WO2004009621A2 - Polypeptides of nontypeable haemophilus influenzae - Google Patents

Polypeptides of nontypeable haemophilus influenzae Download PDF

Info

Publication number
WO2004009621A2
WO2004009621A2 PCT/CA2003/001108 CA0301108W WO2004009621A2 WO 2004009621 A2 WO2004009621 A2 WO 2004009621A2 CA 0301108 W CA0301108 W CA 0301108W WO 2004009621 A2 WO2004009621 A2 WO 2004009621A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
seq
polynucleotide
fragments
analogs
Prior art date
Application number
PCT/CA2003/001108
Other languages
French (fr)
Other versions
WO2004009621A3 (en
Inventor
Nathalie Charland
Denis Martin
Josée Hamel
Bernard R. Brodeur
Annie Charbonneau
Original Assignee
Id Biomedical Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Id Biomedical Corporation filed Critical Id Biomedical Corporation
Priority to AU2003250673A priority Critical patent/AU2003250673A1/en
Publication of WO2004009621A2 publication Critical patent/WO2004009621A2/en
Publication of WO2004009621A3 publication Critical patent/WO2004009621A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/285—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pasteurellaceae (F), e.g. Haemophilus influenza
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention is related to nontypeable Haemophilus influenzae (NTHI) polypeptides and corresponding DNA fragments, which may be used to prevent, diagnose and/or treat Haemophilus influenzae infections.
  • NTHI nontypeable Haemophilus influenzae
  • H. influenzae is a Gram-negative rod that is found in nature only as a human pathogen. Isolates of H. influenzae can be subdivided into capsulated and non-capsulated forms . Encapsulated strains express one of six structurally and antigenically distinct capsular polysaccharides that are designed types a to f . Non-encapsulated strains are defined by their failure to agglutinate with antisera against H. influenzae capsular polysaccharides and are referred to as nontypeable .
  • Nontypeable H. influenzae strains commonly colonize the upper respiratory tract, including the nasopharynx and the posterior oropharynx. A number of surveys of healthy individuals indicate colonization rates from 40% to 80% between both children and adults. Colonization with a particular strain may persist for weeks or months with most individuals remaining asymptomatic throughout this period. The pathogenesis of disease due to NTHI involves contiguous spread within the respiratory tract. Spread to adjacent areas is usually a consequence of abnormalities in either non-specific or specific host defences.
  • Nontypeable H. influenzae causes a variety of respiratory tract infections in children and adults including otitis, sinusitis, bronchitis and pneumonia. These infections may become chronic or recurrent in patients with bronchitis or otitis.
  • NTHI is a frequent cause of acute otitis media and is commonly implicated in recurrent otitis media.
  • infants NTHI is responsible for 27% to 37% of the first episode of otitis media by the age of 1 year. Meningitis is sometimes caused by NTHI and accounts for 1% to 3% of all cases.
  • NTHI is particularly prevalent in hosts with an underlying disease that affects the innate mucosal immune system, such as chronic obstructive pulmonary disease and cystic fibrosis.
  • Nontypeable H. influenzae strains are often found predominantly during exacerbations when the sputum becomes mucopurulent .
  • Acute infective exacerbations of chronic bronchitis play an important role in the morbidity and mortality of patients with chronic pulmonary disease.
  • H. influenzae type b polysaccharide conjugated vaccines Although several H. influenzae type b polysaccharide conjugated vaccines have been developed, these vaccines are ineffective against disease caused by other H. influenzae strains. The identification of conserved cross-protective antigens is critical for the development of a universal vaccine against H. influenzae infection and disease.
  • Protein D-15 is the only conserved immunogen that has been described, in the scientific literature, as being capable of conferring protection against multiple serotypes and nontypeable strains . Therefore, there remains an unmet need for NTHI antigens that may be used as vaccine components for the prophylaxis and/or therapy of NTHI infection.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention relates to polypeptides comprising SEQ ID No : 2 or fragments or analogs thereof .
  • polypeptides encoded by polynucleotides of the invention pharmaceutical compositions, vectors comprising polynucleotides of the invention operably linked to an expression control region, as well as host cells transfected with said vectors and processes for producing polypeptides comprising culturing said host cells under conditions suitable for expression.
  • Figure 1 represents the DNA sequence of SHB-HI-102 gene from NTHI strain 12085; SEQ ID NO : 1. The underlined portion of the sequence represents the leader peptide-coding region.
  • Figure 2 represents the amino acid sequence of SHB-HI-102 polypeptide from NTHI strain 12085; SEQ ID NO: 2.
  • the underlined sequence represents the 23 amino acid residues leader peptide .
  • Figure 3 represents the DNA sequence of meningococcal NspA outer membrane protein leader peptide-coding region from Neisseria meningitidis strain 608B; SEQ ID NO: 3.
  • the underlined portion of the sequence represents the restriction enzyme-recognition site used for in-frame gene cloning.
  • Figure 4 represents the amino acid sequence of meningococcal NspA outer membrane protein leader peptide from Neisseria meningitidis strain 608B; SEQ ID NO: 4.
  • the underlined portion of the sequence represents the linker of amino acid residues encoded by the restriction enzyme-recognition site used for in-frame gene cloning.
  • Figure 5 represents the DNA sequence alignment of SHB-HI-102 genes (without the leader peptide-coding regions) from different H. influenzae strains.
  • Figure 6 represents the polypeptide sequence alignment of SHB- HI-102 polypeptides (without leader peptides) from different H. influenzae strains.
  • Figure 7 represents a clearance model in mice showing the protection conferred by systemic immunization with SHB-HI-102 recombinant polypeptide expressed in E. coli outer membrane vesicles .
  • the present invention provides purified and isolated polynucleotides, which encode H. influenzae polypeptides which may be used to prevent, diagnose and/or treat H. influenzae infection.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof .
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 90% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 98% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least .80% identity to a second- olypeptide comprising .SEQ ID Jo : 2.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 90% identity to a second polypeptide comprising SEQ ID No : 2.
  • the present invention provides an isolated polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2. According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 98% identity to a second polypeptide comprising SEQ ID No : 2.
  • the present invention relates to polypeptides comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention relates to polypeptides comprising SEQ ID No : 2.
  • the present invention relates to polypeptides consisting of SEQ ID No : 2 or fragments or analogs thereof .
  • the present invention relates to polypeptides consisting of SEQ ID No : 2.
  • the present invention provides a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID No : 2.
  • the present invention relates to epitope bearing portions of a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof .
  • the present invention relates to epitope bearing portions of a polypeptide comprising SEQ ID No : 2.
  • the present invention provides an isolated polynucleotide comprising a polynucleotide chosen from:
  • the present invention provides an isolated polynucleotide comprising a polynucleotide chosen from: (a) a polynucleotide encoding a polypeptide having at least
  • a polynucleotide comprising SEQ ID No : 1;
  • a polynucleotide that is complementary to a polynucleotide in (a), (b), (c), (d), (e), (f) or (g) .
  • the present invention provides an isolated polypeptide comprising a polypeptide chosen from: (a) a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
  • polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
  • the present invention provides an isolated polypeptide comprising a polypeptide chosen from: (a) a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2;
  • polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID No : 2;
  • the invention includes DNA molecules, i.e. polynucleotides and their complementary sequences that encode analogs such as mutants, variants, homologues and derivatives of such polypeptides, as described herein in the present patent application.
  • the invention also includes RNA molecules corresponding to the DNA molecules of the invention.
  • the invention includes the corresponding polypeptides and monospecific antibodies that specifically bind to such polypeptides .
  • polypeptides in accordance with the present invention are antigenic.
  • polypeptides in accordance with the present invention are immunogenic .
  • polypeptides in accordance with the present invention can elicit an immune response in a host.
  • the present invention also relates to polypeptides which are able to raise antibodies having binding specificity to the polypeptides of the present invention as defined above.
  • An antibody that "has binding specificity” is an antibody that recognizes and binds the selected polypeptide but which does not substantially recognize and bind other molecules in a sample, e . g.. ,-a biological sample-, which naturally includes the selected peptide. Specific binding can be measured using an ELISA assay in which the selected polypeptide is used as an antigen.
  • protection in the biological studies is defined by a significant increase in the survival curve, rate or period.
  • Statistical analysis using the Log rank test to compare survival curves, and Fisher exact test to compare survival rates and numbers of days to death, respectively, might be useful to calculate P values and determine whether the difference between the two groups is statistically significant. P values of 0.05 are regarded as not significant.
  • immunogenic and/or antigenic fragments of the polypeptides of the invention are provided.
  • the fragments of the present invention should include one or more such epitopic regions or be sufficiently similar to such regions to retain their immunogenic and/or antigenic properties.
  • the present invention further provides an immunogenic fragment of a polypeptide of the invention, said fragment being a contiguous portion of the polypeptide of the invention.
  • the present invention further provides fragments having at least 10 contiguous amino acid residues from the polypeptide sequences of the present invention. In one embodiment, at least 15 contiguous amino acid residues. In one embodiment, at least 20 contiguous amino acid residues. In one embodiment, at least 30 contiguous amino acid residues. In one embodiment, -at least 40 contiguous amino acid residues. In one embodiment, at least 50 contiguous amino acid residues. In one embodiment, at least 100 contiguous amino acid residues. In one embodiment, at least 150 contiguous amino acid residues .
  • the present invention further provides a fragment which has the same or substantially the same immunogenic activity as the polypeptide comprising Seq. ID no. 2.
  • the fragment (when coupled to a carrier, if necessary) is capable of raising an immune response which recognizes the SHB-HI-102 polypeptide.
  • Such an immunogenic fragment may include, for example, the SHB- HI-102 polypeptide lacking an N-terminal leader peptide, and/or a transmembrane domain and/or a C-terminal anchor domain and /or external loops and/or turns.
  • the present invention further provides a fragment of SHB-HI-102 comprising substantially all of the extra cellular domain of a ppoypeptide which has at least 70% identify, preferably 80% identity, more preferably 95% identity, to a second polypeptide comprising Seq. ID No. 2, over the entire length of said sequence.
  • the present invention further provides fragment which comprise a B-cell or T-helper epitope.
  • the present invention further provides fragment that may be part of a larger polypeptide. It can be advantageous to include an additional amino acid sequence which contains secretory or leader sequences, or sequences which aid in purification such as multiple histidine residues, or an additional sequence which increases stability during recombinant production, or an additional polypeptide or lipid tail sequences which increase the immunogenic potential of the final polypeptide .
  • fragments include those polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably conserved) and which may be natural or unnatural .
  • derivatives and analogs of polypeptides of the invention will have about 80% identity with those sequences illustrated in the figures or fragments thereof. That is, 80% of the residues are the same.
  • polypeptides will have greater than 80% identity.
  • polypeptides will have greater than 85% identity.
  • polypeptides will have greater than 90% identity.
  • polypeptides will have greater than 95% identity. In a further embodiment, polypeptides will have greater than 99% identity. In a further embodiment, analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.
  • substitutions are those having a minimal influence on the secondary structure and hydropathic nature of the polypeptide.
  • substitutions are those known in the art as conserved, i.e. the substituted residues share physical or chemical properties such as hydrophobicity, size, charge or functional groups . These include substitutions such as those described by Dayhoff, M. in Atlas of Protein Sequence and.
  • amino acids either natural or unnatural, belonging to one of the following groups represent conservative changes : ala, pro, gly, gin, asn, ser, thr, val; cys, ser, tyr, thr; val, ile, leu, met, ala, phe; lys, arg, orn, his; and phe, tyr, trp, his.
  • the preferred substitutions also include substitutions of D- enantiomers for the corresponding L-amino acids .
  • the analogs could be fusion polypeptides, incorporating moieties which render purification easier, for example by effectively tagging the desired polypeptide. It may be necessary to remove the "tag” or it may be the case that the fusion polypeptide itself retains sufficient antigenicity to be useful .
  • the percentage of homology is defined as the sum of the percentage of identity plus the percentage of similarity or conservation of amino acid type.
  • analogs of polypeptides of the invention will have about 70% identity with those sequences illustrated in the figures or fragments thereof. That is, 70% of the residues are the same.
  • polypeptides will have greater than 80% identity.
  • polypeptides will have greater than 85% identity.
  • polypeptides will have greater than 90% identity.
  • polypeptides will have greater than 95% identity.
  • polypeptides will have greater than 99% identity.
  • analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.
  • analogs of polypeptides of the invention will have about 70% homology with those sequences illustrated in the figures or fragments thereof.
  • polypeptides will have greater than 80% homology.
  • polypeptides will have greater than 85% homology.
  • polypeptides will have greater than 90% homology.
  • polypeptides will have greater than 95% homology.
  • polypeptides will have greater than 99% homology.
  • analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.
  • analogs or derivatives could be fusion polypeptides, incorporating moieties which render purification easier, for example by effectively tagging the desired protein or polypeptide, it may be necessary to remove the "tag” or it may be the case that the fusion polypeptide itself retains sufficient antigenicity to be useful.
  • the fragments of the present invention should include one or more such epitopic regions or be sufficiently similar to such regions to retain their antigenic/immunogenic properties.
  • polypeptides which have fused thereto other compounds which alter the polypeptides biological or pharmacological properties i.e. polyethylene glycol (PEG) to increase half-life; leader or secretory amino acid sequences for ease of purification; prepro- and pro- sequences; and (poly) saccharides .
  • PEG polyethylene glycol
  • leader or secretory amino acid sequences for ease of purification
  • prepro- and pro- sequences and (poly) saccharides .
  • polypeptides of the present invention can be modified by terminal -NH 2 acylation (eg. by acetylation, or thioglycolic acid amidation, terminal carboxy amidation, e.g. with ammonia or methylamine) to provide stability, increased hydrophobicity for linking or binding to a support or other molecule.
  • terminal -NH 2 acylation eg. by acetylation, or thioglycolic acid amidation, terminal carboxy amidation, e.g. with ammonia or methylamine
  • hetero and homo polypeptide multimers of the polypeptide fragments and analogues include, for example, one or more polypeptides that have been cross-linked with cross-linkers such as avidin/biotin, gluteraldehyde or dimethylsuperimidate.
  • polymeric forms also include polypeptides containing two or more tandem or inverted contiguous sequences, produced from multicistronic mRNAs generated by recombinant DNA technology.
  • the present invention also relates to chimeric polypeptides which comprise one or more polypeptides or fragments or analogs thereof as defined in the figures of the present application.
  • the present invention also relates to chimeric polypeptides comprising two or more polypeptides comprising SEQ ID No : 2 or fragments or analogs thereof; provided that the polypeptides are linked as to formed a chimeric polypeptide .
  • the present invention also relates to chimeric polypeptides comprising two or more polypeptides comprising SEQ ID No : 2 provided that the polypeptides are linked as to formed a chimeric polypeptide.
  • a fragment, analog or derivative of a polypeptide of the invention will comprise at least one antigenic region i. archivee. at least one epitope.
  • polypeptides may be utilized having bishaloacetyl groups, nitroarylhalides, or the like, where the reagents being specific for thio groups. Therefore, the link between two mercapto groups of the different polypeptides may be a single bond or may be composed of a linking group of at least two, typically at least four, and not more than 16, but usually not more than about 14 carbon atoms .
  • polypeptide fragments and analogs of the invention do not contain a starting residue, such as methionine (Met) or valine (Val) .
  • polypeptides will not incorporate a leader or secretory sequence (signal sequence) .
  • the signal portion of a polypeptide of the invention may be determined according to established molecular biological techniques.
  • the polypeptide of interest may be isolated from a H. influenzae culture and subsequently sequenced to determine the initial residue of the mature protein and therefore the sequence of the mature polypeptide.
  • polypeptides can be produced and/or used without their start codon (methionine or valine) and/or without their leader peptide to favor production and purification of recombinant polypeptides . It is known that cloning genes without sequences encoding leader peptides will restrict the polypeptides to the cytoplasm of E. coli and will facilitate their recovery (Glick, B.R. and Pasternak, J.J. (1998) Manipulation of gene expression in prokaryotes . In "Molecular biotechnology: Principles and applications of recombinant DNA", 2nd edition, ASM Press, Washington DC, p.109-143).
  • compositions of matter containing a polypeptide of the invention together with a carrier, diluent or adjuvant;
  • a pharmaceutical composition comprising a polypeptide of the invention and a carrier, diluent or adjuvant;
  • a vaccine comprising a polypeptide of the invention and a carrier, diluent or adjuvant;
  • a method for inducing an immune response against H. influenzae, in a host by administering to the host, an immunogenically effective amount of a polypeptide of the invention to elicit an immune response, e.g., a protective immune response to H. influenzae; and particularly, (v) a method for preventing and/or treating a H. influenzae infection, by administering a prophylactic or therapeutic amount of a polypeptide of the invention to a host in need.
  • compositions of matter containing a polynucleotide of the invention together with a carrier, diluent or adjuvant;
  • a pharmaceutical composition comprising a polynucleotide of the invention and a carrier, diluent or adjuvant;
  • a method for inducing an immune response against H. influenzae, in a host by administering to the host, an immunogenically effective amount of a polynucleotide of the invention to elicit an immune response, e.g., a protective immune response to H. influenzae; and particularly, (iv) a method for preventing and/or treating a H. influenzae infection, by administering a prophylactic or therapeutic amount of a polynucleotide of the invention to a host in need.
  • the polypeptides of the invention can also be coupled or conjugated to carrier proteins such as tetanus toxin, diphtheria toxin, hepatitis B virus surface antigen, poliomyelitis virus VPl antigen or any other viral or bacterial toxin or antigen or any suitable proteins to stimulate the development of a stronger immune response .
  • carrier proteins such as tetanus toxin, diphtheria toxin, hepatitis B virus surface antigen, poliomyelitis virus VPl antigen or any other viral or bacterial toxin or antigen or any suitable proteins to stimulate the development of a stronger immune response .
  • This coupling or conjugation can be done chemically or genetically.
  • a more detailed description of peptide-carrier conjugation is available in Van Regenmortel, M.H.V., Briand J.P., Muller S., Plaue S .
  • compositions comprising one or more H. influenzae polypeptides of the invention in a mixture with a pharmaceutically acceptable adjuvant.
  • Suitable adjuvants include (1) oil-in- water emulsion formulations such as MF59TM, SAFTM, RibiTM ; (2) Freund's complete or incomplete adjuvant; (3) salts i.e.
  • poly IC and poly AU detoxified cholera toxin (CTB)and E.coli heat labile toxin for induction of mucosal immunity; and (7) liposomes.
  • CTB cholera toxin
  • E.coli heat labile toxin for induction of mucosal immunity
  • liposomes (7) liposomes.
  • CTB cholera toxin
  • Preferred adjuvants include QuilATM, QS21TM, AlhydrogelTM and Ad uphosTM.
  • compositions of the invention may be administered parenterally by injection, rapid infusion, nasopharyngeal absorption, dermoabsorption, or buccal or oral.
  • composition is also meant to include antibodies.
  • antibodies having binding specificity for the polypeptides of the present invention for the treatment or prophylaxis of H. influenzae infection and/or diseases and symptoms mediated by H. influenzae infection.
  • compositions of the invention are used for the prophylactic or therapeutic treatment of H. influenzae infection and/or diseases and symptoms mediated by H. influenzae infection as described in Manual of Clinical Microbiology, P.R. Murray (Ed, in chief),E.J. Baron, M.A. Pfaller, F.C. Tenover and R.H. Yolken. ASM Press, Washington, D.C. seventh edition, 1999, 1773p.
  • pharmaceutical compositions of the present invention are used for the prophylactic or therapeutic treatment of otitis media, sinusitis, bronchitis, pneumonia, meningitis.
  • vaccine compositions of the invention are used for the prophylactic or therapeutic treatment of H. influenzae infection and/or diseases and symptoms mediated by H. influenzae infection.
  • the H_ ; _ influenzae infection is nontypeable H. influenzae.
  • the invention provides a method for prophylaxis or treatment of H. influenzae infection in a host susceptible to H. influenzae infection comprising administering to said host a prophylactic or therapeutic amount of a composition of the invention.
  • the term "host” includes mammals.
  • the mammal is human.
  • compositions are administered to those hosts at risk of H. influenzae infection such as neonates, infants, children, elderly and immunocompromised hosts.
  • compositions are administered to those hosts at risk of H. influenzae infection such as adults .
  • compositions are preferably in unit dosage form of about 0.001 to 100 ⁇ g/kg (antigen/body weight) and more preferably 0.01 to 10 ⁇ g/kg and most preferably 0.1 to 1 ⁇ g/kg 1 to 3 times with an interval of about 1 to 6 week intervals between immunizations.
  • compositions are preferably in unit dosage form of about 0.1 ⁇ g to 10 mg and more preferably l ⁇ g to 1 g and most preferably 10 to 100 ⁇ g 1 to 3 times with an interval of about 1 to 6 week intervals between immunizations.
  • polypeptides characterized by the amino acid sequence comprising SEQ ID No : 2 or fragments or analogs thereof .
  • polynucleotides are those illustrated in SEQ ID No: 1 which may include the open reading frames (ORF) , encoding the polypeptides of the invention. It will be appreciated that the polynucleotide sequences illustrated in the figures may be altered with degenerate codons yet still encode the polypeptides of the invention. Accordingly the present invention further provides polynucleotides which hybridize to the polynucleotide sequences herein above described (or the complement sequences thereof) having 70% identity between sequences. In one embodiment, at least 80% identity between sequences. In one embodiment, at least 85% identity between sequences. In one embodiment, at least 90% identity between sequences. In a further embodiment, polynucleotides are hybridizable under stringent conditions i.e. having at least 95% identity. In a further embodiment, more than 97% identity.
  • the present invention provides polynucleotides that hybridize under stringent conditions to either
  • polypeptide (a) a DNA sequence encoding a polypeptide or (b) the complement of a DNA sequence encoding a polypeptide ; wherein said polypeptide comprises SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides polynucleotides that hybridize under stringent conditions to either
  • polypeptide comprises a sequence chosen from SEQ ID NO: 2.
  • present invention provides polynucleotides that hybridize under stringent conditions to either
  • polypeptide (b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises at least 10 contiguous amino acid residues from a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
  • the present invention provides polynucleotides that hybridize under stringent conditions to either
  • polypeptide comprises at least 10 contiguous amino acid residues from a polypeptide comprising SEQ ID No : 2.
  • polynucleotides are those illustrated in SEQ ID NO: 1 or fragments or analogs thereof encoding polypeptides of the invention.
  • polynucleotides are those illustrated in SEQ ID NO: 1 encoding polypeptides of the invention.
  • polynucleotides include both DNA and RNA.
  • the present invention also includes polynucleotides complementary to the polynucleotides described in the present application.
  • polynucleotides encoding polypeptides of the invention, or fragments, analogs or derivatives thereof may be used in a DNA immunization method.
  • the use of a polynucleotide of the invention may employ a delivery method such as direct injection of plasmid DNA. That is, the polynucleotide can be incorporated into a vector which is replicable and expressible upon injection thereby producing the antigenic polypeptide in vivo.
  • polynucleotides may be incorporated into a plasmid vector under the control of the CMV promoter which is functional in eukaryotic cells .
  • the vector is injected intramuscularly.
  • suitable delivery methods include delivery of DNA complexed with specific protein carriers, coprecipitation of DNA with calcium phosphate, encapsultaion of DNA in various forms of liposomes, particle bombardment and in vivo infection using cloned retroviral vectors .
  • polypeptides of the invention by recombinant techniques by expressing a polynucleotide encoding said polypeptide in a host cell and recovering the expressed polypeptide product .
  • polypeptides can be produced according to established synthetic chemical techniques i.e. solution phase or solid phase synthesis of oligopeptides which are ligated to produce the full polypeptide (block ligation) .
  • Suitable stringent conditions for hybridization can be readily determined by one of skilled in the art .
  • Stringent and moderately stringent conditions are those commonly defined and available, such as those defined by Sambrook and Russell, Molecular Cloning: A Laboratory Manual, second or third edition, Cold Spring Harbor Laboratory Press, NY, 1989 or 2001 or Ausubel et al . , Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1999.
  • the precise level of stringency is not important, rather, conditions should be selected that provide a clear, detectable signal when specific hybridization has occurred
  • Hybridization is a function of sequence identity (homology) , G+C content of the sequence, buffer salt content, sequence length and duplex melt temperature (T[m] ) among other variables.
  • sequence identity identity
  • buffer salt content sequence length
  • duplex melt temperature T[m]
  • the buffer salt concentration and temperature provide useful variables for assessing sequence identity (homology) by hybridization techniques. For example, where there is at least 90 percent homology, hybridization is commonly carried out at 68°C. in a buffer salt such as 6. times . SCC diluted from 20. times . SSC.
  • the buffer salt utilized for final Southern blot washes can be used at a low concentration, e.g., 0.1. times . SSC and at a relatively high temperature, e.g., 68°C, and two sequences will form a hybrid duplex (hybridize) .
  • Use of the above hybridization and washing conditions together are defined as conditions of high stringency or highly stringent conditions. Moderately stringent conditions can be utilized for hybridization where two sequences share at least about 80 percent homology.
  • hybridization is carried out using 6. times . SSC at a temperature of about 50-55°C.
  • a final wash salt concentration of about 1-3. times .SSC and at a temperature of about 60-68°C. are used. These hybridization and washing conditions define moderately stringent conditions.
  • specific hybridization occurs under conditions in which a high degree of complementarity exists between a nucleic acid comprising the sequence of an isolated sequence and another nucleic acid. With specific hybridization, complementarity will generally be at least about 70%, 75%, 80%, 85%, preferably about 90-100%, or most preferably about 95- 100%.
  • nucleic acid or polypeptide homology or identity is determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al . Proc. Natl. Acad. Sci . USA 87: 2264-2268 (1990) and Altschul, S. F. J. Mol. Evol. 36: 290-300(1993), both of which are herein incorporated by reference) which are tailored for sequence similarity searching.
  • BLAST Basic Local Alignment Search Tool
  • the approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance.
  • the search parameters for histogram, descriptions, alignments, expect i.e., the statistical significance threshold for reporting matches against database sequences
  • cutoff, matrix and filter are at the default settings.
  • the default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoffet al . Proc.
  • the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues) , wherein the default values for M and N are 5 and -4, respectively.
  • M the reward score for a pair of matching residues
  • N the penalty score for mismatching residues
  • M and N are 5 and -4, respectively.
  • a program such as the CLUSTAL program to compare amino acid sequences . This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or homology for an optimal alignment. Both types of identity analysis are contemplated in the present invention.
  • the present invention provides a process for producing a polypeptide comprising culturing a host cell of the invention under conditions suitable for expression of said polypeptide.
  • host cells are transfected with vectors which encode the polypeptides of the invention, and then cultured in a nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes .
  • Suitable vectors are those that are viable and replicable in the chosen host and include chromosomal, non- chromosomal and synthetic DNA sequences e.g. bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA.
  • the polypeptide sequence may be incorporated in the vector at the appropriate site using restriction enzymes such that it is operably linked to an expression control region comprising a promoter, ribosome binding site (consensus region or Shine- Dalgarno sequence) , and optionally an operator (control element) .
  • an expression control region comprising a promoter, ribosome binding site (consensus region or Shine- Dalgarno sequence) , and optionally an operator (control element) .
  • Suitable promoters include but are not limited to LTR or SV40 promoter, E.coli lac, tac or trp promoters and the phage lambda P L promoter.
  • Vectors will preferably incorporate an origin of replication as well as selection markers i.e. ampicilin resistance gene.
  • Suitable bacterial vectors include pET, pQE70, pQE60, pQE-9, pDlO phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNHl ⁇ a, pNHl ⁇ A, pNH46A, ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 and eukaryotic vectors pBlueBacIII, pWLNEO, pSV2CAT, pOG44, pXTl, pSG, pSVK3 , pBPV, pMSG and pSVL.
  • Host cells may be bacterial i.e. E.coli, Bacillus subtilis, Streptomyces ; fungal i.e. Aspergillus niger, Aspergillus nidulins; yeast i.e. Saccharomyces or eukaryotic i.e. CHO, COS.
  • polypeptide Upon expression of the polypeptide in culture, cells are typically harvested by centrifugation then disrupted by physical or chemical means (if the expressed polypeptide is not secreted into the media) and the resulting crude extract retained to isolate the polypeptide of interest. Purification of the polypeptide from culture media or lysate may be achieved by established techniques depending on the properties of the polypeptide i.e. using ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography and lectin chromatography. Final purification may be achieved using HPLC .
  • the polypeptides may be expressed with or without a leader or secretion sequence.
  • the leader may be removed using post-translational processing (see US 4,431,739; US 4,425,437; and US 4,338,397) or be chemically removed subsequent to purifying the expressed polypeptide.
  • the H. influenzae polypeptides of the invention may be used in a diagnostic test for H. influenzae infection, in particular nontypeable H. influenzae infection.
  • a method for the detection of antibody specific to a H. influenzae antigen in a biological sample containing or suspected of containing said antibody may be performed as follows : a) obtaining a biological sample from a host; b) incubating one or more H. influenzae polypeptides of the invention or fragments thereof with the biological sample to form a mixture; and c) detecting specifically bound antigen or bound fragment in the mixture which indicates the presence of antibody specific to H. influenzae .
  • this diagnostic test may take several forms, including an immunological test such as an enzyme-linked immunosorbent assay (ELISA) , a radioimmunoassay or a latex agglutination assay, essentially to determine whether antibodies specific for the protein are present in an organism.
  • an immunological test such as an enzyme-linked immunosorbent assay (ELISA)
  • ELISA enzyme-linked immunosorbent assay
  • radioimmunoassay or a latex agglutination assay
  • the DNA sequences encoding polypeptides of the invention may also be used to design DNA probes for use in detecting the presence of H. influenzae in a biological sample suspected of containing such bacteria.
  • the detection method of this invention comprises : a) obtaining the biological sample from a host; b) incubating one or more DNA probes having a DNA sequence encoding a polypeptide of the invention or fragments thereof with the biological sample to form a mixture; and c) detecting specifically bound DNA probe in the mixture which indicates the presence of H. influenzae bacteria.
  • the DNA probes of this invention may also be used for detecting circulating H. influenzae i.e. H. influenzae nucleic acids in a sample, for example using a polymerase chain reaction, as a method of diagnosing H. influenzae infections.
  • the probe may be synthesized using conventional techniques and may be immobilized on a solid phase, or may be labelled with a detectable label.
  • a preferred DNA probe for this application is an oligomer having a sequence complementary to at least about 6 contiguous nucleotides of the H. influenzae polypeptides of the invention.
  • the preferred DNA probe will be an oligomer having a sequence complementary to at least about 15 contiguous nucleotides of the H. influenzae polypeptides of the invention.
  • the preferred DNA probe will be an oligomer having a sequence complementary to at least about 30 contiguous nucleotides of the H. influenzae polypeptides of the invention. In a further embodiment, the preferred DNA probe will be an oligomer having a sequence complementary to at least about 50 contiguous nucleotides of the H. influenzae polypeptides of the invention.
  • Another diagnostic method for the detection of H. influenzae in a host comprises : a) labelling an antibody reactive with a polypeptide of the invention or fragment thereof with a detectable label ; b) administering the labelled antibody or labelled fragment to the host; and c) detecting specifically bound labelled antibody or labelled fragment in the host which indicates the presence of H. influenzae .
  • a further aspect of the invention is the use of the H. influenzae polypeptides of the invention as immunogens for the production of specific antibodies for the diagnosis and in particular the treatment of H. influenzae infection.
  • Suitable antibodies may be determined using appropriate screening methods, for example by measuring the ability of a particular antibody to passively protect against H. influenzae infection in a test model .
  • One example of an animal model is the mouse model described in the examples herein.
  • the antibody may be a whole antibody or an antigen-binding fragment thereof and may belong to any immunoglobulin class.
  • the antibody or fragment may be of animal origin, specifically of mammalian origin and more specifically of murine, rat or human origin. It may be a natural antibody or a fragment thereof, or if desired, a recombinant antibody or antibody fragment.
  • the term recombinant antibody or antibody fragment means antibody or antibody fragment which was produced using molecular biology techniques .
  • the antibody or antibody fragments may be polyclonal, or preferably monoclonal. It may be specific for a number of epitopes associated with the H. influenzae polypeptides but is preferably specific for one.
  • the present invention provides the use of an antibody for prophylaxis and/or treatment of H. influenzae infections.
  • a further aspect of the invention is the use of the antibodies directed to the polypeptides of the invention for passive immunization.
  • a further aspect of the invention is a method for immunization, whereby an antibody raised by a polypeptide of the invention is administered to a host in an amount sufficient to provide a passive immunization.
  • the invention provides the use of a pharmaceutical composition of the invention in the manufacture of a medicament for the prophylactic or therapeutic treatment of H. influenzae infection.
  • the invention provides a kit comprising a polypeptide of the invention for detection or diagnosis of H. influenzae infection.
  • This example illustrates the cloning and molecular characteristics of SHB-HI-102 gene and corresponding polypeptide .
  • NTHI SHB-HI-102 (SEQ ID NO: 1) gene, from nucleotide 85, was amplified by PCR (Hybaid PCR Express, ESBE Scientific, Markham, Ontario, Canada) from genomic DNA of NTHI strain 12085 using the following oligos that contained base extensions for the addition of restriction sites Ndel (CATATG) and Xhol (CTCGAG) : HiPH33 (5'-
  • PCR products were purified from agarose gel using a QIAquick gel extraction kit following the manufacturer's instructions (Qiagen, Chatsworth, CA) , and digested with Ndel and Xhol (Amersham Pharmacia
  • the Ndel-Xhol PCR products were ligated to the Ndel-Xhol pET21b(+) expression vector.
  • the ligated products were transformed into E. coli strain DH5 « [ ⁇ 80dlacZ ⁇ M15 ⁇ (lacZYA-argF)U169 endAl recAl hsdRl7 (rK-mK+) deoR thi-1 supE44 ⁇ -gyrA96 relAl] (Gibco BRL, Gaithersburg, MD) according to the method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed) , pp. 109-135).
  • Recombinant pET21b(+) plasmid (rpET21b(+)) containing SHB-HI-102 gene was purified using a Qiagen kit and DNA insert was sequenced (Taq Dye Deoxy Terminator Cycle Sequencing kit, ABI, Foster City, CA) .
  • ORF open reading frame
  • MSMLKPFWFKTFSISIITALLVA 23 amino acid residues signal peptide
  • the polypeptide possesses a predicted signal sequence typical of bacterial lipoproteins, with a cysteine as a putative cleavage and lipid attachment site (LXXC) .
  • This example describes the molecular conservation of SHB-HI-102 gene.
  • the amplified PCR products were sequenced using the Taq Dye Deoxy Terminator Cycle Sequencing Kit with an Applied Biosystems Inc. (Foster City, CA) automated sequencer (model 373A) according to the manufacturer's recommendations. Sequence analyses were performed with the Vector NTI analysis package (InforMax, Bethesda, MD) . Sequence comparison revealed that SHB-HI-102 gene and polypeptide sequences are well conserved. Genes sequences present 93.7% identity, whereas polypeptide sequences deduced from gene sequences present 93.9% identity throughout the 5 evaluated strains ( Figures 5 and 6).
  • This example illustrates the cloning of NTHI SHB-HI-102 gene in CMV plasmid pCMV-GH.
  • NTHI SHB-HI-102 polypeptide was inserted in phase downstream of a human growth hormone (hGH) gene which was under the transcriptional control of the cytomegalovirus (CMV) promoter in the plasmid vector pCMV-GH (Tang et al . , Nature, 1992, 356 : 152).
  • CMV cytomegalovirus
  • the CMV promoter is non-functional in EL . coli cells but active upon administration of the plasmid in eukaryotic cells.
  • the vector also incorporated the ampicillin resistance gene.
  • the coding region of SHB-HI-102 (SEQ ID NO: 1) gene without its leader peptide region was amplified by PCR (Hybaid PCR Express, ESBE Scientific) from genomic DNA of NTHI strain 12085 using oligonucleotide primers that contained base extensions for the addition of restriction sites Bam ⁇ I (GGATCC) or Xbal (TCTAGA) , which are described in Table 1.
  • the PCR product was purified from agarose gel using a QIAquick gel extraction kit (Qiagen) , and digested with restriction enzymes (Amersham Pharmacia Biotech, Inc) .
  • the pCMV-GH vector (Laboratory of Dr. Stephen A.
  • EXAMPLE 4 This example illustrates the use of DNA to elicit an immune response to NTHI polypeptide .
  • mice were immunized by intra-muscular injection three times at two- or three-week intervals with 50 ⁇ g of recombinant pCMV-GH encoding the SHB-HI-102 (SEQ ID NO: 1) gene in presence of 50 ⁇ g of granulocyte-macrophage colony- stimulating factor (GM-CSF) -expressing plasmid pCMV-GH-GM-CSF (Laboratory of Dr. Stephen A. Johnston, Department of Biochemistry, The University of Texas, Dallas, Texas) .
  • GM-CSF granulocyte-macrophage colony- stimulating factor
  • mice were injected with 50 ⁇ g of pCMV-GH in presence of 50 ⁇ g of pCMV-GH-GM-CSF .
  • Blood samples were collected from the orbital sinus prior to each immunization and seven days following the third injection.
  • Serum antibody responses were determined by ELISA using the His-Tag labeled NTHI recombinant SHB-HI-102 polypeptide as coating antigen. The production and purification of the His-tag labeled NTHI recombinant polypeptide are presented in Example 5.
  • the recombinant pET21b(+) plasmid with SHB-HI-102 (SEQ ID NO: 1) gene was used to transform by electroporation (Gene Pulser II apparatus, BIO-RAD Labs, Mississauga, Canada) EL .
  • coli strain BL21 Tuner (DE3) [F ⁇ ompT hsdS B (r B " ) gal dcm lacYl (DE3)] (Novagen) .
  • the T7 promoter controlling expression of the recombinant polypeptide is specifically recognized by the T7 RNA polymerase (present on the ⁇ DE3 prophage) whose gene is under the control of the lac promoter, which is inducible by isopropyl- ⁇ -d-thio- galactopyranoside (IPTG) .
  • the transformant Tuner (DE3)/ rpET21 was grown at 37°C with agitation at 250 rpm in Luria-Betani (LB) broth (peptone lOg/L, yeast extract 5g/L, NaCl lOg/L) containing 100 ⁇ g of ampicillin (Sigma-Aldrich Canada Ltd.
  • the purification of the recombinant polypeptide from the insoluble cytoplasmic fractions of IPTG-induced Tuner (DE3 ) /rpET21 was done by affinity chromatography based on the properties of the His «Tag sequence (6 consecutive histidine residues) to bind to divalent cations (Ni 2+ ) immobilized on the His'Bind metal chelation resin.
  • the cells were sonicated and centrifuged as above and the resulting pellet was resuspended in lysis buffer (5 mM imidazole, 2 M NaCl, 20 mM Tris-HCl pH 7.9) with 6 M Guanidine-HCl .
  • the suspension was incubated on ice for 1 h and centrifuged at 39,000 x g for 20 in.
  • the supernatant containing solubilized SHB-HI-102 polypeptide was deposited on a Ni-NTA agarose column (Qiagen) .
  • the His-tag labeled NTHI recombinant polypeptide was eluted with 250 mM imidazole-500mM NaCl-20 mM Tris pH 7.9. The removal of the salt and imidazole from the sample was done by dialysis against PBS at 4°C . To maintain SHB-HI-102 polypeptide in a solubilized state, 0.2% SDS had to be present in PBS after dialysis . The quantity of recombinant polypeptide obtained from the insoluble fraction of E. coli was estimated by MicroBCA (Pierce, Rockford, Illinois) . EXAMPLE 6
  • This example illustrates the cloning of NTHI SHB-HI-102 polypeptide for its expression in EL . coli outer membrane vesicles.
  • SHB-HI-102 polypeptide in E coli outer membrane vesicles
  • SEQ ID NO: 1 the SHB-HI-102 (SEQ ID NO: 1) gene (without its leader peptide-coding region) was cloned in frame with meningococcal NspA outer membrane protein signal sequence (SEQ ID NO: 1)
  • SEQ ID NO: 1 gene, without its leader peptide-coding sequence was amplified by PCR (Hybaid PCR Express, ESBE Scientific, Markham, Ontario, Canada) from genomic DNA of NTHI strain 12085 using oligos HiPH33 and HiPH34 (Table 1) .
  • PCR products were purified from agarose gel using a QIAquick gel extraction kit following the manufacturer's instructions (Qiagen, Chatsworth, CA) , and digested with iVdel and Xhol (Amersham Pharmacia Biotech, Inc, Baie d'Urfe, Canada) .
  • the pETssN vector (Novagen, Madison, WI) was digested with JVdel and Xhol , and purified from agarose gel using the QIAquick gel extraction kit (Qiagen) .
  • the DNA coding region of NTHI SHB-HI-102 polypeptide was inserted in phase downstream of the NspA signal sequence.
  • the iVdel-XhoI PCR products were ligated to the Ndel-Xhol pETssN expression vector. The ligated products were transformed into EL .
  • rpETssN Recombinant pETssN plasmid (rpETssN) containing SHB-HI-102 gene was purified using a Qiagen kit and DNA insert was sequenced
  • the rpETssN plasmid was used to transform by electroporation (Gene Pulser II apparatus, BIO-RAD Labs, Mississauga, Canada) E. coli strain BL21 Tuner (DE3) [F " ompT hsdS B (r B ⁇ m ) gal dcm lacYl (DE3)] (Novagen) .
  • E. coli strain BL21 Tuner (DE3) [F " ompT hsdS B (r B ⁇ m ) gal dcm lacYl (DE3)] (Novagen) .
  • the T7 promoter controlling expression of the recombinant polypeptide is specifically recognized by the T7 RNA polymerase (present on the ⁇ DE3 prophage) whose gene is under the control of the lac promoter, which is inducible by isopropyl- ⁇ -d-thio- galactopyranoside (IPTG).
  • the transformant Tuner (DE3)/ rpETssN was grown at 37°C with agitation at 250 rpm in Luria-Betani (LB) broth (peptone lOg/L, yeast extract 5g/L, NaCl lOg/L) containing 100 ⁇ g of carbenicillin (Sigma-Aldrich Canada Ltd. , Oakville, Canada) per ml until the A 600 reached a value of 0.5.
  • LB Luria-Betani
  • carbenicillin Sigma-Aldrich Canada Ltd. , Oakville, Canada
  • the cells were incubated for 3 additional hours in the presence of IPTG at a final concentration of 1 mM. Induced cells from a 1.25-L culture were pelleted by centrifugation and frozen at -
  • EXAMPLE 7 This example illustrates the purification of EL coli outer membrane vesicles containing NTHI recombinant SHB-HI-102 polypeptide.
  • OMVs outer membrane vesicles
  • DE3 IPTG- induced Tuner
  • the OMVs were then detoxified.
  • One volume of deoxycholic acid 1% (w/v) in 20 mM Tris pH 8.0 was added to the OMVs suspensions.
  • the resulting suspensions were ultra-centrifuged for 2 h, at 126,000 x g, 4 C C . Pellets were recovered, air-dried for 30 min, and resuspended in 1 ml of water. Suspensions were incubated for 2 days at 4°C with gentle agitation. Finally, 140 ⁇ l of 2 M sucrose were added to each tube and detoxified OMVs were kept frozen at -70°C.
  • EXAMPLE 8 This example illustrates the protection of mice against NTHI infection induced by immunization with E . coli outer membrane vesicles containing recombinant SHB-HI-102 polypeptide.
  • mice Groups of 6 female BALB/c mice (Charles River) were immunized 3 times by the intra-peritoneal route with 20 ⁇ g of EL coli outer membrane vesicles containing recombinant SHB-HI-102 polypeptide. The first immunization was performed in presence of complete Freund adjuvant (Gibco BRL) and the last two immunizations in presence of incomplete Freund adjuvant. As negative ' controls, mice were immunized with EL . coli outer membrane vesicles alone or containing an unrelated recombinant polypeptide. Blood samples were collected from the orbital sinus on each immunization day and 14 days following the third injection.
  • mice were challenged intra- trachealy with approximately 2xl0 5 CFU of NTHI strain 12085.
  • Samples of the NTHI challenge inoculum were plated on chocolate agar plates to determine the CFU and to verify the challenge dose.
  • mice were killed by an intra-peritoneal injection of sodium pentobarbital (EuthanylTM) 5 h after infection. The bronchoalveolar lavages were assessed for bacterial clearance by plating of serial dilutions for CFU determination.
  • EuthanylTM sodium pentobarbital
  • Each value represents a mean of five (control) or six (immunized) animals at each time.
  • ** P 0.0178, calculated according to the two-tailed unpaired t test.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Communicable Diseases (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention relates to polypeptides of nontypeable H. influenzae which may be useful for prophylaxis, diagnostic and/or therapy purposes.

Description

POLYPEPTIDES OF NONTYPEABLE HAEMOPHILUS INFLUENZAE
FIELD OF THE INVENTION
The present invention is related to nontypeable Haemophilus influenzae (NTHI) polypeptides and corresponding DNA fragments, which may be used to prevent, diagnose and/or treat Haemophilus influenzae infections.
BACKGROUND OF THE INVENTION
H. influenzae is a Gram-negative rod that is found in nature only as a human pathogen. Isolates of H. influenzae can be subdivided into capsulated and non-capsulated forms . Encapsulated strains express one of six structurally and antigenically distinct capsular polysaccharides that are designed types a to f . Non-encapsulated strains are defined by their failure to agglutinate with antisera against H. influenzae capsular polysaccharides and are referred to as nontypeable .
Nontypeable H. influenzae strains commonly colonize the upper respiratory tract, including the nasopharynx and the posterior oropharynx. A number of surveys of healthy individuals indicate colonization rates from 40% to 80% between both children and adults. Colonization with a particular strain may persist for weeks or months with most individuals remaining asymptomatic throughout this period. The pathogenesis of disease due to NTHI involves contiguous spread within the respiratory tract. Spread to adjacent areas is usually a consequence of abnormalities in either non-specific or specific host defences. Nontypeable H. influenzae causes a variety of respiratory tract infections in children and adults including otitis, sinusitis, bronchitis and pneumonia. These infections may become chronic or recurrent in patients with bronchitis or otitis. In fact, in infants and children, NTHI is a frequent cause of acute otitis media and is commonly implicated in recurrent otitis media. In infants, NTHI is responsible for 27% to 37% of the first episode of otitis media by the age of 1 year. Meningitis is sometimes caused by NTHI and accounts for 1% to 3% of all cases. However, NTHI is particularly prevalent in hosts with an underlying disease that affects the innate mucosal immune system, such as chronic obstructive pulmonary disease and cystic fibrosis. Nontypeable H. influenzae strains are often found predominantly during exacerbations when the sputum becomes mucopurulent . Acute infective exacerbations of chronic bronchitis play an important role in the morbidity and mortality of patients with chronic pulmonary disease.
The etiologies of community-acquired pneumonia appear to have changed in the last decade. While Steptococcus pneumoniae remains the predominant pathogen, the proportion of cases involving other organisms has increased. H. influenzae is now often reported as being the second most common cause of pneumonia. Ten percent of H. influenzae pneumonias are bacteremic . In developing countries, pneumonia caused by NTHI is apparently an important cause of morbidity and mortality in children.
Although several H. influenzae type b polysaccharide conjugated vaccines have been developed, these vaccines are ineffective against disease caused by other H. influenzae strains. The identification of conserved cross-protective antigens is critical for the development of a universal vaccine against H. influenzae infection and disease. The Haemophilus. influenzae genome is available at http: //www.ncbi . nlm.nih.gov/cqi- bin/Entrez/framik?db=Genome&gi=25 and has been published in « Whole-genome random sequencing and assembly of Haemophilus influenzae Rd » by Fleischmann,R.D. et al . , Science 269 (5223), 496-512 (1995). Outer membrane proteins such as Pi, P2, P4, P6, PCP, OMP26 and D-15 have been or are explored as potential vaccine antigens. Protein D-15 is the only conserved immunogen that has been described, in the scientific literature, as being capable of conferring protection against multiple serotypes and nontypeable strains . Therefore, there remains an unmet need for NTHI antigens that may be used as vaccine components for the prophylaxis and/or therapy of NTHI infection.
SUMMARY OF THE INVENTION
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention relates to polypeptides comprising SEQ ID No : 2 or fragments or analogs thereof .
In other aspects, there are provided polypeptides encoded by polynucleotides of the invention, pharmaceutical compositions, vectors comprising polynucleotides of the invention operably linked to an expression control region, as well as host cells transfected with said vectors and processes for producing polypeptides comprising culturing said host cells under conditions suitable for expression.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 represents the DNA sequence of SHB-HI-102 gene from NTHI strain 12085; SEQ ID NO : 1. The underlined portion of the sequence represents the leader peptide-coding region.
Figure 2 represents the amino acid sequence of SHB-HI-102 polypeptide from NTHI strain 12085; SEQ ID NO: 2. The underlined sequence represents the 23 amino acid residues leader peptide .
Figure 3 represents the DNA sequence of meningococcal NspA outer membrane protein leader peptide-coding region from Neisseria meningitidis strain 608B; SEQ ID NO: 3. The underlined portion of the sequence represents the restriction enzyme-recognition site used for in-frame gene cloning.
Figure 4 represents the amino acid sequence of meningococcal NspA outer membrane protein leader peptide from Neisseria meningitidis strain 608B; SEQ ID NO: 4. The underlined portion of the sequence represents the linker of amino acid residues encoded by the restriction enzyme-recognition site used for in-frame gene cloning.
Figure 5 represents the DNA sequence alignment of SHB-HI-102 genes (without the leader peptide-coding regions) from different H. influenzae strains.
Figure 6 represents the polypeptide sequence alignment of SHB- HI-102 polypeptides (without leader peptides) from different H. influenzae strains.
Figure 7 represents a clearance model in mice showing the protection conferred by systemic immunization with SHB-HI-102 recombinant polypeptide expressed in E. coli outer membrane vesicles .
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides purified and isolated polynucleotides, which encode H. influenzae polypeptides which may be used to prevent, diagnose and/or treat H. influenzae infection.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof .
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 90% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 98% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least .80% identity to a second- olypeptide comprising .SEQ ID Jo : 2.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 90% identity to a second polypeptide comprising SEQ ID No : 2.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2. According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 98% identity to a second polypeptide comprising SEQ ID No : 2.
According to one aspect, the present invention relates to polypeptides comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention relates to polypeptides comprising SEQ ID No : 2.
According to one aspect, the present invention relates to polypeptides consisting of SEQ ID No : 2 or fragments or analogs thereof .
According to one aspect, the present invention relates to polypeptides consisting of SEQ ID No : 2.
According to one aspect, the present invention provides a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
According to one aspect, the present invention provides a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID No : 2.
According to one aspect, the present invention relates to epitope bearing portions of a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof .
According to one aspect, the present invention relates to epitope bearing portions of a polypeptide comprising SEQ ID No : 2. According to one aspect, the present invention provides an isolated polynucleotide comprising a polynucleotide chosen from:
(a) a polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID
No : 2 or fragments or analogs thereof;
(b) a polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof; (c) a polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof; (d) a polynucleotide encoding a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof; (e) a polynucleotide encoding a polypeptide capable of generating antibodies having binding specificity for a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(f) a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(g) a polynucleotide comprising SEQ ID No : 1 or fragments or analogs thereof;
(h) a polynucleotide that is complementary to a polynucleotide in (a), (b) , (c) , (d) , (e) , (f) or (g) .
According to one aspect, the present invention provides an isolated polynucleotide comprising a polynucleotide chosen from: (a) a polynucleotide encoding a polypeptide having at least
70% identity to a second polypeptide comprising SEQ ID
No : 2; (b) a polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID No : 2 ;
(c) a polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID
No : 2;
(d) a polynucleotide encoding a polypeptide comprising SEQ ID No : 2;
(e) a polynucleotide encoding a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID No : 2;
(f) a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID No : 2;
(g) a polynucleotide comprising SEQ ID No : 1; (h) a polynucleotide that is complementary to a polynucleotide in (a), (b), (c), (d), (e), (f) or (g) .
According to one aspect, the present invention provides an isolated polypeptide comprising a polypeptide chosen from: (a) a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(b) a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(c) a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(d) a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(e) a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof; (f) an epitope bearing portion of a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof;
(g) the polypeptide of (a), (b) , (c) , (d) , (e) or (f) wherein the N-terminal Met residue is deleted; (h) the polypeptide of (a) , (b) , (c) , (d) , (e) or (f) wherein the secretory amino acid sequence is deleted.
According to one aspect, the present invention provides an isolated polypeptide comprising a polypeptide chosen from: (a) a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID No : 2;
(b) a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID No : 2;
(c) a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID No : 2;
(d) a polypeptide comprising SEQ ID No : 2;
(e) a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID No : 2;
(f) an epitope bearing portion of a polypeptide comprising SEQ ID No : 2;
(g) the polypeptide of (a), (b) , (c) , (d) , (e) or (f) wherein the N-terminal Met residue is deleted;
(h) the polypeptide of (a) , (b) , (c) , (d) , (e) or (f) wherein the secretory amino acid sequence is deleted.
Those skilled in the art will appreciate that the invention includes DNA molecules, i.e. polynucleotides and their complementary sequences that encode analogs such as mutants, variants, homologues and derivatives of such polypeptides, as described herein in the present patent application. The invention also includes RNA molecules corresponding to the DNA molecules of the invention. In addition to the DNA and RNA molecules, the invention includes the corresponding polypeptides and monospecific antibodies that specifically bind to such polypeptides .
In accordance with the present invention, all polynucleotides encoding polypeptides of the invention are within the scope of the present invention.
In a further embodiment, the polypeptides in accordance with the present invention are antigenic.
In a further embodiment, the polypeptides in accordance with the present invention are immunogenic .
In a further embodiment,' the polypeptides in accordance with the present invention can elicit an immune response in a host.
In a further embodiment, the present invention also relates to polypeptides which are able to raise antibodies having binding specificity to the polypeptides of the present invention as defined above.
An antibody that "has binding specificity" is an antibody that recognizes and binds the selected polypeptide but which does not substantially recognize and bind other molecules in a sample, e . g.. ,-a biological sample-, which naturally includes the selected peptide. Specific binding can be measured using an ELISA assay in which the selected polypeptide is used as an antigen.
In accordance with the present invention, "protection" in the biological studies is defined by a significant increase in the survival curve, rate or period. Statistical analysis using the Log rank test to compare survival curves, and Fisher exact test to compare survival rates and numbers of days to death, respectively, might be useful to calculate P values and determine whether the difference between the two groups is statistically significant. P values of 0.05 are regarded as not significant.
In an additional aspect of the invention there are provided immunogenic and/or antigenic fragments of the polypeptides of the invention, or of analogs thereof.
The fragments of the present invention should include one or more such epitopic regions or be sufficiently similar to such regions to retain their immunogenic and/or antigenic properties. Thus, for fragments according to the present invention the degree of identity is perhaps irrelevant, since they may be 100% identical to a particular part of a polypeptide or analog thereof as described herein. The present invention further provides an immunogenic fragment of a polypeptide of the invention, said fragment being a contiguous portion of the polypeptide of the invention. The present invention further provides fragments having at least 10 contiguous amino acid residues from the polypeptide sequences of the present invention. In one embodiment, at least 15 contiguous amino acid residues. In one embodiment, at least 20 contiguous amino acid residues. In one embodiment, at least 30 contiguous amino acid residues. In one embodiment, -at least 40 contiguous amino acid residues. In one embodiment, at least 50 contiguous amino acid residues. In one embodiment, at least 100 contiguous amino acid residues. In one embodiment, at least 150 contiguous amino acid residues .
The present invention further provides a fragment which has the same or substantially the same immunogenic activity as the polypeptide comprising Seq. ID no. 2. The fragment (when coupled to a carrier, if necessary) is capable of raising an immune response which recognizes the SHB-HI-102 polypeptide.
Such an immunogenic fragment may include, for example, the SHB- HI-102 polypeptide lacking an N-terminal leader peptide, and/or a transmembrane domain and/or a C-terminal anchor domain and /or external loops and/or turns. The present invention further provides a fragment of SHB-HI-102 comprising substantially all of the extra cellular domain of a ppoypeptide which has at least 70% identify, preferably 80% identity, more preferably 95% identity, to a second polypeptide comprising Seq. ID No. 2, over the entire length of said sequence.
The present invention further provides fragment which comprise a B-cell or T-helper epitope.
The present invention further provides fragment that may be part of a larger polypeptide. It can be advantageous to include an additional amino acid sequence which contains secretory or leader sequences, or sequences which aid in purification such as multiple histidine residues, or an additional sequence which increases stability during recombinant production, or an additional polypeptide or lipid tail sequences which increase the immunogenic potential of the final polypeptide .
The skilled person will appreciate that analogs of the polypeptides of the invention will also find use in the context of the present invention, i.e. as antigenic/immunogenic material. Thus, for instance proteins or polypeptides which include one or more additions, deletions, substitutions or the like are encompassed by the present invention.
As used herein, "fragments", "analogs" or "derivatives" of the polypeptides of the invention include those polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably conserved) and which may be natural or unnatural . In one embodiment, derivatives and analogs of polypeptides of the invention will have about 80% identity with those sequences illustrated in the figures or fragments thereof. That is, 80% of the residues are the same. In a further embodiment, polypeptides will have greater than 80% identity. In a further embodiment, polypeptides will have greater than 85% identity. In a further embodiment, polypeptides will have greater than 90% identity. In a further embodiment, polypeptides will have greater than 95% identity. In a further embodiment, polypeptides will have greater than 99% identity. In a further embodiment, analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.
These substitutions are those having a minimal influence on the secondary structure and hydropathic nature of the polypeptide.
Preferred substitutions are those known in the art as conserved, i.e. the substituted residues share physical or chemical properties such as hydrophobicity, size, charge or functional groups . These include substitutions such as those described by Dayhoff, M. in Atlas of Protein Sequence and.
Structure 5_, 1978 and by Argos, P. in EMBO J. 8_, 779-785, 1989.
For example, amino acids, either natural or unnatural, belonging to one of the following groups represent conservative changes : ala, pro, gly, gin, asn, ser, thr, val; cys, ser, tyr, thr; val, ile, leu, met, ala, phe; lys, arg, orn, his; and phe, tyr, trp, his. The preferred substitutions also include substitutions of D- enantiomers for the corresponding L-amino acids .
In an alternative approach, the analogs could be fusion polypeptides, incorporating moieties which render purification easier, for example by effectively tagging the desired polypeptide. It may be necessary to remove the "tag" or it may be the case that the fusion polypeptide itself retains sufficient antigenicity to be useful .
The percentage of homology is defined as the sum of the percentage of identity plus the percentage of similarity or conservation of amino acid type.
In one embodiment, analogs of polypeptides of the invention will have about 70% identity with those sequences illustrated in the figures or fragments thereof. That is, 70% of the residues are the same. In a further embodiment, polypeptides will have greater than 80% identity. In a further embodiment, polypeptides will have greater than 85% identity. In a further embodiment, polypeptides will have greater than 90% identity. In a further embodiment, polypeptides will have greater than 95% identity. In a further embodiment, polypeptides will have greater than 99% identity. In a further embodiment, analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.
In one embodiment, analogs of polypeptides of the invention will have about 70% homology with those sequences illustrated in the figures or fragments thereof. In a further embodiment, polypeptides will have greater than 80% homology. In a further embodiment, polypeptides will have greater than 85% homology. In a further embodiment, polypeptides will have greater than 90% homology. In a further embodiment, polypeptides will have greater than 95% homology. In a further embodiment, polypeptides will have greater than 99% homology. In a further embodiment, analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.
In an alternative approach, the analogs or derivatives could be fusion polypeptides, incorporating moieties which render purification easier, for example by effectively tagging the desired protein or polypeptide, it may be necessary to remove the "tag" or it may be the case that the fusion polypeptide itself retains sufficient antigenicity to be useful.
It is well known that it is possible to screen an antigenic polypeptide to identify epitopic regions, i.e. those regions which are responsible for the polypeptide' s antigenicity or immunogenicity. Methods for carrying out such screening are well known in the art. Thus, the fragments of the present invention should include one or more such epitopic regions or be sufficiently similar to such regions to retain their antigenic/immunogenic properties.
Thus, what is important for analogs, derivatives and fragments is that they possess at least a degree of- the antigenicity/ immunogenicity of the protein or polypeptide from which they are derived.
Also included are polypeptides which have fused thereto other compounds which alter the polypeptides biological or pharmacological properties i.e. polyethylene glycol (PEG) to increase half-life; leader or secretory amino acid sequences for ease of purification; prepro- and pro- sequences; and (poly) saccharides . Furthermore, in those situations where amino acid regions are found to be polymorphic, it may be desirable to vary one or more particular amino acids to more effectively mimic the different epitopes of the different H. influenzae strains.
Moreover, the polypeptides of the present invention can be modified by terminal -NH2 acylation (eg. by acetylation, or thioglycolic acid amidation, terminal carboxy amidation, e.g. with ammonia or methylamine) to provide stability, increased hydrophobicity for linking or binding to a support or other molecule.
Also contemplated are hetero and homo polypeptide multimers of the polypeptide fragments and analogues . These polymeric forms include, for example, one or more polypeptides that have been cross-linked with cross-linkers such as avidin/biotin, gluteraldehyde or dimethylsuperimidate. Such polymeric forms also include polypeptides containing two or more tandem or inverted contiguous sequences, produced from multicistronic mRNAs generated by recombinant DNA technology.
In a further embodiment, the present invention also relates to chimeric polypeptides which comprise one or more polypeptides or fragments or analogs thereof as defined in the figures of the present application.
In a further embodiment, the present invention also relates to chimeric polypeptides comprising two or more polypeptides comprising SEQ ID No : 2 or fragments or analogs thereof; provided that the polypeptides are linked as to formed a chimeric polypeptide . In a further embodiment, the present invention also relates to chimeric polypeptides comprising two or more polypeptides comprising SEQ ID No : 2 provided that the polypeptides are linked as to formed a chimeric polypeptide.
Preferably, a fragment, analog or derivative of a polypeptide of the invention will comprise at least one antigenic region i.„e. at least one epitope.
In order to achieve the formation of antigenic polymers (i.e. synthetic multimers) , polypeptides may be utilized having bishaloacetyl groups, nitroarylhalides, or the like, where the reagents being specific for thio groups. Therefore, the link between two mercapto groups of the different polypeptides may be a single bond or may be composed of a linking group of at least two, typically at least four, and not more than 16, but usually not more than about 14 carbon atoms .
In a particular embodiment, polypeptide fragments and analogs of the invention do not contain a starting residue, such as methionine (Met) or valine (Val) . Preferably, polypeptides will not incorporate a leader or secretory sequence (signal sequence) . The signal portion of a polypeptide of the invention may be determined according to established molecular biological techniques. In general, the polypeptide of interest may be isolated from a H. influenzae culture and subsequently sequenced to determine the initial residue of the mature protein and therefore the sequence of the mature polypeptide.
It is understood that polypeptides can be produced and/or used without their start codon (methionine or valine) and/or without their leader peptide to favor production and purification of recombinant polypeptides . It is known that cloning genes without sequences encoding leader peptides will restrict the polypeptides to the cytoplasm of E. coli and will facilitate their recovery (Glick, B.R. and Pasternak, J.J. (1998) Manipulation of gene expression in prokaryotes . In "Molecular biotechnology: Principles and applications of recombinant DNA", 2nd edition, ASM Press, Washington DC, p.109-143).
According to another aspect of the invention, there are also provided (i) a composition of matter containing a polypeptide of the invention, together with a carrier, diluent or adjuvant; (ii) a pharmaceutical composition comprising a polypeptide of the invention and a carrier, diluent or adjuvant; (iii) a vaccine comprising a polypeptide of the invention and a carrier, diluent or adjuvant; (iv) a method for inducing an immune response against H. influenzae, in a host, by administering to the host, an immunogenically effective amount of a polypeptide of the invention to elicit an immune response, e.g., a protective immune response to H. influenzae; and particularly, (v) a method for preventing and/or treating a H. influenzae infection, by administering a prophylactic or therapeutic amount of a polypeptide of the invention to a host in need.
According to another aspect of the invention, there are also provided (i) a composition of matter containing a polynucleotide of the invention, together with a carrier, diluent or adjuvant; (ii) a pharmaceutical composition comprising a polynucleotide of the invention and a carrier, diluent or adjuvant; (iii) a method for inducing an immune response against H. influenzae, in a host, by administering to the host, an immunogenically effective amount of a polynucleotide of the invention to elicit an immune response, e.g., a protective immune response to H. influenzae; and particularly, (iv) a method for preventing and/or treating a H. influenzae infection, by administering a prophylactic or therapeutic amount of a polynucleotide of the invention to a host in need.
Before immunization, the polypeptides of the invention can also be coupled or conjugated to carrier proteins such as tetanus toxin, diphtheria toxin, hepatitis B virus surface antigen, poliomyelitis virus VPl antigen or any other viral or bacterial toxin or antigen or any suitable proteins to stimulate the development of a stronger immune response . This coupling or conjugation can be done chemically or genetically. A more detailed description of peptide-carrier conjugation is available in Van Regenmortel, M.H.V., Briand J.P., Muller S., Plaue S . , «Synthetic Polypeptides as antigens» in Laboratory Techniques in Biochemistry and Molecular Biology, Vol .19 (ed.) Burdou, R.H. & Van Knippenberg P.H. (1988), Elsevier New York.
According to another aspect, there are provided pharmaceutical compositions comprising one or more H. influenzae polypeptides of the invention in a mixture with a pharmaceutically acceptable adjuvant. Suitable adjuvants include (1) oil-in- water emulsion formulations such as MF59™, SAF™, Ribi™ ; (2) Freund's complete or incomplete adjuvant; (3) salts i.e. A1K(S04)2, AlNa(S04)2, AlNH4(S04)2, A1(0H)3, AlP04, silica, kaolin; (4) saponin derivatives such as Stimulon™ or particles generated therefrom such as ISCOMs (immunostimulating complexes) ; (5) cytokines such as interleukins, interferons, macrophage colony stimulating factor (M-CSF) , tumor necrosis factor (TNF) ; (6) other substances such as carbon polynucleotides i.e. poly IC and poly AU, detoxified cholera toxin (CTB)and E.coli heat labile toxin for induction of mucosal immunity; and (7) liposomes. A more detailed description of adjuvants is available in a review by M.Z.I Khan et al. in Pharmaceutical Research, vol. 11, No. 1 (1994) pp2- 11, and also in another review by Gupta et al . , in Vaccine, Vol. 13, No. 14, ppl263-1276 (1995) and in WO 99/24578. Preferred adjuvants include QuilA™, QS21™, Alhydrogel™ and Ad uphos™.
Pharmaceutical compositions of the invention may be administered parenterally by injection, rapid infusion, nasopharyngeal absorption, dermoabsorption, or buccal or oral.
The term pharmaceutical composition is also meant to include antibodies. In accordance with the present invention, there is also provided the use of one or more antibodies having binding specificity for the polypeptides of the present invention for the treatment or prophylaxis of H. influenzae infection and/or diseases and symptoms mediated by H. influenzae infection.
Pharmaceutical compositions of the invention are used for the prophylactic or therapeutic treatment of H. influenzae infection and/or diseases and symptoms mediated by H. influenzae infection as described in Manual of Clinical Microbiology, P.R. Murray (Ed, in chief),E.J. Baron, M.A. Pfaller, F.C. Tenover and R.H. Yolken. ASM Press, Washington, D.C. seventh edition, 1999, 1773p. In one embodiment, pharmaceutical compositions of the present invention are used for the prophylactic or therapeutic treatment of otitis media, sinusitis, bronchitis, pneumonia, meningitis. In one embodiment, vaccine compositions of the invention are used for the prophylactic or therapeutic treatment of H. influenzae infection and/or diseases and symptoms mediated by H. influenzae infection. In a further embodiment, the H_;_ influenzae infection is nontypeable H. influenzae.
In a further embodiment, the invention provides a method for prophylaxis or treatment of H. influenzae infection in a host susceptible to H. influenzae infection comprising administering to said host a prophylactic or therapeutic amount of a composition of the invention.
As used in the present application, the term "host" includes mammals. In a further embodiment, the mammal is human.
In a particular embodiment, pharmaceutical compositions are administered to those hosts at risk of H. influenzae infection such as neonates, infants, children, elderly and immunocompromised hosts.
In a particular embodiment, pharmaceutical compositions are administered to those hosts at risk of H. influenzae infection such as adults .
Pharmaceutical compositions are preferably in unit dosage form of about 0.001 to 100 μg/kg (antigen/body weight) and more preferably 0.01 to 10 μg/kg and most preferably 0.1 to 1 μg/kg 1 to 3 times with an interval of about 1 to 6 week intervals between immunizations.
Pharmaceutical compositions are preferably in unit dosage form of about 0.1 μg to 10 mg and more preferably lμg to 1 g and most preferably 10 to 100 μg 1 to 3 times with an interval of about 1 to 6 week intervals between immunizations.
According to another aspect, there are provided polynucleotides encoding polypeptides characterized by the amino acid sequence comprising SEQ ID No : 2 or fragments or analogs thereof .
In one embodiment, polynucleotides are those illustrated in SEQ ID No: 1 which may include the open reading frames (ORF) , encoding the polypeptides of the invention. It will be appreciated that the polynucleotide sequences illustrated in the figures may be altered with degenerate codons yet still encode the polypeptides of the invention. Accordingly the present invention further provides polynucleotides which hybridize to the polynucleotide sequences herein above described (or the complement sequences thereof) having 70% identity between sequences. In one embodiment, at least 80% identity between sequences. In one embodiment, at least 85% identity between sequences. In one embodiment, at least 90% identity between sequences. In a further embodiment, polynucleotides are hybridizable under stringent conditions i.e. having at least 95% identity. In a further embodiment, more than 97% identity.
In a further embodiment, the present invention provides polynucleotides that hybridize under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or (b) the complement of a DNA sequence encoding a polypeptide ; wherein said polypeptide comprises SEQ ID No : 2 or fragments or analogs thereof.
In a further embodiment, the present invention provides polynucleotides that hybridize under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or
(b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises a sequence chosen from SEQ ID NO: 2. In a further embodiment, the present invention provides polynucleotides that hybridize under stringent conditions to either
(a) a DNA' sequence encoding a polypeptide or
(b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises at least 10 contiguous amino acid residues from a polypeptide comprising SEQ ID No : 2 or fragments or analogs thereof.
In a further embodiment, the present invention provides polynucleotides that hybridize under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or (b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises at least 10 contiguous amino acid residues from a polypeptide comprising SEQ ID No : 2.
In a further embodiment, polynucleotides are those illustrated in SEQ ID NO: 1 or fragments or analogs thereof encoding polypeptides of the invention.
In a further embodiment, polynucleotides are those illustrated in SEQ ID NO: 1 encoding polypeptides of the invention.
As will be readily appreciated by one skilled in the art, polynucleotides include both DNA and RNA.
The present invention also includes polynucleotides complementary to the polynucleotides described in the present application. In a further aspect, polynucleotides encoding polypeptides of the invention, or fragments, analogs or derivatives thereof, may be used in a DNA immunization method. The use of a polynucleotide of the invention may employ a delivery method such as direct injection of plasmid DNA. That is, the polynucleotide can be incorporated into a vector which is replicable and expressible upon injection thereby producing the antigenic polypeptide in vivo. For example polynucleotides may be incorporated into a plasmid vector under the control of the CMV promoter which is functional in eukaryotic cells . Preferably the vector is injected intramuscularly. Other suitable delivery methods include delivery of DNA complexed with specific protein carriers, coprecipitation of DNA with calcium phosphate, encapsultaion of DNA in various forms of liposomes, particle bombardment and in vivo infection using cloned retroviral vectors .
According to another aspect, there is provided a process for producing polypeptides of the invention by recombinant techniques by expressing a polynucleotide encoding said polypeptide in a host cell and recovering the expressed polypeptide product .
Alternatively, the polypeptides can be produced according to established synthetic chemical techniques i.e. solution phase or solid phase synthesis of oligopeptides which are ligated to produce the full polypeptide (block ligation) .
Suitable stringent conditions for hybridization can be readily determined by one of skilled in the art . Stringent and moderately stringent conditions are those commonly defined and available, such as those defined by Sambrook and Russell, Molecular Cloning: A Laboratory Manual, second or third edition, Cold Spring Harbor Laboratory Press, NY, 1989 or 2001 or Ausubel et al . , Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1999. The precise level of stringency is not important, rather, conditions should be selected that provide a clear, detectable signal when specific hybridization has occurred
Hybridization is a function of sequence identity (homology) , G+C content of the sequence, buffer salt content, sequence length and duplex melt temperature (T[m] ) among other variables. See, Maniatis et al . , Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 1982. With similar sequence lengths, the buffer salt concentration and temperature provide useful variables for assessing sequence identity (homology) by hybridization techniques. For example, where there is at least 90 percent homology, hybridization is commonly carried out at 68°C. in a buffer salt such as 6. times . SCC diluted from 20. times . SSC. See Sambrook and Russell, Molecular Cloning:' A Laboratory Manual, second or third edition, Cold Spring Harbor Laboratory Press, NY, 1989 or 2001. The buffer salt utilized for final Southern blot washes can be used at a low concentration, e.g., 0.1. times . SSC and at a relatively high temperature, e.g., 68°C, and two sequences will form a hybrid duplex (hybridize) . Use of the above hybridization and washing conditions together are defined as conditions of high stringency or highly stringent conditions. Moderately stringent conditions can be utilized for hybridization where two sequences share at least about 80 percent homology. Here, hybridization is carried out using 6. times . SSC at a temperature of about 50-55°C. A final wash salt concentration of about 1-3. times .SSC and at a temperature of about 60-68°C. are used. These hybridization and washing conditions define moderately stringent conditions. In particular, specific hybridization occurs under conditions in which a high degree of complementarity exists between a nucleic acid comprising the sequence of an isolated sequence and another nucleic acid. With specific hybridization, complementarity will generally be at least about 70%, 75%, 80%, 85%, preferably about 90-100%, or most preferably about 95- 100%.
As used herein, nucleic acid or polypeptide homology or identity is determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al . Proc. Natl. Acad. Sci . USA 87: 2264-2268 (1990) and Altschul, S. F. J. Mol. Evol. 36: 290-300(1993), both of which are herein incorporated by reference) which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al . (Nature Genetics 6: 119-129 (1994)) which is herein incorporated by reference. The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences) , cutoff, matrix and filter are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoffet al . Proc. Natl. Acad. Sci. USA 89: 10915-10919 (1992), herein incorporated by reference) . For blastn, the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues) , wherein the default values for M and N are 5 and -4, respectively. It is also possible to use a program such as the CLUSTAL program to compare amino acid sequences . This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or homology for an optimal alignment. Both types of identity analysis are contemplated in the present invention.
General methods for obtention and evaluation of polynucleotides and polypeptides are described in the following references :
Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd or
3e ed, Cold Spring Harbor, N.Y., 1989 or 2001; Current
Protocols in Molecular Biology, Edited by Ausubel F.M. et al . ,
John Wiley and Sons, Inc. New York; PCR Cloning Protocols, from Molecular Cloning to Genetic Engineering, Edited by White B.A.,
Humana Press, Totowa, New Jersey, 1997, 490 pages; Protein
Purification, Principles and Practices, Scopes R.K., Springer-
Verlag, New York, 3rd Edition, 1993, 380 pages; Current
Protocols in Immunology, Edited by Coligan J.E. et al . , John Wiley & Sons Inc., New York.
The present invention provides a process for producing a polypeptide comprising culturing a host cell of the invention under conditions suitable for expression of said polypeptide.
For recombinant production, host cells are transfected with vectors which encode the polypeptides of the invention, and then cultured in a nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes . Suitable vectors are those that are viable and replicable in the chosen host and include chromosomal, non- chromosomal and synthetic DNA sequences e.g. bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA. The polypeptide sequence may be incorporated in the vector at the appropriate site using restriction enzymes such that it is operably linked to an expression control region comprising a promoter, ribosome binding site (consensus region or Shine- Dalgarno sequence) , and optionally an operator (control element) . One can select individual components of the expression control region that are appropriate for a given host and vector according to established molecular biology principles (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed, Cold Spring Harbor, N.Y., 1989; Current Protocols in Molecular Biology, Edited by Ausubel F.M. et al . , John Wiley and Sons, Inc. New York) . Suitable promoters include but are not limited to LTR or SV40 promoter, E.coli lac, tac or trp promoters and the phage lambda PL promoter. Vectors will preferably incorporate an origin of replication as well as selection markers i.e. ampicilin resistance gene. Suitable bacterial vectors include pET, pQE70, pQE60, pQE-9, pDlO phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNHlβa, pNHlδA, pNH46A, ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 and eukaryotic vectors pBlueBacIII, pWLNEO, pSV2CAT, pOG44, pXTl, pSG, pSVK3 , pBPV, pMSG and pSVL. Host cells may be bacterial i.e. E.coli, Bacillus subtilis, Streptomyces ; fungal i.e. Aspergillus niger, Aspergillus nidulins; yeast i.e. Saccharomyces or eukaryotic i.e. CHO, COS.
Upon expression of the polypeptide in culture, cells are typically harvested by centrifugation then disrupted by physical or chemical means (if the expressed polypeptide is not secreted into the media) and the resulting crude extract retained to isolate the polypeptide of interest. Purification of the polypeptide from culture media or lysate may be achieved by established techniques depending on the properties of the polypeptide i.e. using ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography and lectin chromatography. Final purification may be achieved using HPLC .
The polypeptides may be expressed with or without a leader or secretion sequence. In the former case the leader may be removed using post-translational processing (see US 4,431,739; US 4,425,437; and US 4,338,397) or be chemically removed subsequent to purifying the expressed polypeptide.
According to a further aspect, the H. influenzae polypeptides of the invention may be used in a diagnostic test for H. influenzae infection, in particular nontypeable H. influenzae infection.
Several diagnostic methods are possible, for example detecting H. influenzae organism in a biological sample, the following procedure may be followed: a) obtaining a biological sample from a host; b) incubating an antibody or fragment thereof reactive with a H. influenzae polypeptide of the invention with the biological sample to form a mixture; and c) detecting specifically bound antibody or bound fragment in the mixture which indicates the presence of H. influenzae .
Alternatively, a method for the detection of antibody specific to a H. influenzae antigen in a biological sample containing or suspected of containing said antibody may be performed as follows : a) obtaining a biological sample from a host; b) incubating one or more H. influenzae polypeptides of the invention or fragments thereof with the biological sample to form a mixture; and c) detecting specifically bound antigen or bound fragment in the mixture which indicates the presence of antibody specific to H. influenzae .
One of skill in the art will recognize that this diagnostic test may take several forms, including an immunological test such as an enzyme-linked immunosorbent assay (ELISA) , a radioimmunoassay or a latex agglutination assay, essentially to determine whether antibodies specific for the protein are present in an organism.
The DNA sequences encoding polypeptides of the invention may also be used to design DNA probes for use in detecting the presence of H. influenzae in a biological sample suspected of containing such bacteria. The detection method of this invention comprises : a) obtaining the biological sample from a host; b) incubating one or more DNA probes having a DNA sequence encoding a polypeptide of the invention or fragments thereof with the biological sample to form a mixture; and c) detecting specifically bound DNA probe in the mixture which indicates the presence of H. influenzae bacteria.
The DNA probes of this invention may also be used for detecting circulating H. influenzae i.e. H. influenzae nucleic acids in a sample, for example using a polymerase chain reaction, as a method of diagnosing H. influenzae infections. The probe may be synthesized using conventional techniques and may be immobilized on a solid phase, or may be labelled with a detectable label. A preferred DNA probe for this application is an oligomer having a sequence complementary to at least about 6 contiguous nucleotides of the H. influenzae polypeptides of the invention. In a further embodiment, the preferred DNA probe will be an oligomer having a sequence complementary to at least about 15 contiguous nucleotides of the H. influenzae polypeptides of the invention. In a further embodiment, the preferred DNA probe will be an oligomer having a sequence complementary to at least about 30 contiguous nucleotides of the H. influenzae polypeptides of the invention. In a further embodiment, the preferred DNA probe will be an oligomer having a sequence complementary to at least about 50 contiguous nucleotides of the H. influenzae polypeptides of the invention.
Another diagnostic method for the detection of H. influenzae in a host comprises : a) labelling an antibody reactive with a polypeptide of the invention or fragment thereof with a detectable label ; b) administering the labelled antibody or labelled fragment to the host; and c) detecting specifically bound labelled antibody or labelled fragment in the host which indicates the presence of H. influenzae .
A further aspect of the invention is the use of the H. influenzae polypeptides of the invention as immunogens for the production of specific antibodies for the diagnosis and in particular the treatment of H. influenzae infection. Suitable antibodies may be determined using appropriate screening methods, for example by measuring the ability of a particular antibody to passively protect against H. influenzae infection in a test model . One example of an animal model is the mouse model described in the examples herein. The antibody may be a whole antibody or an antigen-binding fragment thereof and may belong to any immunoglobulin class. The antibody or fragment may be of animal origin, specifically of mammalian origin and more specifically of murine, rat or human origin. It may be a natural antibody or a fragment thereof, or if desired, a recombinant antibody or antibody fragment. The term recombinant antibody or antibody fragment means antibody or antibody fragment which was produced using molecular biology techniques . The antibody or antibody fragments may be polyclonal, or preferably monoclonal. It may be specific for a number of epitopes associated with the H. influenzae polypeptides but is preferably specific for one.
According to one aspect, the present invention provides the use of an antibody for prophylaxis and/or treatment of H. influenzae infections.
A further aspect of the invention is the use of the antibodies directed to the polypeptides of the invention for passive immunization. One could use the antibodies described in the present application.
A further aspect of the invention is a method for immunization, whereby an antibody raised by a polypeptide of the invention is administered to a host in an amount sufficient to provide a passive immunization.
In a further embodiment, the invention provides the use of a pharmaceutical composition of the invention in the manufacture of a medicament for the prophylactic or therapeutic treatment of H. influenzae infection. In a further embodiment, the invention provides a kit comprising a polypeptide of the invention for detection or diagnosis of H. influenzae infection.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLE 1
This example illustrates the cloning and molecular characteristics of SHB-HI-102 gene and corresponding polypeptide .
The coding region of NTHI SHB-HI-102 (SEQ ID NO: 1) gene, from nucleotide 85, was amplified by PCR (Hybaid PCR Express, ESBE Scientific, Markham, Ontario, Canada) from genomic DNA of NTHI strain 12085 using the following oligos that contained base extensions for the addition of restriction sites Ndel (CATATG) and Xhol (CTCGAG) : HiPH33 (5'-
TGTACCTCTCATATGAAAAACACTCAGATTCCAACCA -3') and HiPH34 (5'- TTCTAGCTCGAGCCGTAATACCCATACTCTACCGTAG -3 ' ) . PCR products were purified from agarose gel using a QIAquick gel extraction kit following the manufacturer's instructions (Qiagen, Chatsworth, CA) , and digested with Ndel and Xhol (Amersham Pharmacia
Biotech, Inc, Baie d'Urfe, Canada) . The pET21b(+) vector
(Novagen, Madison, WI) was digested with Ndel and Xhol and purified from agarose gel using a QIAquick gel extraction kit
(Qiagen) . The Ndel-Xhol PCR products were ligated to the Ndel-Xhol pET21b(+) expression vector. The ligated products were transformed into E. coli strain DH5« [φ80dlacZΔM15 Δ(lacZYA-argF)U169 endAl recAl hsdRl7 (rK-mK+) deoR thi-1 supE44 λ-gyrA96 relAl] (Gibco BRL, Gaithersburg, MD) according to the method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed) , pp. 109-135). Recombinant pET21b(+) plasmid (rpET21b(+)) containing SHB-HI-102 gene was purified using a Qiagen kit and DNA insert was sequenced (Taq Dye Deoxy Terminator Cycle Sequencing kit, ABI, Foster City, CA) .
Table 1. Oligonucleotide primers used for PCR amplification of NTHI SHB-HI-102 gene.
Figure imgf000036_0001
It was determined that the open reading frame (ORF) which codes for SHB-HI-102 polypeptide contains 1110 bp and encodes a 369 amino acid residues polypeptide with a predicted pi of 9.29 and a predicted molecular mass of 40 918 Da. Analysis of the predicted amino acid residues sequence (SEQ ID NO :2) using the
SPScan software (Wisconsin Sequence Analysis Package; Genetics
Computer Group) suggested the existence of a 23 amino acid residues signal peptide (MSMLKPFWFKTFSISIITALLVA) , which ends with a cleavage site located between an alanine and a cysteine residues. The polypeptide possesses a predicted signal sequence typical of bacterial lipoproteins, with a cysteine as a putative cleavage and lipid attachment site (LXXC) .
EXAMPLE 2
This example describes the molecular conservation of SHB-HI-102 gene.
To confirm the presence by PCR amplification of SHB-HI-102 (SEQ ID N0:1) gene, the following 4 distinct NTHI strains were used: NTHI 12085, B20, A18, and A108 clinical isolates. The three later isolates were provided by Dr. Michel G. Bergeron (Centre de Recherche en Infectiologie, Universite Laval, Quebec, Canada). The former 12085 strain was provided by Dr. Robert S. Munson (Ohio State University, Columbus, OH, USA) . The strain used for genome sequencing (H^ influenzae strain Rd, obtained from Dr. Marc Sirois, Universite du Quebec a Trois-Rivieres, Quebec, Canada) was also employed. The E, coli XLl-Blue MRF' was used in these experiments as a negative control . SHB-HI-102
(SEQ ID NO :1) gene was amplified by PCR (Hybaid PCR Express,
ESBE Scientific) from genomic DNA from the 4 NTHI strains, the
Rd strain and the control E_;_ coli strain using the oligonucleotides primers PGHi505 and PGHi506 (Table 1) . PCR was performed with 35 cycles of 45 sec at 94°C, 45 sec at 45°C and 90 sec at 72°C followed by a final elongation period of 7 min at 72°C. The PCR products were size fractionated in 1% agarose gels and were visualized by ethidium bromide staining. The analysis of the amplification products revealed that the SHB- HI-102 (SEQ ID NO :1) gene was present in the genome of all of the 4 NTHI and the Rd strains tested. No such product was detected when the control E^ coli DNA was submitted to identical PCR amplifications with these oligonucleotide primers .
The amplified PCR products were sequenced using the Taq Dye Deoxy Terminator Cycle Sequencing Kit with an Applied Biosystems Inc. (Foster City, CA) automated sequencer (model 373A) according to the manufacturer's recommendations. Sequence analyses were performed with the Vector NTI analysis package (InforMax, Bethesda, MD) . Sequence comparison revealed that SHB-HI-102 gene and polypeptide sequences are well conserved. Genes sequences present 93.7% identity, whereas polypeptide sequences deduced from gene sequences present 93.9% identity throughout the 5 evaluated strains (Figures 5 and 6).
EXAMPLE 3
This example illustrates the cloning of NTHI SHB-HI-102 gene in CMV plasmid pCMV-GH.
The DNA coding region of NTHI SHB-HI-102 polypeptide was inserted in phase downstream of a human growth hormone (hGH) gene which was under the transcriptional control of the cytomegalovirus (CMV) promoter in the plasmid vector pCMV-GH (Tang et al . , Nature, 1992, 356 : 152). The CMV promoter is non-functional in EL. coli cells but active upon administration of the plasmid in eukaryotic cells. The vector also incorporated the ampicillin resistance gene.
The coding region of SHB-HI-102 (SEQ ID NO: 1) gene without its leader peptide region was amplified by PCR (Hybaid PCR Express, ESBE Scientific) from genomic DNA of NTHI strain 12085 using oligonucleotide primers that contained base extensions for the addition of restriction sites BamΑI (GGATCC) or Xbal (TCTAGA) , which are described in Table 1. The PCR product was purified from agarose gel using a QIAquick gel extraction kit (Qiagen) , and digested with restriction enzymes (Amersham Pharmacia Biotech, Inc) . The pCMV-GH vector (Laboratory of Dr. Stephen A. Johnston, Department of Biochemistry, The University of Texas, Dallas, Texas) was digested with BamΑ and Xbal and purified from agarose gel using the QIAquick gel extraction kit (Qiagen) . The digested DNA fragment was ligated to the digested pCMV-GH vector to create the hGH-SHB-HI-102 fusion polypeptide under the control of the CMV promoter. The ligated product was transformed into E^. coli strain DH5α [φ80dlacZΔMl5 Δ(lacZYA-argF) U169 en Al recAl hsdRll (r^- ^ ) deoR thi-1 supE44 λ"gyrA96 relAl] (Gibco BRL) according to the method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed) , pp. 109-135) . The recombinant pCMV plasmid was purified using a Qiagen kit, and the nucleotide sequence of the DNA insert was verified by DNA sequencing.
EXAMPLE 4 This example illustrates the use of DNA to elicit an immune response to NTHI polypeptide .
A group of 8 female BALB/c mice (Charles River, St-Constant, Quebec, Canada) were immunized by intra-muscular injection three times at two- or three-week intervals with 50 μg of recombinant pCMV-GH encoding the SHB-HI-102 (SEQ ID NO: 1) gene in presence of 50 μg of granulocyte-macrophage colony- stimulating factor (GM-CSF) -expressing plasmid pCMV-GH-GM-CSF (Laboratory of Dr. Stephen A. Johnston, Department of Biochemistry, The University of Texas, Dallas, Texas) . As control, a group of mice were injected with 50 μg of pCMV-GH in presence of 50 μg of pCMV-GH-GM-CSF . Blood samples were collected from the orbital sinus prior to each immunization and seven days following the third injection. Serum antibody responses were determined by ELISA using the His-Tag labeled NTHI recombinant SHB-HI-102 polypeptide as coating antigen. The production and purification of the His-tag labeled NTHI recombinant polypeptide are presented in Example 5.
EXAMPLE 5
This example illustrates the production and purification of
NTHI recombinant SHB-HI-102 polypeptide.
The recombinant pET21b(+) plasmid with SHB-HI-102 (SEQ ID NO: 1) gene was used to transform by electroporation (Gene Pulser II apparatus, BIO-RAD Labs, Mississauga, Canada) EL. coli strain BL21 Tuner (DE3) [F~ ompT hsdSB (rB " ) gal dcm lacYl (DE3)] (Novagen) . In this strain of E coli, the T7 promoter controlling expression of the recombinant polypeptide is specifically recognized by the T7 RNA polymerase (present on the λDE3 prophage) whose gene is under the control of the lac promoter, which is inducible by isopropyl-β-d-thio- galactopyranoside (IPTG) . The transformant Tuner (DE3)/ rpET21 was grown at 37°C with agitation at 250 rpm in Luria-Betani (LB) broth (peptone lOg/L, yeast extract 5g/L, NaCl lOg/L) containing 100 μg of ampicillin (Sigma-Aldrich Canada Ltd. , Oakville, Canada) per ml until the A600 reached a value of 0.5. In order to induce the production of His-tagged NTHI recombinant SHB-HI-102 polypeptide, the cells were incubated for 3 additional hours in the presence of IPTG at a final concentration of 1 mM. Induced cells from a 500-mL culture were pelleted by centrifugation and frozen at -70°C.
The purification of the recombinant polypeptide from the insoluble cytoplasmic fractions of IPTG-induced Tuner (DE3 ) /rpET21 was done by affinity chromatography based on the properties of the His«Tag sequence (6 consecutive histidine residues) to bind to divalent cations (Ni2+) immobilized on the His'Bind metal chelation resin. Briefly, for the purification of recombinant polypeptide SHB-HI-102 from the insoluble cytoplasmic fraction, the cells were sonicated and centrifuged as above and the resulting pellet was resuspended in lysis buffer (5 mM imidazole, 2 M NaCl, 20 mM Tris-HCl pH 7.9) with 6 M Guanidine-HCl . The suspension was incubated on ice for 1 h and centrifuged at 39,000 x g for 20 in. The supernatant containing solubilized SHB-HI-102 polypeptide was deposited on a Ni-NTA agarose column (Qiagen) . The His-tag labeled NTHI recombinant polypeptide was eluted with 250 mM imidazole-500mM NaCl-20 mM Tris pH 7.9. The removal of the salt and imidazole from the sample was done by dialysis against PBS at 4°C . To maintain SHB-HI-102 polypeptide in a solubilized state, 0.2% SDS had to be present in PBS after dialysis . The quantity of recombinant polypeptide obtained from the insoluble fraction of E. coli was estimated by MicroBCA (Pierce, Rockford, Illinois) . EXAMPLE 6
This example illustrates the cloning of NTHI SHB-HI-102 polypeptide for its expression in EL. coli outer membrane vesicles.
In order to express SHB-HI-102 polypeptide in E coli outer membrane vesicles, the SHB-HI-102 (SEQ ID NO: 1) gene (without its leader peptide-coding region) was cloned in frame with meningococcal NspA outer membrane protein signal sequence (SEQ
ID NO :3 and NO: 4) already cloned in recombinant pET21b(+) plasmid (named pETssN) . The coding region of NTHI SHB-HI-102
(SEQ ID NO: 1) gene, without its leader peptide-coding sequence was amplified by PCR (Hybaid PCR Express, ESBE Scientific, Markham, Ontario, Canada) from genomic DNA of NTHI strain 12085 using oligos HiPH33 and HiPH34 (Table 1) . PCR products were purified from agarose gel using a QIAquick gel extraction kit following the manufacturer's instructions (Qiagen, Chatsworth, CA) , and digested with iVdel and Xhol (Amersham Pharmacia Biotech, Inc, Baie d'Urfe, Canada) . The pETssN vector (Novagen, Madison, WI) was digested with JVdel and Xhol , and purified from agarose gel using the QIAquick gel extraction kit (Qiagen) . The DNA coding region of NTHI SHB-HI-102 polypeptide was inserted in phase downstream of the NspA signal sequence. The iVdel-XhoI PCR products were ligated to the Ndel-Xhol pETssN expression vector. The ligated products were transformed into EL. coli strain DH5α [φ80d!acZΔM15 Δ(2acZYA-ar≤rF)U169 endAl recAl nsdRl7 (r^πyf) deoR thi-1 supE44 λ"gyrA96 relAl] (Gibco BRL, Gaithersburg, MD) according to the method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed) , pp. 109-135).
Recombinant pETssN plasmid (rpETssN) containing SHB-HI-102 gene was purified using a Qiagen kit and DNA insert was sequenced
(Taq Dye Deoxy Terminator Cycle Sequencing kit, ABI, Foster
City, CA) .
The rpETssN plasmid was used to transform by electroporation (Gene Pulser II apparatus, BIO-RAD Labs, Mississauga, Canada) E. coli strain BL21 Tuner (DE3) [F" ompT hsdSB (rB ~ m ) gal dcm lacYl (DE3)] (Novagen) . In this strain of I coli, the T7 promoter controlling expression of the recombinant polypeptide is specifically recognized by the T7 RNA polymerase (present on the λDE3 prophage) whose gene is under the control of the lac promoter, which is inducible by isopropyl-β-d-thio- galactopyranoside (IPTG). The transformant Tuner (DE3)/ rpETssN was grown at 37°C with agitation at 250 rpm in Luria-Betani (LB) broth (peptone lOg/L, yeast extract 5g/L, NaCl lOg/L) containing 100 μg of carbenicillin (Sigma-Aldrich Canada Ltd. , Oakville, Canada) per ml until the A600 reached a value of 0.5. In order to induce the production of NTHI recombinant SHB-HI- 102 polypeptide and its insertion in EL coli outer membrane, the cells were incubated for 3 additional hours in the presence of IPTG at a final concentration of 1 mM. Induced cells from a 1.25-L culture were pelleted by centrifugation and frozen at -
70°C.
EXAMPLE 7 This example illustrates the purification of EL coli outer membrane vesicles containing NTHI recombinant SHB-HI-102 polypeptide.
The purification of outer membrane vesicles (OMVs) of IPTG- induced Tuner (DE3 ) /rpETssN was done as follows. Briefly, the pelleted cells obtained from a 1.25-L culture induced with IPTG were resuspended in 125 mL of lithium chloride buffer (200 mM
LiCl, 100 mM lithium acetate, pH 6.0) . Suspensions were transferred in 500-mL flasks containing glass beads. Flasks were incubated for 2 h at 45°C under agitation (300 rpm) . The suspensions were then centrifuged 20 min, 15,000 x g.
Supernatants were recovered and ultra-centrifuged for 2 h at
126,000 x g, 4°C . Pellets were recovered and air-dried for 30 min. Volumes of 200 μl of water were added to each pellet and incubated overnight at 4°C with gentle agitation.
The OMVs were then detoxified. One volume of deoxycholic acid 1% (w/v) in 20 mM Tris pH 8.0 was added to the OMVs suspensions. The resulting suspensions were ultra-centrifuged for 2 h, at 126,000 x g, 4CC . Pellets were recovered, air-dried for 30 min, and resuspended in 1 ml of water. Suspensions were incubated for 2 days at 4°C with gentle agitation. Finally, 140 μl of 2 M sucrose were added to each tube and detoxified OMVs were kept frozen at -70°C.
EXAMPLE 8 This example illustrates the protection of mice against NTHI infection induced by immunization with E . coli outer membrane vesicles containing recombinant SHB-HI-102 polypeptide.
Groups of 6 female BALB/c mice (Charles River) were immunized 3 times by the intra-peritoneal route with 20 μg of EL coli outer membrane vesicles containing recombinant SHB-HI-102 polypeptide. The first immunization was performed in presence of complete Freund adjuvant (Gibco BRL) and the last two immunizations in presence of incomplete Freund adjuvant. As negative' controls, mice were immunized with EL. coli outer membrane vesicles alone or containing an unrelated recombinant polypeptide. Blood samples were collected from the orbital sinus on each immunization day and 14 days following the third injection. Three weeks later, the mice were challenged intra- trachealy with approximately 2xl05 CFU of NTHI strain 12085. Samples of the NTHI challenge inoculum were plated on chocolate agar plates to determine the CFU and to verify the challenge dose. To measure the effectiveness of vaccination to limit the in vivo growth of NTHI, mice were killed by an intra-peritoneal injection of sodium pentobarbital (Euthanyl™) 5 h after infection. The bronchoalveolar lavages were assessed for bacterial clearance by plating of serial dilutions for CFU determination.
Protection study results (Table 2) showed that strain 12085 readily multiplied in the lungs of the control animals such that, by 5 hours post-challenge, the number of viable NTHI had increased by 193%. In contrast, significant pulmonary clearance of strain 12085 by the SBH-HI2-immunized mice was clearly demonstrated. Only 54% of the bacterial load (recovered in the non-immune mice 5 hours post-challenge) was recovered in immunized animals . These results indicate a significant 46% lung bacterial clearance (Figure 7).
Table 2. Effect of systemic immunization with recombinant SHB- HI-102 polypeptide expressed in EL. coli outer membrane vesicles on BALB/c mice pulmonary clearance of NTHI 12085* strain.
Figure imgf000045_0001
* Each value represents a mean of five (control) or six (immunized) animals at each time.
** P = 0.0178, calculated according to the two-tailed unpaired t test.

Claims

What is claimed is :
1. An isolated polynucleotide comprising a polynucleotide chosen from: (a) a polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof;
(b) a polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof;
(c) a polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof;
(d) a polynucleotide encoding a polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof;
(e) a polynucleotide encoding a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof;
(f) a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof ;
(g) a polynucleotide comprising SEQ ID NO : 1 or fragments or analogs thereof;
(h) a polynucleotide that is complementary to a polynucleotide in (a), (b) , (c) , (d) , (e) , (f) or (g) .
2. An isolated polynucleotide comprising a polynucleotide chosen from:
(a) a polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising SEQ ID NO:
2;
(b) a polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising SEQ ID NO: 2; (c) a polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising SEQ ID NO: 2;
(d) a polynucleotide encoding a polypeptide comprising SEQ ID NO: 2;
(e) a polynucleotide encoding a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID NO: 2 ;
(f) a polynucleotide encoding an epitope bearing portion of a polypeptide comprising SEQ ID NO: 2;
(g) a polynucleotide comprising SEQ ID NO: 1;
(h) a polynucleotide that is complementary to a polynucleotide in (a), (b), (c), (d), (e), (f) or (g) .
3. The polynucleotide of claim 1, wherein said polynucleotide is DNA.
4. The polynucleotide of claim 2, wherein said polynucleotide is DNA.
5. The polynucleotide of claim 1, wherein said polynucleotide is RNA.
6. The polynucleotide of claim 2 , wherein said polynucleotide is RNA.
7. An isolated polynucleotide that hybridizes under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or (b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises SEQ ID NO: 2 or fragments or analogs thereof.
8. The polynucleotide of claim 1 that hybridizes under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or
(b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises SEQ ID NO: 2 or fragments or analogs thereof.
9. The polynucleotide of claim 2 that hybridizes under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or (b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises SEQ ID NO: 2.
10. The polynucleotide of claim 1 that hybridizes under stringent conditions to either (a) a DNA sequence encoding a polypeptide or
(b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises at least 10 contiguous amino acid residues from a polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof.
11. The polynucleotide of claim 2 that hybridizes under stringent conditions to either
(a) a DNA sequence encoding a polypeptide or
(b) the complement of a DNA sequence encoding a polypeptide; wherein said polypeptide comprises at least 10 contiguous amino acid residues from a polypeptide SEQ ID NO: 2.
12. A vector comprising the polynucleotide of claim 1, wherein said DNA is operably linked to an expression control region .
13. A vector comprising the polynucleotide of claim 2, wherein said DNA is operably linked to an expression control region .
14. A host cell transfected with the vector of claim 12.
15. A host cell transfected with the vector of claim 13.
16. A process for producing a polypeptide comprising culturing a host cell according to claim 14 under conditions suitable for expression of said polypeptide.
17. A process for producing a polypeptide comprising culturing a host cell according to claim 15 under condition suitable for expression of said polypeptide.
18. An isolated polypeptide comprising a polypeptide chosen from:
(a) a polypeptide having at least 70% identity to a second polypeptide having an amino acid sequence SEQ ID NO: 2 or fragments or analogs thereof;
(b) a polypeptide having at least 80% identity to a second polypeptide having an amino acid sequence comprising SEQ
ID NO: 2 or fragments or analogs thereof;
(c) a polypeptide having at least 95% identity to a second polypeptide having an amino acid sequence comprising SEQ ID NO: 2 or fragments or analogs thereof; (d) a polypeptide comprising SEQ ID NO : 2 or fragments or analogs thereof; (e) a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof; (f) an epitope bearing portion of a polypeptide comprising SEQ ID NO: 2 or fragments or analogs thereof; (g) the polypeptide of (a), (b) , (c) , (d) , (e) or (f) wherein the N-terminal Met residue is deleted; (h) the polypeptide of (a), (b) , (c) , (d) , (e) , or (f) wherein the secretory amino acid sequence is deleted.
19. An isolated polypeptide comprising a polypeptide chosen from: (a) a polypeptide having at least 70% identity to a second polypeptide having an amino acid sequence comprising SEQ ID NO: 2;
(b) a polypeptide having at least 80% identity to a second polypeptide having an amino acid sequence comprising SEQ ID NO: 2;
(c) a polypeptide having at least 95% identity to a second polypeptide having an amino acid sequence comprising SEQ ID NO: 2;
(d) a polypeptide comprising SEQ ID NO: 2 ; (e) a polypeptide capable of raising antibodies having binding specificity for a polypeptide comprising SEQ ID NO: 2 ;
(f) an epitope bearing portion of a polypeptide comprising SEQ ID NO: 2;
(g) the polypeptide of (a) , (b) , (c) , (d) , (e) or (f) wherein the N-terminal Met residue is deleted;
(h) the polypeptide of (a) , (b) , (c) , (d) , (e) , or (f ) wherein the secretory amino acid sequence is deleted.
20. A chimeric polypeptide comprising two or more polypeptides comprising SEQ ID NO: 2 or fragments or analogs thereof; provided that the polypeptides are linked as to formed a chimeric polypeptide .
21. A chimeric polypeptide comprising two or more polypeptides comprising SEQ ID NO: 2 provided that the polypeptides are linked as to formed a chimeric polypeptide .
22. A pharmaceutical composition comprising a polypeptide according to any one of claims 18 to 21 and a pharmaceutically acceptable carrier, diluent or adjuvant.
23. A method for prophylactic or therapeutic treatment of H.influenzae infection in a host susceptible to H. influenzae infection comprising administering to said host a prophylactic or therapeutic amount of a composition according to claim 22.
24. A method according to claim 23 wherein the host is a neonate, an infant or a child.
25. A method according to claim 23 wherein the host is an immunocompromised host.
26. A method according to claim 23 wherein the host is an adult.
27. A method for therapeutic or prophylactic treatment of otitis media, sinusitis, persistent cough, acute laryngitis, suppurative keratitis, conjunctivitis neonatorum, and invasive disease comprising administering to said host a therapeutic or prophylactic amount of a composition according to claim 22.
28. A method for diagnostic of H. influenzae infection in an host susceptible to H. influenzae infection comprising
(a) obtaining a biological sample from a host;
(b) incubating an antibody or fragment thereof reactive with a polypeptide according to any one of claims 18 to 21 with the biological sample to form a mixture; and
(c) detecting specifically bound antibody or bound fragment in the mixture which indicates the presence of H. influenzae .
29. A method for the detection of antibody specific to a H. influenzae antigen in a biological sample containing or suspected of containing said antibody comprising
(a) obtaining a biological sample from a host; (b) incubating one or more polypeptides according to any one of claims 18 to 21 or fragments thereof with the biological sample to form a mixture; and (c) detecting specifically bound antigen or bound fragment in the mixture which indicates the presence of antibody specific to H. influenzae .
30. Use of the pharmaceutical composition according to claim 22 in the manufacture of a medicament for the prophylactic or therapeutic treatment of H. influenzae infection.
31. Kit comprising a polypeptide according to any one of claims 18 to 21 for detection or diagnosis of H. influenzae infection.
PCT/CA2003/001108 2002-07-24 2003-07-23 Polypeptides of nontypeable haemophilus influenzae WO2004009621A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003250673A AU2003250673A1 (en) 2002-07-24 2003-07-23 Polypeptides of nontypeable haemophilus influenzae

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US39778502P 2002-07-24 2002-07-24
US60/397,785 2002-07-24

Publications (2)

Publication Number Publication Date
WO2004009621A2 true WO2004009621A2 (en) 2004-01-29
WO2004009621A3 WO2004009621A3 (en) 2004-03-25

Family

ID=30771117

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2003/001108 WO2004009621A2 (en) 2002-07-24 2003-07-23 Polypeptides of nontypeable haemophilus influenzae

Country Status (2)

Country Link
AU (1) AU2003250673A1 (en)
WO (1) WO2004009621A2 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0680765A1 (en) * 1994-05-05 1995-11-08 American Cyanamid Company Vaccine for nontypable haemophilus influenzae strain
WO2002032946A2 (en) * 2000-10-17 2002-04-25 Glaxosmithkline Biologicals S.A. Basb207 polypeptides and polynucleotides from nontypeable haemophilus influenzae
WO2002034778A2 (en) * 2000-10-24 2002-05-02 Glaxosmithkline Biologicals S.A. Baseb209 polypeptides and polynucleotides from haemophilus influenzae

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0680765A1 (en) * 1994-05-05 1995-11-08 American Cyanamid Company Vaccine for nontypable haemophilus influenzae strain
WO2002032946A2 (en) * 2000-10-17 2002-04-25 Glaxosmithkline Biologicals S.A. Basb207 polypeptides and polynucleotides from nontypeable haemophilus influenzae
WO2002034778A2 (en) * 2000-10-24 2002-05-02 Glaxosmithkline Biologicals S.A. Baseb209 polypeptides and polynucleotides from haemophilus influenzae

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FLEISCHMANN R D ET AL: "WHOLE-GENOME RANDOM SEQUENCING AND ASSEMBLY OF HAEMOPHILUS INFLUENZAE RD" SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, US, vol. 269, no. 5223, 28 July 1995 (1995-07-28), pages 496-498,507-51, XP000517090 ISSN: 0036-8075 *
MAY BARBARA J ET AL: "Complete genomic sequence of Pasteurella multocida, Pm70" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 98, no. 6, 13 March 2001 (2001-03-13), pages 3460-3465, XP002202785 ISSN: 0027-8424 & DATABASE EMBL [Online] "AE006132 Pasteurella multocida PM70" , 10 February 2001 (2001-02-10) "Q9CMA6 Hypothetical protein PM0928, 1 June 2001" retrieved from EBI Database accession no. Q9CMA6, AE006132 *

Also Published As

Publication number Publication date
AU2003250673A1 (en) 2004-02-09
WO2004009621A3 (en) 2004-03-25
AU2003250673A8 (en) 2004-02-09

Similar Documents

Publication Publication Date Title
EP2270171B1 (en) Haemophilus influenzae antigens and corresponding DNA fragments
AU2002234455A1 (en) Streptococcus pyogenes polypeptides and corresponding DNA fragments
US20090074807A1 (en) Moraxella (branhamella) catarrhalis antigens
EP1343895A2 (en) Streptococcus pyogenes antigens and corresponding dna fragments
EP1399563B1 (en) Moraxella (branhamella) catarrhalis antigens
WO2004009621A2 (en) Polypeptides of nontypeable haemophilus influenzae
AU2002302236A1 (en) Moraxella(Branhamella) catarrhalis antigens
AU2002325109B2 (en) Moraxella (branhamella) catarrhalis polypeptides and corresponding DNA fragments
EP1444349B1 (en) Polypeptides of moraxella (branhamella) catarrhalis
AU2011253696B8 (en) Haemophilus influenzae antigens and corresponding DNA fragments
AU2007202270B2 (en) Haemophilus influenzae antigens and corresponding DNA fragments
WO2004018514A1 (en) Polypeptides of nontypeable haemophilus influenzae and corresponding dna fragments
AU2002325109A1 (en) Moraxella (branhamella) catarrhalis polypeptides and corresponding DNA fragments
AU2002344869A1 (en) Moraxella (branhamella) catarrhalis antigens

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP