its immobilization on the glass slide.
  • Each slide is then probed with a labeled RNA and binding events are detected by, e.g., a fluorescence-linked assay that is able to detect the label.
  • Table 12 Genes, Locations and Genetic Disorders on Chromosome 11
  • Table 25 Genes, Locations and Genetic Disorders on Chromosome Y
  • a method for identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay comprising the steps of (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds so that a detectably labeled target RNA:compound complex is formed; (b) separating the detectably labeled target RNAxompound complex formed in step (a) from uncomplexed target RNA molecules and compounds; and (c) determining a structure of the compound bound to the RNA in the RNAxompound complex.
  • a method for identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay comprising the steps of (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds so that a target RNAxompound complex that is detectably labeled is formed; (b) separating the target RNAxompound complex formed in step (a) from uncomplexed target RNA molecules and compounds; and (c) determining a structure of the compound bound to the RNA in the RNAxompound complex.
  • RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, specfroscopic colorimetric label, affinity tag, or nanoparticle.
  • the compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; ohgocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries, including but not limited to, libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pynolidines, morpholino compounds, or diazepindiones.
  • screening a library of compounds comprises contacting the compound with the target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions.
  • the aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.
  • the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant
  • the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCI, and from about 0 mM to about 200 mM MgCl 2 .
  • the combination of salts is about 100 mM KCl, 500 mM NaCI, and 10 mM MgCl 2 .
  • the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
  • Any method that detects an altered physical property of a target nucleic acid complexed to a compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids in the method of paragraph 1.
  • electrophoresis is used for separation of the complexed and non-complexed target nucleic acids
  • the electiophoresis is capillary electrophoresis.
  • fluorescence spectroscopy surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships ("SAR") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation are used for the separation of the complexed and non-complexed target nucleic acids.
  • SAR structure-activity relationships
  • the structure of the compound of the RNAxompound complex of paragraph 1 is determined, in part, by the type of library of compounds, hi a preferred embodiment wherein the combinatorial libraries are small organic molecule libraries, mass spectroscopy, NMR, or vibration spectroscopy are used to determine the structure of the compounds.

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Nanotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • Composite Materials (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Materials Engineering (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for screening and identifying compounds that modulate premature translation termination and/or nonsense-mediated messenger ribonucleic acid ('mRNA') by interacting with a preselected target ribonucleic acid ('RNA'). In particular, the present invention relates to identifying compounds that bind to regions of the 28S ribosomal RNA ('rRNA') and analogs thereof. Direct, noncompetitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular compound is detected using any physical method that measures the altered physical property of the target RNA bound to a compound. The structure of the compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.

Description

METHODS FOR IDENTIFYING SMALL MOLECULES THAT
MODULATE PREMATURE TRANSLATION TERMINATION
AND NONSENSE MEDIATED mRNA DECAY
This application is entitled to and claims priority benefit to U.S. Provisional Patent Application No. 60/398,344, filed July 24, 2002 and U.S. Provisional Patent Application No. 60/398,332, filed July 24, 2002, both of which are incorporated herein by reference in their entirety.
1. INTRODUCTION
The present invention relates to a method for screening and identifying compounds that modulate premature translation termination and/or nonsense-mediated messenger ribonucleic acid ("mRNA") decay by interacting with a preselected target ribonucleic acid ("RNA"). i particular, the present invention relates to methods of identifying compounds that bind to regions of the 28S ribosomal RNA ("rRNA") and analogs thereof. Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular compound is detected using any physical method that measures the altered physical property of the target RNA bound to a compound. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.
2. BACKGROUND OF THE INVENTION
Protein synthesis encompasses the processes of translation initiation, elongation, and termination, each of which has evolved to occur with great accuracy and has the capacity to be a regulated step in the pathway of gene expression. Recent studies, including those suggesting that events at termination may regulate the ability of ribosomes to recycle to the start site of the same mRNA, have underscored the potential of termination to regulate other aspects of translation. The RNA triplets UAA, UAG, and UGA are non- coding and promote translational termination. Termination starts when one of the three termination codons enters the A site of the ribosome, thereby signaling the polypeptide chain release factors to bind and recognize the termination signal. Subsequently, the ester bond between the 3' nucleotide of the transfer RNA ("tRNA") located in the ribosome' s P site and the nascent polypeptide chain is hydrolyzed, the completed polypeptide chain is released, and the ribosome subunits are recycled for another round of translation.
Nonsense-mediated mRNA decay is a surveillance mechanism that minimizes the translation and regulates the stability of RNAs that contain chain termination nonsense mutations (see, e.g., Hentze & Kulozik, 1999, Cell 96:307-310; Culbertson, 1999, Trends in Genetics 15:74-80; Li & Wilkinson, 1998, Immunity 8:135-141; and Ruiz- Echevarria et al, 1996, Trends in Biological Sciences, 21 :433-438). Chain termination nonsense mutations are caused when a base substitution or frameshift mutation changes a codon into a termination codon, i.e., a premature stop codon that causes translational termination. In nonsense-mediated mRNA decay, mRNAs with premature stop codons are frequently subjected to degradation. A truncated protein is produced as a result of the translation apparatus prematurely terminating at the stop codon.
Nonsense mutations cause approximately 10 to 30 percent of the individual cases of virtually all inherited diseases. Although nonsense mutations inhibit the synthesis of a full-length protein to one percent or less of wild-type levels, minimally boosting the expression levels of the full-length protein to between five and fifteen percent of normal levels can eliminate or greatly reduce the severity of disease. Nonsense suppression causes the read-through of a termination codon and the generation of full-length protein. Certain ammoglycosides have been found to promote nonsense suppression (see, e.g., Bedwell et al, 1997, Nat. Med. 3:1280-1284 and Howard et al, 1996, Nat. Med. 2:467-469). Clinical approaches that target the translation termination event to promote nonsense suppression have recently been described for model systems of cystic fibrosis and muscular dystrophy; gentamicin is an aminoglycoside antibiotic that causes translational misreading and allows the insertion of an amino acid at the site of the nonsense codon in models of cystic fibrosis, Hurlers Syndrome, and muscular dystrophy (see, e.g., Barton-Davis et al, 1999, J. Clin. Invest. 104:375-381). These results strongly suggest that drugs that promote nonsense suppression by altering translation termination efficiency of a premature termination codon can be therapeutically valuable in the treatment of diseases caused by nonsense mutations.
Certain classes of known antibiotics have been characterized and found to interact with RNA. For example, the antibiotic thiostrepton binds tightly to a 60-mer from ribosomal RNA (Cundliffe et al, 1990, in The Ribosome: Structure, Function & Evolution (Schlessinger et al, eds.) American Society for Microbiology, Washington, D.C. pp. 479- 490), and bacterial resistance to various antibiotics often involves methylation at specific rRNA sites (Cundliffe, 1989, Ann. Rev. Microbiol. 43:207-233). In addition, certain ammoglycosides and other protein synthesis inhibitors have been found to interact with specific bases in 16S rRNA (Woodcock et al, 1991, EMBO J. 10:3099-3103); moreover, an oligonucleotide analog of the 16S rRNA has been shown to interact with certain ammoglycosides (Purohit et al, 1994, Nature 370:659-662). Aminoglycosidic aminocyclitol (aminoglycoside) antibiotics and peptide antibiotics are known to inhibit group I intron splicing by binding to specific regions of the RNA (von Ahsen et al, 1991, Nature (London) 353:368-370). Some of these same ammoglycosides have also been found to inhibit hammerhead ribozyme function (Stage et al, 1995, RNA 1 :95-101). A molecular basis for hypersensitivity to ammoglycosides has been found to be located in a single base change in mitochondrial rRNA (Hutchin et al, 1993, Nucleic Acids Res. 21:4174-4179). Ammoglycosides have also been shown to inhibit the interaction between specific structural RNA motifs and the corresponding RNA binding protein. Zapp et al. (Cell, 1993, 74:969- 978) has demonstrated that the ammoglycosides neomycin B, lividomycin A, and tobramycin can block the binding of Rev, a viral regulatory protein required for viral gene expression, to its viral recognition element in the HB (or RRE) region of HIV RNA. This blockage appears to be the result of competitive binding of the antibiotics directly to the RRE RNA structural motif. Citation or identification of any reference in Section 2 of this application is not an admission that such reference is available as prior art to the present invention.
3. SUMMARY OF THE INVENTION
The present invention provides methods for identifying compounds that modulate translation termination and/or nonsense-mediated mRNA decay by identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements, hi particular, the present invention provides methods of identifying compounds that bind to regions of the 28S rRNA and analogs thereof. The specific target RNA sequences, RNA structural motifs, and or RNA structural elements (i.e., regions or fragments of the 28S rRNA and analogs thereof) are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements. For example, methods are described in which a preselected target RNA having a detectable label or method of detection is used to screen a library of compounds, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the target RNA bound to a compound. Further, methods are described in which a preselected target RNA is used to screen a library of compounds, with each compound in the library having a detectable label or method of detection, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the compound bound to target RNA. The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, in, e.g., labeled tubes or microtiter plate, and detecting the formation of a target RNAxompound complex, hi particular, the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of the 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, in, e.g., labeled tubes or a microtiter plate, and detecting the formation of a target RNAxompound complex. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, labeled target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships ("SARS") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds bound, wherein each compound in the library is attached to a solid support, and detecting the formation of a target RNAxompound complex. In particular, the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds wherein each compound is attached to a solid support, (e.g., a bead-based library of compounds or a microarray of compounds), and detecting the formation of a target RNAxompound complex. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. Compounds in the library that bind to the labeled target RNA will form a solid support detectably labeled complex (e.g., a bead- based-detectably labeles complex), which can be separated from the unbound solid support, (e.g., beads) and unbound target RNA in the liquid phase by a number of physical means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex.
The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex. In particular, the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds free in solution, in e.g., labeled tubes or a microtiter plate, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships ("SARS") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA attached or conjugated to a solid support with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex. Target RNA molecules that bind to labeled compounds will form a detectable labeled complex. Target RNA molecules that bind to labeled compounds will form solid support- detectably labeled complex, which can be separated from unbound solid support-target
RNA and unbound labeled compounds in the liquid phase by a number of means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex. In a specific embodiment, the invention provides a method for identifying a compound that binds to a target RNA, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon; and (b) detecting the formation of a labeled target RNAxompound complex, hi another embodiment, the invention provides a method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a detectably labeled target RNAxompound complex formed from contacting a detectably labeled RNA with a member of a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon. In accordance with these embodiments, each compound in the library may be attached to a solid support. Non-limiting examples of solid supports include a silica gel, a resin, a derivatized plastic film, a glass bead, cotton, a plastic bead, a polystyrene bead, an aluminum gel, a glass slide or a polysaccharide.
In another specific embodiment, the invention provides a method for identifying a compound that binds to a target RNA, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectable target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon; and (b) detecting the formation of a target RNAxompound complex. In another embodiment, the invention provides a method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a target RNAxompound complex formed from contacting a RNA with a member of a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon. In accordance with these embodiments, the target RNA may be attached to a solid support. Non-limiting examples of solid supports include a silica gel, a resin, a derivatized plastic film, a glass bead, cotton, a plastic bead, a polystyrene bead, an aluminum gel, a glass slide or a polysaccharide. In another specific embodiment, the invention provides a method for identifying a compound that binds to a target RNA, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of labeled and the formation of a detectable target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA, or contains a premature stop codon; and (b) detecting the formation of a target RNAxompound complex. In another embodiment, the invention provides a method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a target RNAxompound complex formed from contacting a labeled RNA with a member of a library of detectably labeled compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of labeled compounds and the formation of a target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA or contains a premature stop codon. In accordance with these embodiments, the target RNA may be attached to a solid support. Non-limiting examples of solid supports are provided infra. A number of techniques can be used to detect the interaction between target RNA and the compounds of the invention. In a specific embodiment, fluorescence resonance energy transfer (FRET) is used to detect the interaction between the target RNA and the compound of the invention. Examples of FRET assays are known in the art and are also provided herein (see, e.g., Section 5.6.2). The methods described herein for the identification of compounds that directly bind to 28S rRNA or a RNA containing a premature stop codon are well suited for high-throughput screening. The direct binding method of the invention offers advantages over drug screening systems for competitors that inhibit the formation of naturally- occurring RNA binding protein.'target RNA complexes; i.e., competitive assays. The direct binding method of the invention is rapid and can be set up to be readily performed, e.g., by a technician, making it amenable to high-throughput screening. The methods of the invention also eliminate the bias inherent in the competitive drug screening systems, which require the use of a preselected host cell factor that may not have physiological relevance to the activity of the target RNA. Instead, the methods of the invention are used to identify any compound that can directly bind to a target RNA, (e.g., 28S rRNA or a RNA containing a premature stop codon), preferably under physiologic conditions. As a result, the compounds so identified can inhibit the interaction of the target RNA with any one or more of the native host cell factors (whether known or unknown) required for activity of the RNA in vivo.
The compounds utilized in the assays described herein may be members of a library of compounds. In specific embodiment, the compound is selected from a combinatorial library of compounds comprising peptides; random biooligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; ohgocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries. In a preferred embodiment, the small organic molecule libraries are libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones. In certain embodiments, the compounds are screened in pools. Once a positive pool has been identified, the individual compounds of that pool are tested separately, hi certain embodiments, the pool size is at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 150, at least 200, at least 250, or at least 500 compounds. Once a compound is identified in accordance with the invention, the structure of the compound may be determined utilizing well-known techniques or by referring to a predetermined code. The methods used will depend, in part, on the nature of the library screened. For example, assays of microarrays of compounds, each having an address or identifier, may be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays. Another method for identifying compounds includes de novo structure determination of the compounds using, for example, mass spectrometry or nuclear magnetic resonance ("NMR"). The compounds identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and the like. In addition, small organic molecules which interact specifically with target RNA molecules may be useful as lead compounds for the development of therapeutic agents. A compound identified in accordance with the methods of the invention may bind to a premature stop codon. A compound identified in accordance with the methods of invention may also disrupt an interaction between a premature stop codon and the mRNA translation machinery. In a preferred embodiment, a compound identified in accordance with the methods of the invention binds to RNA and suppresses premature translation termination and/or nonsense-mediated mRNA decay of a gene encoding a protein, polypeptide or peptide whose expression is beneficial to a subject. In another preferred embodiment, a compound identified in accordance with the methods of the invention binds to RNA and increases premature translation termination and/or nonsense-mediated mRNA decay of a gene encoding a protein, polypeptide or peptide whose expression is detrimental to a subject. In a specific embodiment, a compound identified in accordance with the methods of the invention preferentially or differentially modulates premature translation termination and/or nonsense-mediated mRNA decay of a specific nucleotide sequence of interest relative to another nucleotide sequence.
In certain embodiments of the invention, the compound identified using the assays described herein is a small molecule. In a preferred embodiment, the compound identified using the assays described herein is not known to affect premature translation termination and/or nonsense-mediated mRNA decay of a nucleic acid sequence, in particular a nucleic acid sequence of interest. In another preferred embodiment, the compound identified using the assays described herein has not been used as or suggested to be used in the prevention, treatment, management and/or amelioration of a disorder associated with, characterized by or caused by a premature stop codon. In another preferred embodiment, the compound identified using the assays described herein has not been used as or suggested to be used in the prevention, treatment, management and/or amelioration of a particular disorder described herein. A compound identified in accordance with the methods of the invention may be tested in in vitro and/or in vivo assays well-known to one of skill in the art or described herein to determine the prophylactic or therapeutic effect of a particular compound for a particular disorder. In particular, a compound identified utilizing the assays described herein may be tested in an animal model to determine the efficacy of the compound in the prevention, treatment or amelioration of a disorder associated with, characterized by or caused by a premature stop codon, or a disorder described herein, or a symptom thereof. In addition, a compound identified utilizing the assays described herein may be tested for its toxicity in in vitro and/or in vivo assays well-known to one of skill in the art. Further, a compound identified as binding to a target RNA utilizing assays described herein or those well-known in the art may be tested for its ability to modulate premature translation and/or nonsense mediated mRNA decay. In a specific embodiment, the invention provides a method for identifying a compound to test for its ability to modulate premature translation termination or nonsense- mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA or contains a premature stop codon; and (b) detecting a detectably labeled target RNAxompound complex formed in step(a), so that if a target RNAxompound complex is detected then the compound identified is tested for its ability to modulate premature translation or nonsense-mediated mRNA decay. In a specific embodiment, the invention provides a method for identifying a compound to test for its ability to modulate premature translation termination or nonsense- mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region or fragment of 28S rRNA or contains a premature stop codon; and (b) detecting a detectably labeled target RNAxompound complex fonned in step(a), so that if a target RNAxompound complex is detected then the compound identified is tested for its ability to modulate premature translation or nonsense-mediated mRNA decay. The invention provides cell-based and cell-free assays to test the ability of a compound identified in accordance with the methods of the invention to modulate premature translation termination and/or nonsense-mediated mRNA decay, hi particular, the invention provides cell-based and cell-free reporter assays for the identification of a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay. In general, the level of expression and/or activity of a reporter gene product in the reporter gene based-assays described herein is indicative of the effect of the compound on premature translation termination and/or nonsense-mediated mRNA decay. The reporter gene-based assays described herein for the identification of compounds that modulate premature translation termination and/or nonsense-mediated mRNA decay are well suited for high-throughput screening.
The reporter gene cell-based assays may be conducted by contacting a compound with a cell containing a nucleic acid sequence comprising a reporter gene, wherein the reporter gene contains a premature stop codon or nonsense mutation, and measuring the expression of the reporter gene. The reporter gene cell- free assays may be conducted by contacting a compound with a cell-free extract and a nucleic acid sequence comprising a reporter gene, wherein the reporter gene contains a premature stop codon or nonsense mutation, and measuring the expression of the reporter gene. In the cell-based and cell-free reporter gene assays described herein, the alteration in reporter gene expression or activity relative to a previously determined reference range, or to the expression or activity of the reporter gene in the absence of the compound or the presence of an appropriate control (e.g., a negative control) indicates that a particular compound modulates premature translation termination and/or nonsense-mediated mRNA decay. In particular, an increase in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate control (e.g., a negative control) may, depending upon the parameters of the reporter gene assay, indicate that a particular compound reduces or suppresses premature translation termination and/or nonsense-mediated mRNA decay (i.e., increases nonsense suppression). In contrast, a decrease in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate control (e.g., a negative control) may, depending upon the parameters of the reporter gene-based assay, indicate that a particular compound enhances premature translation termination and/or nonsense-mediated mRNA decay (i.e., decreases nonsense suppression).
In a specific embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense- mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, each compound in the library may be attached to a solid support.
In another embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNA compound complex is detected, then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, each compound in the library may be attached to a solid support.
In a specific embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, each compound in the library may be attached to a solid support.
In another embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, each compound in the library may be attached to a solid support.
In a specific embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, the target RNA may be attached or conjugated to a solid support, or detectably labeled.
In another embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, the target RNA may be attached or conjugated to a solid support, or detectably labeled.
In a specific embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense- mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control. In accordance with this embodiment, the target RNA may be attached or conjugated to a solid support, or detectably labeled. In another embodiment, the invention provides a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; (b) detecting a labeled target RNAxompound complex formed in step(a); so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control, hi accordance with this embodiment, the target RNA may be attached or conjugated to a solid support, or detectably labeled. The invention provides methods for preventing, treating, managing or ameliorating a disorder associated with, characterized by or caused by a premature translation termination and/or nonsense-mediated mRNA decay or a symptom thereof, said method comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of a compound, or a pharmaceutically acceptable salt thereof, identified according to the methods described herein.
The present invention may be understood more fully by reference to the detailed description and examples, which are intended to illustrate non-limiting embodiments of the invention.
3.1 Terminology As used herein, the term "compound" refers to any agent or complex that is being tested for its ability to interact with a target nucleic acid (in particular, a target RNA) or has been identified as interacting with a target nucleic acid (in particular, a target RNA). As used herein, the terms "disorder" and "disease" are to refer to a condition in a subject. As used herein, a "dye" refers to a molecule that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional specfroscopic means. As used herein, a "visible dye" refers to a molecule having a chromophore that absorbs radiation in the visible region of the spectrum (i.e., having a wavelength of between about 400 nm and about 700 nm) such that the transmitted radiation is in the visible region and can be detected either visually or by conventional specfroscopic means. As used herein, an "ultraviolet dye" refers to a molecule having a chromophore that absorbs radiation in the ultraviolet region of the spectrum (i.e., having a wavelength of between about 30 nm and about 400 nm). As used herein, an "infrared dye" refers to a molecule having a chromophore that absorbs radiation in the infrared region of the spectrum (i.e., having a wavelength between about 700 nm and about 3,000 nm). A "chromophore" is the network of atoms of the dye that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional specfroscopic means. One of skill in the art will readily appreciate that although a dye absorbs radiation in one region of the spectrum, it may emit radiation in another region of the spectrum. For example, an ultraviolet dye may emit radiation in the visible region of the spectrum. One of skill in the art will also readily appreciate that a dye can transmit radiation or can emit radiation via fluorescence or phosphorescence.
As used herein, the term "effective amount" refers to the amount of a compound which is sufficient to (i) reduce or ameliorate the progression, severity and/or duration of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, (ii) prevent the development, recurrence or onset of a disorder (e.g:, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, (iii) prevent the advancement of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, or (iv) enhance or improve the therapeutic effect(s) of another therapy.
As used herein, the term "fragment", in the context of a protein or polypeptide refers to a peptide sequence of at least 5 contiguous residues, at least 10 contiguous residues, at least 15 contiguous residues, at least 20 contiguous residues, at least 25 contiguous residues, at least 40 contiguous residues, at least 50 contiguous residues, at least 60 contiguous residues, at least 70 contiguous residues, at least 80 contiguous residues, at least 90 contiguous residues, at least 100 contiguous residues, at least 125 contiguous residues, at least 150 contiguous residues, at least 175 contiguous residues, at least 200 contiguous residues, or at least 250 contiguous residues of the sequence of another protein or polypeptide. In a specific embodiment, a fragment of a protein or polypeptide retains at least one function of the protein or polypeptide.
As used herein, the term "fragment", in the context of a nucleic acid sequence refers to a nucleotide sequence of at least 5 contiguous bases, at least 10 contiguous bases, at least 15 contiguous bases, at least 20 contiguous bases, at least 25 contiguous bases, at least 40 contiguous bases, at least 50 contiguous bases, at least 60 contiguous bases, at least 70 contiguous bases, at least 80 contiguous bases, at least 90 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, or at least 250 contiguous bases of the sequence of another nucleic acid sequence. In a specific embodiment, a fragment of a nucleic acid sequence retains at least one domain of the nucleic acid sequence.
As used herein, the term "in combination" refers to the use of more than one therapy (e.g., prophylactic and/or therapeutic agents). The use of the term "in combination" does not restrict the order in which therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject with a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay). A first therapy (e.g., a prophylactic or therapeutic agent such as a compound identified in accordance with the methods of the invention) can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy (e.g., a prophylactic or therapeutic agent such as a chemotherapeutic agent or a TNF-α antagonist) to a subject with a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay).
As used herein, a "label" or "detectable label" is a composition that is detectable, either directly or indirectly, by specfroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes (e.g., 32P, 35S, and 3H), dyes, fluorescent dyes, electron-dense reagents, enzymes and their substrates (e.g., as commonly used in enzyme-linked immunoassays, e.g., alkaline phosphatase and horse radish peroxidase), biotin, streptavidin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available. Moreover, a label or detectable moiety can include an "affinity tag" that, when coupled with the target nucleic acid and incubated with a compound or compound library, allows for the affinity capture of the target nucleic acid along with molecules bound to the target nucleic acid. One skilled in the art will appreciate that an affinity tag bound to the target nucleic acids has, by definition, a complimentary ligand coupled to a solid support that allows for its capture. For example, useful affinity tags and complimentary ligands or partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer complexes, aptamers, or haptens and proteins for which antisera or monoclonal antibodies are available. The label or detectable moiety is typically bound, either covalently, through a linker or chemical bound, or through ionic, van der Waals or hydrogen bonds to the molecule to be detected. As used herein, a "library" in the context of compounds refers to a plurality of compounds with which a target nucleic acid molecule is contacted. A library can be a combinatorial library, e.g., a collection of compounds synthesized using combinatorial chemistry techniques, or a collection of unique chemicals of low molecular weight (less than 1000 daltons) that each occupy a unique three-dimensional space.
As used herein, the terms "manage", "managing" and "management" refer to the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent) which does not result in a cure of the disorder, (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense- mediated mRNA decay). In certain embodiments, a subject is administered one or more therapies to "manage" a disease or disorder so as to prevent the progression or worsening of the disease or disorder.
As used herein, the phrase "modulation of premature translation termination and/or nonsense-mediated mRNA decay" refers to the regulation of gene expression by altering the level of nonsense suppression. For example, if it is desirable to increase production of a defective protem encoded by a gene with a premature stop codon, i. e. , to permit read through of the premature stop codon of the disease gene so translation of the gene can occur, then modulation of premature franslation termination and/or nonsense- mediated mRNA decay entails up-regulation of nonsense suppression. Conversely, if it is desirable to promote the degradation of an mRNA with a premature stop codon, then modulation of premature franslation termination and or nonsense-mediated mRNA decays entails down-regulation of nonsense suppression. As used herein, the terms "non-responsive" and "refractory" describe patients treated with a currently available therapy (e.g., prophylactic or therapeutic agent) for a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay such as, e.g., cancer), which is not clinically adequate to relieve one or more symptoms associated with such disorder. Typically, such patients suffer from severe, persistently active disease and require additional therapy to ameliorate the symptoms associated with their disorder.
As used herein, "nonsense-mediated mRNA decay" refers to any mechanism that mediates the decay of mRNAs containing a premature franslation termination codon. As used herein, a "nonsense mutation" is a point mutation changing a codon corresponding to an amino acid to a stop codon.
As used herein, "nonsense suppression" refers to the inhibition or suppression of premature franslation termination and/or nonsense-mediated mRNA decay.
As used herein, the phrase "pharmaceutically acceptable salt(s)" includes but is not limited to salts of acidic or basic groups that may be present in compounds identified using the methods of the present invention. Compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tarfrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., l,l'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Compounds that include an amino moiety may form pharmaceutically or cosmetically acceptable salts with various amino acids, in addition to the acids mentioned above. Compounds that are acidic in nature are capable of forming base salts with various pharmacologically or cosmetically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts. As used herein, the term "previously determined reference range" refers to a reference range for the readout of a particular assay. Each laboratory will establish its own reference range for each particular assay. In a preferred embodiment, at least one positive control and at least one negative confrol are included in each batch of compounds analyzed.
As used herein, a "premature termination codon" or "premature stop codon" refers to the occurrence of a stop codon instead of a codon corresponding to an amino acid. As used herein, "premature franslation termination" refers to the result of a mutation that changes a codon corresponding to an amino acid to a stop codon.
As used herein, the terms "prevent", " preventing" and "prevention" refer to the prevention of the development, recurrence or onset of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof resulting from the administration of one or more compounds identified in accordance the methods of the invention or the administration of a combination of such a compound and a known therapy for such a disorder. As used herein, the terms "prophylactic agent" and "prophylactic agents" refer to any agent(s) which can be used in the prevention of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay). In certain embodiments, the term "prophylactic agent" refers to a compound identified in the screening assays described herein. In certain other embodiments, the term "prophylactic agent" refers to an agent other than a compound identified in the screening assays described herein which is known to be useful for, or has been or is cunently being used to prevent or impede the onset, development and/or progression of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof.
As used herein, the phrase "prophylactically effective amount" refers to the amount of a therapy (e.g., a prophylactic agent) which is sufficient to result in the prevention of the development, recurrence or onset of one or more symptoms associated with a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay). As used herein, the term "purified," in the context of a compound, e.g., a compound identified in accordance with the method of the invention, refers to a compound that is substantially free of chemical precursors or other chemicals when chemically synthesized, hi a specific embodiment, the compound is 60%, preferably 65%, 70%, 75%, 80%, 85%, 90%, or 99% free of other, different compounds. In a preferred embodiment, a compound identified in accordance with the methods of the invention is purified.
As used herein, the term "reporter gene" refers to a nucleotide sequence encoding a protein, polypeptide or peptide that is readily detectable either by its presence or activity. Any reporter gene well-known to one of skill in the art may be used in reporter gene constructs to ascertain the effect of a compound on premature franslation termination. As used herein, the term "small molecule" and analogous terms include, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heterorganic and/or ganometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
As used herein, the terms "subject" and "patient" are used interchangeably herein. The terms "subject" and "subjects" refer to an animal, preferably a mammal including a non-primate (e.g., a cow, pig, horse, cat, dog, rat, and mouse) and a primate (e.g., a chimpanzee, a monkey such as a cynomolgous monkey and a human), and more preferably a human. In one embodiment, the subject is refractory or non-responsive to current therapies for a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay). In another embodiment, the subject is a farm animal (e.g., a horse, a cow, a pig, etc.) or a pet (e.g., a dog or a cat). In a preferred embodiment, the subject is a human.
As used herein, the term "synergistic" refers to a combination of a compound identified using one of the methods described herein, and another therapy (e.g., a prophylactic or therapeutic agent), which combination is more effective than the additive effects of the therapies. A synergistic effect of a combination of therapies (e.g., prophylactic or therapeutic agents) permits the use of lower dosages of one or more of the therapies and/or less frequent administration of said therapies to a subject with disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay). The ability to utilize lower dosages of a therapy (e.g. , a prophylactic or therapeutic agent) and/or to administer said therapy less frequently reduces the toxicity associated with the administration of said therapy to a subject without reducing the efficacy of said therapies in the prevention, freatment, management or amelioration of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay). In addition, a synergistic effect can result in improved efficacy of therapies (e.g., prophylactic or therapeutic agents) in the prevention, freatment, management or amelioration of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay). Finally, a synergistic effect of a combination of therapies (e.g., prophylactic or therapeutic agents) may avoid or reduce adverse or unwanted side effects associated with the use of either therapy alone.
As used herein, the term "substantially one type of compound" means that the assay can be performed in such a fashion that at some point, only one compound need be used in each reaction so that, if the result is indicative of a binding event occurring between the target RNA molecule and the compound, the compound can be easily identified.
As used herein, a "target nucleic acid" refers to RNA, DNA, or a chemically modified variant thereof. In a preferred embodiment, the target nucleic acid is RNA. A target nucleic acid also refers to tertiary structures of the nucleic acids, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns. A target nucleic acid also refers to RNA elements such as, but not limited to, 28S rRNA and structural analogs thereof, which are described in Sections 5.1 and 5.2. Non-limiting examples of target nucleic acids are presented in Sections 5.1 and 5.2.
As used herein, a "target RNA" refers to RNA or a chemically modified variant thereof. A target RNA also refers to tertiary structures of RNA, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns. A target RNA also refers to RNA elements such as, but not limited to, 28S rRNA and structural analogs thereof, which are described in Sections 5.1 and 5.2. Non-limiting examples of target RNAs are presented in Sections 5.1 and 5.2. In a specific embodiment, a target RNA is at least 25 nucleotides, preferably at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150 nucleotides, at least 175 nucleotides or at least 200 nucleotides in length. As used herein, the terms "therapeutic agent" and "therapeutic agents" refer to any agent(s) which can be used in the prevention, treatment, management or amelioration of one or more symptoms of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay). In certain embodiments, the term "therapeutic agent" refers to a compound identified in the screening assays described herein. In other embodiments, the term "therapeutic agent" refers to an agent other than a compound identified in the screening assays described herein which is known to be useful for, or has been or is currently being used to prevent, treat, manage or ameliorate a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof.
As used herein, the term "therapeutically effective amount" refers to that amount of a therapy (e.g., a therapeutic agent) sufficient to result in (i) the amelioration of one or more symptoms of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), (ii) prevent advancement of a disorder (e.g. , a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), (iii) cause regression of a disorder (e.g., a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay), or (iv) to enhance or improve the therapeutic effect(s) of another therapy (e.g., therapeutic agent). As used herein, the terms "treat", "freatment" and "treating" refer to the reduction or amelioration of the progression, severity and/or duration of a disorder (e.g., a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof resulting from the administration of one or more compounds identified in accordance the methods of the invention, or a combination of one or more compounds identified in accordance with the invention and another therapy.
As used herein, the terms "therapy" and "therapies" refer to any method, protocol and/or agent that can be used in the prevention, freatment, management or amelioration of a disesase or disorder or one or more symptoms thereof. In certain embodiments, such terms refer to chemotherapy, radiation therapy, surgery, supportive therapy and or other therapies useful in the prevention, treatment, management or amelioration of a disease or disorder or one or more symptoms thereof known to skilled medical personnel.
4. DESCRIPTION OF DRAWINGS FIG. 1. The human 28S rRNA. Domains II and V are circled.
FIG. 2. Gel retardation analysis to detect peptide-RNA interactions. In 20 μl reactions containing 50 pmole end-labeled TAR RNA oligonucleotide, increasing concentrations of Tat47-58 peptide (0.1 uM, 0.2 uM, 0.4 uM, 0.8 uM, 1.6 uM) was added in TK buffer. The reaction mixture was then heated at 90°C for 2 min and allowed to cool slowly to 24°C. 10 μl of 30% glycerol was added to each sample and applied to a 12% non-denaturing polyacrylamide gel. The gel was elecfrophoresed using 1200 volt-hours at 4°C in TBE Buffer. Following electrophoresis, the gel was dried and the radioactivity was quantitated with a phosphorimager. The concentration of peptide added is indicated above each lane. FIG. 3. Gentamicin interacts with an oligonucleotide corresponding to the
16S rRNA. 20 μl reactions containing increasing concentrations of gentamicin (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml, 10 μg /ml, 50 μg /ml, 500 μg /ml) were added to 50 pmole end-labeled RNA oligonucleotide in TKM buffer, heated at 90°C for 2 min and allowed to cool slowly to 24°C. 10 μl of 30% glycerol was added to each sample and the samples were applied to a 13.5% non-denaturing polyacrylamide gel. The gel was elecfrophoresed using 1200 volt-hours at 4°C in TBE Buffer. Following electrophoresis, the gel was dried and the radioactivity was quantitated using a phosphorimager. The concentration of gentamicin added is indicated above each lane.
FIG. 4. The presence of 10 pg/ml gentamicin produces a gel mobility shift in the presence of the 16S rRNA oligonucleotide. 20 μl reactions containing increasing concenfrations of gentamicin (100 ng/ml, 10 ng/ml, 1 ng/ml, 100 pg/ml, and 10 pg/ml) were added to 50 pmole end-labeled RNA oligonucleotide in TKM buffer were treated as described for Figure 3.
FIG. 5. Gentamicin binding to the 16S rRNA oligonucleotide is weak in the absence of MgCl2. Reaction mixtures containing gentamicin (1 μg /ml, 100 μg /ml, 10 μg /mil μg /ml, 0.1 μg /ml, and 10 ng/ml) were freated as described in Figure 3 except that the TKM buffer does not contain MgCl .
FIG. 6. Gel retardation analysis to detect peptide-RNA interactions. In reactions containing increasing concentrations of Tat4 -58 peptide (0.1 mM, 0.2 mM, 0.4 mM, 0.8 mM, 1.6 mM) 50 pmole TAR RNA oligonucleotide was added in TK buffer. The reaction mixture was then heated at 90°C for 2 min and allowed to cool slowly to 24°C. The reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pennsylvania). The peaks conespond to the amount of free TAR RNA ("TAR") or the Tat-TAR complex ("Tat-TAR"). The concentration of peptide added is indicated below each lane. FIG. 7. Small molecules involved in nonsense suppression alter the chemical footprinting pattern in Domain V of the 28S rRNA. 100 pmol of ribosomes were incubated with 100 μM compound, followed by treatment with the chemical modifying agents kethoxal (KE) and dimethyl sulfate (DMS, not shown). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
FIG. 8. Small molecules involved in nonsense suppression alter the chemical footprinting pattern in Domain V of the 28S rRNA. 100 pmol of ribosomes were incubated with 100 μM compound, followed by treatment with the chemical modifying agents kethoxal (KE) and dimethyl sulfate (DMS, not shown). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
FIG. 9. Small molecules involved in nonsense suppression alter the chemical footprinting pattern in Domain II (GTPase Center) of the 28S rRNA. 100 pmol of ribosomes were incubated with 100 μM compound, followed by freatment with the chemical modifying agents kethoxal (KE) and dimethyl sulfate (DMS, not shown). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker. FIG. 10. Small molecules involved in nonsense suppression alter the chemical footprinting pattern of domain II of the 28S rRNA. 100 pmol of ribosomes were incubated with 100 μM compound, followed by treatment with chemical modifying agents dimethyl sulfate (DMS) and kethoxal (KE). Following chemical modification, rRNA was prepared and analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to rRNA. A sequencing reaction was run in parallel as a marker.
FIG. 11. A specific region of Domain II can compete for compound binding and prevents nonsense suppression in vitro. The in vitro nonsense suppression assay was performed using a luciferase construct with a UGA nonsense mutation. 0.1 mM compound was present in the reaction to induce nonsense suppression. Competitor RNA corresponding to Domain II was added at the indicated concenfrations (0, 1, 2.5, 5, 7.5, 10 pM) to titrate the small molecule and prevent nonsense suppression.
5. DETAILED DESCRIPTION OF THE INVENTION
The present invention provides methods for identifying compounds that modulate translation termination and/or nonsense-mediated mRNA decay by identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements. In particular, the present invention provides methods of identifying compounds that bind to regions of the 28S rRNA and analogs thereof. The specific target RNA sequences, RNA structural motifs, and or RNA structural elements (i.e., regions of the 28S rRNA and analogs thereof) are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements. For example, methods are described in which a preselected target RNA having a detectable label or method of detection is used to screen a library of compounds, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the target RNA bound to a compound. Further, methods are described in which a preselected target RNA is used to screen a library of compounds, with each compound in the library having a detectable label or method of detection, preferably under physiologic conditions; and any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the labeled or altered physical property of the compound bound to target RNA. The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, and detecting the formation of a target RNAxompound complex. In particular, the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds free in solution, in, e.g., labeled tubes or a microtiter plate, and detecting the formation of a target RNAxompound complex. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, labeled target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships ("SARS") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex. In particular, the present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA, or RNA containing a premature stop codon), said methods comprising contacting a target RNA with a library of compounds free in solution, in, e.g., labeled tubes or a microtiter plate, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labled complex can then be identified and removed from the uncomplexed, unlabeled complex, and from uncomplexed, target RNA, by a variety of methods, including, but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation proximity assay, structure-activity relationships ("SARS") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.
The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions or fragments of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA having a detectable label with a library of compounds bound, wherein each compound in the library is attached to a solid support; and detecting the formation of a target RNAxompound complex. In particular, the present invention provides methods for identifying compounds that bind to a target RNA (in particular, regions of 28S rRNA or RNA containing a premature stop codon), said method comprising contacting a target RNA having a detectable label with a library of compounds, wherein each compound is attached to a solid support (e.g., a bead- based library of compounds or a microarray of compounds), and detecting the formation of a target RNAxompound complex. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. Compounds in the library that bind to the labeled target RNA will form a solid support (e.g., a bead-based) detectably labeled complex, which can be separated from the unbound beads and unbound target RNA in the liquid phase by a number of physical means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex. The present invention provides methods for identifying compounds that bind to a target RNA (e.g., regions of 28S rRNA or RNA containing a premature stop codon), said methods comprising contacting a target RNA attached or conjugated to a solid support with a library of compounds, wherein each compound in the library is detectably labeled, and detecting the formation of a target RNAxompound complex. Target RNA molecules that bind to labeled compounds will form a detectable labeled complex. Target RNA molecules that bind to labeled compounds will form a solid support-based detectably labeled complex, which can be separated from the unbound solid support-target RNA and unbound compounds in the liquid phase by a number of means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex.
Thus, the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds, in which the compounds of the library that specifically bind a preselected target nucleic acid are easily distinguished from non-binding members of the library. In one embodiment, the structures of the binding molecules are deciphered from the input library by methods depending on the type of library that is used. In another embodiment, the structures of the binding molecules are ascertained by de novo structure determination of the compounds using, for example, mass spectrometry or nuclear magnetic resonance ("NMR"). The compounds so identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and lead compounds for development of therapeutics, and the like. Small organic compounds that are identified to interact specifically with the target RNA molecules are particularly attractive candidates as lead compounds for the development of therapeutic agents.
The assays of the invention reduce bias introduced by competitive binding assays which require the identification and use of a host cell factor (presumably essential for modulating RNA function) as a binding partner for the target RNA. The assays of the present invention are designed to detect any compound or agent that binds to 28S rRNA, preferably under physiologic conditions. Such agents can then be tested for biological activity, without establishing or guessing which host cell factor or factors is required for modulating the function and/or activity of 28S rRNA.
5.1 28S rRNA and Analogs Thereof
The ribosome is a 2.5-MDa ribonucleoprotein complex involved in the decoding of genetic material from mRNA to proteins. A combination of biophysical and biochemical analysis have provided three dimensional models of the ribosome as well as detailed analyses into the mechanism of the individual steps in translation (see, e.g., Green & Noller, 1997, Annu. Rev. Biochem. 66:679-716; Cate et al, 1999, Science 285(5436):2095-2104; and Ban et al, 2000, Science.289(5481): 905-920.).
The 28S rRNA is one of the ribosomal RNA components of the 60S subunit of eukaryotic ribosomes. The 28S rRNA sequences are conserved when expressed as mature rRNAs, although the 28S rRNA contains variable sequence tracts that are interspersed among conserved core sequences and lacking in the counterpart bacterial 23 S rRNA (see, e.g., Hancock & Dover, 1988, Mol. Biol. Evol. 5:377-391). A diagram of the 28S rRNA is presented in Figure 1, with domains II and V circled. As indicated in Figure 1, a GTPase center has been mapped to domain II and the peptidyl fransferase center has been mapped to domain V. Compounds that interact in these regions or modulate local changes within these domains of the ribosome (e.g., alter base pairing interactions, base modification or modulate binding of trans-acting factors that bind to these regions) have the potential to modulate franslation termination. These regions, i.e., domains II and V are conserved from prokaryotes to eukaryotes, but the role of these regions in modulating franslation termination has not been realized in eukaryotes. In bacteria, when a short RNA fragment, complementary to the E. coli 23 S rRNA segment comprising nucleotides 735 to 766 (in domain II), is expressed in vivo, suppression of UGA nonsense mutations, but not UAA or UAG, results (Chernyaeva et al, 1999, J Bacteriol 181:5257-5262). Other regions of the 23 S rRNA in E. coli have been implicated in nonsense suppression including the GTPase center in domain II (nt 1034-1120; Jemiolo et al, 1995, Proc. Nat. Acad. Sci. 92:12309-12313).
Genetic mutations in bacteria have also identified rRNA mutations that either increase the level of frameshifting in the trpE or the suppression of a nonsense mutations in the trpA gene (reviewed in Green & Noller, 1997, Annu. Rev. Biochem. 66:679-716). The frameshifting mutations mapped to domains IV and V of the 23S rRNA. Disruption of the interaction of the CCA end of the tRNA with the peptidyl fransferase center of the ribosome has been demonstrated to result in an increased translational error frequency (reviewed in Green & Noller, 1997, Annu. Rev. Biochem. 66:679-716).
Regions of the 28S rRNA involved in frameshifting, nonsense mutation suppression, GTPase activity, or peptidyl fransferase are atfractive target RNAs to identify compounds that modulate premature translation termination and/or nonsense mediated decay. The interference of a compound with one or more of these functions could potentially mediate translation termination by interfering with premature translation termination. Without being bound by theory, a compound could potentially mediate franslation termination by causing read through of a premature translation codon, therefore allowing the synthesis of the full-length protein.
In a preferred embodiment, the target RNA comprises a region of 28S rRNA corresponding to domain II (see, e.g., nucleotides 1310 to 2333 of accession number Ml 1167) or domain V of 28S rRNA (see, e.g., nucleotides 3859 to 4425 of accession number Ml 1167) or an analog thereof. It will become apparent to one of skill in the art that an analog of the 28S rRNA has an analogous structure and function to native 28S rRNA. For example, an analog of human 28S rRNA includes, but is not limited to, a human 28S rRNA retropseudogene (see, e.g., Wang et al, 1997, Gene 196:105-111, Accession Number L20636). Regions corresponding to domain II or domain V of the 28S rRNA pseudogene could be used as target RNAs in the present invention. In a preferred embodiment, the 28S rRNA is a human 28S rRNA, although the teachings of the present invention are applicable to mammals.
Synthesis of the target RNAs, i.e., regions of 28S rRNA, can be performed by methods known to one of skill in the art (see, e.g., Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York and Glover, D.M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II). In a preferred embodiment, the target RNAs are cloned as DNAs downstream of a promoter, such as but not limited to T7, T3, or Sp6 promoters, and in vitro transcribed with the corresponding polymerase. A detectable label can be incorporated into the in vitro transcribed RNA or alternatively, the target RNA is end-labeled (see Section 5.3 infra). Alternatively, the target RNA can be amplified by polymerase chain reaction with a primer containing an RNA promoter and subsequently in vitro transcribed, as described in U.S. Patent No. 6,271, 002, which is incorporated by reference in its entirety.
S.2 Stop Codon Containing Target RNA The present invention provides for methods for screening and identifying compounds that modulate premature franslation termination and/or nonsense-mediated mRNA decay. A target RNA may be engineered to contain a premature stop codon or, alternatively, a target RNA may naturally contain a premature stop codon. The premature stop codon may any one of the stop codons known in the art including UAG, UAA and UGA.
The stop codons are UAG, UAA, and UGA, i.e., signals to the ribosome to terminate protein synthesis, presumably through protein release factors. Even though the use of these stop codons is widespread, they are not universal. For example, UGA specifies tryptophan in the mitochondria of mammals, yeast, Neurospora crassa, Drosophila, protozoa, and plants (see, e.g., Breitenberger & RajBhandary, 1985, Trends Biochem Sci 10:481). Other examples include the use of UGA for tryptophan in Mycoplasma and, in ciliated protozoa, the use of UAA and UAG for glutamine (see, e.g., Jukes et al., 1987, Cold Spring Harb Symp Quant Biol. 52:769-776), the use of UGA for cysteine in the ciliate Euplotes aediculatus (see, e.g., Kervestin et al., 2001, EMBO Rep 2001 Aug;2(8):680-684), the use of UGA for tryptophan in Blepharisma americanum and the use of UAR for glutamine in Tetrahymena, and three spirotrichs, Stylonychia lemnae, S. mytilus, and Oxytricha trifallax (see, e.g., Lozupone et al., 2001, Curr Biol 11(2):65-74). It has been proposed that the ancestral mitochondrion was bearing the universal genetic code and subsequently reassigned the UGA codon to tryptophan independently, at least in the lineage of ciliates, kinetoplastids, rhodophytes, prymnesiophytes, and fungi (see, e.g., Inagaki et al., 1998, J Mol Evol 47(4):378-384).
The readthrough of stop codons also occurs in positive-sense ssRNA viruses by a variety of naturally occurring suppressor tRNAs. Such naturally-occurring suppressor tRNAs include, but are not limited to, cytoplasmic tRNATyr, which reads through the UAG stop codon; cytoplasmic tRNAsGln, which read through UAG and UAA; cytoplasmic fRNAsLeu, which read through UAG; chloroplast and cytoplasmic tRNAsTrp, which read through UGA; chloroplast and cytoplasmic tRNAsCys, which read through UGA; cytoplasmic tRNAsArg, which read through UGA (see, e.g., Beier & Grimm, 2001, Nucl Acids Res 29(23):4767-4782 for a review); and the use of selenocysteine to suppress UGA in E. coli (see, e.g., Baron & Bock, 1995, The selenocysteine inserting tRNA species: structure and function, hi Sόll,D. and RajBhandary,U.L. (eds), tRNA: Structure,
Biosynthesis and Function, ASM Press, Washington, DC, pp. 529 544). The mechanism is thought to involve unconventional base interactions and/or codon context effects.
As described above, the stop codons are not necessarily universal, with considerable variation amongst organelles (e.g., mitochondria and chloroplasts), viruses (e.g., single strand viruses), and protozoa (e.g., ciliated protozoa) as to whether the codons UAG, UAA, and UGA signal translation termination or encode amino acids. Even though a single release factor most probably recognizes all of the stop codons in eukaryotes, it appears that all of the stop codons are not suppressed in a similar matter. For example, in the yeast Saccharomyces pombe, nonsense suppression has to be strictly codon specific (see, e.g., Hottinger et al., 1984, EMBO J 3:423-428). fri another example, significant differences were found in the degree of suppression amongst three UAG codons and two UAA codons in different mRNA contexts in Escherichia coli and in human 293 cells, although data suggested that the context effects of nonsense suppression operated differently in E. coli and human cells (see, e.g., Martin et al., 1989, Mol Gen Genet 217(2 3):411 8). Since unconventional base interactions and/or codon context effects have been implicated in nonsense suppression, it is conceivable that compounds involved in nonsense suppression of one stop codon may not necessarily be involved in nonsense suppression of another stop codon. hi other words, compounds involved in suppressing UAG codons may not necessarily be involved in suppressing UGA codons. In a specific embodiment, a target RNA contains or is engineered to contain the premature stop codon UAG. In another embodiment, a target RNA contains or is engineered to contain the premature stop codon UGA. hi a particular embodiment, a target RNA contains or is engineered to contain two or more stop codons. i accordance with this embodiment, the stop codons are preferably at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 75 nucleotides or at least 100 nucleotides apart from each other. Further, in accordance with this embodiment, at least one of the stop codons is preferably UAG or UGA. In a specific embodiment, a target RNA contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides from the start codon in the coding sequence. In another embodiment, a target RNA contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides from the native stop codon in the coding sequence of the full-length protein, polypeptide or peptide. In another embodiment, a target RNA contains or is engineered to contain a premature stop codon at least 15 nucleotides (preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides) from the start codon in the coding sequence and at least 15 nucleotides (preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides) from the native stop codon in the coding sequence of the full-length protein, polypeptide or peptide. In accordance with these embodiments, the premature stop codon is preferably UAG or UGA.
The premature franslation stop codon can be produced by in vitro mutagenesis techniques such as, but not limited to, polymerase chain reaction ("PCR"), linker insertion, oligonucleotide-mediated mutagenesis, and random chemical mutagenesis.
5.3 Target RNAs (Detectably Labeled or Attached to a Solid Support)
Target nucleic acids, including but not limited to RNA and DNA, useful in the methods of the present invention have a label that is detectable via conventional specfroscopic means or radiographic means. Preferably, target nucleic acids are labeled with a covalently attached dye molecule. Useful dye-molecule labels include, but are not limited to, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes. Preferably, the dye is a visible dye.
Useful labels in the present invention can include, but are not limited to, specfroscopic labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, teframethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDye™, and the like), radiolabels (e.g., H, I, S, C, P, P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), specfroscopic colorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads, or nanoparticles - nanoclusters of inorganic ions with defined dimension from 0.1 to 1000 nm. Useful affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer-sfreptavidin, or haptens and proteins for which antisera or monoclonal antibodies are available. The label may be coupled directly or indirectly to a component of the detection assay (e.g. , the detection reagent) according to methods well known in the art. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. hi one embodiment, nucleic acids that are labeled at one or more specific locations are chemically synthesized using phosphoramidite or other solution or solid-phase methods. Detailed descriptions of the chemistry used to form polynucleotides by the phosphoramidite method are well known (see, e.g., Caruthers et al, U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al, 1982, Genetic Engineering 4:1-17; Users Manual Model 392 and 394 Polynucleotide Synthesizers, 1990, pages 6-1 through 6-22, Applied Biosystems, Part No. 901237; Ojwang, et al, 1997, Biochemistry, 36:6033-6045). The phosphoramidite method of polynucleotide synthesis is the prefened method because of its efficient and rapid coupling and the stability of the starting materials. The synthesis is performed with the growing polynucleotide chain attached to a solid support, such that excess reagents, which are generally in the liquid phase, can be easily removed by washing, decanting, and/or filtration, thereby eliminating the need for purification steps between synthesis cycles.
The following briefly describes illustrative steps of a typical polynucleotide synthesis cycle using the phosphoramidite method. First, a solid support to which is attached a protected nucleoside monomer at its 3' terminus is freated with acid, e.g., trichloroacetic acid, to remove the 5 '-hydroxyl protecting group, freeing the hydroxyl group for a subsequent coupling reaction. After the coupling reaction is completed an activated intermediate is formed by contacting the support-bound nucleoside with a protected nucleoside phosphoramidite monomer and a weak acid, e.g., tetrazole. The weak acid protonates the nitrogen atom of the phosphoramidite forming a reactive intermediate. Nucleoside addition is generally complete within 30 seconds. Next, a capping step is performed, which terminates any polynucleotide chains that did not undergo nucleoside addition. Capping is preferably performed using acetic anhydride and 1-methylimidazole. The phosphite group of the internucleotide linkage is then converted to the more stable phosphotriester by oxidation using iodine as the prefened oxidizing agent and water as the oxygen donor. After oxidation, the hydroxyl protecting group of the newly added nucleoside is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated one or more times until chain elongation is complete. After synthesis, the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine. The cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl. Finally, the protecting groups on the exocyclic amines of the bases and any protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., at about 55°C. Preferably the various protecting groups are removed using ammonium hydroxide or t-butyl amine.
Any of the nucleoside phosphoramidite monomers can be labeled using standard phosphoramidite chemistry methods (Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et al, 1997, Biochemistry. 36:6033-6045 and references cited therein). Dye molecules useful for covalently coupling to phosphoramidites preferably comprise a primary hydroxyl group that is not part of the dye's chromophore. Illustrative dye molecules include, but are not limited to, disperse dye CAS 4439-31-0, disperse dye CAS 6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St. Louis, MO), disperse red, and 1-pyrenebutanol (Molecular Probes, Eugene, OR). Other dyes useful for coupling to phosphoramidites will be apparent to those of skill in the art, such as fluoroscein, cy3, and cy5 fluorescent dyes, and may be purchased from, e.g., Sigma-Aldrich, St. Louis, MO or Molecular Probes, Inc., Eugene, OR. hi another embodiment, dye-labeled target molecules are synthesized enzymatically using in vitro transcription (Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein), ha this embodiment, a mixture of ribonucleoside-5 ' -triphosphates capable of supporting template-directed enzymatic extension (e.g., a mixture including GTP, ATP, CTP, and UTP, including one or more dye- labeled ribonucleotides; Sigma-Aldrich, St. Louis, MO) is added to a promoter-containing DNA template. Next, a polymerase enzyme is added to the mixture under conditions where the polymerase enzyme is active, which are well-known to those skilled in the art. A labeled polynucleotide is formed by the incorporation of the labeled ribonucleotides during polymerase-mediated strand synthesis.
In yet another embodiment of the invention, nucleic acid molecules are end- labeled after their synthesis. Methods for labeling the 5 '-end of an oligonucleotide include but are by no means limited to: (i) periodate oxidation of a 5 '-to-5' -coupled ribonucleotide, followed by reaction with an amine-reactive label (Heller & Morisson, 1985, in Rapid
Detection and Identification of Infectious Agents, D.T. Kingsbury and S. Falkow, eds., pp. 245-256, Academic Press); (ii) condensation of ethylenediamine with 5'-phosphorylated polynucleotide, followed by reaction with an amine reactive label (Morrison, European Patent Application 232 967); (iii) introduction of an aliphatic amine substituent using an aminohexyl phosphite reagent in solid-phase DNA synthesis, followed by reaction with an amine reactive label (Cardullo et al, 1988, Proc. Natl. Acad. Sci. USA 85:8790-8794); and (iv) introduction of a thiophosphate group on the 5 '-end of the nucleic acid, using phosphatase freatment followed by end-labeling with ATP-7S and kinase, which reacts specifically and efficiently with maleimide-labeled fluorescent dyes (Czworkowski et al, 1991, Biochem. 30:4821-4830).
A detectable label should not be incorporated into a target nucleic acid at the specific binding site at which compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the compounds at this site. Accordingly, if the region of the target nucleic acid that binds to a host cell factor is known, a detectable label is preferably incorporated into the nucleic acid molecule at one or more positions that are spatially or sequentially remote from the binding region.
After synthesis, the labeled target nucleic acid can be purified using standard techniques known to those skilled in the art (see Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96(23): 12997-13002 and references cited therein). Depending on the length of the target nucleic acid and the method of its synthesis, such purification techniques include, but are not limited to, reverse-phase high-performance liquid chromatography ("reverse-phase HPLC"), fast performance liquid chromatography ("FPLC"), and gel purification. After purification, the target RNA is refolded into its native conformation, preferably by heating to approximately 85-95°C and slowly cooling to room temperature in a buffer, e.g., a buffer comprising about 50 mM Tris-HCl, pH 8 and 100 mM NaCI.
In another embodiment, the target nucleic acid can also be radiolabeled. A radiolabel, such as, but not limited to, an isotope of phosphorus, sulfur, or hydrogen, may be incorporated into a nucleotide, which is added either after or during the synthesis of the target nucleic acid. Methods for the synthesis and purification of radiolabeled nucleic acids are well known to one of skill in the art. See, e.g., Sambrook et al, 1989, in Molecular Cloning: A Laboratory Manual, pp 10.2-10.70, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties. hi another embodiment, the target nucleic acid can be attached to an inorganic nanoparticle. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Nanoparticles have unique optical, electronic and catalytic properties relative to bulk materials which can be adjusted according to the size of the particle. Methods for the attachment of nucleic acids are well known to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem. hit. Ed. 40: 4129-4158, International Patent Publication WO/0218643, and the references cited therein, the disclosures of which are hereby incorporated by reference in their entireties). hi yet another embodiment of the invention, target nucleic acids can be attached or conjugated to a solid support for use in the assays of the invention. There are a number of methods, known in the art, that can be used to immobilize nucleic acids on a solid support. For example, modified DNA has been covalently immobilized to a variety of surfaces using amino acids (see, e.g., Running, J. A., and Urdea, M. S. (1990) Biotechniques, 8, 276-277), (Newton, C. R., et al., (1993) Nucl. Acids. Res., 21 1155- 1162.), (Nikiforov, T. T., and Rogers, Y. H. (1995) Anal. Biochem., 227, 201-209). Alternatively, carboxyl groups, (Zhang, Y., et al., (1991) Nucl. Acids Res., 19, 3929-3933), epoxy groups (Lamture, J. B., et al., (1994) Nucl. Acids Res. 22, 2121-2125), (Eggers, M. D., et al., (1994) BioTechniques, 17, 516-524) or amino groups (Rasmussen, S. R., et al., (1991) Anal. Biochem., 198, 138-142), can be used to attach nucleic acids to solid surfaces. Such embodiments would be useful in, e.g., high throughput assays intended to screen a library of compounds in order to identify molecules that bind to target nucleic acids that have been attached to a solid support. In a particular embodiment, target RNA molecules are attached or conjugated to a solid support, e.g., a slide or a bead, using an appropriate molecule that does not interfere with its binding to compounds of the invention and then subsequently screened with a library of compounds. Members of a library of compounds are preferably detectably labeled so that compounds that bind to target RNAs can be identified. Suitable detectable labels that can be used to label compounds are known in the art and also described herein. In a more prefened embodiment, target RNA molecules are immobilized on a surface suitable for preforming microarray assays. Any technique known in the art can be used to immobilize nucleic acid molecules on a solid support surface. The nucleic acid is preferably, for example, covalently attached to the solid support.
5.4 Libraries of Small Molecules Libraries screened using the methods of the present invention can comprise a variety of types of compounds. In one embodiment, the libraries screened using the methods of the present invention can comprise a variety of types of compounds on solid supports. In other embodiments described below, the libraries can be synthesized on solid supports or the compounds of the library can be attached to solid supports by linkers. In some embodiments, the compounds are nucleic acid or peptide molecules. In a non- limiting example, peptide molecules can exist in a phage display library. In other embodiments, types of compounds include, but are not limited to, peptide analogs including peptides comprising non-naturally occurring amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as o;-amino phosphoric acids and α-amino phosphoric acids, or amino acids having non-peptide linkages, nucleic acid analogs such as phosphorothioates and PNAs, hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose. Libraries of polypeptides or proteins can also be used. In a prefened embodiment, the combinatorial libraries are small organic molecule libraries, such as, but not limited to, benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pynolidines, morpholino compounds, and diazepindiones. In another embodiment, the combinatorial libraries comprise peptoids; random bio-oligomers; benzodiazepines; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; ohgocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; or carbohydrate libraries. Combinatorial libraries are themselves commercially available (see, e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX, Moscow Russia; BioFocus pic, Sittingboume, UK; Bionet Research (A division of Key Organics Limited ), Camelford, UK; ChemBridge Corporation, San Diego, California; ChemDiv Inc, San Diego, California.; ChemRx Advanced Technologies, South San Francisco, California; ComGenex Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd., Kiev, Ukraine; Maybridge pic, Cornwall, UK; PharmaCore, Inc., North Carolina; SIDDCO hie, Tucson, Arizona; TimTec Inc, Newark, Delaware; Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg, Russia), hi a specific embodiment, the combinatorial libaries are small molecules.
In another embodiment, combinatorial libraries, useful in the present invention are combinatorial libraries of labeled compounds with each compound in the library having a label that is detectable via conventional specfroscopic means or radiographic means. Preferably, compounds are labeled with a covalently attached and detectable isotope. Other useful labels in the present invention include, but are not limited to, fluorescent tags or dye molecules. Useful dye molecules, include, for example, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes. Useful fluorescent tags, include, for example, fluoresein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDye™, and the like), radiolabels (e.g., 3H, 1251, 35S, 14C, 32P, 33P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), specfroscopic colorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads, or nanoparticles - nanoclusters of inorganic ions with defined dimension from 0.1 to 1000 nm. The label may be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. In one embodiment, the combinatorial compound library for the methods of the present invention may be synthesized. There is a great interest in synthetic methods directed toward the creation of large collections of small organic compounds, or libraries, which could be screened for pharmacological, biological or other activity (Dolle, 2001, J. Comb. Chem. 3:477-517; Hall et al, 2001, J. Comb. Chem. 3:125-150; Dolle, 2000, J.
Comb. Chem. 2:383-433; Dolle, 1999, J. Comb. Chem. 1:235-282). The synthetic methods applied to create vast combinatorial libraries are performed in solution or in the solid phase, t.e., on a solid support. Solid-phase synthesis makes it easier to conduct multi-step reactions and to drive reactions to completion with high yields because excess reagents can be easily added and washed away after each reaction step. Solid-phase combinatorial synthesis also tends to improve isolation, purification and screening. However, the more traditional solution phase chemistry supports a wider variety of organic reactions than solid-phase chemistry. Methods and strategies for the synthesis of combinatorial libraries can be found in A Practical Guide to Combinatorial Chemistry, A.W. Czarnik and S.H. Dewitt , eds., American Chemical Society, 1997; The Combinatorial Index, B.A. Bunin, Academic Press, 1998; Organic Synthesis on Solid Phase, F.Z. Dδrwald, Wiley- VCH, 2000; and Solid-Phase Organic Syntheses, Vol. 1, A.W. Czarnik, ed., Wiley hiterscience, 2001.
Combinatorial compound libraries of the present invention may be synthesized using apparatuses described in US Patent No. 6,358,479 to Frisina et al, U.S. Patent No. 6,190,619 to Kilcoin et al, US Patent No. 6,132,686 to Gallup et al, US Patent No. 6,126,904 to Zuellig et al, US Patent No. 6,074,613 to Harness et al, US Patent No. 6,054,100 to Stanchfield et al, and US Patent No. 5,746,982 to Saneii et al. which are hereby incorporated by reference in their entirety. These patents describe synthesis apparatuses capable of holding a plurality of reaction vessels for parallel synthesis of multiple discrete compounds or for combinatorial libraries of compounds.
In one embodiment, the combinatorial compound library can be synthesized in solution. The method disclosed in U.S. Patent No. 6,194,612 to Boger et al, which is hereby incorporated by reference in its entirety, features compounds useful as templates for solution phase synthesis of combinatorial libraries. The template is designed to permit reaction products to be easily purified from unreacted reactants using liquid/liquid or solid/liquid extractions. The compounds produced by combinatorial synthesis using the template will preferably be small organic molecules. Some compounds in the library may mimic the effects of non-peptides or peptides. In contrast to solid-phase synthesis of combinatorial compound libraries, liquid-phase synthesis does not require the use of specialized protocols for monitoring the individual steps of a multistep solid-phase synthesis (Egner et al, 1995, J.Org. Chem. 60:2652; Anderson et al, 1995, J. Org. Chem. 60:2650; Fitch et al, 1994, J. Org. Chem. 59:7955; Look et al, 1994, J. Org. Chem. 49:7588; Metzger et al, 1993, Angew. Chem., hit. Ed. Engl. 32:894; Youngquist et al, 1994, Rapid Commun. Mass Spect. 8:77; Chu et al, 1995, J. Am. Chem. Soc. 117:5419; Brummel et al, 1994, Science 264:399; Stevanovic et al, 1993, Bioorg. Med. Chem. Lett. 3:431).
Combinatorial compound libraries useful for the methods of the present invention can be synthesized on solid supports, h one embodiment, a split synthesis method, a protocol of separating and mixing solid supports during the synthesis, is used to synthesize a library of compounds on solid supports (see Lam et al, 1997, Chem. Rev. 97:41-448; Ohlmeyer et al, 1993, Proc. Natl. Acad. Sci. USA 90: 10922-10926 and references cited therein). Each solid support in the final library has substantially one type of compound attached to its surface. Other methods for synthesizing combinatorial libraries on solid supports, wherein one product is attached to each support, will be known to those of skill in the art (see, e.g., Nefzi et al, 1997, Chem. Rev. 97:449-472 and US Patent No. 6,087, 186 to Cargill et al. which are hereby incorporated by reference in their entirety). As used herein, the term "solid support" is not limited to a specific type of solid support. Rather a large number of supports are available and are known to one skilled in the art. Solid supports that can be used in the assays of the invention include, for example, any surface to which compounds, either natively or via a linker, can be attached. Solid supports include silica gels, resins, derivatized plastic films, glass beads, glass slides (e.g, Hergenrother et al, 2000, J. Am. Chem. Soc. 122:7849-7850 and Kuruvilla et al, 2002, Nature 416:653-657) and cotton, plastic beads, polystyrene beads, doped polystyrene beads (as described by Fenniri et al, 2000, J. Am. Chem. Soc. 123:8151-8152), polystyrene macrobeads (as described by Blackwell et al, 2001, Chemistry & Biology 8:1167-1182), alumina gels, and polysaccharides. In a specific embodiment, the solid support is a glass slide. In a more specific embodiment, the solid support is a glass microscope slide.
A suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols. For example, for peptide synthesis, a solid support can be a resin such as p-methylbenzhydrylamine (pMBHA) resin (Peptides International, Louisville, KY), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly (dimethylacrylamide)- grafted styrene co-divinyl-benzene (e.g., POLYHIPE resin, obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California), or Sepharose (Pharmacia, Sweden). In another embodiment, the solid support can be a magnetic bead coated with streptavidin, such as Dynabeads Streptavidin (Dynal Biotech, Oslo, Norway).
In one embodiment, the solid phase support is suitable for in vivo use, i.e., it can serve as a carrier or support for administration of the compound to a patient (e.g., TENTAGEL, Bayer, Tubingen, Germany). In a particular embodiment, the solid support is palatable and/or orally ingestable.
Any technique known to one of skill in the art can be used attach compounds to a solid support for use in the assays of the invention, h some embodiments of the present invention, compounds can be attached to solid supports via linkers. Linkers can be integral and part of the solid support, or they may be nonintegral that are either synthesized on the solid support or attached thereto after synthesis. Linkers are useful not only for providing points of compound attachment to the solid support, but also for allowing different groups of molecules to be cleaved from the solid support under different conditions, depending on the nature of the linker. For example, linkers can be, inter alia, electrophilically cleaved, nucleophilically cleaved, photocleavable, enzymatically cleaved, cleaved by metals, cleaved under reductive conditions or cleaved under oxidative conditions.
In some embodiments of the present invention, each compound contains a common functional group that mediates covalent attachment to a solid support, hi a specific embodiment of the invention, the functional group that mediates covalent attachment to a solid support varies between the compounds. Compounds can be attached on a solid support in any orientation and distribution that is suitable for the assays of the invention, hi a further embodiment, compounds are attached or spotted on a solid support such as, e.g., a glass slide, with high spatial density and uniform distance between each spot so that an array is formed. Each surface is subsequently probed with a compound of interest.
In one embodiment, compounds are applied directly to a surface, such as, e.g., a glass slide, using a manual transfer technique, hi a particular embodiment, the compounds are fransfened or spotted on a surface from a microtiter plate using a robotic arrayer. In another embodiment, the compounds are attached to beads that are subsequently fransfened to wells in a microtiter plate where the compounds are released before being anayed on a surface using any of the means described above. Any type and size of bead can be used to attach compounds of the invention. One skilled in the art would be familiar with the bead properties necessary for a specific purpose. In a particular embodiment, the bead material is polystyrene. In another embodiment, the combinatorial compound libraries can be assembled in situ using dynamic combinatorial chemistry as described in European Patent Application 1,118,359 Al to Lehn; Hue & Nguyen, 2001, Comb. Chem. High Throughput. Screen. 4:53-74; Lehn and Eliseev, 2001, Science 291:2331-2332; Cousins et al 2000, Cu . Opin. Chem. Biol. 4: 270-279; and Karan & Miller, 2000, Drug. Disc. Today 5:67-75 which are incorporated by reference in their entirety.
Dynamic combinatorial chemistry uses non-covalent interaction with a target biomolecule, including but not limited to a protein, RNA, or DNA, to favor assembly of the most tightly binding molecule that is a combination of constituent subunits present as a mixture in the presence of the biomolecule. According to the laws of thermodynamics, when a collection of molecules is able to combine and recombine at equilibrium through reversible chemical reactions in solution, molecules, preferably one molecule, that bind most tightly to a templating biomolecule will be present in greater amount than all other possible combinations. The reversible chemical reactions include, but are not limited to, imine, acyl-hydrazone, amide, acetal, or ester formation between carbonyl-containing compounds and amines, hydrazines, or alcohols; thiol exchange between disulfides; alcohol exchange in borate esters; Diels-Alder reactions; thermal- or photoinduced sigmafropic or elecfrocyclic reanangements; or Michael reactions. hi the prefened embodiment of this technique, the constituent components of the dynamic combinatorial compound library are allowed to combine and reach equilibrium in the absence of the target RNA and then incubated in the presence of the target RNA, preferably at physiological conditions, until a second equilibrium is reached. The second, perturbed, equilibrium (the so-called "templated mixture") can, but need not necessarily, be fixed by a further chemical transformation, including but not limited to reduction, oxidation, hydrolysis, acidification, or basification, to prevent restoration of the original equilibrium when the dynamical combinatorial compound library is separated from the target RNA. hi the prefened embodiment of this technique, the predominant product or products of the templated dynamic combinatorial library can separated from the minor products and directly identified. In another embodiment, the identity of the predominant product or products can be identified by a deconvolution strategy involving preparation of derivative dynamic combinatorial libraries, as described in European Patent Application 1 , 118,359 Al , which is incorporated by reference in its entirety, whereby each component of the mixture is, preferably one-by-one but possibly group-wise, left out of the mixture and the ability of the derivative library mixture at chemical equilibrium to bind the target RNA is measured. The components whose removal most greatly reduces the ability of the derivative dynamic combinatorial library to bind the target RNA are likely the components of the predominant product or products in the original dynamic combinatorial library.
5.5 Library Screening After a target nucleic acid, such as but not limited to RNA or DNA, is labeled and a compound library is synthesized or purchased or both, the labeled target nucleic acid is used to screen the library to identify compounds that bind to the nucleic acid. Screening comprises contacting a labeled target nucleic acid with an individual, or small group, of the compounds of the compound library. Preferably, the contacting occurs in an aqueous solution, and most preferably, under physiologic conditions. The aqueous solution preferably stabilizes the labeled target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the compounds. The aqueous solution can be similar to the solution in which a complex between the target RNA and its conesponding host cell factor (if known) is formed in vitro. For example, TK buffer, which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of compounds for RNA binding compounds.
Alternatively, compounds are labeled and target RNA molecules are used to screen the library of labeled compounds. After compounds are labeled, target nucleic acids are used to screen the library of labeled compounds to identify those nucleic acids that bind to the labeled compounds. Screening comprises contacting a target nucleic acid with an individual, or small group, of the compounds of the labeled compound library. Preferably, the contacting occurs in an aqueous solution, and most preferably under physiologic conditions. The aqueous solution preferably stabilizes the target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the compounds. The aqueous solution can be similar to the solution in which a complex between the target RNA and its conesponding host cell factor (if known) is formed in vitro. For example, TK buffer, which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of compounds for RNA binding compounds.
The methods of the present invention for screening a library of compounds preferably comprise contacting a compound with a target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. The aqueous solution optionally further comprises non-specific nucleic acids, such as, but not limited to, DNA; yeast tRNA; salmon sperm DNA; homoribopolymers such as, but not limited to, poly IC, polyA, polyU, and polyC; and non-specific RNA. The non-specific RNA may be an unlabeled target nucleic acid having a mutation at the binding site, which renders the unlabeled nucleic acid incapable of interacting with a compound at that site. For example, if dye-labeled TAR RNA is used to screen a library, unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24 bulge region may also be present in the aqueous solution. Without being bound by any theory, the addition of unlabeled RNA that is essentially identical to the dye-labeled target RNA except for a mutation at the binding site might minimize interactions of other regions of the dye-labeled target RNA with compounds or with the solid support and prevent false positive results.
The solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant. The pH of the aqueous solution typically ranges from about 5 to about 8, preferably from about 6 to about 8, most preferably from about 6.5 to about 8. A variety of buffers may be used to achieve the desired pH. Suitable buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada, Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso, Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly, Bicine, and sodium-potassium phosphate. The buffering agent comprises from about 10 mM to about 100 mM, preferably from about 25 mM to about 75 mM, most preferably from about 40 mM to about 60 mM buffering agent. The pH of the aqeuous solution can be optimized for different screening reactions, depending on the target RNA used and the types of compounds in the library, and therefore, the type and amount of the buffer used in the solution can vary from screen to screen, hi a prefened embodiment, the aqueous solution has a pH of about 7.4, which can be achieved using about 50 mM Tris buffer.
In addition to an appropriate buffer, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KC1, from about 0 mM to about 1 M NaCI, and from about 0 mM to about 200 mM MgCl2. In a prefened embodiment, the combination of salts is about 100 mM KC1, 500 mM NaCI, and 10 mM MgCl2. Without being bound by any theory, Applicant has found that a combination of KC1, NaCI, and MgCl2 stabilizes the target RNA such that most of the RNA is not denatured or digested over the course of the screening reaction. The optional concentration of each salt used in the aqueous solution is dependent on the particular target RNA used and can be determined using routine experimentation.
The solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant. Without being bound by any theory, a small amount of detergent or surfactant in the solution might reduce non-specific binding of the target RNA to the solid support and confrol aggregation and increase stability of target RNA molecules. Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N- laurylsarcosine, lauryl sulfate, 1 -octane sulfonic acid and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alkyl amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-l- propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D- glucopyranoside, n-decyl β-D-maltopyranoside, n-dodecyl β-D-maltoside, n-octyl β-D- glucopyranoside, sorbitan esters, n-tetradecyl β-D-maltoside, octylphenoxy polyethoxyethanol (Nonidet P-40), nonylphenoxypolyethoxyethanol (NP-40), and tritons. Preferably, the detergent, if present, is a nonionic detergent. Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol. More preferably, the detergent, if present, is Triton X-100 and present in an amount of about 0.1% (w/v).
Non-specific binding of a labeled target nucleic acid to compounds can be further mimmized by treating the binding reaction with one or more blocking agents. Nonspecific binding of a unlabeled target nucleic acid to labeled compounds can be further minimized by treating the binding reaction with one or more blocking agents. In one embodiment, the binding reactions are treated with a blocking agent, e.g., bovine serum albumin ("BSA"), before contacting with to the labeled target nucleic acid, hi another embodiment, the binding reactions are treated sequentially with at least two different blocking agents. This blocking step is preferably performed at room temperature for from about 0.5 to about 3 hours. In a subsequent step, the reaction mixture is further treated with unlabeled RNA having a mutation at the binding site. This blocking step is preferably performed at about 4°C for from about 12 hours to about 36 hours before addition of the dye-labeled target RNA. Preferably, the solution used in the one or more blocking steps is substantially similar to the aqueous solution used to screen the library with the dye-labeled target RNA, e.g., in pH and salt concentration.
Once contacted, the mixture of labeled target nucleic acid and the compound is preferably maintained at 4°C for from about 1 day to about 5 days, preferably from about
2 days to about 3 days with constant agitation. To identify the reactions in which binding to the labeled target nucleic acid occurred, after the incubation period, bound from free compounds are determined using any of the methods disclosed in Section 5.5 infra, hi a specific embodiment, the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i.e., spectrometry) that diferentiates between bound and unbound target nucleic acids is used.
In another embodiment, once contacted, the mixture of target nucleic acid and the labeled compound is preferably maintained at 4°C for from about 1 day to about 5 days, preferably from about 2 days to about 3 days with constant agitation. To identify the reactions in which binding to the target nucleic acid occuned, after the incubation period, bound from free compounds are determined using any of the methods disclosed in Section 5.5 infra. In a specific embodiment, the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i. e. , spectrometry) that diferentiates between bound and unbound target nucleic acids is used.
The methods for identifying small molecules bound to labeled nucleic acid will vary with the type of label on the target nucleic acid. For example, if a target RNA is labeled with a visible of fluorescent dye, the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions. The reactions conesponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction. Alternatively, complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass specfrometric technique. In this fashion the bound small molecule can be identified on the basis of its molecular weight, hi this reaction a priori knowledge of the exact molecular weights of all compounds within the library is known. In another embodiment, the compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a technique such as, but not limited to, spectrometry is used.
The methods for identifying labeled small molecules bound to unlabeled nucleic acid will vary with the type of label on the compound. For example, if compound is labeled with a visible of fluorescent dye, the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions. The reactions conesponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction. Alternatively, complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass specfrometric technique. In this fashion the bound small molecule can be identified on the basis of its molecular weight, hi this reaction a priori knowledge of the exact molecular weights of all compounds within the library is known, h another embodiment, the compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a techmque such as, but not limited to, spectrometry is used.
5.6 Separation Methods for Screening Compounds
Any method that detects an altered physical property of a target nucleic acid complexed to a compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids. Methods that can be utilized for the physical separation of complexed target RNA from unbound target RNA include, but are not limited to, electrophoresis, fluorescence specfroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships ("SAR") by NMR specfroscopy, size exclusion chromatography, affinity chromatography, nanoparticle aggregation, flow cytometry, manual batch, and suspension of beads in electric fields.
In embodiments that use solid support based methods, after the labeled target RNA is contacted with the library of compounds immobilized on a solid support (e.g., beads) or the target RNA conjugated or attached to the solid support is contacted with the library of detectably labeled compounds, the solid support (e.g., beads) must then be separated from the unbound target RNA or unbound compounds, respectively, in the liquid phase. This can be accomplished by any number of physical means; e.g., sedimentation, centrifugation. Thereafter, a number of methods can be used to separate the solid support- based library that is complexed with the labeled target RNA from uncomplexed beads in order to isolate the compound on the bead. Alternatively, mass specfroscopy and NMR spectroscopy can be used to simultaneously identify and separate beads complexed to the labeled target RNA from uncomplexed beads.
5.6.1 Electrophoresis
Methods for separation of the complex of a target RNA bound to a compound from the unbound RNA comprises any method of electrophoretic separation, including but not limited to, denaturing and non-denaturing polyacrylamide gel electrophoresis, urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, agarose gel electrophoresis, and capillary electrophoresis. hi a prefened embodiment, an automated electrophoretic system comprising a capillary cartridge having a plurality of capillary tubes is used for high-throughput screening of compounds bound to target RNA. Such an apparatus for performing automated capillary gel electrophoresis is disclosed in U.S. Patent Nos. 5,885,430; 5,916,428; 6,027,627; and 6,063,251, the disclosures of which are incorporated by reference in their entireties.
The device disclosed in U.S. Patent No. 5,885,430, which is incorporated by reference in its entirety, allows one to simultaneously introduce samples into a plurality of capillary tubes directly from microtiter frays having a standard size. U.S. Patent No. 5,885,430 discloses a disposable capillary cartridge which can be cleaned between electrophoresis runs, the cartridge having a plurality of capillary tubes. A first end of each capillary tube is retained in a mounting plate, the first ends collectively forming an array in the mounting plate. The spacing between the first ends corresponds to the spacing between the centers of the wells of a microtiter tray having a standard size. Thus, the first ends of the capillary tubes can simultaneously be dipped into the samples present in the fray's wells. The cartridge is provided with a second mounting plate in which the second ends of the capillary tubes are retained. The second ends of the capillary tubes are ananged in an anay which conesponds to the wells in the microtiter fray, which allows for each capillary tube to be isolated from its neighbors and therefore free from cross-contamination, as each end is dipped into an individual well.
Plate holes may be provided in each mounting plate and the capillary tubes inserted through these plate holes. In such a case, the plate holes are sealed airtight so that the side of the mounting plate having the exposed capillary ends can be pressurized. Application of a positive pressure in the vicinity of the capillary openings in this mounting plate allows for the infroduction of air and fluids during elecfrophoretic operations and also can be used to force out gel and other materials from the capillary tubes during reconditioning. The capillary tubes may be protected from damage using a needle comprising a cannula and/or plastic tubes, and the like when they are placed in these plate holes. When metallic cannula or the like are used, they can serve as electrical contacts for current flow during electrophoresis. In the presence of a second mounting plate, the second mounting plate is provided with plate holes through which the second ends of the capillary tubes project, hi this instance, the second mounting plate serves as a pressure containment member of a pressure cell and the second ends of the capillary tubes communicate with an internal cavity of the pressure cell. The pressure cell is also formed with an inlet and an outlet. Gels, buffer solutions, cleaning agents, and the like may be introduced into the internal cavity through the inlet, and each of these can simultaneously enter the second ends of the capillaries.
In another prefened embodiment, the automated elecfrophoretic system can comprise a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while elecfrophoretic separation of the products of another sample is taking place in a different part of the chip. Such a system is disclosed in U.S. Patent Nos. 5,699,157; 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the disclosures of which are incorporated by reference in their entireties.
The system disclosed in U.S. Patent No. 5,699,157, which is hereby incoφorated by reference in its entirety, provides for a micro fluidic system for high-speed elecfrophoretic analysis of subject materials for applications in the fields of chemistry, biochemistry, biotechnology, molecular biology and numerous other areas. The system has a channel in a substrate, a light source and a photoreceptor. The channel holds subject materials in solution in an electric field so that the materials move through the channel and separate into bands according to species. The light source excites fluorescent light in the species bands and the photoreceptor is ananged to receive the fluorescent light from the bands. The system further has a means for masking the channel so that the photoreceptor can receive the fluorescent light only at periodically spaced regions along the channel. The system also has an unit connected to analyze the modulation frequencies of light intensity received by the photoreceptor so that velocities of the bands along the channel are determined, which allows the materials to be analyzed.
The system disclosed in U.S. Patent No. 5,699,157 also provides for a method of performing high-speed elecfrophoretic analysis of subject materials, which comprises the steps of holding the subject materials in solution in a channel of a micro fluidic system; subjecting the materials to an electric field so that the subject materials move through the channel and separate into species bands; directing light toward the channel; receiving light from periodically spaced regions along the channel simultaneously; and analyzing the frequencies of light intensity of the received light so that velocities of the bands along the channel can be determined for analysis of said materials. The determination of the velocity of a species band determines the elecfrophoretic mobility of the species and its identification.
U.S. Patent No. 5,842,787, which is hereby incoφorated by reference in its entirety, is generally directed to devices and systems employ channels having, at least in part, depths that are varied over those which have been previously described (such as the device disclosed in U.S. Patent No. 5,699,157), wherein said channel depths provide numerous beneficial and unexpected results such as but not limited to, a reduction in sample perturbation, reduced non-specific sample mixture by diffusion, and increased resolution, hi another embodiment, the electrophoretic method of separation comprises polyacrylamide gel electrophoresis. hi a prefened embodiment, the polyacrylamide gel electrophoresis is non-denaturing, so as to differentiate the mobilities of the target RNA bound to a compound from free target RNA. If the polyacrylamide gel electrophoresis is denaturing, then the target RNAxompound complex must be cross-linked prior to electrophoresis to prevent the disassociation of the target RNA from the compound during electrophoresis. Such techniques are well known to one of skill in the art. hi one embodiment of the method, the binding of compounds to target nucleic acid can be detected, preferably in an automated fashion, by gel electrophoretic analysis of interference footprinting. RNA can be degraded at specific base sites by enzymatic methods such as ribonucleases A, U2, CL3, Tls Phy M, and B. cereus or chemical methods such as diethylpyrocarbonate, sodium hydroxide, hydrazine, piperidine formate, dimethyl sulfate, [2,12-dimethyl-3,7,l l,17-tefraazacyclo[l 1.3.1]heptadeca- l(17),2,ll,13,15-pentaenato] nickel(II) (NiCR), cobalt(U)chloride, or iron(H) ethylenediaminetefraacetate (Fe-EDTA) as described for example in Zheng et al, 1999, Biochem. 37:2207-2214; Latham & Cech, 1989, Science 245:276-282; and Sambrook et al, 2001, in Molecular Cloning: A Laboratory Manual, pp 12.61-12.73, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incoφorated by reference in their entireties.
The specific pattern of cleavage sites is determined by the accessibility of particular bases to the reagent employed to initiate cleavage and, as such, is therefore is determined by the three-dimensional structure of the RNA. The interaction of small molecules with a target nucleic acid can change the accessibility of bases to these cleavage reagents both by causing conformational changes in the target nucleic acid or by covering a base at the binding interface. When a compound binds to the nucleic acid and changes the accessibility of bases to cleavage reagents, the observed cleavage pattern will change. This method can be used to identify and characterize the binding of small molecules to RNA as described, for example, by Prudent et al, 1995, J. Am. Chem. Soc. 117:10145-10146 and Mei et al, 1998, Biochem. 37:14204-14212. hi the prefened embodiment of this technique, the detectably labeled target nucleic acid is incubated with an individual compound and then subjected to treatment with a cleavage reagent, either enzymatic or chemical. The reaction mixture can be preferably be examined directly, or freated further to isolate and concentrate the nucleic acid. The fragments produced are separated by electrophoresis and the pattern of cleavage can be compared to a cleavage reaction performed in the absence of compound. A change in the cleavage pattern directly indicates that the compound binds to the target nucleic acid. Multiple compounds can be examined both in parallel and serially.
Other embodiments of elecfrophoretic separation include, but are not limited to urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, and agarose gel electrophoresis.
5.6.2 Fluorescence Spectroscopy h a prefened embodiment, fluorescence polarization specfroscopy, an optical detection method that can differentiate the proportion of a fluorescent molecule that is either bound or unbound in solution (e.g., the labeled target nucleic acid of the present invention), can be used to read reaction results without electrophoretic separation of the samples. Fluorescence polarization specfroscopy can be used to read the reaction results in the chip system disclosed in U.S. Patent Nos. 5,699,157; 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the disclosures of which are incoφorated by reference in their entireties. The application of fluorescence polarization specfroscopy to the chip system disclosed in the U.S. Patents listed supra is fast, efficient, and well-adapted for high-throughput screening.
In another embodiment, a compound that has an affinity for the target nucleic acid of interest can be labeled with a fluorophore to screen for compounds that bind to the target nucleic acid. For example, a pyrene-containing aminoglycoside analog was used to accurately monitor antagonist binding to a prokaryotic 16S rRNA A site (which comprises the natural target for aminoglycoside antibiotics) in a screen using a fluorescence quenching technique in a 96-well plate format (Hamasaki & Rando, 1998, Anal. Biochem. 261(2): 183-90). hi another embodiment, fluorescence resonance energy transfer (FRET) can be used to screen for compounds that bind to the target nucleic acid. FRET, a characteristic change in fluorescence, occurs when two fluorophores with overlapping emission and excitation wavelength bands are held together in close proximity, such as by a binding event. In the prefened embodiment, the fluorophore on the target nucleic acid and the fluorophore on the compounds will have overlapping excitation and emission spectra such that one fluorophore (the donor) transfers its emission energy to excite the other fluorophore (the acceptor). The acceptor preferably emits light of a different wavelength upon relaxing to the ground state, or relaxes non-radiatively to quench fluorescence. FRET is very sensitive to the distance between the two fluorophores, and allows measurement of molecular distances less than 10 nm. For example, U.S, Patent 6,337,183 to Arenas et al, which is incoφorated by reference in its entirety, describes a screen for compounds that bind RNA that uses FRET to measure the effect of compounds on the stability of a target RNA molecule where the target RNA is labeled with both fluorescent acceptor and donor molecules and the distance between the two fluorophores as determined by FRET provides a measure of the folded structure of the RNA. Matsumoto et al. (2000, Bioorg. Med. Chem. Lett. 10:1857-1861) describe a system where a peptide that binds to HIV-1 TAR RNA is labeled on one end with a fluorescein fluorophore and a tetramethylrhodamine on the other end. The conformational change of the peptide upon binding to the RNA provided a FRET signal to screen for compounds that bound to the TAR RNA.
In the prefened embodiment, both the target nucleic acid and a compound that has an affinity for the target nucleic acid of interest are labeled with fluorophores with overlapping emission and excitation spectra (donor and acceptor), including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules. Binding of a labeled compound to the target nucleic acid can be identified by the change in observable fluorescence as a result of FRET.
If the target nucleic acid is labeled with the donor fluorophore, then the compounds are labeled with the acceptor fluorophore. Conversely, if the target nucleic acid is labeled with the acceptor fluorophore, then the compounds are labeled with the donor fluorophore. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. The fluorophore on the target nucleic acid must be in close proximity to the binding site of the compounds, but should not be incoφorated into a target nucleic acid at the specific binding site at which compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the compounds at this site.
In yet another embodiment, homogeneous time-resolved fluorescence ("HTRF") techniques based on time-resolved energy transfer from lanthanide ion complexes to a suitable acceptor species can be adapted for high-throughput screening for inhibitors of RNA-protein complexes (Hemmila, 1999, J. Biomol. Screening 4:303-307; Mathis, 1999, J. Biomol. Screening 4:309-313). HTRF is similar to fluorescence resonance energy transfer using conventional organic dye pairs, but has several advantages, such as increased sensitivity and efficiency, and background elimination (Xavier et al, 2000, Trends Biotechnol. 18(8):349-356).
It is also contemplated that the target RNA may be labeled with a fluorophore and the compounds in the library labeled with a quencher of the fluorophore, or alternatively, the target RNA labeled with a quencher of the fluorophore and the compounds in the library labeled with a fluorophore, so that when a compound and target RNA bind, the fluorescent signal of the fluorophore is quenched.
Fluorescence specfroscopy has traditionally been used to characterize DNA- protein and protein-protein interactions, but fluorescence specfroscopy has not been widely used to characterize RNA-protein interactions because of an interfering absoφtion of RNA nucleotides with the intrinsic tryptophan fluorescence of proteins (Xavier et al. , 2000,
Trends Biotechnol. 18(8):349-356.). However, fluorescence spectroscopy has been used in studying the single tryptophan residue within the arginine-rich RNA-binding domain of Rev protein and its interaction with the RRE in a time-resolved fluorescence study (Kwon & Carson, 1998, Anal. Biochem. 264:133-140). Thus, in this invention, fluorescence specfroscopy is less prefened if the compounds or peptides or proteins possess intrinsic tryptophan fluorescence. However, fluorescence specfroscopy can be used for compounds that do not possess intrinsic fluorescence.
5.6.3 Surface Plasmon Resonance ("SPR")
Surface plasmon resonance (SPR) can be used for determining kinetic rate constants and equilibrium constants for macromolecular interactions by following the association project in "real time" (Schuck, 1997, Annu. Rev. Biophys. Biomol. Struct. 26:541-566).
The principle of SPR is summarized by Xavier et al. (Trends Biotechnol., 2000, 18(8):349-356) as follows. Total internal reflection occurs at the boundary between two substances of different refractive index. The incident light's electromagnetic field penetrates beyond the interface as an evanescent wave, which extends a few hundred nanometers beyond the surface into the medium. Insertion of a thin gold foil at the interace produced SPR owing to the absoφtion of the energy from the evanescent wave by free elecfron clouds of the metal (plasmons). As a result of this absorbance, there is a drop in the intensity of the reflected light at a particular angle of incidence. The evanescent wave profile depends exquisitely on the refractive index of the medium it probes. Thus, the angle at which absoφtion occurs is very sensitive to the refractive changes in the external medium. All proteins and nucleic acids are known to change the refractive index of water by a similar amount per unit mass, inespective of their amino acid or nucleotide composition (the refractive index change is different for proteins and nucleic acids). When the protein or nucleic acid content of the layer at the sensor changes, the refractive index also changes. Typically, one member of a complex is immobilized in a dextran layer and then the other member is introduced into the solution, either in a flow cell (Biacore AB, Uppsala, Sweden) or a stined cuvette (Affinity Sensors, Santa Fe, New Mexico). It has been determined that there is a linear conelation between the surface concentration of protein or nucleic acid and the shift in resonance angle, which can be used to quantitate kinetic rate constants and/or the equilibrium constants. hi the present invention, the target RNA may be immobilized to the sensor surface through a sfreptavidin-biotin linkage, the linkage of which is disclosed by Crouch et al. (Methods Mol. Biol., 1999, 118:143-160). The RNA is biotinylated either during synthesis or post-synthetically via the conversion of the 3' terminal ribonucleoside of the RNA into a reactive free amino group or using a T7 polymerase incoφorated guanosine monophosphorothioate at the 5' end. SPR has been used to determine the stoichiometry and affinity of the interaction between the HIV Rev protein and the RRE (Van Ryk & Venkatesan, 1999, J. Biol. Chem. 274:17452-17463) and the aminoglycoside antibiotics with RRE and a model RNA derived from the 16S ribosomal A site, respectively (Hendrix et al, 1997, J. Am. Chem. Soc. 119:3641-3648; Wong et al, 1998, Chem. Biol. 5:397-406). In one embodiment of the present invention, the target nucleic acid can be immobilized to a sensor surface (e.g., by a sfreptavidin-biotin linkage) and SPR can be used to (a) determine whether the target RNA binds a compound and (b) further characterize the binding of the target nucleic acids of the present invention to a compound.
5.6.4 Mass Spectrometry An automated method for analyzing mass spectrometer data which can analyze complex mixtures containing many thousands of components and can conect for background noise, multiply charged peaks and atomic isotope peaks is described in U.S. Patent No. 6,147,344, which is hereby incoφorated by reference in its entirety. The system disclosed in U.S. Patent No. 6,147,344 is a method for analyzing mass specfrometer data in which a confrol sample measurement is performed providing a background noise check. The peak height and width values at each m/z ratio as a function of time are stored in a memory. A mass spectrometer operation on a material to be analyzed is performed and the peak height and width values at each m/z ratio versus time are stored in a second memory location. The mass spectrometer operation on the material to be analyzed is repeated a fixed number of times and the stored confrol sample values at each m/z ratio level at each time increment are subtracted from each conesponding one from the operational runs, thus producing a difference value at each mass ratio for each of the multiple runs at each time increment. If the MS value minus the background noise does not exceed a preset value, the m/z ratio data point is not recorded, thus eliminating background noise, chemical noise and false positive peaks from the mass spectrometer data. The stored data for each of the multiple runs is then compared to a predetermined value at each m/z ratio and the resultant series of peaks, which are now determined to be above the background, is stored in the m/z points in which the peaks are of significance. One possibility for the utilization of mass spectrometry in high throughput screening is the integration of SPR with mass spectrometry. Approaches that have been tried are direct analysis of the analyte retained on the sensor chip and mass spectrometry with the eluted analyte (Sonksen et al, 1998, Anal. Chem. 70:2731-2736; Nelson & Krone,
1999, J. Mol. Recog. 12:77-93). Further developments, especially in the interfacing of the sensor chip with the mass spectrometer and in reusing the sensor chip, are required to make
SPR combined with mass spectroscopy a high-throughput method for biomolecular interaction analysis and the screening of targets for small molecule inhibitors (Xavier et al,
2000, Trends Biotechnol. 18(8):349-356).
In one embodiment of the present invention, the target nucleic acid complexed to a compound can be determined by any of the mass spectrometry processed described supra. Furthermore, mass spectrometry can also be used to elucidate the structure of the compound.
5.6.5 Scintillation Proximity Assay ("SPA") Scintillation proximity assay ("SPA") is a method that can be used for screening small molecules that bind to the target RNAs. SPA would involve radiolabeling either the target RNA or the compound and then quantitating its binding to the other member to a bead or a surface impregnated with a scintillant (Cook, 1996, Drug Discov. Today 1 :287-294). Cunently, fluorescence-based techniques are prefened for high- throughput screening (Pope et al, 1999, Drug Discov. Today 4:350-362).
Screening for small molecules that inhibit Tat peptide:TAR RNA interaction has been performed with SPA, and inhibitors of the interaction were isolated and characterized (Mei et al, 1997, Bioorg. Med. Chem. 5:1173-1184; Mei et al, 1998, Biochemistry 37:14204-14212). A similar approach can be used to identify small molecules that directly bind to a preselected target RNA element in accordance with the invention can be utilized.
SPA can be adapted to high throughput screening by the availability of microplates, wherein the scintillant is directly incoφorated into the plastic of the microtiter wells (Nakayama et al, 1998, J. Biomol. Screening 3:43-48). Thus, one embodiment of the present invention comprises (a) labeling of the target nucleic acid with a radioactive or fluorescent label; (b) contacted the labeled nucleic acid with compounds, wherein each compound is in a microtiter well coated with scintillant and is tethered to the microtiter well; and (c) identifying and quantifying the compounds bound to the target nucleic acid with SPA, wherein the compound is identified by virtue of its location in the microplate.
5.6.6 Structure- Activity Relationships ("SAR") by NMR Spectroscopy
NMR spectroscopy is a valuable technique for identifying complexed target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects, and NMR-based approaches have been used in the identification of small molecule binders of protein drug targets (Xavier et al. , 2000, Trends Biotechnol. 18(8):349-356). The determination of structure-activity relationships ("SAR") by NMR is the first method for NMR described in which small molecules that bind adjacent subsites are identified by two-dimentional 'H-^N spectra of the target protein (Shuker et al, 1996, Science 274:1531-1534). The signal from the bound molecule is monitored by employing line broadening, fransfened NOEs and pulsed field gradient diffusion measurements (Moore, 1999, Curr. Opin. Biotechnol. 10:54-58). A strategy for lead generation by NMR using a library of small molecules has been recently described (Fejzo et al, 1999, Chem. Biol. 6:755-769). In one embodiment of the present invention, the target nucleic acid complexed to a compound can be determined by SAR by NMR. Furthermore, SAR by NMR can also be used to elucidate the structure of the compound.
5.6.7 Size Exclusion Chromatography In another embodiment of the present invention, size-exclusion chromatography is used to purify compounds that are bound to a target nucleic from a complex mixture of compounds. Size-exclusion chromatography separates molecules based on their size and uses gel-based media comprised of beads with specific size distributions. When applied to a column, this media settles into a tightly packed matrix and forms a complex array of pores. Separation is accomplished by the inclusion or exclusion of molecules by these pores based on molecular size. Small molecules are included into the pores and, consequently, their migration through the matrix is retarded due to the added distance they must travel before elution. Large molecules are excluded from the pores and migrate with the void volume when applied to the matrix, fri the present invention, a target nucleic acid is incubated with a mixture of compounds while free in solution and allowed to reach equilibrium. When applied to a size exclusion column, compounds free in solution are retained by the column, and compounds bound to the target nucleic acid are passed through the column. In a prefened embodiment, spin columns commonly used for "desalting" of nucleic acids will be employed to separate bound from unbound compounds (e.g. , Bio-Spin columns manufactured by BIO-RAD). In another embodiment, the size exclusion matrix is packed into multiwell plates to allow high throughput separation of mixtures (e.g., PLASMID 96-well SEC plates manufactured by Millipore).
5.6.8 Affinity Chromatography
In one embodiment of the present invention, affinity capture is used to purify compounds that are bound to a target nucleic acid labeled with an affinity tag from a complex mixture of compounds. To accomplish this, a target nucleic acid labeled with an affinity tag is incubated with a mixture of compounds while free in solution and then captured to a solid support once equilibrium has been established; alternatively, target nucleic acids labeled with an affinity tag can be captured to a solid support first and then allowed to reach equilibrium with a mixture of compounds.
The solid support is typically comprised of, but not limited to, cross-linked agarose beads that are coupled with a ligand for the affinity tag. Alternatively, the solid support may be a glass, silicon, metal, or carbon, plastic (polystyrene, polypropylene) surface with or without a self-assembled monolayer (SAM) either with a covalently attached ligand for the affinity tag, or with inherent affinity for the tag on the target nucleic acid.
Once the complex between the target nucleic acid and compound has reached equilibrium and has been captured, one skilled in the art will appreciate that the retention of bound compounds and removal of unbound compounds is facilitated by washing the solid support with large excesses of binding reaction buffer. Furthermore, retention of high affinity compounds and removal of low affinity compounds can be accomplished by a number of means that increase the stringency of washing; these means include, but are not limited to, increasing the number and duration of washes, raising the salt concentration of the wash buffer, addition of detergent or surfactant to the wash buffer, and addition of non-specific competitor to the wash buffer.
In one embodiment, the compounds themselves are detectably labeled with fluorescent dyes, radioactive isotopes, or nanoparticles. When the compounds are applied to the captured target nucleic acid in a spatially addressed fashion (e.g. , in separate wells of a 96-well microplate), binding between the compounds and the target nucleic acid can be determined by the presence of the detectable label on the compound using fluorescence.
Following the removal of unbound compounds, bound compounds with high affinity for the target nucleic acid can be eluted from the immobilized target nucleic acids and analyzed. The elution of compounds can be accomplished by any means that break the non-covalent interactions between the target nucleic acid and compound. Means for elution include, but are not limited to, changing the pH, changing the salt concentration, the application of organic solvents, and the application of molecules that compete with the bound ligand. In a prefened embodiment, the means employed for elution will release the compound from the target RNA, but will not effect the interaction between the affinity tag and the solid support, thereby achieving selective elution of compound. Moreover, a prefened embodiment will employ an elution buffer that is volatile to allow for subsequent concentration by lyophilization of the eluted compound (e.g., 0 M to 5 M ammonium acetate). In another embodiment of the invention, the target RNA can be labeled with biotin, an antigen, or a ligand. Library beads complexed to the target RNA can be separated from uncomplexed beads using affinity techniques designed to capture the labeled moiety on the target RNA. For example, a solid support, such as but not limited to, a column or a well in a microwell plate coated with avidin/streptavidin, an antibody to the antigen, or a receptor for the ligand can be used to capture or immobilize the labeled beads. Complexed RNA may or may not be irreversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead. Such linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an elecfrophile and a nucleophile, or alkylating reagents. See, e.g., International Patent Publication WO/0146461, the contents of which are hereby incoφorated by reference. The unbound library beads can be removed after the binding reaction by washing the solid phase. If the RNA is ineversibly bound to the bead, compounds can be isolated from the bead following destruction of the bound RNA by preferably, but not limited to, enzymatic or chemical (e.g., alkaline hydrolysis) degradation. The library beads bound to the solid phase can then be eluted with any solution that disrupts the binding between the labeled target RNA and the solid phase. Such solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art. h another embodiment, the compounds can be eluted from the solid phase by heat.
In one embodiment, the library of compounds can be prepared on magnetic beads, such as Dynabeads Streptavidin (Dynal Biotech, Oslo, Norway). The magnetic bead library can then be mixed with the labeled target RNA under conditions that allow binding to occur. The separation of the beads from unbound target RNA in the liquid phase can be accomplished using a magnet. After removal of the magnetic field, the bead complexed to the labeled RNA may be separated from uncomplexed library beads via the label used on the target RNA; e.g., biotinylated target RNA can be captured by avidin/sfreptavidin; target RNA labeled with antigen can be captured by the appropriate antibody; target RNA labeled with ligand can be captured using the appropriate immobilized receptor. The captured library bead can then be eluted with any solution that disrupts the binding between the labeled target RNA and the immobilized surface. Such solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art. Complexed RNA may or may not be ineversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead. Such linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an electrophile and a nucleophile, or alkylating reagents. See, e.g., International Patent Publication WO/0146461, the contents of which are hereby incoφorated by reference. If the RNA is ineversibly bound to the bead, compounds can be isolated from the bead following destruction of the bound RNA by enzymatic degradation including, but not limited to, ribonucleases A, U2, CL3, Tls Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following freatment with sodium hydroxide, hydrazine, piperidine formate, or dimethyl sulfate), or metal-assisted (e.g. nickel(ιι), cobalt(II), or iron(II)) oxidative cleavage. In another embodiment, the preselected target RNA can be labeled with a heavy metal tag and incubated with the library beads to allow binding of the compounds to the target RNA. The separation of the labeled beads from unlabeled beads can be accomplished using a magnetic field. After removal of the magnetic field, the compound can be eluted with any solution that disrupts the binding between the preselected target RNA and the compound. Such solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art. hi another embodiment, the compounds can be eluted from the solid phase by heat.
5.6.9 Nanoparticle Aggregation hi one embodiment of the present invention, both the target nucleic acid and the compounds are labeled with nanoparticles. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Methods for the attachment of nucleic acids and small molecules to nanoparticles are well know to one of skill in the art (reviewed in Niemeyer, 2001, Angew. Chem. Int. Ed. 40:4129-4158. The references cited therein are hereby incoφorated by reference in their entireties). In particular, if multiple copies of the target nucleic acid are attached to a single nanoparticle and multiple copies of a compound are attached to another nanoparticle, then interaction between the compound and target nucleic acid will induce aggregation of nanoparticles as described, for example, byMitchel et al. 1999, J. Am. Chem. Soc. 121:8122-8123. The aggregate can be detected by changes in absorbance or fluorescence spectra and physically separated from the unbound components through filtration or centrifugation.
5.6.10 Flow Cytometry In a prefened embodiment, the complexed and non-complexed target nucleic acids are separated by flow cytometry methods. Flow cytometers for sorting and examining biological cells are well known in the art; this technology can be applied to separate the labeled library beads from unlabeled beads. Known flow cytometers are described, for example, in U.S. Patent Nos. 4,347,935; 5,464,581; 5,483,469; 5,602,039; 5,643,796; and 6,211,477; the entire contents of which are incoφorated by reference herein. Other known flow cytometers are the FACS Vantage™ system manufactured by Becton Dickinson and Company, and the COP AS™ system manufactured by Union Biometrica.
A flow cytometer typically includes a sample reservoir for receiving a biological sample. The biological sample contains particles (hereinafter refened to as "beads") that are to be analyzed and sorted by the flow cytometer. Beads are transported from the sample reservoir at high speed (>100 beads/second) to a flow cell in a stream of liquid "sheath" fluid. High-frequency vibrations of a nozzle that directs the stream to the flow cell causes the stream to partition and form ordered droplets, with each droplet containing a single bead. Physical properties of beads can be measured as they intersect a laser beam within the cytometer flow cell. As beads move one by one through the intenogation point, they cause the laser light to scatter and fluorescent molecules on the labeled beads (i.e., beads complexed with labeled target RNA) become excited. Alternatively, if the target nucleic acid is labeled with an inorganic nanoparticle, the beads complexed with bound target nucleic acid can be distinguished not only by unique fluorescent properties but also on the basis of specfrometric properties (e.g. including but not limited to increased optical density due to the reduction of Ag+ ions in the presence of gold nanoparticles (see, e.g., Taton et al. Science 2000, 289: 1757-1760)).
5.6.11 Manual Batch In one embodiment, a for separating complexed beads. To explore a bead-based library within a reasonable time period, the primary screens should be operated with sufficient throughput. To do this, the target nucleic acid is labeled with a dye and then incubated with the combinatorial library. An advantage of such an assay is the fast identification of active library beads by color change. In the lower concenfrations of the dye-labeled target molecule, only those library beads that bind the target molecules most tightly are detected because of higher local concentration of the dye. When washed and plated into a liquid monolayer, colored beads are easily separated from non-colored beads with the aid of a dissecting microscope. One of the problems associated with this method could be the interaction between the red dye and library substrates. Control experiments using the dye alone and dye attached to mutant RNA sequences with the libraries are performed to eliminate this possibility.
5.6.12 Suspension of Beads in Electric Fields hi another embodiment of the invention, library beads bound to the target
RNA can be separated from unbound beads on the basis of the altered charge properties due to RNA binding, hi a prefened embodiment of this technique, beads are separated from unbound nucleic acid and suspended, preferably but not only, in the presence of an electric field where the bound RNA causes the beads bound to the target RNA to migrate toward the anode, or positive, end of the field.
Beads can be preferentially suspended in solution as a colloidal suspension with the aid of detergents or surfactants. Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1 -octane sulfonic acid, carboxymethylcellulose, canageenan, and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alky amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-l-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D-glucopyranoside, n-decyl-D-maltopyranoside, n-dodecyl -D-maltoside, n-octyl -D-glucopyranoside, sorbitan esters, n-tefradecyl -D-maltoside and tritons. Preferably, the detergent, if present, is a nonionic detergent. Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol.
Complexed RNA may or may not be ineversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead. Such linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an elecfrophile and a nucleophile, or alkylating reagents. If the RNA is ineversibly bound to the bead, compounds can be isolated from the bead following destruction of the bound RNA by enzymatic degradation including, but not limited to, ribonucleases A, U2, CL3, Tls Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following treatment with sodium hydroxide, hydrazine, piperidine formate, or dimethyl sulfate), or metal-assisted (e.g. nickel(Iι), cobalt(H), or iron(II)) oxidative cleavage.
5.6.13 Microwave Spectroscopy hi another embodiment, the complexed beads are separated from uncomplexed beads by microwave specfroscopy. For example, as described in U.S. Patent Nos. 6,395,480; 6,376,258; 6,368,795; 6,340,568; 6,338,968; 6,287,874; and 6,287,776 to Hefti, the disclosures of which are hereby incoφorated by reference, the unique dielectric properties of molecules and binding complexes, such as hybridization complexes formed between a nucleic acid probe and a nucleic acid target, molecular binding events, and protein/ligand complexes, result in varying microwave spectra which can be measured. The molecule's dielectric properties can be observed by coupling a test signal to the molecule and observing the resulting signal. When the test signal excites the molecule at a frequency within the molecule's dispersion regime, especially at a resonant frequency, the molecule will interact strongly with the signal, and the resulting signal will exhibit dramatic variations in its measured amplitude and phase, thereby generating a unique signal response. This response can be used to detect and identify the bound molecular structure, hi addition, because most molecules will exhibit different dispersion properties over the same or different frequency bands, each generates a unique signal response which can be used to identify the molecular structure.
5.7 Methods for Identifying or Characterizing the Compounds Bound to the Target Nucleic Acids
If the library comprises anays or microarrays of compounds, wherein each compound has an address or identifier, the compound can be deconvoluted, e.g., by cross- referencing the positive sample to original compound list that was applied to the individual test assays.
If the library is a peptide or nucleic acid library, the sequence of the compound can be determined by direct sequencing of the peptide or nucleic acid. Such methods are well known to one of skill in the art. A number of physico-chemical techniques can be used for the de novo characterization of compounds bound to the target.
5.7.1 Mass Spectrometry
Mass spectrometry (e.g., electrospray ionization ("ESI") and matrix-assisted laser desoφtion-ionization ("MALDI"), Fourier-transform ion cyclofron resonance ("FT- ICR")) can be used both for high-throughput screening of compounds that bind to a target RNA and elucidating the structure of the compound. Thus, one example of mass spectroscopy is that separation of a bound and unbound complex and compound structure elucidation can be carried out in a single step. MALDI uses a pulsed laser for desoφtion of the ions and a time-of- flight analyzer, and has been used for the detection of noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj et al, 1997, J. Biol. Chem. 272:32084-32091). However, covalent cross-linking between the target nucleic acid and the compound is required for detection, since a non-covalently bound complex may dissociate during the MALDI process.
ESI mass spectrometry ("ESI-MS") has been of greater utility for studying non-covalent molecular interactions because, unlike the MALDI process, ESI-MS generates molecular ions with little to no fragmentation (Xavier et al, 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been used to study the complexes formed by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et al, 1997, Anal. Chem. 69:5130-5135). Fourier-transform ion cyclofron resonance ("FT-ICR") mass spectrometry provides high-resolution spectra, isotope-resolved precursor ion selection, and accurate mass assignments (Xavier et al, 2000, Trends Biotechnol. 18(8):349-356). FT-ICR has been used to study the interaction of aminoglycoside antibiotics with cognate and non- cognate RNAs (Hofstadler et al, 1999, Anal. Chem. 71 :3436-3440; Griffey et al, 1999, Proc. Natl. Acad. Sci. USA 96:10129-10133). As true for all of the mass spectrometry methods discussed herein, FT-ICR does not require labeling of the target RNA or a compound.
An advantage of mass specfroscopy is not only the elucidation of the structure of the compound, but also the determination of the structure of the compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a compound that specifically binds to a preselected target RNA. In a specific embodiment, the structure of the compound is determined by time of flight mass spectroscopy ("TOF-MS"). hi time of flight methods of mass spectrometry, charged (ionized) molecules are produced in a vacuum and accelerated by an electric field into a time of flight tube or drift tube. The velocity to which the molecules may be accelerated is proportional to the accelerating potential, proportional to the charge of the molecule, and inversely proportional to the square of the mass of the molecule. The charged molecules travel, i.e., "drift" down the TOF tube to a detector. The time taken for the molecules to travel down the tube may be inteφreted as a measure of their molecular weight. Time-of-flight mass spectrometers have been developed for all of the major ionization techniques such as, but limited to, elecfron impact ("El"), infrared laser desoφtion ("IRLD"), plasma desoφtion ("PD"), fast atom bombardment ("FAB"), secondary ion mass spectrometry ("SIMS"), matrix-assisted laser desoφtion/ionization ("MALDI"), and electrospray ionization ("ESI").
5.7.2 Edman Degradation In an embodiment wherein the library is a peptide library or a derivative thereof, Edman degradation can be used to determine the structure of the compound. In one embodiment, a modified Edman degradation process is used to obtain compositional tags for proteins, which is described in U.S. Patent No. 6,277,644 to Farnsworth et al, which is hereby incoφorated by reference in its entirety. The Edman degradation chemistry is separated from amino acid analysis, circumventing the serial requirement of the conventional Edman process. Multiple cycles of coupling and cleavage are performed prior to extraction and compositional analysis of amino acids. The amino acid composition information is then used to search a database of known protein or DNA sequences to identify the sample protein. An apparatus for performing this method comprises a sample holder for holding the sample, a coupling agent supplier for supplying at least one coupling agent, a cleavage agent supplier for supplying a cleavage agent, a controller for directing the sequential supply of the coupling agents, cleavage agents, and other reagents necessary for performing the modified Edman degradation reactions, and an analyzer for analyzing amino acids. In another embodiment, the method can be automated as described in U.S.
Patent No. 5,565,171 to Dovichi et al, which is hereby incoφorated by reference in its entirety. The apparatus includes a continuous capillary connected between two valves that confrol fluid flow in the capillary. One part of the capillary forms a reaction chamber where the sample may be immobilized for subsequent reaction with reagents supplied through the valves. Another part of the capillary passes through or terminates in the detector portion of an analyzer such as an electrophoresis apparatus, liquid chromatographic apparatus or mass spectrometer. The apparatus may form a peptide or protein sequencer for carrying out the Edman degradation reaction and analyzing the reaction product produced by the reaction. The protein or peptide sequencer includes a reaction chamber for canying out coupling and cleavage on a peptide or protein to produce derivatized amino acid residue, a conversion chamber for carrying out conversion and producing a converted amino acid residue and an analyzer for identifying the converted amino acid residue. The reaction chamber may be contained within one arm of a capillary and the conversion chamber is located in another arm of the capillary. An electrophoresis length of capillary is directly capillary coupled to the conversion chamber to allow electrophoresis separation of the converted amino acid residue as it leaves the conversion chamber. Identification of the converted amino acid residue takes place at one end of the electrophoresis length of the capillary.
5.7.3 NMR Spectroscopy As described above, NMR specfroscopy is a technique for identifying binding sites in target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects. Examples of NMR that can be used for the invention include, but are not limited to, one-dimentional NMR, two- dimentional NMR, conelation specfroscopy ("COSY"), and nuclear Overhauser effect ("NOE") spectroscopy. Such methods of structure determination of compounds are well known to one of skill in the art.
Similar to mass specfroscopy, an advantage of NMR is the not only the elucidation of the structure of the compound, but also the determination of the structure of the compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a compound that specifically binds to a preselected target RNA.
5.7.4 Vibrational Spectroscopy
Vibrational specfroscopy (e.g. infrared (IR) specfroscopy or Raman specfroscopy) can be used for elucidating the structure of the compound on the isolated bead.
Infrared specfroscopy measures the frequencies of infrared light (wavelengths from 100 to 10,000 nm) absorbed by the compound as a result of excitation of vibrational modes according to quantum mechanical selection rules which require that absoφtion of light cause a change in the electric dipole moment of the molecule. The infrared spectrum of any molecule is a unique pattern of absoφtion wavelengths of varying intensity that can be considered as a molecular fmgeφrint to identify any compound. Infrared spectra can be measured in a scanning mode by measuring the absoφtion of individual frequencies of light, produced by a grating which separates frequencies from a mixed-frequency infrared light source, by the compound relative to a standard intensity (double-beam instrument) or pre-measured ('blank') intensity (single-beam instrument), hi a prefened embodiment, infrared spectra are measured in a pulsed mode (FT-IR) where a mixed beam, produced by an interferometer, of all infrared light frequencies is passed through or reflected off the compound. The resulting interferogram, which may or may not be added with the resulting interferograms from subsequent pulses to increase the signal strength while averaging random noise in the electronic signal, is mathematically transformed into a spectrum using Fourier Transform or Fast Fourier Transform algorithms. Raman specfroscopy measures the difference in frequency due to absoφtion of infrared frequencies of scattered visible or ultraviolet light relative to the incident beam. The incident monochromatic light beam, usually a single laser frequency, is not truly absorbed by the compound but interacts with the electric field transiently. Most of the light scattered off the sample with be unchanged (Rayleigh scattering) but a portion of the scatter light will have frequencies that are the sum or difference of the incident and molecular vibrational frequencies. The selection rules for Raman (inelastic) scattering require a change in polarizability of the molecule. While some vibrational transitions are observable in both infrared and Raman spectrometry, must are observable only with one or the other technique. The Raman spectrum of any molecule is a unique pattern of absoφtion wavelengths of varying intensity that can be considered as a molecular fingeφrint to identify any compound.
Raman spectra are measured by submitting monochromatic light to the sample, either passed through or preferably reflected off, filtering the Rayleigh scattered light, and detecting the frequency of the Raman scattered light. An improved Raman specfrometer is described in US Patent No. 5,786,893 to Fink et al. , which is hereby incoφorated by reference.
Vibrational microscopy can be measured in a spatially resolved fashion to address single beads by integration of a visible microscope and spectrometer. A microscopic infrared spectrometer is described in U.S. Patent No. 5,581,085 to Reffher et al , which is hereby incoφorated by reference in its entirety. An instrument that simultaneously performs a microscopic infrared and microscopic Raman analysis on a sample is described in U.S. Patent No. 5,841,139 to Sostek et al, which is hereby incoφorated by reference in its entirety. In one embodiment of the method, compounds are synthesized on polystyrene beads doped with chemically modified styrene monomers such that each resulting bead has a characteristic pattern of absoφtion lines in the vibrational (IR or Raman) spectrum, by methods including but not limited to those described by Fer iri et al, 2000, J. Am. Chem. Soc. 123:8151-8152. Using methods of split-pool synthesis familiar to one of skill in the art, the library of compounds is prepared so that the specfroscopic pattern of the bead identifies one of the components of the compound on the bead. Beads that have been separated according to their ability to bind target RNA can be identified by their vibrational spectrum. In one embodiment of the method, appropriate sorting and binning of the beads during synthesis then allows identification of one or more further components of the compound on any one bead. In another embodiment of the method, partial identification of the compound on a bead is possible through use of the specfroscopic pattern of the bead with or without the aid of further sorting during synthesis, followed by partial resynthesis of the possible compounds aided by doped beads and appropriate sorting during synthesis. h another embodiment, the JJ . or Raman spectra of compounds are examined while the compound is still on a bead, preferably, or after cleavage from bead, using methods including but not limited to photochemical, acid, or heat freatment. The compound can be identified by comparison of the IR or Raman spectral pattern to spectra previously acquired for each compound in the combinatorial library. In a specific embodiment, compounds can be identified by matching the IR or Raman spectra of a compound to a dataset of vibrational (IR or Raman) spectra previously acquired for each compound in the combinatorial library. By this method, the spectra of compounds with known structure are recorded so that comparison with these spectra can identify compounds again when isolated from RNA binding experiments. 5.7.5 Microwave Spectroscopy
In another embodiment, the microwave spectra of a compound can be used to elucidate the structure of the compound. For example, as described in U.S. Patent Nos. 6,395,480; 6,376,258; 6,368,795; 6,340,568; 6,338,968; 6,287,874; and 6,287,776 to Hefti, the disclosures of which are hereby incoφorated by reference, the unique dielectric properties of molecules and binding complexes, such as hybridization complexes formed between a nucleic acid probe and a nucleic acid target, molecular binding events, and protein/ligand complexes, result in varying microwave spectra which can be measured. The molecule's dielectric properties can be observed by coupling a test signal to the molecule and observing the resulting signal. When the test signal excites the molecule at a frequency within the molecule's dispersion regime, especially at a resonant frequency, the molecule will interact strongly with the signal, and the resulting signal will exhibit dramatic variations in its measured amplitude and phase, thereby generating a unique signal response. This response can be used to detect and identify the bound molecular structure. In addition, because most molecules will exhibit different dispersion properties over the same or different frequency bands, each generates a unique signal response which can be used to identify the molecular structure.
5.7.6 X-Ray Crystallography
X-ray crystallography can be used to elucidate the structure of a compound. For a review of x-ray crystallography see, e.g., Blundell et al. 2002, Nat Rev Drug Discov l(l):45-54. The first step in x-ray crystallography is the formation of crystals. The formation of crystals begins with the preparation of highly purified and soluble samples. The conditions for crystallization is then determined by optimizing several solution variables known to induce nucleation, such as pH, ionic strength, temperature, and specific concenfrations of organic additives, salts and detergent. Techniques for automating the crystallization process have been developed to automate the production of high-quality protein crystals. Once crystals have been formed, the crystals are harvested and prepared for data collection. The crystals are then analyzed by diffraction (such as multi-circle diffractometers, high-speed CCD detectors, and detector off-set). Generally, multiple crystals must be screened for structure determinations.
A number of methods can be used to acquire a diffraction patter so that a compound can be characterized. In one embodiment, an X-ray source is provided, for example, by a rotating anode generator producing an X-ray beam of a characteristic wavelength. There are a number of sources of X-ray radiation that may be used in the methods of the invention, including low and high intensity radiation. In one example, the tunable X-ray radiation is produced by a Synchrotron. In another embodiment, the primary X-ray beam is monochromated by either crystal monochromators or focusing minors and the beam is passed through a helium flushed collimator. In a prefened embodiment, the crystal is mounted on a pin on a goniometer head, that is mounted to a goniometer which allows to position the crystal in different orientations in the beam. The diffracted X-rays can be recorded using a number of techniques, including, but not limited to image plates, multiwire detectors or CCD cameras. In other embodiments, flash cooling, for example, of protein crystals, to cryogenic temperatures (~100 K) offers many advantages, the most significant of which is the elimination of radiation damage.
5.8 Naturally Occurring Genes with Premature Stop Codons: Examples of Disorders and Diseases
The invention provides for naturally occurring genes with premature stop codons to ascertain the effects of compounds on premature translation termination and/or nonsense-mediated mRNA decay. In general, the expression of the gene product, in particular, a full-length gene product, is indicative of the effect of the compounds on premature franslation termination and/or nonsense-mediated mRNA decay. hi a prefened embodiment, the naturally occurring genes with premature stop codons are genes that cause diseases which are due, in part, to the lack of expression of the gene resulting from the premature stop codon. Such diseases include, but are not limited to, cystic fibrosis, muscular dystrophy, heart disease (e.g., familial hypercholesterolemia), p53-associated cancers (e.g., lung, breast, colon, pancreatic, non- Hodgkin's lymphoma, ovarian, and esophageal cancer), colorectal carcinomas, neurofibromatosis, retinoblastoma, Wilm's tumor, retinitis pigmentosa, collagen disorders (e.g., osteogenesis imperfecta and cinhosis), Tay Sachs disease, blood disorders (e.g., hemophilia, von Willebrand disease, b-Thalassemia), kidney stones, ataxia-telangiectasia, lysosomal storage diseases, and tuberous sclerosis. Genes involved in the etiology of these diseases are discussed below.
The recognition of franslation termination signals is not necessarily limited to a simple trinucleotide stop codon, but is instead recognized by the sequences sunounding the stop codon in addition to the stop codon itself (see, e.g., Manuvakhova et al, 2000, RNA 6(7): 1044- 1055, which is hereby incoφorated by reference in its entirety). Thus, any genes containing particular tetranucleotide sequences at the stop codon, such as, but not limited to, UGAC, UAGU, UAGC, UAGG, UAAC, UAAU, UAAG, and UAAA, are candidates of naturally occurring genes with premature stop codons that are useful in the present invention. Human disease genes that contain these particular sequence motifs are sorted by chromosome is presented as an Example in Section 8.
5.8.1 Cystic Fibrosis Cystic fibrosis is caused by mutations in the cystic fibrosis conductance regulator ("CFTR") gene. Such mutations vary between populations and depend on a multitude of factors such as, but not limited to, ethnic background and geographic location. Nonsense mutations in the CFTR gene are expected to produce little or not CFTR chloride channels. Several nonsense mutations in the CFTR gene have been identified (see, e.g., Tzetis et al, 2001, Hum Genet. 109(6):592-601. Sfrandvik et al, 2001, Genet Test. 5(3):235-42; Feldmann et al, 2001, Hum Mutat. 17(4):356; Wilschanski et al, 2000, Am J Respir Crit Care Med. 161(3 Pt l):860-5; Castaldo et al, 1999, Hum Mutat. 14(3):272; Mitfre et al, 1999, Hum Mutat. 14(2):182; Mickle et al, 1998, Hum Mol Genet. 7(4):729-35; Casals et al, 1997, Hum Genet. 101(3):365-70; Mitfre et al, 1996, Hum Mutat. 8(4):392-3; Bonizzato et al, 1995, Hum Genet. 1995 Apr;95(4):397-402; Greil et al, 1995, Wien Klin Wochenschr. 107(15):464-9; Zielenski et al, 1995, Hum Mutat. 5(l):43-7; Dork et al, 1994, Hum Genet. 94(5):533-42; Balassopoulou et al, 1994, Hum Mol Genet. 3(10):1887-8; Ghanem et al, 1994, 21(2):434-6; Will et al, J Clin Invest. 1994 Apr;93(4): 1852-9; Hull et al, 1994, Genomics. 1994 Jan 15;19(2):362-4; Dork et al, 1994, Hum Genet. 93(l):67-73; Rolfini & Cabrini, 1993, J Clin Invest. 92(6):2683-7; Will et al, 1993, J Med Genet. 30(10):833-7; Bienvenu et al, 1993, J Med Genet. 30(7):621-2; Cheadle et al, 1993, Hum Mol Genet. 2(7):1067-8; Casals et al, 1993, Hum Genet. 91(l):66-70; Reiss et al, 1993, Hum Genet. 91(l):78-9; Chevalier-Porst et al, 1992, Hum Mol Genet. l(8);647-8; Hamosh et al, 1992, Hum Mol Genet. l(7):542-4; Gasparini et al, 1992, J Med Genet. 29(8):558-62; Fanen et al, 1992, Genomics. 13(3):770-6; Jones et al, 1992, Hum Mol Genet. l(l):ll-7; Ronchetto et al, 1992, Genomics. 12(2):417-8.; Macek et al, 1992, Hum Mutat. l(6):501-2; Shoshani et al, 1992, Am J Hum Genet. 50(l):222-8; Schloesser et al, 1991, J Med Genet. 28(12):878-80; Hamosh et al, 1991, J Clin Invest. 88(6):1880-5; Bal et al, 1991, J Med Genet. 28(10):715-7; Dork et al, 1991, Hum Genet. 87(4):441-6; Beaudet et al, 1991, Am J Hum Genet. 48(6):1213; Gasparini et al, 1991, Genomics. 10(l):193-200; Cutting et al, 1990, N Engl J Med. 1990, 323(24):1685-9; and Kerem et al, 1990, Proc Natl Acad Sci U S A. 87(21):8447-51, the disclosures of which are hereby incoφorated by reference in their entireties). Any CFTR gene encoding a premature franslation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
5.8.2 Muscular Dystrophy Muscular dystrophy is a genetic disease characterized by severe, progressive muscle wasting and weakness. Duchenne muscular dystrophy and Becker muscular dystrophy are generally caused by nonsense mutations of the dystrophin gene (see, e.g., Ken et al., 2001, Hum Genet. 109(4):402-7 and Wagner et al, 2001, Ann Neurol. 49(6):706-l 1). Nonsense mutations in other genes have also been implicated in other types of muscular dystrophy, such as, but not limited to, collagen genes in Ullrich congenital muscular dystrophy (see, e.g., Demir et al, 2002, Am J Hum Genet. 70(6): 1446-58), the emerin gene and lamins genes in Emery-Dreifuss muscular dystrophy (see, e.g., Holt et al., 2001, Biochem Biophys Res Comniun. 287(5):1129-33; Becane et al., 2000, Pacing Clin Elecfrophysiol. 23(11 Pt l):1661-6; and Bonne et al, 2000, Ann Neurol. 48(2):170-80.), the dysferlin gene in Miyoshi myopathy (see, e.g., Nakagawa et al., 2001, J Neurol Sci. 184(l):15-9), the plectin gene in late onset muscular dystrophy (see, e.g., Bauer et al., 2001, Am J Pathol. 158(2):617-25), the delta-sarcoglycan gene in recessive limb-girdle muscular dystrophy (see, e.g., Duggan et al, 1997, Neurogenetics. l(l):49-58), the laminina2-chain gene in congenital muscular dystrophy (see, e.g., Mendell et al., 1998, Hum Mutat.
12(2):135), the plectin gene in late-onset muscular dystrophy (see, e.g., Rouan et al., 2000, J Invest Dermatol. 114(2):381-7 and Kunz et al., 2000, J Invest Dermatol. 114(2):376-80), the myophosphorylase gene in McArdle's disease (see, e.g., Bruno et al, 1999, Neuromuscul Disord. 9(l):34-7), and the collagen VI in Bethlem myopathy (see, e.g., Lamande et al., 1998, Hum Mol Genet. 1998 Jun;7(6):981-9).
Several nonsense mutations in the dystrophin gene have been identified (see, e.g., Ken et al, 2001, Hum Genet. 109(4):402-7; Mendell et al, 2001, Neurology 57(4):645-50; Fajkusova et al, 2001, Neuromuscul Disord. ll(2):133-8; Ginjaar et al, 2000, Eur J Hum Genet. 8(10):793-6; Lu et al, 2000, J Cell Biol. 148(5):985-96; Tuffery-Giraud et al, 1999, Hum Mutat. 14(5):359-68; Fajkusova et al, 1998, J
Neurogenet. 12(3):183-9; Tuffery et al, 1998, Hum Genet. 102(3):334-42; Shiga et α/., 1997, J Clin Invest. 100(9):2204-10; Winnard et al, 1995, Am J Hum Genet. 56(l):158-66; Prior et al, 1994, Am J Med Genet. 50(l):68-73; Prior et al, 1993, Hum Mol Genet. 2(3):311-3; Prior et al, 1993, Hum Mutat. 2(3):192-5; Nigro et al., 1992, Hum Mol Genet. l(7):517-20; Worton, 1992, J Inherit Metab Dis. 15(4):539-50; and Buhnan et al, 1991, Genomics. 10(2):457-60; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in muscular dystrophy including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
5.8.3 Familial Hypercholesterolemia
Hypercholesterolemia, or high blood cholesterol, results from either the oveφroduction or the underutilization of low density lipoprotein ("LDL").
Hypercholesterolemia is caused by either the genetic disease familial hypercholesterolemia or the consumption of a high cholesterol diet. Nonsense mutations in the LDL receptor gene have been implicated in familial hypercholesterolemia. Several nonsense mutations in the LDL receptor gene have been identified (see, e.g., Lind et al, 2002, Atherosclerosis 163(2):399-407; Salazar et al, 2002, Hum Mutat. 19(4):462-3; Kuhrova et al, 2002, Hum Mutat. 19(1):80; Zakharova et al, 2001, Bioorg Khim. 27(5):393-6; Kuhrova et al, 2001, Hum Mutat. 18(3):253; Genschel et al, 2001, Hum Mutat. 17(4):354; Weiss et al, 2000, J Inherit Metab Dis. 23(8):778-90; Mozas et al, 2000, Hum Mutat. 15(5):483-4; Shin et al, 2000, Clin Genet. 57(3):225-9; Graham et al, 1999, Atherosclerosis 147(2):309-16; Hattori et al, 1999, Hum Mutat. 14(1):87; Cenano et al., 1998, Hum Mutat. 11(5):413; Rodningen et al, 1999, Hum Mutat. 13(3):186-96; Hirayama et al, 1998, J Hum Genet. 43(4):250-4; Lind et al, 1998, J Intern Med. 244(l):19-25; Thiart et al, 1997, Mol Cell Probes 11(6):457-8; Maruyama et al, 1995, Arterioscler Thromb Vase Biol. 15(10):1713-8; Koivisto et al, 1995, Am J Hum Genet. 57(4):789-97; Lombardi et al, 1995, J Lipid Res. 36(4):860-7; Leren et al, 1993, Hum Genet. 92(1):6-10; Landsberger et al., 1992, Am J Hum Genet. 50(2):427-33; Loux et al., 1992, Hum Mutat. 1992;l(4):325-32; Motulsky, 1989, Arteriosclerosis. 9(1 Suppl):I3-7; Lehrman et al, 1987, J Biol Chem. 262(1):401-10; and Lehrman et al, 1985, Cell 41(3):735-43; the disclosures of which are hereby incoφorated by reference in their entireties). Any LDL receptor gene encoding a premature translation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
5.8.4 p53-associated Cancers
Mutant forms of the p53 protein, which is thought to act as a negative regulator of cell proliferation, transformation, and tumorigenesis, have been implicated as a common genetic change characteristic of human cancer (see, e.g., Levine et al, 1991, Nature 351:453-456 and Hollstein et al, 1991, Science 253:49-53). p53 mutations have been implicated in cancers such as, but not limited to, lung cancer, breast cancer, colon cancer, pancreatic cancer, non-Hodgkin's lymphoma, ovarian cancer, and esophageal cancer.
Nonsense mutations have been identified in the p53 gene and have been implicated in cancer. Several nonsense mutations in the p53 gene have been identified (see, e.g, Masuda et al, 2000, Tokai J Exp Clin Med. 25(2):69-77; Oh et al, 2000, Mol Cells 10(3):275-80; Li et al, 2000, Lab Invest. 80(4):493-9; Yang et al, 1999, Zhonghua Zhong Liu Za Zhi 21(2):114-8; Finkelstein et al, 1998, Mol Diagn. 3(1):37-41; Kajiyama et al, 1998, Dis Esophagus. 11(4):279-83; Kawamura et al, 1999, Leuk Res. 23(2):115-26; Radig et al, 1998, Hum Pathol. 29(ll):1310-6; Schuyer et al, 1998, hit J Cancer 76(3):299-303; Wang-Gohrke et al, 1998, Oncol Rep. 5(l):65-8; Fulop et al, 1998, J Reprod Med. 43(2):119-27; Ninomiya et al, 1997, J Dermatol Sci. 14(3):173-8; Hsieh et al, 1996, Cancer Lett. 100(1-2):107-13; Rail et al, 1996, Pancreas. 12(l):10-7; Fukutomi et al, 1995, Nippon Rinsho. 53(11):2764-8; Frebourg et al., 1995, Am J Hum Genet. 56(3):608-15; Dove et al, 1995, Cancer Surv. 25:335-55; Adamson et al, 1995, Br J Haematol. 89(l):61-6; Grayson et al., 1994, Am J Pediati Hematol Oncol. 16(4):341-7; Lepelley et al, 199 , Leukemia. 8(8): 1342-9; Mclntyre et al, 199 , J Clin Oncol. 12(5):925-30; Horio et al, 1994, Oncogene. 9(4):1231-5; Nakamura et al, 1992, Jpn J Cancer Res. 83(12):1293-8; Davidoff et al., 1992, Oncogene. 7(l):127-33; and Ishioka et al, 1991, Biochem Biophys Res Commun. 177(3):901-6; the disclosures of which are hereby incoφorated by reference in their entireties). Any p53 gene encoding a premature franslation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
5.8.5 Colorectal Carcinomas Molecular genetic abnormalities resulting in colorectal carcinoma involve tumor-suppressor genes that undergo inactivation (such as, but not limited to, ape, mcc, dec, p53, and possibly genes on chromosomes 8p, lp, and 22q) and dominant-acting oncogenes (such, but not limited to, ras, src, and myc) (see, e.g., Hamilton, 1992, Cancer 70(5 Suppl):1216-21). Nonsense mutations in the adenomatous polyposis coli ("APC") gene and mismatch repair genes (such as, but not limited to, mlhl and msh2) have also been described. Nonsense mutations have been implicated in colorectal carcinomas (see, e.g., Viel et al, 1997, Genes Chromosomes Cancer. 18(1):8-18; Akiyama et al, 1996, Cancer 78(12):2478-84; Itoh & Imai , 1996, Hokkaido Igaku Zasshi 71(1):9-14; Kolodner et al, 1994, Genomics. 24(3):516-26; Ohue t β/., 1994, Cancer Res. 54(17):4798-804; and Yin et al, 1993, Gasfroenterology. 104(6): 1633-9; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature franslation codon implicated in colorectal carcinoma including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense- mediated mRNA decay.
5.8.6 Neurofibromatosis
Neurofibromatosis is an inherited disorder, which is commonly caused caused by mutations in the NF1 and NF2 tumor suppressor genes. It is characterized by multiple infracranial tumors including schwannomas, memngiomas, and ependymomas. Nonsense mutations in the NF1 and NF2 genes have been described. Nonsense mutations have been implicated in neurofibromatosis (see, e.g., Lamszus et al, 2001, hit J Cancer 91(6):803-8; Sestini et al, 2000, Hum Genet. 107(4): 366-71; Fukasawa et al, 2000, Jpn J Cancer Res. 91(12):1241-9; Park et al, 2000, J Hum Genet. 45(2):84-5; Ueki et al, 1999, Cancer Res. 59(23):5995-8; , 1999, Hokkaido Igaku Zasshi. 74(5):377-86; Buske et al, 1999, Am J Med Genet. 86(4):328-30; Harada et al, 1999, Surg Neurol. 51(5):528-35; Krkljus et al, 1998, Hum Mutat. 11(5):411; Klose et al, 1999, Am J Med Genet. 83(1):6-12; Park & Pivnick, 1998, J Med Genet. 35(10):813-20; Bahuau et al, 1998, Am J Med Genet. 75(3):265-72; Bijlsma et al, 1997, J Med Genet. 34(11):934-6; MacCollin et al, 1996, Ann Neurol. 40(3):440-5; Upadhyaya et al, 1996, Am J Med Genet. 67(4):421-3; Robinson et al, 1995, Hum Genet. 96(l):95-8.; Legius et al, 1995, J Med Genet. 32(4):316-9; von Deimling et al, 1995, Brain Pathol. 5(1):11-4; Dublin et al, 1995, Hum Mutat. 5(l):81-5; Legius et al, 1994, Genes Chromosomes Cancer. 10(4):250-5; Purandare et al, 1994, Hum Mol Genet. 3(7):1109-15; Shen & Upadhyaya, 1993, Hum Genet. 92(4):410-2; and Estivill et al, 1991, Hum Genet. 88(2):185-8; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in neurofibromatosis including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
5.8.7 Retinoblastoma
The retinoblastoma gene plays important roles in the genesis of human cancers. Several pieces of evidence have shown that the retinoblastoma protein has dual roles in gating cell cycle progression and promoting cellular differentiation (see, e.g., Lee & Lee, 1997, Gan To Kagaku Ryoho 24(11): 1368-80 for a review). Nonsense mutations in the RBI gene have been described. Nonsense mutations have been implicated in retinoblastoma (see, e.g., Klutz et al, 2002, Am J Hum Genet. 71(1): 174-9; Alonso et al., 2001, Hum Mutat. 17(5):412-22; Wong et al, 2000, Cancer Res. 60(21):6171-7; Harbour , 1998, Ophthalmology 105(8):1442-7; Fulop et al., 1998, J Reprod Med. 43(2):119-27; Onadim et al., 1997, Br J Cancer 76(11): 1405-9; Lohmann et al., 1997, Ophthalmologe 94(4):263-7; Cowell & Cragg, 1996, Eur J Cancer. 32A(10):1749-52; Lohmann et al., 1996, Am J Hum Genet. 58(5):940-9; Shapiro et al., 1995, Cancer Res. 55(24):6200-9; Huang et al., 1993, Cancer Res. 53(8): 1889-94; and Cheng & Haas, 1990, Mol Cell Biol.
10(10):5502-9; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in retinoblastoma including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
5.8.8 Wilm's Tumor
Wilm's tumor, or nephroblastoma, is an embryonal malignancy of the kidney that affects children. Nonsense mutations in the WT1 gene have been implicated in Wilm's tumor. Several nonsense mutations in the WT1 have been identified (see, e.g., Nakadate et al, 1999, Genes Chromosomes Cancer 25(l):26-32; Diller et al, 1998, J Clin Oncol.
16(ll):3634-40; Schumacher et al, 1997, Proc Natl Acad Sci U S A. 94(8):3972-7; Coppes et al, 1993, Proc Natl Acad Sci U S A. 90(4): 1416-9; and Little et al, 1992, Proc Natl Acad Sci U S A. 89(11):4791-5; the disclosures of which are hereby incoφorated by reference in their entireties). Any WT1 gene encoding a premature translation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
5.8.9 Retinitis Pigmentosa
Retimtis pigmentosa is a genetic disease in which affected individuals develop progressive degeneration of the rod and cone photoreceptors. Retinitis pigmentosa cannot be explained by a single genetic defect but instead the hereditary abenation responsible for triggering the onset of the disease is localized in different genes and at different sites within these genes (reviewed in, e.g., Kohler et al, 1997, Klin Monatsbl Augenheilkd 211(2):84-93). Nonsense mutations have been implicated in retinitis pigmentosa (see, e.g., Ching et al, 2002, Neurology 58(ll):1673-4; Zhang et al, 2002, Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 19(3):194-7; Zhang et al, 2002, Hum Mol Genet. 1;11(9):993-1003; Dietrich et al, 2002, Br J Ophthalmol. 86(3):328-32; Grayson et al, 2002, J Med Genet. 39(l):62-7; Liu et al, 2001, Zhonghua Yi Xue Za Zhi 81(2):71-2; Damji et al, 2001, Can J Ophthalmol. 36(5):252-9; Berson et al, 2001, Invest Ophthalmol Vis Sci. 42(10):2217-24; Chan et al, 2001, Br J Ophthalmol. 85(9):1046-8; Baum et al, 2001, Hum Mutat. 17(5):436; Mashima et al, 2001, Ophthalmic Genet. 22(l):43-7; Zwaenepoel et al, 2001, Hum Mutat. 2001;17(1):34-41; Bork et al, 2001, Am J Hum Genet. 68(l):26-37; Sharon et al, 2000, Invest Ophthalmol Vis Sci. 41(9):2712-21; Dreyer et al, 2000, Eur J Hum Genet. 8(7):500-6; Liu et al, 2000, Hum Mutat. 15(6):584; Wang et al, 1999, Exp Eye Res. 69(4):; Bowne et al, 1999, Hum Mol Genet. 8(ll):2121-8; Guillonneau et al, 1999, Hum Mol Genet. 8(8):1541-6; Dryja et al, 1999, Invest Ophthalmol Vis Sci. 40(8): 1859-65; Sullivan et al, 1999, Nat Genet. 22(3):255-9; Pierce et al, 1999, Nat Genet. 22(3):248-54; Janecke et al, 1999, Hum Mutat. 13(2):133-40; Cuevas et al, 1998, Mol Cell Probes 12(6):417-20; Schwahn et al, 1998, Nat Genet. 19(4):327-32; Buraczynska et al, 1997, Am J Hum Genet. 61(6): 1287-92; Meindl et al, 1996, Nat Genet. 13(l):35-42; Keen et al, 1996, Hum Mutat. 8(4):297-303; Dryja et al, 1995, Proc Natl Acad Sci U S A. 92(22):10177-81; Apfelstedt-Sylla et al, 1995, Br J Ophthalmol. 79(l):28-34; Bayes et al, 1995, Hum Mutat. 5(3):228-34; Shastry, 1994, Am J Med Genet. 52(4):467-74; Gal et al, 1994, Nat Genet. 7(l):64-8; Sargan et al, 1994, Gene Ther. 1 Suppl 1:S89; McLaughlin et al, 1993, Nat Genet. 4(2):130-4; Rosenfeld et al, 1992, Nat Genet. 1(3):209-13; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in retinitis pigmentosa including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
5.8.10 Osteogenesis Imperfecta
Osteogenesis imperfecta is a heterogeneous disorder of type I collagen resulting in varying degrees of severity and results from mutations the genes that encode the proalpha chains of type I collagen. Nonsense mutations have been implicated in the genes that encode the proalpha chains of type I collagen ("COLA1" genes) (see, e.g., Slayton et al, 2000, Matrix Biol. 19(l):l-9; Bateman et al, 1999, Hum Mutat. 13(4):311-7; and Willing et al, 1996, Am J Hum Genet. 59(4):799-809; the disclosures of which are hereby incoφorated by reference in their entireties). Any COLA1 gene encoding a premature translation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay. 5.8.11 Cirrhosis
Cinhosis generally refers to a chronic liver disease that is marked by replacement of normal tissue with fibrous tissue. The multidrug resistance 3 gene has been implicated in cinhosis, and nonsense mutations have been identified in this gene (see, e.g.,
Jacquemin t α ., 2001, Gasfroenterology. 2001 May;120(6): 1448-58; the disclosure of which is hereby incoφorated by reference in its entirety). Any gene involved in cinhosis encoding a premature franslation codon including, but not limited to, the nonsense mutations described in the reference cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay. 5.8.12 Tav Sachs Disease
Tay Sachs disease is an autosomal recessive disorder affecting the central nervous system. The disorder results from mutations in the gene encoding the alpha-subunit of beta-hexosaminidase A, a lysosomal enzyme composed of alpha and beta polypeptides. Several nonsense mutations have been implicated in Tay Sachs disease (see, e.g., Rajavel & Neufeld, 2001, Mol Cell Biol. 21(16):5512-9; Myerowitz, 1997, Hum
Mutat. 9(3):195-208; Akli et al, 1993, Hum Genet. 90(6):614-20; Mules et al, 1992, Am J Hum Genet. 50(4):834-41; and Akli et al, 1991, Genomics. ll(l):124-34; the disclosures of which are hereby incoφorated by reference in their entireties). Any hexosaminidase gene encoding a premature franslation codon including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense- mediated mRNA decay.
5.8.13 Blood Disorders
Hemophilia is caused by a deficiency in blood coagulation factors. Affected individuals are at risk for spontaneous bleeding into organs and treatment usually consists of administration of clotting factors. Hemophilia A is caused by a deficiency of blood coagulation factor VIII and hemophilia B is caused by a deficiency in blood coagulation factor IX. Nonsense mutations in the genes encoding coagulation factors have been implicated in hemophilia (see, e.g., Dansako et al, 2001, Ann Hematol. 80(5):292-4; Moller-Morlang et al, 1999, Hum Mutat. 13(6):504; Kamiya et al, 1998, Rinsho Ketsueki 39(5):402-4; Freson et al, 1998, Hum Mutat. 11(6):470-9; Kamiya et al, 1995, hit J Hematol. 62(3):175-81; Walter et al, 1994, Thromb Haemost. 72(l):74-7; Figueiredo, 1993, Braz J Med Biol Res. 26(9):919-31; Reiner & Thompson, 1992, Hum Genet.
89(l):88-94; Koeberl et al, 1990, Hum Genet. 84(5):387-90; Driscoll et al, 1989, Blood. 74(2):737-42; Chen et al, 1989, Am J Hum Genet. 44(4):567-9; Mikami et al, 1988, Jinrui Idengaku Zasshi. 33(4):409-15; Gitschier et al, 1988, Blood 72(3):1022-8; and Sommer et al, 1987, Mayo Clin Proc. 62(5): 387-404; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in hemophilia including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
Von Willebrand disease is a single-locus disorder resulting from a deficiency of von Willebrand factor: a multimeric multifunctional protein involved in platelet adhesion and platelet-to-platelet cohesion in high shear stress vessels, and in protecting from proteolysis and directing circulating factor VIII to the site of injury (reviewed in Rodeghiero, 2002, Haemophilia. 8(3):292-300). Nonsense mutations have implicated in von Willehbrand disease (see, e.g., Rodeghiero, 2002, Haemophilia. 8(3):292-300; Enayat et al, 2001, Blood 98(3):674-80; Surdhar et al, 2001, Blood 98(l):248-50; Casana et al, 2000, Br J Haematol. 111(2):552-5; Baronciani et al, 2000, Thromb Haemost. 84(4):536-40; Fellowes et al, 2000, Blood 96(2):773-5; Waseem et al, 1999, Thromb Haemost. 81(6):900-5; Mohlke et al, 1999, Int J Clin Lab Res. 29(l):l-7; Rieger et al, 1998, Thromb Haemost. 80(2):332-7; Kenny et al, 1998, Blood 92(l):175-83; Mazurier et al, 1998, Ann Genet. 41(l):34-43; Hagiwara et al, 1996, Thromb Haemost. 76(2):253-7; Mazurier & Meyer, 1996, Baillieres Clin Haematol. 9(2):229-41; Schneppenheim et al, 1994, Hum Genet. 94(6):640-52; Zhang et al, 1994, Genomics 21(l):188-93; Ginsburg & Sadler, 1993, Thromb Haemost. 69(2):177-84; Eikenboom et al, 1992, Thromb Haemost. 68(4):448-54; Zhang et al, 1992, Am J Hum Genet. 51(4):850-8; Zhang et al, 1992, Hum Mol Genet. l(l):61-2; and Mancuso et al, 1991, Biochemistry 30(l):253-69; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature franslation codon implicated in von Willebrand disease including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay. β thalassemia is caused by a deficiency in beta globin polypeptides which in turn causes a deficiency in hemoglobin production. Nonsense mutations have been implicated in b thalassemia (see, e.g., El-Latif et al, 2002, Hemoglobin 26(l):33-40; Sanguansermsri et al, 2001, Hemoglobin 25(l):19-27; Romao 2000, Blood 96(8):2895-901; Perea et al, 1999, Hemoglobin 23(3):231-7; Rhodes et al, 1999, Am J Med Sci. 317(5):341-5; Fonseca et al, 1998, Hemoglobin 22(3): 197-207; Gasperini et al, 1998, Am J Hematol. 1998 Jan;57(l):43-7; Galanello et al, 1997, Br J Haematol. 99(2):433-6; Pistidda et al, 1997, Eur J Haematol. 58(5):320-5; Oner et al, 1997, Br J Haematol. 96(2):229-34; Yasunaga et β/., 1995, Intern Med. 34(12): 1198-200; Molina et al, 1994, Sangre (Bare) 39(4):253-6; Chang et al, 1994, hit J Hematol. 59(4):267-72; Gilman et al, 1994, Am J Hematol. 45(3):265-7; Chan et al, 1993, Prenat Diagn. 13(10):977-82; George et al, 1993, Med J Malaysia 48(3):325-9; Divoky et al, 1993, Br J Haematol. 83(3):523-4; Fioretti et al, 1993, Hemoglobin 17(1):9-17; Rosatelli et al, 1992, Am J Hum Genet. 50(2):422-6; Moi et al, 1992, Blood 79(2):512-6; Loudianos et al, 1992, Hemoglobin 16(6):503-9; Fukumaki, 1991, Rinsho Ketsueki 32(6):587-91; Cao et al, 1991, Am J Pediati Hematol Oncol. 13(2):179-88; Galanello et al, 1990, Clin Genet. 38(5):327-31; Liu, 1990, Zhongguo Yi Xue Ke Xue Yuan Xue Bao 12(2):90-5; Aulehla-Scholz et al, 1990, Hum Genet. 84(2):195-7; Cao et al, 1990, Ann N Y Acad Sci. 612:215-25; Sanguansermsri et al, 1990, Hemoglobin 14(2):157-68; Galanello et al, 1989, Blood 74(2):823-7; Rosatelli et al, 1989, Blood 73(2):601-5; Galanello et al, 1989, Prog Clin Biol Res. 316B:113-21; Galanello et al, 1988, Am J Hematol. 29(2):63-6; Chan et al, 1988, Blood 72(4):1420-3; Atweh et al, 1988, J Clin Invest. 82(2):557-61; Masala et al, 1988, Hemoglobin 12(5-6):661-71; Pirasxu et al, 1987, Proc Natl Acad Sci U S A 84(9):2882-5; Kazazian et al, 1986, Am J Hum Genet. 38(6):860-7; Cao et al, 1986, Prenat Diagn. 6(3): 159-67; Cao et al, 1985, Ann N Y Acad Sci. 1985;445:380-92; Pirasxu et al, 1984, Science 223(4639):929-30; Pirastix et al, 1983, N Engl J Med. 309(5):284-7; Trecartin et al, 1981, J Clin Invest. 68(4):1012-7; and Liebhaber et al, 1981, Trans Assoc Am Physicians 94:88-96; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in b thalassemia including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay. 5.8.14 Kidney Stones
Kidney stones (nephrolithiasis), which affect 12% of males and 5% of females in the western world, are familial in 45% of patients and are most commonly associated with hypercalciuria (see, e.g., Lloyd et al, Nature 1996 Feb l;379(6564):445-9). Mutations of the renal-specific chloride channel gene are associated with hypercalciuric nephrolithiasis (kidney stones). Nonsense mutations have been implicated in kidney stones (see, e.g., Hoopes et al, 1998, Kidney hit. 54(3):698-705; Lloyd et al, 1997, Hum Mol Genet. 6(8):1233-9; Lloyd et al, 1996, Nature 379(6564):445-9; and Pras et al, 1995, Am J Hum Genet. 56(6): 1297-303; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in kidney stones including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature tianslation termination and/or nonsense-mediated mRNA decay.
5.8.15 Ataxia-Telangiectasia Ataxia-telangiectasia is characterized by increased sensitivity to ionizing radiation, increased incidence of cancer, and neurodegeneration and is generally caused by mutations in the ataxia-telangiectasia gene (see, e.g., Barlow et al, 1999, Proc Natl Acad Sci USA 96(17):9915-9). Nonsense mutations have been implicated in ataxia-telangiectasia (see, e.g., Camacho et al, 2002, Blood 99(l):238-44; Pitts et al, 2001, Hum Mol Genet. 10(11):1155-62; Laake et al, 2000, Hum Mutat. 16(3):232-46; Li & Swift, 2000, Am J Med Genet. 92(3):170-7; Teraoka et al, 1999, Am J Hum Genet. 64(6):1617-31; and Stoppa-Lyonnet et al, 1998, Blood 91(10):3920-6; the disclosures of which are hereby incoφorated by reference in their entireties). Any gene encoding a premature translation codon implicated in ataxia-telangiectasia including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense- mediated mRNA decay.
5.8.16 Lysosomal Storage Diseases
There are more than 40 individually recognized lysosomal storage disorders. Each disorder results from a deficiency in the activity of a specific enzyme, which impedes the lysosome from carrying out its normal degradative role. These include but are not limited to the diseases listed subsequently. Aspartylglucosaminuria is caused by a deficiency of N-aspartyl-beta-glucosaminidase (Fisher et al., 1990, FEBS Lett. 269:440-
444); cholesterol ester storage disease (Wolman disease) is caused by mutations in the LIP A gene (Fujiyama et al., 1996, Hum. Mutat. 8:377-380); mutations in the CTNS gene are associated with cystinosis (Town et al., 1998, Nature Genet. 18:319-324); mutations in a- galactosidase A are associated with Fabry disease (Eng et al.,1993, Pediat. Res. 33:128A; Sakuraba et al., 1990, Am. J. Hum. Genet. 47:784-789; Davies et al., 1993, Hum. Molec. Genet. 2:1051-1053; Miyamura et al., 1996, J. Clin. Invest. 98:1809-1817); fucosidosis is caused by mutations in the FUCA1 gene(Kretz et al., 1989, J. Molec. Neurosci. 1:177-180; Yang et al., 1992, Biochem. Biophys. Res. Commun. 189:1063-1068; Seo et al., 1993, Hum. Molec. Genet. 2:1205-1208); mucolipidosis type I results from mutations in the NEU1 gene (Bonten et al.,1996, Genes Dev. 10:3156-3169); mucolipidosis type IV results from mutations in theMCOLNl gene (Bargal et al., 2000, Nature Genet. 26: 120-123; Sun et al., 2000,Hum. Molec. Genet. 9:2471-2478); Mucopolysaccharidosis type I (Hurler syndrome) is caused by mutations in the IDUA gene (Scott et al., 1992, Genomics 13:1311- 1313;Bach et al., 1993, Am. J. Hum. Genet. 53:330-338); Mucopolysaccharidosis type II (Hunter syndrome) is caused by mutations in the IDS gene (Sukegawa et al., 1992, Biochem. Biophys. Res. Commun. 183:809-813; Bunge et al., 1992 Hum. Molec. Genet. 1:335-339; Flomen et al., 1992, Genomics 13:543-550); mucopolysaccharidosis type 25IIIB (Sanfilippo syndrome type A) is caused by mutations in the SGSH gene(Yogalingam et al., 2001, Hum. Mutat. 18:264-281); mucopolysaccharidosis type TUB (Sanfilippo syndrome) is caused by mutations in the NAGLU gene (Zhao et al., 1996, Proc. Nat. Acad. Sci. 93:6101- 6105; Zhao et al., 1995, Am. J. Hum. Genet. 57:A185); mucopolysaccharidosis type ITTD is caused by mutations in the glucosamine-6-sulfatase (G6S) gene (Robertson et al., 1988, Hum. Genet. 79:175-178); mucopolysaccharidosis type IVA (Morquio syndrome) is caused by mutations in the GALNS gene (Tomatsu et al., 1995, Am. J. Hum. Genet. 57:556-563; Tomatsu et al.,1995, Hum. Mutat. 6:195-196); mucopolysaccharidosis type VI (Maroteaux- Lamysyndrome) is caused by mutations in the ARSB gene (Litjens et al., 1992, Hum.
Mutat. 1:397-402; Isbrandt et al., 1996, Hum. Mutat. 7:361-363); mucopolysaccharidosis type VII (Sly syndrome) is caused by mutations in the beta-glucuronidase (GUSB) gene(Yamada et al., 1995, Hum. Molec. Genet. 4:651-655); mutations in CLN1 (PPT1) cause infantile neuronal ceroid lipofuscinosis (Das et al., 1998 J. Clin. Invest. 102:361-370; Mitchison et al., 1998, Hum. Molec. Genet. 7:291-297); late infantile type ceroid lipofuscinosis is caused by mutations in the CLN2 gene (Sleat et al., 1997, Science 277:1802-1805); juvenile neuronal ceroid lipofuscinosis (Batten disease) is caused bymutations in the CLN3 gene (Mole et al., 1999, Hum. Mutat. 14: 199-215); late infantileneuronal ceroid lipofuscinosis, Finnish variant, is caused by mutations in the CLN5 gene(Savukoski et al., 1998, Nature Genet. 19:286-288); late-infantile form of neuronal ceroid lipofuscinosis is caused by mutations in the CLN6 gene (Gao et al., 2002, Am. J.Hum. Genet. 70:324-335); Niemann-Pick disease is caused by mutations in the ASM gene (Takahashi et al., 1992, J. Biol. Chem. 267:12552-12558; types A and B) and theNPCl gene (Millat et al., 2001, Am. J. Hum. Genet. 68:1373-1385; type C); Kanzaki disease is caused by mutations in the NAGA gene (Keulemans et et al., 1996, J. Med.Genet. 33 :458- 464); Gaucher disease is caused by mutations in the GBA gene (Stone, et al., 1999, Europ. J. Hum. Genet. 7:505-509); Glycogen storage disease II is the prototypic lysosomal storage disease and is caused by mutations in the GAA gene(Becker et al., 1998, Am. J. Hum. Genet. 62:991-994); Krabbe disease is caused by mutations in the GALC gene (Sakai et al., 1994, Biochem. Biophys. Res. Commun. 198:485-491); Tay-Sachs disease is caused by mutations in the HEXA gene (Akli et al., 1991, Genomics 11:124-134; Mules et al., 1992, Am. J. Hum. Genet. 50: 834-841 ;Triggs-Raine et al., 1991, Am. J. Hum. Genet. 49:1041- 1054; Drucker et al., 1993, Hum. Mutat. 2:415-417; Shore et al., 1992, Hum. Mutat. 1:486- 490); mutations in the GM2Agene causes Tay-Sachs variant AB (Schepers et al., 1996, Am. J. Hum. Genet. 59:1048-1056; Chen et al., 1999, Am. J. Hum. Genet. 65:77-87); mutations in the HEXB gene cause Sandhoff disease (Zhang et al., 1994, Hum Mol Genet 3:139-145); alphamannosidosis type II is caused by mutations in the MAN2B1 gene (Gotoda et al., 1998, Am. J. Hum. Genet. 63:1015-1024; Autio et al., 1973, Acta Paediat. Scand. 62:555- 565); metachromatic leukodystrophy is caused by mutations in the ARSA gene(Gieselmann et al., 1994, Hum. Mutat. 4:233-242). Any gene containing a premature translation codon implicated in lysosomal storage disease disorders including, but not limited to, the nonsense mutations and genes described in the references cited above, can be used in the present invention to identify compounds that mediate premature franslation termination and/or nonsense-mediated mRNA decay.
5.8.17 Tuberous Sclerosis
Tuberous sclerosis complex (TSC) is a dominantly inherited disease characterized by the presence of hamartomata in multiple organ systems. The disease is caused bymutations in TSC1 (van Slegtenhorst et al, 1997 Science 277:805-808; Sato et al, 2002, J. Hum. Genet. 47:20-28) and/or TSC2 (Vrtel et al, 1996, J. Med. Genet. 33:47- 51; Wilson et al, 1996, Hum. Molec. Genet. 5:249-256; Au et al, 1998, Am. J.Hum.
Genet. 62:286-294; Verhoef et al, 1999, Europ. J. Pediat. 158:284-287;Carsillo et al, 2000, Proc. Nat. Acad. Sci. 97:6085-6090). Any gene containing a premature translation codon implicated in tuberous sclerosis including, but not limited to, the nonsense mutations described in the references cited above, can be used in the present invention to identify compounds that mediate premature translation termination and/or nonsense-mediated mRNA decay.
5.9 Secondary Biological Screens
5.9.1 In Vitro Assays The compounds identified in the nonsense suppression assay (for convenience refened to herein as a "lead" compound) can be tested for biological activity using host cells containing or engineered to contain the target RNA element coupled to a functional readout system.
5.9.1.1 Reporter Gene Assays The lead compound can be tested in a host cell engineered to contain the
RNA with a premature translation termination codon controlling the expression of a reporter gene. In this example, the lead compounds are assayed in the presence or absence of the RNA with the premature franslation termination codon. Compounds that modulate premature franslation termination and/or nonsense-mediated mRNA decay will result in increased expression of the full-length gene, i. e. , past the premature termination codon. Alternatively, a phenotypic or physiological readout can be used to assess activity of the target RNA with the premature franslation termination codon in the presence and absence of the lead compound, hi another embodiment of the invention, the compounds identified in the nonsense suppression assay (for convenience refened to herein as a "lead" compound) can also be tested for biological activity using an in vitro transcribed RNA from the gene with a premature franslation termination codon and subsequent in vitro translation of that RNA in a cell-free franslation extract. The activity of the lead compound in the in vitro translation mixture can be determined by any method that measures increased expression of the full-length gene, i.e., past the premature termination codon. For example, expression of a functional protein from the full-length gene (e.g. , a reporter gene) can be measured to determine the effect of the lead compound on premature franslation termination and/or nonsense-mediated mRNA decay in an in vitro system. Both the in vitro and in vivo nonsense suppression assays described in International Patent Publication No. WO 01/44516 and International Patent Application No. PCT/US03/19760, each of which is incoφorated by reference in its entirety.
5.9.1.1.1 Reporter Gene Constructs, Transfected Cells and Cell-Free Extracts
The invention provides for reporter genes to ascertain the effects of a compound on premature franslation termination and/or nonsense-mediated mRNA decay. In general, the level of expression and/or activity of a reporter gene product is indicative of the effect of the compound on premature franslation termination and/or nonsense-mediated mRNA decay.
The invention provides for specific vectors comprising a reporter gene operably linked to one or more regulatory elements and host cells transfected with the vectors. The invention also provides for the in vitro franslation of a reporter gene flanked by one or more regulatory elements. A reporter gene may or may not contain a premature stop codon depending on the assay conducted. Techniques for practicing this specific aspect of this invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, and recombinant DNA manipulation and production, which are routinely practiced by one of skill in the art. See, e.g., Sambrook, 1989, Molecular Cloning, A Laboratory Manual, Second Edition; DNA Cloning, Volumes I and II (Glover, Ed. 1985); Oligonucleotide Synthesis (Gait, Ed. 1984); Nucleic Acid Hybridization (Hames & Higgins, Eds. 1984); Transcription and Translation (Hames & Higgins, Eds. 1984); Animal Cell Culture (Freshney, Ed. 1986); Immobilized Cells and Enzymes (IRL Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); Gene Transfer Vectors for Mammalian Cells (Miller & Calos, Eds. 1987, Cold Spring Harbor Laboratory); Methods in Enzymology, Volumes 154 and 155 (Wu & Grossman, and Wu, Eds., respectively), (Mayer & Walker, Eds., 1987); hnmunochemical Methods in Cell and Molecular Biology (Academic Press, London, Scopes, 1987), Expression of Proteins in
Mammalian Cells Using Vaccinia Viral Vectors in Cunent Protocols in Molecular Biology, Volume 2 (Ausubel et al., Eds., 1991).
5.9.1.1.1.1 Reporter Genes
Any reporter gene well-known to one of skill in the art may be used in reporter gene constructs to ascertain the effect of a compound on premature franslation termination. Reporter genes refer to a nucleotide sequence encoding a protein, polypeptide or peptide that is readily detectable either by its presence or activity. Reporter genes may be obtained and the nucleotide sequence of the elements determined by any method well- known to one of skill in the art. The nucleotide sequence of a reporter gene can be obtained, e.g., from the literature or a database such as GenBank. Alternatively, a polynucleotide encoding a reporter gene may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular reporter gene is not available, but the sequence of the reporter gene is known, a nucleic acid encoding the reporter gene may be chemically synthesized or obtained from a suitable source (e.g., a cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the reporter gene) by PCR amplification. Once the nucleotide sequence of a reporter gene is determined, the nucleotide sequence of the reporter gene may be manipulated using methods well-known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al, eds., 1998, Cunent Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incoφorated by reference herein in their entireties), to generate reporter genes having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
In a specific embodiment, a reporter gene is any naturally-occurring gene with a premature stop codon. Genes with premature stop codons that are useful in the present invention include, but are not limited to, the genes described below, hi an alternative embodiment, a reporter gene is any gene that is not known in nature to contain a premature stop codon. Examples of reporter genes include, but are not limited to, luciferase (e.g., firefly luciferase, renilla luciferase, and click beetle luciferase), green fluorescent protein ("GFP") (e.g., green fluorescent protein, yellow fluorescent protein, red fluorescent protein, cyan fluorescent protein, and blue fluorescent protein), beta-galactosidase ("beta- gal"), beta-glucoronidase, beta-lactamase, chloramphemcol acetylfransferase ("CAT"), and alkaline phosphatase ("AP"). Alternatively, a reporter gene can also be a protein tag, such as, but not limited to, myc, His, FLAG, or GST, so that nonsense suppression will produce the peptide and the protein can be monitored by an ELISA, a western blot, or any other immunoassay to detect the protein tag. Such methods are well known to one of skill in the art. hi a prefened embodiment, the reporter gene is easily assayed and has an activity which is not normally found in the gene of interest. Table 27 below lists various reporter genes and the properties of the products of the reporter genes that can be assayed. In a prefened embodiment, a reporter gene utilized in the reporter constructs is easily assayed and has an activity which is not normally found in the cell or organism of interest.
TABLE 27: Reporter Genes and the Properties of the Reporter Gene Products
Reporter Gene Protein Activity & Measurement
CAT (chloramphemcol acetylfransferase) Transfers radioactive acetyl groups to chloramphemcol or detection by thin layer chromatography and autoradiography Reporter Gene Jfrotein Activity & Measurement
GAL (beta-galactosidase) Hydrolyzes colorless galactosides to yield colored products.
GUS (beta-glucuronidase) Hydrolyzes colorless glucuronides to yield colored products.
LUC (luciferase) Oxidizes luciferin, emitting photons
GFP (green fluorescent protein) Fluorescent protein without substrate
SEAP (secreted alkaline phosphatase) Luminescence reaction with suitable substrates or with substrates that generate chromophores
HRP (horseradish peroxidase) In the presence of hydrogen oxide, oxidation of 3,3',5,5'-tetramethylbenzidine to form a colored complex
AP (alkaline phosphatase) Luminescence reaction with suitable substrates or with substrates that generate chromophores
Described hereiribelow in further detailed are specific reporter genes and characteristics of those reporter genes.
Luciferase
Luciferases are enzymes that emit light in the presence of oxygen and a substrate (luciferin) and which have been used for real-time, low-light imaging of gene expression in cell cultures, individual cells, whole organisms, and transgenic organisms
(reviewed by Greer & Szalay, 2002, Luminescence 17(l):43-74).
As used herein, the term "luciferase" is intended to embrace all luciferases, or recombinant enzymes derived from luciferases which have luciferase activity. The luciferase genes from fireflies have been well characterized, for example, from the Photinus and Luciola species (see, e.g., International Patent Publication No. WO 95/25798 for
Photinus pyralis, European Patent Application No. EP 0 524448 Tor Luciola cruciata and
Luciola lateralis, andDevine et al., 1993, Biochim. Biophys. Acta 1173(2):121-132 for
Luciola mingrelica). Other eucaryotic luciferase genes include, but are not limited to, the click beetle (Photinus plagiophthalamus, see, e.g., Wood et al., 1989, Science 244:700-
702), the sea panzy (Renilla reniformis, see, e.g., Lorenz et al., 1991, Proc Natl Acad Sci U
S A 88(10):4438-4442), and the glow worm (Lampyris noctiluca, see e.g., Sula-Newby et al., 1996, Biochem J. 313:761-767). The click beetle is unusual in that different members of the species emit bioluminescence of different colors, which emit light at 546 nm (green), 560 nm (yellow-green), 578 nm (yellow) and 593 nm (orange) (see, e.g, U.S. Patent Nos.
6,475,719; 6,342,379; and 6,217,847, the disclosures of which are incoφorated by reference in their entireties). Bacterial luciferin-luciferase systems include, but are not limited to, the bacterial lux genes of tenestrial Photorhabdus luminescens (see, e.g., Manukhov et al., 2000, Genetika 36(3):322-30) and marine bacteria Vibrio fischeri and Vibrio harveyi (see, e.g., Miyamoto et al., 1988, J Biol Chem. 263 (26): 13393-9, and Cohn et al., 1983, Proc Natl Acad Sci USA., 80(1): 120-3, respectively). The luciferases encompassed by the present invention also includes the mutant luciferases described in U.S. Patent No. 6,265,177 to Squinell et al, which is hereby incoφorated by reference in its entirety. hi a specific embodiment, the luciferase is a firefly luciferase, a renilla luciferase, or a click beetle luciferase, as described in any one of the references listed supra, the disclosures of which are incoφorated by reference in their entireties. Green Fluorescent Protein
Green fluorescent protein ("GFP") is a 238 amino acid protein with amino acid residues 65 to 67 involved in the formation of the chromophore which does not require additional substrates or cofactors to fluoresce (see, e.g., Prasher et al., 1992, Gene 111:229- 233; Yang et al., 1996, Nature Biotechnol. 14:1252-1256; and Cody et al., 1993, Biochemistry 32:1212-1218).
As used herein, the term "green fluorescent protein" or "GFP" is intended to embrace all GFPs (including the various forms of GFPs which exhibit colors other than green), or recombinant enzymes derived from GFPs which have GFP activity. In a prefened embodiment, GFP includes green fluorescent protein, yellow fluorescent protein, red fluorescent protein, cyan fluorescent protein, and blue fluorescent protein. The native gene for GFP was cloned from the bioluminescent jellyfish Aequorea victoria (see, e.g., Morin et al., 1972, J. Cell Physiol. 77:313-318). Wild type GFP has a major excitation peak at 395 nm and a minor excitation peak at 470 nm. The absoφtion peak at 470 nm allows the monitoring of GFP levels using standard fluorescein isothiocyanate (FITC) filter sets. Mutants of the GFP gene have been found useful to enhance expression and to modify excitation and fluorescence. For example, mutant GFPs with alanine, glycine, isoleucine, or threonine substituted for serine at position 65 result in mutant GFPs with shifts in excitation maxima and greater fluorescence than wild type protein when excited at 488 nm (see, e.g., Heim et al., 1995, Nature 373:663-664; U.S. Patent No. 5,625,048; Delagrave et al., 1995, Biotechnology 13:151-154; Cormack et al., 1996, Gene 173:33-38; and Cramer et al, 1996, Nature Biotechnol. 14:315-319). The ability to excite GFP at 488 nm permits the use of GFP with standard fluorescence activated cell sorting ("FACS") equipment. In another embodiment, GFPs are isolated from organisms other than the jellyfish, such as, but not limited to, the sea pansy, Renilla reriformis. Techniques for labeling cells with GFP in general are described in U.S. Patent Nos. 5,491,084 and 5,804,387, which are incoφorated by reference in their entireties; Chalfie et al., 1994, Science 263:802-805; Heim et al., 1994, Proc. Natl. Acad. Sci. USA 91:12501-12504; Morise et al., 1974, Biochemistry 13:2656-2662; Ward et al., 1980, Photochem. Photobiol. 31:611-615; Rizzuto et al., 1995, Cun. Biology 5:635-642; an Kaether & Gerdes, 1995, FEBS Lett 369:267-271. The expression of GFPs inE. coli and C. elegans are described in U.S. Patent No. 6,251,384 to Tan et al., which is incoφorated by reference in its entirety. The expression of GFP in plant cells is discussed in Hu & Cheng, 1995, FΕBS Lett 369:331-33, and GFP expression in Drosophila is described in Davis et al., 1995, Dev. Biology 170:726-729.
Beta Galactosidase
Beta galactosidase ("beta-gal") is an enzyme that catalyzes the hydrolysis of beta-galactosides, including lactose, and the galactoside analogs o-nifrophenyl-beta-D- galactopyranoside ("ONPG") and chlorophenol red-beta-D-galactopyranoside ("CPRG") (see, e.g., Nielsen et al, 1983 Proc Natl Acad Sci USA 80(17):5198-5202; Εustice et al, 1991, Biotechniques 11:739-742; and Henderson et al., 1986, Clin. Chem. 32:1637-1641). The beta-gal gene functions well as a reporter gene because the protein product is extremely stable, resistant to proteolytic degradation in cellular lysates, and easily assayed. When ONPG is used as the substrate, beta-gal activity can be quantitated with a spectrophotometer or microplate reader.
As used herein, the term "beta galactosidase" or "beta-gal" is intended to embrace all beta-gals, including lacZ gene products, or recombinant enzymes derived from beta-gals which have beta-gal activity. The beta-gal gene functions well as a reporter gene because the protein product is extremely stable, resistant to proteolytic degradation in cellular lysates, and easily assayed. In an embodiment where ONPG is the substrate, beta- gal activity can be quantitated with a spectrophotometer or microplate reader to determine the amount of ONPG converted at 420 nm. In an embodiment when CPRG is the substrate, beta-gal activity can be quantitated with a spectrophotometer or microplate reader to determine the amount of CPRG converted at 570 to 595 nm. hi yet another embodiment, the beta-gal activity can be visually ascertained by plating bacterial cells transformed with a beta-gal construct onto plates containing Xgal and TPTG. Bacterial colonies that are dark blue indicate the presence of high beta-gal activity and colonies that are varying shades of blue indicate varying levels of beta-gal activity. Beta-Glucuronidase
Beta-glucuronidase ("GUS") catalyzes the hydrolysis of a very wide variety of beta-glucuronides, and, with much lower efficiency, hydrolyzes some beta- galacturonides. GUS is very stable, will tolerate many detergents and widely varying ionic conditions, has no cofactors, nor any ionic requirements, can be assayed at any physiological pH, with an optimum between 5.0 and 7.8, and is reasonably resistant to thermal inactivation (see, e.g., U.S. Patent No. 5,268,463, which is incoφorated by reference in its entirety).
In one embodiment, the GUS is derived from the Esherichia coli beta- glucuronidase gene. In alternate embodiments of the invention, the beta-glucuronidase encoding nucleic acid is homologous to the E. coli beta-glucuronidase gene and/or may be derived from another organism or species.
GUS activity can be assayed either by fluorescence or spectrometry, or any other method described in U.S. Patent No. 5,268,463, the disclosure of which is incoφorated by reference in its entirety. For a fluorescent assay, 4- trifluoromethylumbelliferyl beta-D-glucuronide is a very sensitive substrate for GUS. The fluorescence maximum is close to 500 nm~bluish green, where very few plant compounds fluoresce or absorb. 4-trifluoromethylumbelliferyl beta-D-glucuronide also fluoresces much more strongly near neutral pH, allowing continuous assays to be performed more readily than with MUG. 4-trifluoromethylumbelliferyl beta-D-glucuronide can be used as a fluorescent indicator in vivo. The spectrophotometric assay is very straightforward and moderately sensitive (Jefferson et al., 1986, Proc. Natl. Acad. Sci. USA 86:8447-8451). A prefened substrate for spectrophotometric measurement is p-nifrophenyl beta-D- glucuronide, which when cleaved by GUS releases the chromophore p-nifrophenol. At a pH greater than its pKa (around 7.15) the ionized chromophore absorbs light at 400-420 nm, giving a yellow color.
Beta-Lactamases
Beta-lactamases are nearly optimal enzymes in respect to their almost diffusion-controlled catalysis of beta-lactam hydrolysis, making them suited to the task of an intracellular reporter enzyme (see, e.g., Christensen et al., 1990, Biochem. J. 266: 853- 861). They cleave the beta-lactam ring of beta-lactam antibiotics, such as penicillins and cephalosporins, generating new charged moieties in the process (see, e.g., O'Callaghan et al., 1968, Antimicrob. Agents. Chemother. 8: 57-63 and Sfratton, 1988, J. Antimicrob. Chemother. 22, Suppl. A: 23-35). A large number of beta-lactamases have been isolated and characterized, all of which would be suitable for use in accordance with the present invention (see, e.g., Richmond & Sykes, 1978, Adv.Microb.Physiol. 9:31-88 and Ambler, 1980, Phil. Trans. R. Soc. Lond. [Ser.B.] 289: 321-331, the disclosures of which are incoφorated by reference in their entireties). The coding region of an exemplary beta-lactamase employed has been described in U.S. Patent No. 6,472,205, Kadonaga et al., 1984, J.Biol.Chem. 259: 2149- 2154, and Sutcliffe, 1978, Proc. Natl. Acad. Sci. USA 75: 3737-3741, the disclosures of which re incoφorated by reference in their entireties. As would be readily apparent to those skilled in the field, this and other comparable sequences for peptides having beta-lactamase activity would be equally suitable for use in accordance with the present invention. The combination of a fluorogenic substrate described in U.S. Patent Nos. 6,472,205, 5,955,604, and 5,741,657, the disclosures of which are incoφorated by reference in their entireties, and a suitable beta-lactamase can be employed in a wide variety of different assay systems, such as are described in U.S. Patent No. 4,740,459, which is hereby incoφorated by reference in its entirety.
Chloramphenicol Acetyltransferase
Chloramphemcol acetyl fransferase ("CAT") is commonly used as a reporter gene in mammalian cell systems because mammalian cells do not have detectable levels of CAT activity. The assay for CAT involves incubating cellular extracts with radiolabeled chloramphenicol and appropriate co-factors, separating the starting materials from the product by, for example, thin layer chromatography ("TLC"), followed by scintillation counting (see, e.g., U.S. Patent No. 5,726,041, which is hereby incoφorated by reference in its entirety).
As used herein, the term "chloramphenicol acetyltransferase" or "CAT" is intended to embrace all CATs, or recombinant enzymes derived from CAT which have CAT activity. While it is preferable that a reporter system which does not require cell processing, radioisotopes, and chromatographic separations would be more amenable to high through-put screening, CAT as a reporter gene may be preferable in situations when stability of the reporter gene is important. For example, the CAT reporter protein has an in vivo half life of about 50 hours, which is advantageous when an accumulative versus a dynamic change type of result is desired.
Secreted Alkaline Phosphatase The secreted alkaline phosphatase ("SEAP") enzyme is a truncated form of alkaline phosphatase, in which the cleavage of the transmembrane domain of the protein allows it to be secreted from the cells into the sunounding media. In a prefened embodiment, the alkaline phosphatase is isolated from human placenta. As used herein, the term "secreted alkaline phosphatase" or "SEAP" is intended to embrace all SEAP or recombinant enzymes derived from SEAP which have alkaline phosphatase activity. SEAP activity can be detected by a variety of methods including, but not limited to, measurement of catalysis of a fluorescent substrate, immunoprecipitation, HPLC, and radiometric detection. The luminescent method is prefened due to its increased sensitivity over calorimetric detection methods. The advantages of using SEAP is that a cell lysis step is not required since the SEAP protein is secreted out of the cell, which facilitates the automation of sampling and assay procedures. A cell-based assay using SEAP for use in cell-based assessment of inhibitors of the Hepatitis C virus protease is described in U.S. Patent No. 6,280,940 to Potts et al. which is hereby incoφorated by reference in its entirety.
5.9.1.1.1.2 Stop Codons
The present invention provides for methods for screening and identifying compounds that modulate premature translation termination and/or nonsense-mediated mRNA decay. A reporter gene may be engineered to contain a premature stop codon or may naturally contain a premature stop codon. Alternatively, a protein, polypeptide or peptide that regulates (directly or indirectly) the expression of a reporter gene may be engineered to contain or may naturally contain a premature stop codon. The premature stop codon may any one of the stop codons known in the art including UAG, UAA and UGA. In a specific embodiment, a reporter gene contains or is engineered to contain the premature stop codon UAG. In another embodiment, a reporter gene contains or is engineered to contain the premature stop codon UGA.
In a particular embodiment, a reporter gene contains or is engineered to contain two or more stop codons. In accordance with this embodiment, the stop codons are preferably at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 75 nucleotides or at least 100 nucleotides apart from each other. Further, in accordance with this embodiment, at least one of the stop codons is preferably UAG or UGA. In a specific embodiment, a reporter gene contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides from the start codon in the coding sequence. In another embodiment, a reporter gene contains or is engineered to contain a premature stop codon at least 15 nucleotides, preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides from the native stop codon in the coding sequence of the full-length reporter gene product or protein, polypeptide or peptide. In another embodiment, a reporter gene contains or is engineered to contain a premature stop codon at least 15 nucleotides (preferably at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides or at least 75 nucleotides) from the start codon in the coding sequence and at least 15 nucleotides (preferably at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150, at least 175 nucleotides or at least 200 nucleotides) from the native stop codon in the coding sequence of the full-length reporter gene product or protein, polypeptide or peptide. In accordance with these embodiments, the premature stop codon is preferably UAG or UGA. The premature translation stop codon can be produced by in vitro mutagenesis techniques such as, but not limited to, polymerase chain reaction ("PCR"), linker insertion, oligonucleotide-mediated mutagenesis, and random chemical mutagenesis.
5.9.1.1.1.3 Vectors
The nucleotide sequence encoding for a protein, polypeptide or peptide (e.g., a reporter gene), can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and franslation of the inserted protein- coding sequence. The necessary transcriptional and translational elements can also be supplied by the protein, polypeptide or peptide. The regulatory regions and enhancer elements can be of a variety of origins, both natural and synthetic. In a specific embodiment, a reporter gene is operably linked to regulatory element that is responsive to a regulatory protein whose expression is dependent upon the suppression of a premature stop codon.
A variety of host-vector systems may be utilized to express a protein, polypeptide or peptide. These include, but are not limited to, mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA; and stable cell lines generated by transformation using a selectable marker. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable tianscription and translation elements may be used.
Any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric nucleic acid consisting of appropriate transcriptional/translational confrol signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of a first nucleic acid sequence encoding a protein, polypeptide or peptide, such as a reporter gene, may be regulated by a second nucleic acid sequence so that the first nucleic acid sequence is expressed in a host transformed with the second nucleic acid sequence. For example, expression of a nucleic acid sequence encoding a protein, polypeptide or peptide, such as a reporter gene, may be controlled by any promoter/enhancer element known in the art, such as a constitutive promoter, a tissue-specific promoter, or an inducible promoter. Specific examples of promoters which may be used to control gene expression include, but are not limited to, the SV40 early promoter region (Bernoist & Chambon, 1981, Nature 290:304- 310), the promoter contained in the 3 ' long terminal repeat of Rous sarcoma virus
(Yamamoto et al., 1980, Cell 22:787-797), the heφes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42); prokaryotic expression vectors such as the /3-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer et al, 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; plant expression vectors comprising the nopaline synthetase promoter region (Henera-Esfrella et al., Nature 303:209-213) or the cauliflower mosaic virus 35S RNA promoter (Gardner, et al., 1981, Nucl. Acids Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Henera-Esfrella et al.,
1984, Nature 310:115-120); promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control region which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene confrol region which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus confrol region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al., 1987, Genes and Devel. 1:268-276), alpha-fetoprotein gene confrol region which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58; alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al., 1987, Genes and Devel. 1:161-171), beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94; myelin basic protein gene confrol region which is active in ohgodendrocyte cells in the brain (Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene confrol region which is active in skeletal muscle (Sani, 1985, Nature 314:283- 286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al., 1986, Science 234:1372-1378). hi a specific embodiment, a vector is used that comprises a promoter operably linked to a reporter gene, one or more origins of replication, and, optionally, one or more selectable markers (e.g., an antibiotic resistance gene), hi a prefened embodiment, the vectors are CMV vectors, T7 vectors, lac vectors, pCEP4 vectors, 5.0/F vectors, or vectors with a tetracycline-regulated promoter (e.g., pcDNA™5/FRT/TO from Invitrogen). Some vectors may be obtained commercially. Non-limiting examples of useful vectors are described in Appendix 5 of Cunent Protocols in Molecular Biology, 1988, ed. Ausubel et al., Greene Publish. Assoc. & Wiley friterscience, which is incoφorated herein by reference; and the catalogs of commercial suppliers such as Clonteeh Laboratories, Stratagene Inc., and Invitrogen, Inc.
Expression vectors containing a construct of the present invention can be identified by the following general approaches: (a) nucleic acid hybridization, (b) presence or absence of "marker" nucleic acid functions, (c) expression of inserted sequences, and (d) sequencing. In the first approach, the presence of a particular nucleic acid sequence inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to the inserted nucleic acid sequence. In the second approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "marker" nucleic acid functions (e.g., thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of the nucleic acid sequence of interest in the vector. For example, if the nucleic acid sequence of interest is inserted within the marker nucleic acid sequence of the vector, recombinants containing the insert can be identified by the absence of the marker nucleic acid function. In the third approach, recombinant expression vectors can be identified by assaying the product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the particular nucleic acid sequence.
In a prefened embodiment, nucleic acid sequences encoding proteins, polypeptides or peptides are cloned into stable cell line expression vectors. In a prefened embodiment, the stable cell line expression vector contains a site specific genomic integration site. In another prefened embodiment, the reporter gene construct is cloned into an episomal mammalian expression vector.
5.9.1.1.1.4 Transfection
Once a vector encoding the appropriate gene has been synthesized, a host cell is transformed or transfected with the vector of interest. The use of stable fransformants is prefened. In a prefened embodiment, the host cell is a mammalian cell, hi a more prefened embodiment, the host cell is a human cell. In another embodiment, the host cells are primary cells isolated from a tissue or other biological sample of interest. Host cells that can be used in the methods of the present invention include, but are not limited to, hybridomas, pre-B cells, 293 cells, 293T cells, HeLa cells, HepG2 cells, K562 cells, 3T3 cells, hi another prefened embodiment, the host cells are derived from tissue specific to the nucleic acid sequence encoding a protein, polypeptide or peptide. hi another preferred embodiment, the host cells are immortalized cell lines derived from a source, e.g., a tissue. Other host cells that can be used in the present invention include, but are not limited to, bacterial cells, yeast cells, virally-infected cells, or plant cells.
Prefened mammalian host cells include but are not limited to those derived from humans, monkeys and rodents, (see, for example, Kriegler M. in "Gene Transfer and Expression: A Laboratory Manual", New York, Freeman & Co. 1990), such as monkey kidney cell line transformed by SV40 (COS-7, ATCC Accession No. CRL 1651); human embryonic kidney cell lines (293, 293-EBNA, or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol., 36:59, 1977; baby hamster kidney cells (BHK, ATCC Accession No. CCL 10); Chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chasin. Proc. Natl. Acad. Sci. 77; 4216, 1980); mouse sertoli cells (Mather, Biol. Reprod. 23:243-251, 1980); mouse fibroblast cells (NTH-3T3), monkey kidney cells (CVI ATCC Accession No. CCL 70); african green monkey kidney cells (VERO-76, ATCC Accession No. CRL-1587); human cervical carcinoma cells (HELA, ATCC Accession No. CCL 2); canine kidney cells (MDCK, ATCC Accession No. CCL 34); buffalo rat liver cells (BRL 3A, ATCC Accession No. CRL 1442); human lung cells (W138, ATCC Accession No. CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor cells (MMT 060562, ATCC Accession No. CCL51). Other useful eukaryotic host- vector system may include yeast and insect systems. In yeast, a number of vectors containing constitutive or inducible promoters may be used with Saccharomyces cerevisiae (baker's yeast), Schizosaccharomyces pombe (fission yeast), Pichia pastoris, and Hansenula polymorpha (methylotropic yeasts). For a review see, Cunent Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C, Ch. 3; and Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al., Cold Spring Harbor Press, Vols. I and II.
Standard methods of introducing a nucleic acid sequence of interest into host cells can be used. Transformation may be by any known method for introducing polynucleotides into a host cell, including, for example packaging the polynucleotide in a virus and transducing a host cell with the virus, and by direct uptake of the polynucleotide. The transformation procedure used depends upon the host to be transformed. Mammalian transformations (i.e., transfections) by direct uptake may be conducted using the calcium phosphate precipitation method of Graham & Van der Eb, 1978, Virol. 52:546, or the various known modifications thereof. Other methods for introducing recombinant polynucleotides into cells, particularly into mammalian cells, include dexfran-mediated transfection, calcium phosphate mediated transfection, polybrene mediated transfection, protoplast fusion, electioporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the polynucleotides into nuclei. Such methods are well-known to one of skill in the art. In a prefened embodiment, stable cell lines containing the constructs of interest are generated for high throughput screening. Such stable cells lines may be generated by introducing a construct comprising a selectable marker, allowing the cells to grow for 1-2 days in an enriched medium, and then growing the cells on a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
A number of selection systems may be used, including but not limited to the heφes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine- guanine phosphoribosyltiansferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltiansferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, anti-metabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methofrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colbene-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygromycin (Santene, et al., 1984, Gene 30:147) genes. 5.9.1.1.1.5 Cell-Free Extracts
The invention provides for the franslation of a nucleic acid sequence encoding a protein, polypeptide or peptide (with or without a premature translation stop codon) in a cell-free system. Techniques for practicing the specific aspect of this invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, and recombinant DNA manipulation and production, which are routinely practiced by one of skill in the art. See, e.g., Sambrook, 1989, Molecular Cloning, A Laboratory Manual, Second Edition; DNA Cloning, Volumes I and II (Glover, Ed. 1985); and Transcription and Translation (Hames & Higgins, Eds. 1984).
Any technique well-known to one of skill in the art may be used to generate cell-free exfracts for translation. For example, the cell-free exfracts can be generated by centrifuging cells and clarifying the supernatant. In one embodiment, the cells are incubated on ice during the preparation of the cell-free extract. In another embodiment, the cells are incubated on ice at least 12 hours, at least 24 hours, at least two days, at least five days, at least one week, at least longer than one week. In a more specific embodiment, the cells are incubated on ice at least long enough so as to improve the franslation activity of the cell exfract in comparison to cell extracts that are not incubated on ice. In yet another embodiment, the cells are incubated at a temperature between about 0 °C and 10 °C. hi a prefened embodiment, the cells are incubated at about 4 °C. In another prefened embodiment, the cells are centrifuged at a low speed to isolate the cell-free exfract for in vitro translation reactions. In a prefened embodiment, the cell extract is the supernatant from cells that are centrifuged at about 2 x g to 20,000 x g. In a more prefened embodiment, the cell extract is the supernatant from cells that are centrifuged at about 5 x g to 15,000 x g. In an even more prefened embodiment, the cell extiact is the supernatant from cells that are centrifuged at about 10,000 x g. Alternatively, in a prefened embodiment, the cell-free exfract is about the SI to S50 extract. In a more prefened embodiment, the cell exfract is about the S5 to S25 exfract. In an even more prefened embodiment, the cell extract is about the S10 extiact.
The cell-free franslation extract may be isolated from cells of any species origin. In another embodiment, the cell-free translation extract is isolated from yeast, cultured mouse or rat cells, Chinese hamster ovary (CHO) cells, Xenopus oocytes, reticulocytes, wheat germ, or rye embryo (see, e.g., Krieg & Melton, 1984, Nature 308:203 and Dignam et al, 1990 Methods Enzymol. 182:194-203). Alternatively, the cell-free franslation extract, e.g., rabbit reticulocyte lysates and wheat germ extract, can be purchased from, e.g., Promega, (Madison, WT). In another embodiment, the cell-free translation extiact is prepared as described in International Patent Publication No. WO 01/44516 and U.S. Patent No. 4,668,625 to Roberts, the disclosures of which are incoφorated by reference in their entireties. In a prefened embodiment, the cell-free exfract is an exfract isolated from human cells. In a more prefened embodiment, the human cells are HeLa cells. It is prefened that the endogenous expression of the genes with the premature translation codons is minimal, and preferably absent, in the cells from which the cell-free translation exfract is prepared.
Systems for the in vitro transcription of RNAs with the gene of interest cloned in an expression vectors using promoters such as, but not limited to, Sp6, T3, or T7 promoters (see, e.g., expression vectors from Invitrogen, Carlesbad, CA; Promega,
Madison, WI; and Stratagene, La Jolla, CA), and the subsequent transcription of the gene with the appropriate polymerase are well-known to one of skill in the art (see, e.g., Contreras et al, 1982, Nucl. Acids. Res. 10:6353). hi another embodiment, the gene encoding the premature stop codon can be PCR-amplified with the appropriate primers, with the sequence of a promoter, such as but not limited to, Sp6, T3, or T7 promoters, incoφorated into the upstream primer, so that the resulting amplified PCR product can be in vitro transcribed with the appropriate polymerase.
Alternatively, a coupled transcription-translation system can be used for the expression of a gene encoding a premature stop codon in a cell free extract, such as the TnT® Coupled Transcription/Translation System (Promega, Madison, WI) or the system described in U.S. Patent No. 5,895,753 to Mierendorf et al, which is incoφorated by reference in its entirety.
5.9.1.1.2 Assays Various in vitro assays can be used to identify and verify the ability of a compound to modulate premature franslation termination and/or nonsense-mediated mRNA decay. Multiple in vitro assays can be performed simultaneously or sequentially to assess the affect of a compound on premature franslation termination and/or nonsense-mediated mRNA decay. In a prefened embodiment, the in vitro assays described herein are performed in a high throughput format (e.g. , in microtiter plates).
In a specific embodiment, the invention provides a method for identifying a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay, said method comprising: (a) contacting a member of a library of compounds with a cell containing a nucleic acid sequence comprising a reporter gene, wherein the reporter gene comprises a premature stop codon; and (b) detecting the expression of said reporter gene, wherein a compound that modulates premature franslation termination and/or nonsense-mediated mRNA decay is identified if the expression of said reporter gene in the presence of a compound is altered relative to a previously determined reference range, or the expression of said reporter gene in the absence of said compound or the presence of an appropriate control (e.g., a negative contiol).
In another embodiment, the invention provides a method for identifying a compound that modulates premature translation termination and/or nonsense- mediated mRNA decay, said method comprising: (a) contacting a member of a library of compounds with a cell-free extract and a nucleic acid sequence comprising a reporter gene, wherein the reporter gene comprises a premature stop codon; and (b) detecting the expression of said reporter gene, wherein a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay is identified if the expression of said reporter gene in the presence of a compound is altered relative to a previously determined reference range, or the expression of said reporter gene in the absence of said compound or the presence of an appropriate control (e.g., a negative control). In accordance with this embodiment, the cell-extract is preferably isolated from cells that have been incubated at about 0°C to about 10°C and/or an S10 to S30 cell-free exfract.
The alteration in reporter gene expression and/or activity in the reporter gene assays relative to a previously determined reference range, or to the expression or activity of the reporter gene in the absence of the compound or the presence of an appropriate control (e.g., a negative control such as phosphate buffered saline) indicates that a particular compound modulates premature franslation termination and/or nonsense-mediated mRNA decay. In particular, an increase in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate control (e.g., a negative control) may, depending upon the parameters of the reporter gene assay, indicate that a particular compound reduces or suppresses premature franslation termination and/or nonsense-mediated mRNA decay. In contrast, a decrease in reporter gene expression or activity relative to a previously determined reference range, or to the expression in the absence of the compound or the presence of an appropriate confrol (e.g., a negative control) may, depending upon the parameters of the reporter gene-based assay, indicate that a particular compound enhances premature translation termination and/or nonsense-mediated mRNA decay.
The step of contacting a compound or a member of a library of compounds with cell in the reporter gene-based assays described herein is preferably conducted under physiologic conditions. In specific embodiment, a compound or a member of a library of compounds is added to the cells in the presence of an aqueous solution, hi accordance with this embodiment, the aqueous solution may comprise a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. Alternatively, the aqueous solution may comprise a buffer, a combination of salts, and a detergent or a surfactant. Examples of salts which may be used in the aqueous solution include, but not limited to, KC1, NaCI, and/or MgCl2. The optimal concentration of each salt used in the aqueous solution is dependent on the cells and compounds used and can be determined using routine experimentation. The step of contacting a compound or a member of a library of compounds with a cell containing a reporter gene construct and in some circumstances, a nucleic acid sequence encoding a regulatory protein, may be performed for at least 0.2 hours, 0.25 hours, 0.5 hours, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 8 hours, 10 hours, 12 hours, 18 hours, at least 1 day, at least 2 days or at least 3 days. The expression of a reporter gene and/or activity of the protein encoded by the reporter gene in the reporter-gene assays may be detected by any technique well-known to one of skill in the art. The expression of a reporter gene can be readily detected, e.g., by quantifying the protein and/or RNA encoded by said gene. Compounds that modulate premature translation termination and/or nonsense-mediated mRNA decay may be identified by changes in the gene encoding the premature translation stop codon, i.e., there is readthrough of the premature franslation stop codon and a longer gene product is detected. If a gene encoding a naturally-occurring premature franslation stop codon is used, a longer gene product in the presence of a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay can be detected by any method in the art that permits the detection of the longer polypeptide, such as, but not limited to, immunological methods.
Many methods standard in the art can be thus employed, including, but not limited to, immunoassays to detect and/or visualize gene expression (e.g., Western blot, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), immunocytochemistry, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, or an epitope tag using an antibody that is specific to the polypeptide encoded by the gene of interest) and/or hybridization assays to detect gene expression by detecting and/or visualizing respectively mRNA encoding a gene (e.g., Northern assays, dot blots, in situ hybridization, etc), etc. Preferably, the antibody is specific to the C-terminal portion of the polypeptide used in an immunoassay. Such assays are routine and well known in the art (see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incoφorated by reference herein in its entirety). Exemplary immunoassays are described briefly below (but are not intended by way of limitation).
Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody which recognizes the antigen to the cell lysate, incubating for a period of time (e.g., 1 to 4 hours) at 40° C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 40° C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre-clearing the cell lysate with sepharose beads). For further discussion regarding immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1. Western blot analysis generally comprises preparing protein samples, elecfrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody which recognizes the antigen) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 3 P or 125I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding western blot protocols see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1. ELIS As comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding a primary antibody (which recognizes the antigen) conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen. In ELIS As the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognizes the primary antibody) conjugated to a detectable compound may be added to the well. Further, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected as well as other variations of ELIS As known in the art. For further discussion regarding ELIS As see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1. Methods for detecting the activity of a protein encoded by a reporter gene will vary with the reporter gene used. Assays for the various reporter genes are well-known to one of skill in the art. For example, as described in Section 5.1.1., luciferase, beta- galactosidase ("beta-gal"), beta-glucoronidase ("GUS"), beta-lactamase, chloramphemcol acetylfransferase ("CAT"), and alkaline phosphatase ("AP") are enzymes that can be analyzed in the presence of a substrate and could be amenable to high throughput screening. For example, the reaction products of luciferase, beta-galactosidase ("beta-gal"), and alkaline phosphatase ("AP") are assayed by changes in light imaging (e.g., luciferase), spectrophotometric absorbance (e.g., beta-gal), or fluorescence (e.g., AP). Assays for changes in light output, absorbance, and/or fluorescence are easily adapted for high throughput screening. For example, beta-gal activity can be measured with a microplate reader. Green fluorescent protein ("GFP") activity can be measured by changes in fluorescence. For example, in the case of mutant GFPs that fluoresce at 488 nm, standard fluorescence activated cell sorting ("FACS") equipment can be used to separate cells based upon GFP activity. Changes in mRNA stability of the gene encoding the premature franslation stop codon can be measured. As discussed above, nonsense-mediated mRNA decay alters the stability of an mRNA with a premature translation stop codon so that such mRNA is targeted for rapid decay instead of translation. In the presence of a compound that modulates premature translation termination and/or nonsense-mediated mRNA decay, the stability of the mRNA with the premature franslation stop codon is likely altered, i.e., stabilized. Methods of measuring changes in steady state levels of mRNA are well-known to one of skill in the art. Such methods include, but are not limited to, Northern blots, dot blots, solution hybridization, RNase protection assays, and SI nuclease protection assays, wherein the steady state levels of the mRNA of interest are measured with an appropriately labeled nucleic acid probe. Alternatively, methods such as semi-quantitative polymerase chain reaction ("PCR") can be used to measure changes in steady state levels of the mRNA of interest using the appropriate primers for amplification.
Alterations in the expression of a reporter gene may be determined by comparing the level of expression and/or activity of the reporter gene to a negative contiol (e.g., PBS or another agent that is known to have no effect on the expression of the reporter gene) and optionally, a positive confrol (e.g., an agent that is known to have an effect on the expression of the reporter gene, preferably an agent that effects premature franslation termination and/or nonsense-mediated mRNA decay). Alternatively, alterations in the expression and/or activity of a reporter gene may be determined by comparing the level of expression and/or activity of the reporter gene to a previously determined reference range.
5.9.1.2 Other In Vitro Assays
Where the gene product of interest is involved in cell growth or viability, the in vivo effect of the lead compound can be assayed by measuring the cell growth or viability of the target cell. Such assays can be carried out with representative cells of cell types involved in a particular disease or disorder (e.g., leukocytes such as T cells, B cells, natural killer cells, macrophages, neutrophils and eosinophils). A lower level of proliferation or survival of the contacted cells indicates that the lead compound is effective to treat a condition in the patient characterized by uncontrolled cell growth. Alternatively, instead of culturing cells from a patient, a lead compound may be screened using cells of a tumor or malignant cell line or an endothelial cell line. Specific examples of cell culture models include, but are not limited to, for lung cancer, primary rat lung tumor cells (see, e.g., Swafford et al., 1997, Mol. Cell. Biol., 17:1366-13 '4) and large-cell undifferentiated cancer cell lines (see, e.g., Mabry et al., 1991, Cancer Cells, 3:53-58); colorectal cell lines for colon cancer (see, e.g., Park & Gazdar, 1996, J. Cell Biochem. Suppl. 24:131-141); multiple established cell lines for breast cancer (see, e.g., Hambly et al., 1997, Breast Cancer Res. Treat. 43:247-258; Gierthy et al., 1997, Chemosphere 34:1495-1505; and Prasad & Church, 1997, Biochem. Biophys. Res. Commun. 232:14-19); a number of well- characterized cell models for prostate cancer (see, e.g., Webber et al., 1996, Prostate, Part 1, 29:386-394; Part 2, 30:58-64; and Part 3, 30:136-142 and Boulikas, 1997, Anticancer Res. 17:1471-1505); for genitourinary cancers, continuous human bladder cancer cell lines (see, e.g., Ribeiro et al., 1997, Int. J. Radiat. Biol. 72:11-20); organ cultures of transitional cell carcinomas (see, e.g., Booth et al., 1997, Lab Invest. 76:843-857) and rat progression models (see, e.g., Vet et al., 1997, Biochim. Biophys Acta 1360:39-44); and established cell lines for leukemias and lymphomas (see, e.g., Drexler, 1994, Leuk. Res. 18:919-927 and Tohyama, 1997, Int. J. Hematol. 65:309-317).
Many assays well-known in the art can be used to assess the survival and/or growth of a patient cell or cell line following exposure to a lead compound; for example, cell proliferation can be assayed by measuring bromodeoxyuridine (BrdU) incoφoration (see, e.g., Hoshino et al., 1986, hit. J. Cancer 38:369 and Campana et al., 1988, J. Jmmunol. Meth. 107:79) or (3H)-thymidine incoφoration (see, e.g., Chen, 1996, Oncogene 13:1395- 403 and Jeoung, 1995, J. Biol. Chem. 270:18367-73), by direct cell count, by detecting changes in tianscription, translation or activity of known genes such as proto-oncogenes (e.g., fos, myc) or cell cycle markers (Kb, cdc2, cyclin A, Dl, D2, D3, E, etc.). The levels of such protein and mRNA and activity can be determined by any method well known in the art. For example, protein can be quantitated by known immunodiagnostic methods such as western blotting or immunoprecipitation using commercially available antibodies. mRNA can be quantitated using methods that are well known and routine in the art, for example, using northern analysis, RNase protection, the polymerase chain reaction in connection with reverse transcription ("RT-PCR"). Cell viability can be assessed by using trypan-blue staining or other cell death or viability markers known in the art. hi a specific embodiment, the level of cellular ATP is measured to determined cell viability. Differentiation can be assessed, for example, visually based on changes in moφhology. The lead compound can also be assessed for its ability to inhibit cell transformation (or progression to malignant phenotype) in vitro, h this embodiment, cells with a transformed cell phenotype are contacted with a lead compound, and examined for change in characteristics associated with a transformed phenotype (a set of in vitro characteristics associated with a tumorigenic ability in vivo), for example, but not limited to, colony formation in soft agar, a more rounded cell moφhology, looser substratum attachment, loss of contact inhibition, loss of anchorage dependence, release of proteases such as plasminogen activator, increased sugar transport, decreased serum requirement, or expression of fetal antigens, etc. (see, e.g., Luria et al., 1978, General Virology, 3d Ed., John Wiley & Sons, New York, pp. 436-446).
Loss of invasiveness or decreased adhesion can also be assessed to demonstrate the anti-cancer effects of a lead compound. For example, an aspect of the formation of a metastatic cancer is the ability of a precancerous or cancerous cell to detach from primary site of disease and establish a novel colony of growth at a secondary site. The ability of a cell to invade peripheral sites reflects its potential for a cancerous state. Loss of invasiveness can be measured by a variety of techniques known in the art including, for example, induction of E-cadherin-mediated cell-cell adhesion. Such E-cadherin-mediated adhesion can result in phenotypic reversion and loss of invasiveness (see, e.g., Hordijk et al., 1997, Science 278:1464-66). Loss of invasiveness can further be examined by inhibition of cell migration. A variety of 2-dimensional and 3-dimensional cellular matrices are commercially available (Calbiochem-Novabiochem Coφ. San Diego, CA). Cell migration across or into a matrix can be examined using microscopy, time-lapsed photography or videography, or by any method in the art allowing measurement of cellular migration. In a related embodiment, loss of invasiveness is examined by response to hepatocyte growth factor ("HGF"). HGF- induced cell scattering is conelated with invasiveness of cells such as Madin-Darby canine kidney ("MDCK") cells. This assay identifies a cell population that has lost cell scattering activity in response to HGF (see, e.g., Hordijk et al., 1997, Science 278:1464-66). Alternatively, loss of invasiveness can be measured by cell migration through a chemotaxis chamber (Neuroprobe/ Precision Biochemicals Inc. Vancouver, BC). In such assay, a chemo-attractant agent is incubated on one side of the chamber (e.g., the bottom chamber) and cells are plated on a filter separating the opposite side (e.g., the top chamber). In order for cells to pass from the top chamber to the bottom chamber, the cells must actively migrate through small pores in the filter. Checkerboard analysis of the number of cells that have migrated can then be conelated with invasiveness (see e.g., Ohnishi, 1993, Biochem. Biophys. Res. Commun.193:518-25).
A lead compound can also be assessed for its ability to alter the expression of a secondary protein (as determined, e.g. by western blot analysis) or RNA, whose expression and/or activation is regulated directly or indirectly by the gene product of a gene of interest containing a premature stop codon or a nonsense mutation (as determined, e.g., by RT-PCR or northern blot analysis) in cultured cells in vitro using methods which are well known in the art. Further, chemical footprinting analysis can be conducted and is well- known in the art. In another embodiment of the invention, the lead compound can be tested in a host cell. In such an embodiment, the host cell can enode a nucleic acid with a premature translation termination sequence or stop codon. Such nucleic acids can be encoded by a number of vehicles, including, but not limited to, recombinant or chimeric vectors, viruses or the genome of the host cell. In another embodiment of the invention, the presence of the gene, containing a premature stop codon or translation termination sequence, causes a detectable phenotype in the host cell. Moreover, the effect of lead compounds on the phenotype of the cell can be examined in order to determine suitable candidates that modulate premature translation termination from a pool of compounds, hi one embodiment, a host cell containing a gene encoding a premature translation termination sequence or stop codon, exhibits an abnormal phenotype relative to the wild type cell that does not encode a gene with a premature stop codon. In such an embodiment, the effect of a compound on the host cell phenotype can be examined in order to determine the effect of a lead compound on premature translation termination or nonsense mediate mRNA decay. By way of example and not meant to limit the possible models, host cells, expressing mutations in a gene that controls cell cycle or proliferation, e.g., p53, can be exposed to various lead compounds in order to determine their effect on cell proliferation. Any lead compound that affects the proliferative activity of the host cell is identified as a compound that modulates premature translation termination or nonsense mediated mRNA decay. 5.9.2 Animal Models
Animal model systems can be used to demonstrate the safety and efficacy of the lead compounds identified in the nonsense suppression assays described above. The lead compounds identified in the nonsense suppression assay can then be tested for biological activity using animal models for a disease, condition, or syndrome of interest. These include animals engineered to contain the target RNA element coupled to a functional readout system, such as a transgenic mouse.
There are a number of methods that can be used to conduct animal model studies. Briefly, a compound identified in accordance with the methods of the invention is introduced into an animal model so that the effect of the compound on the manifestation of disease can be determined. The prevention or reduction in the severity, duration or onset of a symptom associated with the disease or disorder of the animal model that is associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay would indicate that the compound adminstered to the animal model had a prophylactic or therapeutic effect. Any method can be used to introduce the compound into the animal model, including, but not limited to, injection, intravenous infusion, oral ingestion, or inhalation. In a prefened embodiment, transgenic hosts are constructed so that the animal genome encodes a gene of interest with a premature franslation termination sequence or stop codon. In such an embodiment, the gene, containg a premature translation termination sequence or stop codon, would not encode a full length peptide from a transcribed mRNA. The adminsitiation of a compound to the animal model, and the expression of a full length protein, polypeptide or peptide, for example, conesponding to the gene containing a premature stop codon would indicate that the compound modulates premature translation termination. Any method known in the art, or described herein, can be used to determine if the stop codon was modulated by the compound. In another embodiment, the animal host genome encodes a native gene containing a premature stop codon. In another embodiment of the invention, the animal host is a natural mutant, i.e., natively encoding a gene with a premature stop codon. For example, the animal can be a model for cystic fibrosis wherein the animal genome contains a natural mutation that incoφorates a premature stop codon or translation termination sequence.
Examples of animal models for cystic fibrosis include, but are not limited to, cftr(-/-) mice (see, e.g., Freedman et al, 2001, Gasfroenterology 121(4):950-7), cftr(tmlHGU/tmlHGU) mice (see, e.g., Bernhard et al, 2001, Exp Lung Res 27(4):349- 66), CFTR-deficient mice with defective cAMP-mediated Cl(-) conductance (see, e.g., Stotland et al, 2000, Pediati Pulmonol 30(5):413-24), and C57BL/6- Cftr(mlUNC)/Cftr(mlUNC) knockout mice (see, e.g., Stotland et al, 2000, Pediafr Pulmonol 30(5):413-24).
Examples of animal models for muscular dysfrophy include, but are not limited to, mouse, hamster, cat, dog, and C. elegans. Examples of mouse models for muscular dysfrophy include, but are not limited to, the dy-/- mouse (see, e.g., Connolly et al, 2002, J Neuroimmunol 127(l-2):80-7), a muscular dysfrophy with myositis (mdm) mouse mutation (see, e.g., Garvey et al, 2002, Genomics 79(2): 146-9), the mdx mouse (see, e.g., Nakamura et al, 2001, Neuromuscul Disord 11(3):251-9), the utiophin- dystrophin knockout (dko) mouse (see, e.g., Nakamura et al, 2001, Neuromuscul Disord 11(3):251-9), the dy/dy mouse (see, e.g., Dubowitz et al, 2000, Neuromuscul Disord 10(4- 5):292-8), the mdx(Cv3) mouse model (see, e.g., Pillers et al, 1999, Laryngoscope 109(8): 1310-2), and the myotonic ADR-MDX mutant mice (see, e.g., Kramer et al, 1998, Neuromuscul Disord 8(8):542-50). Examples of hamster models for muscular dystrophy include, but are not limited to, sarcoglycan-deficient hamsters (see, e.g., Nakamura et al, 2001, Am J Physiol Cell Physiol 281(2):C690-9) and the BIO 14.6 dystrophic hamster (see, e.g., Schlenker & Burbach, 1991, J Appl Physiol 71(5):1655-62). An example of a feline model for muscular dysfrophy includes, but is not limited to, the hyperfrophic feline muscular dystrophy model (see, e.g., Gaschen & Burgunder, 2001, Acta Neuropathol (Berl) 101(6):591-600). Canine models for muscular dysfrophy include, but are not limited to, golden retriever muscular dystrophy (see, e.g., Fletcher et al, 2001, Neuromuscul Disord 11(3):239-43) and canine X-linked muscular dystrophy (see, e.g., Valentine et al, 1992, Am J Med Genet 42(3): 352-6). Examples of C. elegans models for muscular dysfrophy are described in Chamberlain & Benian, 2000, Cun Biol 10(21):R795-7 and Culette & Sattelle,
2000, Hum Mol Genet 9(6):869-77.
Examples of animal models for familial hypercholesterolemia include, but are not limited to, mice lacking functional LDL receptor genes (see, e.g., Aji et al, 1997, Circulation 95(2):430-7), Yoshida rats (see, e.g., Fantappie et al, 1992, Life Sci
50(24):1913-24), the JCR:LA-cp rat (see, e.g., Richardson et al, 1998, Atherosclerosis 138(1): 135-46), swine (see, e.g., Hasler-Rapacz et al, 1998, Am J Med Genet 76(5):379- 86), and the Watanabe heritable hyperlipidaemic rabbit (see, e.g., Tsutsumi et al, 2000, Arzneimittelforschung 50(2):118-21; Harsch et al, 1998, Br J Pharmacol 124(2):227-82; and Tanaka et al, 1995, Atherosclerosis 114(l):73-82).
An example of an animal model for human cancer in general includes, but is not limited to, spontaneously occurring tumors of companion animals (see, e.g., Vail & MacEwen, 2000, Cancer Invest 18(8):781-92). Examples of animal models for lung cancer include, but are not limited to, lung cancer animal models described by Zhang & Roth (1994, In Vivo 8(5):755-69) and a transgenic mouse model with disrupted p53 function (see, e.g., Morris et al, 1998, J La State Med Soc 150(4):179-85). An example of an animal model for breast cancer includes, but is not limited to, a transgenic mouse that overexpresses cyclin Dl (see, e.g., Hosokawa et al, 2001, Transgenic Res 10(5):471-8). An example of an animal model for colon cancer includes, but is not limited to, a TCRbeta and p53 double knockout mouse (see, e.g., Kado et al, 2001, Cancer Res 61(6):2395-8). Examples of animal models for pancreatic cancer include, but are not limited to, a metastatic model of Panc02 murine pancreatic adenocarcinoma (see, e.g., Wang et al,
2001, hit J Pancreatol 29(l):37-46) and nu-nu mice generated in subcutaneous pancreatic tumours (see, e.g., Ghaneh et al, 2001, Gene Ther 8(3): 199-208). Examples of animal models for non-Hodgkin's lymphoma include, but are not limited to, a severe combined immunodeficiency ("SCID") mouse (see, e.g., Bryant et al, 2000, Lab Invest 80(4):553-73) and an IgHmu-HOXll transgenic mouse (see, e.g., Hough et al, 1998, Proc Natl Acad Sci USA 95(23): 13853-8). An example of an animal model for esophageal cancer includes, but is not limited to, a mouse transgenic for the human papillomavirus type 16 E7 oncogene (see, e.g., Herber et al, 1996, J Virol 70(3): 1873-81). Examples of animal models for colorectal carcinomas include, but are not limited to, Ape mouse models (see, e.g., Fodde & Smits, 2001, Trends Mol Med 7(8):369-73 and Kuraguchi et al, 2000, Oncogene 19(50):5755-63). An example of an animal model for neurofibromatosis includes, but is not limited to, mutant NF1 mice (see, e.g., Cichowski et al, 1996, Semin Cancer Biol 7(5):291 -8). Examples of animal models for retinoblastoma include, but are not limited to, transgenic mice that expression the simian virus 40 T antigen in the retina (see, e.g., Howes et al, 1994, Invest Ophthalmol Vis Sci 35(2):342-51 and Windle et al, 1990, Nature 343(6259):665-9) and inbred rats (see, e.g., Nishida et al, 1981, Curr Eye Res l(l):53-5 and Kobayashi et al, 1982, Acta Neuropathol (Berl) 57(2-3):203-8). Examples of animal models for Wilm's tumor include, but are not limited to, a WT1 knockout mice (see, e.g., Scharnhorst et al, 1997, Cell Growth Differ 8(2): 133-43), a rat subline with a high incidence of neuphroblastoma (see, e.g., Mesfin & Breech, 1996, Lab Anim Sci 46(3):321- 6), and a Wistar/Furth rat with Wilms' tumor (see, e.g., Muφhy et al, 1987, Anticancer Res 7(4B):717-9).
Examples of animal models for retinitis pigmentosa include, but are not limited to, the Royal College of Surgeons ("RCS") rat (see, e.g., Vollrath et al, 2001, Proc Natl Acad Sci USA 98(22); 12584-9 and Hanitzsch et al, 1998, Acta Anat (Basel) 162(2- 3):119-26), a rhodopsin knockout mouse (see, e.g., Jaissle et al, 2001, Invest Ophthalmol Vis Sci 42(2):506-13), and Wag/Rij rats (see, e.g., Lai et al, 1980, Am J Pathol 98(1):281- 4).
Examples of animal models for cinhosis include, but are not limited to, CC -exposed rats (see, e.g., Kloehn et al, 2001, Horm Metab Res 33(7):394-401) and rodent models instigated by bacterial cell components or colitis (see, e.g., Vierling, 2001, Best Pract Res Clin Gastroenterol 15(4):591-610).
Examples of animal models for hemophilia include, but are not limited to, rodent models for hemophilia A (see, e.g., Reipert et al, 2000, Thromb Haemost 84(5): 826- 32; Jarvis et al,. 1996, Thromb Haemost 75(2):318-25; and Bi et al, 1995, Nat Genet 10(1):119-21), canine models for hemophilia A (see, e.g., Gallo-Penn et al, 1999, Hum Gene Ther 10(11):1791-802 and Connelly et al, 1998, Blood 91(9);3273-81), murine models for hemophilia B (see, e.g., Snyder et al, 1999, Nat Med 5(l):64-70; Wang et al, 1997, Proc Natl Acad Sci USA 94(21):11563-6; and Fang et al, 1996, Gene Ther 3(3):217- 22), canine models for hemophilia B (see, e.g., Mount et al, 2002, Blood 99(8):2670-6; Snyder et al, 1999, Nat Med 5(l):64-70; Fang et al, 1996, Gene Ther 3(3):217-22); and Kay et al, 1994, Proc Natl Acad Sci USA 91(6):2353-7), and a rhesus macaque model for hemophilia B (see, e.g., Lozier et al, 1999, Blood 93(6):1875-81).
Examples of animal models for von Willebrand disease include, but are not limited to, an inbred mouse strain RIIIS/J (see, e.g., Nichols et al, 1994, 83(11):3225-31 and Sweeney et al, 1990, 76(ll):2258-65), rats injected with bofrocetin (see, e.g., Sanders et al, 1988, Lab Invest 59(4):443-52), and porcine models for von Willebrand disease (see, e.g., Nichols et al, 1995, Proc Natl Acad Sci USA 92(7):2455-9; Johnson & Bowie, 1992, J Lab Clin Med 120(4):553-8); and Brinkhous et al, 1991, Mayo Clin Proc 66(7):733-42).
Examples of animal models for β-thalassemia include, but are not limited to, murine models with mutations in globin genes (see, e.g., Lewis et al, 1998, Blood
91(6):2152-6; Raja et al, 1994, Br J Haematol 86(l):156-62; Popp et al, 1985, 445:432-44; and Skow et al, 1983, Cell 34(3):1043-52).
Examples of animal models for kidney stones include, but are not limited to, genetic hypercalciuric rats (see, e.g., Bushinsky et al, 1999, Kidney hit 55(l):234-43 and Bushinsky et al, 1995, Kidney hit 48(6): 1705-13), chemically freated rats (see, e.g., Grases et al, 1998, Scand J Urol Nephrol 32(4):261-5; Burgess et al, 1995, Urol Res 23(4):239- 42; Kumar et al, 1991, J Urol 146(5):1384-9; Okada et al, 1985, Hinyokika Kiyo 31(4):565-77; and Bluestone et al, 1975, Lab Invest 33(3):273-9), hyperoxaluric rats (see, e.g., Jones et al, 1991, J Urol 145(4):868-74), pigs with unilateral retrograde flexible nephroscopy (see, e.g., Seifinah et al, 2001, 57(4):832-6), and rabbits with an obstructed upper urinary tract (see, e.g., Itatani et al, 1979, Invest Urol 17(3):234-40).
Examples of animal models for ataxia-telangiectasia include, but are not limited to, murine models of ataxia-telangiectasia (see, e.g., Barlow et al, 1999, Proc Natl Acad Sci USA 96(17):9915-9 and frioue et al, 1986, Cancer Res 46(8):3979-82). A mouse model was generated for ataxia-telangiectasia using gene targeting to generate mice that did not express the Arm protein (see, e.g., Elson et al, 1996, Proc. Nat. Acad. Sci. 93: 13084- 13089).
Examples of animal models for lysosomal storage diseases include, but are not limited to, mouse models for mucopolysaccharidosis type VII (see, e.g., Brooks et al, 2002, Proc Natl Acad Sci U S A. 99(9):6216-21; Monroy et al, 2002, Bone 30(2):352-9; Vogler et al, 2001, Pediati Dev Pathol. 4(5):421-33; Vogler et al, 2001, Pediafr Res. 49(3):342-8; and Wolfe et al, 2000, Mol Ther. 2(6):552-6), a mouse model for metachromatic leukodystrophy (see, e.g., Matzner et al, 2002, Gene Ther. 9(l):53-63), a mouse model of Sandhoff disease (see, e.g., Sango et al, 2002, Neuropathol Appl Neurobiol. 28(l):23-34), mouse models for mucopolysaccharidosis type III A (see, e.g., Bhattacharyya et al, 2001, Glycobiology 11(1):99-10 and Bhaumik et al, 1999, Glycobiology 9(12):1389-96.), arylsulfatase A (ASA)-deficient mice (see, e.g., D'Hooge et al, 1999, Brain Res. 847(2):352-6 and D'Hooge et al, 1999, Neurosci Lett. 273(2):93-6); mice with an aspartylglucosaminuria mutation (see, e.g., Jalanko et al., 1998, Hum Mol Genet. 7(2):265-72); feline models of mucopolysaccharidosis type VI (see, e.g., Crawley et al, 1998, J Clin Invest. 101(1):109-19 andNondin et al., 1995, Bone 17(5):485-9); a feline model of Niemann-Pick disease type C (see, e.g., March et al, 1997, Acta Neuropathol (Berl). 94(2): 164-72); acid sphingomyelinase-deficient mice (see, e.g., Otterbach & Stoffel, 1995, Cell 81(7): 1053-6), and bovine mannosidosis (see, e.g., Jolly et al, 1975, Birth Defects Orig Artie Ser. 11(6):273-8).
Examples of animal models for tuberous sclerosis ("TSC") include, but are not limited to, a mouse model of TSC 1 (see, e.g., Kwiatkowski et al, 2002, Hum Mol Genet. ll(5):525-34), a Tscl (TSC1 homologue) knockout mouse (see, e.g., Kobayashi et al, 2001, Proc Natl Acad Sci U S A. 2001 Jul 17;98(15):8762-7), a TSC2 gene mutant(Eker) rat model (see, e.g., Hino 2000, Nippon Rinsho 58(6):1255-61; Mizuguchi et al, 2000, J Neuropathol Exp Neurol. 59(3):188-9; and Hino et al, 1999, Prog Exp Tumor Res. 35:95-108); and Tsc2(+/-) mice (see, e.g., Onda et al., 1999, J Clin Invest. 104(6):687-95). 5.9.3 Toxicity
The toxicity and/or efficacy of a compound identified in accordance with the invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). Cells and cell lines that can be used to assess the cytotoxicity of a compound identified in accordance with the invention include, but are not limited to, peripheral blood mononuclear cells (PBMCs), Caco-2 cells, and Huh7 cells. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. A compound identified in accordance with the invention that exhibits large therapeutic indices is prefened. While a compound identified in accordance with the invention that exhibits toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage of a compound identified in accordance with the invention for use in humans. The dosage of such agents lies preferably within a range of circulating concenfrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any agent used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
5.10 Design of Congeners or Analogs
The compounds which display the desired biological activity can be used as lead compounds for the development or design of congeners or analogs having useful pharmacological activity. For example, once a lead compound is identified, molecular modeling techniques can be used to design variants of the compound that can be more effective. Examples of molecular modeling systems are the CHARM and QUANTA programs (Polygen Coφoration, Waltham, MA). CHARM performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
A number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen et al., 1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, 1998, New Scientist 54-57; McKinaly & Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry & Davies, OSAR: Quantitative Structure- Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, hie. 1989); Lewis & Dean, 1989, Proc. R. Soc. Lond. 236:125-140 and 141-162; Askew et al., 1989, J. Am. Chem. Soc. 111 : 1082-1090. Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc. (Pasadena, California), Allelix, Inc.
(Mississauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario). Although these are primarily designed for application to drugs specific to particular proteins, they can be adapted to design of drugs specific to any identified region. The analogs and congeners can be tested for binding to translational machinery using assays well-known in the art or described herein for biologic activity. Alternatively, lead compounds with little or no biologic activity, as ascertained in the screen, can also be used to design analogs and congeners of the compound that have biologic activity.
5.11 Uses of Compounds to Prevent/Treat a Disorder The present invention provides methods of preventing, freating, managing or ameliorating a disorder or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof. In particular, the present invention provides methods of preventing, treating, managing or ameliorating a disorder associated with premature tianslation termination and/or nonsense- mediated mRNA decay, or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof. Examples of diseases associated with, characterized by or caused by associated with premature translation termination and/or nonsense-mediated mRNA decay include, but are not limited to, cystic fibrosis, muscular dystrophy, heart disease, lung cancer, breast cancer, colon cancer, pancreatic cancer, non-Hodgkin's lymphoma, ovarian cancer, esophageal cancer, colorectal carcinomas, neurofibromatosis, retinoblastoma, Wilm's tumor, retinitis pigmentosa, collagen disorders, cinhosis, Tay-Sachs disease, blood disorders, kidney stones, ataxia-telangiectasia, lysosomal storage diseases, and tuberous sclerosis. See Sections 5.8 and 6.5 for additional non-limiting examples of diseases and genetic disorders which can be prevented, treated, managed or ameliorated by administering one or more of the compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof. Genes that contain one or more nonsense mutations that are potentially involved in causing disease are presented in table form according to chromosome location in Example 6.5 infra.
Tax a prefened embodiment, it is first determined that the patient is suffering from a disease associated with premature translation termination and/or nonsense-mediated mRNA decay before administering a compound identified in accordance with the invention or a combination therapy described herein. In a prefened embodiment, the DNA of the patient can be sequenced or subject to Southern Blot, polymerase chain reaction (PCR), use of the Short Tandem Repeat (STR), or polymoφhic length restriction fragments (RFLP) analysis to determine if a nonsense mutation is present in the DNA of the patient. Alternatively, it can be determined if altered levels of the protein with the nonsense mutation are expressed in the patient by western blot or other immunoassays. Such methods are well known to one of skill in the art. h one embodiment, the invention provides a method of preventing, treating, managing or ameliorating a disorder or one or more symptoms thereof, said method comprising administering to a subject in need thereof a dose of a prophylactically or therapeutically effective amount of one or more compounds identified in accordance with the methods of the invention. In another embodiment, a compound identified in accordance with the methods of the invention is not administered to prevent, treat, or ameliorate a disorder or one or more symptoms thereof, if such compound has been used previously to prevent, treat, manage or ameliorate said disorder. In a more specific embodiment of the invention, disorders that can be prevented, managed and/or treated with the compounds of the invention, include, but are not limited to, disorders that are associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay.
The invention provides methods of preventing, treating, managing or ameliorating a disorder or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more of the compounds identified utilizing the screening methods described herein or a pharmaceutically acceptable salt thereof, and one or more other therapies (e.g., prophylactic or therapeutic agents). In particular, the invention provides methods of preventing, treating, managing or ameliorating a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense mediate mRNA decay, or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more of the compounds identified utilizing the screening methods described herein or a pharmaceutically acceptable salt thereof, and one or more other therapies (e.g., prophylactic or therapeutic agents). Preferably, the other therapies are currently being used, have been used or are known to be useful in the prevention, treatment, management or amelioration of said disorder or a symptom thereof. Non-limiting examples of such therapies are in Section 5.11.1 infra. The therapies (e.g., prophylactic or therapeutic agents) or the combination therapies of the invention can be administered sequentially or concunently. hi a specific embodiment, the combination therapies of the invention comprise a compound identified in accordance with the invention and at least one other therapy that has the same mechanism of action as said compound. In another specific embodiment, the combination therapies of the invention comprise a compound identified in accordance with the methods of the invention and at least one other therapy (e.g., prophylactic or therapeutic agent) which has a different mechanism of action than said compound. The combination therapies of the present invention improve the prophylactic or therapeutic effect of a compound of the invention by functioning together with the compound to have an additive or synergistic effect. The combination therapies of the present invention reduce the side effects associated with the therapies (e.g., prophylactic or therapeutic agents).
The prophylactic or therapeutic agents of the combination therapies can be administered to a subject in the same pharmaceutical composition. Alternatively, the prophylactic or therapeutic agents of the combination therapies can be administered concunently to a subject in separate pharmaceutical compositions. The prophylactic or therapeutic agents may be administered to a subject by the same or different routes of administration.
In a specific embodiment, a pharmaceutical composition comprising one or more compounds identified in a screening assay described herein is administered to a subject, preferably a human, to prevent, treat, manage or ameliorate a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense mediated mRNA decay) or one or more symptoms thereof, hi accordance with the invention, the pharmaceutical composition may also comprise one or more other prophylactic or therapeutic agents. Preferably, such prophylactic or theapeutic agents are cunently being used, have been used or are known to be useful in the prevention, treatment, management or amelioration of a disorder (in particular, a disorder associated with, characterized by, or caused by premature translation termination or nonsense- mediated mRNA decay) or one or more symptoms thereof. A compound identified in accordance with the methods of the invention may be used as a first, second, third, fourth or fifth line of therapy for a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay). The invention provides methods for treating, managing or ameliorating a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof in a subject refractory to conventional therapies for such disorder, said methods comprising administering to said subject a dose of a prophylactically or therapeutically effective amount of a compound identified in accordance with the methods of the invention. In particular, a disorder may be determined to be refractory to a therapy when at least some significant portion of the disorder is not resolved in response to the therapy. Such a determination can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of a therapy on a subject, using the art- accepted meanings of "refractory" in such a context. In a specific embodiment, a disorder is refractory where the number of symptoms of the disorder has not been significantly reduced, or has increased.
The invention provides methods for freating, managing or ameliorating one or more symptoms of a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) in a subject refractory to existing single agent therapies for such disorder, said methods comprising administering to said subject a dose of a prophylactically or therapeutically effective amount of a compound identified in accordance with the methods of the invention and a dose of a prophylactically or therapeutically effective amount of one or more other therapies (e.g., prophylactic or therapeutic agents). The invention also provides methods for treating or managing a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) by administering a compound identified in accordance with the methods of the invention in combination with any other therapy (e.g., radiation therapy, chemotherapy or surgery) to patients who have proven refractory to other therapies but are no longer on these therapies. The invention also provides methods for the treatment or management of a patient having disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay) and said patient is immunosuppressed or immunocompromised by reason of having previously undergone other therapies. Further, the invention provides methods for preventing the recunence of a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) such as, e.g., cancer in patients that have been undergone therapy and have no disease activity by administering a compound identified in accordance with the methods of the invention. In addition to the use of the compounds identified in accordance with the invention for the prevention, treatment, management or amelioration of a disorder or a symptom thereof, the compounds may be used in vitro to modulate the expression of particular genes of interest, for example, the compounds may be used to increase or decrease the expression of a particular gene of interest when conducting in vitro studies. 5.11.1 Other Therapies
The present invention provides methods of preventing, freating, managing or ameliorating a disorder (in particular, a disorder associated with, characterized by or caused by premature franslation termination and/or nonsense-mediated mRNA decay), or one or more symptoms thereof, said methods comprising administering to a subject in need thereof one or more compounds identified in accordance with the methods of the invention or a pharmaceutically acceptable salt thereof, and one or more other therapies (e.g., prophylactic or therapeutic agents). Any therapy (e.g., chemotherapies, radiation therapies, hormonal therapies, and/or biological therapies/immunotherapies) which is known to be useful, or which has been used or is cunently being used for the prevention, freatment, management or amelioration of a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay) or one or more symptoms thereof can be used in combination with a compound identified in accordance with the methods of the invention. Examples of therapeutic or prophylactic agents which can be used in combination with a compound identified in accordance with the invention include, but are not limited to, peptides, polypeptides, fusion proteins, nucleic acid molecules, small molecules, mimetic agents, synthetic drugs, inorganic molecules, and organic molecules.
Proliferative disorders associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay can be prevented, treated, managed or ameliorated by administering to a subject in need thereof one or more of the compounds identified in accordance with the methods of the invention, and one or more other therapies for prevention, treatment, management or amelioration of said disorders or a symptom thereof. Examples of such therapies include, but are not limited to, angiogenesis inhibitors, topoisomerase inhibitors, immunomodulatory agents
(such as chemotherapeutic agents) and radiation therapy. Angiogenesis inhibitors (i.e., anti- angiogenic agents) include, but are not limited to, angiostatin (plasminogen fragment); antiangiogenic antithrombin III; angiozyme; ABT-627; Bay 12-9566; Benefin; Bevacizumab; BMS-275291; cartilage-derived inhibitor (GDI); CAI; CD59 complement fragment; CEP-7055; Col 3; combretastatin A-4; endostatin (collagen XVIII fragment); fibronectin fragment; Gro-beta; Halofuginone; Heparinases; Heparin hexasaccharide fragment; HMV833; human chorionic gonadotropin (hCG); IM-862; Interferon alpha/beta/gamma; Interferon inducible protein (IP- 10); Interleukin-12; Kringle 5 (plasminogen fragment); Marimastat; Metalloproteinase inhibitors (TIMPs); 2- methoxyestradiol; MMI 270 (CGS 27023A); MoAb IMC-lCl 1; Neovastat; NM-3; Panzem; PI-88; Placental ribonuclease inhibitor; plasminogen activator inhibitor; platelet factor-4 (PF4); Prinomastat; Prolactin 16kD fragment; Proliferin-related protein (PRP); PTK 787/ZK 222594; retinoids; solimastat; squalamine; SS 3304; SU 5416; SU6668; SU11248; tetrahydrocortisol-S; tetrathiomolybdate; thalidomide; thrombospondin-1 (TSP-1); TNP- 470; transforming growth factor-beta; vasculostatin; vasostatin (calreticulin fragment);
ZD6126; ZD 6474; farnesyl fransferase inhibitors (FTI); and bisphosphonates. In a specific embodiment, anti-angiogenic agents do not include antibodies or fragments thereof that immunospecifically bind to integrin ov/33. Specific examples of propylactic or therapeutic agents which can be used in accordance with the methods of the invention to prevent, treat, manage or ameliorate a proliferative disorder associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay, or a symptom thereof include, but not limited to: acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantione acetate; ammoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisanfrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone; caracemide; carbetimer; carboplatin; carmustine; carubicin hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin; cisplatin; cladribine; crisnatol mesylate; cyclophosphamide; cytarabine; dacarbazine; dactinomycin; daunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edafrexate; eflornithine hydrochloride; elsamitrucin; enloplatin; enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; esframustine; estiamustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; flurocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; ilmofosine; interleukin II (including recombinant interleukin TJ, or rIL2), interferon alpha-2a; interferon alpha-2b; interferon alpha-nl ; interferon alpha-n3; interferon beta-I a; interferon gamma-I b; iproplatin; irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansine; mechlorethamine hydrochloride; megestrol acetate; melengestrol acetate; melphalan; menogaril; mercaptopurine; methotiexate; methotiexate sodium; metoprine; meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazole; nogalamycin; ormaplatin; oxisuran; paclitaxel; pegaspargase; peliomycin; pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; plomestane; porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; simfrazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride; spiromustine; spiroplatin; streptonigrin; stieptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfin; teniposide; teroxirone; testolactone; thiamiprine; tMoguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine phosphate; trimefrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate; vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin; zinostatin; zorubicin hydrochloride. Other anti-cancer drugs include, but are not limited to: 20-epi-l,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; alfretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing moφho genetic protein- 1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin
B; betulinic acid; bFGF inhibitor; bicalutamide; bisanfrene; bisaziridinylspermine; bisnafide; bisfratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorlns; chloroquinoxaline sulfonamide; cicaprost; cis-poφhyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin
B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflornithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandromc acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; immunostimulant peptides; insulin-like growth factor- 1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lomefrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxanfrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadofrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor
1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall exfract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphteφin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nifroxide antioxidant; nitrullyn; O6-benzylguanine; ocfreotide; okicenone; oligonucleotides; onapristone; ondansefron; ondansefron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; penfrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocaφine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; puφurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; raltitrexed; ramosetion; ras farnesyl protein fransferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RH retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone Bl; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; sizofiran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1 ; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; 5-fluorouracil; leucovorin; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetiachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopuφurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyφhostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; thalidomide; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer.
Specific examples of propylactic or therapeutic agents which can be used in accordance with the methods of the invention to prevent, treat, manage and/or ameliorate a central nervous system disorders associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay, or a symptom thereof include, but are not limited to: Levodopa, L-DOPA, cocaine, α-methyl-tyrosine, reseφine, tefrabenazine, benzotropine, pargyline, fenodolpam mesylate, cabergoline, pramipexole dihydrochloride, ropinorole, amantadine hydrochloride, selegiline hydrochloride, carbidopa, pergolide mesylate, Sinemet CR, or Symmefrel. Specific examples of propylactic or therapeutic agents which can be used in accordance with the methods of the invention to prevent, treat, manage and/or ameliorate a metabolic disorders associated with, characterized by or caused by premature translation termination and/or nonsense-mediated mRNA decay, or a symptom thereof include, but are not limited to: a monoamine oxidase inhibitor (MAO), for example, but not limited to, iproniazid, clorgyline, phenelzine and isocarboxazid; an acetylcholinesterase inhibitor, for example, but not limited to, physostigmine saliclate, physostigmine sulfate, physostigmine bromide, meostigmine bromide, neostigmine methylsulfate, ambenonim chloride, edrophonium chloride, tacrine, pralidoxime chloride, obidoxime chloride, trimedoxime bromide, diacetyl monoxim, endrophonium, pyridostigmine, and demecarium; an anti- inflammatory agent, including, but not limited to, naproxen sodium, diclofenac sodium, diclofenac potassium, celecoxib, sulindac, oxaprozin, diflunisal, etodolac, meloxicam, ibuprofen, ketoprofen, nabumetone, refecoxib, methotiexate, leflunomide, sulfasalazine, gold salts, RHo-D Immune Globulin, mycophenylate mofetil, cyclosporine, azathioprine, tacrolimus, basiliximab, daclizumab, salicylic acid, acetylsalicylic acid, methyl salicylate, diflunisal, salsalate, olsalazine, sulfasalazine, acetaminophen, indomethacin, sulindac, mefenamic acid, meclofenamate sodium, tolmetin, ketorolac, dichlofenac, flurbinprofen, oxaprozin, piroxicam, meloxicam, ampiroxicam, droxicam, pivoxicam, tenoxicam, phenylbutazone, oxyphenbutazone, antipyrine, aminopyrine, apazone, zileuton, aurothioglucose, gold sodium thiomalate, auranofin, methotiexate, colchicine, allopurinol, probenecid, sulfinpyrazone and benzbromarone or betamethasone and other glucocorticoids; an antiemetic agent, for example, but not limited to, metoclopromide, domperidone, prochloφerazine, promethazine, chloφromazine, trimethobenzamide, ondansefron, granisetron, hydroxyzine, acetylleucine monoethanolamine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, buclizine, clebopride, cyclizine, dimenhydrinate, diphenidol, dolasefron, meclizine, methallatal, metopimazine, nabilone, oxyperndyl, pipamazine, scopolamine, sulphide, tetrahydrocannabinol, thiethylperazine, thioproperazine, fropisetron, and mixtures thereof.
5.12 Compounds and Methods of Administering Compounds Biologically active compounds identified using the methods of the invention or a pharmaceutically acceptable salt thereof can be administered to a patient, preferably a mammal, more preferably a human, suffering from a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay). In a specific embodiment, a compound or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disorder (in particular, a disorder associated with, characterized by or caused by premature translation termination and/or nonsense mediated mRNA decay). hi one embodiment, the compound or a pharmaceutically acceptable salt thereof is administered as a preventative measure to a patient. According to this embodiment, the patient can have a genetic predisposition to a disease, such as a family history of the disease, or a non-genetic predisposition to the disease. Accordingly, the compound and pharmaceutically acceptable salts thereof can be used for the treatment of one manifestation of a disease and prevention of another.
A compound identified in accordance with the invention, or a pharmaceutically acceptable salt thereof, may be a component of a composition optionally comprising a carrier, diluent or excipient. When administered to a patient, the compound or a pharmaceutically acceptable salt thereof is preferably administered as component of a composition that optionally comprises a pharmaceutically acceptable vehicle. The composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by absoφtion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and may be administered together with another biologically active agent. Admimstration can be systemic or local. Various delivery systems are known, e.g. , encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the compound and pharmaceutically acceptable salts thereof.
Methods of administration include but are not limited to intiadermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intianasal, epidural, oral, sublingual, intianasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the compound or a pharmaceutically acceptable salt thereof into the bloodstream. In specific embodiments, it may be desirable to administer the compound or a pharmaceutically acceptable salt thereof locally. This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
In certain embodiments, it may be desirable to introduce the compound or a pharmaceutically acceptable salt thereof into the central nervous system by any suitable route, including intraventricular, intrathecal and epidural injection. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the compound and pharmaceutically acceptable salts thereof can be formulated as a suppository, with traditional binders and vehicles such as triglycerides.
In another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).
In yet another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a controlled release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled- release systems discussed in the review by Langer, 1990, Science 249: 1527-1533 may be used, hi one embodiment, a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321 :574). hi another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled-release system can be placed in proximity of a target RNA of the compound or a pharmaceutically acceptable salt thereof, thus requiring only a fraction of the systemic dose.
Compositions comprising the compound or a pharmaceutically acceptable salt thereof ("compound compositions") can additionally comprise a suitable amount of a pharmaceutically acceptable vehicle so as to provide the form for proper administration to the patient. hi a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in ammals, mammals, and more particularly in humans. The term "vehicle" refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is administered. Such pharmaceutical vehicles can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical vehicles can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents may be used. When administered to a patient, the pharmaceutically acceptable vehicles are preferably sterile. Water is a prefened vehicle when the compound of the invention is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions. Suitable pharmaceutical vehicles also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Compound compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
Compound compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained- release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the pharmaceutically acceptable vehicle is a capsule (see e.g., U.S. Patent No. 5,698,155). Other examples of suitable pharmaceutical vehicles are described in Remington's Pharmaceutical Sciences, Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, PA, 19th ed., 1995, pp. 1447 to 1676, incoφorated herein by reference. hi a prefened embodiment, the compound or a pharmaceutically acceptable salt thereof is formulated in accordance with routine procedures as a pharmaceutical composition adapted for oral administration to human beings. Compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absoφtion in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. In these later platforms, fluid from the environment sunounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A time delay material such as glycerol monostearate or glycerol stearate may also be used. Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Such vehicles are preferably of pharmaceutical grade. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions may also include a solubilizing agent.
In another embodiment, the compound or a pharmaceutically acceptable salt thereof can be formulated for intravenous administration. Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the compound or a pharmaceutically acceptable salt thereof is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the compound or a pharmaceutically acceptable salt thereof is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. The amount of a compound or a pharmaceutically acceptable salt thereof that will be effective in the treatment of a particular disease will depend on the nature of the disease, and can be determined by standard clinical techniques, hi addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for oral administration are generally about 0.001 milligram to about 500 milligrams of a compound or a pharmaceutically acceptable salt thereof per kilogram body weight per day. In specific prefened embodiments of the invention, the oral dose is about 0.01 milligram to about 100 milligrams per kilogram body weight per day, more preferably about 0.1 milligram to about 75 milligrams per kilogram body weight per day, more preferably about 0.5 milligram to 5 milligrams per kilogram body weight per day. The dosage amounts described herein refer to total amounts administered; that is, if more than one compound is administered, or if a compound is administered with a therapeutic agent, then the prefened dosages conespond to the total amount administered. Oral compositions preferably contain about 10% to about 95% active ingredient by weight.
Suitable dosage ranges for intravenous (i.v.) admimstiation are about 0.01 milligram to about 100 milligrams per kilogram body weight per day, about 0.1 milligram to about 35 milligrams per kilogram body weight per day, and about 1 milligram to about 10 milligrams per kilogram body weight per day. Suitable dosage ranges for intianasal administration are generally about 0.01 pg/kg body weight per day to about 1 mg/kg body weight per day. Suppositories generally contain about 0.01 milligram to about 50 milligrams of a compound of the invention per kilogram body weight per day and comprise active ingredient in the range of about 0.5% to about 10% by weight.
Recommended dosages for infradermal, intramuscular, intraperitoneal, subcutaneous, epidural, sublingual, infracerebral, infravaginal, transdermal administration or administration by inhalation are in the range of about 0.001 milligram to about 200 milligrams per kilogram of body weight per day. Suitable doses for topical administration are in the range of about 0.001 milligram to about 1 milligram, depending on the area of administration. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Such animal models and systems are well known in the art. The compound and pharmaceutically acceptable salts thereof are preferably assayed in vitro and in vivo, for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays can be used to determine whether it is preferable to administer the compound, a pharmaceutically acceptable salt thereof, and/or another therapeutic agent. Animal model systems can be used to demonstrate safety and efficacy.
6. EXAMPLES
6.1 EXAMPLE: IDENTIFICATION OF A DYE-LABELED TARGET
RNA BOUND TO SMALL MOLECULAR WEIGHT COMPOUNDS
The results presented in this Example indicate that gel mobility shift assays can be used to detect the binding of small molecules, such as the Tat peptide and gentamicin, to their respective target RNAs.
Materials and Methods
Buffers
Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KC1, 0.1%Triton X-100, and 0.5mM MgCl2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium chloride- magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KC1, 0.1%Triton X-100 and 5mM MgCl2.
Gel retardation analysis
RNA oligonucleotides were purchased from Dharmacon, Inc, Lafayette, CO). 500 pmole of either a 5' fluorescein labeled oligonucleotide conesponding to the 16S rRNA A site (5'-GGCGUCACACCUUCGGGUGAAGUCGCC-3' (SEQ ID NO: 1); Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al, 1991, EMBO J. 10:3099- 3103; Yoshizawa et al, 1998, EMBO J. 17:6437-6448) or a 5' fluorescein labeled oligonucleotide conesponding to the HIV-l TAR element TAR RNA (5'- GGCAGAUCUGAGCCUGGGAGCUCUCUGCC-3' (SEQ ID NO: 2); Huq et al, 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was 3' labeled with 5'-32P cytidine 3', 5'-bis(phosphate) (NEN) and T4 RNA ligase (NEBiolabs) in 10% DMSO as per manufacturer's instructions. The labeled oligonucleotides were purified using G-25 Sephadex columns (Boehringer Mannheim). For Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27: 1084-1093) was utilized with TK buffer containing 0.5mM MgCl2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 3; single letter amino acid code). For 16S rRNA-gentamicin reactions, the method of Huq et al. was used with TKM buffer. In 20 μl reaction volumes 50 pmoles of 32P cytidine-labeled oligonucleotide and either gentamicin sulfate (Sigma) or the short Tat peptide (Tat47-58) in TK or TKM buffer were heated at 90°C for 2 minutes and allow to cool to room temperature (approximately 24°C) over 2 hours. Then 10 μl of 30% glycerol was added to each reaction tube and the entire sample was loaded onto a TBE non-denaturing polyacrylamide gel and elecfrophoresed at 1200-1600 volt-hours at 4°C. The gel was exposed to an intensifying screen and radioactivity was quantitated using a Typhoon phosporimager (Molecular Dynamics).
Background
One method used to demonstrate small molecule interactions with natural occurring RNA structures such as ribosomes is by a method called chemical footprinting or toe printing (Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al, 1991, EMBO J. 10:3099-3103; Yoshizawa et al, 1998, EMBO J. 17:6437-6448). Here the use of gel mobility shift assays to monitor RNA-small molecule interactions are described. This approach allows for rapid visualization of small molecule-RNA interactions based on the difference between mobility of RNA alone versus RNA in a complex with a small molecule. To validate this approach, an RNA oligonucleotide conesponding to the well- characterized gentamicin binding site on the 16S rRNA (Moazed & Noller, 1987, Nature 327:389-394) and the equally well-characterized HJV-1 TAT protein binding site on the HIV-1 TAR element (Huq et al, 1999, Nucleic Acids Res. 27: 1084-1093) were chosen. The puφose of these experiments is to lay the groundwork for the use of chromatographic techniques in a high throughput fashion, such as microcapillary electrophoresis, for drug discovery.
Results
A gel retardation assay was performed using the Tat4 -58 peptide and the TAR RNA oligonucleotide. As shown in Figure 2, in the presence of the Tat peptide, a clear shift is visible when the products are separated on a 12% non-denaturing polyacrylamide gel. In the reaction that lacks peptide, only the free RNA is visible. These observations confirm previous reports made using other Tat peptides (Hamy et al, 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al, 1999, Nucleic Acids Res. 27: 1084- 1093). Based on the results of Figure 2, it was hypothesized that RNA interactions with small organic molecules could also be visualized using this method. As shown in Figure 3, the addition of varying concenfrations of gentamicin to an RNA oligonucleotide conesponding to the 16S rRNA A site produces a mobility shift. These results demonstrate that the binding of the small molecule gentamicin to an RNA oligonucleotide having a defined structure in solution can be monitored using this approach. In addition, as shown in Figure 3, a concentration as low as lOng/ml gentamicin produces the mobility shift. To determine whether lower concentrations of gentamicin would be sufficient to produce a gel shift, a similar experiment was performed, as shown in Figure 3, except that the concentiations of gentamicin ranged from 100 ng/ml to 10 pg/ml. As shown in Figure 4, gel mobility shifts are produced when the gentamicin concentration is as low as 10 pg/ml. Further, the results shown in Figure 4 demonstrate that the shift is specific to the 16S rRNA oligonucleotide as the use of an unrelated oligonucleotide, conesponding to the HIV TAR RNA element, does not result in a gel mobility shift when incubated with 10 mg/ml gentamicin. In addition, if a concentration as low as 10 pg/ml gentamicin produces a gel mobility shift then it should be possible to detect changes to RNA structural motifs when small amounts of compound from a library of diverse compounds is screened in this fashion. Further analysis of the gentamicin-RNA interaction indicates that the interaction is Mg- and temperature dependent. As shown in Figure 5, when MgCl2 is not present (TK buffer), lmg/ml of gentamicin must be added to the reaction to produce a gel shift. Similarly, the temperature of the reaction when gentamicin is added is also important. When gentamicin is present in the reaction during the entire denaturation/renaturation cycle, that is, when gentamicin is added at 90C°C or 85°C, a gel shift is visualized (data not shown). In contrast, when gentamicin is added after the renaturation step has proceeded to 75°C, a mobility shift is not produced. These results are consistent with the notion that gentamicin may recognize and interact with an RNA structure formed early in the renaturation process.
6.2 EXAMPLE: IDENTIFICATION OF A DYE-LABELED TARGET
RNA BOUND TO SMALL MOLECULAR WEIGHT COMPOUNDS BY CAPILLARY ELECTROPHORESIS
The results presented in this Example indicate that interactions between a peptide and its target RNA, such as the Tat peptide and TAR RNA, can be monitored by gel retardation assays in an automated capillary electrophoresis system.
Materials and Methods Buffers
Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1%Triton X-100, and 0.5mM MgCl2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium chloride- magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1 %Triton X-100 and 5mM MgCl2.
Gel Retardation Analysis Using Capillary Electrophoresis
RNA oligonucleotides were purchased from Dharmacon, hie, Lafayette, CO). 500 pmole of a 5' fluorescein labeled oligonucleotide conesponding to the HIV-1 TAR element TAR RNA (5 '-GGCAGAUCUGAGCCUGGGAGCUCUCUGCC-3 ' (SEQ ID NO: 2); Huq et al, 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al, 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was used. For Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27:1084-1093) was utilized with TK buffer containing 0.5mM MgCl2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 3); single letter amino acid code). In 20 μl reaction volumes 50 pmoles of labeled oligonucleotide and the short Tat peptide (Tat47-58) in TK or TKM buffer were heated at 90°C for 2 minutes and allow to cool to room temperature (approximately 24°C) over 2 hours. The reactions were loaded onto a SCE9610 automated capillary electiophoresis apparatus (SpectruMedix; State College, Pennsylvania). Results
As presented in the previous sections of the Example 6.1, interactions between a peptide and RNA can be monitored by gel retardation assays. It was hypothesized that interactions between a peptide and RNA could be monitored by gel retardation assays by an automated capillary electrophoresis system. To test this hypothesis, a gel retardation assay by an automated capillary electrophoresis system was performed using the Tat4 -58 peptide and the TAR RNA oligonucleotide. As shown in Figure 6 using the capillary electrophoresis system, in the presence of the Tat peptide, a clear shift is visible upon the addition of increasing concenfrations of Tat peptide. In the reaction that lacks peptide, only a peak conesponding to the free RNA is observed. These observations confirm previous reports made using other Tat peptides (Hamy et al, 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al, 1999, Nucleic Acids Res. 27: 1084- 1093). 6.3 EXAMPLE: COMPOUNDS THAT MODULATE TRANSLATION TERMINATION BIND SPECIFIC REGIONS OF 28S RRNA
Data is presented in this Example that demonstrates that specific regions of the 28S rRNA are involved in modulating translation termination in mammalian cells.
Compounds that interact in these regions or modulate local changes within these regions of the ribosome (e.g., alter base pairing interactions, base modification or modulate binding of trans-acting factors that bind to these regions) have the potential to modulate translation termination. These regions are conserved from prokaryotes to eukaryotes, but the role of these regions in modulating translation termination has not been realized in eukaryotes. h bacteria, when a short RNA fragment, complementary to the E. coli 23S rRNA segment comprising nucleotides 735 to 766 (in domain TJ), is expressed in vivo, suppression of UGA nonsense mutations, but not UAA of UAG, results (Chernyaeva et al, 1999, J Bacteriol 181 : 5257-5262). Other regions of the 23 S rRNA inE. coli have been implicated in nonsense suppression including the GTPase center in domain U (nt 1034-1120; Jemiolo et al, 1995, Proc. Nat. Acad. Sci. 92:12309-12313).
Materials and Methods
Small Molecules Involved in Modulating Translation Termination
Small molecules involved in modulating tianslation termination, i.e., nonsense suppression, were used in the footprinting experiments presented in Figures 2 to 6 and are listed as Compound A (molecular formula C1 H21NO4), Compound B (molecular formula C19H21N2O5), Compound C (molecular formula C^H^ sO), Compound D (molecular formula C23H15O Br), Compound Ε (molecular formula C19H 1NO4), Compound F, Compound G (molecular formula C12H15N5θ), Compound H (molecular formula C 3H15NO5), Compound I (molecular formula C23H15NO5), Compound J, and Compound K.
Preparation of a Translation Extract from HeLa cells
HeLa S3 cells were grown to a density of 106 cells/ml in DMEM; 5%CO2, 10%FBS, IX P/S in a spinner flask. Cells were harvested by spinning at lOOOXg. Cells were washed twice with phosphate buffered saline. The cell pellet was on ice for 12-24 hours before proceeding. By letting the cells sit on ice, the activity of the exfract is increased up to twenty-fold. The length of time on ice can range from 0 hours to 1 week. The cells were resuspended in 1.5 volumes (packed cell volume) of hypotonic buffer (10 mM HEPES (KOH) pH 7.4; 15 mM KCl; 1.5 mM Mg(OAc)2; 0.5 mM Pefabloc (Roche); 2 mM DTT). The cells were allowed to swell for 5 minutes on ice, dounce homogenized with 10 to 100 strokes using a tight-fitting pestle, and spun for 10 minutes at 12000Xg at 4°C in a Sorvall SS-34 rotor. The supernatant was collected with a Pasteur pipet without disturbing the lipid layer, fransfened into Eppendorf tubes (50 to 200 ml aliquots), and immediately frozen in liquid nitrogen.
Footprinting
Ribosomes prepared from HeLa cells were incubated with the small molecules (at a concentration of 100 μM), followed by treatment with chemical modifying agents (dimethyl sulfate [DMS] and kethoxal [KE]). Following chemical modification, rRNA was phenol-chloroform extracted, ethanol precipitated, analyzed in primer extension reactions using end-labeled oligonucleotides hybridizing to different regions of the rRNAs and resolved on 6% polyacrylamide gels. The probes used for primer extension cover the entire 18S (7 oligonucleotide primers), 28S (24 oligonucleotide primers), and 5S (one primer) rRNAs are presented in Table 1 (also see, e.g., Gonzalez et al., 1985 Proc Natl Acad Sci U S A. 82(22):7666-70 and McCallum & Maden, 1985, Biochem. J. 232 (3): 725-733). Controls in these experiments include DMSO (a control for changes in rRNA accessibility induced by DMSO), paromomycin (a marker for 18S rRNA binding), and anisomycin (a marker for 28S rRNA binding).
Table 1 : 18S, 28S, and 5S rRNA primers
5S#1 AAAGCCTACAGCACCC SEQ ID NO.: 4
28S#1 TACTGAGGGAATCCTGG SEQ ID NO.: 5
28S#2 TTACCACCCGCTTTGGG SEQ ID NO.: 6
28S#3 GGGGGCGGGAAAGATCC SEQ ID NO.: 7
28S#4 CCCCGAGCCACCTTCCC SEQ IDNO.: 8
28S#5 GGCCCCGGGATTCGGCG SEQ ID NO.: 9
28S#6 CACTGGGGACAGTCCGC SEQ ID NO.: 10
28S#7 CGCGGCGGGCGAGACGGG SEQ IDNO.: 11
28S#8 GAGGGAAACTTCGGAGGG SEQ ID NO.: 12
28S#9 CATCGGGCGCCTTAACCC SEQ ID NO.: 13
28S#10 CGACGCACACCACACGC SEQ ID NO.: 14
28S#11 CCAAGATCTGCACCTGC SEQ IDNO.: 15
28S#12 TTACCGCACTGGACGCC SEQ ID NO.: 16
28S#13 GCCAGAGGCTGTTCACC SEQ ID NO.: 17
28S#14 TGGGGAGGGAGCGAGCGGCG SEQ ID NO.: 18
28S#15 AAGGGCCCGGCTCGCGTCC SEQ ID NO.: 19
28S#16 AGGGCGGGGGGACGAACCGC SEQ ID NO.: 20
28S#17 TTAAACAGTCGGATTCCCCTGG SEQ ID NO.: 21 28S#18 TTCATCCATTCATGCGCG SEQ ID NO.: 22
28S#19 AGTAGTGGTATTTCACCGG SEQ ID NO.: 23
28S#20 ACGGGAGGTTTCTGTCC SEQ ID NO.: 24
28S#21 ACAATGATAGGAAGAGCCG SEQ ID NO.: 25
28S#22 AGGCGTTCAGTCATAATCCC SEQ ID NO.: 26
28S#23 TCCGCACCGGACCCCGGTCC SEQ ID NO.: 27
28S#24 GGGCTAGTTGATTCGGCAGGTGAGTTG SEQ ID NO.: 28
18S#1 TCTCCGGAATCGAACCCT SEQ ID NO.: 29
18S#2 ATT ACC GCGGCTGCTGGC SEQ ID NO.: 30
18S#3 TTGGCAAATGCTTTCGC SEQ ID NO.: 31
18S#4 CCGTCAATTCCTTTAAGTTTC SEQ ID NO.: 32
18S#5 AGGGCATCACAGACCTGTTAT SEQ ID NO.: 33
18S#6 CGACGGGCGGTGTGTAC SEQ ID NO.: 34
18S#7 CCGCAGGTTCACCTACGG SEQ ID NO.: 35
Results
The results of these foot-printing experiments (see, e.g., Figures 7 to 11) indicated that the small molecules involved in modulating translation termination alter the accessibility of the chemical modifying agents to specific nucleotides in the 28S rRNA. More specifically, the regions protected by the small molecules include a conserved region in the vicinity of the peptidyl fransferase center (domain V, see, e.g., Figures 7 and 8) implicated in peptide bond formation and a conserved region in domain II (see, e.g., Figures 9, 10, and 11) that may interact with the peptidyl fransferase center based on binding of vernamycin B to both these areas (Vannuffel et al., 1994, Nucleic Acids Res. 22(21):4449-53).
6.4 EXAMPLE: HIGH THROUGHPUT IDENTIFICATION OF COMPOUNDS USING ARRAYS
To identify molecules of the invention, high throughput assays that enable each compound to be screened against many different nucleic acids in a parallel manner are used. In brief, synthesis beads, with compounds of the invention attached, are distributed into micro titer plates at a density of one bead per well. Compounds of the invention that are attached to the beads are then released from the beads and dissolved in a small amount of solvent in each microtiter well. A high precision technique, such as a robotic anayer, is then used to transfer small volumes of solution containing dissolved compounds of the invention from each microtiter well, delivering the compounds to defined locations on glass slides. The glass slides are derivatized so that the compounds of the invention are immobilized on the surface of the slide. Each compound contains a functional group that allows for its immobilization on the glass slide. Each slide is then probed with a labeled RNA and binding events are detected by, e.g., a fluorescence-linked assay that is able to detect the label.
6.5 EXAMPLE: HUMAN DISEASE GENES SORTED BY CHROMOSOME
Table 2: Genes, Locations and Genetic Disorders on Chromosome 1
Figure imgf000141_0001
Figure imgf000142_0001
Figure imgf000143_0001
Figure imgf000144_0001
Figure imgf000145_0001
Figure imgf000146_0001
Figure imgf000147_0001
Table 3: Genes, Locations and Genetic Disorders on Chromosome 2
Figure imgf000148_0001
Figure imgf000149_0001
Figure imgf000150_0001
Figure imgf000151_0001
Figure imgf000152_0001
Table 4: Genes, Locations and Genetic Disorders on Chromosome 3
Figure imgf000152_0002
Figure imgf000153_0001
Figure imgf000154_0001
Figure imgf000155_0001
Figure imgf000156_0001
Table 5: Genes, Locations and Genetic Disorders on Chromosome 4
Figure imgf000156_0002
Figure imgf000157_0001
Figure imgf000158_0001
Figure imgf000159_0001
Table 6: Genes, Locations and Genetic Disorders on Chromosome 5
Figure imgf000160_0001
Figure imgf000161_0001
Figure imgf000162_0001
Table 7: Genes, Locations and Genetic Disorders on Chromosome 6
Figure imgf000162_0002
Figure imgf000163_0001
Figure imgf000164_0001
Figure imgf000165_0001
Figure imgf000166_0001
Figure imgf000167_0001
Figure imgf000168_0001
Figure imgf000169_0001
Table 9: Genes, Locations and Genetic Disorders on Chromosome 8
Figure imgf000170_0001
Figure imgf000171_0001
Figure imgf000172_0001
Table 10: Genes, Locations and Genetic Disorders on Chromosome 9
Figure imgf000172_0002
Figure imgf000173_0001
Figure imgf000174_0001
Table 11: Genes, Locations and Genetic Disorders on Chromosome 10
Figure imgf000174_0002
Figure imgf000175_0001
Figure imgf000176_0001
Table 12: Genes, Locations and Genetic Disorders on Chromosome 11
Figure imgf000176_0002
Figure imgf000177_0001
Figure imgf000178_0001
Figure imgf000179_0001
Figure imgf000180_0001
Table 13: Genes, Locations and Genetic Disorders on Chromosome 12
Figure imgf000181_0001
Figure imgf000182_0001
Figure imgf000183_0001
Figure imgf000184_0001
Table 14: Genes, Locations and Genetic Disorders on Chromosome 13
Figure imgf000184_0002
Figure imgf000185_0001
Table 15: Genes, Locations and Genetic Disorders on Chromosome 14
Figure imgf000185_0002
Figure imgf000186_0001
Figure imgf000187_0001
Table 16: Genes, Locations and Genetic Disorders on Chromosome 15
Figure imgf000187_0002
Figure imgf000188_0001
Figure imgf000189_0001
Table 17: Genes, Locations and Genetic Disorders on Chromosome 16
Figure imgf000189_0002
Figure imgf000190_0001
Figure imgf000191_0001
Table 18: Genes, Locations and Genetic Disorders on Chromosome 17
Figure imgf000191_0002
Figure imgf000192_0001
Figure imgf000193_0001
Figure imgf000194_0001
Figure imgf000195_0001
Table 19: Genes, Locations and Genetic Disorders on Chromosome 18
Figure imgf000195_0002
Figure imgf000196_0001
Table 20: Genes, Locations and Genetic Disorders on Chromosome 19
Figure imgf000196_0002
Figure imgf000197_0001
Figure imgf000198_0001
Figure imgf000199_0001
Table 21: Genes, Locations and Genetic Disorders on Chromosome 20
Figure imgf000199_0002
Figure imgf000200_0001
Figure imgf000201_0001
Table 22: Genes, Locations and Genetic Disorders on Chromosome 21
Figure imgf000201_0002
Figure imgf000202_0001
Table 23: Genes, Locations and Genetic Disorders on Chromosome 22
Figure imgf000202_0002
Figure imgf000203_0001
Table 24: Genes, Locations and Genetic Disorders on Chromosome X
Figure imgf000203_0002
Figure imgf000204_0001
Figure imgf000205_0001
Figure imgf000206_0001
Figure imgf000207_0001
Figure imgf000208_0001
Figure imgf000209_0001
Figure imgf000210_0001
Figure imgf000211_0001
Figure imgf000212_0001
Table 25: Genes, Locations and Genetic Disorders on Chromosome Y
Figure imgf000213_0001
Figure imgf000213_0002
Figure imgf000214_0001
Figure imgf000215_0001
Figure imgf000216_0001
Figure imgf000217_0001
Equivalents:
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.
The invention can be illustrated by the following embodiments enumerated in the numbered paragraphs that follow:
1. A method for identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, comprising the steps of (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds so that a detectably labeled target RNA:compound complex is formed; (b) separating the detectably labeled target RNAxompound complex formed in step (a) from uncomplexed target RNA molecules and compounds; and (c) determining a structure of the compound bound to the RNA in the RNAxompound complex.
2. A method for identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, comprising the steps of (a) contacting a target RNA molecule with a library of detectably labeled compounds under conditions that permit direct binding of the target RNA to a member of the library of labeled compounds so that a target RNAxompound complex that is detectably labeled is formed; (b) separating the target RNAxompound complex formed in step (a) from uncomplexed target RNA molecules and compounds; and (c) determining a structure of the compound bound to the RNA in the RNAxompound complex.
3. The method of paragraph 1 in which the target RNA molecule contains regions of 28S rRNA or analogs thereof.
4. The method of paragraph 1 in which the detectably labeled RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, specfroscopic colorimetric label, affinity tag, or nanoparticle.
5. The method of paragraph 1 in which the compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; ohgocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries, including but not limited to, libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pynolidines, morpholino compounds, or diazepindiones.
6. The method of paragraph 1 in which screening a library of compounds comprises contacting the compound with the target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. 7. The method of paragraph 6 in which the aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.
8. The method of paragraph 6 in which the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant, hi another embodiment, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCI, and from about 0 mM to about 200 mM MgCl2. i a preferred embodiment, the combination of salts is about 100 mM KCl, 500 mM NaCI, and 10 mM MgCl2. In another embodiment, the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
9. Any method that detects an altered physical property of a target nucleic acid complexed to a compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids in the method of paragraph 1. h a preferred embodiment, electrophoresis is used for separation of the complexed and non-complexed target nucleic acids, hi a preferred embodiment, the electiophoresis is capillary electrophoresis. hi other embodiments, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships ("SAR") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation are used for the separation of the complexed and non-complexed target nucleic acids.
10. The structure of the compound of the RNAxompound complex of paragraph 1 is determined, in part, by the type of library of compounds, hi a preferred embodiment wherein the combinatorial libraries are small organic molecule libraries, mass spectroscopy, NMR, or vibration spectroscopy are used to determine the structure of the compounds.

Claims

WHAT IS CLAIMED IS:
1. A method for identifying a compound that binds to a target RNA, said method comprising
(a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; and (b) detecting the formation of a detectably labeled target
RNAxompound complex.
2. A method for identifying a compound to test for its ability to modulate premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28 S rRNA or contains a premature stop codon; and
(b) detecting a detectably labeled target RNAxompound complex formed in step(a), so that if a target RNAxompound complex is detected then the compound identified is tested for its ability to modulate premature translation or nonsense- mediated mRNA delay.
3. A method for identifying a compound that binds to a target RNA, said method comprising detecting the formation of a detectably labeled target RNAxompound complex formed from contacting a detectably labeled RNA with a member of a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon.
4. A method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising:
(a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; and
(b) detecting a detectably labeled target RNAxompound complex formed in step(a), so that if a target RNAxompound complex is detected, then
(c) contacting the compound with a cell-free translation mixture and a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and
(d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control.
5. A method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay, said method comprising: (a) contacting a detectably labeled target RNA molecule with a library of compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of compounds and the formation of a detectably labeled target RNAxompound complex, wherein the target RNA is a region of 28S rRNA or contains a premature stop codon; and
(b) detecting a detectably labeled target RNAxompound complex formed in step(a), so that if a target RNAxompound complex is detected, then (c) contacting the compound with a cell containing a nucleic acid sequence comprising a regulatory element operably linked to a reporter gene, wherein the reporter gene contains a premature stop codon; and (d) detecting the expression of the reporter gene, wherein a compound that modulates premature translation termination or nonsense-mediated mRNA decay is identified if the expression of the reporter gene in the presence of the compound is altered relative to the expression of the reporter gene in the absence of the compound or the presence of a negative control.
6. The method of claim 1, 2, 3, 4 or 5, wherein each compound in the library is attached to a solid support.
7. The method of claim 6, wherein the solid support is a silica gel, a resin, a derivatived plastic film, a glass bead, cotton, a plastic bead, a polystyrene bead, an aluminum gel, a glass slide or a polysaccharide.
8. The method of claim 1, 2, 3, 4 or 5, wherein the library of compounds is attached to a chip.
9. The method of claim 1, 2, 3, 4 or 5, wherein the detectably labeled RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, specfroscopic colorimetric label, affinity tag, or nanoparticle.
10. The method of claim 1, 2, 3, 4 or 5, wherein the compound is a combinatorial library of compounds comprising peptoids; random biooligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; or small organic molecule libraries.
11. The method of claim 10, wherein the small organic molecule libraries are libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones.
12. The method of claim 1, 2, 3, 4 or 5, wherein the detectably labeled target RNAxompound complex is detected by electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure- activity relationships ("SAR") by NMR spectroscopy, size exclusion chromatography, affinity chromatography, or nanoparticle aggregation.
13. The method of claim 1, 2, 3, 4 or 5, wherein the method further comprises determining the structure of the compound.
14. The method of claim 13, wherein the structure of the compound is determined by mass spectroscopy, NMR, X-ray crystallography, Edman degradation or vibration spectroscopy.
15. The method of claim 1, 2, 3, 4 or 5, wherein the premature stop codon is UAG, UGA or UAA.
PCT/US2003/023075 2002-07-24 2003-07-24 METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY Ceased WO2004010106A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002493808A CA2493808A1 (en) 2002-07-24 2003-07-24 Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mrna decay
US10/521,775 US7927791B2 (en) 2002-07-24 2003-07-24 Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mRNA decay
AU2003252136A AU2003252136A1 (en) 2002-07-24 2003-07-24 METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY
EP03765998A EP1543157A4 (en) 2002-07-24 2003-07-24 METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US39833202P 2002-07-24 2002-07-24
US39834402P 2002-07-24 2002-07-24
US60/398,344 2002-07-24
US60/398,332 2002-07-24

Publications (2)

Publication Number Publication Date
WO2004010106A2 true WO2004010106A2 (en) 2004-01-29
WO2004010106A3 WO2004010106A3 (en) 2004-08-26

Family

ID=30773079

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/023075 Ceased WO2004010106A2 (en) 2002-07-24 2003-07-24 METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY

Country Status (5)

Country Link
US (1) US7927791B2 (en)
EP (1) EP1543157A4 (en)
AU (1) AU2003252136A1 (en)
CA (1) CA2493808A1 (en)
WO (1) WO2004010106A2 (en)

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007083094A1 (en) * 2006-01-18 2007-07-26 University Court Of The University Of Dundee Prevention/treatment of ichthyosis vulgaris, atopy and other disorders
US7291461B2 (en) 2002-06-21 2007-11-06 Ptc Therapeutics, Inc. Methods for identifying small molecules that modulate premature translation termination and nonsense mRNA decay
EP2251437A1 (en) 2009-05-13 2010-11-17 Hannelore Breitenbach-Koller Method for identifying compounds that control the translational activity of ribosomal proteins in differential mRNA expression
US7927791B2 (en) 2002-07-24 2011-04-19 Ptc Therapeutics, Inc. Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mRNA decay
EP2387995A1 (en) 2006-03-30 2011-11-23 PTC Therapeutics, Inc. Methods for the production of functional protein from DNA having a nonsense mutation and the treatment of disorders associated therewith
WO2013151668A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2014028537A1 (en) * 2012-08-14 2014-02-20 10X Technologies, Inc. Microcapsule compositions and methods
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US8999635B2 (en) 2005-12-15 2015-04-07 University Court Of The University Of Dundee Filaggrin
WO2015051214A1 (en) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2015082658A1 (en) * 2013-12-04 2015-06-11 Evolva Sa Methods and materials for identifying compounds promoting translational read-through of nonsense mutations
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US9388465B2 (en) 2013-02-08 2016-07-12 10X Genomics, Inc. Polynucleotide barcode generation
US9410201B2 (en) 2012-12-14 2016-08-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9694361B2 (en) 2014-04-10 2017-07-04 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US9701998B2 (en) 2012-12-14 2017-07-11 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9824068B2 (en) 2013-12-16 2017-11-21 10X Genomics, Inc. Methods and apparatus for sorting data
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9951386B2 (en) 2014-06-26 2018-04-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9975122B2 (en) 2014-11-05 2018-05-22 10X Genomics, Inc. Instrument systems for integrated sample processing
US10011872B1 (en) 2016-12-22 2018-07-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10221436B2 (en) 2015-01-12 2019-03-05 10X Genomics, Inc. Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same
US10221442B2 (en) 2012-08-14 2019-03-05 10X Genomics, Inc. Compositions and methods for sample processing
US10273541B2 (en) 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10287623B2 (en) 2014-10-29 2019-05-14 10X Genomics, Inc. Methods and compositions for targeted nucleic acid sequencing
US10323279B2 (en) 2012-08-14 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10395758B2 (en) 2013-08-30 2019-08-27 10X Genomics, Inc. Sequencing methods
US10400280B2 (en) 2012-08-14 2019-09-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10400235B2 (en) 2017-05-26 2019-09-03 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US10428326B2 (en) 2017-01-30 2019-10-01 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
US10533221B2 (en) 2012-12-14 2020-01-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10550429B2 (en) 2016-12-22 2020-02-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10650912B2 (en) 2015-01-13 2020-05-12 10X Genomics, Inc. Systems and methods for visualizing structural variation and phasing information
US10697000B2 (en) 2015-02-24 2020-06-30 10X Genomics, Inc. Partition processing methods and systems
US10745742B2 (en) 2017-11-15 2020-08-18 10X Genomics, Inc. Functionalized gel beads
US10752949B2 (en) 2012-08-14 2020-08-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10774370B2 (en) 2015-12-04 2020-09-15 10X Genomics, Inc. Methods and compositions for nucleic acid analysis
US10815525B2 (en) 2016-12-22 2020-10-27 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10829815B2 (en) 2017-11-17 2020-11-10 10X Genomics, Inc. Methods and systems for associating physical and genetic properties of biological particles
US10839939B2 (en) 2014-06-26 2020-11-17 10X Genomics, Inc. Processes and systems for nucleic acid sequence assembly
US10854315B2 (en) 2015-02-09 2020-12-01 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
US11081208B2 (en) 2016-02-11 2021-08-03 10X Genomics, Inc. Systems, methods, and media for de novo assembly of whole genome sequence data
US11084036B2 (en) 2016-05-13 2021-08-10 10X Genomics, Inc. Microfluidic systems and methods of use
US11155881B2 (en) 2018-04-06 2021-10-26 10X Genomics, Inc. Systems and methods for quality control in single cell processing
US11274343B2 (en) 2015-02-24 2022-03-15 10X Genomics, Inc. Methods and compositions for targeted nucleic acid sequence coverage
US11591637B2 (en) 2012-08-14 2023-02-28 10X Genomics, Inc. Compositions and methods for sample processing
US11629344B2 (en) 2014-06-26 2023-04-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11773389B2 (en) 2017-05-26 2023-10-03 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US11898206B2 (en) 2017-05-19 2024-02-13 10X Genomics, Inc. Systems and methods for clonotype screening
WO2024006765A3 (en) * 2022-06-27 2024-04-18 Wisconsin Alumni Research Foundation Universal method for parasite and eukaryotic endosymbiont identification
US12163191B2 (en) 2014-06-26 2024-12-10 10X Genomics, Inc. Analysis of nucleic acid sequences
US12264411B2 (en) 2017-01-30 2025-04-01 10X Genomics, Inc. Methods and systems for analysis
US12312640B2 (en) 2014-06-26 2025-05-27 10X Genomics, Inc. Analysis of nucleic acid sequences
US12421558B2 (en) 2020-02-13 2025-09-23 10X Genomics, Inc. Systems and methods for joint interactive visualization of gene expression and DNA chromatin accessibility
US12427518B2 (en) 2016-05-12 2025-09-30 10X Genomics, Inc. Microfluidic on-chip filters

Families Citing this family (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060228730A1 (en) * 2001-04-11 2006-10-12 Rando Robert F Methods for identifying small molecules that bind specific RNA structural motifs
JP4681455B2 (en) * 2004-02-04 2011-05-11 田辺三菱製薬株式会社 Paraoxonase-containing preparation
US7414723B2 (en) * 2004-02-23 2008-08-19 Malvern Instruments Incorporated Automated interleaved spectral imaging calibration
DE102004021707A1 (en) * 2004-04-30 2005-11-24 Cytotools Gmbh Process for the isolation of specific molecules that bind highly selectively to selected target molecules
US9488655B2 (en) * 2004-07-14 2016-11-08 The Regents Of The University Of California Biomarkers for detection of early- and late-stage endometrial cancer
EP2199801B1 (en) * 2004-07-14 2013-05-29 The Regents of The University of California Biomarkers for early detection of ovarian cancer
WO2012047930A2 (en) 2010-10-04 2012-04-12 The Regents Of The University Of California Compositions and methods for treatment of gynecologic cancers
EP1836302B1 (en) * 2004-12-23 2010-04-14 Amersham Biosciences Corp. Ligation-based rna amplification
EP2198040B1 (en) * 2007-08-31 2018-08-15 Case Western Reserve University In vivo imaging of myelin
US8097434B2 (en) 2007-10-19 2012-01-17 Becton, Dickinson And Company Methods for the detection of beta-lactamases
WO2010047778A1 (en) 2008-10-20 2010-04-29 Becton Dickinson And Company Compositions for the detection of intracellular bacterial targets and other intracellular microorganism targets
WO2010123993A1 (en) * 2009-04-21 2010-10-28 Tuan Vo-Dinh Non-invasive energy upconversion methods and systems for in-situ photobiomodulation
US8956859B1 (en) 2010-08-13 2015-02-17 Aviex Technologies Llc Compositions and methods for determining successful immunization by one or more vaccines
US9474454B2 (en) * 2010-10-20 2016-10-25 Advanced Mri Technologies Llc MRI using faster multiplexed echo planar imaging (EPI) pulse sequences
US9241976B2 (en) 2011-08-29 2016-01-26 The Regents Of The University Of California Use of HDL-related molecules to treat and prevent proinflammatory conditions
DE19216461T1 (en) 2011-10-03 2021-10-07 Modernatx, Inc. MODIFIED NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS AND USES THEREOF
CA3018046A1 (en) 2011-12-16 2013-06-20 Moderna Therapeutics, Inc. Modified nucleoside, nucleotide, and nucleic acid compositions
US20150141274A1 (en) * 2012-05-09 2015-05-21 The Rockefeller University Methods and Compositions for Activity Dependent Transcriptome Profiling
US9422602B2 (en) 2012-08-15 2016-08-23 Bio-Rad Laboratories, Inc. Methods and compositions for determining nucleic acid degradation
PL2922554T3 (en) 2012-11-26 2022-06-20 Modernatx, Inc. Terminally modified rna
JP6278551B2 (en) * 2013-01-31 2018-02-14 オリンパス株式会社 Contrast agent, production method and production kit
WO2014180996A1 (en) * 2013-05-10 2014-11-13 Embl Use of 5-azacytidine to inhibit nonsense-mediated rna decay (nmd)
WO2016025801A1 (en) * 2014-08-14 2016-02-18 University Of Rochester Compositions and methods for treating diseases associated with nonsense-mediated decay resistant mrna
KR101745590B1 (en) * 2015-11-13 2017-06-09 고려대학교 산학협력단 Optical Microscopy for RNA Splicing on Single Molecules Using Scattering Intensity, Localized Surface Plasmon Resonance and Surface-Enhanced Raman Scattering
US10234524B2 (en) * 2016-10-18 2019-03-19 Siemens Healthcare Gmbh Shifted pulses for simultaneous multi-slice imaging
WO2018160405A1 (en) * 2017-03-03 2018-09-07 Waters Technologies Corporation Method and system for screening of cells and organoids
KR20200057071A (en) * 2017-09-25 2020-05-25 스카이호크 테라퓨틱스, 인코포레이티드 Methods and compositions for screening and identification of splicing modulators
CN119264211A (en) 2018-08-27 2025-01-07 瑞泽恩制药公司 Application of Raman spectroscopy in downstream purification
WO2020117715A1 (en) 2018-12-03 2020-06-11 Board Of Regents, The University Of Texas System Oligo-benzamide analogs and their use in cancer treatment
DE102020120218A1 (en) 2020-07-31 2022-02-03 KBHB Consult GmbH Molecules directed against the ribosomal protein rpL35/uL29 for use in the treatment of diseases, in particular epidermolysis bullosa (EB)
EP4368729A1 (en) 2022-11-09 2024-05-15 Merck Patent GmbH Molecules targeting ribosomal protein rpl40 for use in cosmetics and the treatment of diseases of the skin

Family Cites Families (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US566341A (en) * 1896-08-25 Herbert
IT1176332B (en) * 1984-06-27 1987-08-18 Erba Farmitalia PROCEDURE FOR THE PREPARATION OF PEPTIDES
US5015570A (en) * 1988-05-13 1991-05-14 Molecular Therapeutics, Inc. Molecular diagnosis of Alzheimer Disease
US5650489A (en) * 1990-07-02 1997-07-22 The Arizona Board Of Regents Random bio-oligomer library, a method of synthesis thereof, and a method of use thereof
US5998603A (en) * 1994-09-29 1999-12-07 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analogs, and oligomers thereof
WO1993013114A1 (en) * 1991-12-24 1993-07-08 Isis Pharmaceuticals, Inc. COMPOSITIONS AND METHODS FOR MODULATING β-AMYLOID
US5663317A (en) * 1992-03-02 1997-09-02 The Board Of Trustees Of The Leland Stanford Jr. Univ. Microorganism having attenuated invasiveness
US5470705A (en) * 1992-04-03 1995-11-28 Applied Biosystems, Inc. Probe composition containing a binding domain and polymer chain and methods of use
US6391542B1 (en) * 1992-09-10 2002-05-21 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of Hepatitis C virus-associated diseases
US5721099A (en) * 1992-10-01 1998-02-24 Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
DK0705279T3 (en) * 1993-05-27 2003-06-10 Selectide Corp Topologically separate, solid-phase coding libraries
WO1995005389A1 (en) 1993-08-18 1995-02-23 The Board Of Trustees Of The Leland Stanford Junior University Sequence-specific glycoconjugate transcriptional antagonists
JPH09504176A (en) * 1993-10-25 1997-04-28 ライボジーン、インコーポレイテッド Antifungal selection method
JPH09511486A (en) * 1994-01-13 1997-11-18 ザ・トラスティーズ・オブ・コランビア・ユニバーシティー・イン・ザ・シティー・オブ・ニューヨーク Synthetic receptors, libraries and their use
US5667975A (en) * 1994-05-06 1997-09-16 The University Of North Carolina Method of fluorescent detection of nucleic acids and cytoskeleton elements using bis-dicationic aryl furans
US5643722A (en) * 1994-05-11 1997-07-01 Trustees Of Boston University Methods for the detection and isolation of proteins
US5650316A (en) * 1994-06-06 1997-07-22 Research Development Foundation Uses of triplex forming oligonucleotides for the treatment of human diseases
US5712096A (en) * 1994-08-23 1998-01-27 University Of Massachusetts Medical Center Oligoribonucleotide assays for novel antibiotics
US6071700A (en) * 1995-01-20 2000-06-06 University Of Massachusetts Heterologous polypeptide production in the absence of nonsense-mediated MRNA decay functions
US5679566A (en) * 1995-01-20 1997-10-21 University Of Massachusetts Medical Center Yeast NMD2 gene
US5593835A (en) * 1995-05-12 1997-01-14 President And Fellows Of Harvard College Methods and kits for RNA binding compounds
EP0791008A4 (en) 1995-09-08 2003-04-23 Anadys Pharmaceuticals Inc SCREENING METHOD FOR CONNECTIONS HAVING AN AFNESS TO RNS
US5666341A (en) 1995-09-18 1997-09-09 Matsushita Electric Industrial Co., Ltd. Data detection apparatus
US5716825A (en) * 1995-11-01 1998-02-10 Hewlett Packard Company Integrated nucleic acid analysis system for MALDI-TOF MS
US5840702A (en) * 1996-03-22 1998-11-24 Uab Research Foundation Cystic fibrosis treatment
US5866341A (en) * 1996-04-03 1999-02-02 Chugai Pharmaceutical Co., Ltd. Compositions and methods for screening drug libraries
US6107029A (en) * 1996-07-31 2000-08-22 Message Pharmaceticals, Inc. Universal method for detecting interactions between RNA molecules and RNA binding proteins
US6004749A (en) * 1996-07-31 1999-12-21 Message Pharmaceuticals Method for identifying compounds affecting RNA/RNA binding protein interactions
US6060240A (en) * 1996-12-13 2000-05-09 Arcaris, Inc. Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom
WO1999020797A1 (en) 1997-10-21 1999-04-29 University Of Massachusetts HETEROLOGOUS POLYPEPTIDE PRODUCTION IN THE ABSENCE OF NONSENSE-MEDIATED mRNA DECAY FUNCTION
CA2309535A1 (en) 1997-11-12 1999-05-20 Brigham And Women's Hospital, Inc. The translation enhancer element of the human amyloid precursor protein gene
US6211477B1 (en) * 1998-02-26 2001-04-03 Becton Dickinson And Company Electrostatic deceleration system for flow cytometer
US6428956B1 (en) * 1998-03-02 2002-08-06 Isis Pharmaceuticals, Inc. Mass spectrometric methods for biomolecular screening
US6207391B1 (en) * 1998-03-31 2001-03-27 Tularik Inc. High-throughput screening assays for modulators of STAT4 and STAT6 activity
AU766146B2 (en) * 1998-05-26 2003-10-09 University Of Medicine And Dentistry Of New Jersey System for reproducing and modulating stability and turnover of RNA molecules
JP2004500541A (en) 1998-07-10 2004-01-08 セテク コーポレイション Methods for the detection and analysis of strong binding ligands in complex biochemical samples
JP4278872B2 (en) 1998-08-17 2009-06-17 フィロス インク. Identification of compound-protein interaction using protein-nucleic acid fusion molecule library
US6420109B1 (en) * 1998-09-11 2002-07-16 Genelabs Technologies, Inc. Nucleic acid ligand interaction assays
US6147344A (en) * 1998-10-15 2000-11-14 Neogenesis, Inc Method for identifying compounds in a chemical mixture
WO2000036152A1 (en) * 1998-12-14 2000-06-22 Li-Cor, Inc. A system and methods for nucleic acid sequencing of single molecules by polymerase synthesis
DE60042338D1 (en) * 1999-10-04 2009-07-16 Univ New Jersey Med TAR RNA binding peptides
US6458538B1 (en) * 1999-12-14 2002-10-01 Ptc Therapeutics, Inc. Methods of assaying for compounds that inhibit premature translation termination and nonsense-mediated RNA decay
US20060228730A1 (en) * 2001-04-11 2006-10-12 Rando Robert F Methods for identifying small molecules that bind specific RNA structural motifs
WO2002083837A1 (en) 2001-04-11 2002-10-24 Ptc Therapeutics, Inc. Methods for identifying small molecules that bind specific rna structural motifs
US20040219545A1 (en) * 2001-04-13 2004-11-04 Rando Robert F. Methods for identifying small molecules that bind specific rna structural motifs
WO2002083953A1 (en) 2001-04-11 2002-10-24 Ptc Therapeutics, Inc. Methods for identifying small molecules that bind specific rna structural motifs
JP2004536063A (en) * 2001-05-18 2004-12-02 ゾルファイ ファーマスーティカルズ ゲゼルシャフト ミット ベシュレンクテル ハフツング Use of combined compounds having NEP / MP-inhibitory activity in the manufacture of a medicament
ZA200204907B (en) * 2001-06-26 2003-03-03 Univ Nat Taiwan Collapsin Response Mediator Protein-1.
AU2003247610A1 (en) * 2002-06-21 2004-01-06 Ptc Therapeutics, Inc. METHODS FOR IDENTIFYING SMALL MOLECULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY
AU2003256755A1 (en) * 2002-07-24 2004-02-09 Ptc Therapeutics, Inc. Ureido substituted benzoic acid compounds, their use for nonsense suppression and the treatment of diseases caused by such mutations
WO2004009610A2 (en) * 2002-07-24 2004-01-29 Ptc Therapeutics, Inc. Use of nucleoside compounds for nonsense suppression and the treatment of genetic diseases
AU2003252136A1 (en) 2002-07-24 2004-02-09 Ptc Therapeutics, Inc. METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY
US7247741B2 (en) * 2005-01-21 2007-07-24 Ptc Therapeutics, Inc. Acetylamino benzoic acid compounds and their use for nonsense suppression and the treatment of disease
US7291603B2 (en) * 2002-07-24 2007-11-06 Ptc Therapeutics, Inc. Nucleoside compounds and their use for treating cancer and diseases associated with somatic mutations
HUE047569T2 (en) * 2003-04-11 2020-04-28 Ptc Therapeutics Inc 1,2,4-oxadiazole benzoic acid compound and its use for nonsense suppression and the treatment of disease
US20060067900A1 (en) * 2004-09-29 2006-03-30 Isp Investments Inc. Method and composition for imparting high shine to a polymeric substrate
US20080207538A1 (en) 2004-03-11 2008-08-28 Lawrence David S Enhanced Production of Functional Proteins From Defective Genes
EP2402323A3 (en) 2004-10-13 2012-05-30 PTC Therapeutics, Inc. Pyrazole or triazole compounds and their use for the manufacture of a medicament for treating somatic mutation-related diseases
US7379842B2 (en) * 2005-01-25 2008-05-27 Drop Zone Corp. Hang timer for determining time of flight of an object

Cited By (155)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7291461B2 (en) 2002-06-21 2007-11-06 Ptc Therapeutics, Inc. Methods for identifying small molecules that modulate premature translation termination and nonsense mRNA decay
US7927791B2 (en) 2002-07-24 2011-04-19 Ptc Therapeutics, Inc. Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mRNA decay
US8999635B2 (en) 2005-12-15 2015-04-07 University Court Of The University Of Dundee Filaggrin
WO2007083094A1 (en) * 2006-01-18 2007-07-26 University Court Of The University Of Dundee Prevention/treatment of ichthyosis vulgaris, atopy and other disorders
US8338386B2 (en) 2006-01-18 2012-12-25 University Court Of The University Of Dundee Prevention/treatment of ichthyosis vulgaris, atopy and other disorders
EP2387995A1 (en) 2006-03-30 2011-11-23 PTC Therapeutics, Inc. Methods for the production of functional protein from DNA having a nonsense mutation and the treatment of disorders associated therewith
EP2251437A1 (en) 2009-05-13 2010-11-17 Hannelore Breitenbach-Koller Method for identifying compounds that control the translational activity of ribosomal proteins in differential mRNA expression
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10064959B2 (en) 2010-10-01 2018-09-04 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
WO2013151668A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of secreted proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US10501512B2 (en) 2012-04-02 2019-12-10 Modernatx, Inc. Modified polynucleotides
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
WO2013151666A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of biologics and proteins associated with human disease
WO2013151736A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics In vivo production of proteins
US9695468B2 (en) 2012-08-14 2017-07-04 10X Genomics, Inc. Methods for droplet-based sample preparation
US10669583B2 (en) 2012-08-14 2020-06-02 10X Genomics, Inc. Method and systems for processing polynucleotides
US9689024B2 (en) 2012-08-14 2017-06-27 10X Genomics, Inc. Methods for droplet-based sample preparation
US11035002B2 (en) 2012-08-14 2021-06-15 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11078522B2 (en) 2012-08-14 2021-08-03 10X Genomics, Inc. Capsule array devices and methods of use
US10752950B2 (en) 2012-08-14 2020-08-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
CN113528634A (en) * 2012-08-14 2021-10-22 10X基因组学有限公司 Microcapsule compositions and methods
US11359239B2 (en) 2012-08-14 2022-06-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10752949B2 (en) 2012-08-14 2020-08-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11441179B2 (en) 2012-08-14 2022-09-13 10X Genomics, Inc. Methods and systems for processing polynucleotides
AU2013302756B2 (en) * 2012-08-14 2018-02-08 10X Genomics, Inc. Microcapsule compositions and methods
JP2015528283A (en) * 2012-08-14 2015-09-28 テンエックス・ジェノミクス・インコーポレイテッド Microcapsule composition and method
US11591637B2 (en) 2012-08-14 2023-02-28 10X Genomics, Inc. Compositions and methods for sample processing
US11021749B2 (en) 2012-08-14 2021-06-01 10X Genomics, Inc. Methods and systems for processing polynucleotides
AU2013302756C1 (en) * 2012-08-14 2018-05-17 10X Genomics, Inc. Microcapsule compositions and methods
US10626458B2 (en) 2012-08-14 2020-04-21 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10597718B2 (en) 2012-08-14 2020-03-24 10X Genomics, Inc. Methods and systems for sample processing polynucleotides
US12037634B2 (en) 2012-08-14 2024-07-16 10X Genomics, Inc. Capsule array devices and methods of use
AU2018203012B2 (en) * 2012-08-14 2020-03-12 10X Genomics, Inc. Microcapsule compositions and methods
US10584381B2 (en) 2012-08-14 2020-03-10 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10053723B2 (en) 2012-08-14 2018-08-21 10X Genomics, Inc. Capsule array devices and methods of use
US12098423B2 (en) 2012-08-14 2024-09-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
WO2014028537A1 (en) * 2012-08-14 2014-02-20 10X Technologies, Inc. Microcapsule compositions and methods
US10221442B2 (en) 2012-08-14 2019-03-05 10X Genomics, Inc. Compositions and methods for sample processing
US10450607B2 (en) 2012-08-14 2019-10-22 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10400280B2 (en) 2012-08-14 2019-09-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10323279B2 (en) 2012-08-14 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10273541B2 (en) 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10533221B2 (en) 2012-12-14 2020-01-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11473138B2 (en) 2012-12-14 2022-10-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10227648B2 (en) 2012-12-14 2019-03-12 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10676789B2 (en) 2012-12-14 2020-06-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10253364B2 (en) 2012-12-14 2019-04-09 10X Genomics, Inc. Method and systems for processing polynucleotides
US9701998B2 (en) 2012-12-14 2017-07-11 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10612090B2 (en) 2012-12-14 2020-04-07 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9856530B2 (en) 2012-12-14 2018-01-02 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9567631B2 (en) 2012-12-14 2017-02-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9410201B2 (en) 2012-12-14 2016-08-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11421274B2 (en) 2012-12-14 2022-08-23 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9644204B2 (en) 2013-02-08 2017-05-09 10X Genomics, Inc. Partitioning and processing of analytes and other species
US10150963B2 (en) 2013-02-08 2018-12-11 10X Genomics, Inc. Partitioning and processing of analytes and other species
US10150964B2 (en) 2013-02-08 2018-12-11 10X Genomics, Inc. Partitioning and processing of analytes and other species
US9388465B2 (en) 2013-02-08 2016-07-12 10X Genomics, Inc. Polynucleotide barcode generation
US11193121B2 (en) 2013-02-08 2021-12-07 10X Genomics, Inc. Partitioning and processing of analytes and other species
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US10395758B2 (en) 2013-08-30 2019-08-27 10X Genomics, Inc. Sequencing methods
US12249402B2 (en) 2013-08-30 2025-03-11 10X Genomics, Inc. Sequencing methods
US12131805B2 (en) 2013-08-30 2024-10-29 10X Genomics, Inc. Sequencing methods
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2015051214A1 (en) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2015082658A1 (en) * 2013-12-04 2015-06-11 Evolva Sa Methods and materials for identifying compounds promoting translational read-through of nonsense mutations
US9824068B2 (en) 2013-12-16 2017-11-21 10X Genomics, Inc. Methods and apparatus for sorting data
US11853389B2 (en) 2013-12-16 2023-12-26 10X Genomics, Inc. Methods and apparatus for sorting data
US11030276B2 (en) 2013-12-16 2021-06-08 10X Genomics, Inc. Methods and apparatus for sorting data
US10071377B2 (en) 2014-04-10 2018-09-11 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US9694361B2 (en) 2014-04-10 2017-07-04 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US10343166B2 (en) 2014-04-10 2019-07-09 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US10137449B2 (en) 2014-04-10 2018-11-27 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US12005454B2 (en) 2014-04-10 2024-06-11 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US10150117B2 (en) 2014-04-10 2018-12-11 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
US10030267B2 (en) 2014-06-26 2018-07-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11629344B2 (en) 2014-06-26 2023-04-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10480028B2 (en) 2014-06-26 2019-11-19 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9951386B2 (en) 2014-06-26 2018-04-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11713457B2 (en) 2014-06-26 2023-08-01 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10760124B2 (en) 2014-06-26 2020-09-01 10X Genomics, Inc. Methods and systems for processing polynucleotides
US12163191B2 (en) 2014-06-26 2024-12-10 10X Genomics, Inc. Analysis of nucleic acid sequences
US10337061B2 (en) 2014-06-26 2019-07-02 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10457986B2 (en) 2014-06-26 2019-10-29 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10344329B2 (en) 2014-06-26 2019-07-09 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10208343B2 (en) 2014-06-26 2019-02-19 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10839939B2 (en) 2014-06-26 2020-11-17 10X Genomics, Inc. Processes and systems for nucleic acid sequence assembly
US11133084B2 (en) 2014-06-26 2021-09-28 10X Genomics, Inc. Systems and methods for nucleic acid sequence assembly
US10041116B2 (en) 2014-06-26 2018-08-07 10X Genomics, Inc. Methods and systems for processing polynucleotides
US12312640B2 (en) 2014-06-26 2025-05-27 10X Genomics, Inc. Analysis of nucleic acid sequences
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
US10287623B2 (en) 2014-10-29 2019-05-14 10X Genomics, Inc. Methods and compositions for targeted nucleic acid sequencing
US10245587B2 (en) 2014-11-05 2019-04-02 10X Genomics, Inc. Instrument systems for integrated sample processing
US11135584B2 (en) 2014-11-05 2021-10-05 10X Genomics, Inc. Instrument systems for integrated sample processing
US9975122B2 (en) 2014-11-05 2018-05-22 10X Genomics, Inc. Instrument systems for integrated sample processing
US10221436B2 (en) 2015-01-12 2019-03-05 10X Genomics, Inc. Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same
US11414688B2 (en) 2015-01-12 2022-08-16 10X Genomics, Inc. Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same
US10557158B2 (en) 2015-01-12 2020-02-11 10X Genomics, Inc. Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same
US12553074B2 (en) 2015-01-12 2026-02-17 10X Genomics, Inc. Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same
US12387821B2 (en) 2015-01-13 2025-08-12 10X Genomics, Inc. Systems and methods for visualizing structural variation and phasing information
US10650912B2 (en) 2015-01-13 2020-05-12 10X Genomics, Inc. Systems and methods for visualizing structural variation and phasing information
US10854315B2 (en) 2015-02-09 2020-12-01 10X Genomics, Inc. Systems and methods for determining structural variation and phasing using variant call data
US11274343B2 (en) 2015-02-24 2022-03-15 10X Genomics, Inc. Methods and compositions for targeted nucleic acid sequence coverage
US11603554B2 (en) 2015-02-24 2023-03-14 10X Genomics, Inc. Partition processing methods and systems
US10697000B2 (en) 2015-02-24 2020-06-30 10X Genomics, Inc. Partition processing methods and systems
US12421539B2 (en) 2015-12-04 2025-09-23 10X Genomics, Inc. Methods and compositions for nucleic acid analysis
US11873528B2 (en) 2015-12-04 2024-01-16 10X Genomics, Inc. Methods and compositions for nucleic acid analysis
US10774370B2 (en) 2015-12-04 2020-09-15 10X Genomics, Inc. Methods and compositions for nucleic acid analysis
US11624085B2 (en) 2015-12-04 2023-04-11 10X Genomics, Inc. Methods and compositions for nucleic acid analysis
US11473125B2 (en) 2015-12-04 2022-10-18 10X Genomics, Inc. Methods and compositions for nucleic acid analysis
US11081208B2 (en) 2016-02-11 2021-08-03 10X Genomics, Inc. Systems, methods, and media for de novo assembly of whole genome sequence data
US12427518B2 (en) 2016-05-12 2025-09-30 10X Genomics, Inc. Microfluidic on-chip filters
US11084036B2 (en) 2016-05-13 2021-08-10 10X Genomics, Inc. Microfluidic systems and methods of use
US12138628B2 (en) 2016-05-13 2024-11-12 10X Genomics, Inc. Microfluidic systems and methods of use
US10011872B1 (en) 2016-12-22 2018-07-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10815525B2 (en) 2016-12-22 2020-10-27 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10550429B2 (en) 2016-12-22 2020-02-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10480029B2 (en) 2016-12-22 2019-11-19 10X Genomics, Inc. Methods and systems for processing polynucleotides
US12084716B2 (en) 2016-12-22 2024-09-10 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10793905B2 (en) 2016-12-22 2020-10-06 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10323278B2 (en) 2016-12-22 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11180805B2 (en) 2016-12-22 2021-11-23 10X Genomics, Inc Methods and systems for processing polynucleotides
US12534760B2 (en) 2016-12-22 2026-01-27 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10858702B2 (en) 2016-12-22 2020-12-08 10X Genomics, Inc. Methods and systems for processing polynucleotides
US12264411B2 (en) 2017-01-30 2025-04-01 10X Genomics, Inc. Methods and systems for analysis
US11193122B2 (en) 2017-01-30 2021-12-07 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
US12600961B2 (en) 2017-01-30 2026-04-14 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
US12264316B2 (en) 2017-01-30 2025-04-01 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
US10428326B2 (en) 2017-01-30 2019-10-01 10X Genomics, Inc. Methods and systems for droplet-based single cell barcoding
US11898206B2 (en) 2017-05-19 2024-02-13 10X Genomics, Inc. Systems and methods for clonotype screening
US10844372B2 (en) 2017-05-26 2020-11-24 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US10927370B2 (en) 2017-05-26 2021-02-23 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US11155810B2 (en) 2017-05-26 2021-10-26 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US10400235B2 (en) 2017-05-26 2019-09-03 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US11773389B2 (en) 2017-05-26 2023-10-03 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US11198866B2 (en) 2017-05-26 2021-12-14 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
US10876147B2 (en) 2017-11-15 2020-12-29 10X Genomics, Inc. Functionalized gel beads
US10745742B2 (en) 2017-11-15 2020-08-18 10X Genomics, Inc. Functionalized gel beads
US11884962B2 (en) 2017-11-15 2024-01-30 10X Genomics, Inc. Functionalized gel beads
US10829815B2 (en) 2017-11-17 2020-11-10 10X Genomics, Inc. Methods and systems for associating physical and genetic properties of biological particles
US11155881B2 (en) 2018-04-06 2021-10-26 10X Genomics, Inc. Systems and methods for quality control in single cell processing
US12421558B2 (en) 2020-02-13 2025-09-23 10X Genomics, Inc. Systems and methods for joint interactive visualization of gene expression and DNA chromatin accessibility
WO2024006765A3 (en) * 2022-06-27 2024-04-18 Wisconsin Alumni Research Foundation Universal method for parasite and eukaryotic endosymbiont identification

Also Published As

Publication number Publication date
EP1543157A2 (en) 2005-06-22
AU2003252136A8 (en) 2004-02-09
US7927791B2 (en) 2011-04-19
AU2003252136A1 (en) 2004-02-09
US20060257866A1 (en) 2006-11-16
EP1543157A4 (en) 2006-11-15
CA2493808A1 (en) 2004-01-29
WO2004010106A3 (en) 2004-08-26

Similar Documents

Publication Publication Date Title
WO2004010106A2 (en) METHODS FOR IDENTIFYING SMALL MOLEDULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY
WO2004001010A2 (en) METHODS FOR IDENTIFYING SMALL MOLECULES THAT MODULATE PREMATURE TRANSLATION TERMINATION AND NONSENSE MEDIATED mRNA DECAY
US8278085B2 (en) RNA processing protein complexes and uses thereof
Barral et al. Unc-45 mutations in Caenorhabditis elegans implicate a CRO1/She4p-like domain in myosin assembly
Wilk et al. Extracellular NAD+ enhances PARP-dependent DNA repair capacity independently of CD73 activity
Aoki et al. The diversity of O-linked glycans expressed during Drosophila melanogaster development reflects stage-and tissue-specific requirements for cell signaling
Cortone et al. Interaction of the Warsaw breakage syndrome DNA helicase DDX11 with the replication fork-protection factor Timeless promotes sister chromatid cohesion
EP2322529B1 (en) Selective glycosidase inhibitors and uses thereof
Jacobson et al. A novel pharmacological approach to treating cardiac ischemia: binary conjugates of A1 and A3 adenosine receptor agonists
Jones et al. Development of a split esterase for protein–protein interaction-dependent small-molecule activation
US7939468B2 (en) Methods of identifying compounds that target tRNA splicing endonuclease and uses of said compounds as anti-proliferative agents
US20110172108A1 (en) TARGETING ENZYMES OF THE tRNA SPLICING PATHWAY FOR IDENTIFICATION OF ANTI-FUNGAL AND/OR ANTI-PROLIFERATIVE MOLECULES
Gasparutto et al. Synthesis and biochemical properties of cyanuric acid nucleoside-containing DNA oligomers
Hackl et al. Molecular Cloning and Subcellular Localisation of the snRNP-associated Protein 69KD, a Structural Homologue of the Proto-oncoproteins TLS and EWS, with RNA and DNA-binding Properties
JP2014091731A (en) Peptide compound from novel somatostatin, and dna polymerase inhibitor, anticancer agent and apoptosis-inducing agent comprising the same
JP2003532428A (en) Enzymatic assays for screening anticancer drugs
CN120289547A (en) A tandem double-locked liver-targeted fluorescent probe and its preparation method and application
US20040146903A1 (en) Methods and compositions for modulating activator protein 1
JP2002524719A (en) Subfamily of RNA helicases that are modulators of translation termination fidelity and uses thereof
JP2003245096A (en) Method for screening substances for ability to inhibit heparanase activity
Wilson Investigating the role and regulation of human mitochondrial poly (A) polymerase
JP2008533978A (en) Use of Mst protein for the treatment of thromboembolic disorders

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2493808

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003765998

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2003765998

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006257866

Country of ref document: US

Ref document number: 10521775

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: JP

WWP Wipo information: published in national office

Ref document number: 10521775

Country of ref document: US