WO2004006753A2

WO2004006753A2 - Sga-72m, a cancer associated antigen, and uses thereof

Info

Publication number: WO2004006753A2
Application number: PCT/US2003/022113
Authority: WO
Inventors: Joseph M. Petroziello; Che-Leung Law; Alan F. Wahl
Original assignee: Seattle Genetics, Inc.
Priority date: 2002-07-11
Filing date: 2003-07-11
Publication date: 2004-01-22
Also published as: WO2004006753A3; AU2003253930A1; AU2003253930A8

Abstract

The present invention relates to a gene and gene product, SGA-72M that is differentially expressed in cancer tissues and cell-lines. Suppression Subtractive Hybridization and microarray screening were used to screen for differential expression of SGA-72M in cancer tissues and cell-lines. Northern blot analysis and semi-quantitative RTPCR demonstrated over expression of SGA-72M in breast cancer tissue and breast cancer derived cell-lines. The gene is expressed as a 4.2kb mRNA. The SGA-72M cDNA comprises an open reading frame encoding 1342 amino acids. Monitoring expression levels of SGA-72M is useful for the diagnosis and prognosis of cancer as well as for evaluating the risk of developing certain types of cancers and the risk of metastasis of cancer. Antagonists that inhibit SGA-72M expression or activity are useful for the treatment of cancer. The SGA-72M polypeptide is associated with the plasma membrane and is on the cell surface of breast carcinoma cells and is a useful target for antibody-based therapeutics.

Description

SGA-72M, A CANCER ASSOCIATED ANTIGEN. AND USES THEREOF

This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 60/395,752, filed July 11, 2002, which is incoφorated by reference herein in its entirety.

1. FIELD OF THE INVENTION

The present invention relates generally to the field of cancer diagnosis, prognosis, treatment and prevention. More particularly, the present invention relates to methods of diagnosing, treating and preventing cancer, more particularly breast cancer. The instant invention provides compositions comprising, and methods of using, products of a gene termed SGA-72M. Such SGA-72M gene products include SGA-72M polypeptides and nucleic acids that are differentially expressed in tumor cells. Methods of using SGA- 72M nucleic acids, polypeptides, and antibodies against SGA-72M polypeptides, to treat, diagnose or prevent cancer, are provided for by the present invention.

2. BACKGROUND OF THE INVENTION Cancer is characterized primarily by an increase in the number of abnormal cells derived from a given normal tissue, invasion of adjacent tissues by these abnormal cells, and lymphatic or blood-borne spread of malignant cells to regional lymph nodes and to distant sites (metastasis). Clinical data and molecular biologic studies indicate that cancer is a multistep process that begins with minor preneoplastic changes, which may under certain conditions progress to neoplasia.

Pre-malignant abnormal cell growth is exemplified by hypeφlasia, metaplasia, or most particularly, dysplasia (for review of such abnormal growth conditions, see Robbins & Angell, 1976, Basic Pathology, 2d Ed., W.B. Saunders Co., Philadelphia, pp. 68-79). The neoplastic lesion may evolve clonally and develop an increasing capacity for growth, metastasis, and heterogeneity, especially under conditions in which the neoplastic cells escape the host's immune surveillance (Roitt, I., Brostoff, J. and Kale, D., 1993, Immunology, 3rd ed., Mosby, St. Louis, pps. 17.1-17.12).

The incidence of breast cancer, a leading cause of death in women, has been gradually increasing in the United States over the last thirty years. Its cumulative risk is relatively high, 1 in 8 women, for example, by age 85 in the United States. In fact, breast cancer is the most common cancer in women and the second most common cause of cancer death in the United States. In 1997, it was estimated that 181,000 new cases were reported in the U.S., and that 44,000 people would die of breast cancer (Parker et al, 1997, CA Cancer J. Clin. 47:5; Chu et al, 1996, J. Nat. Cancer Inst. 88:1571). While the mechanism of tumorigenesis for most breast carcinomas is largely unknown, there are genetic factors that can predispose some women to developing breast cancer (Miki et al, 1994, Science 266:66). The discovery and characterization oϊBRCAl and BRCA2 has expanded the knowledge of genetic factors that can contribute to familial breast cancer. Germ-line mutations within these two loci are associated with a 50 to 85% lifetime risk of breast and/or ovarian cancer (Casey, 1997, Curr. Opin. Oncol 9:88; Marcus et al, 1996, Cancer 77:697). Sporadic tumors, those not currently associated with a known germline mutation, constitute the majority of breast cancers. It is likely that other, non-genetic factors also have a significant effect on the etiology of the disease. Regardless of its origin, breast cancer morbidity and mortality increases significantly if it is not detected early in its progression. Thus, considerable effort has focused on the early detection of cellular transformation and tumor formation in breast tissue. Only about 5% to 10% of breast cancers are associated with breast cancer susceptibility genes, BRCA1 and BRCA2. The cumulative lifetime risk of breast cancer for women who carry the mutant BRCA1 is predicted to be approximately 92%, while the cumulative lifetime risk for the non-carrier majority is estimated to be approximately 10%. BRCA1 is a tumor suppressor gene that is involved in DΝA repair and cell cycle control, which are both important for the maintenance of genomic stability. More than 90% of all mutations reported so far result in a premature truncation of the protein product with abnormal or abolished function. The histology of breast cancer in BRCA1 mutation carriers differs from that in sporadic cases, but mutation analysis is the only way to find the carrier. Like BRCA1, BRCA2 is involved in the development of breast cancer and plays a role in DΝA repair. However, unlike BRCA1, it is not involved in ovarian cancer.

Other genes have been linked to breast cancer, for example c-erb-2 (HER2) and p53 (Beenken et al, 2001, Ann. Surg. 233(5):630). Over expression of c-erb-2 (HER2) has been correlated with poor prognosis (Rudolph et al. 2001 , Hum. Pathol 32(3): 311), as has been aberrant expression oimdm2 (Lukas et al. 2001, Cancer Res. 61(7):3212), cyclinl and ρ27 (Porter & Roberts, International Publication WO98/33450, published August 6, 1998).

A marker-based approach to tumor identification and characterization promises improved diagnostic and prognostic reliability. Typically, the diagnosis of breast cancer and other types of cancer requires histopathological proof of the presence of the tumor. In addition to diagnosis, histopathological examinations also provide information about prognosis and selection of treatment regimens. Prognosis may also be established based upon clinical parameters such as tumor size, tumor grade, the age of the patient, and lymph node metastasis.

In clinical practice, accurate diagnosis of various subtypes of cancer is important because treatment options, prognosis, and the likelihood of therapeutic response all vary broadly depending on the diagnosis. Accurate prognosis, or determination of distant metastasis- free survival, could allow the oncologist to tailor the administration of adjuvant chemotherapy, with patients having poorer prognoses being given the most aggressive treatment. Furthermore, accurate prediction of poor prognosis would greatly impact climcal trials for new breast cancer therapies, because potential study patients could then be stratified according to prognosis. Trials could then be limited to patients having poor prognosis, in turn making it easier to discern if an experimental therapy is efficacious. To date, no set of satisfactory predictors for prognosis based on the clinical information alone has been identified. The detection of BRCA1 or BRCA2 mutations represents a step towards the design of therapies to better control and prevents the appearance of these tumors.

It would, therefore, be beneficial to provide specific methods and reagents for the diagnosis, staging, prognosis, monitoring and treatment of cancer, including breast cancer, and to provide methods that would identify individuals with a predisposition for the onset of breast cancer, and other types of cancer, and hence are appropriate subjects for preventive therapy.

3. SUMMARY OF THE INVENTION Intensive and systematic evaluation of gene expression patterns is essential in understanding the physiological mechanisms associated with cellular transformation and metastasis associated with cancer. Differential expression methodology has led the present inventors to the identification and characterization of the SGA-72M gene as a gene whose expression is associated with breast cancer and other types of cancer. SGA-72M has an expression pattern that is up-regulated in cancer tissues and cell lines, e.g., breast cancer tissues and cell lines. This discovery by the present inventors has made possible the use of SGA-72M for the treatment, prevention and diagnosis of cancers, including but not limited to breast cancer.

Studies by the inventors indicate that the protein encoded by the SGA-72M gene is a cell surface protein. According, this protein is a useful target antibody-based anti- SGA-72M therapeutics, for example, for delivery of chemotherapeutic agents to SGA-72M- expressing tumor cells as described herein.

The present invention provides SGA-72M nucleic acid molecules and SGA- 72M-related nucleic acid molecules. In certain embodiments, a SGA-72M nucleic acid molecule is selected from the group consisting of (a) an isolated a nucleic acid molecule corresponding to SEQ ID NO:l, (b) an isolated nucleic acid molecule derived a nucleic acid corresponding to SEQ ID NO:l, including but not limited to RNAs comprising SEQ ID NO:l and/or SEQ ID NO:2, (c) an isolated nucleic acid molecule that encodes a polypeptide of SEQ ID NO:3, (d) an isolated nucleic acid molecule comprising a nucleotide sequence of at least 25 consecutive nucleotides of SEQ ID NO:l, or a compliment thereof; (e) an isolated nucleic acid molecule comprising a nucleotide sequence of at least 25 consecutive nucleotides of SEQ ID NO:2, or a compliment thereof; (f) an isolated nucleic acid molecule comprising a nucleotide sequence of at least 50 consecutive nucleotides of SEQ ID NO:l, or a compliment thereof; (g) an isolated nucleic acid molecule comprising a nucleotide sequence of at least 50 consecutive nucleotides of SEQ ID NO:2, or a compliment thereof; (h) an isolated nucleic acid molecule comprising a nucleotide sequence of at least 100 consecutive nucleotides of SEQ ID NO:l, or a compliment thereof; and (i) an isolated nucleic acid molecule comprising a nucleotide sequence of at least 100 consecutive nucleotides of SEQ ID NO:2, (j) an isolated nucleic acid comprising a nucleotide sequence encoding at least 8 contiguous amino acid residues of SEQ ID NO:3, or a compliment thereof, (k) an isolated nucleic acid comprising a nucleotide sequence encoding at least 10 contiguous amino acid residues of SEQ ID NO:3, or a compliment thereof; (1) an isolated nucleic acid comprising a nucleotide sequence encoding at least 20 contiguous amino acid residues of SEQ ID NO: 3, or a compliment thereof; (m) an isolated nucleic acid comprising a nucleotide sequence encoding at least 50 contiguous amino acid residues of SEQ ID NO:3, or a compliment thereof; and (n) an isolated nucleic acid comprising a nucleotide sequence encoding at least 100 contiguous amino acid residues of SEQ ID NO:3, or a compliment thereof, or a fragment thereof. In certain other embodiments, a SGA-72M-related nucleic acid molecule is a SGA-72M nucleic acid or a nucleic acid selected from the group consisting of (a) a nucleic acid comprising a sequence hybridizable (e.g., under low, moderate or highly stringent conditions, such as disclosed infra in Section 5.1.1) to (i) SEQ ID NO:l, (ii) the antisense strand to SEQ ID NO: 1, (iii) SEQ ID NO:2, or (iv) the antisense strand to SEQ ID NO:2, or (b) a nucleic acid that is at least 70% homologous (e.g., as determined using the NBLAST algorithm under default parameters) to SEQ ID NO:l, is at least 70% homologous to SEQ ID NO:2, or (c) a nucleic acid that hybridizable (e.g., under low, moderate or highly stringent conditions, such as disclosed infra in Section 5.1.1) to the nucleic acid sequence, or the complement thereof, that encodes the amino acid sequence of SEQ ID NO:3, (d) an isolated nucleic acid molecule which encodes a polypeptide comprising an amino acid sequence which is at least 70% homologous to SEQ ID NO:3, or a fragment thereof.

In certain prefened embodiments, the SGA-72M nucleic acid does not consist of the nucleotide sequence of any of SEQ ID NOs: 19-22, and is not a vector containing an insert which consists of the nucleotide sequence of any of SEQ ID NOs: 19- 22. In other preferred embodiments, the SGA-72M nucleic acid does not consist of the nucleotide sequence of SEQ ID NOs:27 or SEQ ID NO:28, and is not a vector containing an insert which consists of the nucleotide sequence SEQ ID NO:27 or SEQ ID NO:28.

In yet other embodiments, the SGA-72M nucleic acid does not consist of the nucleotide sequence of any of SEQ ID NOs: 23 -26, and is not a vector contaimng an insert which consists of the nucleotide sequence of any of SEQ ID NOs:23-26.

In preferred embodiments of the present invention, an SGA-72M nucleic acid comprising a contiguous SGA-72M nucleotide sequence. In a specific embodiment, an SGA-72M nucleic acid comprises a contiguous nucleotide sequence encoding an SGA-72M polypeptide. In another specific embodiment, the SGA-72M nucleic acid does not comprise intronic sequences. In another specific embodiment, the SGA-72M nucleic acid comprises or encodes a sequence that serves as a translation initiation site, and/or a sequence that serves as a translation termination site.

In certain preferred embodiments, the SGA-72M nucleic acid molecule is less than 50 kb, less than 20 kb, less than 10 kb, or less than 5 kb in size. The SGA-72M nucleic acid molecule can be a genomic DNA molecule, a cDNA molecule, or an RNA molecule. Further, the SGA-72M nucleic acid molecule can be single-stranded or double- stranded. In certain embodiments of the present invention, the SGA-72M nucleic acid molecule is purified. Vectors comprising an SGA-72M nucleic acid, optionally further comprising a nucleic acid sequence which regulates expression of a polypeptide encoded by the SGA-72M nucleic acid molecule, are also provided, as are host cells, preferably mammalian or bacterial host cells, comprising such vectors. The present invention further provides methods for producing a polypeptide encoded by an SGA-72M nucleic acid, comprising culturing a host cell which contains an SGA-72M expression vector, under conditions in which the nucleic acid molecule is expressed.

Additional SGA-72M nucleic acids are described in Section 5.1 below. The present invention further provides SGA-72M polypeptides and SGA-

72M-related polypeptides. In certain embodiments, the SGA-72M polypeptide is selected from the group consisting of (a) an isolated polypeptide comprising SEQ ID NO:3, (c) an isolated polypeptide comprising at least 8 contiguous amino acid residues of SEQ ID NO:3; (d) an isolated polypeptide comprising at least 10 contiguous amino acid residues of SEQ ID NO:3; (e) an isolated polypeptide comprising at least 20 contiguous amino acid residues of SEQ ED NO:3; (g) an isolated polypeptide comprising at least 50 contiguous amino acid residues of SEQ ID NO: 3; and (h) an isolated polypeptide comprising at least 100 contiguous amino acid residues of SEQ ID NO:3. In certain other embodiments, SGA- 72M-related polypeptides are SGA-72M polypeptides or polypeptides selected from the group consisting of: (a) an isolated polypeptide which comprises an amino acid sequence which is encoded by a nucleotide sequence which is at least 70% homologous to SEQ ID NO: 2 (e.g., as determined using the NBLAST algorithm with a score of 100 and a word length of 12); (b) an isolated polypeptide comprising an amino acid sequence which is at least 70% homologous to SEQ ID NO: 3 (e.g., as determined using the ALIGN program in the GCG software package, using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4), (c) an isolated polypeptide encoded by a nucleic acid that is hybridizable (e.g., under low, moderate or highly stringent conditions such as disclosed infra in Section 5.1.1) to (i) SEQ ID NO:l, (ii) the antisense strand to SEQ ID NO:l, (iii) SEQ ID NO:2, (iv) the antisense strand to SEQ ID NO:2, or (b) an isolated polypeptide that is encoded by a nucleic acid that is at least 70% homologous to (i) SEQ ID NO:l or (ii) SEQ ID NO:2, or a fragment thereof.

In certain preferred embodiments, the SGA-72M polypeptide is purified. The SGA-72M polypeptides of the invention include fusion polypeptides which comprise an SGA-72M polypeptide and a heterologous peptide or polypeptide. Vectors comprising nucleotide sequences encoding an SGA-72M polypeptide, optionally further comprising a nucleic acid sequence which regulates expression of the SGA-72M polypeptide, are also provided. Host cells, preferably mammalian or bacterial host cells, comprising such vectors are further provided. The present invention further provides methods for producing SGA- 72M polypeptides, comprising culturing a host cell which contains an expression vector comprising a nucleotide sequence encoding an SGA-72M polypeptide, under conditions in which the SGA-72M polypeptide is expressed.

In preferred embodiments of the present invention, an SGA-72M polypeptide is not encoded by the nucleotide sequence of SEQ ID NO: 27 or SEQ ID

NO:28, nor is it a polypeptide comprising or consisting of the amino acid sequence of SEQ ID NO:29 or SEQ ID NO:30.

In certain embodiments of the present invention, an SGA-72M polypeptide is not encoded by a nucleic acid consisting of the nucleotide sequence of any of SEQ ID NOs: 19-26.

In certain preferred embodiments, the SGA-72M nucleic acid molecule is less than 50 kb, less than 20 kb, less than 10 kb, or less than 5 kb in size. The SGA-72M nucleic acid molecule can be a genomic DNA molecule, a cDNA molecule, or an RNA molecule. Further, the SGA-72M nucleic acid molecule can be single-stranded or double- stranded. In certain embodiments of the present invention, the SGA-72M nucleic acid molecule is purified. Vectors comprising an SGA-72M nucleic acid, optionally further comprising a nucleic acid sequence which regulates expression of a polypeptide encoded by the SGA-72M nucleic acid molecule, are also provided, as are host cells, preferably mammalian or bacterial host cells, comprising such vectors. The present invention further provides methods for producing a polypeptide encoded by an SGA-72M nucleic acid, comprising culturing a host cell which contains an SGA-72M expression vector, under conditions in which the nucleic acid molecule is expressed. The present invention yet further provides antibodies that bind to SGA-72M polypeptides or SGA-72M-related polypeptides. Such anti-SGA-72M antibodies can be polyclonal or monoclonal. The antibodies can also be human, humanized or chimeric. In a preferred embodiment, an anti-SGA-72M antibody is purified.

The anti-SGA-72M antibodies of the invention may be conjugated to a cytotoxic agent. In certain embodiments, the anti-SGA-72M antibody of an anti-SGA-72M antibody-cytotoxic agent conjugate of the invention is conjugated to the cytotoxic agent via a linker, wherein the linker is hydrolyzable at a pH of less than 5.5. In a specific embodiment the linker is hydrolyzable at a pH of less than 5.0.

In certain embodiments, the anti-SGA-72M antibody of an anti-SGA-72M antibody-cytotoxic agent conjugate of the invention is conjugated to the cytotoxic agent via a linker, wherein the linker is cleavable by a protease. In a specific embodiment, the protease is a lysosomal protease. In other specific embodiments, the protease is, inter alia, a membrane-associated protease, an intracellular protease, or an endosomal protease.

The present invention encompasses anti-SGA-72M antibodies that are fusion proteins comprising the amino acid sequence of a second protein such as bryodin or a pro- drug converting enzyme.

The anti-SGA-72M antibodies of the invention, including conjugates and fusion proteins, can be used in conjunction with radiation therapy, chemotherapy, hormonal therapy and/or immunotherapy. In specific embodiments, the chemotherapeutic agent is a cytostatic, cytotoxic, and/or immunosuppressive agent. Any of the chemotherapeutic agents described hereinbelow as being capable of being conjugated to an anti-SGA-72M antibody may be administered in unconjugated form in combination therapy with an anti-SGA-72M antibody (in conjugated or unconjugated form).

In certain specific embodiments, the immunosuppressive agent is gancyclovir, acyclovir, etanercept, rapamycin, cyclosporine or tacrolimus. In other embodiments, the immunosuppressive agent is an antimetabohte, a purine antagomst (e.g., azathioprine or mycophenolate mofetil), a dihydrofolate reductase inhibitor (e.g., methotrexate), a glucocorticoid. (e.g., cortisol or aldosterone), or a glucocorticoid analogue (e.g., prednisone or dexamethasone). In yet other embodiments, the immunosuppressive agent is an alkylating agent (e.g., cyclophosphamide). In yet other embodiments, the immunosuppressive agent is an anti-inflammatory agent, including but not limited to a cyclooxygenase inhibitor, a 5-lipoxygenase inhibitor, and a leukotriene receptor antagonist.

The present invention yet further provides methods of diagnosing cancer, including but not limited to breast cancer, in a subject, for example a human subject, comprising detecting or measuring an SGA-72M gene product in a sample derived from said subject, in which elevated levels of the SGA-72M gene product compared to a non-cancerous sample or a pre-determined standard value for a noncancerous sample, indicates the presence of cancer in the subject. In certain embodiments, an SGA-72M gene product is: (a) an RNA corresponding to SEQ ID NO:l, or a nucleic acid derived therefrom; (b) a polypeptide comprising or consisting essentially of SEQ ID NO:3; (c) a nucleic acid at least 70% homologous to SEQ ID NO: 1 or its complement as determined using the

NBLAST algorithm with a score of 100 and a word length of 12; or (d) a nucleic acid at least 70% homologous to SEQ ID NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional gene products of SGA-72M are described in Sections 5.1 and 5.2 below. The sample can be a tissue sample, a plurality of cells, or a bodily fluid. In certain embodiments, the RNA corresponding to SEQ ID NO:l is an mRNA and/or comprises or corresponds to SEQ ID NO:2. In other embodiments, the SGA-72M gene product is detected or measured using an antibody that binds a SGA-72M gene product, such as an antibody that binds to a polypeptide consisting essentially of the amino acid sequence of SEQ ID NO:3. In yet other embodiments, the SGA-72M gene product is detected or measured using an oligonucleotide, preferably a DNA oligonucleotide, that is specific or selective to the SGA-72M gene product.

The present invention yet further provides a method of staging cancer, including but not limited to breast cancer, in a subject, for example a human subject, comprising detecting or measuring a SGA-72M gene product or a SGA-72M-related gene product in a sample derived from said subject, in which elevated levels of the SGA-72M gene product or the SGA-72M-related gene product compared to a non-cancerous sample or a pre-determined standard value for a noncancerous sample, indicates an advanced stage of cancer in the subject.

In one embodiment, a SGA-72 gene product is a SGA-72M nucleic acid such as nucleic acids corresponding to SEQ ID NO:l, a nucleic acid derived therefrom, including but not limited to RNAs comprising SEQ ID NO: 1 and/or SEQ ID NO:2, or a nucleic acid that encodes a polypeptide of SEQ ID NO:3. In another embodiment, a SGA- 72M gene product is a SGA-72M polypeptide such as the amino acid sequence depicted in FIG. 3, i.e., SGA-72M SEQ ID NO:3. In other embodiments, a SGA-72M-related gene product is a SGA-72M-related nucleic acid such as nucleic acid that (a) hybridizes under low, moderate or highly stringent conditions (as disclosed infra in Section 5.1.1) to SEQ ID NO: 1, the antisense strand to SEQ ID NO: 1, SEQ ID NO:2, the antisense strand to SEQ ID NO:2, or (b) is at least 70% homologous (e.g., as determined using the NBLAST algorithm with a score of 100 and a word length of 12) to SEQ ID NO: 1, is at least 70% homologous to SEQ ID NO:2, or (c) that hybridizes under low, moderate or highly stringent conditions (as disclosed infra in Section 5.1.1) to the nucleic acid sequence or the complement that encode the amino acid sequence of SEQ ID NO:3, or a fragment thereof. In other embodiments, a SGA-72M-related gene product is a SGA-72M-related polypeptide such as a protein encoded by a nucleic acid that (a) hybridizes under low, moderate or highly stringent conditions (as disclosed infra in Section 5.1.1) to SEQ ID NO:l, the antisense strand to SEQ ID NO:l, SEQ ID NO:2, the antisense strand to SEQ ID NO:2, or (b) is at least 70% homologous to SEQ ID NO:l, is at least 70% homologous to SEQ ID NO:2, or a fragment thereof. Additional gene products of SGA-72M are described in Sections 5.1 and 5.2 below. In certain specific embodiments, the cancer involves regional lymph nodes or distant metastasis. The sample can be a tissue sample, a plurality of cells, or a bodily fluid. In certain embodiments, the RNA corresponding to SEQ ID NO:l is an mRNA and/or comprises or corresponds to SEQ ID NO:2. In other embodiments, the SGA-72M gene product is detected or measured using an antibody that binds a SGA-72M gene product, such as an antibody that bind to a polypeptide consisting essentially of the amino acid sequence of SEQ ID NO:3. In yet other embodiments, the SGA-72M gene product is detected or measured using an oligonucleotide, preferably a DNA oligonucleotide, that is specific or selective to the SGA-72M gene product. The present invention yet further provides methods for the treatment of cancer, including but not limited to breast cancer, in a subject, for example a human subject, comprising administering to the subject an amount effective for treatment of cancer of a compound that antagonizes an SGA-72M gene product. In certain embodiments, the SGA-72M gene product is: (a) an RNA corresponding to SEQ ID NO:l, or a nucleic acid derived therefrom; (b) an RNA corresponding to SEQ ID NO:2, or a nucleic acid derived therefrom; (c) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ ID NO:3; (d) a nucleic acid at least 70% homologous to SEQ ID NO: 1 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (e) a nucleic acid at least 70% homologous to SEQ ID NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional gene products of SGA-72M are described in Sections 5.1 and 5.2 below. In certain embodiments, the compound decreases expression of the SGA-72M gene product and wherein said SGA-72M gene product is: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO:3; (2) an RNA corresponding to SEQ ED NO: 1; or (3) an RNA corresponding to SEQ ID NO:2. The antagonist can be a polypeptide; a peptide; an organic molecule with a molecular weight of less than 500 daltons; an inorganic molecule with a molecular weight of less than 500 daltons; an antisense oligonucleotide molecule that binds to an SGA-72M RNA and inhibits translation of said RNA; a ribozyme molecule that targets an SGA-72M RNA and inhibits translation of said RNA; an antibody that is specific or selective to an SGA-72M gene product (e.g., an antibody that binds to a polypeptide consisting essentially of the amino acid sequence of SEQ ID NO:3); a double stranded oligonucleotide that forms a triple helix with a promoter of an SGA-72M gene, wherein said SGA-72M gene comprises a sequence that is at least 70% (more preferably at least 80%, 85% or 90%) homologous to SEQ ID NO:l, SEQ ID NO:2, or the complement of SEQ ID NO:l or SEQ ID NO:2 as determined using the NBLAST algorithm.

The invention further provides a method for the treatment or prevention of cancer, for example, breast cancer, in a subject comprising admimstering to the subject, in an amount effective for said treatment or prevention, an antibody binds SGA-72M and a pharmaceutically acceptable carrier. In certain embodiments, the antibody is conjugated to a cytotoxic agent.

The present invention yet further provides a method of vaccinating a subject, for example a human subject, against cancer, including but not limited to breast cancer, comprising admimstering to the subject a molecule that elicits an immune response to an SGA-72M gene product. In certain embodiments, the SGA-72M gene product is: (a) an RNA corresponding to SEQ ID NO:l, or a nucleic acid derived therefrom; (b) an RNA corresponding to SEQ LD NO:2, or a nucleic acid derived therefrom; (c) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ ID NO:3; (d) a nucleic acid at least 70% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; (e) a nucleic acid at least 70% homologous to SEQ ID NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby; (f) a DNA molecule comprising SEQ DD NO: 1 ; or (g) a DNA molecule comprising SEQ DD NO:2. Additional gene products of SGA-72M are described in Sections 5.1 and 5.2 below. In certain embodiments, the molecule that elicits an immune response to an SGA-72M gene is an isolated DNA molecule comprising SEQ DD NO:l or SEQ DD NO:2. In other embodiments, the molecule is an isolated polypeptide comprising the amino acid sequence of SEQ DD NO:3. The cellular immune response induced can be a cellular immune response and/or a humoral immune response.

The present invention yet further provides methods of determining if a subject, for example a human subject, is at risk of developing cancer, including but not limited to breast cancer, said method comprising: (a) measuring an amount of an SGA-72M gene product in a sample derived from the subject, and (b) comparing the amount of said SGA-72M gene product in the subject with the amount of SGA-72M gene product present in a non-cancerous sample or predetermined standard for a noncancerous sample, wherein an elevated amount of said SGA-72M gene product in the subject compared to the amount in the non-cancerous sample or predetermined standard for a noncancerous sample indicates a risk of developing cancer in the subject. In certain embodiments, the SGA-72M gene product is: (i) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (ii) an RNA corresponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (iv) a nucleic acid at least 70% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (v) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. In certain embodiments, the amount of SGA-72M gene product is measured using an antibody that is specific or selective to an SGA-72M gene product, for example a polypeptide consisting essentially of the amino acid sequence of SEQ ID NO:3. In other embodiments, the amount of the SGA-72M gene product is measured using an oligonucleotide, for example a DNA oligonucleotide, that is specific or selective to the SGA-72M gene product.

The present invention further provides methods of determining if a subject, for example a human subject, suffering from cancer, including but not limited to breast cancer, is at risk of metastasis of said cancer, said method comprising measuring an amount of an SGA-72M gene product in a sample derived from the subject, wherein an elevated amount of SGA-72M gene product in the subject compared to the amount in the non-cancerous sample, or in the sample from the subject with the non-metastasizing cancer, or the amount in the predetermined standard for a noncancerous or non-metastasizing sample, indicates a risk of developing metastasis of said cancer in the subject. In certain embodiments, the gene product is: (a) an RNA conesponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (b) an RNA corresponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (c) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (d) a nucleic acid at least 70% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (e) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional gene products of SGA-72M are described in Sections 5.1 and 5.2 below. The sample can be a tissue sample, a plurality of cells, or a bodily fluid. In certain embodiments, the RNA corresponding to SEQ DD NO: 1 is an mRNA and/or comprises or conesponds to SEQ DD NO:2. In other embodiments, the SGA-72M gene product is detected or measured using an antibody that binds a SGA-72M gene product, such as an antibody that binds to a polypeptide consisting essentially of the amino acid sequence of SEQ DD NO:3. In yet other embodiments, the SGA-72M gene product is detected or measured using an oligonucleotide, preferably a DNA oligonucleotide, that is specific or selective to the SGA-72M gene product.

The present invention further provides methods of screening for a compound that binds to an SGA-72M molecule, said method comprising: (a) contacting the SGA-72M molecule, which is optionally expressed on the surface of a cell or in the cytosol of a cell, with a candidate agent, and (b) determining whether or not the candidate agent binds the SGA-72M molecule. In certain embodiments, the SGA-72M molecule is: (i) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (ii) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (iv) a nucleic acid at least 70% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (v) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional SGA-72M molecules are described in Sections 5.1 and 5.2 below. In certain embodiments, the screening assay is performed in vitro. In one embodiment, the SGA-72M molecule is anchored to a solid phase. In another embodiment, the candidate agent is anchored to a solid phase. In other embodiments, the screening assay is performed in the liquid phase. Where the SGA-72M molecule is expressed on the surface of a cell or in the cytosol of a cell, the SGA-72M molecule is preferably a polypeptide comprising the amino acid sequence of SEQ DD NO:3. The cell can be engineered to express the SGA-72M molecule. In certain embodiment of the foregoing screening assays, the candidate agent can be labeled, for example radioactively or enzymatically. The present invention further provides methods of screening for an intracellular polypeptide that interacts with an SGA-72M gene product, said method comprising (a) immunoprecipitating the SGA-72M gene product from a cell lysate, and (b) determining whether or not any intracellular polypeptides bind to or form a complex with the SGA-72M gene product in the immunoprecipitate. In certain embodiments, the SGA- 72M gene product is (i) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (ii) an RNA corresponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (iv) a nucleic acid at least 70% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (v) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional SGA-72M molecules are described in Sections 5.1 and 5.2 below. The present invention provides methods of screening for a candidate agent that modulates expression level of an SGA-72M gene, said method comprising: (a) contacting said SGA-72M gene with a candidate agent, wherein said SGA-72M gene comprises a nucleotide sequence at least 70% homologous to SEQ DD NO:l or SEQ DD NO:2 as determined using the NBLAST algorithm algorithm with a score of 100 and a word length of 12; and (b) measuring the level of expression of an SGA-72M gene product, wherein an increase or decrease in said level of expression relative to said level of expression in the absence of said candidate agent indicates that the candidate agent modulates expression of an SGA-72M gene. In certain embodiments, the SGA-72M gene product is (i) an mRNA conesponding to SEQ DD NO:l, (ii) an mRNA conesponding to SEQ DD NO:2, or (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3. Additional SGA-72M molecules are described in Sections 5.1 and 5.2 below.

The present invention yet further provides vaccines formulation for the prevention of cancer comprising: (a) an immunogenic amount of an SGA-72M gene product and (b) a pharmaceutically acceptable excipient. In certain embodiments, the SGA-72M gene product is (i) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (ii) an RNA corresponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (iv) a nucleic acid at least 70% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (v) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional SGA-72M molecules are described in Sections 5.1 and 5.2 below.

The present invention yet further provides immunogenic compositions comprising: (a) a purified SGA-72M gene product in an amount effective at eliciting an immune response and (b) an excipient. In certain embodiments the SGA-72M gene product is (i) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (ii) an RNA corresponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (iv) a nucleic acid at least 70% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (v) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional SGA-72M gene products are described in Sections 5.1 and 5.2 below.

The present invention yet further provides pharmaceutical compositions comprising: (a) an antibody that binds to a polypeptide consisting essentially of SEQ DD NO:3; and (b) a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition is formulated for delivery as an aerosol. In another embodiment, the pharmaceutical composition is formulated for delivery parenterally. In yet another embodiment, the pharmaceutical composition is formulated for delivery orally. The present invention yet further provides pharmaceutical compositions comprising: (a) an SGA-72M gene product and (b) a pharmaceutically acceptable carrier., wherein said gene product is: (i) an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; (ii) an RNA corresponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (iii) a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (iv) a nucleic acid at least 70% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (v) a nucleic acid at least 70% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12, or a polypeptide encoded thereby. Additional SGA-72M molecules are described in Sections 5.1 and 5.2 below. In a preferred embodiment, the SGA-72M gene product is purified. In one embodiment, the pharmaceutical composition is formulated for delivery as an aerosol. In another embodiment, the pharmaceutical composition is formulated for delivery parenterally. In yet another embodiment, the pharmaceutical composition is formulated for delivery orally.

The present invention yet further provides pharmaceutical compositions comprising (a) a purified nucleic acid comprising SEQ DD NO:2; and (b) a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition is formulated for delivery as an aerosol. In another embodiment, the pharmaceutical composition is formulated for delivery parenterally. In yet another embodiment, the pharmaceutical composition is formulated for delivery orally.

The present invention yet further provides methods of diagnosing cancer in a subject comprising (a) admimstering to said subject a compound that is capable of binding a polypeptide consisting essentially of the amino acid sequence of SEQ DD NO:3, wherein said compound is bound to an imaging agent; and (b) obtaining an internal image of said subject by use of said imaging agent; wherein the localization or amount of said image indicates whether or not cancer is present in said subject. In certain embodiments, the compound is an antibody. In one embodiment, the antibody is conjugated to a radioactive metal and the obtaining step comprises recording a scintographic image obtained from the decay of the radioactive metal.

In a preferred embodiment of the invention, the cancer to be diagnosed, prognosed, treated or prevented according to the present invention is breast cancer. In certain specific modes of this embodiment, the breast cancer is non-infiltrating intraductal breast cancer, infiltrating intraductal breast cancer, infiltrating ductal breast cancer, mixed lobular breast cancer, infiltrating lobular breast cancer, infiltrating ductal breast cancer, tubular breast adenocarcinoma, or medullar breast adenocarcinoma.

In other embodiments of the invention, the cancer to be diagnosed, prognosed, treated or prevented according to the present invention is a carcinoma, for example colon, lung or stomach carcinoma. In a specific embodiment, the carcinoma is an adenocarcinoma, for example colon, lung or stomach adenocarcinoma. The present invention yet further provides kits comprising (a) in one or more containers, a pair of oligonucleotide primers, each primer comprising an at least 5 nucleotide sequence complementary to a different strand of a double-stranded nucleic acid comprising SEQ DD NO:l; and (b) in a separate container, a purified double-stranded nucleic acid comprising SEQ DD NO:l.

The present invention yet further provides transgenic non-human animals which express from a transgene an RNA corresponding to SEQ DD NO:2 or a polypeptide comprising the amino acid sequence of SEQ DD NO:3. The present invention yet further provides methods of testing the effects of a candidate therapeutic compound, comprising: (a) administering the compound to the transgenic non-human animal; and (b) determimng any effects of said compound upon the transgenic non-human animal.

The present invention yet further provides transgenic non-human animals comprising cells that contain a disruption of the SGA-72M locus, wherein said disruption prevents reduces the amount of SGA-72M polypeptide in said cells. The present invention yet further provides methods of testing the effects of a candidate therapeutic compound, comprising: (a) administering the compound to the transgenic non-human animal; and (b) determining any effects of said compound upon the transgenic non-human animal.

3.1 ABBREVIATIONS

The abbreviation "AEFP" refers to dimethylvaline-valine-dolaisoleuine- dolaproine-phenylalanine-p-phenylenediamine, the auristatin

AEFP The abbreviation "MMAE" refers to monomethyl auristatin E, the auristatin E derivative depicted below:

MMAE The abbreviation "AEB" refers to an ester produced by reacting auristatin E with paraacetyl benzoic acid, the structure of which is depicted below:

AEB

The abbreviation "AEVB" refers to an ester produced by reacting auristatin E with benzoylvaleric acid, the structure of which is depicted below:

AEVB The abbreviations "fk" and "phe-lys" refer to the linker phenylalanine- lysine.

The abbreviations "vc" and "val-cit" refer to the linker valine-citrulline.

3.2 DEFINITIONS SPECIFIC: a nucleic acid used in a reaction, such as a probe used in a hybridization reaction, a primer used in a PCR, or a nucleic acid present in a pharmaceutical preparation, is referred to as "specific" if it hybridizes or reacts only with the intended target. Similarly, a polypeptide is referred to as "specific" if it binds only to its intended target, such as a ligand, hapten, substrate, antibody, or other polypeptide. An antibody is refened to as "specific" if it binds only to the intended target. A marker or gene product is specific to a particular cell or tissue type if it is detectably expressed only in or on that cell or tissue type.

SELECTIVE: a nucleic acid used in a reaction, such as a probe used in a hybridization reaction, a primer used in a PCR, or a nucleic acid present in a pharmaceutical preparation, is referred to as "selective" if it hybridizes or reacts with the intended target more frequently, more rapidly, or with greater duration than it does with alternative substances. Similarly, a polypeptide is referred to as "selective" if it binds an intended target, such as a ligand, hapten, substrate, antibody, or other polypeptide more frequently, more rapidly, or with greater duration than it does to alternative substances. An antibody is referred to as "selective" if it binds via at least one antigen recognition site to the intended target more frequently, more rapidly, or with greater duration than it does to alternative substances. A marker or gene product is selective to a particular cell or tissue type if it is expressed predominantly in or on that cell or tissue type, particularly with respect to a biological sample of interest. Selective binding does not exclude some cross-reactivity. TUMOR-SPECIFIC: a nucleic acid used in a reaction, such as a probe used in a hybridization reaction, a primer used in a PCR, or a nucleic acid present in a pharmaceutical preparation, is referred to as "tumor specific" if it hybridizes or reacts only with the intended tumor material. Similarly, a polypeptide, such as a ligand, hapten, substrate, antibody, or other polypeptide, is refened to as "tumor specific" if it binds only to cells of its intended type of tumor or a material within cells of the type of tumor. An antibody is refened to as "tumor specific" if it binds only to cells of the intended type of tumor. A marker or gene product is specific to a particular tumor type if it is expressed only in or on cells or tissue of that tumor type.

TUMOR-SELECΉVE: a nucleic acid used in a reaction, such as a probe used in a hybridization reaction, a primer used in a PCR, or a nucleic acid present in a pharmaceutical preparation, is referred to as "tumor-selective" if it hybridizes or reacts with the intended tumor more frequently, more rapidly, or with greater duration than it does with alternative substances. Similarly, a polypeptide is referred to as "tumor-selective" if it binds an intended tumor, such as a ligand, hapten, substrate, antibody, or other polypeptide more frequently, more rapidly, or with greater duration than it does to alternative substances. An antibody is refened to as "tumor-selective" if it binds via at least one antigen recognition site to the intended tumor more frequently, more rapidly, or with greater duration than it does to alternative substances. A marker or gene product is selective to a particular tumor type if it is expressed predominantly in or on cells or tissue of that tumor type. TUMOR- ASSOCIATED: Tumor-specific or tumor-selective.

CORRESPOND OR CORRESPONDING: Between nucleic acids, "conesponding" means homologous to or complementary to a particular sequence or portion of the sequence of a nucleic acid. As between nucleic acids and polypeptides, "corresponding" refers to amino acids of a peptide in an order derived from the sequence or portion of the sequence of a nucleic acid or its complement. As between polypeptides (or peptides and polypeptides), "conesponding" refers to amino acids of a first polypeptide (or peptide) in an order derived from the sequence or portion of the sequence of a second polypeptide.

SGA-72M GENE PRODUCT: AS used herein, unless otherwise indicated, an SGA-72M gene product is: an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom (including, but not limited to, the SGA-72M open reading frame (SEQ DD NO:2); a polypeptide comprising SEQ DD NO:3; a nucleic acid comprising a sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency, or a polypeptide comprising a sequence encoded by said hybridizable sequence; a nucleic acid comprising a sequence hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency, or a polypeptide comprising a sequence encoded by said hybridizable sequence; a nucleic acid at least 70%, more preferably at least 80%, and most preferably at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm; a nucleic acid at least 70% homologous to SEQ DD NO:2 or a fragment or derivative of any of the foregoing polypeptides or nucleic acids. Where an SGA-72M gene product is a nucleic acid, the SGA-72M gene product is preferably not a nucleic acid consisting of any of SEQ DD NOs: 18-22, 27 and 28, is not a vector containing an insert which consists of the nucleotide sequence of any of SEQ DD NOs: 18-22, 27 and 28, and is not a nucleic acid encoding the polypeptides of SEQ DD NOs:29 or 30. Where an SGA-72M gene product is a polypeptide, the SGA-72M polypeptide is preferably not a polypeptide encoded by the nucleotide sequence of SEQ DD NO:27 or SEQ DD NO:28, nor a polypeptide comprising the amino acid sequence of SEQ DD NO:29 or SEQ DD NO:30.

4. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. SGA-72M nucleic acid sequence of 4183 bp.

FIG. 2. SGA-72M coding sequence (CDS) spanning 60-4085 bp within the nucleic acid sequence as outlined in FIG. 1.

FIG.3. SGA-72M polypeptide of 1342 amino acids. FIG.4. Normal and transformed breast cells are evaluated for SGA-72M expression by Northern. SGA-72M cDNA was amplified by PCR and used as a probe. Ten μg of total RNA was loaded in each lane. Samples were loaded as follows: (1) normal human mammary epithelial cells (HMECs), and (2) MCF-7 tumor cell-line.

FIG. 5. Semi-quantitative RT-PCR of normal vs. transformed breast cells. Five μg of total RNA was used to synthesize cDNA for this experiment. SGA-72M cDNA was amplified in this assay. RT-PCR products were visualized by ethidium bromide staining. Samples are loaded as follows: (1) MCF-7, (2) T47-D, (3) normal human mammary epithelial cells (HMECs), (4) SKBR-3, (5) Hs578T, (6) MDA-MB-231, (7) MDA-MB-435s, (8) MDA-MB-453, (9) H3396, and (10) BT549. The control gene EF-1 was included for comparison.

FIG. 6. Semi-quantitative RT-PCR for SGA-72M on various tumor cell- lines available from the American Type Culture Collection (ATCC, P.O. Box 1549, Manassas, VA 20108). Five μg of total RNA was used to synthesize cDNA for this experiment. SGA-72M cDNA was amplified in this assay. RT-PCR products were visualized by ethidium bromide staining. Samples are loaded as follows: (1) HCT-15, (2) HCT-116, (3) HT-29, (4) RCA, (5) NCI-H23, (6) NCI-H460, (7) NCI-H226, (8) MiaPaCa- 2, (9) Bx-PC3, (10) CAPAN-2, (11) WM-115, (12) SK-MEL5, (13) SK-MEL28, (14) Colo- 853, (15) Colo-857, and (16) GRM

FIG. 7. Tissue type and location of various poly A+ RNA isolates found on the Multiple Tissue Expression (MTE) Array. FIG. 8. Analysis of SGA-72M and EF-1 mRNA expression levels using the

Multiple Tissue Expression (MTE) Anay, as detailed in FIG. 7. SGA-72M cDNA was amplified and used as a probe for this experiment. The control gene EF-1 was included for comparison.

FIG. 9. Tissue type and location of 241 tumor and normal patient pairs as spotted on the Cancer Profiling Array (CPA). Numbers across the top of the grid from left to right (1-48) represent patient pairs. Letters (A-FF) are included as line designations for ease of data analysis. The distribution of the 241 patient pairs are as follows: breast (50), uterus (42), colon (35), stomach (27), ovary (14), cervix (1), lung (21), kidney (20), rectum (18), small intestine (2), thyroid (6), prostate (4), and pancreas (1). FIG. 10. SGA-72M mRNA expression analysis on 241 patient pairs using the Cancer Profiling Array (CPA), as detailed in FIG. 9. SGA-72M cDNA was amplified and used as a probe for this experiment. Breast tumor/normal pairs with SGA-72M tumor- selective expression are indicated by arrows.

FIGS. 11A-11B. Subcellular localization for SGA-72M. Subcellular localization was determined by analyzing the expression of an SGA-72M/green fluorescent protein (GFP) construct by DeltaVisiona microscopy. GFP alone, and SGA-72M/GFP were transiently expressed in human 293 kidney cells (A) and breast carcinoma SKBR-3 cells (B). The localization of green fluorescence signals was determined by microscopy.

FIG. 12. FACS binding data for SGA-72M hybridoma colonies. Cell- surface binding was evaluated using supernatant from SGA-72M C-terminal (7.3 and 7.21) and N-terminal (8.11 and 8.39) hybridoma colonies on SKBR-3 breast carcinoma cells. SGA-72M C-terminal hybridoma colonies 7.3 and 7.21 exhibited the highest level of binding on intact/non-permeabilized cells (shown in solid bars).

5. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the discovery that the SGA-72M gene is over-expressed in cancer cells and tissues such as breast cancer cells. The invention relates to methods of using the SGA-72M gene and/or the SGA-72M gene products to diagnose, treat and prevent cancer, e.g., breast cancer. The invention further relates to methods of using the SGA-72M gene or SGA-72M gene products to evaluate the prognosis of a patient diagnosed with cancer. The invention also relates to the discovery that the SGA-72M gene is over-expressed in metastatic cancer cells. Thus, the invention contemplates the use of the SGA-72M gene and/or gene products to evaluate a cancer patient's risk of the metastasis of said cancer, e.g., breast cancer.

In the development of breast neoplasia and other cancers, there are a subset of genes that will be specifically or selectively expressed at various stages, and a certain number of these will be critical for the progression of malignancy, especially those associated with the metastatic spread of the disease. As described by way of example, infra, genes whose expression is associated with breast carcinomas in various stages of neoplastic development, were identified using Suppression Subtractive Hybridization (SSH) and high- throughput cDNA microanay (Chu et al, 1997, Proc. Natl. Acad. Sci. U.S.A. 94(19):10057; Kuang et al, 1998, Nuc. Acids Res. 26(4):1116). SSH generated cDNA libraries derived from the breast cancer cell line MCF-7 were screened using microarrays for genes which were expressed at elevated levels in the cancerous MCF-7 cells as compared to normal breast cells. A total of 1536 clones were screened. Several previously identified breast cancer associated genes, as well as SGA-72M was identified by this analysis. The details concerning the isolation and characterization of the SGA-72M cDNA and its association with cancer cell lines and tissues is described in detail in the examples provided infra.

The present invention encompasses methods for the diagnosis, prognosis and staging of breast cancer and other cancers, e.g., by the monitoring of the effect of a therapeutic treatment. Further provided are methods for the use of the SGA-72M gene and/or SGA-72M gene products in the identification of compounds that modulate the expression of the SGA-72M gene or the activity of the SGA-72M gene product. Expression of the SGA-72M gene is upregulated in various types of cancer cells including breast cancer cell lines and tissues. As such, the SGA-72M gene product can be involved in the mechanisms underlying the onset and development of breast cancer and other types of cancer as well as the regional infiltration and metastatic spread of cancer. Thus, the present invention also provides methods for the prevention and/or treatment of breast cancer and other types of cancer, and for the control of metastatic spread of breast cancer and other types of cancer that is based on modulation of the expression of the SGA-72M gene or gene product.

The invention further provides for screening assays and methods of identifying agonists and antagonists of the SGA-72M gene or gene product. The invention also provides methods of vaccinating an individual against cancer, including breast cancer, by admimstering an amount of the SGA-72M gene, gene product, or fragment thereof, in an amount which effectively elicits an immune response in a subject who has cancer or is at risk of developing cancer, including breast cancer.

The invention relates to the use of the SGA-72M gene, gene products, and antagonists of the SGA-72M gene or gene products (SGA-72M cDNA, RNA, and/or polypeptide) as targets for diagnosis, drug screening and therapies for cancer. The present invention also relates to the use of the SGA-72M gene and gene products or derivatives thereof as vaccines against cancer. In a prefened embodiment, the invention provides for methods of using the polypeptide, SGA-72M, or nucleic acids that encode SGA-72M polypeptide, for the treatment, prevention and diagnosis of breast cancer.

In particular, the methods of the present invention include using nucleic acid molecules that encode the SGA-72M polypeptide, including recombinant DNA molecules, cloned genes or degenerate variants thereof, and in particular naturally occurring variants that encode SGA-72M gene products. The methods of the present invention additionally include using cloning vectors, including expression vectors, containing the nucleic acid molecules encoding SGA-72M and hosts that contain such nucleic acid molecules. The methods of the present invention also encompass the use of SGA-72M gene products, fusion polypeptides, and antibodies directed against such SGA-72M gene products or conserved variants or fragments thereof. In certain specific embodiments, a fragment or other derivative of an SGA-72M polypeptide (e.g. , a polypeptide of SEQ DD NO:3) is at least 6, at least 8, at least 10, at least 12, at least 15 or at least 20 amino acids long. In other specific embodiments, a fragment of a SGA-72M nucleic acid or derivative thereof (e.g., a nucleic acid of SEQ DD NO:l or SEQ DD NO:2) is at least 10, at least 12, at least 15, at least 18, at least 20, at least 25, at least 30 or at least 40 nucleotides long. The nucleotide sequence of the cDNA of a human SGA-72M gene (SEQ DD

NO:l) is provided. The nucleotide sequence of the SGA-72M ORF (SEQ DD NO:2) in the SGA-72M gene, as well as the amino acid sequences of the encoded gene product, are also provided (SEQ DD NO:3). The SGA-72M gene was cloned by PCR. The SGA-72M transcript encodes a polypeptide of 1342 amino acids (SEQ DD NO:3). An in-frame start and stop were observed by sequence analysis for the SGA-72M gene. The SGA-72M transcript was detected at elevated levels in both breast cancer cell-lines and breast tumor isolates compared to normal tissues. Elevated transcription levels of the SGA-72M gene were also detected in several other tumor types and cancer cells as described in Section 6 below.

The present invention further relates to methods for the diagnostic evaluation and prognosis of cancer in a subject animal. Preferably the subject is a mammal, more preferably the subject is a human. In a prefened embodiment the invention relates to methods for diagnostic evaluation and prognosis of breast cancer. For example, nucleic acid molecules of the invention can be used as diagnostic hybridization probes or as primers for diagnostic PCR analysis for detection of abnormal expression of the SGA-72M gene.

Antibodies or other binding partners to the SGA-72M polypeptide of the invention can be used in a diagnostic test to detect the presence of the SGA-72M gene product in body fluids, cells or in tissue biopsy. In specific embodiments, measurement of serum or cellular SGA-72M polypeptide levels can be made to detect or stage breast cancer, e.g., infiltrative ductal carcinoma.

The present invention also relates to methods for the identification of subjects having a predisposition to cancer, e.g., breast cancer. The subject can be any animal, but preferably the subject is a mammal, and most preferably the subject is a human. In a non-limiting example nucleic acid molecules of the invention can be used as diagnostic hybridization probes or as primers for quantitative RT-PCR analysis to determine expression levels of the SGA-72M gene product. In another example, nucleic acid molecules of the invention can be used as diagnostic hybridization probes or as primers for diagnostic PCR analysis for the identification of SGA-72M naturally occurring or non- naturally occurring gene mutations, allelic variations and regulatory defects in the SGA- 72M gene.

Imaging methods, for imaging the localization and/or amounts of SGA-72M gene products in a patient, are also provided for diagnostic and prognostic use.

Further, methods are presented for the treatment of cancer, including breast cancer. Such methods comprise the administration of compositions that are capable of modulating the level of SGA-72M gene expression and/or the level of SGA-72M gene product activity in a subject. The subject can be any animal, preferably a mammal, more preferably a human.

Still further, the present invention relates to methods for the use of the SGA- 72M gene and/or SGA-72M gene products for the identification of compounds that modulate SGA-72M gene expression and/or the activity of SGA-72M gene products. Such compounds can be used as agents to prevent and/or treat breast cancer or any cancer wherein SGA-72M is expressed at levels that are higher than what is found in conesponding normal tissue. Such compounds can also be used to palliate the symptoms of the disease, and control the metastatic potential of breast cancer or any cancer wherein

SGA-72M is expressed at levels that are higher than what is found in corresponding normal tissue.

The invention also provides methods of preventing cancer by admimstering the product of the SGA-72M gene or a fragment of the SGA-72M gene product in an amount effective to elicit an immune response in a subject. The subject can be any animal, preferably a mammal, more preferably a human. The invention also provides methods of treating or preventing cancer by administering the nucleic acid that encodes the SGA-72M gene product or a fragment of the nucleic acid that encodes the SGA-72M gene product in an amount effective to elicit an immune response. The invention further provides methods of treating or preventing cancer by admimstering a polypeptide or a peptide encoded by the SGA-72M gene in an amount effective to elicit an immune response. The immune response can be either humoral or cellular or both. In a preferred embodiment the invention provides a method of immunizing vs. breast cancer.

The invention relates to screening assays to identify antagonists or agonists of the SGA-72M gene or gene product. Thus, the invention relates to methods of identifying agonists or antagonists of the SGA-72M gene or gene product and the use of said agonist or antagonist to treat or prevent breast cancer or other types of cancer.

The invention also provides methods of treating cancer by providing therapeutic amounts of an anti-sense nucleic acid molecule. An anti-sense nucleic molecule is a nucleic acid molecule that is the complement of all or a part of the SGA-72M gene sequence (SEQ DD NO:l) or SGA-72M ORF (SEQ DD NO:2) and which therefore can hybridize to the SGA-72M gene or a fragment thereof. Hybridization of the anti-sense molecule can inhibit expression of the SGA-72M gene. In a prefened embodiment the method is used to treat breast cancer.

The invention also includes a kit for assessing whether a patient is afflicted with breast cancer or other types of cancer. This kit comprises reagents for assessing expression of an SGA-72M gene product.

In another aspect, the invention relates to a kit for assessing the suitability of each of a plurality of compounds for inhibiting cancer including breast cancer in a patient. The kit comprises a reagent for assessing expression of an SGA-72M gene product, and may also comprise a plurality of compounds. In another aspect, the invention relates to a kit for assessing the presence of cancer cells. This kit comprises an antibody, wherein the antibody binds specifically or selectively with a polypeptide conesponding to an SGA-72M gene product. The kit may also comprise a plurality of antibodies, wherein the plurality binds specifically or selectively with different epitopes on an SGA-72M gene product. The invention also includes a kit for assessing the presence of cancer cells, wherein the kit comprises a nucleic acid (e.g., oligonucleotide) probe. The probe binds specifically or selectively with a transcribed polynucleotide corresponding to an SGA-72M gene product. The kit may also comprise a plurality of probes, wherein each of the probes binds specifically or selectively with a transcribed polynucleotide conesponding to a different mRNA sequence transcribed from the SGA-72M gene.

Kits for diagnostic use, comprising in a container, primers for use in PCR that can amplify SGA-72M cDNA and/or genes and, in a separate container, a standard amount of SGA-72M cDNA are also provided.

The present invention yet further provides SGA-72M nucleic acids, SGA- 72M polypeptides, including fusion polypeptides, and antibodies against SGA-72M polypeptides. Vectors comprising SGA-72M nucleic acids, including expression vectors, are also provided. Host cells, for example bacterial and mammalian host cells, comprising such expression vectors are further provided. Methods of expressing SGA-72M polypeptides, comprising culturing such host cells under conditions under which the SGA- 72M polypeptide is expressed, are also provided.

The invention also provides transgenic non-human animals (e.g., mice) that express SGA-72M nucleic acids and polypeptides encoded by a transgene. Transgenic, non-human knockout animals (e.g., mice), in which an SGA-72M gene has been inactivated, are also provided.

5.1 THE SGA-72M GENE AND SGA-72M NUCLEIC ACIDS

Nucleotide sequences that encode the SGA-72M gene open reading frame are described herein. The SGA-72M cDNA (4183 bp) SEQ DD NO: 1 was cloned by PCR. The DNA sequence contains an open reading frame SEQ DD NO:2 spanning 60-4085 bp within SEQ DD NO:l that encodes a polypeptide of 1342 amino acids (SEQ DD NO:3).

In one embodiment, a SGA-72 gene product is a SGA-72M nucleic acid such as nucleic acids corresponding to SEQ DD NO:l, a nucleic acid derived therefrom, including but not limited to RNAs comprising SEQ DD NO: 1 and/or SEQ DD NO:2, or a nucleic acid that encodes a polypeptide of SEQ DD NO:3. In other embodiments, a SGA- 72M-related gene product is SGM-72M related nucleic acid such as a SGA-72M nucleic acid or a nucleic acid selected from the group consisting of (a) a nucleic acid comprising a sequence hybridizable (e.g., under low, moderate or highly stringent conditions, such as disclosed infra in Section 5.1.1) to (i) SEQ DD NO:l, (ii) the antisense strand to SEQ DD NO:l, (iii) SEQ DD NO:2, or (iv) the antisense strand to SEQ DD NO:2, or (b) a nucleic acid that is at least 70% homologous (e.g., as determined using the NBLAST algorithm under default parameters) to SEQ DD NO:l, is at least 70% homologous to SEQ DD NO:2, or (c) a nucleic acid that hybridizable (e.g., under low, moderate or highly stringent conditions, such as disclosed infra in Section 5.1.1) to the nucleic acid sequence, or the complement thereof, that encodes the amino acid sequence of SEQ DD NO:3, or a fragment thereof. As used herein an "RNA corresponding to" a SEQ DD number (e.g., SEQ DD NO:l or 2) means an RNA comprising a sequence that is the same or the (inverse) complement of the SEQ DD number (e.g., SEQ DD NO:l or 2), except that thymidines (T's) are replaced with uridines (U's). Such RNAs conesponding to SEQ DD NO: 1 include for example RNA encoded by a gene that gives rise to a cDNA of SEQ DD NO:l, as well as RNA of which the cDNA of SEQ DD NO: 1 is a copy. A nucleic acid derived from such an RNA includes but is not limited to cDNA of said RNA, and cRNA (e.g., RNA that is derived from said cDNA; see, e.g., U.S. Patent Nos. 5,545,522; 5,891,636; 5,716,785). In the present invention, hybridizability can be determined under low, moderate, or high stringency conditions and preferably is under conditions of high stringency. In a specific embodiment, nucleic acids of the invention encode an SGA- 72M gene product or SGA-72M-related gene product that has at least one conservative or silent substitution.

SGA-72M encoded polypeptides are also provided for use. Additional molecules of the invention include, but are not limited to, polypeptide derivatives that can be made by altering their sequences by substitutions, additions or deletions, and their encoding nucleic acids. Due to the degeneracy of nucleotide coding sequences, other DNA sequences that encode substantially the same amino acid sequence as a component gene or cDNA are within the scope of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of the component polypeptide gene that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a silent change. Likewise, the derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of a component polypeptide, including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a silent change. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity (a "conservative amino acid substitution") that acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

In certain embodiments, the present invention includes SGA-72M nucleic acids comprising or conesponding to a fragment of the SGA-72M cDNA of about 100 bp in length. In certain specific embodiments, the 100 bp fragment spans from nucleotides 1-100, 51-150, 101-200, 151-250, 201-300, 251-350, 301-400, 351-450, 401-500, 451-550, 501- 600, 551-650, 601-700, 651-750, 701-800, 75-850, 801-900, 851-950, 901-1000, 951-1050, 1001-1100, 1051-1150, 1101-1200, 1151-1250, 1201-1300, 1251-1350, 1301-1400, 1351- 1450, 1401-1500, 1451-1550, 1501-1600, 1551-1650, 1601-1700, 1651-1750, 1701-1800, 1751-1850, 1801-1900, 1951-2050, 2001-2100, 2051-2150, 2101-2200, 2151-2250, 2201- 2300, 2251-2350, 2301-2400, 2351-2450, 2401-2500, 2451-2550, 2501-2600, 2551-2650, 2601-2700, 2651-2750, 2701-2800, 2751-2850, 2801-2900, 2951-3050, 3001-3100, 3051- 3150, 3101-3200, 3151-3250, 3201-3300, 3251-3350, 3301-3400, 3351-3450, 3401-3500, 3451-3550, 3501-3600, 3551-3650, 3601-3700, 3651-3750, 3701-3800, 3751-3850, 3801- 3900, 3951-4050, 4001-4100, 4051-4150, 4101-4200, 4151-4250 of SEQ DD NO:l or SEQ DD NO:2. In a specific embodiment, the nucleic acid fragment of the invention encodes an antigenic or immunogenic protein (i.e., polypeptide or peptide).

In certain embodiments, the present invention includes SGA-72M nucleic acids comprising or conesponding to a fragment of the SGA-72M cDNA of about 200 bp in length. In certain specific embodiments, the 200 bp fragment spans from nucleotides 1-200, 101-300, 201-400, 301-500, 401-600, 501-700, 601-800, 701-900, 801-1000, 901-1100, 1001-1200, 1101-1300, 1201-1400, 1301-1500, 1401-1600, 1501-1700, 1601-1800, 1701- 1900, 1801-2000, 1901-2100, 2001-2200, 2101-2300, 2201-2400, 2301-2500, 2401-2600, 2501-2700, 2601-2800, 2701-2900, 2801-3000, 2901-3100, 3001-3200, 3101-3300, 3201- 3400, 3301-3500, 3401-3600, 3501-3700, 3601-3800, 3701-3900, 3801-4000, 3901-4100, 4001-4200, 4101-4300 of SEQ DD NO:l or SEQ DD NO:2. In a specific embodiment, the nucleic acid fragment of the invention encodes an antigenic or immunogenic protein.

In certain embodiments, the present invention includes SGA-72M nucleic acids comprising or conesponding to a fragment of the SGA-72M cDNA of about 400 bp in length. In certain specific embodiments, the 400 bp fragment spans from nucleotides nucleotides 1-400, 101-500, 201-600, 301-700, 401-800, 501-900, 601-1000, 701-1100, 801-1200, 901-1300, 1001-1400, 1101-1500, 1201-1600, 1301-1700, 1401-1800, or 1501- 1900, 1601-2000, 1701-2100, 1801-2200, 1901-2300, 2001-2400, 2101-2500, 2201-2600, 2301-2700, 2401-2800, 2501-2900, 2601-3000, 2701-3100, 2801-3200, 2901-3300, 3001- 3400, 3101-3500, 3201-3600, 3301-3700, 3401-3800, 3501-3900, 3601-4000, 3701-4100, 3801-4200, 3901-4300, 4001-4400, 4101-4500 of SEQ DD NO:l or SEQ DD NO:2. In a specific embodiment, the nucleic acid fragment of the invention encodes an antigenic or immunogenic protein.

In certain embodiments, the present invention includes SGA-72M nucleic acids comprising or conesponding to a nucleic acid that encodes an N-terminal fragment of the SGA-72M polypeptide. Such nucleic acids can comprise cDNA of at least 51, 102, 252, 501, 750, 900, or 936 nucleotides contiguous to the 5' end of the open reading frame (e.g., SEQ DD NO:2), but of less than 2000 bp or less than 1000 bp or less than 500 bp. In a specific embodiment, the nucleotide sequence that encodes the N-terminal fragment of SGA-72M is nucleotide numbers 1-936 of SEQ DD NO:2. In other embodiments, the present invention includes SGA-72M nucleic acids comprising or conesponding to a nucleic acid that encodes a C-terminal fragment of the SGA-72M polypeptide. Such nucleic acids can comprise cDNA of at least 51, 102, 252, 501, 750, 900, or 936 nucleotides contiguous to the 3' end of the open reading frame (e.g., SEQ DD NO:2), but of less than 2000 bp or less than 1000 bp or less than 500 bp. In a specific embodiment, the nucleotide sequence that encodes the C-terminal fragment of SGA-72M is nucleotide numbers 3100- 4026 ofSEQ DD NO:2 Antibodies to the protein fragments encoded by the above-described fragments are also provided.

In certain embodiments, the present invention includes SGA-72M nucleic acids comprising or conesponding to a fragment of the SGA-72M cDNA which encodes a cytoplasmic, transmembrane, extracellular, or other domain (e.g., ligand binding domain) of a SGA-72M polypeptide. A hydropathy plot can be used to determine relatively hydrophobic regions of the protein which conespond to transmembrane domains thus allowing determination of extracellular and intracellular domains.

The invention includes SGA-72M nucleic acids comprising nucleotide sequences which preferably hybridize under highly stringent or moderately stringent conditions as described infra in Section 5.1.1 to at least about 6, preferably about 12, more preferably about 18, consecutive nucleotides of the SGA-72M gene sequences described above as being useful for the detection of an SGA-72M gene product for the diagnosis and prognosis of cancer, e.g., an RNA corresponding to SEQ DD NO:l and/or SEQ DD NO:2, or a nucleic acid derived therefrom; a nucleic acid comprising a sequence hybridizable to SEQ DD NO: 1 and/or SEQ DD NO:2, or its complement under conditions of high stringency; a nucleic acid comprising a sequence hybridizable to SEQ DD NO:l and/or SEQ DD NO:2 or its complement under conditions of high stringency; a nucleic acid at least 90% homologous to SEQ DD NO:l and/or SEQ DD NO:2 or its complement as determined using the NBLAST algorithm. The invention also includes the nucleic acid molecules, preferably DNA molecules, that preferably hybridize under highly stringent or moderately stringent conditions as described infra in Section 5.1.1. Such nucleic acid molecules are therefore the inverse complements SGA-72M coding sequences, such as, for example, all or a portion of the following nucleic acid sequences: an RNA corresponding to SEQ DD NO:l, or a nucleic acid derived therefrom; an RNA conesponding to SEQ DD NO:2, or a nucleic acid derived therefrom; (c) a nucleic acid encoding a polypeptide comprising or consisting essentially of the amino acid sequence of SEQ DD NO:3; (d) a nucleic acid at least 70% (more preferably at least 80%, most preferably at least 90%) homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12; or (e) a nucleic acid at least 70% (more preferably at least 80%, most preferably at least 90%) homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm with a score of 100 and a word length of 12. These nucleic acid molecules may encode or act as SGA-72M gene coding sequence antisense molecules useful, for example, in SGA-72M gene regulation. With respect to SGA-72M gene regulation, such techniques can be used to modulate, for example, the phenotype and metastatic potential of breast cancer or other cancer cells. Further, such sequences may be used as part of ribozyme and/or triple helix sequences, also useful for SGA-72M gene regulation and thus may be used for the treatment and/or prevention of cancer.

In one embodiment, the invention encompasses SGA-72M gene coding sequence or fragments and degenerate variants of DNA sequences which encode the SGA- 72M gene or gene product, including naturally occurring and non-naturally occurring variants thereof, and their use in the methods of the invention. A non-naturally occurring variant is one that is engineered by man. A naturally occurring SGA-72M gene, gene product, or variant thereof is one that is not engineered by man. In the methods of the invention wherein an SGA-72M gene product in a sample derived from a subject is detected or measured, naturally occurring SGA-72M gene products are detected, including, but not limited to wild-type SGA-72M gene products as well as mutants, allelic variants, splice variants, polymoφhic variants, etc. In general, such mutants and variants are believed to be highly homologous to SEQ DD NO:l, SEQ DD NO:2 or SEQ DD NO:3, e.g., at least 70% homologous and/or hybridizable under high stringency conditions. In specific embodiments, the mutants and variants being detected or measured comprise (or, if nucleic acids, encode) not more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90 or 100 point mutations (substitutions) relative to SEQ DD NO:l, SEQ DD NO:2 or SEQ DD NO:3, and or comprise or encode only conservative amino acid substitutions. In other methods of the invention, wild-type, or naturally occurring variant, or non-naturally occurring variant SGA-72M sequences may be used in the methods of the invention (e.g., in vaccination, immunization, antisense, or ribozyme procedures).

An SGA-72M gene fragment may be a complementary DNA (cDNA) molecule or a genomic DNA molecule that may comprise one or more intervening sequences or introns, as well as regulating regions located beyond the 5' and 3' ends of the coding region or within an intron. In some embodiments, the SGA-72M gene fragment does not include the non-coding (e.g., intronic) nucleotide sequences which naturally flank the coding nucleotide sequences of SGA-72M. The present invention provides for isolated nucleic acid molecules encoding an SGA-72M polypeptide, polypeptide, or fragments, derivatives, and variants thereof which include, both naturally occurring and non-naturally occurring variants or mutants. The invention also encompasses 1) any nucleic acid that encodes an SGA-72M polypeptide of the invention (for example the polypeptides described in Section 5.2 below); 2) any nucleic acid that hybridizes to the complement of the sequences disclosed herein, preferably under highly stringent conditions as disclosed infra in Section 5.1.1, and encodes a functionally equivalent gene product; and/or 3) any nucleic acid sequence that hybridizes to the complement of the sequences disclosed herein, preferably under moderately stringent conditions, as disclosed infra in Section 5.1.1 yet which still encodes a gene product that displays a functional activity of SGA-72M.

As discussed above, the invention also contemplates isolated nucleic acid molecules that encode a variant polypeptide. The variant polypeptide can occur naturally or non-naturally. It can be engineered by introducing nucleotide substitutions, e.g., point mutations, or additions or deletions into the nucleotide sequence of SEQ DD NO:l, or SEQ DD NO:2. In a specific embodiment, one or more, but not more than 5, 10, or 25 amino acid substitutions, additions or deletions are introduced into the encoded polypeptide. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR- mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. Following mutagenesis, the encoded polypeptide can be expressed recombinantly and the activity of the polypeptide can be determined. In a specific embodiment, the invention provides SGA-72M nucleic acid derivatives and analogs which are functionally active, i.e., they are capable of displaying one or more known functional activities associated with a (wild-type) SGA-72M-encoded polypeptide. Such functional activities include but are not limited to antigenicity (ability to bind (or compete with SGA-72M for binding) to an anti-SGA-72M or anti-SGA-72M antibody, respectively), immunogenicity (ability to generate antibody which binds to SGA- 72M, ability to bind (or compete with SGA-72M for binding) to other polypeptides or fragments thereof, ability to bind (or compete with SGA-72M for binding) to a receptor for SGA-72M. Using all or a portion of the nucleic acid sequences of SEQ DD NO: 1 , for example SEQ DD NO:2 or portions thereof, as a hybridization probe, nucleic acid molecules encoding an SGA-72M gene product can be isolated using standard hybridization and cloning techniques (See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) for use in the methods of the invention.

In addition, gene products encoded by SGA-72M, including SGA-72M peptide fragments, as well as specific or selective antibodies thereto, can be used for construction of fusion polypeptides to facilitate recovery, detection, or localization of another polypeptide of interest. In addition, genes and gene products encoded for by SGA- 72M (e.g., SGA-72M can be used as a research reagent, e.g., for genetic mapping).

Additionally, the present invention contemplates nucleic acid molecules, polypeptides, and/or antagonists of gene products encoded for by the SGA-72M gene to screen, diagnose, prevent and/or treat disorders characterized by abenant expression or activity of the SGA-72M polypeptides, which include, cancers, such as but not limited to cancer of the breast, ovary, skin and lymphoid system.

The present invention encompasses the use of SGA-72M nucleic acid molecules comprising cDNA, genomic DNA, introns, exons, promoter regions, 5' and 3^* regulatory regions of the gene, RNA, hnRNA, mRNA, regulatory regions within RNAs, and degenerate variants thereof in the methods of the invention. Promoter sequences for SGA- 72M can be determined by promoter-reporter gene assays and in vitro binding assays.

In one embodiment, the invention encompasses a variant SGA-72M nucleic acid sequence that hybridizes to a naturally-occurring or non-naturally occurring variant SGA-72M nucleic acid molecule under stringent conditions as described infra in Section 5.1.1. In another embodiment, the invention contemplates an SGA-72M variant nucleic acid sequence that hybridizes to a naturally-occurring or non-naturally occurring variant SGA-72M nucleic acid molecule under moderately stringent conditions as described infra in Section 5.1.1.

In certain embodiments of the present invention, an SGA-72M nucleic acid is not a nucleic acid consisting essentially of any of SEQ DD NOs: 19-26 or a fragment of any of the foregoing nucleic acids. In certain other embodiments, an SGA-72M nucleic acid does not comprise a coding nucleic acid sequence flanked on one or both sides by non- coding (e.g., intronic) nucleic acid sequences, particularly by native intronic sequences. In certain embodiments, nucleic acids of SEQ DD NO: 27 or 28 are not encompassed by the invention.

In certain embodiments, an SGA-72M nucleic acid is greater than approximately 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800 or 900 nucleotides in length. In other embodiments, an SGA-72M nucleic acid is greater than approximately 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 7 kb or 10 kb in length.

In other embodiments, an SGA-72M nucleic acid is less than approximately 900, 800, 700, 600, 500, 450, 400, 350, 300, 250, 200, 150 or 100 nucleotides in length. In specific embodiments, an SGA-72M nucleic acid is less than 90, 75, 60, 50, 40, or 30, 25, or 20 nucleotides in length. In other embodiments, an SGA-72M nucleic acid is less than approximately 10 kb, 7 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1.5 kb or 1 kb in length.

A nucleic acid molecule is intended to include DNA molecules (e.g., cDNA, genomic DNA), RNA molecules (e.g., hnRNA, pre-mRNA, mRNA), and DNA or RNA analogs generated using nucleotide analogs. The nucleic acid molecule can be single- stranded or double-stranded.

The SGA-72M nucleic acids of the invention are of human origin, however, homologs of SGA-72M isolated from other mammals may also be used in the methods of the invention. Thus, the invention also includes the use of SGA-72M homologs isolated from non-human animals such as non-human primates; rats; mice; farm animals including, but not limited to: cattle; horses; goats; sheep; pigs; etc.; household pets including, but not limited to: cats; dogs; etc. in the methods of the invention. Still further, the use of any of the SGA-72M nucleic acid as components of diagnostic and/or prognostic methods is contemplated, whereby, for example, the presence of a particular SGA-72M allele or alternatively spliced SGA-72M transcript responsible for causing or predisposing one to breast cancer or other cancers may be detected. The invention also includes the use of transcriptional regulators that control the level of expression of an SGA-72M gene product. A transcriptional regulator can include, e.g., a polypeptide which binds a DNA sequence and which up-regulates or down regulates the transcription of the SGA-72M gene. A transcriptional regulator can also include a nucleic acid sequence that can be either up stream or down stream from the SGA- 72M gene and which binds an effector molecule that enhances or suppresses SGA-72M gene transcription.

Still further, the invention encompasses the use of SGA-72M gene coding sequences or fragments thereof as a screen in an engineered yeast system, including, but not limited to, the yeast two hybrid system as a method to identify polypeptides, peptides or nucleic acids related to the onset and or metastatic spread of cancer, including breast cancer.

The invention also encompasses the use of (a) DNA vectors that contain any of the foregoing SGA-72M coding sequences and/or their complements (e.g., antisense); (b) DNA expression vectors that contain any of the foregoing SGA-72M coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences; and (c) genetically engineered host cells that contain any of the foregoing SGA- 72M coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences in the host cell. Cell lines and/or vectors which contain and/or express SGA-72M can be used to produce the SGA-72M gene product for use in the methods of the invention, e.g., vaccination against breast cancer or other cancers in which expression of SGA-72M is found to be elevated and screening assays for antagonists and agonists that bind, or interact with SGA-72M or suppress or enhance expression of SGA- 72M.

As used herein, regulatory elements include, but are not limited to inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art that drive and regulate expression. Such regulatory elements include but are not limited to the cytomegalovirus (hCMV) immediate early promoter, the early or late promoters of SV40 adenovirus, the lac system, the frp_ system, the TAC system, the TRC system, the major operator and promoter regions of phage A, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase, the promoters of acid phosphatase, and the promoters of the yeast a- or α-mating factors.

The invention includes the use of fragments or derivatives of any of the nucleic acids disclosed herein in any of the methods of the invention. In various embodiments, a fragment or derivative comprises 10, 15, 20, 25, 50, 100, or 200 nucleotides of SEQ DD NO:l, or SEQ DD NO:2 or encodes all or a fragment of SEQ DD NO:3. In the same or alternative embodiments, a nucleic acid is not more than 500, 1000, 2000, 5000, 7500, or 10,000 nucleotides in size. In certain specific embodiments, the present invention encompasses nucleic acid molecules comprising a nucleotide sequence which conesponds to a fragment of the nucleotide sequence of SEQ DD NO:l or SEQ DD NO:2, wherein the fragment comprises at least 25 contiguous nucleotides of SEQ DD NO:l or SEQ DD NO:2. Accordingly, the present invention encompasses nucleic acids having nucleotide sequences of the following fragments of SEQ DD NO:l or SEQ DD NO:2: nucleotides 1-25, 2-26, 3-27, 4-28, 5-29, 6-30, 7-31, 8-32, 9-33, 10-34, 11-35, 12-36, 13-37, 14-38, 15-39, 16-40, 17-41, 18-42, 19-43, 20-44, 21-45, 22-46, 23-47, 24-48, 25-49, 26-50, 27-51, 28-52, 29-53, 30-54, 31-55, 32-56, 33-57, 34-58, 35-59, 36-60, 37-61, 38-62, 39-63, 40-64, 41-65, 42-66, 43-67, 44-68, 45-69, 46-70, 47-71, 48-72, 49-73, 50-74, 51-75, 52-76, 53-77, 54-78, 55-79, 56-80, 57-81, 58-82, 59-83, 60-84, 61-85, 62-86, 63-87, 64-88, 65-89, 66-90, 67-91, 68-92, 69-93, 70-94, 71-95, 72-96, 73-97, 74-98, 75-99, 76-100, 77-101, 78-102, 79-103, 80-104, 81-105, 82-106, 83-107, 84-108, 85-109, 86-110, 87-111, 88-112, 89-113, 90-114, 91-115, 92-116, 93-117, 94-118, 95-119, 96-120, 97-121, 98-122, 99-123, 100-124, 101-125, 102-126, 103-127, 104-128, 105-129, 106-130, 107-131, 108-132, 109-133, 110-134, 111-135, 112-136, 113-137, 114-138, 115-139, 116-140, 117-141, 118-142, 119-143, 120-144, 121-145, 122-146, 123-147, 124-148, 125-149, 126-150, 127-151, 128-152, 129-153, 130-154, 131-155, 132-156, 133-157, 134-158, 135-159, 136-160, 137-161, 138-162, 139-163, 140-164, 141-165, 142-166, 143-167, 144-168, 145-169, 146-170, 147-171, 148-172, 149-173, 150-174, 151-175, 152-176, 153-177, 154-178, 155-179, 156-180, 157-181, 158-182, 159-183, 160-184, 161-185, 162-186, 163-187, 164-188, 165-189, 166-190, 167-191, 168-192, 169-193, 170-194, 171-195, 172-196, 173-197, 174-198, 175-199, 176-200, 177-201, 178-202, 179-203, 180-204, 181-205, 182-206, 183-207, 184-208, 185-209, 186-210, 187-211, 188-212, 189-213, 190-214, 191-215, 192-216, 193-217194-218 195-219, 196-220, 197-221 198-222, 199-223 200-224201-225, 202-226203-227204-228, 205-229, 206-230207-231,208-232209-233210-234, 211-235212-236213-237, 214-238,215-239216-240,217-241 218-242219-243, 220-244, 221-245 222-246, 223-247, 224-248225-249, 226-250227-251 228-252, 229-253230-254231-255, 232-256, 233-257234-258, 235-259236-260237-261, 238-262239-263 240-264,, 241-265, 242-266243-267, 244-268245-269246-270, 247-271 248-272249-273, 250-274,251-275 252-276, 253-277254-278255-279, 256-280_; 257-281 258-282, 259-283, 260-284261-285, 262-286263-287264-288, 265-289266-290267-291, 268-292, 269-293 270-294,271-295 272-296273-297, 274-298275-299276-300, 277-301, 278-302279-303, 280-304, 281-305282-306, 283-307284-308285-309,286-310,287-311 288-312,289-313 290-314, 291-315, 292-316293-317_; 294-318,295-319, 296-320297-321, 298-322299-323 300-324, 301-325 302-326303-327, 304-328, 305-329306-330, 307-331 308-332309-333, 310-334311-335 312-336, 313-337,314-338 315-339,316-340, 317-341 318-342, 319-343320-344321-345, 322-346, 323-347324-348, 325-349, 326-350327-351, 328-352329-353 330-354,331-355, 332-356333-357, 334-358 335-359336-360, 337-361 338-362339-363, 340-364, 341-365 342-366, 343-367, 344-368 345-369, 346-370347-371 348-372, 349-373, 350-374351-375,352-376, 353-377354-378, 355-379356-380_; 357-381, 358-382, 359-383 360-384, 361-385 362-386363-387, 364-388365-389366-390, 367-391, 368-392 369-393, 370-394, 371-395 372-396, 373-397374-398375-399, 376-400, 377-401 378-402, 379-403 380-404381-405, 382-406383-407, 384-408, 385-409, 386-410387-411,388-412 389-413 390-414, 391-415 392-416393-417, 394-418, 395-419 396-420, 397-421 398-422399-423, 400-424, 401-425402-426, 403-427, 404-428 405-429, 406-430, 407-431 408-432, 409-433410-434, 411-435, 412-436, 413-437414-438,415-439416-440417-441, 418-442419-443 420-444, 421-445, 422-446423-447, 424-448425-449426-450, 427-451 428-452429-453, 430-454,431-455 432-456, 433-457434-458435-459, 436-460, 437-461 438-462, 439-463, 440-464441-465, 442-466443-467444-468, 445-469446-470, 447-471, 448-472, 449-473 450-474,451-475 452-476453-477, 454-478455-479456-480,,457-481, 458-482459-483, 460-484461-485462-486, 463-487464-488465-489, 466-490,467-491 468-492, 469-493 470-494471-495, 472-496473-497474-498, 475-499, 476-500477-501,478-502479-503480-504, 481-505482-506483-507,, 484-508, 485-509486-510,487-511 488-512489-513, 490-514491-515492-516,,493-517,494-518495-519,496-520, 497-521 498-522, 499-523 500-524501-525502-526 503-527504-528 505-529 506-530507-531, 508-532 509-533 510-534 511-535 512-536513-537 514-538 515-539516-540, 517-541 518-542 519-543 520-544, 521-545 522-546 523-547 524-548 525-549, 526-550, 527-551 528-552 529-553 530-554, 531-555 532-556 533-557534-558, 535-559536-560 537-561 538-562 539-563 540-564 541-565 542-566543-567, 544-568 545-569 546-570 547-571 548-572 549-573 550-574 551-575 552-576, 553-577 554-578 555-579 556-580557-581 558-582 559-583 560-584561-585, 562-586, 563-587 564-588 565-589 566-590567-591 568-592 569-593 570-594, 571-595 572-596 573-597 574-598 575-599576-600 577-601 578-602579-603, 580-604581-605 582-606 583-607 584-608 585-609586-610587-611 588-612, 589-613 590-614591-615 592-616 593-617, 594-618 595-619 596-620597-621, 598-622 599-623 600-624, 601-625 602-626603-627 604-628 605-629606-630, 607-631 608-632 609-633 610-634611-635 612-636 613-637 614-638615-639, 616-640617-641 618-642 619-643 620-644621-645 622-646 623-647624-648, 625-649626-650627-651 628-652 629-653 630-654, 631-655 632-656633-657, 634-658 635-659636-660, 637-661 638-662639-663 640-664641-665642-666, 643-667644-668 645-669 646-670647-671 648-672 649-673 650-674651-675, 652-676653-677, 654-678 655-679656-680, 657-681 658-682 659-683660-684, 661-685 662-686663-687 664-688665-689666-690, 667-691 668-692669-693, 670-694671-695 672-696 673-697674-698 675-699676-700677-701 678-702, 679-703 680-704681-705 682-706683-707, 684-708 685-709686-710687-711, 688-712689-713 690-714 691-715 692-716693-717 694-718 695-719696-720, 697-721 698-722 699-723 700-724701-725 702-726703-727704-728705-729, 706-730707-731 708-732 709-733 710-734711-735 712-736 713-737714-738, 715-739716-740717-741 718-742719-743 720-744721-745 722-746723-747, 724-748 725-749 726-750, 727-751 728-752 729-753 730-754731-755 732-756, 733-757734-758 735-759 736-760, 737-761 738-762 739-763 740-764741-765, 742-766743-767 744-768 745-769746-770747-771 748-772 749-773 750-774, 751-775 752-776 753-777 754-778 755-779756-780757-781 758-782759-783, 760-784761-785 762-786 763-787764-788 765-789766-790767-791 768-792, 769-793 770-794771-795 772-796773-797 774-798 775-799776-800777-801, 778-802779-803 780-804 781-805 782-806 783-807 784-808785-809786-810, 787-811 788-812 789-813 790-814791-815 792-816793-817794-818795-819, 796-820, 797-821 798-822 799-823 800-824, 801-825 802-826 803-827804-828, 805-829, 806-830, 807-831, 808-832, 809-833, 810-834, 811-835, 812-836, 813-837, 814-838, 815-839, 816-840, 817-841, 818-842, 819-843, 820-844, 821-845, 822-846, 823-847, 824-848, 825-849, 826-850, 827-851, 828-852, 829-853, 830-854, 831-855, 832-856, 833-857, 834-858, 835-859, 836-860, 837-861, 838-862, 839-863, 840-864, 841-865, 842-866, 843-867, 844-868, 845-869, 846-870, 847-871, 848-872, 849-873, 850-874, 851-875, 852-876, 853-877, 854-878, 855-879, 856-880, 857-881, 858-882, 859-883, 860-884, 861-885, 862-886, 863-887, 864-888, 865-889, 866-890, 867-891, 868-892, 869-893, 870-894, 871-895, 872-896, 873-897, 874-898, 875-899, 876-900, 877-901, 878-902, 879-903, 880-904, 881-905, 882-906, 883-907, 884-908, 885-909, 886-910, 887-911, 888-912, 889-913, 890-914, 891-915, 892-916, 893-917, 894-918, 895-919, 896-920, 897-921, 898-922, 899-923, 900-924, 901-925, 902-926, 903-927, 904-928, 905-929, 906-930, 907-931, 908-932, 909-933, 910-934, 911-935, 912-936, 913-937, 914-938, 915-939, 916-940, 917-941, 918-942, 919-943, 920-944, 921-945, 922-946, 923-947, 924-948, 925-949, 926-950, 927-951, 928-952, 929-953, 930-954, 931-955, 932-956, 933-957, 934-958, 935-959, 936-960, 937-961, 938-962, 939-963, 940-964, 941-965, 942-966, 943-967, 944-968, 945-969, 946-970, 947-971, 948-972, 949-973, 950-974, 951-975, 952-976, 953-977, 954-978, 955-979, 956-980, 957-981, 958-982, 959-983, 960-984, 961-985, 962-986, 963-987, 964-988, 965-989, 966-990, 967-991, 968-992, 969-993, 970-994, 971-995, 972-996, 973-997, 974-998, 975-999, 976-1000, 977-1001, 978-1002, 979-1003, 980-1004, 981-1005, 982-1006, 983-1007, 984-1008, 985-1009, 986-1010, 987-1011, 988-1012, 989-1013, 990-1014, 991-1015, 992-1016, 993-1017, 994-1018, 995-1019, 996-1020, 997-1021, 998-1022, 999-1023, 1000-1024, 1001-1025, 1002-1026, 1003-1027, 1004-1028, 1005-1029, 1006-1030, 1007-1031, 1008-1032, 1009-1033, 1010-1034, 1011-1035, 1012-1036, 1013-1037, 1014-1038, 1015-1039, 1016-1040, 1017-1041, 1018-1042, 1019-1043, 1020-1044, 1021-1045, 1022-1046, 1023-1047, 1024-1048, 1025-1049, 1026-1050, 1027-1051, 1028-1052, 1029-1053, 1030-1054, 1031-1055, 1032-1056, 1033-1057, 1034-1058, 1035-1059, 1036-1060, 1037-1061, 1038-1062, 1039-1063, 1040-1064, 1041-1065, 1042-1066, 1043-1067, 1044-1068, 1045-1069, 1046-1070, 1047-1071, 1048-1072, 1049-1073, 1050-1074, 1051-1075, 1052-1076, 1053-1077, 1054-1078, 1055-1079, 1056-1080, 1057-1081, 1058-1082, 1059-1083, 1060-1084, 1061-1085, 1062-1086, 1063-1087, 1064-1088, 1065-1089, 1066-1090, 1067-1091, 1068-1092, 1069-1093, 1070-1094, 1071-1095, 1072-1096, 1073-1097, 1074-1098, 1075-1099, 1076-1100, 1077-1101, 1078-1102, 1079-1103, 1080-1104, 1081-1105, 1082-1106, 1083-1107, 1084-1108 1085-1109 1086-1110, 1087-1111 1088-1112 1089-1113 1090-1114, 1091-1115 1092-1116 1093-1117 1094-1118 1095-11191096-1120, 1097-1121, 1098-1122 1099-1123 1100-11241101-1125 1102-1126 1103-1127 1104-1128, 1105-1129 1106-1130, 1107-1131 1108-1132 1109-1133 1110-1134 1111-1135, 1112-11361113-1137, 1114-1138 1115-1139 1116-1140 1117-1141 1118-1142, 1119-1143 1120-1144 1121-1145 1122-1146 1123-1147 1124-1148 1125-1149, 1126-1150 1127-1151 1128-1152 1129-1153 1130-11541131-1155 1132-1156, 1133-11571134-1158 1135-1159, 1136-1160, 1137-1161 1138-1162, 1139-1163, 1140-1164, 1141-1165 1142-1166 1143-1167 1144-1168 1145-11691146-1170, 1147-1171 1148-1172, 1149-1173 1150-1174 1151-1175 1152-1176 1153-1177, 1154-1178 1155-1179, 1156-1180, 1157-1181 1158-1182 1159-1183 1160-1184, 1161-1185 1162-1186, 1163-1187 1164-1188 1165-1189 1166-1190 1167-1191, 1168-1192 1169-1193 1170-1194 1171-1195 1172-1196 1173-1197 1174-1198, 1175-1199 1176-1200, 1177-1201 1178-1202 1179-1203 1180-12041181-1205, 1182-1206 1183-1207, 1184-1208 1185-1209 1186-1210, 1187-1211 1188-1212, 1189-1213 1190-12141191-1215 1192-1216 1193-1217 1194-1218 1195-1219, 1196-1220, 1197-1221 1198-12221199-1223 1200-1224, 1201-1225 1202-1226, 1203-1227 1204-1228 1205-1229 1206-1230 1207-1231 1208-12321209-1233, 1210-12341211-1235 1212-1236 1213-1237 1214-1238 1215-1239 1216-1240, 1217-1241 1218-1242 1219-1243 1220-1244 1221-1245 1222-1246 1223-1247, 1224-1248 1225-1249 1226-1250 1227-1251 1228-1252 1229-1253 1230-1254, 1231-1255 1232-1256 1233-12571234-1258 1235-1259 1236-1260 1237-1261, 1238-1262 1239-1263 1240-1264 1241-1265 1242-1266 1243-1267 1244-1268, 1245-1269 1246-1270, 1247-1271 1248-1272 1249-1273 1250-12741251-1275, 1252-1276 1253-1277, 1254-1278 1255-12791256-1280, 1257-1281 1258-1282, 1259-1283 1260-12841261-1285 1262-1286 1263-1287 1264-1288 1265-1289, 1266-1290 1267-1291 1268-12921269-1293 1270-1294, 1271-1295 1272-1296, 1273-12971274-1298 1275-12991276-1300 1277-1301 1278-1302 1279-1303, 1280-13041281-1305 1282-13061283-1307 1284-1308 1285-13091286-1310, 1287-1311 1288-1312 1289-1313 1290-13141291-1315 1292-1316 1293-1317, 1294-1318 1295-1319, 1296-1320 1297-1321 1298-1322 1299-1323 1300-1324, 1301-1325 1302-1326 1303-1327 1304-1328 1305-13291306-1330 1307-1331, 1308-1332 1309-1333 1310-1334, 1311-1335 1312-1336 1313-1337 1314-1338, 1315-1339, 1316-1340 1317-1341 1318-13421319-1343 1320-1344, 1321-1345, 1322-13461323-1347, 1324-1348 1325-13491326-1350, 1327-1351 1328-1352, 1329-1353 1330-1354, 1331-1355 1332-13561333-1357 1334-1358 1335-1359, 1336-1360 1337-1361 1338-1362 1339-1363 1340-1364 1341-1365 1342-1366, 1343-1367 1344-1368 1345-1369, 1346-1370 1347-1371 1348-1372 1349-1373, 1350-13741351-1375 1352-1376, 1353-1377 1354-1378 1355-13791356-1380, 1357-1381 1358-1382 1359-1383 1360-13841361-1385 1362-1386 1363-1387, 1364-1388 1365-13891366-1390 1367-1391 1368-1392 1369-1393 1370-1394, 1371-1395 1372-1396 1373-1397 1374-1398 1375-1399 1376-1400 1377-1401, 1378-1402 1379-1403 1380-1404, 1381-1405 1382-1406 1383-1407 1384-1408, 1385-14091386-1410, 1387-1411 1388-1412, 1389-1413 1390-1414, 1391-1415, 1392-1416 1393-1417 1394-1418 1395-14191396-1420 1397-1421 1398-1422, 1399-1423 1400-1424, 1401-1425 1402-1426 1403-1427 1404-1428 1405-1429, 1406-1430 1407-1431 1408-1432 1409-1433 1410-14341411-1435 1412-1436, 1413-1437 1414-1438 1415-1439, 1416-1440 1417-1441 1418-1442 1419-1443, 1420-14441421-1445 1422-14461423-1447 1424-1448 1425-14491426-1450, 1427-1451 1428-1452 1429-1453 1430-14541431-1455 1432-1456 1433-1457, 1434-1458 1435-14591436-14601437-1461 1438-1462 1439-1463 1440-1464, 1441-1465 1442-1466 1443-1467, 1444-1468 1445-14691446-1470, 1447-1471, 1448-1472 1449-1473 1450-14741451-1475 1452-1476 1453-1477, 1454-1478, 1455-1479 1456-1480 1457-1481 1458-1482 1459-1483 1460-14841461-1485, 1462-1486 1463-1487, 1464-1488 1465-1489 1466-1490, 1467-1491 1468-1492, 1469-1493 1470-14941471-1495 1472-1496 1473-1497, 1474-1498 1475-1499, 1476-1500 1477-1501 1478-1502 1479-1503 1480-1504 1481-1505 1482-1506, 1483-1507 1484-1508 1485-1509, 1486-1510 1487-1511 1488-1512 1489-1513, 1490-15141491-1515 1492-15161493-1517 1494-1518 1495-15191496-1520, 1497-1521 1498-15221499-1523 1500-15241501-1525 1502-1526, 1503-1527, 1504-1528 1505-1529 1506-1530 1507-1531 1508-1532 1509-1533 1510-1534, 1511-1535 1512-15361513-15371514-1538 1515-15391516-1540 1517-1541, 1518-15421519-1543 1520-1544 1521-1545 1522-1546 1523-1547 1524-1548, 1525-15491526-1550 1527-1551 1528-1552 1529-1553 1530-1554, 1531-1555, 1532-1556 1533-1557, 1534-1558 1535-1559 1536-1560 1537-1561 1538-1562, 1539-1563 1540-15641541-1565 1542-1566 1543-15671544-1568 1545-1569, 1546-1570, 1547-1571 1548-15721549-1573 1550-15741551-1575 1552-1576, 1553-1577 1554-1578 1555-15791556-1580, 1557-1581 1558-1582 1559-1583, 1560-1584 1561-1585 1562-1586 1563-1587, 1564-1588 1565-15891566-1590, 1567-1591 1568-1592 1569-1593 1570-1594 1571-1595 1572-1596 1573-1597, 1574-1598 1575-1599 1576-1600 1577-1601 1578-16021579-1603 1580-1604, 1581-1605 1582-1606 1583-1607 1584-1608 1585-1609 1586-1610, 1587-1611, 1588-1612 1589-1613 1590-1614 1591-1615 1592-1616 1593-1617 1594-1618, 1595-1619 1596-1620 1597-1621 1598-1622 1599-1623 1600-1624 1601-1625, 1602-1626 1603-1627 1604-1628 1605-16291606-1630 1607-1631 1608-1632, 1609-1633 1610-1634 1611-1635 1612-1636 1613-1637 1614-1638 1615-1639, 1616-1640 1617-1641 1618-1642 1619-1643 1620-16441621-1645 1622-1646, 1623-16471624-1648 1625-1649 1626-1650 1627-1651 1628-16521629-1653, 1630-16541631-1655 1632-1656 1633-1657 1634-1658 1635-16591636-1660, 1637-1661 1638-1662 1639-1663 1640-16641641-1665 1642-1666 1643-1667, 1644-1668 1645-1669 1646-1670 1647-1671 1648-1672 1649-1673 1650-1674, 1651-1675 1652-1676 1653-1677 1654-1678 1655-1679 1656-1680, 1657-1681, 1658-16821659-1683 1660-1684 1661-1685 1662-1686 1663-1687 1664-1688, 1665-1689 1666-1690 1667-1691 1668-1692 1669-1693 1670-1694, 1671-1695, 1672-16961673-1697 1674-1698 1675-1699 1676-1700, 1677-1701 1678-1702, 1679-1703 1680-1704 1681-1705 1682-1706 1683-1707 1684-1708 1685-1709, 1686-1710 1687-1711 1688-1712 1689-1713 1690-1714, 1691-1715 1692-1716, 1693-1717 1694-1718 1695-1719 1696-1720 1697-1721 1698-1722 1699-1723, 1700-1724 1701-1725 1702-1726 1703-1727 1704-1728 1705-17291706-1730, 1707-1731 1708-1732 1709-1733 1710-1734, 1711-1735 1712-1736 1713-1737, 1714-1738 1715-1739 1716-1740, 1717-1741 1718-1742 1719-1743 1720-1744, 1721-1745 1722-1746 1723-1747 1724-1748 1725-1749 1726-1750, 1727-1751, 1728-17521729-1753 1730-1754, 1731-1755 1732-1756 1733-1757 1734-1758, 1735-17591736-1760 1737-1761 1738-1762 1739-1763 1740-17641741-1765, 1742-17661743-1767 1744-1768 1745-1769, 1746-1770, 1747-1771 1748-1772, 1749-1773 1750-17741751-1775 1752-1776, 1753-1777 1754-1778 1755-1779, 1756-1780 1757-1781 1758-1782 1759-1783 1760-1784, 1761-1785 1762-1786, 1763-17871764-1788 1765-1789 1766-1790, 1767-1791 1768-1792 1769-1793, 1770-1794 1771-1795 1772-1796 1773-1797 1774-1798 1775-17991776-1800, 1777-1801 1778-1802 1779-1803 1780-18041781-1805 1782-18061783-1807, 1784-1808 1785-1809 1786-1810, 1787-1811 1788-1812 1789-1813 1790-1814, 1791-1815 1792-1816 1793-1817, 1794-1818 1795-1819 1796-1820 1797-1821, 1798-18221799-1823 1800-18241801-1825 1802-1826, 1803-18271804-1828, 1805-1829 1806-1830 1807-1831 1808-18321809-1833 1810-18341811-1835, 1812-18361813-1837, 1814-1838 1815-18391816-1840, 1817-1841 1818-1842, 1819-1843 1820-18441821-1845 1822-18461823-1847, 1824-1848 1825-1849, 1826-1850 1827-1851 1828-1852 1829-1853 1830-18541831-1855 1832-1856, 1833-18571834-1858 1835-18591836-1860 1837-1861 1838-18621839-1863, 1840-18641841-1865 1842-18661843-18671844-1868 1845-1869 1846-1870, 1847-1871 1848-18721849-1873 1850-18741851-1875 1852-1876 1853-1877, 1854-1878 1855-18791856-1880, 1857-1881 1858-18821859-1883 1860-1884, 1861-1885 1862-18861863-1887 1864-1888 1865-18891866-1890, 1867-1891, 1868-1892 1869-1893 1870-18941871-1895 1872-1896 1873-1897 1874-1898, 1875-1899 1876-1900 1877-1901 1878-1902 1879-1903 1880-19041881-1905, 1882-1906 1883-19071884-1908 1885-19091886-1910 1887-1911 1888-1912, 1889-1913 1890-19141891-1915 1892-1916 1893-19171894-1918 1895-1919, 1896-1920, 1897-1921 1898-1922 1899-1923 1900-19241901-1925 1902-1926, 1903-1927 1904-1928 1905-1929, 1906-1930, 1907-1931 1908-1932 1909-1933, 1910-19341911-1935 1912-1936 1913-19371914-1938 1915-19391916-1940, 1917-1941 1918-19421919-1943 1920-19441921-1945 1922-1946 1923-1947, 1924-1948 1925-1949 1926-1950, 1927-1951 1928-19521929-1953 1930-1954, 1931-19551932-19561933-1957, 1934-1958 1935-19591936-1960 1937-1961, 1938-19621939-1963 1940-19641941-1965 1942-1966 1943-1967 1944-1968, 1945-19691946-1970 1947-1971 1948-19721949-1973 1950-1974, 1951-1975, 1952-19761953-19771954-1978 1955-19791956-1980 1957-1981 1958-1982, 1959-1983 1960-19841961-1985 1962-1986 1963-19871964-1988 1965-1989, 1966-1990 1967-1991 1968-1992 1969-1993 1970-19941971-1995 1972-1996, 1973-19971974-1998 1975-1999 1976-2000 1977-2001 1978-2002 1979-2003, 1980-2004 1981-2005 1982-2006 1983-2007 1984-2008 1985-20091986-2010, 1987-2011 1988-20121989-2013 1990-20141991-2015 1992-20161993-2017, 1994-2018 1995-2019 1996-2020, 1997-2021 1998-2022 1999-2023 2000-2024, 2001-2025 2002-20262003-20272004-20282005-20292006-20302007-2031, 2008-2032, 2009-2033 2010-20342011-20352012-20362013-20372014-2038, 2015-20392016-20402017-2041 2018-20422019-20432020-20442021-2045, 2022-20462023-20472024-20482025-2049, 2026-20502027-2051 2028-2052, 2029-2053 2030-20542031-20552032-20562033-20572034-20582035-2059, 2036-20602037-2061 2038-20622039-2063 2040-20642041-2065 2042-2066, 2043-20672044-20682045-2069, 2046-20702047-2071 2048-20722049-2073, 2050-20742051-2075 2052-20762053-20772054-20782055-2079, 2056-2080, 2057-2081 2058-20822059-2083 2060-2084, 2061-2085 2062-20862063-2087, 2064-20882065-20892066-20902067-2091 2068-20922069-2093 2070-2094, 2071-2095 2072-20962073-20972074-2098 2075-20992076-21002077-2101, 2078-21022079-2103 2080-21042081-2105 2082-21062083-2107, 2084-2108, 2085-21092086-2110, 2087-2111 2088-21122089-2113 2090-21142091-2115, 2092-21162093-21172094-21182095-21192096-21202097-2121 2098-2122, 2099-2123 2100-2124, 2101-2125 2102-21262103-21272104-21282105-2129, 2106-21302107-2131 2108-21322109-2133 2110-21342111-21352112-2136, 2113-21372114-2138 2115-21392116-2140, 2117-2141 2118-21422119-2143, 2120-21442121-2145 2122-21462123-21472124-21482125-21492126-2150, 2127-2151 2128-21522129-2153 2130-21542131-2155 2132-21562133-2157, 2134-21582135-2159, 2136-2160, 2137-2161 2138-21622139-2163 2140-2164, 2141-2165 2142-21662143-21672144-21682145-21692146-21702147-2171, 2148-21722149-2173 2150-2174, 2151-2175 2152-21762153-21772154-2178, 2155-21792156-21802157-2181 2158-21822159-2183 2160-21842161-2185, 2162-21862163-21872164-21882165-2189, 2166-21902167-2191 2168-2192, 2169-2193 2170-21942171-2195 2172-21962173-21972174-21982175-2199, 2176-2200, 2177-2201 2178-22022179-2203 2180-22042181-2205 2182-2206, 2183-22072184-22082185-22092186-2210, 2187-2211 2188-22122189-2213, 2190-2214, 2191-2215 2192-22162193-22172194-22182195-22192196-2220, 2197-2221 2198-22222199-2223 2200-22242201-2225 2202-22262203-2227, 2204-22282205-22292206-2230, 2207-2231 2208-22322209-2233 2210-2234, 2211-2235 2212-22362213-2237 2214-22382215-22392216-22402217-2241, 2218-22422219-2243 2220-2244, 2221-2245 2222-22462223-22472224-2248, 2225-22492226-22502227-2251 2228-22522229-2253 2230-22542231-2255, 2232-22562233-22572234-22582235-2259, 2236-22602237-2261 2238-2262, 2239-2263 2240-22642241-2265 2242-22662243-22672244-2268 2245-2269, 2246-2270, 2247-2271 2248-22722249-2273 2250-22742251-2275 2252-2276, 2253-22772254-22782255-22792256-2280, 2257-2281 2258-22822259-2283, 2260-22842261-2285 2262-22862263-22872264-22882265-2289, 2266-2290, 2267-2291 2268-22922269-2293 2270-22942271-2295 2272-2296, 2273-2297, 2274-2298, 2275-2299, 2276-23002277-2301 2278-23022279-2303 2280-2304, 2281-2305,2282-2306, 2283-23072284-23082285-23092286-2310, 2287-2311, 2288-2312,2289-2313,2290-23142291-2315 2292-23162293-23172294-2318, 2295-2319,2296-2320,2297-2321 2298-23222299-2323 2300-23242301-2325, 2302-2326, 2303-2327, 2304-23282305-2329, 2306-2330, 2307-2331 2308-2332, 2309-2333,2310-2334,2311-2335 2312-23362313-23372314-2338 2315-2339, 2316-2340,2317-2341,2318-23422319-2343 2320-2344, 2321-2345 2322-2346, 2323-2347, 2324-2348, 2325-23492326-23502327-2351 2328-23522329-2353, 2330-2354,2331-2355, 2332-2356, 2333-23572334-23582335-23592336-2360, 2337-2361,2338-2362, 2339-2363 2340-2364, 2341-2365 2342-23662343-2367, 2344-2368, 2345-2369, 2346-23702347-2371 2348-23722349-2373 2350-2374, 2351-2375,2352-2376, 2353-23772354-23782355-23792356-23802357-2381, 2358-2382, 2359-2383, 2360-23842361-2385 2362-23862363-23872364-2388, 2365-2389, 2366-2390,2367-2391 2368-23922369-2393 2370-23942371-2395, 2372-2396,2373-2397, 2374-23982375-23992376-2400, 2377-2401 2378-2402, 2379-2403, 2380-2404,2381-2405 2382-24062383-24072384-2408 2385-2409, 2386-2410, 2387-2411,2388-24122389-2413 2390-2414, 2391-2415 2392-2416, 2393-2417, 2394-2418,2395-24192396-24202397-2421 2398-2422 2399-2423, 2400-2424, 2401-2425, 2402-24262403-24272404-2428 2405-24292406-2430, 2407-2431,2408-2432, 2409-2433 2410-24342411-2435 2412-2436, 2413-2437, 2414-2438,2415-2439,2416-2440, 2417-2441 2418-24422419-2443 2420-2444, 2421-2445, 2422-^■2446, 2423-24472424-2448 2425-2449, 2426-2450, 2427-2451, 2428-2452, 2429-2453, 2430-24542431-2455 2432-2456, 2433-24572434-2458, 2435-2459, 2436-2460,2437-2461 2438-24622439-2463 2440-2464, 2441-2465, 2442-2466, 2443-2467, 2444-24682445-24692446-2470, 2447-2471 2448-2472, 2449-2473, 2450-2474,2451-2475 2452-24762453-24772454-24782455-2479, 2456-2480, 2457-2481,2458-24822459-2483 2460-2484, 2461-2485 2462-2486, 2463-2487, 2464-2488, 2465-24892466-24902467-2491 2468-24922469-2493, 2470-2494, 2471-2495, 2472-24962473-24972474-24982475-2499, 2476-2500, 2477-2501, 2478-2502, 2479-2503 2480-25042481-2505 2482-2506, 2483-2507, 2484-2508, 2485-2509,2486-2510, 2487-2511 2488-25122489-2513 2490-2514, 2491-2515,2492-2516,2493-25172494-25182495-25192496-25202497-2521, 2498-2522, 2499-2523, 2500-25242501-2525 2502-25262503-25272504-2528, 2505-2529, 2506-2530,2507-2531 2508-25322509-2533 2510-25342511-2535, 2512-25362513-25372514-2538, 25152539,2516-25402517-2541, 2518-2542, 2519-2543 2520-25442521-2545, 25222546, 2523-25472524-2548, 2525-2549, 2526-2550 2527-2551 2528-2552, 25292553, 2530-25542531-2555, 2532-2556, 2533-2557 2534-25582535-2559, 25362560, 2537-2561 2538-2562, 2539-2563, 2540-2564 2541-2565 2542-2566, 25432567, 2544-25682545-2569, 2546-2570, 2547-2571 2548-25722549-2573, 25502574,2551-2575 2552-2576, 2553-2577, 2554-2578 2555-25792556-2580, 25572581,2558-25822559-2583, 2560-2584, 2561-2585 2562-25862563-2587, 25642588, 2565-25892566-2590, 2567-2591, 2568-2592 2569-2593 2570-2594, 25712595, 2572-25962573-2597, 2574-2598, 2575-2599 2576-2600, 2577-2601,25782602, 2579-2603 2580-2604, 2581-2605, 2582-2606 2583-26072584-2608, 25852609, 2586-26102587-2611, 2588-2612, 2589-2613 2590-26142591-2615,25922616, 2593-26172594-2618, 2595-2619, 2596-2620 2597-2621 2598-2622, 25992623, 2600-26242601-2625, 2602-2626, 2603-2627 2604-26282605-2629, 26062630,2607-2631 2608-2632, 2609-2633, 2610-2634 2611-2635 2612-2636, 26132637, 2614-26382615-2639, 2616-2640, 2617-2641 2618-26422619-2643, 26202644, 2621-2645 2622-2646, 2623-2647, 2624-2648 2625-26492626-2650, 26272651,2628-26522629-2653, 2630-2654, 2631-2655 2632-26562633-2657, 26342658, 2635-26592636-2660, 2637-2661, 2638-2662 2639-2663 2640-2664, 26412665, 2642-26662643-2667, 2644-2668, 2645-2669 2646-2670, 2647-2671,2648 •2672, 2649-2673 2650-2674, 2651-2675, 2652-2676 2653-26772654-2678, 26552679, 2656-2680, 2657-2681, 2658-2682, 2659-2683 2660-2684, 2661-2685, 26622686, 2663-26872664-2688, 2665-2689, 2666-2690, 2667-2691 2668-2692, 2669 •2693, 2670-2694, 2671-2695, 2672-2696, 2673-2697 2674-26982675-2699, 2676 ^■2700, 2677-2701 2678-2702, 2679-2703, 2680-2704, 2681-2705 2682-2706, 2683 •2707, 2684-27082685-2709, 2686-2710, 2687-2711 2688-27122689-2713, 2690 ^■2714,2691-2715 2692-2716, 2693-2717, 2694-2718 2695-27192696-2720, 2697 •2721, 2698-27222699-2723, 2700-2724, 2701-2725 2702-27262703-2727, 2704 •2728, 2705-27292706-2730, 2707-2731, 2708-2732 2709-2733 2710-2734,2711 •2735, 2712-27362713-2737, 2714-2738, 2715-2739 2716-2740, 2717-2741,2718 •2742, 2719-2743 2720-2744, 2721-2745, 2722-2746, 2723-27472724-2748, 2725 •2749, 2726-2750, 2727-2751, 2728-2752, 2729-2753 2730-27542731-2755,2732 ^■2756, 2733-27572734-2758, 2735-2759, 2736-2760, 2737-2761 2738-2762, 2739•2763, 2740-27642741-2765, 2742-2766, 2743-2767, 2744-27682745-2769, 27462770,2747-2771 2748-2772, 2749-2773, 2750-27742751-2775 2752-27762753-2777, 2754-27782755-27792756-2780, 2757-2781 2758-27822759-2783 2760-2784, 2761-2785 2762-27862763-2787, 2764-27882765-27892766-2790, 2767-2791 2768-27922769-2793 2770-2794, 2771-2795 2772-27962773-27972774-2798 2775-27992776-28002777-2801, 2778-28022779-2803 2780-28042781-2805 2782-28062783-28072784-2808, 2785-28092786-28102787-2811 2788-28122789-2813 2790-2814, 2791-2815, 2792-28162793-28172794-28182795-28192796-2820, 2797-2821 2798-2822, 2799-2823 2800-28242801-2825 2802-28262803-28272804-28282805-2829, 2806-28302807-2831 2808-2832, 2809-2833 2810-2834, 2811-2835 2812-2836, 2813-28372814-28382815-28392816-2840, 2817-2841 2818-28422819-2843, 2820-2844, 2821-2845 2822-28462823-28472824-2848 2825-28492826-2850, 2827-2851 2828-28522829-2853 2830-28542831-2855 2832-28562833-2857, 2834-2858 2835-28592836-28602837-2861 2838-28622839-2863 2840-2864, 2841-2865 2842-28662843-28672844-2868 2845-2869, 2846-2870, 2847-2871, 2848-28722849-2873 2850-28742851-2875 2852-2876, 2853-28772854-2878, 2855-2879, 2856-2880, 2857-2881 2858-28822859-2883 2860-2884, 2861-2885, 2862-2886, 2863-28872864-2888 2865-28892866-2890, 2867-2891 2868-2892, 2869-2893 2870-28942871-2895 2872-28962873-2897, 2874-28982875-2899, 2876-2900, 2877-2901 2878-29022879-2903 2880-2904, 2881-29052882-2906, 2883-2907, 2884-29082885-29092886-29102887-2911 2888-29122889-2913, 2890-29142891-2915 2892-29162893-29172894-29182895-29192896-2920, 2897-2921 2898-29222899-2923 2900-29242901-2925 2902-29262903-2927, 2904-29282905-29292906-29302907-2931 2908-29322909-2933 2910-2934, 2911-2935 2912-29362913-29372914-2938 2915-29392916-29402917-2941, 2918-29422919-2943 2920-29442921-2945 2922-29462923-29472924-2948, 2925-29492926-2950, 2927-2951 2928-2952 2929-2953 2930-2954, 2931-2955, 2932-29562933-29572934-29582935-29592936-2960, 2937-2961 2938-2962, 2939-2963 2940-29642941-2965 2942-29662943-29672944-29682945-2969, 2946-29702947-2971 2948-29722949-2973 2950-2974, 2951-2975 2952-2976, 2953-29772954-2978 2955-29792956-29802957-2981 2958-29822959-2983, 2960-29842961-2985 2962-29862963-29872964-29882965-29892966-2990, 2967-2991 2968-29922969-2993 2970-29942971-2995 2972-29962973-2997, 2974-29982975-29992976-30002977-3001 2978-30022979-3003 2980-3004, 2981-3005 2982-30062983-30072984-3008 2985-30092986-30102987-3011, 2988-30122989-3013 2990-30142991-3015 2992-30162993-30172994-3018, 2995-3019, 2996-30202997-3021 2998-3022 2999-3023 3000-3024, 3001-3025, 3002-30263003-30273004-3028 3005-3029, 3006-30303007-3031 3008-3032, 3009-3033 3010-30343011-3035 3012-3036 3013-3037 3014-3038 3015-3039, 3016-30403017-3041 3018-30423019-3043 3020-30443021-3045 3022-3046, 3023-3047 3024-3048 3025-30493026-30503027-3051 3028-3052 3029-3053, 3030-30543031-3055 3032-30563033-3057 3034-3058 3035-30593036-3060, 3037-3061 3038-30623039-3063 3040-3064 3041-3065 3042-3066, 3043-3067, 3044-3068 3045-30693046-30703047-3071 3048-3072 3049-3073 3050-3074, 3051-3075 3052-3076, 3053-30773054-3078 3055-3079, 3056-3080, 3057-3081, 3058-3082 3059-3083 3060-30843061-3085 3062-3086, 3063-30873064-3088, 3065-3089, 3066-30903067-3091 3068-3092 3069-3093 3070-3094, 3071-3095, 3072-30963073-30973074-3098 3075-3099 3076-3100, 3077-3101 3078-3102, 3079-3103 3080-31043081-3105 3082-31063083-3107, 3084-3108 3085-3109, 3086-31103087-3111 3088-3112 3089-3113 3090-31143091-3115 3092-3116, 3093-3117 3094-3118 3095-3119 3096-31203097-3121 3098-3122 3099-3123, 3100-31243101-3125 3102-31263103-31273104-3128 3105-31293106-3130, 3107-3131 3108-31323109-3133 3110-3134 3111-3135 3112-31363113-3137, 3114-3138 3115-31393116-3140, 3117-3141 3118-31423119-3143 3120-3144, 3121-3145 3122-31463123-3147, 3124-3148 3125-31493126-3150, 3127-3151, 3128-31523129-3153 3130-31543131-3155 3132-31563133-3157, 3134-3158, 3135-31593136-31603137-3161 3138-3162 3139-3163 3140-31643141-3165, 3142-31663143-31673144-3168 3145-31693146-31703147-3171 3148-3172, 3149-3173 3150-31743151-3175 3152-3176 3153-31773154-3178 3155-3179, 3156-31803157-3181 3158-3182 3159-3183 3160-31843161-3185 3162-3186, 3163-3187 3164-3188 3165-31893166-3190 3167-3191 3168-3192 3169-3193, 3170-31943171-3195 3172-3196 3173-3197 3174-31983175-3199 3176-3200, 3177-3201 3178-32023179-3203 3180-3204 3181-3205 3182-32063183-3207, 3184-3208 3185-32093186-32103187-3211 3188-32123189-3213 3190-3214, 3191-3215 3192-32163193-3217 3194-3218 3195-32193196-3220, 3197-3221, 3198-32223199-3223 3200-32243201-3225 3202-32263203-32273204-3228, 3205-3229, 3206-3230, 3207-3231 3208-3232 3209-3233 3210-32343211-3235, 3212-3236, 3213-32373214-3238 3215-32393216-3240, 3217-3241 3218-3242, 3219-3243 3220-32443221-3245 3222-3246 3223-32473224-3248 3225-3249, 3226-32503227-3251 3228-32523229-3253 3230-32543231-3255 3232-3256, 3233-32573234-3258 3235-32593236-3260, 3237-3261 3238-32623239-3263, 3240-32643241-3265 3242-32663243-3267, 3244-3268 3245-32693246-3270, 3247-3271 3248-3272 3249-3273 3250-32743251-3275 3252-32763253-3277, 3254-32783255-3279 3256-3280, 3257-3281 3258-3282, 3259-3283 3260-3284, 3261-3285 3262-3286 3263-32873264-3288 3265-32893266-3290, 3267-3291, 3268-32923269-3293 3270-3294, 3271-3295 3272-3296, 3273-32973274-3298, 3275-3299, 3276-33003277-3301 3278-3302 3279-3303 3280-3304, 3281-3305, 3282-33063283-3307 3284-3308 3285-3309 3286-3310 3287-3311 3288-3312, 3289-3313 3290-3314, 3291-3315 3292-3316 3293-33173294-3318 3295-3319, 3296-33203297-3321 3298-3322, 3299-3323 3300-33243301-3325 3302-3326, 3303-33273304-3328 3305-3329, 3306-3330, 3307-3331 3308-33323309-3333, 3310-33343311-3335 3312-33363313-3337 3314-3338 3315-33393316-3340, 3317-3341 3318-33423319-3343 3320-3344, 3321-3345 3322-33463323-3347, 3324-33483325-33493326-3350, 3327-3351 3328-3352 3329-3353 3330-3354, 3331-3355 3332-3356 3333-33573334-3358 3335-3359 3336-33603337-3361, 3338-33623339-3363 3340-33643341-3365 3342-3366 3343-3367, 3344-3368, 3345-33693346-3370, 3347-3371 3348-3372 3349-3373 3350-33743351-3375, 3352-33763353-3377 3354-3378 3355-3379 3356-3380, 3357-3381 3358-3382, 3359-3383 3360-3384, 3361-3385 3362-3386 3363-3387 3364-3388 3365-3389, 3366-33903367-3391 3368-3392 3369-3393 3370-3394, 3371-3395 3372-3396, 3373-33973374-3398 3375-33993376-3400 3377-3401 3378-3402 3379-3403, 3380-34043381-3405 3382-3406 3383-34073384-3408 3385-34093386-3410, 3387-3411 3388-34123389-3413 3390-34143391-3415 3392-34163393-3417, 3394-34183395-34193396-3420, 3397-3421 3398-3422 3399-3423 3400-3424, 3401-3425 3402-34263403-34273404-3428 3405-34293406-3430, 3407-3431, 3408-34323409-3433 3410-34343411-3435 3412-3436 3413-34373414-3438, 3415-34393416-34403417-3441 3418-3442 3419-3443 3420-3444, 3421-3445, 3422-34463423-3447 3424-3448 3425-3449 3426-34503427-3451 3428-3452, 3429-3453 3430-34543431-3455 3432-34563433-3457, 3434-3458 3435-3459, 3436-3460, 3437-3461 3438-3462 3439-3463 3440-34643441-3465 3442-3466, 3443-34673444-3468 3445-3469, 3446-3470, 3447-3471 3448-34723449-3473, 3450-3474, 3451-3475 3452-3476 3453-34773454-3478 3455-34793456-3480, 3457-3481 3458-3482 3459-3483 3460-34843461-3485 3462-34863463-3487, 3464-34883465-34893466-34903467-3491 3468-3492 3469-3493 3470-3494, 3471-34953472-34963473-3497 3474-3498 3475-3499 3476-3500, 3477-3501, 3478-35023479-3503 3480-35043481-3505 3482-3506 3483-3507 3484-3508, 3485-35093486-3510, 3487-3511 3488-35123489-3513 3490-3514, 3491-3515, 3492-35163493-35173494-3518 3495-35193496-35203497-3521 3498-3522, 3499-35233500-3524, 3501-3525 3502-35263503-3527 3504-3528 3505-3529, 3506-3530, 3507-3531 3508-35323509-3533 3510-35343511-3535 3512-3536, 3513-35373514-35383515-35393516-3540, 3517-3541 3518-3542 3519-3543, 3520-35443521-3545 3522-35463523-35473524-3548 3525-3549 3526-3550, 3527-3551 3528-35523529-3553 3530-35543531-3555 3532-3556 3533-3557, 3534-35583535-35593536-35603537-3561 3538-35623539-3563 3540-3564, 3541-35653542-35663543-35673544-3568 3545-35693546-3570, 3547-3571, 3548-35723549-3573 3550-3574, 3551-3575 3552-35763553-3577 3554-3578, 3555-35793556-3580, 3557-3581 3558-35823559-3583 3560-3584, 3561-3585, 3562-35863563-35873564-3588 3565-35893566-35903567-3591 3568-3592, 3569-35933570-35943571-3595 3572-35963573-35973574-3598 3575-3599, 3576-36003577-3601 3578-36023579-3603 3580-3604, 3581-3605 3582-3606, 3583-36073584-36083585-36093586-3610, 3587-3611 3588-3612 3589-3613, 3590-3614, 3591-3615 3592-36163593-36173594-3618 3595-36193596-3620, 3597-3621 3598-36223599-3623 3600-3624, 3601-3625 3602-3626 3603-3627, 3604-36283605-3629, 3606-36303607-3631 3608-36323609-3633 3610-3634, 3611-3635 3612-36363613-36373614-3638 3615-36393616-36403617-3641, 3618-36423619-3643 3620-36443621-3645 3622-36463623-3647 3624-3648, 3625-36493626-36503627-3651 3628-36523629-3653 3630-36543631-3655, 3632-36563633-36573634-3658 3635-36593636-36603637-3661 3638-3662, 3639-3663 3640-36643641-3665 3642-36663643-36673644-3668 3645-3669, 3646-3670, 3647-3671 3648-36723649-3673 3650-3674, 3651-3675 3652-3676, 3653-36773654-3678 3655-36793656-36803657-3681 3658-36823659-3683, 3660-36843661-3685 3662-36863663-3687 3664-36883665-36893666-3690, 3667-3691 3668-3692, 3669-3693 3670-36943671-3695 3672-36963673-3697, 3674-36983675-36993676-3700, 3677-3701 3678-37023679-3703 3680-3704, 3681-37053682-37063683-3707.3684-37083685-37093686-3710, 3687-3711, 3688-37123689-3713 3690-37143691-3715 3692-37163693-37173694-3718, 3695-37193696-37203697-3721 3698-37223699-3723 3700-37243701-3725, 3702-37263703-37273704-3728 3705-3729, 3706-3730, 3707-3731 3708-3732, 3709-3733 3710-3734, 3711-3735 3712-3736, 3713-37373714-3738 3715-3739, 3716-3740 3717-3741 3718-3742 3719-3743, 3720-37443721-3745 3722-3746, 3723-3747 3724-3748 3725-3749 3726-3750, 3727-3751 3728-37523729-3753, 3730-3754 3731-3755 3732-37563733-3757, 3734-3758 3735-37593736-3760, 3737-3761 3738-3762 3739-3763 3740-3764, 3741-3765 3742-37663743-3767, 3744-3768 3745-37693746-3770, 3747-3771, 3748-37723749-3773 3750-3774, 3751-3775 3752-37763753-37773754-3778, 3755-37793756-37803757-3781, 3758-3782 3759-3783 3760-3784, 3761-3785, 3762-3786, 3763-37873764-3788, 3765-3789 3766-3790 3767-3791 3768-3792, 3769-3793 3770-37943771-3795, 3772-3796 3773-37973774-3798 3775-3799, 3776-3800, 3777-3801 3778-3802, 3779-3803 3780-38043781-3805 3782-3806, 3783-3807, 3784-38083785-3809, 3786-3810 3787-3811 3788-3812 3789-3813, 3790-38143791-3815 3792-3816, 3793-3817 3794-3818 3795-3819 3796-3820, 3797-3821 3798-38223799-3823, 3800-3824 3801-3825 3802-3826 3803-3827, 3804-3828 3805-38293806-3830, 3807-3831 3808-3832 3809-3833 3810-3834, 3811-3835 3812-38363813-3837, 3814-3838 3815-38393816-38403817-3841, 3818-38423819-3843 3820-3844, 3821-3845 3822-38463823-3847 3824-3848, 3825-3849, 3826-38503827-3851, 3828-3852 3829-3853 3830-38543831-3855, 3832-38563833-38573834-3858, 3835-3859 3836-3860, 3837-3861 3838-3862, 3839-3863 3840-3864, 3841-3865, 3842-3866 3843-38673844-3868 3845-3869, 3846-38703847-3871 3848-3872, 3849-3873 3850-3874, 3851-3875 3852-3876, 3853-3877, 3854-3878 3855-3879, 3856-3880 3857-3881 3858-3882 3859-3883, 3860-38843861-3885 3862-3886, 3863-3887 3864-3888 3865-38893866-3890, 3867-3891 3868-38923869-3893, 3870-3894 3871-3895 3872-38963873-3897, 3874-3898 3875-38993876-3900, 3877-3901 3878-3902 3879-3903 3880-3904, 3881-3905 3882-39063883-3907, 3884-3908 3885-39093886-39103887-3911, 3888-39123889-3913 3890-3914, 3891-3915 3892-39163893-3917 3894-3918, 3895-39193896-39203897-3921, 3898-3922 3899-3923 3900-39243901-3925, 3902-39263903-3927 3904-3928, 3905-3929 3906-39303907-3931 3908-3932, 3909-3933 3910-39343911-3935, 3912-3936 3913-39373914-3938 3915-3939, 3916-39403917-3941 3918-3942, 3919-3943 3920-39443921-3945 3922-3946, 3923-39473924-3948 3925-3949, 3926-3950 3927-3951 3928-39523929-3953, 3930-3954, 3931-3955 3932-3956, 3933-3957 3934-3958 3935-39593936-3960, 3937-3961 3938-39623939-3963, 3940-3964, 3941-3965, 3942-3966, 3943-3967, 3944-3968, 3945-3969, 3946-3970, 3947-3971, 3948-3972, 3949-3973, 3950-3974, 3951-3975, 3952-3976, 3953-3977, 3954-3978, 3955-3979, 3956-3980, 3957-3981, 3958-3982, 3959-3983, 3960-3984, 3961-3985, 3962-3986, 3963-3987, 3964-3988, 3965-3989, 3966-3990, 3967-3991, 3968-3992, 3969-3993, 3970-3994, 3971-3995, 3972-3996, 3973-3997, 3974-3998, 3975-3999, 3976-4000, 3977-4001, 3978-4002, 3979-4003, 3980-4004, 3981-4005, 3982-4006, 3983-4007, 3984-4008, 3985-4009, 3986-4010, 3987-4011, 3988-4012, 3989-4013, 3990-4014, 3991-4015, 3992-4016, 3993-4017, 3994-4018, 3995-4019, 3996-4020, 3997-4021, 3998-4022, 3999-4023, 4000-4024, 4001-4025, 4002-4026 ofSEQ DD NO:2, or the foregoing fragments and the following fragments: nucleotides 4003-4027, 4004-4028, 4005-4029, 4006-4030, 4007-4031, 4008-4032, 4009-4033, 4010-4034, 4011-4035, 4012-4036, 4013-4037, 4014-4038, 4015-4039, 4016-4040, 4017-4041, 4018-4042, 4019-4043, 4020-4044, 4021-4045, 4022-4046, 4023-4047, 4024-4048, 4025-4049, 4026-4050, 4027-4051, 4028-4052, 4029-4053, 4030-4054, 4031-4055, 4032-4056, 4033-4057, 4034-4058, 4035-4059, 4036-4060, 4037-4061, 4038-4062, 4039-4063, 4040-4064, 4041-4065, 4042-4066, 4043-4067, 4044-4068, 4045-4069, 4046-4070, 4047-4071, 4048-4072, 4049-4073, 4050-4074, 4051-4075, 4052-4076, 4053-4077, 4054-4078, 4055-4079, 4056-4080, 4057-4081, 4058-4082, 4059-4083, 4060-4084, 4061-4085, 4062-4086, 4063-4087, 4064-4088, 4065-4089, 4066-4090, 4067-4091, 4068-4092, 4069-4093, 4070-4094, 4071-4095, 4072-4096, 4073-4097, 4074-4098, 4075-4099, 4076-4100, 4077-4101, 4078-4102, 4079-4103, 4080-4104, 4081-4105, 4082-4106, 4083-4107, 4084-4108, 4085-4109, 4086-4110, 4087-4111, 4088-4112, 4089-4113, 4090-4114, 4091-4115, 4092-4116, 4093-4117, 4094-4118, 4095-4119, 4096-4120, 4097-4121, 4098-4122, 4099-4123, 4100-4124, 4101-4125, 4102-4126, 4103-4127, 4104-4128, 4105-4129, 4106-4130, 4107-4131, 4108-4132, 4109-4133, 4110-4134, 4111-4135, 4112-4136, 4113-4137, 4114-4138, 4115-4139, 4116-4140, 4117-4141, 4118-4142, 4119-4143, 4120-4144, 4121-4145, 4122-4146, 4123-4147, 4124-4148, 4125-4149, 4126-4150, 4127-4151, 4128-4152, 4129-4153, 4130-4154, 4131-4155, 4132-4156, 4133-4157, 4134-4158, 4135-4159, 4136-4160, 4137-4161, 4138-4162, 4139-4163, 4140-4164, 4141-4165, 4142-4166, 4143-4167, 4144-4168, 4145-4169, 4146-4170, 4147-4171, 4148-4172, 4149-4173, 4150-4174, 4151-4175, 4152-4176, 4153-4177, 4154-4178, 4155-4179, 4156-4180, 4157-4181, 4158-4182, or 4159-4183 ofSEQ DD NO:1. In other specific embodiments, the present invention encompasses nucleic acid molecules comprising a nucleotide sequence which corresponds to a fragment of the nucleotide sequence of SEQ DD NO:l or SEQ DD NO:2, wherein the fragment comprises at least 50 contiguous nucleotides of SEQ DD NO:l or SEQ DD NO:2. Accordingly, the present invention encompasses nucleic acids having nucleotide sequences of the following fragments of SEQ DD NO:l or SEQ DD NO:2: nucleotides 1-50, 2-51, 3-52, 4-53, 5-54, 6-55, 7-56, 8-57, 9-58, 10-59, 11-60, 12-61, 13-62, 14-63, 15-64, 16-65, 17-66, 18-67, 19-68, 20-69, 21-70, 22-71, 23-72, 24-73, 25-74, 26-75, 27-76, 28-77, 29-78, 30-79, 31-80, 32-81, 33-82, 34-83, 35-84, 36-85, 37-86, 38-87, 39-88, 40-89, 41-90, 42-91, 43-92, 44-93, 45-94, 46-95, 47-96, 48-97, 49-98, 50-99, 51-100, 52-101, 53-102, 54-103, 55-104, 56-105, 57-106, 58-107, 59-108, 60-109, 61-110, 62-111, 63-112, 64-113, 65-114, 66-115, 67-116, 68-117, 69-118, 70-119, 71-120, 72-121, 73-122, 74-123, 75-124, 76-125, 77-126, 78-127, 79-128, 80-129, 81-130, 82-131, 83-132, 84-133, 85-134, 86-135, 87-136, 88-137, 89-138, 90-139, 91-140, 92-141, 93-142, 94-143, 95-144, 96-145, 97-146, 98-147, 99-148, 100-149, 101-150, 102-151, 103-152, 104-153, 105-154, 106-155, 107-156, 108-157, 109-158,

110-159 111-160, 112-161, 113-162 114-163 115-164 116-165 ,117-166 118-167, 119-168 120-169 121-170, 122-171 123-172124-173 125-174, 126-175 127-176, 128-177 129-178 130-179, 131-180, 132-181 133-182134-183, 135-184 136-185, 137-186 138-187139-188, 140-189, 141-190 142-191 143-192, 144-193 145-194, 146-195 147-196 148-197, 149-198 150-199 151-200 152-201, 153-202 154-203, 155-204 156-205 157-206, 158-207 159-208 160-209 161-210,,162-211 163-212, 164-213 165-214166-215, 167-216, 168-217169-218 170-219, 171-220 172-221, 173-222 174-223 175-224, 176-225 177-226 178-227 179-228, 180-229 181-230, 182-231 183-232 184-233, 185-234, 186-235 187-236 188-237, 189-238 190-239, 191-240, 192-241 193-242, 194-243 195-244 196-245 197-246,, 198-247 199-248, 200-249 201-250202-251, 203-252204-253 205-254206-255, 207-256208-257, 209-258 210-259211-260, 212-261 213-262214-263215-264, 216-265 217-266, 218-267 219-268220-269, 221-270, 222-271 223-272224-273, 225-274226-275, 227-276, 228-277229-278, 230-279, 231-280232-281 233-282, 234-283 235-284, 236-285 237-286238-287, 239-288240-289241-290, 242-291, 243-292244-293, 245-294, 246-295247-296, 248-297249-298250-299251-300,, 252-301 253-302, 254-303 255-304256-305, 257-306258-307259-308260-309,261-310262-311, 263-312 264-313265-314, 266-315267-316268-317269-318,270-319271-320, 272-321 273-322274-323, 275-324276-325 277-326278-327, 279-328280-329, 281-330, 282-331 283-332, 284■333, 285-334, 286-335 287-336 288-337, 289-338, 290-339 291-340, 292-341, 293 ■342, 294-343 295-344 296-345 297-346, 298-347, 299-348 300-349 301-350, 302■351,303-352 304-353 305-354306-355, 307-356, 308-357 309-358 310-359,311 ^■360,312-361 313-362 314-363 315-364,316-365, 317-366 318-367 319-368,320 ^■369, 321-370, 322-371 323-372 324-373, 325-374, 326-375 327-376, 328-377, 329^■378, 330-379, 331-380 332-381 333-382, 334-383, 335-384, 336-385 337-386, 338 ^■387, 339-388 340-389 341-390 342-391,343-392, 344-393 345-394, 346-395, 347^■396, 348-397349-398 350-399351-400,352-401, 353-402 354-403 355-404, 356 ^■405, 357-406, 358-407 359-408 360-409, 361-410, 362-411 363-412 364-413,365 ^■414, 366-415 367-416 368-417369-418,370-419, 371-420, 372-421 373-422, 374^■423, 375-424, 376-425 377-426 378-427, 379-428, 380-429 381-430, 382-431,383 ^■432, 384-433 385-434386-435 387-436, 388-437, 389-438 390-439 391-440, 392^■441, 393-442, 394-443 395-444 396-445, 397-446, 398-447 399-448 400-449, 401 ^■450,402-451 403-452 404-453 405-454, 406-455, 407-456 408-457 409-458, 410 ^■459,411-460, 412-461 413-462 414-463,415-464, 416-465 417-466 418-467,419 ^■468, 420-469 421-470 422-471 423-472, 424-473, 425-474, 426-475 427-476, 428 ^■477, 429-478 430-479 431-480 432-481,433-482, 434-483 435-484, 436-485, 437 ^■486, 438-487 439-488 440-489 441-490,442-491, 443-492 444-493 445-494, 446495, 447-496 448-497 449-498 450-499,451-500, 452-501 453-502 454-503, 455 •504, 456-505 457-506 458-507 459-508, 460-509, 461-510, 462-511 463-512,464•513,465-514, 466-515 467-516 468-517,469-518, 470-519 471-520 472-521, 473 ^■522, 474-523 475-524 476-525 477-526, 478-527, 479-528 480-529 481-530,482 ■531,483-532 484-533 485-534486-535, 487-536, 488-537489-538 490-539, 491 ■540, 492-541 493-542 494-543 495-544, 496-545, 497-546 498-547 499-548, 500 ^■549, 501-550, 502-551 503-552 504-553, 505-554, 506-555 507-556 508-557, 509^■558, 510-559 511-560 512-561 513-562,514-563, 515-564516-565 517-566,518 •567,519-568 520-569 521-570 522-571, 523-572, 524-573 525-574526-575, 527 ^■576, 528-577 529-578 530-579 531-580, 532-581, 533-582 534-583 535-584, 536 ^■585, 537-586 538-587, 539-588 540-589, 541-590, 542-591 543-592 544-593, 545 •594, 546-595 547-596 548-597 549-598, 550-599, 551-600, 552-601 553-602, 554 •603, 555-604556-605 557-606 558-607, 559-608, 560-609 561-610 562-611,563 •612, 564-613 565-614 566-615 567-616, 568-617, 569-618 570-619 571-620, 572 ^■621, 573-622, 574-623 575-624 576-625, 577-626, 578-627 579-628 580-629, 581630, 582-631 583-632 584-633 585-634, 586-635, 587-636, 588-637 589-638 590-639 591-640, 592-641 593-642 594-643 595-644, 596-645, 597-646598-647 599-648 600-649601-650602-651 603-652604-653, 605-654, 606-655 607-656 608-657 609-658610-659611-660, 612-661 613-662, 614-663,615-664616-665 617-666 618-667, 619-668 620-669621-670622-671, 623-672, 624-673 625-674, 626-675 627-676, 628-677629-678 630-679631-680, 632-681, 633-682 634-683 635-684 636-685 637-686, 638-687 639-688 640-689, 641-690, 642-691 643-692 644-693 645-694646-695 647-696648-697649-698, 650-699,651-700652-701 653-702 654-703 655-704, 656-705 657-706658-707, 659-708, 660-709661-710, 662-711 663-712664-713 665-714666-715 667-716, 668-717,669-718 670-719 671-720 672-721 673-722674-723 675-724676-725, 677-726, 678-727 679-728 680-729 681-730, 682-731 683-732 684-733 685-734, 686-735, 687-736688-737 689-738 690-739691-740, 692-741 693-742694-743, 695-744, 696-745 697-746 698-747 699-748 700-749701-750702-751 703-752, 704-753, 705-754706-755 707-756 708-757, 709-758 710-759711-760712-761, 713-762, 714-763 715-764, 716-765 717-766, 718-767, 719-768 720-769721-770, 722-771, 723-772 724-773 725-774 726-775 727-776, 728-777, 729-778730-779, 731-780, 732-781 733-782 734-783 735-784736-785 737-786 738-787739-788, 740-789, 741-790742-791 743-792 744-793 745-794, 746-795 747-796748-797, 749-798, 750-799751-800, 752-801 753-802 754-803 755-804756-805 757-806, 758-807, 759-808 760-809, 761-810762-811 763-812764-813 765-814766-815, 767-816, 768-817 769-818 770-819 771-820, 772-821 773-822774-823 775-824, 776-825, 777-826 778-827 779-828 780-829 781-830, 782-831 783-832784-833, 785-834, 786-835 787-836 788-837 789-838 790-839, 791-840792-841 793-842, 794-843, 795-844796-845 797-846 798-847 799-848 800-849 801-850802-851, 803-852, 804-853 805-854 806-855 807-856, 808-857, 809-858 810-859811-860, 812-861, 813-862 814-863 815-864, 816-865 817-866, 818-867 819-868 820-869, 821-870,, 822-871 823-872 824-873 825-874826-875 827-876 828-877 829-878, 830-879,831-880 832-881 833-882 834-883 835-884, 836-885 837-886838-887, 839-888, 840-889 841-890, 842-891 843-892 844-893 845-894 846-895 847-896, 848-897, 849-898 850-899 851-900, 852-901 853-902854-903 855-904856-905, 857-906, 858-907 859-908 860-909 861-910, 862-911 863-912 864-913 865-914, 866-915, 867-916 868-917 869-918 870-919871-920872-921 873-922 874-923, 875-924, 876-925 877-926 878-927 879-928 880-929881-930 882-931 883-932, 884-933, 885-934886-935 887-936 888-937 889-938 890-939 891-940892-941, 893-942, 894-943, 895-944, 896-945, 897-946, 898-947, 899-948, 900-949, 901-950, 902-951, 903-952, 904-953, 905-954, 906-955, 907-956, 908-957, 909-958, 910-959, 911-960, 912-961, 913-962, 914-963, 915-964, 916-965, 917-966, 918-967, 919-968, 920-969, 921-970, 922-971, 923-972, 924-973, 925-974, 926-975, 927-976, 928-977, 929-978, 930-979, 931-980, 932-981, 933-982, 934-983, 935-984, 936-985, 937-986, 938-987, 939-988, 940-989, 941-990, 942-991, 943-992, 944-993, 945-994, 946-995, 947-996, 948-997, 949-998, 950-999, 951-1000, 952-1001, 953-1002, 954-1003, 955-1004, 956-1005, 957-1006, 958-1007, 959-1008, 960-1009, 961-1010, 962-1011, 963-1012, 964-1013, 965-1014, 966-1015, 967-1016, 968-1017, 969-1018, 970-1019, 971-1020, 972-1021, 973-1022, 974-1023, 975-1024, 976-1025, 977-1026, 978-1027, 979-1028, 980-1029, 981-1030, 982-1031, 983-1032, 984-1033, 985-1034, 986-1035, 987-1036, 988-1037, 989-1038, 990-1039, 991-1040, 992-1041, 993-1042, 994-1043, 995-1044, 996-1045, 997-1046, 998-1047, 999-1048, 1000-1049, 1001-1050, 1002-1051, 1003-1052, 1004-1053, 1005-1054, 1006-1055, 1007-1056, 1008-1057, 1009-1058, 1010-1059,

1011-1060, 1012-1061 1013-1062 1014-1063 1015-1064, 1016-1065 1017-1066, 1018-1067 1019-1068 1020-1069 1021-1070 1022-1071 1023-1072 1024-1073, 1025-10741026-1075 1027-1076 1028-1077 1029-1078 1030-1079 1031-1080, 1032-1081 1033-10821034-1083 1035-10841036-1085 1037-1086 1038-1087, 1039-1088 1040-10891041-1090 1042-1091 1043-1092 1044-1093 1045-1094, 1046-1095 1047-1096 1048-10971049-1098 1050-1099 1051-1100 1052-1101, 1053-11021054-1103 1055-11041056-1105 1057-1106 1058-1107 1059-1108, 1060-11091061-1110 1062-1111 1063-1112 1064-1113 1065-11141066-1115, 1067-11161068-11171069-1118 1070-11191071-1120, 1072-1121 1073-1122, 1074-1123 1075-1124 1076-1125 1077-1126 1078-1127 1079-1128 1080-1129, 1081-11301082-1131 1083-11321084-1133 1085-1134, 1086-1135 1087-1136, 1088-11371089-1138 1090-1139 1091-1140 1092-1141 1093-1142 1094-1143, 1095-11441096-1145 1097-11461098-1147 1099-1148 1100-1149 1101-1150, 1102-1151 1103-11521104-1153 1105-11541106-1155 1107-1156 1108-1157, 1109-1158 1110-11591111-1160 1112-1161 1113-11621114-1163 1115-1164, 1116-1165 1117-11661118-11671119-1168 1120-1169 1121-1170 1122-1171, 1123-11721124-1173 1125-11741126-1175 1127-1176 1128-1177 1129-1178, 1130-11791131-1180 1132-1181 1133-1182 1134-1183 1135-1184 1136-1185, 1137-1186, 1138-1187, 1139-1188 1140-1189 1141-1190 1142-1191 1143-1192, 1144-1193 1145-11941146-1195 1147-1196 1148-1197 1149-1198 1150-1199, 1151-12001152-1201 1153-12021154-1203 1155-12041156-1205 1157-1206, 1158-1207 1159-1208 1160-1209, 1161-1210 1162-1211 1163-1212 1164-1213, 1165-1214 1166-1215 1167-1216, 1168-12171169-1218 1170-1219, 1171-1220, 1172-1221 1173-12221174-1223 1175-12241176-1225 1177-1226 1178-1227, 1179-1228 1180-12291181-1230, 1182-1231 1183-12321184-1233 1185-1234, 1186-1235 1187-12361188-1237, 1189-1238 1190-12391191-1240, 1192-1241, 1193-1242 1194-1243 1195-12441196-1245 1197-1246 1198-1247 1199-1248, 1200-1249 1201-1250 1202-1251 1203-12521204-1253 1205-12541206-1255, 1207-1256 1208-1257 1209-1258 1210-1259 1211-1260, 1212-1261 1213-1262, 1214-1263 1215-12641216-1265 1217-1266 1218-1267 1219-1268 1220-1269, 1221-1270 1222-1271 1223-12721224-1273 1225-1274, 1226-1275 1227-1276, 1228-1277 1229-1278 1230-12791231-1280, 1232-1281 1233-1282 1234-1283, 1235-1284 1236-1285 1237-12861238-12871239-1288 1240-12891241-1290, 1242-1291 1243-1292 1244-1293 1245-12941246-1295 1247-1296 1248-1297, 1249-1298 1250-1299 1251-1300 1252-1301 1253-1302 1254-1303 1255-1304, 1256-1305 1257-1306 1258-13071259-1308 1260-1309 1261-1310 1262-1311, 1263-1312 1264-1313 1265-13141266-1315 1267-1316 1268-13171269-1318, 1270-1319, 1271-1320, 1272-1321 1273-13221274-1323 1275-13241276-1325, 1277-1326 1278-13271279-1328 1280-1329 1281-1330, 1282-1331 1283-1332, 1284-1333 1285-1334, 1286-1335 1287-1336 1288-1337 1289-1338 1290-1339, 1291-1340 1292-1341 1293-13421294-1343 1295-1344 1296-1345 1297-1346, 1298-1347, 1299-1348 1300-13491301-1350, 1302-1351 1303-13521304-1353, 1305-1354 1306-1355 1307-13561308-13571309-1358 1310-13591311-1360, 1312-1361 1313-13621314-1363 1315-13641316-1365 1317-1366 1318-1367, 1319-1368 1320-13691321-1370 1322-1371 1323-13721324-1373 1325-1374, 1326-1375 1327-1376 1328-1377 1329-1378 1330-13791331-1380 1332-1381, 1333-1382 1334-1383 1335-13841336-1385 1337-13861338-1387 1339-1388, 1340-1389 1341-1390 1342-1391 1343-1392 1344-1393 1345-1394, 1346-1395, 1347-1396 1348-13971349-1398 1350-13991351-1400 1352-1401 1353-1402, 1354-1403 1355-14041356-1405 1357-1406, 1358-1407 1359-1408 1360-1409, 1361-1410 1362-1411 1363-14121364-1413 1365-14141366-1415 1367-1416, 1368-1417 1369-1418 1370-1419, 1371-1420 1372-1421 1373-1422 1374-1423, 1375-1424, 1376-1425 1377-1426, 1378-1427 1379-1428 1380-1429 1381-1430, 1382-1431 1383-1432 1384-1433 1385-1434, 1386-1435 1387-14361388-1437, 1389-1438 1390-1439, 1391-1440, 1392-1441 1393-1442 1394-1443 1395-1444, 1396-1445 1397-1446, 1398-1447 1399-1448 1400-1449 1401-1450, 1402-1451, 1403-14521404-1453 1405-1454 1406-1455 1407-1456 1408-1457 1409-1458, 1410-1459 1411-1460 1412-1461 1413-1462 1414-1463 1415-1464, 1416-1465, 1417-1466 1418-1467 1419-1468 1420-1469 1421-1470, 1422-1471 1423-1472, 1424-1473 1425-1474 1426-1475 1427-1476 1428-1477 1429-1478 1430-1479, 1431-1480 1432-1481 1433-1482 1434-1483 1435-1484, 1436-1485 1437-1486, 1438-14871439-1488 1440-1489 1441-1490, 1442-1491 1443-1492 1444-1493, 1445-14941446-1495 1447-1496, 1448-1497 1449-1498 1450-14991451-1500, 1452-1501 1453-1502 1454-1503 1455-1504, 1456-1505 1457-1506 1458-1507, 1459-1508 1460-1509 1461-1510, 1462-1511 1463-1512, 1464-1513 1465-1514, 1466-1515 1467-1516 1468-1517 1469-1518 1470-1519 1471-1520 1472-1521, 1473-15221474-1523 1475-1524 1476-1525 1477-1526 1478-1527 1479-1528, 1480-15291481-1530 1482-1531 1483-1532 1484-1533 1485-15341486-1535, 1487-15361488-1537 1489-1538 1490-1539 1491-1540 1492-1541 1493-1542, 1494-1543 1495-1544, 1496-1545 1497-1546 1498-1547 1499-1548 1500-1549, 1501-1550, 1502-1551 1503-1552 1504-1553 1505-1554 1506-1555 1507-1556, 1508-15571509-1558 1510-1559 1511-1560 1512-1561 1513-1562 1514-1563, 1515-15641516-1565 1517-1566 1518-1567 1519-1568 1520-1569 1521-1570, 1522-1571 1523-1572 1524-1573 1525-1574 1526-1575 1527-1576 1528-1577, 1529-1578 1530-1579 1531-1580 1532-1581 1533-1582 1534-1583 1535-1584, 1536-1585 1537-1586 1538-1587 1539-1588 1540-1589 1541-1590 1542-1591, 1543-15921544-1593 1545-1594 1546-1595 1547-1596 1548-1597 1549-1598, 1550-15991551-1600, 1552-1601 1553-1602 1554-1603 1555-1604 1556-1605, 1557-1606 1558-1607 1559-1608 1560-1609 1561-1610, 1562-1611 1563-1612, 1564-1613 1565-1614, 1566-1615 1567-1616 1568-1617 1569-1618 1570-1619, 1571-1620 1572-1621 1573-1622 1574-1623 1575-1624 1576-1625 1577-1626, 1578-16271579-1628 1580-1629 1581-1630, 1582-1631 1583-1632 1584-1633, 1585-16341586-1635 1587-1636 1588-1637 1589-1638 1590-1639, 1591-1640, 1592-1641 1593-1642 1594-1643 1595-1644, 1596-1645 1597-1646 1598-1647, 1599-1648 1600-1649 1601-1650, 1602-1651 1603-1652 1604-1653 1605-1654, 1606-1655 1607-1656 1608-1657 1609-1658 1610-1659 1611-1660, 1612-1661, 1613-16621614-1663 1615-1664 1616-1665 1617-1666 1618-1667 1619-1668, 1620-16691621-1670 1622-1671 1623-1672 1624-1673 1625-16741626-1675, 1627-1676 1628-1677 1629-1678 1630-1679 1631-1680, 1632-1681 1633-1682, 1634-1683 1635-1684 1636-1685 1637-1686 1638-1687 1639-1688 1640-1689, 1641-1690, 1642-1691 1643-1692 1644-1693 1645-1694 1646-1695 1647-1696, 1648-1697 1649-1698 1650-16991651-1700, 1652-1701 1653-1702 1654-1703, 1655-1704, 1656-1705 1657-1706 1658-1707 1659-1708 1660-1709, 1661-1710, 1662-1711 1663-1712 1664-1713 1665-1714, 1666-1715 1667-1716 1668-1717, 1669-1718 1670-1719 1671-1720, 1672-1721 1673-1722 1674-1723 1675-1724, 1676-1725 1677-1726 1678-1727 1679-1728 1680-1729 1681-1730, 1682-1731, 1683-1732, 1684-1733 1685-17341686-1735 1687-1736 1688-17371689-1738, 1690-1739, 1691-1740 1692-1741 1693-1742 1694-1743 1695-17441696-1745, 1697-1746, 1698-1747 1699-1748 1700-1749 1701-1750 1702-1751 1703-1752, 1704-1753 1705-17541706-1755 1707-1756 1708-1757 1709-1758 1710-1759, 1711-1760, 1712-1761 1713-1762 1714-1763 1715-17641716-1765 1717-1766, 1718-1767, 1719-1768 1720-1769 1721-1770 1722-1771 1723-17721724-1773, 1725-1774, 1726-1775 1727-1776 1728-17771729-1778 1730-17791731-1780, 1732-1781 1733-17821734-1783 1735-17841736-1785 1737-1786 1738-1787, 1739-1788 1740-1789 1741-1790 1742-1791 1743-1792 1744-1793 1745-1794, 1746-1795 1747-1796 1748-17971749-1798 1750-1799 1751-1800 1752-1801, 1753-1802 1754-1803 1755-1804, 1756-1805 1757-1806 1758-1807 1759-1808, 1760-1809, 1761-1810 1762-1811 1763-18121764-1813 1765-18141766-1815, 1767-1816, 1768-18171769-1818 1770-18191771-1820 1772-1821 1773-1822, 1774-1823 1775-1824 1776-1825 1777-1826 1778-18271779-1828 1780-1829, 1781-1830, 1782-1831 1783-18321784-1833 1785-18341786-1835 1787-1836, 1788-18371789-1838 1790-18391791-1840 1792-1841 1793-1842 1794-1843, 1795-18441796-1845 1797-1846 1798-18471799-1848 1800-18491801-1850, 1802-1851 1803-18521804-1853 1805-18541806-1855 1807-1856 1808-1857, 1809-1858 1810-1859 1811-1860 1812-1861 1813-1862 1814-1863 1815-1864, 1816-1865 1817-18661818-1867 1819-1868 1820-1869 1821-1870 1822-1871, 1823-18721824-1873 1825-18741826-1875 1827-1876 1828-1877 1829-1878, 1830-18791831-1880, 1832-1881 1833-18821834-1883 1835-18841836-1885, 1837-1886 1838-1887, 1839-1888 1840-18891841-1890 1842-1891 1843-1892, 1844-1893 1845-18941846-1895 1847-1896 1848-1897 1849-1898 1850-1899, 1851-1900 1852-1901 1853-1902 1854-1903 1855-19041856-1905 1857-1906, 1858-1907 1859-1908 1860-19091861-1910 1862-1911 1863-1912 1864-1913, 1865-1914 1866-1915 1867-19161868-19171869-1918 1870-1919, 1871-1920,

1872-1921 1873-1922 1874-1923 1875-19241876-1925 1877-1926 1878-1927,

1879-1928 1880-1929 1881-1930 1882-1931 1883-19321884-1933 1885-1934,

1886-1935 1887-1936 1888-1937 1889-1938 1890-19391891-1940, 1892-1941,

1893-1942 1894-1943 1895-1944, 1896-1945 1897-1946 1898-1947, 1899-1948,

1900-1949 1901-1950 1902-1951 1903-1952 1904-1953 1905-19541906-1955,

1907-1956 1908-1957 1909-1958 1910-1959 1911-1960 1912-1961 1913-1962,

1914-1963 1915-1964 1916-1965 1917-1966 1918-1967 1919-1968 1920-1969,

1921-1970, 1922-1971 1923-1972 1924-1973 1925-1974, 1926-1975 1927-1976,

1928-1977 1929-1978 1930-1979, 1931-1980, 1932-1981 1933-19821934-1983,

1935-19841936-1985 1937-1986 1938-1987 1939-1988 1940-19891941-1990,

1942-1991 1943-1992 1944-1993 1945-19941946-1995 1947-1996 1948-1997,

1949-1998 1950-1999 1951-2000 1952-2001 1953-2002 1954-2003 1955-2004,

1956-2005 1957-2006 1958-2007 1959-2008 1960-2009 1961-2010, 1962-2011,

1963-2012 1964-2013 1965-2014 1966-2015 1967-2016 1968-2017 1969-2018,

1970-20191971-2020, 1972-2021 1973-2022 1974-2023 1975-2024, 1976-2025,

1977-2026 1978-2027 1979-2028 1980-2029 1981-2030 1982-2031 1983-2032,

1984-2033 1985-2034 1986-2035 1987-2036 1988-2037 1989-2038 1990-2039,

1991-2040 1992-2041 1993-2042 1994-2043 1995-2044 1996-2045 1997-2046,

1998-2047 1999-2048 2000-2049 2001-2050, 2002-2051 2003-20522004-2053,

2005-2054, 2006-2055 2007-2056 2008-20572009-20582010-20592011-2060,

2012-2061 2013-2062 2014-2063 2015-20642016-2065 2017-2066, 2018-2067,

2019-20682020-2069 2021-2070 2022-2071 2023-2072 2024-2073 2025-2074,

2026-2075 2027-2076 2028-2077 2029-2078 2030-20792031-2080, 2032-2081,

2033-20822034-2083 2035-2084 2036-2085 2037-20862038-20872039-2088,

2040-20892041-2090 2042-2091 2043-20922044-2093 2045-2094, 2046-2095,

2047-20962048-2097 2049-2098 2050-2099, 2051-21002052-2101 2053-2102,

2054-2103 2055-2104 2056-2105 2057-21062058-2107 2059-21082060-2109,

2061-2110, 2062-2111 2063-2112 2064-2113 2065-21142066-2115 2067-2116,

2068-21172069-2118 2070-2119, 2071-21202072-2121 2073-21222074-2123,

2075-21242076-2125 2077-2126, 2078-21272079-21282080-2129, 2081-2130,

2082-2131 2083-2132 2084-2133 2085-2134, 2086-2135 2087-21362088-2137,

2089-21382090-2139 2091-2140, 2092-2141 2093-21422094-2143 2095-2144,

2096-2145 2097-2146 2098-2147 2099-21482100-21492101-2150, 2102-2151, 2103-21522104-21532105-21542106-21552107-21562108-21572109-2158, 2110-21592111-2160, 2112-2161 2113-21622114-2163 2115-2164, 2116-2165, 2117-21662118-21672119-21682120-21692121-2170, 2122-2171 2123-2172, 2124-21732125-2174, 2126-2175 2127-21762128-21772129-21782130-2179, 2131-21802132-2181 2133-21822134-2183 2135-2184, 2136-2185 2137-2186, 2138-21872139-21882140-21892141-21902142-2191 2143-21922144-2193, 2145-21942146-21952147-21962148-21972149-2198 2150-21992151-2200, 2152-2201 2153-22022154-22032155-22042156-2205 2157-22062158-2207, 2159-22082160-22092161-22102162-2211 2163-22122164-2213 2165-2214, 2166-22152167-22162168-22172169-22182170-2219, 2171-2220, 2172-2221, 2173-22222174-22232175-22242176-2225 2177-22262178-22272179-2228, 2180-22292181-2230, 2182-2231 2183-22322184-2233 2185-2234, 2186-2235, 2187-22362188-22372189-22382190-22392191-2240, 2192-2241 2193-2242, 2194-2243 2195-22442196-2245 2197-22462198-22472199-2248 2200-2249, 2201-22502202-2251 2203-22522204-22532205-22542206-2255 2207-2256, 2208-22572209-22582210-22592211-22602212-2261 2213-22622214-2263, 2215-22642216-22652217-22662218-22672219-22682220-22692221-2270, 2222-2271 2223-22722224-2273 2225-22742226-2275 2227-22762228-2277, 2229-22782230-22792231-2280, 2232-2281 2233-22822234-2283 2235-2284, 2236-22852237-22862238-22872239-22882240-22892241-2290, 2242-2291, 2243-22922244-2293 2245-22942246-2295 2247-22962248-22972249-2298, 2250-2299, 2251-2300, 2252-2301 2253-2302, 2254-2303 2255-2304, 2256-2305, 2257-23062258-23072259-23082260-2309, 2261-2310, 2262-2311 2263-2312, 2264-2313 2265-23142266-23152267-23162268-23172269-23182270-2319, 2271-23202272-2321 2273-23222274-2323 2275-23242276-23252277-2326, 2278-23272279-23282280-23292281-23302282-2331 2283-23322284-2333, 2285-23342286-23352287-23362288-23372289-23382290-23392291-2340, 2292-2341 2293-23422294-2343 2295-23442296-23452297-23462298-2347, 2299-2348 2300-23492301-2350, 2302-2351 2303-23522304-2353 2305-2354, 2306-2355 2307-23562308-23572309-23582310-23592311-2360, 2312-2361, 2313-23622314-23632315-23642316-23652317-23662318-23672319-2368, 2320-23692321-23702322-2371 2323-23722324-2373 2325-23742326-2375, 2327-23762328-23772329-23782330-23792331-2380, 2332-2381 2333-2382, 2334-2383 2335-23842336-2385 2337-23862338-23872339-23882340-2389, 2341-23902342-2391 2343-23922344-23932345-23942346-23952347-2396, 2348-23972349-23982350-23992351-2400, 2352-2401 2353-24022354-2403, 2355-2404, 2356-2405 2357-2406, 2358-2407, 2359-24082360-24092361-2410, 2362-2411 2363-24122364-2413 2365-2414, 2366-2415 2367-24162368-2417, 2369-24182370-24192371-24202372-2421 2373-24222374-2423 2375-2424, 2376-2425 2377-24262378-24272379-24282380-2429, 2381-2430, 2382-2431, 2383-24322384-2433 2385-24342386-24352387-24362388-24372389-2438, 2390-2439, 2391-24402392-2441 2393-24422394-2443 2395-2444, 2396-2445, 2397-24462398-24472399-24482400-2449, 2401-24502402-2451 2403-2452, 2404-2453 2405-24542406-2455 2407-24562408-24572409-24582410-2459, 2411-24602412-2461 2413-24622414-24632415-24642416-2465 2417-2466, 2418-24672419-2468 2420-24692421-24702422-2471 2423-24722424-2473, 2425-24742426-2475 2427-24762428-24772429-24782430-2479, 2431-2480, 2432-2481 2433-24822434-2483 2435-24842436-2485 2437-24862438-2487, 2439-24882440-24892441-24902442-2491 2443-24922444-2493 2445-2494, 2446-2495 2447-24962448-24972449-24982450-24992451-2500, 2452-2501, 2453-25022454-2503 2455-25042456-2505 2457-25062458-25072459-2508, 2460-25092461-2510, 2462-2511 2463-25122464-2513 2465-25142466-2515, 2467-25162468-25172469-2518 2470-25192471-25202472-2521 2473-2522, 2474-2523 2475-25242476-2525 2477-25262478-25272479-2528 2480-2529, 2481-25302482-2531 2483-25322484-2533 2485-25342486-2535 2487-2536, 2488-25372489-25382490-25392491-2540, 2492-2541 2493-2542, 2494-2543, 2495-25442496-2545 2497-25462498-2547, 2499-25482500-2549, 2501-2550, 2502-2551 2503-25522504-2553 2505-25542506-2555 2507-25562508-2557, 2509-25582510-25592511-2560, 2512-2561 2513-25622514-2563 2515-2564, 2516-25652517-2566, 2518-2567, 2519-2568, 2520-2569, 2521-2570, 2522-2571, 2523-25722524-2573 2525-2574, 2526-2575 2527-25762528-25772529-2578, 2530-25792531-25802532-2581 2533-25822534-2583 2535-2584, 2536-2585, 2537-25862538-25872539-2588 2540-2589, 2541-25902542-2591 2543-2592, 2544-2593 2545-25942546-2595 2547-25962548-25972549-25982550-2599, 2551-2600, 2552-2601 2553-26022554-2603 2555-26042556-2605 2557-2606, 2558-2607, 2559-26082560-26092561-26102562-2611 2563-26122564-2613, 2565-26142566-2615 2567-26162568-26172569-2618 2570-26192571-2620, 2572-2621 2573-26222574-2623 2575-26242576-2625 2577-26262578-2627, 2579-26282580-26292581-26302582-2631 2583-26322584-2633 2585-2634, 2586-2635 2587-26362588-2637 2589-2638 2590-2639, 2591-26402592-2641, 2593-26422594-2643 2595-2644, 2596-2645 2597-26462598-26472599-2648, 2600-26492601-2650, 2602-2651 2603-26522604-2653 2605-26542606-2655, 2607-26562608-26572609-2658 2610-26592611-2660, 2612-2661 2613-2662, 2614-26632615-26642616-2665 2617-26662618-26672619-26682620-2669, 2621-2670, 2622-2671 2623-2672 2624-2673 2625-2674, 2626-2675 2627-2676, 2628-26772629-26782630-2679 2631-2680, 2632-2681 2633-26822634-2683, 2635-26842636-2685 2637-2686, 2638-26872639-26882640-26892641-2690, 2642-2691 2643-26922644-2693 2645-26942646-2695 2647-26962648-2697, 2649-2698 2650-26992651-2700, 2652-2701 2653-27022654-2703 2655-2704, 2656-27052657-27062658-2707, 2659-27082660-27092661-27102662-2711, 2663-27122664-2713 2665-2714 2666-2715 2667-27162668-27172669-2718, 2670-27192671-27202672-2721 2673-27222674-2723 2675-27242676-2725, 2677-27262678-27272679-2728 2680-27292681-27302682-2731 2683-2732, 2684-2733 2685-27342686-2735 2687-27362688-27372689-2738 2690-2739, 2691-27402692-2741 2693-2742 2694-2743 2695-27442696-2745 2697-2746, 2698-27472699-27482700-2749 2701-2750, 2702-2751 2703-27522704-2753, 2705-27542706-2755 2707-2756 2708-27572709-27582710-2759, 2711-2760, 2712-2761 2713-27622714-2763 2715-27642716-2765 2717-27662718-2767, 2719-27682720-27692721-2770, 2722-2771 2723-27722724-2773 2725-2774, 2726-27752727-27762728-2777, 2729-27782730-27792731-2780, 2732-2781, 2733-27822734-2783 2735-2784, 2736-2785 2737-27862738-27872739-2788, 2740-2789, 2741-27902742-2791 2743-27922744-2793 2745-2794, 2746-2795, 2747-27962748-27972749-2798 2750-27992751-28002752-2801 2753-2802, 2754-2803 2755-28042756-2805 2757-28062758-2807, 2759-2808 2760-2809, 2761-2810, 2762-2811 2763-2812 2764-2813 2765-28142766-2815 2767-2816, 2768-28172769-2818 2770-2819 2771-28202772-2821 2773-28222774-2823, 2775-2824, 2776-2825 2777-2826, 2778-28272779-28282780-28292781-2830, 2782-2831 2783-28322784-2833 2785-28342786-2835 2787-28362788-2837, 2789-28382790-2839, 2791-2840, 2792-2841 2793-28422794-2843 2795-2844, 2796-28452797-28462798-2847 2799-28482800-2849, 2801-2850, 2802-2851, 2803-2852, 2804-2853 2805-2854 2806-28552807-28562808-28572809-2858, 2810-28592811-28602812-2861 2813-28622814-2863 2815-2864, 2816-2865, 2817-28662818-28672819-28682820-28692821-2870, 2822-2871 2823-2872, 2824-2873 2825-2874, 2826-28752827-28762828-28772829-28782830-2879, 2831-28802832-2881 2833-28822834-28832835-2884, 2836-28852837-2886, 2838-28872839-28882840-28892841-28902842-2891 2843-28922844-2893, 2845-28942846-2895 2847-28962848-28972849-28982850-2899, 2851-2900, 2852-2901 2853-29022854-29032855-29042856-29052857-2906, 2858-2907, 2859-29082860-2909, 2861-2910, 2862-2911 2863-29122864-29132865-2914, 2866-2915 2867-29162868-2917, 2869-29182870-29192871-2920, 2872-2921, 2873-29222874-2923 2875-2924, 2876-2925 2877-29262878-29272879-2928, 2880-29292881-2930, 2882-2931 2883-29322884-2933 2885-29342886-2935, 2887-29362888-2937, 2889-29382890-29392891-2940, 2892-2941 2893-2942, 2894-2943 2895-29442896-29452897-29462898-29472899-29482900-2949, 2901-29502902-2951 2903-29522904-2953 2905-2954, 2906-29552907-2956, 2908-29572909-29582910-29592911-29602912-2961 2913-29622914-2963, 2915-29642916-2965 2917-29662918-29672919-29682920-2969, 2921-2970, 2922-2971 2923-29722924-29732925-29742926-29752927-2976, 2928-2977, 2929-29782930-29792931-2980, 2932-2981 2933-29822934-2983 2935-2984, 2936-2985 2937-29862938-2987, 2939-29882940-29892941-2990, 2942-2991, 2943-29922944-2993 2945-2994, 2946-2995 2947-29962948-29972949-2998, 2950-29992951-30002952-3001 2953-30022954-30032955-30042956-3005, 2957-30062958-30072959-30082960-30092961-30102962-3011 2963-3012, 2964-3013 2965-30142966-30152967-30162968-30172969-30182970-3019, 2971-30202972-3021 2973-30222974-3023 2975-30242976-3025 2977-3026, 2978-30272979-30282980-30292981-30302982-3031 2983-30322984-3033, 2985-30342986-3035 2987-30362988-30372989-30382990-30392991-3040, 2992-3041 2993-30422994-30432995-30442996-3045 2997-30462998-3047, 2999-3048 3000-3049, 3001-3050, 3002-3051 3003-30523004-3053 3005-3054, 3006-3055 3007-30563008-30573009-3058 3010-30593011-30603012-3061, 3013-30623014-3063 3015-3064, 3016-3065 3017-30663018-30673019-3068, 3020-3069 3021-30703022-3071 3023-3072, 3024-3073 3025-30743026-3075, 3027-3076 3028-30773029-3078 3030-30793031-30803032-3081 3033-3082, 3034-3083 3035-3084, 3036-3085 3037-30863038-3087, 3039-3088 3040-3089, 3041-30903042-3091 3043-30923044-3093 3045-30943046-3095 3047-3096, 3048-3097 3049-30983050-30993051-31003052-3101 3053-31023054-3103, 3055-31043056-3105 3057-3106 3058-31073059-3108 3060-31093061-3110, 3062-3111 3063-31123064-3113 3065-31143066-3115 3067-3116, 3068-3117, 3069-31183070-31193071-31203072-3121 3073-31223074-3123 3075-3124, 3076-3125 3077-31263078-31273079-3128 3080-31293081-3130, 3082-3131, 3083-31323084-3133 3085-31343086-3135 3087-31363088-31373089-3138, 3090-31393091-31403092-3141 3093-3142 3094-3143 3095-31443096-3145, 3097-31463098-31473099-3148 3100-31493101-31503102-3151 3103-3152, 3104-3153 3105-31543106-3155 3107-31563108-31573109-3158 3110-3159, 3111-31603112-3161 3113-31623114-3163 3115-31643116-3165 3117-3166, 3118-31673119-3168 3120-31693121-31703122-3171 3123-3172 3124-3173, 3125-31743126-3175 3127-31763128-31773129-3178 3130-3179, 3131-3180, 3132-3181 3133-31823134-3183 3135-31843136-3185 3137-31863138-3187, 3139-3188 3140-31893141-3190, 3142-3191 3143-3192 3144-3193 3145-3194, 3146-3195 3147-31963148-31973149-3198 3150-31993151-3200, 3152-3201, 3153-32023154-3203 3155-3204, 3156-3205 3157-3206 3158-3207 3159-3208, 3160-32093161-32103162-3211 3163-32123164-3213 3165-32143166-3215, 3167-32163168-32173169-3218 3170-32193171-3220, 3172-3221 3173-3222, 3174-3223 3175-32243176-3225 3177-3226 3178-3227 3179-3228 3180-3229, 3181-3230, 3182-3231 3183-3232 3184-3233 3185-32343186-3235 3187-3236, 3188-3237 3189-3238 3190-32393191-3240, 3192-3241 3193-3242 3194-3243, 3195-32443196-3245 3197-32463198-3247 3199-3248 3200-3249 3201-3250, 3202-3251 3203-3252 3204-3253 3205-3254, 3206-3255 3207-32563208-3257, 3209-3258 3210-32593211-32603212-3261 3213-3262 3214-3263 3215-3264, 3216-3265 3217-32663218-3267 3219-3268 3220-3269, 3221-32703222-3271, 3223-3272 3224-3273 3225-3274, 3226-3275 3227-3276 3228-3277 3229-3278, 3230-3279 3231-32803232-3281 3233-3282 3234-3283 3235-32843236-3285, 3237-3286 3238-3287 3239-3288 3240-3289, 3241-3290 3242-3291 3243-3292, 3244-3293 3245-32943246-3295 3247-3296, 3248-3297 3249-3298 3250-3299, 3251-33003252-3301 3253-3302 3254-3303 3255-3304, 3256-3305 3257-3306, 3258-3307 3259-3308 3260-3309, 3261-3310, 3262-3311 3263-3312 3264-3313, 3265-3314, 3266-3315 3267-3316, 3268-3317 3269-3318 3270-3319 3271-3320, 3272-3321 3273-3322 3274-3323 3275-3324, 3276-3325 3277-3326 3278-3327, 3279-3328 3280-3329 3281-3330, 3282-3331 3283-3332 3284-3333 3285-3334, 3286-3335 3287-33363288-33373289-3338 3290-33393291-3340 3292-3341, 3293-33423294-3343 3295-33443296-3345 3297-33463298-33473299-3348, 3300-33493301-33503302-3351 3303-33523304-3353 3305-3354, 3306-3355, 3307-33563308-3357, 3309-33583310-33593311-3360, 3312-3361 3313-3362, 3314-33633315-33643316-3365 3317-33663318-33673319-33683320-3369, 3321-33703322-3371 3323-3372, 3324-3373 3325-33743326-3375 3327-3376, 3328-33773329-33783330-33793331-33803332-3381 3333-33823334-3383, 3335-33843336-3385 3337-33863338-33873339-33883340-33893341-3390, 3342-3391 3343-33923344-3393 3345-33943346-3395 3347-33963348-3397, 3349-33983350-33993351-34003352-3401 3353-34023354-3403 3355-3404, 3356-34053357-34063358-34073359-3408 3360-34093361-3410, 3362-3411, 3363-34123364-3413 3365-34143366-3415 3367-34163368-34173369-3418, 3370-3419, 3371-34203372-3421 3373-34223374-3423 3375-34243376-3425, 3377-3426, 3378-34273379-34283380-34293381-3430, 3382-3431 3383-3432, 3384-3433 3385-34343386-3435 3387-3436, 3388-34373389-3438 3390-3439, 3391-3440.3392-3441 3393-34423394-3443 3395-34443396-3445 3397-3446, 3398-34473399-3448 3400-34493401-34503402-3451 3403-34523404-3453, 3405-34543406-3455 3407-34563408-34573409-34583410-34593411-3460, 3412-3461 3413-34623414-3463 3415-3464, 3416-3465 3417-34663418-3467, 3419-34683420-34693421-34703422-3471 3423-34723424-3473 3425-3474, 3426-3475 3427-34763428-34773429-3478 3430-34793431-3480, 3432-3481, 3433-34823434-3483 3435-34843436-3485 3437-34863438-34873439-3488, 3440-3489, 3441-34903442-3491 3443-34923444-3493 3445-34943446-3495, 3447-34963448-34973449-3498 3450-34993451-3500, 3452-3501 3453-3502, 3454-3503 3455-35043456-3505 3457-35063458-35073459-35083460-3509, 3461-3510, 3462-3511 3463-35123464-3513 3465-35143466-3515 3467-3516, 3468-3517.3469-35183470-35193471-3520, 3472-3521 3473-3522, 3474-3523, 3475-35243476-3525 3477-35263478-35273479-35283480-35293481-3530, 3482-3531 3483-3532 3484-3533 3485-35343486-3535 3487-35363488-3537, 3489-35383490-35393491-35403492-3541 3493-35423494-3543 3495-3544, 3496-35453497-35463498-35473499-35483500-35493501-3550, 3502-3551, 3503-35523504-3553 3505-35543506-3555 3507-35563508-35573509-3558, 3510-35593511-35603512-3561 3513-35623514-3563 3515-3564, 3516-3565, 3517-35663518-3567, 3519-3568 3520-35693521-35703522-3571 3523-3572, 3524-3573 3525-35743526-3575 3527-35763528-35773529-35783530-3579, 3531-35803532-3581 3533-35823534-3583 3535-3584, 3536-3585 3537-3586, 3538-35873539-3588 3540-3589 3541-35903542-3591 3543-3592 3544-3593, 3545-35943546-3595 3547-3596, 3548-3597 3549-3598 3550-3599, 3551-3600, 3552-3601 3553-3602 3554-3603 3555-36043556-3605 3557-36063558-3607, 3559-36083560-3609, 3561-3610, 3562-3611 3563-3612 3564-3613 3565-3614, 3566-3615 3567-36163568-3617, 3569-3618 3570-36193571-36203572-3621, 3573-36223574-3623 3575-36243576-3625 3577-36263578-36273579-3628, 3580-36293581-3630, 3582-3631 3583-3632 3584-3633 3585-36343586-3635, 3587-36363588-3637, 3589-3638 3590-36393591-36403592-3641 3593-3642, 3594-3643 3595-36443596-3645 3597-36463598-36473599-3648 3600-3649, 3601-36503602-3651 3603-3652 3604-3653 3605-36543606-3655 3607-3656, 3608-36573609-36583610-3659, 3611-36603612-3661 3613-36623614-3663, 3615-36643616-3665 3617-36663618-36673619-3668 3620-36693621-3670, 3622-3671 3623-3672, 3624-3673 3625-3674, 3626-3675 3627-36763628-3677, 3629-36783630-3679, 3631-36803632-3681 3633-36823634-3683 3635-3684, 3636-3685 3637-36863638-36873639-3688 3640-36893641-36903642-3691, 3643-3692 3644-3693 3645-36943646-3695 3647-36963648-36973649-3698, 3650-36993651-37003652-3701 3653-37023654-3703 3655-37043656-3705, 3657-37063658-37073659-3708 3660-37093661-37103662-3711 3663-3712, 3664-3713 3665-37143666-3715 3667-37163668-37173669-37183670-3719, 3671-37203672-3721 3673-37223674-3723 3675-37243676-3725 3677-3726, 3678-37273679-37283680-3729, 3681-37303682-3731 3683-37323684-3733, 3685-37343686-3735 3687-37363688-37373689-3738 3690-37393691-3740, 3692-3741 3693-37423694-3743 3695-3744, 3696-3745 3697-37463698-3747, 3699-3748 3700-3749, 3701-37503702-3751 3703-37523704-3753 3705-3754, 3706-3755 3707-3756, 3708-3757, 3709-3758 3710-37593711-37603712-3761, 3713-3762 3714-3763 3715-37643716-3765 3717-37663718-37673719-3768, 3720-3769, 3721-37703722-3771 3723-37723724-3773 3725-37743726-3775, 3727-37763728-37773729-3778 3730-37793731-3780, 3732-3781 3733-3782, 3734-3783 3735-37843736-3785 3737-37863738-3787, 3739-3788 3740-3789, 3741-3790, 3742-3791 3743-37923744-3793 3745-3794, 3746-3795 3747-3796, 3748-3797 3749-3798 3750-37993751-38003752-3801 3753-38023754-3803, 3755-38043756-3805 3757-3806, 3758-38073759-3808 3760-38093761-3810, 3762-3811 3763-38123764-3813 3765-38143766-3815 3767-38163768-3817, 3769-3818, 3770-3819, 3771-3820, 3772-3821, 3773-3822, 3774-3823, 3775-3824, 3776-3825, 3777-3826, 3778-3827, 3779-3828, 3780-3829, 3781-3830, 3782-3831, 3783-3832, 3784-3833, 3785-3834, 3786-3835, 3787-3836, 3788-3837, 3789-3838, 3790-3839, 3791-3840, 3792-3841, 3793-3842, 3794-3843, 3795-3844, 3796-3845, 3797-3846, 3798-3847, 3799-3848, 3800-3849, 3801-3850, 3802-3851, 3803-3852, 3804-3853, 3805-3854, 3806-3855, 3807-3856, 3808-3857, 3809-3858, 3810-3859, 3811-3860, 3812-3861, 3813-3862, 3814-3863, 3815-3864, 3816-3865, 3817-3866, 3818-3867, 3819-3868, 3820-3869, 3821-3870, 3822-3871, 3823-3872, 3824-3873, 3825-3874, 3826-3875, 3827-3876, 3828-3877, 3829-3878, 3830-3879, 3831-3880, 3832-3881, 3833-3882, 3834-3883, 3835-3884, 3836-3885, 3837-3886, 3838-3887, 3839-3888, 3840-3889, 3841-3890, 3842-3891, 3843-3892, 3844-3893, 3845-3894, 3846-3895, 3847-3896, 3848-3897, 3849-3898, 3850-3899, 3851-3900, 3852-3901, 3853-3902, 3854-3903, 3855-3904, 3856-3905, 3857-3906, 3858-3907, 3859-3908, 3860-3909, 3861-3910, 3862-3911, 3863-3912, 3864-3913, 3865-3914, 3866-3915, 3867-3916, 3868-3917, 3869-3918, 3870-3919, 3871-3920, 3872-3921, 3873-3922, 3874-3923, 3875-3924, 3876-3925, 3877-3926, 3878-3927, 3879-3928, 3880-3929, 3881-3930, 3882-3931, 3883-3932, 3884-3933, 3885-3934, 3886-3935, 3887-3936, 3888-3937, 3889-3938, 3890-3939, 3891-3940, 3892-3941, 3893-3942, 3894-3943, 3895-3944, 3896-3945, 3897-3946, 3898-3947, 3899-3948, 3900-3949, 3901-3950, 3902-3951, 3903-3952, 3904-3953, 3905-3954, 3906-3955, 3907-3956, 3908-3957, 3909-3958, 3910-3959, 3911-3960, 3912-3961, 3913-3962, 3914-3963, 3915-3964, 3916-3965, 3917-3966, 3918-3967, 3919-3968, 3920-3969, 3921-3970, 3922-3971, 3923-3972, 3924-3973, 3925-3974, 3926-3975, 3927-3976, 3928-3977, 3929-3978, 3930-3979, 3931-3980, 3932-3981, 3933-3982, 3934-3983, 3935-3984, 3936-3985, 3937-3986, 3938-3987, 3939-3988, 3940-3989, 3941-3990, 3942-3991, 3943-3992, 3944-3993, 3945-3994, 3946-3995, 3947-3996, 3948-3997, 3949-3998, 3950-3999, 3951-4000, 3952-4001, 3953-4002, 3954-4003, 3955-4004, 3956-4005, 3957-4006, 3958-4007, 3959-4008, 3960-4009, 3961-4010, 3962-4011, 3963-4012, 3964-4013, 3965-4014, 3966-4015, 3967-4016, 3968-4017, 3969-4018, 3970-4019, 3971-4020, 3972-4021, 3973-4022, 3974-4023, 3975-4024, 3976-4025, 3977-4026 ofSEQ DD NO:2, or the foregoing fragments and the following fragments: nucleotides 3978-4027, 3979-4028, 3980-4029, 3981-4030, 3982-4031, 3983-4032, 3984-4033, 3985-4034, 3986-4035, 3987-4036, 3988-4037, 3989-4038, 3990-4039, 3991-4040, 3992-4041, 3993-4042, 3994-4043, 3995-4044, 3996-4045, 3997-4046, 3998-4047, 3999-4048, 4000-4049, 4001-4050, 4002-4051, 4003-4052, 4004-4053, 4005-4054, 4006-4055, 4007-4056, 4008-4057, 4009-4058, 4010-4059, 4011-4060, 4012-4061, 4013-4062, 4014-4063, 4015-4064, 4016-4065, 4017-4066, 4018-4067, 4019-4068, 4020-4069, 4021-4070, 4022-4071, 4023-4072, 4024-4073, 4025-4074, 4026-4075, 4027-4076, 4028-4077, 4029-4078, 4030-4079, 4031-4080, 4032-4081, 4033-4082, 4034-4083, 4035-4084, 4036-4085, 4037-4086, 4038-4087, 4039-4088, 4040-4089, 4041-4090, 4042-4091, 4043-4092, 4044-4093, 4045-4094, 4046-4095, 4047-4096, 4048-4097, 4049-4098, 4050-4099, 4051-4100, 4052-4101, 4053-4102, 4054-4103, 4055-4104, 4056-4105, 4057-4106, 4058-4107, 4059-4108, 4060-4109, 4061-4110, 4062-4111, 4063-4112, 4064-4113, 4065-4114, 4066-4115, 4067-4116, 4068-4117, 4069-4118, 4070-4119, 4071-4120, 4072-4121, 4073-4122, 4074-4123, 4075-4124, 4076-4125, 4077-4126, 4078-4127, 4079-4128, 4080-4129, 4081-4130, 4082-4131, 4083-4132, 4084-4133, 4085-4134, 4086-4135, 4087-4136, 4088-4137, 4089-4138, 4090-4139, 4091-4140, 4092-4141, 4093-4142, 4094-4143, 4095-4144, 4096-4145, 4097-4146, 4098-4147, 4099-4148, 4100-4149, 4101-4150, 4102-4151, 4103-4152, 4104-4153, 4105-4154, 4106-4155, 4107-4156, 4108-4157, 4109-4158, 4110-4159, 4111-4160, 4112-4161, 4113-4162, 4114-4163, 4115-4164, 4116-4165, 4117-4166, 4118-4167, 4119-4168, 4120-4169, 4121-4170, 4122-4171, 4123-4172, 4124-4173, 4125-4174, 4126-4175, 4127-4176, 4128-4177, 4129-4178, 4130-4179, 4131-4180, 4132-4181, 4133-4182, 4134-4183, 4135-4184, or 4136-4185 of SEQ DD NO:l.

In addition to the use of the SGA-72M gene sequences described above, homologs of such sequences, exhibiting extensive homology to the SGA-72M gene product present in other species can be identified and readily isolated, and used in the methods of the invention without undue experimentation, by molecular biological techniques well known in the art. Further, there can exist homolog genes at other genetic loci within the genome that encode polypeptides that have extensive homology to SGA-72M. These genes can also be identified via similar techniques and used in the methods of the invention. Still further, there can exist alternatively spliced variants of the SGA-72M gene. The invention thus includes the use of any of these homologs in the methods of the invention. As an example, in order to clone a mammalian SGA-72M gene homolog or variants using isolated human SGA-72M gene sequences as disclosed herein, such human SGA-72M gene sequences are labeled and used to screen a cDNA library constructed from mRNA obtained from appropriate cells or tissues (e.g., breast epithelial cells) derived from the organism of interest. With respect to the cloning of such a mammalian SGA-72M homolog, a mammalian breast cancer cell cDNA library may, for example, be used for screening. In one embodiment, such a screen would employ a probe conesponding to all or a portion of the SGA-72M open reading frame SEQ DD NO:3. In yet another embodiments, such a screen would employ one or more probes conesponding to all or a portion of the SGA-72M open reading frame, for example, a probe conesponding to the SGA-72M cDNA SEQ DD NO:l or SEQ DD NO:2.

The hybridization and wash conditions used should be of a low stringency, as described infra in Section 5.1.1 when the cDNA library is derived from a different type of organism than the one from which the labeled sequence was derived.

Alternatively, the labeled fragment may be used to screen a genomic library derived from the organism of interest, again, using appropriately stringent conditions well known to those of skill in the art.

Further, an SGA-72M gene homolog may be isolated from nucleic acid of the organism of interest by performing PCR using two degenerate oligonucleotide primer pools designed on the basis of amino acid sequences within an SGA-72M encoded gene product, for example by performing PCR using two degenerate oligonucleotide primer pools conesponding to portions of either SGA-72M. The template for the reaction may be cDNA obtained by reverse transcription of mRNA prepared from, for example, mammalian cell lines or tissue known or suspected to express an SGA-72M gene homology or allele.

The PCR product may be subcloned and sequenced to ensure that the amplified sequences represent the sequences of an SGA-72M-related nucleic acid sequence. The PCR fragment may then be used to isolate a SGA-72M cDNA clone by a variety of methods. For example, the amplified fragment may be labeled and used to screen a cDNA library, such as a bacteriophage cDNA library. Alternatively, the labeled fragment may be used to isolate genomic clones via the screening of a genomic library.

PCR technology may be utilized to isolate cDNA sequences. For example, RNA may be isolated, following standard procedures, from an appropriate cellular or tissue source (e.g., one known, or suspected, to express the SGA-72M gene, such as, for example, breast cancer cell-lines). A reverse transcription reaction may be performed on the RNA using an oligonucleotide primer specific or selective for the most 5' end of the amplified fragment for the priming of first strand synthesis. The resulting RNA/DNA hybrid may then be "tailed" with guanines using a standard terminal transferase reaction, the hybrid may be digested with RNAase H, and second strand synthesis may then be primed with a poly-C primer. Thus, cDNA sequences upstream of the amplified fragment may easily be isolated. For a review of PCR technology and cloning strategies which may be used, see, e.g. , PCR Primer, 1995, Dieffenbach et al. , ed., Cold Spring Harbor Laboratory Press; Sambrook et al, 1989, supra.

SGA-72M gene coding sequences may additionally be used to isolate SGA- 72M gene alleles and mutant SGA-72M gene alleles. Such mutant alleles may be isolated from individuals either known or susceptible to or predisposed to have a genotype that contributes to the development of cancer, e.g., breast cancer, including metastasis. Such mutant alleles may also be isolated from individuals either known or susceptible to or predisposed to have a genotype that contributes to resistance to the development of cancer, e.g., breast cancer, including metastasis. Mutant alleles and mutant allele products may then be utilized in the screening, therapeutic and diagnostic methods and systems described herein. Additionally, such SGA-72M gene sequences can be used to detect SGA-72M gene regulatory (e.g., promoter) defects that can affect the development and outcome of cancer. Mutants can be isolated by any technique known in the art, e.g., PCR, screening genomic libraries, screening expression libraries.

As described below, the invention also relates to the use of an SGA-72M gene product, such as an SGA-72M nucleic acid or polypeptide, in the methods of the invention. An SGA-72M gene product includes, but is not limited to an RNA conesponding to SEQ DD NO:l or SEQ DD NO:2, a nucleic acid derived therefrom, a polypeptide comprising SEQ DD NO:3, or a nucleic acid comprising a sequence hybridizable to SEQ DD NO:l or SEQ DD NO:2 under conditions of high stringency, or a polypeptide comprising a sequence encoded by said hybridizable sequence or a nucleic acid at least 70% homologous to SEQ DD NO:l, or SEQ DD NO:2 as determined by the NBLAST algorithm or a polypeptide encoded thereby.

5.1.1 HYBRIDIZATION CONDITIONS

A nucleic acid which is hybridizable to an SGA-72M nucleic acid (e.g., having a sequence as set forth in SEQ DD NO:l or SEQ DD NO:2), or to its reverse complement, or to a nucleic acid encoding an SGA-72M derivative, or to its reverse complement under conditions of low stringency can be used in the methods of the invention to detect the presence of an SGA-72M gene and/or presence or expression level of an SGA- 72M gene product. By way of example and not limitation, procedures using such conditions of low stringency are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. Sci. U.S.A. 78, 6789-6792). In one embodiment, filters containing DNA are pretreated for 6 h at 40°C in a solution containing 35% formamide, 5X SSC, 50mM Tris- HCl (pH 7.5), 5mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 X 10⁶ cpm ³²P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 h at 40°C, and then washed for 1.5 h at 55°C in a solution containing 2X SSC, 25mM Tris-HCl (pH 7.4), 5mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 60°C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and re-exposed to film. In another embodiment, an example of low stringency conditions included hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS, for 1.5 hours at 60°C. Other conditions of low stringency that may be used are well known in the art (e.g., as employed for cross-species hybridizations).

A nucleic acid which is hybridizable to an SGA-72M nucleic acid (e.g., having a sequence as set forth in SEQ DD NO:l or SEQ DD NO:2), or to its reverse complement, or to a nucleic acid encoding an SGA-72M derivative, or to its reverse complement under conditions of high stringency is also provided for use in the methods of the invention. By way of example and not limitation, procedures using such conditions of high stringency are as follows. Prehybridization of filters containing DNA is carried out for 8 h to overnight at 65°C in buffer composed of 6X SSC, 50mM Tris-HCl (pH 7.5), ImM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65 °C in prehybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20 X 10⁶ cpm of ³²P-labeled probe. Washing of filters is done at 37°C for 1 h in a solution contaimng 2X SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1X SSC at 50°C for 45 min before autoradiography. Other conditions of high stringency that may be used are well known in the art.

A nucleic acid which is hybridizable to an SGA-72M nucleic acid (e.g., having a sequence as set forth in SEQ DD NO: 1 or SEQ DD NO:2), or to its reverse complement, or to a nucleic acid encoding an SGA-72M derivative, or to its reverse complement under conditions of moderate stringency is also provided for use in the methods of the invention. For example, but not limited to, procedures using such conditions of moderate stringency are as follows: Filters containing DNA are pretreated for 6 hours at 55°C in a solution containing 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with 5-20 x 10⁶ cpm ³²P-labeled probe. Filters are incubated in hybridization mixture for 18-20 hours at 55°C, and then washed twice for 30 minutes at 60°C in a solution containing IX SSC and 0.1% SDS. Filters are blotted dry and exposed for autoradiography. Washing of filters is done at 37°C for 1 hour in a solution containing 2X SSC, 0.1% SDS. Other conditions of moderate stringency that may be used are well-known in the art. (see, e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; see also, Ausubel et al., eds., in the Current Protocols in Molecular Biology series of laboratory technique manuals, 1987-1997 Current Protocols,© 1994-1997 John Wiley and Sons, Inc.).

5.2 POLYPEPTIDE PRODUCTS OF THE SGA-72M GENE

In another embodiment, the present invention provides for the use of SGA- 72M gene products or SGA-72M-related gene products, including SGA-72M polypeptides (e.g., polypeptides, peptides), SGA-72M-related polypeptides (e.g., polypeptides, peptides), or fragments thereof which can be used for the generation of antibodies, in diagnostic assays, or for the identification of other cellular gene products involved in the development of cancer, such as, for example, breast cancer.

In one embodiment, a SGA-72M gene product is a SGA-72M polypeptide selected from the group consisting of (a) an isolated polypeptide comprising SEQ DD NO:3, (c) an isolated polypeptide comprising at least 8 contiguous amino acid residues of SEQ DD NO:3; (d) an isolated polypeptide comprising at least 10 contiguous amino acid residues of SEQ DD NO:3; (e) an isolated polypeptide comprising at least 20 contiguous amino acid residues of SEQ DD NO:3; (g) an isolated polypeptide comprising at least 50 contiguous amino acid residues of SEQ DD NO:3; and (h) an isolated polypeptide comprising at least 100 contiguous amino acid residues of SEQ DD NO:3. In certain other embodiments, a SGA-72M-related gene product is a SGA-72M-related polypeptide such as a SGA-72M polypeptide or a polypeptide selected from the group consisting of: (a) an isolated polypeptide which comprises an amino acid sequence which is encoded by a nucleotide sequence which is at least 70% homologous to SEQ DD NO:2 (e.g., as determined using the NBLAST algorithm with a score of 100 and a word length of 12); (b) an isolated polypeptide comprising an amino acid sequence which is at least 70% homologous to SEQ DD NO: 3 (e.g., as determined using the ALIGN program in the GCG software package, using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4), (c) an isolated polypeptide encoded by a nucleic acid that is hybridizable (e.g., under low, moderate or highly stringent conditions such as disclosed infra in Section 5.1.1) to (i) SEQ DD NO:l, (ii) the antisense strand to SEQ DD NO:l, (iii) SEQ DD NO:2, (iv) the antisense strand to SEQ DD NO:2, or (b) an isolated polypeptide that is encoded by a nucleic acid that is at least 70% homologous to (i) SEQ DD NO:l or (ii) SEQ DD NO:2, or a fragment thereof. SGM-72M-related polypeptides may additionally include those gene products encoded by the SGA72M nucleic acids described in Section 5.1 supra.

In certain specific embodiments, the present invention encompasses polypeptides comprising an amino acid sequence which conesponds to a fragment of the amino acid sequence of SEQ DD NO: 3, wherein the fragment comprises at least 8 contiguous amino acids of SEQ DD NO: 3. Accordingly, the present invention encompasses polypeptides composed, or alternatively consisting of, one or more of amino acid sequences of the following fragments of SEQ DD NO:3: amino acids 1-8, 2-9, 3-10, 4-11, 5-12, 6-13, 7-14, 8-15, 9-16, 10-17, 11-18, 12-19, 13-20, 14-21, 15-22, 16-23, 17-24, 18-25, 19-26, 20- 27, 21-28, 22-29, 23-30, 24-31, 25-32, 26-33, 27-34, 28-35, 29-36, 30-37, 31-38, 32-39, 33- 40, 34-41, 35-42, 36-43, 37-44, 38-45, 39-46, 40-47, 41-48, 42-49, 43-50, 44-51, 45-52, 46- 53, 47-54, 48-55, 49-56, 50-57, 51-58, 52-59, 53-60, 54-61, 55-62, 56-63, 57-64, 58-65, 59- 66, 60-67, 61-68, 62-69, 63-70, 64-71, 65-72, 66-73, 67-74, 68-75, 69-76, 70-77, 71-78, 72- 79, 73-80, 74-81, 75-82, 76-83, 77-84, 78-85, 79-86, 80-87, 81-88, 82-89, 83-90, 84-91, 85- 92, 86-93, 87-94, 88-95, 89-96, 90-97, 91-98, 92-99, 93-100, 94-101, 95-102, 96-103, 97- 104, 98-105, 99-106, 100-107, 101-108, 102-109, 103-110, 104-111, 105-112, 106-113, 107-114, 108-115, 109-116, 110-117, 111-118, 112-119, 113-120, 114-121, 115-122, 116- 123, 117-124, 118-125, 119-126, 120-127, 121-128, 122-129, 123-130, 124-131, 125-132, 126-133, 127-134, 128-135, 129-136, 130-137, 131-138, 132-139, 133-140, 134-141, 135- 142, 136-143, 137-144, 138-145, 139-146, 140-147, 141-148, 142-149, 143-150, 144-151, 145-152, 146-153, 147-154, 148-155, 149-156, 150-157, 151-158, 152-159, 153-160, 154- 161, 155-162, 156-163, 157-164, 158-165, 159-166, 160-167, 161-168, 162-169, 163-170, 164-171, 165-172, 166-173, 167-174, 168-175, 169-176, 170-177, 171-178, 172-179, 173- 180, 174-181, 175-182, 176-183, 177-184, 178-185, 179-186, 180-187, 181-188, 182-189, 183-190, 184-191, 185-192, 186-193, 187-194, 188-195, 189-196, 190-197, 191-198, 192- 199, 193-200, 194-201, 195-202, 196-203, 197-204, 198-205, 199-206, 200-207, 201-208, 202-209, 203-210, 204-211, 205-212, 206-213, 207-214, 208-215, 209-216, 210-217, 211- 218, 212-219, 213-220, 214-221, 215-222, 216-223, 217-224, 218-225, 219-226, 220-227, 221-228, 222-229, 223-230, 224-231, 225-232, 226-233, 227-234, 228-235, 229-236, 230- 237, 231-238, 232-239, 233-240, 234-241, 235-242, 236-243, 237-244, 238-245, 239-246, 240-247, 241-248, 242-249, 243-250, 244-251, 245-252, 246-253, 247-254, 248-255, 249- 256, 250-257, 251-258, 252-259, 253-260, 254-261, 255-262, 256-263, 257-264, 258-265, 259-266, 260-267, 261-268, 262-269, 263-270, 264-271, 265-272, 266-273, 267-274, 268- 275, 269-276, 270-277, 271-278, 272-279, 273-280, 274-281, 275-282, 276-283, 277-284, 278-285, 279-286, 280-287, 281-288, 282-289, 283-290, 284-291, 285-292, 286-293, 287- 294, 288-295, 289-296, 290-297, 291-298, 292-299, 293-300, 294-301, 295-302, 296-303, 297-304, 298-305, 299-306, 300-307, 301-308, 302-309, 303-310, 304-311, 305-312, 306- 313, 307-314, 308-315, 309-316, 310-317, 311-318, 312-319, 313-320, 314-321, 315-322, 316-323, 317-324, 318-325, 319-326, 320-327, 321-328, 322-329, 323-330, 324-331, 325- 332, 326-333, 327-334, 328-335, 329-336, 330-337, 331-338, 332-339, 333-340, 334-341, 335-342, 336-343, 337-344, 338-345, 339-346, 340-347, 341-348, 342-349, 343-350, 344- 351, 345-352, 346-353, 347-354, 348-355, 349-356, 350-357, 351-358, 352-359, 353-360, 354-361, 355-362, 356-363, 357-364, 358-365, 359-366, 360-367, 361-368, 362-369, 363- 370, 364-371, 365-372, 366-373, 367-374, 368-375, 369-376, 370-377, 371-378, 372-379, 373-380, 374-381, 375-382, 376-383, 377-384, 378-385, 379-386, 380-387, 381-388, 382- 389, 383-390, 384-391, 385-392, 386-393, 387-394, 388-395, 389-396, 390-397, 391-398, 392-399, 393-400, 394-401, 395-402, 396-403, 397-404, 398-405, 399-406, 400-407, 401- 408, 402-409, 403-410, 404-411, 405-412, 406-413, 407-414, 408-415, 409-416, 410-417, 411-418, 412-419, 413-420, 414-421, 415-422, 416-423, 417-424, 418-425, 419-426, 420- 427, 421-428, 422-429, 423-430, 424-431, 425-432, 426-433, 427-434, 428-435, 429-436, 430-437, 431-438, 432-439, 433-440, 434-441, 435-442, 436-443, 437-444, 438-445, 439- 446, 440-447, 441-448, 442-449, 443-450, 444-451, 445-452, 446-453, 447-454, 448-455, 449-456, 450-457, 451-458, 452-459, 453-460, 454-461, 455-462, 456-463, 457-464, 458- 465, 459-466, 460-467, 461-468, 462-469, 463-470, 464-471, 465-472, 466-473, 467-474, 468-475, 469-476, 470-477, 471-478, 472-479, 473-480, 474-481, 475-482, 476-483, 477- 484, 478-485, 479-486, 480-487, 481-488, 482-489, 483-490, 484-491, 485-492, 486-493, 487-494, 488-495, 489-496, 490-497, 491-498, 492-499, 493-500, 494-501, 495-502, 496- 503, 497-504, 498-505, 499-506, 500-507, 501-508, 502-509, 503-510, 504-511, 505-512, 506-513, 507-514, 508-515, 509-516, 510-517, 511-518, 512-519, 513-520, 514-521, 515- 522, 516-523, 517-524, 518-525, 519-526, 520-527, 521-528, 522-529, 523-530, 524-531, 525-532, 526-533, 527-534, 528-535, 529-536, 530-537, 531-538, 532-539, 533-540, 534- 541, 535-542, 536-543, 537-544, 538-545, 539-546, 540-547, 541-548, 542-549, 543-550, 544-551, 545-552, 546-553, 547-554, 548-555, 549-556, 550-557, 551-558, 552-559, 553- 560, 554-561, 555-562, 556-563, 557-564, 558-565, 559-566, 560-567, 561-568, 562-569, 563-570, 564-571, 565-572, 566-573, 567-574, 568-575, 569-576, 570-577, 571-578, 572- 579, 573-580, 574-581, 575-582, 576-583, 577-584, 578-585, 579-586, 580-587, 581-588, 582-589, 583-590, 584-591, 585-592, 586-593, 587-594, 588-595, 589-596, 590-597, 591- 598, 592-599, 593-600, 594-601, 595-602, 596-603, 597-604, 598-605, 599-606, 600-607, 601-608, 602-609, 603-610, 604-611, 605-612, 606-613, 607-614, 608-615, 609-616, 610- 617, 611-618, 612-619, 613-620, 614-621, 615-622, 616-623, 617-624, 618-625, 619-626, 620-627, 621-628, 622-629, 623-630, 624-631, 625-632, 626-633, 627-634, 628-635, 629- 636, 630-637, 631-638, 632-639, 633-640, 634-641, 635-642, 636-643, 637-644, 638-645, 639-646, 640-647, 641-648, 642-649, 643-650, 644-651, 645-652, 646-653, 647-654, 648- 655, 649-656, 650-657, 651-658, 652-659, 653-660, 654-661, 655-662, 656-663, 657-664, 658-665, 659-666, 660-667, 661-668, 662-669, 663-670, 664-671, 665-672, 666-673, 667- 674, 668-675, 669-676, 670-677, 671-678, 672-679, 673-680, 674-681, 675-682, 676-683, 677-684, 678-685, 679-686, 680-687, 681-688, 682-689, 683-690, 684-691, 685-692, 686- 693, 687-694, 688-695, 689-696, 690-697, 691-698, 692-699, 693-700, 694-701, 695-702, 696-703, 697-704, 698-705, 699-706, 700-707, 701-708, 702-709, 703-710, 704-711, 705- 712, 706-713, 707-714, 708-715, 709-716, 710-717, 711-718, 712-719, 713-720, 714-721, 715-722, 716-723, 717-724, 718-725, 719-726, 720-727, 721-728, 722-729, 723-730, 724- 731, 725-732, 726-733, 727-734, 728-735, 729-736, 730-737, 731-738, 732-739, 733-740, 734-741, 735-742, 736-743, 737-744, 738-745, 739-746, 740-747, 741-748, 742-749, 743- 750, 744-751, 745-752, 746-753, 747-754, 748-755, 749-756, 750-757, 751-758, 752-759, 753-760, 754-761, 755-762, 756-763, 757-764, 758-765, 759-766, 760-767, 761-768, 762- 769, 763-770, 764-771, 765-772, 766-773, 767-774, 768-775, 769-776, 770-777, 771-778, 772-779, 773-780, 774-781, 775-782, 776-783, 777-784, 778-785, 779-786, 780-787, 781- 788, 782-789, 783-790, 784-791, 785-792, 786-793, 787-794, 788-795, 789-796, 790-797, 791-798, 792-799, 793-800, 794-801, 795-802, 796-803, 797-804, 798-805, 799-806, 800- 807, 801-808, 802-809, 803-810, 804-811, 805-812, 806-813, 807-814, 808-815, 809-816, 810-817, 811-818, 812-819, 813-820, 814-821, 815-822, 816-823, 817-824, 818-825, 819- 826, 820-827, 821-828, 822-829, 823-830, 824-831, 825-832, 826-833, 827-834, 828-835, 829-836, 830-837, 831-838, 832-839, 833-840, 834-841, 835-842, 836-843, 837-844, 838- 845, 839-846, 840-847, 841-848, 842-849, 843-850, 844-851, 845-852, 846-853, 847-854, 848-855, 849-856, 850-857, 851-858, 852-859, 853-860, 854-861, 855-862, 856-863, 857- 864, 858-865, 859-866, 860-867, 861-868, 862-869, 863-870, 864-871, 865-872, 866-873, 867-874, 868-875, 869-876, 870-877, 871-878, 872-879, 873-880, 874-881, 875-882, 876- 883, 877-884, 878-885, 879-886, 880-887, 881-888, 882-889, 883-890, 884-891, 885-892, 886-893, 887-894, 888-895, 889-896, 890-897, 891-898, 892-899, 893-900, 894-901, 895- 902, 896-903, 897-904, 898-905, 899-906, 900-907, 901-908, 902-909, 903-910, 904-911, 905-912, 906-913, 907-914, 908-915, 909-916, 910-917, 911-918, 912-919, 913-920, 914- 921, 915-922, 916-923, 917-924, 918-925, 919-926, 920-927, 921-928, 922-929, 923-930, 924-931, 925-932, 926-933, 927-934, 928-935, 929-936, 930-937, 931-938, 932-939, 933- 940, 934-941, 935-942, 936-943, 937-944, 938-945, 939-946, 940-947, 941-948, 942-949, 943-950, 944-951, 945-952, 946-953, 947-954, 948-955, 949-956, 950-957, 951-958, 952- 959, 953-960, 954-961, 955-962, 956-963, 957-964, 958-965, 959-966, 960-967, 961-968, 962-969, 963-970, 964-971, 965-972, 966-973, 967-974, 968-975, 969-976, 970-977, 971- 978, 972-979, 973-980, 974-981, 975-982, 976-983, 977-984, 978-985, 979-986, 980-987, 981-988, 982-989, 983-990, 984-991, 985-992, 986-993, 987-994, 988-995, 989-996, 990- 997, 991-998, 992-999, 993-1000, 994-1001, 995-1002, 996-1003, 997-1004, 998-1005, 999-1006, 1000-1007, 1001-1008, 1002-1009, 1003-1010, 1004-1011, 1005-1012, 1006- 1013, 1007-1014, 1008-1015, 1009-1016, 1010-1017, 1011-1018, 1012-1019, 1013-1020, 1014-1021, 1015-1022, 1016-1023, 1017-1024, 1018-1025, 1019-1026, 1020-1027, 1021- 1028, 1022-1029, 1023-1030, 1024-1031, 1025-1032, 1026-1033, 1027-1034, 1028-1035, 1029-1036, 1030-1037, 1031-1038, 1032-1039, 1033-1040, 1034-1041, 1035-1042, 1036- 1043, 1037-1044, 1038-1045, 1039-1046, 1040-1047, 1041-1048, 1042-1049, 1043-1050, 1044-1051, 1045-1052, 1046-1053, 1047-1054, 1048-1055, 1049-1056, 1050-1057, 1051- 1058, 1052-1059, 1053-1060, 1054-1061, 1055-1062, 1056-1063, 1057-1064, 1058-1065, 1059-1066, 1060-1067, 1061-1068, 1062-1069, 1063-1070, 1064-1071, 1065-1072, 1066- 1073, 1067-1074, 1068-1075, 1069-1076, 1070-1077, 1071-1078, 1072-1079, 1073-1080, 1074-1081, 1075-1082, 1076-1083, 1077-1084, 1078-1085, 1079-1086, 1080-1087, 1081- 1088, 1082-1089, 1083-1090, 1084-1091, 1085-1092, 1086-1093, 1087-1094, 1088-1095, 1089-1096, 1090-1097, 1091-1098, 1092-1099, 1093-1100, 1094-1101, 1095-1102, 1096- 1103, 1097-1104, 1098-1105, 1099-1106, 1100-1107, 1101-1108, 1102-1109, 1103-1110, 1104-1111, 1105-1112, 1106-1113, 1107-1114, 1108-1115, 1109-1116, 1110-1117, 1111- 1118, 1112-1119, 1113-1120, 1114-1121, 1115-1122, 1116-1123, 1117-1124, 1118-1125, 1119-1126, 1120-1127, 1121-1128, 1122-1129, 1123-1130, 1124-1131, 1125-1132, 1126- 1133, 1127-1134, 1128-1135, 1129-1136, 1130-1137, 1131-1138, 1132-1139, 1133-1140, 1134-1141, 1135-1142, 1136-1143, 1137-1144, 1138-1145, 1139-1146, 1140-1147, 1141- 1148, 1142-1149, 1143-1150, 1144-1151, 1145-1152, 1146-1153, 1147-1154, 1148-1155, 1149-1156, 1150-1157, 1151-1158, 1152-1159, 1153-1160, 1154-1161, 1155-1162, 1156- 1163, 1157-1164, 1158-1165, 1159-1166, 1160-1167, 1161-1168, 1162-1169, 1163-1170, 1164-1171, 1165-1172, 1166-1173, 1167-1174, 1168-1175, 1169-1176, 1170-1177, 1171- 1178, 1172-1179, 1173-1180, 1174-1181, 1175-1182, 1176-1183, 1177-1184, 1178-1185, 1179-1186, 1180-1187, 1181-1188, 1182-1189, 1183-1190, 1184-1191, 1185-1192, 1186- 1193, 1187-1194, 1188-1195, 1189-1196, 1190-1197, 1191-1198, 1192-1199, 1193-1200, 1194-1201, 1195-1202, 1196-1203, 1197-1204, 1198-1205, 1199-1206, 1200-1207, 1201- 1208, 1202-1209, 1203-1210, 1204-1211, 1205-1212, 1206-1213, 1207-1214, 1208-1215, 1209-1216, 1210-1217, 1211-1218, 1212-1219, 1213-1220, 1214-1221, 1215-1222, 1216- 1223, 1217-1224, 1218-1225, 1219-1226, 1220-1227, 1221-1228, 1222-1229, 1223-1230, 1224-1231, 1225-1232, 1226-1233, 1227-1234, 1228-1235, 1229-1236, 1230-1237, 1231- 1238, 1232-1239, 1233-1240, 1234-1241, 1235-1242, 1236-1243, 1237-1244, 1238-1245, 1239-1246, 1240-1247, 1241-1248, 1242-1249, 1243-1250, 1244-1251, 1245-1252, 1246- 1253, 1247-1254, 1248-1255, 1249-1256, 1250-1257, 1251-1258, 1252-1259, 1253-1260, 1254-1261, 1255-1262, 1256-1263, 1257-1264, 1258-1265, 1259-1266, 1260-1267, 1261- 1268, 1262-1269, 1263-1270, 1264-1271, 1265-1272, 1266-1273, 1267-1274, 1268-1275, 1269-1276, 1270-1277, 1271-1278, 1272-1279, 1273-1280, 1274-1281, 1275-1282, 1276- 1283, 1277-1284, 1278-1285, 1279-1286, 1280-1287, 1281-1288, 1282-1289, 1283-1290, 1284-1291, 1285-1292, 1286-1293, 1287-1294, 1288-1295, 1289-1296, 1290-1297, 1291- 1298, 1292-1299, 1293-1300, 1294-1301, 1295-1302, 1296-1303, 1297-1304, 1298-1305, 1299-1306, 1300-1307, 1301-1308, 1302-1309, 1303-1310, 1304-1311, 1305-1312, 1306- 1313, 1307-1314, 1308-1315, 1309-1316, 1310-1317, 1311-1318, 1312-1319, 1313-1320, 1314-1321, 1315-1322, 1316-1323, 1317-1324, 1318-1325, 1319-1326, 1320-1327, 1321- 1328, 1322-1329, 1323-1330, 1324-1331, 1325-1332, 1326-1333, 1327-1334, 1328-1335, 1329-1336, 1330-1337, 1331-1338, 1332-1339, 1333-1340, 1334-1341, or 1335-1342 of SEQ DD NO:3. In a specific embodiment, the polypeptide fragment of the invention is an antigenic or immunogenic fragment. In other embodiments, the present invention encompasses polypeptides comprising an amino acid sequence which conesponds to a fragment of the amino acid sequence of SEQ DD NO: 3, wherein the fragment comprises at least 10 contiguous amino acids of SEQ DD NO: 3. Accordingly, the present invention encompasses polypeptides having one or more of amino acid sequences of the following fragments of SEQ DD NO:3: amino acids 1 - 10, 2-11, 3-12, 4-13, 5-14, 6-15, 7-16, 8-17, 9-18, 10-19, 11-20, 12-21, 13- 22, 14-23, 15-24, 16-25, 17-26, 18-27, 19-28, 20-29, 21-30, 22-31, 23-32, 24-33, 25-34, 26- 35, 27-36, 28-37, 29-38, 30-39, 31-40, 32-41, 33-42, 34-43, 35-44, 36-45, 37-46, 38-47, 39- 48, 40-49, 41-50, 42-51, 43-52, 44-53, 45-54, 46-55, 47-56, 48-57, 49-58, 50-59, 51-60, 52- 61, 53-62, 54-63, 55-64, 56-65, 57-66, 58-67, 59-68, 60-69, 61-70, 62-71, 63-72, 64-73, 65- 74, 66-75, 67-76, 68-77, 69-78, 70-79, 71-80, 72-81, 73-82, 74-83, 75-84, 76-85, 77-86, 78- 87, 79-88, 80-89, 81-90, 82-91, 83-92, 84-93, 85-94, 86-95, 87-96, 88-97, 89-98, 90-99, 91- 100, 92-101, 93-102, 94-103, 95-104, 96-105, 97-106, 98-107, 99-108, 100-109, 101-110, 102-111, 103-112, 104-113, 105-114, 106-115, 107-116, 108-117, 109-118, 110-119, 111- 120, 112-121, 113-122, 114-123, 115-124, 116-125, 117-126, 118-127, 119-128, 120-129, 121-130, 122-131, 123-132, 124-133, 125-134, 126-135, 127-136, 128-137, 129-138, 130- 139, 131-140, 132-141, 133-142, 134-143, 135-144, 136-145, 137-146, 138-147, 139-148, 140-149, 141-150, 142-151, 143-152, 144-153, 145-154, 146-155, 147-156, 148-157, 149- 158, 150-159, 151-160, 152-161, 153-162, 154-163, 155-164, 156-165, 157-166, 158-167, 159-168, 160-169, 161-170, 162-171, 163-172, 164-173, 165-174, 166-175, 167-176, 168- 177, 169-178, 170-179, 171-180, 172-181, 173-182, 174-183, 175-184, 176-185, 177-186, 178-187, 179-188, 180-189, 181-190, 182-191, 183-192, 184-193, 185-194, 186-195, 187- 196, 188-197, 189-198, 190-199, 191-200, 192-201, 193-202, 194-203, 195-204, 196-205, 197-206, 198-207, 199-208, 200-209, 201-210, 202-211, 203-212, 204-213, 205-214, 206- 215, 207-216, 208-217, 209-218, 210-219, 211-220, 212-221, 213-222, 214-223, 215-224, 216-225, 217-226, 218-227, 219-228, 220-229, 221-230, 222-231, 223-232, 224-233, 225- 234, 226-235, 227-236, 228-237, 229-238, 230-239, 231-240, 232-241, 233-242, 234-243, 235-244, 236-245, 237-246, 238-247, 239-248, 240-249, 241-250, 242-251, 243-252, 244- 253, 245-254, 246-255, 247-256, 248-257, 249-258, 250-259, 251-260, 252-261, 253-262, 254-263, 255-264, 256-265, 257-266, 258-267, 259-268, 260-269, 261-270, 262-271, 263- 272, 264-273, 265-274, 266-275, 267-276, 268-277, 269-278, 270-279, 271-280, 272-281, 273-282, 274-283, 275-284, 276-285, 277-286, 278-287, 279-288, 280-289, 281-290, 282- 291, 283-292, 284-293, 285-294, 286-295, 287-296, 288-297, 289-298, 290-299, 291-300, 292-301, 293-302, 294-303, 295-304, 296-305, 297-306, 298-307, 299-308, 300-309, 301- 310, 302-311, 303-312, 304-313, 305-314, 306-315, 307-316, 308-317, 309-318, 310-319, 311-320, 312-321, 313-322, 314-323, 315-324, 316-325, 317-326, 318-327, 319-328, 320- 329, 321-330, 322-331, 323-332, 324-333, 325-334, 326-335, 327-336, 328-337, 329-338, 330-339, 331-340, 332-341, 333-342, 334-343, 335-344, 336-345, 337-346, 338-347, 339- 348, 340-349, 341-350, 342-351, 343-352, 344-353, 345-354, 346-355, 347-356, 348-357, 349-358, 350-359, 351-360, 352-361, 353-362, 354-363, 355-364, 356-365, 357-366, 358- 367, 359-368, 360-369, 361-370, 362-371, 363-372, 364-373, 365-374, 366-375, 367-376, 368-377, 369-378, 370-379, 371-380, 372-381, 373-382, 374-383, 375-384, 376-385, 377- 386, 378-387, 379-388, 380-389, 381-390, 382-391, 383-392, 384-393, 385-394, 386-395, 387-396, 388-397, 389-398, 390-399, 391-400, 392-401, 393-402, 394-403, 395-404, 396- 405, 397-406, 398-407, 399-408, 400-409, 401-410, 402-411, 403-412, 404-413, 405-414, 406-415, 407-416, 408-417, 409-418, 410-419, 411-420, 412-421, 413-422, 414-423, 415- 424, 416-425, 417-426, 418-427, 419-428, 420-429, 421-430, 422-431, 423-432, 424-433, 425-434, 426-435, 427-436, 428-437, 429-438, 430-439, 431-440, 432-441, 433-442, 434- 443, 435-444, 436-445, 437-446, 438-447, 439-448, 440-449, 441-450, 442-451, 443-452, 444-453, 445-454, 446-455, 447-456, 448-457, 449-458, 450-459, 451-460, 452-461, 453- 462, 454-463, 455-464, 456-465, 457-466, 458-467, 459-468, 460-469, 461-470, 462-471, 463-472, 464-473, 465-474, 466-475, 467-476, 468-477, 469-478, 470-479, 471-480, 472- 481, 473-482, 474-483, 475-484, 476-485, 477-486, 478-487, 479-488, 480-489, 481-490, 482-491, 483-492, 484-493, 485-494, 486-495, 487-496, 488-497, 489-498, 490-499, 491- 500, 492-501, 493-502, 494-503, 495-504, 496-505, 497-506, 498-507, 499-508, 500-509, 501-510, 502-511, 503-512, 504-513, 505-514, 506-515, 507-516, 508-517, 509-518, 510- 519, 511-520, 512-521, 513-522, 514-523, 515-524, 516-525, 517-526, 518-527, 519-528, 520-529, 521-530, 522-531, 523-532, 524-533, 525-534, 526-535, 527-536, 528-537, 529- 538, 530-539, 531-540, 532-541, 533-542, 534-543, 535-544, 536-545, 537-546, 538-547, 539-548, 540-549, 541-550, 542-551, 543-552, 544-553, 545-554, 546-555, 547-556, 548- 557, 549-558, 550-559, 551-560, 552-561, 553-562, 554-563, 555-564, 556-565, 557-566, 558-567, 559-568, 560-569, 561-570, 562-571, 563-572, 564-573, 565-574, 566-575, 567- 576, 568-577, 569-578, 570-579, 571-580, 572-581, 573-582, 574-583, 575-584, 576-585, 577-586, 578-587, 579-588, 580-589, 581-590, 582-591, 583-592, 584-593, 585-594, 586- 595, 587-596, 588-597, 589-598, 590-599, 591-600, 592-601, 593-602, 594-603, 595-604, 596-605, 597-606, 598-607, 599-608, 600-609, 601-610, 602-611, 603-612, 604-613, 605- 614, 606-615, 607-616, 608-617, 609-618, 610-619, 611-620, 612-621, 613-622, 614-623, 615-624, 616-625, 617-626, 618-627, 619-628, 620-629, 621-630, 622-631, 623-632, 624- 633, 625-634, 626-635, 627-636, 628-637, 629-638, 630-639, 631-640, 632-641, 633-642, 634-643, 635-644, 636-645, 637-646, 638-647, 639-648, 640-649, 641-650, 642-651, 643- 652, 644-653, 645-654, 646-655, 647-656, 648-657, 649-658, 650-659, 651-660, 652-661, 653-662, 654-663, 655-664, 656-665, 657-666, 658-667, 659-668, 660-669, 661-670, 662- 671, 663-672, 664-673, 665-674, 666-675, 667-676, 668-677, 669-678, 670-679, 671-680, 672-681, 673-682, 674-683, 675-684, 676-685, 677-686, 678-687, 679-688, 680-689, 681- 690, 682-691, 683-692, 684-693, 685-694, 686-695, 687-696, 688-697, 689-698, 690-699, 691-700, 692-701, 693-702, 694-703, 695-704, 696-705, 697-706, 698-707, 699-708, 700- 709, 701-710, 702-711, 703-712, 704-713, 705-714, 706-715, 707-716, 708-717, 709-718, 710-719, 711-720, 712-721, 713-722, 714-723, 715-724, 716-725, 717-726, 718-727, 719- 728, 720-729, 721-730, 722-731, 723-732, 724-733, 725-734, 726-735, 727-736, 728-737, 729-738, 730-739, 731-740, 732-741, 733-742, 734-743, 735-744, 736-745, 737-746, 738- 747, 739-748, 740-749, 741-750, 742-751, 743-752, 744-753, 745-754, 746-755, 747-756, 748-757, 749-758, 750-759, 751-760, 752-761, 753-762, 754-763, 755-764, 756-765, 757- 766, 758-767, 759-768, 760-769, 761-770, 762-771, 763-772, 764-773, 765-774, 766-775, 767-776, 768-777, 769-778, 770-779, 771-780, 772-781, 773-782, 774-783, 775-784, 776- 785, 777-786, 778-787, 779-788, 780-789, 781-790, 782-791, 783-792, 784-793, 785-794, 786-795, 787-796, 788-797, 789-798, 790-799, 791-800, 792-801, 793-802, 794-803, 795- 804, 796-805, 797-806, 798-807, 799-808, 800-809, 801-810, 802-811, 803-812, 804-813, 805-814, 806-815, 807-816, 808-817, 809-818, 810-819, 811-820, 812-821, 813-822, 814- 823, 815-824, 816-825, 817-826, 818-827, 819-828, 820-829, 821-830, 822-831, 823-832, 824-833, 825-834, 826-835, 827-836, 828-837, 829-838, 830-839, 831-840, 832-841, 833- 842, 834-843, 835-844, 836-845, 837-846, 838-847, 839-848, 840-849, 841-850, 842-851, 843-852, 844-853, 845-854, 846-855, 847-856, 848-857, 849-858, 850-859, 851-860, 852- 861, 853-862, 854-863, 855-864, 856-865, 857-866, 858-867, 859-868, 860-869, 861-870, 862-871, 863-872, 864-873, 865-874, 866-875, 867-876, 868-877, 869-878, 870-879, 871- 880, 872-881, 873-882, 874-883, 875-884, 876-885, 877-886, 878-887, 879-888, 880-889, 881-890, 882-891, 883-892, 884-893, 885-894, 886-895, 887-896, 888-897, 889-898, 890- 899, 891-900, 892-901, 893-902, 894-903, 895-904, 896-905, 897-906, 898-907, 899-908, 900-909, 901-910, 902-911, 903-912, 904-913, 905-914, 906-915, 907-916, 908-917, 909- 918, 910-919, 911-920, 912-921, 913-922, 914-923, 915-924, 916-925, 917-926, 918-927, 919-928, 920-929, 921-930, 922-931, 923-932, 924-933, 925-934, 926-935, 927-936, 928- 937, 929-938, 930-939, 931-940, 932-941, 933-942, 934-943, 935-944, 936-945, 937-946, 938-947, 939-948, 940-949, 941-950, 942-951, 943-952, 944-953, 945-954, 946-955, 947- 956, 948-957, 949-958, 950-959, 951-960, 952-961, 953-962, 954-963, 955-964, 956-965, 957-966, 958-967, 959-968, 960-969, 961-970, 962-971, 963-972, 964-973, 965-974, 966- 975, 967-976, 968-977, 969-978, 970-979, 971-980, 972-981, 973-982, 974-983, 975-984, 976-985, 977-986, 978-987, 979-988, 980-989, 981-990, 982-991, 983-992, 984-993, 985- 994, 986-995, 987-996, 988-997, 989-998, 990-999, 991-1000, 992-1001, 993-1002, 994- 1003, 995-1004, 996-1005, 997-1006, 998-1007, 999-1008, 1000-1009, 1001-1010, 1002- 1011, 1003-1012, 1004-1013, 1005-1014, 1006-1015, 1007-1016, 1008-1017, 1009-1018, 1010-1019, 1011-1020, 1012-1021, 1013-1022, 1014-1023, 1015-1024, 1016-1025, 1017- 1026, 1018-1027, 1019-1028, 1020-1029, 1021-1030, 1022-1031, 1023-1032, 1024-1033, 1025-1034, 1026-1035, 1027-1036, 1028-1037, 1029-1038, 1030-1039, 1031-1040, 1032- 1041, 1033-1042, 1034-1043, 1035-1044, 1036-1045, 1037-1046, 1038-1047, 1039-1048, 1040-1049, 1041-1050, 1042-1051, 1043-1052, 1044-1053, 1045-1054, 1046-1055, 1047- 1056, 1048-1057, 1049-1058, 1050-1059, 1051-1060, 1052-1061, 1053-1062, 1054-1063, 1055-1064, 1056-1065, 1057-1066, 1058-1067, 1059-1068, 1060-1069, 1061-1070, 1062- 1071, 1063-1072, 1064-1073, 1065-1074, 1066-1075, 1067-1076, 1068-1077, 1069-1078, 1070-1079, 1071-1080, 1072-1081, 1073-1082, 1074-1083, 1075-1084, 1076-1085, 1077- 1086, 1078-1087, 1079-1088, 1080-1089, 1081-1090, 1082-1091, 1083-1092, 1084-1093, 1085-1094, 1086-1095, 1087-1096, 1088-1097, 1089-1098, 1090-1099, 1091-1100, 1092- 1101, 1093-1102, 1094-1103, 1095-1104, 1096-1105, 1097-1106, 1098-1107, 1099-1108, 1100-1109, 1101-1110, 1102-1111, 1103-1112, 1104-1113, 1105-1114, 1106-1115, 1107- 1116, 1108-1117, 1109-1118, 1110-1119, 1111-1120, 1112-1121, 1113-1122, 1114-1123, 1115-1124, 1116-1125, 1117-1126, 1118-1127, 1119-1128, 1120-1129, 1121-1130, 1122- 1131, 1123-1132, 1124-1133, 1125-1134, 1126-1135, 1127-1136, 1128-1137, 1129-1138, 1130-1139, 1131-1140, 1132-1141, 1133-1142, 1134-1143, 1135-1144, 1136-1145, 1137- 1146, 1138-1147, 1139-1148, 1140-1149, 1141-1150, 1142-1151, 1143-1152, 1144-1153, 1145-1154, 1146-1155, 1147-1156, 1148-1157, 1149-1158, 1150-1159, 1151-1160, 1152- 1161, 1153-1162, 1154-1163, 1155-1164, 1156-1165, 1157-1166, 1158-1167, 1159-1168, 1160-1169, 1161-1170, 1162-1171, 1163-1172, 1164-1173, 1165-1174, 1166-1175, 1167- 1176, 1168-1177, 1169-1178, 1170-1179, 1171-1180, 1172-1181, 1173-1182, 1174-1183, 1175-1184, 1176-1185, 1177-1186, 1178-1187, 1179-1188, 1180-1189, 1181-1190, 1182- 1191, 1183-1192, 1184-1193, 1185-1194, 1186-1195, 1187-1196, 1188-1197, 1189-1198, 1190-1199, 1191-1200, 1192-1201, 1193-1202, 1194-1203, 1195-1204, 1196-1205, 1197- 1206, 1198-1207, 1199-1208, 1200-1209, 1201-1210, 1202-1211, 1203-1212, 1204-1213, 1205-1214, 1206-1215, 1207-1216, 1208-1217, 1209-1218, 1210-1219, 1211-1220, 1212- 1221, 1213-1222, 1214-1223, 1215-1224, 1216-1225, 1217-1226, 1218-1227, 1219-1228, 1220-1229, 1221-1230, 1222-1231, 1223-1232, 1224-1233, 1225-1234, 1226-1235, 1227- 1236, 1228-1237, 1229-1238, 1230-1239, 1231-1240, 1232-1241, 1233-1242, 1234-1243, 1235-1244, 1236-1245, 1237-1246, 1238-1247, 1239-1248, 1240-1249, 1241-1250, 1242- 1251, 1243-1252, 1244-1253, 1245-1254, 1246-1255, 1247-1256, 1248-1257, 1249-1258, 1250-1259, 1251-1260, 1252-1261, 1253-1262, 1254-1263, 1255-1264, 1256-1265, 1257- 1266, 1258-1267, 1259-1268, 1260-1269, 1261-1270, 1262-1271, 1263-1272, 1264-1273, 1265-1274, 1266-1275, 1267-1276, 1268-1277, 1269-1278, 1270-1279, 1271-1280, 1272- 1281, 1273-1282, 1274-1283, 1275-1284, 1276-1285, 1277-1286, 1278-1287, 1279-1288, 1280-1289, 1281-1290, 1282-1291, 1283-1292, 1284-1293, 1285-1294, 1286-1295, 1287- 1296, 1288-1297, 1289-1298, 1290-1299, 1291-1300, 1292-1301, 1293-1302, 1294-1303, 1295-1304, 1296-1305, 1297-1306, 1298-1307, 1299-1308, 1300-1309, 1301-1310, 1302- 1311, 1303-1312, 1304-1313, 1305-1314, 1306-1315, 1307-1316, 1308-1317, 1309-1318, 1310-1319, 1311-1320, 1312-1321, 1313-1322, 1314-1323, 1315-1324, 1316-1325, 1317- 1326, 1318-1327, 1319-1328, 1320-1329, 1321-1330, 1322-1331, 1323-1332, 1324-1333, 1325-1334, 1326-1335, 1327-1336, 1328-1337, 1329-1338, 1330-1339, 1331-1340, 1332- 1341, or 1333-1342 of SEQ DD NO:3. In a specific embodiment, the polypeptide fragment of the invention is an antigenic or immunogenic fragment.

In certain embodiments, the present invention includes SGA-72M polypeptides comprising or conesponding to a N-terminal fragment of the SGA-72M polypeptide of at least 10, 25, 40, 60, 75, 100, 125, 150, 200, 250, 300, 350 amino acids contiguous to the N-terminus, but of less than 800 amino acids or less than 500 amino acids or less than 100 amino acids. In a specific embodiment, the N-terminal fragment is amino acids 1-312 of SEQ DD NO:3. In other embodiments, the present invention includes SGA- 72M polypeptides comprising or conesponding to a C-terminal fragment of the SGA-72M polypeptide of at least 10, 25, 40, 60, 75, 100, 125, 150, 200, 250, 300, 350 amino acids contiguous to the C-terminus, but of less than 800 amino acids or less than 500 amino acids or less than 100 amino acids. In a specific embodiment, the C-terminal fragment is amino acids 1033-1342 of SEQ DD NO:3.

In certain embodiments, the present invention includes SGA-72M polypeptides comprising or conesponding to a fragment of the SGA-72M polypeptide which is a cytoplasmic, transmembrane, extracellular, or other domain (e.g., ligand binding domain) of a SGA-72M polypeptide. A hydropathy plot can be used to determine relatively hydrophobic regions of the protein which conespond to transmembrane domains thus allowing determination of extracellular and intracellular domains.

In addition, SGA-72M derivatives may include polypeptides that have conservative amino acid substitution(s) and/or display a functional activity of an SGA-72M gene product, including but not limited to SGA-72M. Such a derivative may contain deletions, additions or substitutions of amino acid residues within the amino acid sequence encoded by the SGA-72M gene sequences described, above, in Section 5.1, but which result in a silent change, thus producing a functionally equivalent SGA-72M gene product. In a specific embodiment, the invention provides a functionally equivalent polypeptide that exhibits a substantially similar in vivo activity as an endogenous SGA-72M gene product encoded by an SGA-72M gene sequence described in Section 5.1, above. An in vivo activity of the SGA-72M gene product can be exhibited by, for example, preneoplastic and/or neoplastic transformation of a cell upon overexpression of the gene product, such as for example, may occur in the onset and progression and metastasis of breast cancer.

An SGA-72M gene product sequence preferably comprises an amino acid sequence that exhibits at least about 65% sequence similarity to SGA-72M, more preferably exhibits at least 70% sequence similarity to SGA-72M, yet more preferably exhibits at least about 75% sequence similarity to SGA-72M. In other embodiments, the SGA-72M gene product sequence preferably comprises an amino acid sequence that exhibits at least 85% sequence similarity to SGA-72M, yet more preferably exhibits at least 90% sequence similarity to SGA-72M, and most preferably exhibits at least about 95% sequence similarity to SGA-72M. In other embodiments of the present invention, an SGA-72M gene product sequence preferably comprises an amino acid sequence that exhibits at least about 65% sequence identity to SGA-72M, more preferably exhibits at least 70% sequence identity to SGA-72M, yet more preferably exhibits at least about 75% sequence identity to SGA-72M. In yet other embodiments, the SGA-72M gene product sequence preferably comprises an amino acid sequence that exhibits at least 85% sequence identity to SGA-72M, yet more preferably exhibits at least 90% sequence identity to SGA-72M, and most preferably exhibits at least about 95% sequence identity to SGA-72M.

The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A prefened, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc Natl Acad Sci. 87:2264-2268, modified as in Karlin and Altschul (1993) Proc Natl Acad Sci. 90:5873-5877. Such an algorithm is incoφorated into the NBLAST and XBLAST programs of Altschul et al (1990) J. Mol Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST polypeptide searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to polypeptide molecules of the invention. To obtain gapped alignments for comparison puφoses, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389- 3402. Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI- Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.

Another prefened, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) CABIOS 4: 11-17. Such an algorithm is incoφorated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Additional algorithms for sequence analysis are known in the art and include ADVANCE and ADAM as described in Torellis and Robotti (1994) Comput. Appl. Biosci., 10:3-5; and FASTA described in Pearson and Lipman (1988) 85 :2444-8. Within FASTA, ktup is a control option that sets the sensitivity and speed of the search. If ktup=2, similar regions in the two sequences being compared are found by looking at pairs of aligned residues; if ktup=l, single aligned amino acids are examined, ktup can be set to 2 or 1 for polypeptide sequences, or from 1 to 6 for DNA sequences. The default if ktup is not specified is 2 for polypeptides and 6 for DNA. For a further description of FASTA parameters, see http://bioweb.pasteur.fr/docs/man/man/fasta.1.html#sect2.

The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted. However, conservative substitutions should be considered in evaluating sequences that have a low percent identity with the SGA-72M sequences disclosed herein.

In a specific embodiment, molecules or polypeptides comprising at least 10, 20, 30, 40 or 50 amino acids of SEQ DD NO:3, or at least 10, 20, 30, 40, 50, 75, 100, or 200 amino acids of SEQ DD NO: 3 are used in the present invention.

In certain embodiments of the present invention, an SGA-72M polypeptide is not encoded by a nucleotide sequence comprising an open reading frame consisting essentially of any of SEQ DD NOs: 19-26 or a fragment of any of the foregoing nucleic acids.

In certain embodiments, an SGA-72M polypeptide is greater than approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100 or 1200 amino acids in length.

In other embodiments, an SGA-72M polypeptide is less than approximately 1200, 1100, 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 250, 200, 175, 150, 140, 130, 120, 110, or 100 amino acids in length. In specific embodiments, an SGA-72M polypeptide (or peptide) is less than 90, 75, 60, 50, 40, or 30, 25, or 20 amino acids in length.

5.2.1 FUSION POLYPEPTIDES SGA-72M gene products can also include fusion polypeptides comprising an

SGA-72M gene product sequence as described above operatively associated to a heterologous, component, e.g., peptide for use in the methods of the invention. Heterologous components can include, but are not limited to sequences that facilitate isolation and purification of fusion polypeptide, or label components. Heterologous components can also include sequences that confer stability to the SGA-72M gene product. Such isolation and label components are well known to those of skill in the art. The present invention encompasses the use of fusion polypeptides comprising the polypeptide or fragment thereof encoded for by the SGA-72M gene open reading frames SEQ DD NO: 3 and a heterologous polypeptide (i.e., an unrelated polypeptide or fragment thereof, preferably at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids of the polypeptide). The fusion can be direct, but may occur through linker sequences. The heterologous polypeptide may be fused to the N-terminus or C-terminus of an SGA-72M gene product.

A fusion polypeptide can comprise an SGA-72M gene product fused to a heterologous signal sequence at its N-terminus. Various signal sequences are commercially available. Eukaryotic heterologous signal sequences include, but art not limited to, the secretory sequences of melittin and human placental alkaline phosphatase (Sfratagene; La Jolla, California). Prokaryotic heterologous signal sequences useful in the methods of the invention include, but are not limited to, the phoA secretory signal (Sambrook et al, eds., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and the protein A secretory signal (Pharmacia Biotech; Piscataway, New Jersey).

The SGA-72M polypeptide or fragment thereof encoded for by the SGA- 72M open reading frames SEQ DD NO: 3 can be fused to tag sequences, e.g., a hexahistidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., Chatsworth, CA, 91311), among others, many of which are commercially available for use in the methods of the invention. As described in Gentz et al, 1989, Proc. Natl. Acad. Sci. USA, 86:821-824, for instance, hexa-histidine provides for convenient purification of the fusion polypeptide. Other examples of peptide tags are the hemagglutinin "HA" tag, which conesponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, 1984, Cell, 37:767) and the "flag" tag (Knappik et al, 1994, Biotechniques, 17(4):754-761). These tags are especially useful for purification of recombinantly produced polypeptides of the invention.

Any fusion polypeptide may be readily purified by utilizing an antibody specific or selective for the fusion polypeptide being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion polypeptides expressed in human cell lines (Janknecht et al, 1991, Proc. Natl Acad. Sci. USA 88:8972). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni²⁺ nitriloacetic acid-agarose columns and histidine-tagged polypeptides are selectively eluted with imidazole-containing buffers.

An affinity label can also be fused at its amino terminal to the carboxyl terminal of the polypeptide or fragment thereof encoded for by an SGA-72M open reading frame SEQ DD NO:3 for use in the methods of the invention. The precise site at which the fusion is made in the carboxyl terminal is not critical. The optimal site can be determined by routine experimentation. An affinity label can also be fused at its carboxyl terminal to the amino terminal of the SGA-72M gene product for use in the methods of the invention. A variety of affinity labels known in the art may be used, such as, but not limited to, the immunoglobulin constant regions, (Petty, 1996, Metal-chelate affinity chromatography, in Current Protocols in Molecular Biology, Vol. 2, Ed. Ausubel et al, Greene Publish. Assoc. & Wiley Interscience), glutathione S-transferase (GST; Smith, 1993, Methods Mol Cell Bio. 4:220-229), the E. coli maltose binding protein (Guan et al, 1987, Gene 67:21-30), and various cellulose binding domains (U.S. Patent Nos. 5,496,934; 5,202,247; 5,137,819; Tomme et al, 1994, Protein Eng. 7:117-123), etc. Other affinity labels may impart fluorescent properties to an SGA-72M gene product, e.g., green fluorescent protein and the like. Other affinity labels are recognized by specific binding partners and thus facilitate isolation by affinity binding to the binding partner that can be immobilized onto a solid support. Some affinity labels may afford the SGA-72M gene product novel structural properties, such as the ability to form multimers. These affinity labels are usually derived from proteins that normally exist as homopolymers. Affinity labels such as the extracellular domains of CD8 (Shiue et al, 1988, J. Exp. Med. 168:1993- 2005), or CD28 (Lee et al, 1990, J. Immunol. 145:344-352), or fragments of the immunoglobulin molecule containing sites for interchain disulfide bonds, could lead to the formation of multimers.

As will be appreciated by those skilled in the art, many methods can be used to obtain the coding region of the above-mentioned affinity labels, including but not limited to, DNA cloning, DNA amplification, and synthetic methods. Some of the affinity labels and reagents for their detection and isolation are available commercially.

A prefened affinity label is a non- variable portion of the immunoglobulin molecule. Typically, such portions comprise at least a functionally operative CH2 and CH3 domain of the constant region of an immunoglobulin heavy chain. Fusions are also made using the carboxyl terminus of the Fc portion of a constant domain, or a region immediately amino-terminal to the CHI of the heavy or light chain. Suitable immunoglobulin-based affinity label may be obtained from IgG-1, -2, -3, or -4 subtypes, IgA, IgE, IgD, or IgM, but preferably IgGl . Preferably, a human immunoglobulin is used when the SGA-72M gene product is intended for in vivo use for humans. Many DNA encoding immunoglobulin light or heavy chain constant regions are known or readily available from cDNA libraries. See, for example, Adams et al, Biochemistry, 1980, 19:2711-2719; Gough et al, 1980, Biochemistry, 19:2702-2710; Dolby et al, 1980, Proc. Natl. Acad. Sci. U.S.A., 77:6027- 6031; Rice et al, 1982, Proc. Natl. Acad. Sci. U.S.A., 79:7862-7865; Falkner et al, 1982, Nαtwre, 298:286-288; and Morrison et al, 1984, Ann. Rev. Immunol, 2:239-256. Because many immunological reagents and labeling systems are available for the detection of immunoglobulins, the SGA-72M gene product-Ig fusion polypeptide can readily be detected and quantified by a variety of immunological techniques known in the art, such as the use of enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, fluorescence activated cell sorting (FACS), etc. Similarly, if the affinity label is an epitope with readily available antibodies, such reagents can be used with the techniques mentioned above to detect, quantitate, and isolate the SGA-72M gene product containing the affinity label. In many instances, there is no need to develop specific or selective antibodies to the SGA-72M gene product.

A fusion polypeptide can comprise an SGA-72M gene product fused to the Fc domain of an immunoglobulin molecule or a fragment thereof for use in the methods of the invention. A fusion polypeptide can also comprise an SGA-72M gene product fused to the CH2 and/or CH3 region of the Fc domain of an immunoglobulin molecule. Furthermore, a fusion polypeptide can comprise an SGA-72M gene product fused to the CH2, CH3, and hinge regions of the Fc domain of an immunoglobulin molecule (see Bowen et al, 1996, J. Immunol. 156:442-49). This hinge region contains three cysteine residues that are normally involved in disulfide bonding with other cysteines in the Ig molecule. Since none of the cysteines are required for the peptide to function as a tag, one or more of these cysteine residues may optionally be substituted by another amino acid residue, such as for example, serine.

Various leader sequences known in the art can be used for the efficient secretion of the SGA-72M gene product from bacterial and mammalian cells (von Heijne, 1985, J. Mol Biol. 184:99-105). Leader peptides are selected based on the intended host cell, and may include bacterial, yeast, viral, animal, and mammalian sequences. For example, the heφes virus glycoprotein D leader peptide is suitable for use in a variety of mammalian cells. A prefened leader peptide for use in mammalian cells can be obtained from the V- J2-C region of the mouse immunoglobulin kappa chain (Bernard et al. , 1981 , Proc. Natl. Acad. Sci. 78:5812-5816). Prefened leader sequences for targeting SGA-72M gene product expression in bacterial cells include, but are not limited to, the leader sequences of the E. coli proteins OmpA (Hobom et al, 1995, E>ev. Biol. Stand. 84:255- 262), Pho A (Oka et al, 1985, Proc. Natl Acad. Sci 82:7212-16), OmpT (Johnson et al, 1996, Protein Expression 7:104-113), LamB and OmpF (Hoffman & Wright, 1985, Proc. Natl. Acad. Sci. USA 82:5107-5111), β-lactamase (Kadonaga et al, 1984, J. Biol. Chem. 259:2149-54), enterotoxins (Morioka-Fujimoto et al, 1991, J. Biol Chem. 266:1728-32), and the Staphylococcus aureus protein A (Abrahmsen et al, 1986, Nucleic Acids Res. 14:7487-7500), and the B. subtilis endoglucanase (Lo et al, Appl. Environ. Microbiol. 54:2287-2292), as well as artificial and synthetic signal sequences (Maclntyre et al, 1990, Mol Gen. Genet. 221:466-74; Kaiser et al, 1987, Science, 235:312-317).

A fusion polypeptide can comprise an SGA-72M gene product and a cell permeable peptide, which facilitates the transport of a polypeptide across the plasma membrane for use in the methods of the invention. Examples of cell permeable peptides include, but are not limited to, peptides derived from hepatitis B virus surface antigens (e.g., the PreS2- domain of hepatitis B virus surface antigens), heφes simplex virus VP22, antennapaedia, 6H, 6K, and 6R. See, e.g., Oess et al, 2000, Gene Ther. 7:750-758, DeRossi et al, 1998, Trends Cell Biol 8(2): 84-7, and Hawiger, 1997, J. Curr Opin Immunol 9(2): 189-94. Fusion polypeptides can be produced by standard recombinant DNA techniques or by protein synthetic techniques, e.g., by use of a peptide synthesizer. For example, a nucleic acid molecule encoding a fusion polypeptide can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, e.g., Current Protocols in Molecular Biology, Ausubel et al, eds., John Wiley & Sons, 1992). The nucleotide sequence coding for a fusion polypeptide can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted polypeptide-coding sequence. The expression of a fusion polypeptide may be regulated by a constitutive, inducible or tissue-specific or - selective promoter. It will be understood by the skilled artisan that fusion polypeptides, which can facilitate solubility and/or expression, and can increase the in vivo half-life of the polypeptide or fragment thereof encoded for by an SGA-72M ORF SEQ DD NO:3 and thus are useful in the methods of the invention. The SGA-72M gene products or peptide fragments thereof, or fusion polypeptides can be used in any assay that detects or measures SGA-72M gene products or in the calibration and standardization of such assay.

The methods of invention encompass the use of SGA-72M gene products or peptide fragments thereof, which may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing the SGA-72M gene polypeptides and peptides of the invention by expressing nucleic acid containing SGA-72M gene sequences are described herein. Methods that are well known to those skilled in the art can be used to construct expression vectors containing SGA-72M gene product coding sequences (including but not limited to SEQ DD NO:3) and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook et al, 1989, supra, and Ausubel et al,

1989, supra. Alternatively, RNA capable of encoding SGA-72M gene product sequences may be chemically synthesized using, for example, synthesizers (see e.g., the techniques described in Oligonucleotide Synthesis, 1984, Gait, M.J. ed., D L Press, Oxford).

5.2.2 EXPRESSION SYSTEMS A variety of host-expression vector systems may be utilized to express the

SGA-72M gene coding sequences for use in the methods of the invention. Such host- expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, exhibit the SGA-72M gene product of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing SGA-72M gene product coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing the SGA-72M gene product coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the SGA-72M gene product coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing SGA-72M gene product coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter).

In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the SGA-72M gene product being expressed. For example, when a large quantity of such a polypeptide is to be produced, for the generation of pharmaceutical compositions of SGA-72M polypeptide or for raising antibodies to SGA-72M polypeptide, vectors that direct the expression of high levels of fusion polypeptide products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al, 1983, EMBOJ. 2:1791), in which the SGA-72M gene product coding sequence maybe ligated individually into the vector in frame with the lac Z coding region so that a fusion polypeptide is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503); and the like. pGΕX vectors may also be used to express foreign polypeptides as fusion polypeptides with glutathione S- transferase (GST). In general, such fusion polypeptides are soluble and can easily be purified from lysed cells by adsoφtion and binding to a matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGΕX vectors are designed to include, e.g., thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.

In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The SGA-72M gene coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of SGA-72M gene coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed (e.g., see Smith et al, 1983, J. Virol. 46:584; Smith, U.S. Patent No. 4,215,051). In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the SGA-72M gene coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing SGA-72M gene product in infected hosts. (See, e.g., Logan & Shenk, 1984, Proc. Natl Acad. Sci. USA 8 .:3655). Specific initiation signals may also be required for efficient translation of inserted SGA- 72M gene product coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire SGA-72M gene, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the SGA-72M gene coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (See Bittner et al, 1987, Methods in Enzymol. 153:516).

In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of polypeptide products may be important for the function of the polypeptide. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of polypeptides and gene products. Appropriate cell lines or host systems can be chosen to ensure the conect modification and processing of the foreign polypeptide expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB26, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.

For long-term, high-yield production of recombinant polypeptides, stable expression is preferred. For example, cell lines that stably express the SGA-72M gene product may be engineered. Rather than using expression vectors that contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci that in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines that express the SGA-72M gene product. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the SGA-72M gene product. A number of selection systems may be used, including but not limited to the heφes simplex virus thymidine kinase (Wigler et al, 1977, Cell 11 :223), hypoxanthine- guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy et al, 1980, Cell 22:817) genes can be employed in tk^", hgprt^" or aprf cells, respectively. Also, antimetabohte resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al, 1980, Proc Natl. Acad. Sci. USA 77:3567; O'Hare et al, 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colbene-Garapin et al, 1981, J. Mol Biol. 150:1); and hygro, which confers resistance to hygromycin (Santene et al, 1984, Gene 30:147). 5.2.3 SGA-72M TRANSGENIC ANIMALS

The SGA-72M gene products can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, guinea pigs, sheep, pigs, micro-pigs, goats, and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate SGA-72M transgenic animals.

Transgenic animals that over- or mis-express an SGA-72M gene product may be used in any of the methods of the invention. For example transgenic animals may be used to study the in vivo effects of enhanced expression levels of SGA-72M and the onset, diagnosis or prognosis of cancer. Transgenic animals would be useful to screen antagonists or agonists of SGA-72M. Transgenic animals could be used to screen the in vivo effects of anti-sense or ribozyme therapeutic molecules in the treatment of cancer. Transgenic animals could be used to screen for methods of vaccinating against cancer using an SGA-72M gene product or a portion thereof.

Further, SGA-72M knock out animals are also useful in the methods of the invention. For example, animals with disruptions in only SGA-72M can be useful in assessing the relative contribution of each of these gene products to the cancer state, as well as assessing the positive effect of a cancer therapeutic candidate.

For over- or mis-expression of an SGA-72M gene product, any technique known in the art may be used to introduce the SGA-72M gene product into animals to produce the founder lines of transgenic animals. Such techniques include, but are not limited to pronuclear microinjection (Hoppe and Wagner, 1989, U.S. Pat. No. 4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten et al, 1985, Proc. Natl. Acad. Sci. USA 82:6148); gene targeting in embryonic stem cells (Thompson et al, 1989, Cell 56:313); electroporation of embryos (Lo, 1983, Mol Cell. Biol. 3:1803); and sperm- mediated gene transfer (Lavifrano et al, 1989, Cell 57:717); etc. For a review of such techniques, see Gordon, 1989, Transgenic Animals, Intl. Rev. Cytol. 115:171.

The methods of the invention provide for the use of transgenic animals that carry the SGA-72M transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i.e., mosaic animals. The transgene may be integrated as a single transgene or in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al (Lasko et al, 1992, Proc. Natl. Acad. Sci. USA 89:6232). The regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.

When it is desired that the SGA-72M transgene be integrated into the chromosomal site of the endogenous SGA-72M gene, for example to disrupt the expression of SGA-72M, gene targeting is prefened. Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenous SGA-72M gene are designed for the puφose of integrating, via homologous recombination with chromosomal sequences, into and partially or wholly disrupting the function of the nucleotide sequence of the endogenous SGA-72M gene. The transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenous SGA- 72M gene in only that cell type, by following, for example, the teaching of Gu et al (Gu et al, 1994, Science 265:103). The regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.

Methods for the production of single-copy transgenic animals with chosen sites of integration are also well known to those of skill in the art. See, for example, Bronson et al. (Bronson, S.K. et al, 1996, Proc. Natl Acad. Sci. USA 93:9067).

Once transgenic animals have been generated, the expression of the recombinant SGA-72M gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to assay whether integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include but are not limited to Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and RT-PCR. Samples of SGA-72M gene-expressing tissue, may also be evaluated immunocytochemically using antibodies specific or selective for the SGA-72M gene product.

5.3 ANTIBODIES TO SGA-72M GENE PRODUCTS The present invention provides anti-SGA-72M antibodies and fragments thereof capable of specifically or selectively recognizing one or more SGA-72M gene product epitopes or epitopes of conserved variants or peptide fragments of the SGA-72M gene products. Such antibodies may include, but are not limited to, polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')₂ fragments, Fv fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.

Such antibodies may be used, for example, in the detection of an SGA-72M gene product in an biological sample and may, therefore, be utilized as part of a diagnostic or prognostic technique whereby patients may be tested for abnormal levels of SGA-72M gene products, and/or for the presence of abnormal forms of the such gene products. Such antibodies may also be included as a reagent in a kit for use in a diagnostic or prognostic technique. Such antibodies may also be utilized in conjunction with, for example, compound screening methods, as described, below, in Section 5.7, for the evaluation of the effect of test compounds on SGA-72M gene product levels and/or activity. Additionally, such antibodies can be used in conjunction with the gene therapy techniques described, below, in Section 5.8.4, to, for example, evaluate the normal and/or engineered SGA-72M- expressing cells prior to their introduction into the patient.

Antibodies to the SGA-72M gene product may additionally be used in a method for the inhibition of SGA-72M gene product activity. Thus, such antibodies may, therefore, be utilized as part of cancer diagnostic and treatment methods. Described herein are methods for the production of antibodies or fragments thereof. Any of such antibodies or fragments thereof may be produced by standard immunological methods or by recombinant expression of nucleic acid molecules encoding the antibody or fragments thereof in an appropriate host organism.

Antibodies of the invention are preferably monoclonal, and may be multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, and SGA- 72M binding fragments of any of the above. The term "antibody," as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds SGA-72M. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule. In certain embodiments of the invention, the antibodies are human antigen- binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')₂, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a light chain variable domain ("VL") or a heavy chain variable domain ("VH"). Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CHI, CH2, CH3 and CL domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CHI, CH2, CH3 and CL domains. Preferably, the antibodies are human, murine (e.g., mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camelid, horse, or chicken. As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries, from human B cells, or from animals transgenic for one or more human immunoglobulin, as described infra and, for example in U.S. Patent No. 5,939,598 by Kucherlapati et al.

The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of SGA-72M or may be specific for both SGA-72M as well as for a heterologous protein. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al, 1991, J. Immunol. 147:60-69; U.S. Patent Nos.

4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al, 1992, J. Immunol. 148:1547-1553.

Antibodies of the present invention may also be described or specified in terms of their binding affinity to SGA-72M. Prefened binding affinities include those with a dissociation constant or Kd less than 5 X 10^"2 M, 10^"2 M, 5 X 10^"3 M, 10^"3 M, 5 X 10^"4 M, 10^"4 M, 5 X 10^"5 M, 10^"5 M, 5 X 10^"6 M, 10^"6 M, 5 X 10^"7 M, 10^"7M, 5 X 10^"8 M, 10^"8 M, 5 X 10^"9 M, 10^"9 M, 5 X 10-¹⁰ M, 10^-10 M, 5 X 10^"11 M, 10^"11 M, 5 X 10^"12 M, 10^"12 M, 5 X ^'13 M, 10^"13 M, 5 X 10^"14 M, 10^"14 M, 5 X 10^"15 M, or 10^"15 M. Antibodies can be screened using antibody binding kinetic assays well known in the art (e.g., surface plasmon resonance based assays, such as a BIACORE™ assay) to identify antibodies having a desired Kd rate.

The antibodies and proteins of the invention can be purified, for example by affinity chromatography with the SGA-72M antigen or using Protein A affinity chromatography. In certain embodiments, the antibody is at least 50%, at least 60%, at least 70% or at least 80% pure. In other embodiments, the antibody is more than 85% pure, more than 90% pure, more than 95% pure or more than 99% pure.

* The antibodies of the invention include derivatives that are modified, i.e, by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from binding to SGA-72M. For example, but not by way of limitation, the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.

The antibodies of the present invention may be generated by any suitable method known in the art. Any of the SGA-72M polypeptides, SGA-72M-related polypeptides, fragments, or derivatives described above can be used as immunogens in the generation of antibodies. In specific embodiments, immunogenic fragments of SGA-72M polypeptides or SGA-72M-related polypeptides are at least 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100, 150, 200, 250, 250, 300, 350, or 400 amino acid residues. Polyclonal antibodies to SGA-72M can be produced by various procedures well known in the art. For example, a SGA-72M polypeptide or a fragment (e.g., an N-terminal fragment that is 10- 800, 10-500, 10-100, or 10-100 residues of SEQ ID NO:3 such as residues 1-312 of SEQ DD NO:3, a C-terminal fragment that is 10-800, 10-500, 10-100, or 10-100 residues of SEQ DD NO:3 such as residues 1033-1342 of SEQ DD NO:3, extracellular domain, intracellular domain, ligand binding domain, binding partner domain) or derivative thereof can be administered to various animals including, but not limited to, rodents (e.g., mouse, rat), donkey, sheep, rabbit, goat, guinea pig, camelid, horse, or chicken, etc. to induce the production of sera containing polyclonal antibodies specific for the protein. Various adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art. Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al. , Antibodies: A Laboratory Manual, (Cold Spring Harbor

Laboratory Press, 2nd ed., 1988); Hammerling, et al, in: Monoclonal Antibodies and T- Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said references incoφorated by reference in their entireties). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. In a non-limiting example, animals, including, but not limited to, rodents (e.g., mouse, rat), donkey, sheep, rabbit, goat, guinea pig, camelid, horse, or chicken, can be immunized with an immunogenic SGA-72M polypeptide, SGA-72M-related polypeptide, or fragment thereof (e.g., an N-terminal fragment that is 10-800, 10-500, 10-100, or 10-100 residues of SEQ DD NO:3 such as residues 1-312 of SEQ ID NO:3, a C-terminal fragment that is 10-800, 10-500, 10-100, or 10-100 residues of SEQ DD NO:3 such as residues 1033-1342 of SEQ DD NO:3, extracellular domain, intracellular domain, ligand binding domain, binding partner domain) or derivative thereof or a cell expressing an immunogenic SGA-72M polypeptide, a fragment or derivative thereof. In specific embodiments, immunogenic fragments of SGA- 72M polypeptides or SGA-72M-related polypeptides are at least 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100, 150, 200, 250, 250, 300, 350, or 400 amino acid redidues. Once an immune response is detected, e.g., anti-SGA-72M antibodies are detected in the serum of the immumzed animal, the spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies that bind SGA-72M. Ascites fluid, which generally contains high levels of antibodies, can be generated by injecting animals, preferably mice, with positive hybridoma clones. Accordingly, the present invention provides methods of generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with a SGA-72M polypeptide or a SGA-72M-related polypeptide of the invention with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind to SGA-72M or a SGA-72M-related polypeptide.

In one embodiment, a method of making an antibody comprises immunizing an animal with a molecule comprising (a) SEQ DD NO:3 or (b) an immunogenic fragment of SEQ DD NO:3.

In another embodiment, a method of making an antibody comprises:

(a)administering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO: 1 , the antisense strand to SEQ ID NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C, such that an antibody to said SGA-72M polypeptide is produced by said animal; and

(b) recovering the antibody. In another embodiment, a method of making an antibody comprises:

(a) administering a immunogenic amount of a fragment of a SGA-72M- related polypeptide to an animal, in which the fragment comprises a domain of the SGA- 72M-related polypeptide selected from the group consisting of the N-terminal domain, C- terminal domain, extracellular domain, transmembrane domain, and intracellular domain, in which the SGA-72M polypeptide comprises an amino acid sequence encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C, such that an antibody to said fragment is produced by said animal; and

(b) recovering the antibody. In another embodiment, a method of making a monoclonal antibody comprises:

(a) admimstering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ LD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) recovering spleen cells from said animal; (c) fusing the recovered spleen cells with a cell of a myeloma to generate hybridomas;

(d) screening to select a hybridoma producing antibody to said SGA-72M- related polypeptide; and

(e) recovering the antibody. In another embodiment, a method of making a monoclonal antibody comprises: (a) fusing a spleen cell from an animal immumzed with an immunogenic amount of a SGA-72M-related polypeptide with a cell of a myeloma to generate hybridomas, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO: 1 , the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) screening to select a hybridoma producing antibody to said SGA-72M- related polypeptide; and

(c) recovering the antibody.

In another embodiment, a method of making a monoclonal antibody comprises:

(a) administering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02%

PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) recovering lymphocytes from said animal; (c) fusing the recovered lymphocytes with a cell of a myeloma, plastocytoma or lymphoblastoid cell line to generate hybridomas;

(d) screening to select a hybridoma producing antibody to said SGA-72M- related polypeptide; and (e) recovering the antibody.

In another embodiment, a method of making a monoclonal antibody comprises:

(a) fusing a lymphocyte from an animal immumzed with an immunogenic amount of a SGA-72M-related polypeptide with a cell of a myeloma, plastocytoma or lymphoblastoid cell line to generate hybridomas, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(c) recovering the antibody.

In another embodiment, a method of making a monoclonal antibody comprises:

(a) administering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS, for 1.5 hours at 60°C;

(b) recovering lymphocytes from said animal;

(c) immortalizing the recovered lymphocytes with Epstein-Barr virus to generate immortalized cells; (d) screening to select an immortalized cell producing antibody to said SGA-

72M-related polypeptide; and

(e) recovering the antibody.

In another embodiment, a method of making a monoclonal antibody comprises: (a) immortalizing a lymphocyte from an animal immunized with an immunogenic amount of a SGA-72M-related polypeptide with Epstein-Ban virus to generate immortalized cells, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO: 1 , the antisense strand to SEQ DD NO: 1 , SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) screening to select an immortalized cell producing antibody to said SGA- 72M-related polypeptide; and (c) recovering the antibody. In another embodiment, a method of producing a phage Fab expression library comprises:

(a) isolating spleen cells from an animal immunized with an immunogenic amount of a SGA-72M-related polypeptide, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris- HCI (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C; (b) amplifying, by polymerase chain reaction, antibody heavy and light chain nucleotide sequences from messenger RNA isolated from the spleen cells;

(c) cloning the amplified heavy chain and light chain nucleotide sequences into a lambda phage vector to produce a heavy chain library and a light chain library, respectively; (d) combimng and ligating the heavy and light chain nucleotide sequences from the heavy chain and light chain libraries to produce a phage Fab expression library that co-expresses antibody heavy and light chains; and

(e) screening the expression library for a phage that binds said SGA-72M- related polypeptide. In a specific embodiment, antibodies of the invention that bind to SGA-72M polypeptide are antibodies produced by hybridoma colonies 7.3, 7.21, 8.11, and 8.39. Each hybridoma colony was subjected to limited dilution cloning (see Section 6.2.13) and the homogenous hybridomas conesponding to hybridoma colonies 7.3, 7.21, 8.11, and 8.39 were designated 7.3.1, 7.21.1, 8.11.1, and 8.39.1, respectively. Antibodies produced by hybridomas 7.3.1, 7.21.1, 8.11.1, and 8.39.1 are designated monoclonal antibodies 7.3.1, 7.21.1, 8.11.1, and 8.39.1, respectively. Thus, in a more specific embodiment, antibodies of the invention that bind to SGA-72M polypeptide are monoclonal antibodies 7.3.1, 7.21.1, 8.11.1, and 8.39.1. Hybridoma 7.3.1 producing monoclonal antibody 7.3.1 has been deposited with the American Type Culture Collection (ATCC, P.O. Box 1549, Manassas, VA 20108) on July 11, 2003 under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Puφoses of Patent Procedures, and assigned accession number _, and is incoφorated by reference.

The present invention also encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide at its N-terminus (e.g., residues 1-312 of SEQ DD NO:3) or its C-terminus (e.g., residues 1033-1342 of SEQ DD NO:3). In a specific embodiment, the antibody that binds a SGA-72M polypeptide at its N-terminus is antibody 8.11.1 or 8.39.1. In a specific embodiment, the antibody that binds a SGA-72M polypeptide at its C-terminus is monoclonal antibody 7.3.1 or 7.21.1.

The present invention also encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide competitively inhibits the binding of monoclonal antibodies 7.3.1, 7.21.1, 8.11.1, and/or 8.39.1 with a SGA-72M polypeptide, e.g. as assayed by ELISA or any other appropriate immunoassay. The present invention also encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide and block monoclonal antibodies 7.3.1, 7.21.1, 8.11.1, and/or 8.39.1 binding to a SGA-72M polypeptide, e.g. as assayed by ELISA or any other appropriate immunoassay.

The present invention also encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide and comprise one or more complementarity determining regions (CDRs) from monoclonal antibody 7.3.1. CDRs are hypervariable regions in antibody light chains and in antibody heavy chains, (see, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991)) The present invention also encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide or SGA-related polypeptide, said antibodies comprising one out of three, two out of three, or all three VH CDRs of the VH CDRs of monoclonal antibody 7.3.1. The present invention also encompasses the use of antibodies that bind to a SGA-72M polypeptide or SGA-72M-related polypeptide, said antibodies comprising one or more VH CDRs and one or more VL CDRs of monoclonal antibody 7.3.1. In particular, the invention encompasses the use of antibodies that bind to a SGA- 72M polypeptide or SGA-72M-related polypeptide, said antibodies comprising all three VH CDRs of the VH CDRs of monoclonal antibody 7.3.1 and all three VL CDRs the VL CDRs of monoclonal antibody 7.3.1.

The present invention also encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide or a SGM-72M-related polypeptide , said antibodies or antibody fragments comprising an amino acid sequence of a light chain and/or heavy chain variable domain that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%o, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of the light chain and/or heavy chain variable domain of monoclonal antibody 7.3.1. The present invention further encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide or a SGA-related polypeptide, said antibodies or antibody fragments comprising amino acid sequences of at least one out of three, at least two out of three, or all three VH CDRs that are at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of at least one out of three, at least two out of three, or all three VH CDRs, respectively, of monoclonal antibody 7.3.1. The determination of percent identity of two amino acid sequences can be determined by any method known to one skilled in the art, including BLAST protein searches.

The present invention also encompasses antibodies or antibody fragments that bind to a SGA-72M polypeptide or SGA-72M-related polypeptide, where said antibodies or antibody fragments are encoded by a nucleotide sequence that hybridizes to the nucleotide sequence of monoclonal antibody 7.3.1 under stringent conditions. In one embodiment, the invention provides antibodies or fragments thereof that bind to a SGA- 72M polypeptide or SGA-72M-related polypeptide, said antibodies or antibody fragments comprising a light chain variable domain encoded by a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of the light chain variable domain of monoclonal antibody 7.3.1. In another embodiment, the invention provides antibodies or fragments thereof that bind to a SGA-72M polypeptide, said antibodies or antibody fragments comprising a heavy chain variable domain encoded by a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of the heavy chain variable domain of monoclonal antibody 7.3.1. In another embodiment, the invention provides antibodies or fragments thereof that bind to a SGA-72M polypeptide, said antibodies or antibody fragments comprising one or more CDRs encoded by a nucleotide sequence that

no hybridizes under stringent conditions to the nucleotide sequence of one or more CDRs of monoclonal antibody 7.3.1. Stringent hybridization conditions include, but are not limited to, hybridization to filter-bound DNA in 6X sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2X SSC/0.1% SDS at about 50-65°C, highly stringent conditions such as hybridization to filter-bound DNA in 6X SSC at about 45°C followed by one or more washes in 0.1X SSC/0.2% SDS at about 60°C, or any other stringent hybridization conditions (e.g., Section 5.1.1) known to those skilled in the art (see, for example, Ausubel, F.M. et al., eds. 1989 Current Protocols in Molecular Biology, vol. 1, Green Publishing Associates, Inc. and John Wiley and Sons, Inc., NY at pages 6.3.1 to 6.3.6 and 2.10.3).

The present invention further encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide, said antibodies or antibody fragments comprising an amino acid sequence of one or more CDRs comprising amino acid residue substitutions, deletions or additions as compared to one or more CDRs of monoclonal antibody 7.3.1. The antibody comprising the one or more CDRs comprising amino acid residue substitutions, deletions or additions may have substantially the same binding, better binding, or worse binding when compared to an antibody comprising one or more CDRs without amino acid residue substitutions, deletions or additions. In specific embodiments, one, two, three, four, or five amino acid residues of the CDR have been substituted, deleted or added (i.e., mutated).

The present invention further encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide, said antibodies or antibody fragments comprising one or more CDRs encoded by a nucleotide sequence comprising nucleic acid residue substitutions, deletions or additions as compared to the nucleotide sequence of one or more CDRs of monoclonal antibody 7.3.1. The antibody comprising the one or more CDRs comprising nucleic acid residue substitutions, deletions or additions may have substantially the same binding, better binding, or worse binding when compared to an antibody comprising one or more CDRs without nucleic acid residue substitutions, deletions or additions. In specific embodiments, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or fifteen nucleic acid residues of the CDR have been substituted, deleted or added (i.e., mutated). The nucleic acid substitutions may or may not change the amino acid sequence of the mutated CDR.

ill Standard techniques known to those skilled in the art can be used to introduce mutations in the nucleotide sequence encoding an antibody, or fragment thereof, including, e.g., site-directed mutagenesis and PCR-mediated mutagenesis, which results in amino acid substitutions. Preferably, the derivatives include less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the original antibody or fragment thereof. In a prefened embodiment, the derivatives have conservative amino acid substitutions made at one or more predicted non-essential amino acid residues. Antibody fragments which recognize specific epitopes may be generated by known techniques. For example, Fab and F(ab')₂ fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')₂ fragments). F(ab')₂ fragments contain the variable region, the light chain constant region and the CH 1 domain of the heavy chain.

For example, the antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the nucleic acid sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the nucleic acid sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of lymphoid tissues). The DNA encoding the VH and VL domains are recombined together with an scFv linker by PCR and cloned into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS). The vector is electroporated in E. coli and the E. coli is infected with helper phage. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Phage expressing an antigen binding domain that binds to SGA-72M can be selected or identified with antigen e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al, 1995, J. Immunol. Methods 182:41- 50; Ames et al, 1995, J. Immunol. Methods 184:177-186; Kettleborough et al, 1994, Eur. J. Immunol. 24:952-958; Persic et al, 1997, Gene 187:9-18; Burton et al, 1994, Advances in Immunology, 191-280; PCT Application No. PCT/GB91/O1 134; PCT Publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/1 1236; WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incoφorated herein by reference in its entirety. As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')₂ fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al, BioTechniques 1992, 12(6): 864-869; and Sawai et al, 1995, AJRI 34:26-34; and Better et al, 1988, Science 240:1041-1043 (said references incoφorated by reference in their entireties).

Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Patents 4,946,778 and 5,258,498; Huston et al. , 1991, Methods in Enzymology 203:46-88 ; Shu et al, 1993, PNAS 90:7995-7999; and Skena et al, 1988, Science 240:1038-1040 . For some uses, including in vivo use of antibodies in humans and in vitro proliferation or cytotoxicity assays, it is preferable to use chimeric, humanized, or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science, 1985, 229:1202 ; Oi et al, 1986, BioTechniques 4:214; Gillies et al, 1989, J. Immunol. Methods 125:191-202; U.S. Patent Nos. 5,807,715; 4,816,567; and 4,816,397, which are incoφorated herein by reference in their entirety. Humanized antibodies are antibody molecules from non-human species antibody that binds the desired antigen having one or more CDRs from the non-human species and framework and constant regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the conesponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al, U.S. Patent No. 5,585,089; Riechmann et al, 1988, Nature 332:323 , which are incoφorated herein by reference in their entireties.) Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 9 1/09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology, 1991, 28(4/5):489-498: Studnicka et al, 1994, Protein Engineering 7(6):805-814; Roguska. et al, 1994, PNAS £1:969-973), and chain shuffling (U.S. Patent No. 5,565,332).

Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incoφorated herein by reference in its entirety.

Human antibodies can also be produced using transgenic mice which express human immunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring which express human antibodies. The transgenic mice are immumzed in the normal fashion with a selected antigen, e.g., all or a portion of SGA-72M polypeptide. Monoclonal antibodies directed against the antigen can be obtained from the immumzed, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see, Lonberg and Huszar, 1995, Int. Rev. Immunol.13:65-93. For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incoφorated by reference herein in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.

Completely human antibodies which recognize a selected epitope can be generated using a technique refened to as "guided selection." In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al, 199 , Bio/technology 12:899-903).

Further, antibodies to SGA-72M can, in turn, be utilized to generate anti- idiotype antibodies that "mimic" proteins of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, 1989, FASEB J. 7f5):437-444: and Nissinoff, 1991, J. Immunol. 147(8):2429-2438). Fab fragments of such anti-idiotypes can be used in therapeutic regimens to elicit an individual's own immune response against SGA-72M and SGA-72M-expressing tumor cells. As discussed in more detail below, the anti-SGA-72M antibodies of the present invention may be used either alone or in combination with other compositions in the prevention or treatment of HD. The proteins may further be recombinantly fused to a heterologous protein at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to cytotoxic agents, proteins or other compositions. For example, anti-SGA-72M antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as chemotherapeutics or toxins, or comprise a radionuclide for use as a radio-therapeutic. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387. The invention encompasses antibodies, fragments, or derivatives thereof that bind to a SGA-72M polypeptide comprising a heavy or light chain variable domain, said variable domain comprising (a) a set of three CDRs, in which said set of CDRs are from a monoclonal antibody to a gene product encoded for by an SGA-72M open reading frame SEQ DD NO:3, and (b) a set of four framework regions, in which said set of framework regions differs from the set of framework regions in the monoclonal antibody to a gene product encoded by an SGA-72M open reading frame SEQ DD NO:3, and in which said antibody, fragment, or derivative thereof that bind to the gene product encoded for by the SGA-72M gene sequence. Preferably, the set of framework regions is from a human monoclonal antibody, e.g., a human monoclonal antibody that does not bind the gene product encoded for by the SGA-72M gene sequence. In a specific embodiment, one or more CDRs are from monoclonal antibody 7.3.1.

In a specific embodiment, the invention provides monoclonal antibody 7.3.1 or a molecule comprising the variable region thereof (e.g., Fab), or a humanized or chimeric form of monoclonal antibody 7.3.1.

5.4 ANTI-SGA-72M ANTIBODY-DRUG CONJUGATES

As discussed, supra, the present invention encompasses anti-SGA-72M antibodies. Because SGA-72M polypeptide is a cell surface-expressed proteins, anti-SGA- 72M antibodies are expected to be useful in delivering cytotoxic agents to SGA-72M- expressing tumor cells. Thus, in certain embodiments, the antibodies of the invention are further fused or conjugated to heterologous proteins or cytotoxic agents. In prefened embodiments, antibodies that bind to a C-terminal fragment of SGA-72M (e.g., amino acid residues 1033-1342 of SEQ DI NO:3) are fused or conjugated to one or more heterologous proteins or cytotoxic agents. In more prefened embodiments, monoclonal antibodies 7.3.1 and/or 7.21.1 are fused or conjugated to one or more heterologous proteins or cytotoxic agents.

In certain embodiments, an antibody of the invention may be chemically modified. For example, an anti-SGA-72M antibody of the invention can be administered as a conjugate. Particularly suitable moieties for conjugation to proteins of the invention are chemotherapeutic agents, pro-drug converting enzymes, radioactive isotopes or compounds, or toxins. Alternatively, a nucleic acid encoding an anti-SGA-72M antibody or antibody chain may be modified to functionally couple the coding sequence of a pro-drug converting enzyme with the coding sequence the antibody or antibody chain, such that a fusion protein comprising the functionally active pro-drug converting enzyme and antibody or antibody chain is expressed in the subject upon administration of the nucleic acid in accordance with the gene therapy methods described in Sections 5.8 and 5.10, infra. In another embodiment, the anti-SGA-72M antibodies of the invention are fused or conjugated to a therapeutic agent. For example, an anti-SGA-72M antibody of the invention may be conjugated to a cytotoxic agent such as a chemotherapeutic agent, a toxin (e.g., a cytostatic or cytocidal agent), or a radionuclide (e.g., alpha-emitters such as, for example, ^2l2Bi, ²¹¹At, or beta-emitters such as, for example, ¹³¹1, ⁹⁰Y, or ⁶⁷Cu). Drugs such as methotrexate (Endo et al. , 1987, Cancer Research 47 : 1076-

1080), daunomycin (Gallego et al, 1984, Int. J. Cancer. 33:737-744), mitomycin C (MMC) (Ohkawa et al, 1986, Cancer Immunol. Immunother. 23:81-86) and vinca alkaloids (Rowland et al, 1986, Cancer Immunol Immunother. 21:183-187) have been attached to antibodies and the derived conjugates have been investigated for anti-tumor activities. Care should be taken in the generation of chemotherapeutic agent conjugates to ensure that the activity of the drug and or protein does not diminish as a result of the conjugation process.

Examples of chemotherapeutic agents include the following non-mutually exclusive classes of chemotherapeutic agents: alkylating agents, anthracyclines, antibiotics, antifolates, antimetabolites, antitubulin agents, auristatins, chemotherapy sensitizers, DNA minor groove binders, DNA replication inhibitors, duocarmycins, etoposides, fluorinated pyrimidines, lexitropsins, nitrosoureas, platinols, purine antimetabolites, puromycins, radiation sensitizers, steroids, taxanes, topoisomerase inhibitors, and vinca alkaloids. Examples of individual chemotherapeutics that can be conjugated to a nucleic acid or protein of the invention include but are not limited to an androgen, anthramycin (AMC), asparaginase, 5-azacytidine, azathioprine, bleomycin, busulfan, buthionine sulfoximine, camptothecin, carboplatin, carmustine (BSNU), CC-1065, CC-1065 analogues, calichiamicin, chlorambucil, cisplatin, colchicine, cyclophosphamide, cytarabine, cytidine arabinoside, cytochalasin B, dacarbazine, dactinomycin (formerly actinomycin), daunorubicin, decarbazine, docetaxel, dolastatin 10, doxorubicin, an estrogen, 5- fluordeoxyuridine, 5-fluorouracil, gramicidin D, hydroxyurea, idarubicin, ifosfamide, irinotecan, lomustine (CCNU), maytansine, mechlorethamine, melphalan, 6- mercaptopurine, methotrexate, mithramycin, mitomycin C, mitoxantrone, nifroimidazole, paclitaxel, palytoxin, plicamycin, procarbizine, rhizoxin, streptozotocin, tenoposide, 6- thioguanine, thioTEPA, topotecan, vinblastine, vincristine, vinorelbine, VP-16 and VM-26. In a prefened embodiment, the chemotherapeutic agent is auristatin E. Examples of other suitable drugs for conjugation to the anti-SGA-72M antibodies of the present invention are provided in Section 5.5, infra. In a more prefened embodiment, the chemotherapeutic agent is the auristatin E derivative AEB (as described in U.S. Application No. 09/845,786 filed April 30, 2001, which is incoφorated by reference here in its entirety).

The anti-SGA-72M antibodies can be conjugated or fused to non-classical therapeutic agents such as toxins for delivery of the toxins to SGA-72M-expressing tumor cells. Such toxins include, for example, abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin.

Techniques for conjugating such therapeutic moieties to proteins, and in particular to antibodies, are well known, see, e.g., Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc., 1985); Hellsfrom et al, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc., 1987); Thoφe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thoφe et al, 1982, Immunol. Rev. 62:119-58.

Two approaches may be taken to minimize drug activity outside tumor cells that are targeted by the anti-SGA-72M antibodies of the invention: first, an antibody that binds to cell surface but not soluble SGA-72M may be used, so that the drug, including drug produced by the actions of the prodrug converting enzyme, is concentrated at the cell surface of the activated lymphocyte. A more prefened approach for minimizing the activity of drugs bound to the antibodies of the invention is to conjugate the drugs in a manner that would reduce their activity unless they are hydrolyzed or cleaved off the antibody. Such methods would employ attaching the drug to the antibodies with linkers that are sensitive to the environment at the cell surface of the SGA-72M expressing tumor cell (e.g., the activity of a protease that is present at the cell surface of the SGA-72M expressing tumor cell) or to the environment inside the SGA-72M expressing tumor cell, which the conjugate encounters when it is taken up by the SGA-72M expressing tumor cell (e.g., in the endosomal environment or, for example by virtue of pH sensitivity or protease sensitivity, in the lysosomal environment).

In one embodiment, the linker is an acid- labile hydrazone or hydrazide group that is hydrolyzed in the lysosome (see, e.g., U.S. Patent No. 5,622,929) In alternative embodiments, drugs can be appended to anti-SGA-72M antibodies through other acid-labile linkers, such as cis-aconitic amides, orthoesters, acetals and ketals (Dubowchik and Walker, 1999, Pharm. Therapeutics 83:67-123; Neville et al, 1989, Biol. Chem. 264: 14653-14661). Such linkers are relatively stable under neutral pH conditions, such as those in the blood, but are unstable at below pH 5, the approximate pH of the lysosome. In other embodiments, drugs are attached to the anti-SGA-72M antibodies of the invention using peptide spacers that are cleaved by intracellular proteases. Target enzymes include cathepsins B and D and plasmin, all of which are known to hydrolyze dipeptide drug derivatives resulting in the release of active drug inside target cells (Dubowchik and Walker, 1999, Pharm. Therapeutics 83:67-123). The advantage of using intracellular proteolytic drug release is that the drug is highly attenuated when conjugated and the serum stabilities of the conjugates can be extraordinarily high.

In yet other embodiments, the linker is a malonate linker (Johnson et al, 1995, Anticancer Res. 15:1387-93), a maleimidobenzoyl linker (Lau et al, 1995, Bioorg. Med. Chem. 3(10): 1299-1304), or a 3'-N-amide analog (Lau et al, 1995, Bioorg. Med. Chem. 3(10): 1305-12).

Alternatively, an antibody of the invention can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is incoφorated herein by reference in its entirety.

As discussed above, in certain embodiments of the invention, an antibody of the invention can be co-administered with a pro-drug converting enzyme. The pro-drug converting enzyme can be expressed as a fusion protein with or conjugated to a protein of the invention. Exemplary pro-drug converting enzymes are carboxypeptidase G2, beta- glucuronidase, penicillin- V-amidase, penicillin-G-amidase, /3-lactamase, β-glucosidase, nitroreductase and carboxypeptidase A. The methods of the present invention also encompass the use of antibody- drug conjugates comprising antibodies or fragments thereof that have half-lives (e.g., serum half-lives) in a mammal, preferably a human, of greater than 15 days, preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months. The increased half-lives of the antibodies of the present invention or fragments thereof in a mammal, preferably a human, result in a higher serum titer of said antibodies or antibody fragments in the mammal, and thus, reduce the frequency of the administration of said antibodies or antibody fragments and/or reduces the concentration of said antibodies or antibody fragments to be administered. Antibodies or fragments thereof having increased in vivo half-lives can be generated by techniques known to those of skill in the art. For example, antibodies or fragments thereof with increased in vivo half-lives can be generated by modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fc domain and the FcRn receptor (see, e.g., International Publication Nos. WO 97/34631 and WO 02/060919, which are incoφorated herein by reference in their entireties). Antibodies or fragments thereof with increased in vivo half-lives can be generated by attaching to said antibodies or antibody fragments polymer molecules such as high molecular weight polyethyleneglycol (PEG). PEG can be attached to said antibodies or antibody fragments with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C- terminus of said antibodies or antibody fragments or via epsilon-amino groups present on lysine residues. Linear or branched polymer derivatization that results in minimal loss of biological activity will be used. The degree of conjugation will be closely monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies. Unreacted PEG can be separated from antibody-PEG conjugates by, e.g., size exclusion or ion-exchange chromatography.

5.4.1 LINKERS As discussed above in Section 5.4, ADCs are generally made by conjugating a drug to an antibody through a linker. Thus, a majority of the ADCs of the present invention, which comprise an anti-SGA-72M antibody and a drug, further comprise a linker. Any linker that is known in the art may be used in the ADCs of the present invention, e.g., bifunctional agents (such as dialdehydes or imidoesters) or branched hydrazone linkers (see, e.g., U.S. Patent No. 5,824,805, which is incoφorated by reference herein in its entirety).

In certain, non-limiting, embodiments of the invention, the linker region between the drug moiety and the antibody moiety of the anti-SGA-72M ADC is cleavable or hydrolyzable under certain conditions, wherein cleavage or hydrolysis of the linker releases the drug moiety from the antibody moiety. Preferably, the linker is sensitive to cleavage or hydrolysis under intracellular conditions.

In a prefened embodiment, the linker region between the drug moiety and the antibody moiety of the anti-SGA-72M ADC is hydrolyzable if the pH changes by a certain value or exceeds a certain value. In a particularly prefened embodiment of the invention, the linker is hydrolyzable in the milieu of the lysosome, e.g., under acidic conditions (i.e., a pH of around 5-5.5 or less). In other embodiments, the linker is a peptidyl linker that is cleaved by a peptidase or protease enzyme, including but not limited to a lysosomal protease enzyme, a membrane-associated protease, an intracellular protease, or an endosomal protease. Preferably, the linker is at least two amino acids long, more preferably at least three amino acids long. Peptidyl linkers that are cleavable by enzymes that are present in SGA-72M-expressing cancers are preferred. For example, a peptidyl linker that is cleavable by cathepsin-B (e.g., a Gly-Phe-Leu-Gly linker), a thiol-dependent protease that is highly expressed in cancerous tissue, can be used. Other such linkers are described, e.g., in U.S. Patent No. 6,214,345, which is incoφorated by reference in its entirety herein.

In other, non-mutually exclusive embodiments of the invention, the linker by which the anti-SGA-72M antibody and the drug of an ADC of the invention are conjugated promotes cellular intemahzation. In certain embodiments, the linker-drug moiety of the ADC promotes cellular intemahzation. In certain embodiments, the linker is chosen such that the structure of the entire ADC promotes cellular intemahzation.

In a specific embodiment of the invention, derivatives of valine-citrulline are used as linker (val-cit linker). The synthesis of doxorubicin with the val-cit linker have been previously described (U.S. patent 6,214,345 to Dubowchik and Firestone, which is incoφorated by reference herein in its entirety).

In another specific embodiment, the linker is a phe-lys linker.

In another specific embodiment, the linker is a thioether linker (see, e.g., U.S. Patent No. 5,622,929 to Willner et al, which is incoφorated by reference herein in its entirety). In yet another specific embodiment, the linker is a hydrazone linker (see, e.g., U.S. Patent Nos. 5,122,368 to Greenfield et al and 5,824,805 to King et al, which are incoφorated by reference herein in their entireties).

In yet other specific embodiments, the linker is a disulfide linker. A variety of disulfide linkers are known in the art, including but not limited to those that can be formed using SATA (N-succinimidyl-S-acetylthioacetate), SPDP (N-succinimidyl-3-(2- pyridyldithio)propionate), SPDB (N-succinimidyl-3-(2-pyridyldithio)butyrate) and SMPT (N-succinimidyl-oxycarbonyl-alpha-methyl-alpha-(2-pyridyl-dithio)toluene). SPDB and SMPT (see, e.g., Thoφe et al, 1987, Cancer Res., 47:5924-5931; Wawrzynczak et al. , 1987, In Immunoconjugates: Antibody Conjugates in Radioimagery and Therapy of

Cancer, ed. C. W. Vogel, Oxford U. Press, pp. 28-55; .see also U.S. Patent No. 4,880,935 to Thoφe et al, which is incoφorated by reference herein in its entirety).

A variety of linkers that can be used with the compositions and methods of the present invention are described in U.S. provisional application no. 60/400,403, entitled "Drug Conjugates and their use for treating cancer, an autoimmune disease or an infectious disease", by Inventors: Peter D. Senter, Svetlana Doronina and Brian E. Toki, submitted on July 31, 2002, which is incoφorated by reference in its entirety herein.

In yet other embodiments of the present invention, the linker unit of an anti- SGA-72M antibody-linker-drug conjugate (anti-SGA-72M ADC) links the cytotoxic or cytostatic agent (drug unit; -D) and the anti-SGA-72M antibody unit (-A). As used herein the term anti-SGA-72M ADC encompasses anti-SGA-72M antibody drug conjugates with and without a linker unit. The linker unit has the general formula:

— T— W— Y_y

wherein: -T- is a stretcher unit; a is 0 or 1 ; each -W- is independently an amino acid unit; w is independently an integer ranging from 2 tol2;

-Y- is a spacer unit; and y is 0, 1 or 2. 5.4.2 THE STRETCHER UNIT

The stretcher unit (-T-), when present, links the anti-SGA-72M antibody unit to an amino acid unit (-W-). Useful functional groups that can be present on an anti-SGA- 72M antibody, either naturally or via chemical manipulation include, but are not limited to, sulfhydryl, amino, hydroxyl, the anomeric hydroxyl group of a carbohydrate, and carboxyl. Preferred functional groups are sulfhydryl and amino. Sulfhydryl groups can be generated by reduction of the intramolecular disulfide bonds of an anti-SGA-72M antibody. Alternatively, sulfhydryl groups can be generated by reaction of an amino group of a lysine moiety of an anti-SGA-72M antibody with 2-iminothiolane (Traut's reagent) or other sulfhydryl generating reagents. In specific embodiments, the anti-SGA-72M antibody is a recombinant antibody and is engineered to carry one or more lysines. In other embodiments, the recombinant anti-SGA-72M antibody is engineered to carry additional sulfhydryl groups, e.g., additional cysteines.

In certain specific embodiments, the stretcher unit forms a bond with a sulfur atom of the anti-SGA-72M antibody unit. The sulfur atom can be derived from a sulfhydryl (-SH) group of a reduced anti-SGA-72M antibody (A). Representative stretcher units of these embodiments are depicted within the square brackets of Formulas (la) and (lb; see infra), wherein A-, -W-, -Y-, -D, w and y are as defined above and R¹ is selected from -d- C_JO alkylene-, -C₃-C₈ carbocyclo-, -©-(C Csalkyl)-, -arylene-, -Ci-Cio alkylene-arylene-, - arylene- -do alkylene-, -d-Cio alkylene-(C₃-C₈ carbocyclo)-, -(C₃-C₈ carbocyclo)-Cι-Cιo alkylene-, -C₃-C₈ heterocyclo-, -C₁-C₁₀alkylene-(C₃-C₈ heterocyclo)-, -(C₃-C₈ heterocyclo)- C Cjo alkylene-, -(CH₂CH₂O)_r-, and -(CH₂CH₂O)_r-CH₂-; and r is an integer ranging from 1-10.

(la)

H

→-CH₂-CON-R¹ C(O)- ^■Wi w

(lb) An illustrative stretcher unit is that offormula (la) where R¹ is -(CH₂)₅-:

Another illustrative stretcher unit is that of formula (la) where R¹ is -(CH₂CH₂O)_r-CH₂-; and r is 2:

Still another illustrative stretcher unit is that of formula (lb) where R¹ is

-(CH₂)₅

In certain other specific embodiments, the stretcher unit is linked to the anti- SGA-72M antibody unit (A) via a disulfide bond between a sulfur atom of the anti-SGA- 72M antibody unit and a sulfur atom of the stretcher unit. A representative stretcher unit of this embodiment is depicted within the square brackets of Formula (II), wherein R¹, A-, - W-, -Y-, -D, w and y are as defined above.

In even other specific embodiments, the reactive group of the stretcher contains a reactive site that can be reactive to an amino group of an anti-SGA-72M antibody. The amino group can be that of an arginine or a lysine. Suitable amine reactive sites include, but are not limited to, activated esters such as succinimide esters, 4- nitrophenyl esters, pentafluorophenyl esters, anhydrides, acid chlorides, sulfonyl chlorides, isocyanates and isothiocyanates. Representative stretcher units of these embodiments are depicted within the square brackets of Formulas (Ilia) and (IHb), wherein R , A-, -W-, -Y-, -D, w and y are as defined above;

A- CON-R¹ C(OH-WVJΓ- Yy^"

(THa)

(IHb)

In yet another aspect of the invention, the reactive function of the stretcher contains a reactive site that is reactive to a modified carbohydrate group that can be present on an anti-SGA-72M antibody. In a specific embodiment, the anti-SGA-72M antibody is glycosylated enzymatically to provide a carbohydrate moiety. The carbohydrate may be mildly oxidized with a reagent such as sodium periodate and the resulting carbonyl unit of the oxidized carbohydrate can be condensed with a stretcher that contains a functionality such as a hydrazide, an oxime, a reactive amine, a hydrazine, a thiosemicarbazone, a hydrazine carboxylate, and an arylhydrazide such as those described by Kaneko, T. et al, 1991, Bioconjugate Chem. 2, 133-41. Representative stretcher units of this embodiment are depicted within the square brackets of Formulas (IVa)-(IVc), wherein R¹, A-, -W-, -Y-, -D, w and y are as defined above.

AiN-NH-R¹ C(OH-Ww— ^γy — ^D

A=£=N-O-R¹ C(O)-H/V— Yy — D

(IVb)

(IVc) 5.4.3 THE AMINO ACID UNIT

The amino acid unit (-W-) links the stretcher unit (-T-) to the Spacer unit (- Y-) if the Spacer unit is present, and links the stretcher unit to the cytotoxic or cytostatic agent (Drug unit; D) if the spacer unit is absent.

- W_w- is a dipeptide, tripeptide, tetrapeptide, pentapeptide, hexapeptide, heptapeptide, octapeptide, nonapeptide, decapeptide, undecapeptide or dodecapeptide unit. Each -W- unit independently has the formula denoted below in the square brackets, and w is an integer ranging from 2 to 12:

wherein R is hydrogen, methyl, isopropyl, isobutyl, .fee-butyl, benzyl, -hydroxybenzyl, - CH₂OH, -CH(OH)CH₃, -CH₂CH₂SCH₃, -CH₂CONH₂, -CH₂COOH, -CH₂CH₂CONH₂, -CH₂CH₂COOH, -(CH₂)₃NHC(=NH)NH₂, -(CH₂)₃NH₂, -(CH₂)₃NHCOCH₃, -(CH₂)₃NHCHO, -(CH₂)₄NHC(=NH)NH₂, -(CH₂)₄NH₂, -(CH₂)₄NHCOCH₃, -(CH₂)₄NHCHO, -(CH₂)₃NHCONH₂, -(CH₂)₄NHCONH₂, -CH₂CH₂CH(OH)CH₂NH₂, 2-pyridylmethyl-, 3-pyridylmethyl-, 4-pyridylmethyl-, phenyl, cyclohexyl,

The amino acid unit of the linker unit can be enzymatically cleaved by an enzyme including, but not limited to, a tumor-associated protease to liberate the drug unit (- D) which is protonated in vivo upon release to provide a cytotoxic drug (D).

Illustrative W_w units are represented by formulas (V)-(VII):

(V)

wherein R³ and R⁴ are as follows:

R^J

Benzyl (CH₂)₄NH₂;

Methyl (CH₂)₄NH₂;

Isopropyl (CH₂)₄NH₂;

Isopropyl (CH₂)₃NHCONH₂;

Benzyl (CH₂)₃NHCONH₂;

Isobutyl (CH₂)₃NHCONH₂;

.sec-butyl (CH₂)₃NHCONH₂; (CH₂)₃NHCONH₂;

Benzyl methyl; and Benzyl (CH₂)₃NHC(=NH)NH₂;

(VI) wherein R >3 , τ R>4 and R are as follows:

R^J R⁴ Ef

Benzyl Benzyl (CH₂)₄NH₂;

Isopropyl Benzyl (CH₂)₄NH₂; and

H Benzyl (CH₂)₄NH₂;

(VII)

wherein R³, R⁴, R⁵ and R⁶ are as follows:

E Ri

H Benzyl Isobutyl H; and methyl isobutyl Methyl isobutyl.

Prefened amino acid units include, but are not limited to, units offormula (V) where: R³ is benzyl and R⁴ is -(CH₂)₄NH₂; R³ is isopropyl and R⁴ is -(CH₂)₄NH₂; R³ is isopropyl and R⁴ is -(CH₂)₃NHCONH₂. Another prefened amino acid unit is a unit of formula (VI), where: R³ is benzyl, R⁴ is benzyl, and R⁵ is -(CH₂)₄NH₂.

-W_w- units useful in the present invention can be designed and optimized in their selectivity for enzymatic cleavage by a particular tumor-associated protease. The preferred -W_w - units are those whose cleavage is catalyzed by the proteases, cathepsin B, C and D, and plasmin.

In one embodiment, -W_w- is a dipeptide, tripeptide or tetrapeptide unit.

Where R², R³, R⁴, R⁵ or R⁶ is other than hydrogen, the carbon atom to which R², R³, R⁴, R⁵ or R⁶ is attached is chiral. Each carbon atom to which R², R³, R⁴, R⁵ or R⁶ is attached is independently in the (S) or (R) configuration. In a prefened embodiment, the amino acid unit is a phenylalanine-lysine dipeptide (phe-lys or FK linker). In another prefened embodiment, the amino acid umt is a valine-citrulline dipeptide (val-cit or VC linker).

5.4.4 THE SPACER UNIT The spacer unit (-Y-), when present, links an amino acid unit to the drug unit. Spacer units are of two general types: self-immolative and non self-immolative. A non self-immolative spacer unit is one in which part or all of the spacer unit remains bound to the drug unit after enzymatic cleavage of an amino acid unit from the anti-SGA-72M antibody-linker-drug conjugate or the drug- linker compound. Examples of a non self- immolative spacer unit include, but are not limited to a (glycine-glycine) spacer unit and a glycine spacer unit (both depicted in Scheme 1). When an anti-SGA-72M antibody-linker- drug conjugate of the invention containing a glycine-glycine spacer unit or a glycine spacer unit undergoes enzymatic cleavage via a tumor-cell associated-protease, a cancer-cell- associated protease or a lymphocyte-associated protease, a glycine-glycine-drug moiety or a glycine-drug moiety is cleaved from A-T-W_w-. To liberate the drug, an independent hydrolysis reaction should take place within the target cell to cleave the glycine-drug unit bond.

In a prefened embodiment, -Y_y- is a p-aminobenzyl ether which can be substituted with Q_m where Q is -Ci-Cs alkyl, -d-Cs alkoxy, -halogen,- nitro or -cyano; and m is an integer ranging from 0-4.

Scheme 1

L-|A— W— Gly-D .-|-A— W— Gly-Gly -D

enzymatic enzymatic cleavage cleavage

Gly— D Gly-Gly-D hydrolysis

Drug Drug

In one embodiment, a non self-immolative spacer unit (-Y-) is -Gly-Gly-. In another embodiment, a non self-immolative the spacer unit (-Y-) is -Gly-. In one embodiment, the drug-linker compound or an anti-SGA-72M antibody-linker-drug conjugate lacks a spacer unit (y=0).

Alternatively, an anti-SGA-72M antibody-linker-drug conjugate of the invention containing a self-immolative spacer unit can release the drug (D) without the need for a separate hydrolysis step. In these embodiments, -Y- is a »-aminobenzyl alcohol (PAB) unit that is linked to -W_w- via the nitrogen atom of the PAB group, and connected directly to -D via a carbonate, carbamate or ether group (Scheme 2 and Scheme 3).

Scheme 2

enzymatic cleavage

1,6-elimination

Drug

where Q is -Cι-C₈ alkyl, -Cι-C₈ alkoxy, -halogen, -nitro or -cyano; m is an integer ranging from 0-4; and p is an integer ranging from 1-20.

Scheme 3

enzymatic cleavage

1,6-elimination

Drug where Q is -C Cs alkyl, -Cj-Cs alkoxy, -halogen,- nitro or -cyano; m is an integer ranging from 0-4; and p is an integer ranging from 1-20.

Other examples of self-immolative spacers include, but are not limited to, aromatic compounds that are electronically equivalent to the PAB group such a 2- aminoimidazol-5 -methanol derivatives (see Hay et al, Bioorg. Med. Chem. Lett., 1999, 9, 2237 for examples) and ortho or para-aminobenzylacetals. Spacers can be used that undergo facile cyclization upon amide bond hydrolysis, such as substituted and unsubstituted 4-aminobutyric acid amides (Rodrigues et al, Chemistry Biology, 1995, 2, 223), appropriately substituted bicyclo[2.2.1] and bicyclo[2.2.2] ring systems (Storm, et al, J. Amer. Chem. Soc, 1972, 94, 5815) and 2-aminophenylpropionic acid amides (Amsberry, et al, J. Org. Chem., 1990, 55, 5867). Elimination of amine-containing drugs that are substituted at the a-position of glycine (Kingsbury, et al, J. Med. Chem., 1984, 27, 1447) are also examples of self-immolative spacer strategies that can be applied to the anti-SGA- 72M antibody-linker-drug conjugates of the invention.

In an alternate embodiment, the spacer unit is a branched bis(hydroxymethyl)styrene (BHMS) unit (Scheme 4), which can be used to incoφorate additional drugs.

Scheme 4

enzymatic cleavage

2 drugs where Q is -Cι-C₈ alkyl, -d-C₈ alkoxy, -halogen, -nitro or -cyano; m is an integer ranging from 0-4; n is 0 or 1 ; and p is an integer raging from 1-20.

In one embodiment, the two -D moieties are the same. In another embodiment, the two -D moieties are different.

Prefened spacer units (-Y_y-) are represented by Formulas (VIII)-(X):

(VIII) where Q is d-C₈ alkyl, d-C₈ alkoxy, halogen, nitro or cyano; and m is an integer ranging from 0-4;

(IX); and

j — NHCH₂C(0)-NHCH₂C(0)

(X) 5.5 DRUGS

The present invention encompasses the use of anti-SGA-72M ADCs for the treatment or prevention of an SGA-72M expressing cancer, e.g., breast cancer. In a prefened embodiment, the term "drug" or "cytotoxic agent," where employed in the context of an anti-SGA-72M ADC of the invention, does not include radioisotopes. Otherwise, any drug that is known to the skilled artisan can be used in connection with the ADCs of the present invention.

The drugs used for conjugation to the anti-SGA-72M antibodies of the present invention can include conventional chemotherapeutics, such as doxorubicin, paclitaxel, melphalan, vinca alkaloids, methotrexate, mitomycin C, etoposide, and others. In addition, potent agents such CC-1065 analogues, calichiamicin, maytansine, analogues of dolastatin 10, rhizoxin, and palytoxin can be linked to the anti-SGA-72M antibodies using the conditionally stable linkers to form potent immunoconjugates.

In certain embodiments, the ADCs of the invention high potency drugs. Such drugs include, but are not limited to: DNA minor groove binders, including enediynes and lexitropsins, duocarmycins, taxanes (including paclitaxel and docetaxel), puromycins, vinca alkaloids, CC-1065, SN-38, topotecan, moφholino-doxorubicin, rhizoxin, cyanomoφholino-doxorubicin, echinomycin, combretastatin, nefropsin, epithilone A and B, estramustine, cryptophysins, cemadotin, maytansinoids, dolastatins, e.g., auristatin E, dolastatin 10, MMAE, discodermolide, eleutherobin, and mitoxanfrone.

In certain specific embodiments, an anti-SGA-72M ADC of the invention comprises an enediyne moiety. In a specific embodiment, the enediyne moiety is calicheamicin. Enediyne compounds cleave double stranded DNA by generating a diradical via Bergman cyclization. A variety of cytotoxic and cytostatic agents that can be used with the compositions and methods of the present invention are described in U.S. provisional application no. 60/400,403, entitled "Drug Conjugates and their use for treating cancer, an autoimmune disease or an infectious disease", by Inventors: Peter D. Senter, Svetlana Doronina and Brian E. Toki, filed on July 31, 2002, which is incoφorated by reference in its entirety herein.

In other specific embodiments, the cytotoxic or cytostatic agent is auristatin E or a derivative thereof.

In prefened embodiments, the auristatin E derivative is an ester formed between auristatin E and a keto acid. For example, auristatin E can be reacted with paraacetyl benzoic acid or benzoylvaleric acid to produce AEB and AEVB, respectively. Other preferred auristatin derivatives include MMAE and AEFP. The synthesis and structure of auristatin E, also known in the art as dolastatin- 10, and its derivatives are described in U.S. Patent Application Nos.: 09/845,786 and 10/001,191 ; in the International Patent Application No.: PCT/US02/13435, in U.S. Patent Nos: 6,323,315; 6,239,104; 6,034,065; 5,780,588; 5,665,860; 5,663,149; 5,635,483; 5,599,902; 5,554,725; 5,530,097; 5,521,284; 5,504,191; 5,410,024; 5,138,036; 5,076,973; 4,986,988; 4,978,744; 4,879,278; 4,816,444; and 4,486,414, all of which are incoφorated by reference in their entireties herein.

In specific embodiments, the drug is a DNA minor groove binding agent. Examples of such compounds and their syntheses are disclosed in U.S. Patent No.: 6,130,237, which is incoφorated by reference in its entirety herein. In certain embodiments, the drug is a CBI compound.

In certain embodiments of the invention, an ADC of the invention comprises an anti-tubulin agent. Anti-tubulin agents are a well established class of cancer therapy compounds. Examples of anti-tubulin agents include, but are not limited to, taxanes (e.g., Taxol® (paclitaxel), docetaxel), T67 (Tularik), vincas, and auristatins (e.g., auristatin E, AEB, AEVB, MMAE, AEFP). Antitubulin agents included in this class are also: vinca alkaloids, including vincristine and vinblastine, vindesine and vinorelbine; taxanes such as paclitaxel and docetaxel and baccatin derivatives, epithilone A and B, nocodazole, colchicine and colcimid, estramustine, cryptophysins, cemadotin, maytansinoids, combretastatins, dolastatins, discodermolide and eleutherobin.

In a specific embodiment, the drug is a maytansinoid, a group of anti-tubulin agents. In a more specific embodiment, the drug is maytansine. Further, in a specific embodiment, the cytotoxic or cytostatic agent is DM-1 (ImmunoGen, Inc.; see also Chari et al, 1992, Cancer Res. 52:127-131). Maytansine, a natural product, inhibits tubulin polymerization resulting in a mitotic block and cell death. Thus, the mechanism of action of maytansine appears to be similar to that of vincristine and vinblastine. Maytansine, however, is about 200 to 1, 000-fold more cytotoxic in vitro than these vinca alkaloids.

In another specific embodiment, the drug is an AEFP.

In certain specific embodiments of the invention, the drug is not a polypeptide of greater than 50, 100 or 200 amino acids, for example a toxin. In a specific embodiment of the invention, the drug is not ricin. In other specific embodiments of the invention, an ADC of the invention does not comprise one or more of the cytotoxic or cytostatic agents the following non- mutually exclusive classes of agents: alkylating agents, anthracyclines, antibiotics, antifolates, antimetabolites, antitubulin agents, auristatins, chemotherapy sensitizers, DNA minor groove binders, DNA replication inhibitors, duocarmycins, etoposides, fluorinated pyrimidines, lexitropsins, nitrosoureas, platinols, purine antimetabolites, puromycins, radiation sensitizers, steroids, taxanes, topoisomerase inhibitors, vinca alkaloids, purine antagonists, and dihydrofolate reductase inhibitors. In more specific embodiments, the high potency drug is not one or more of an androgen, anthramycin (AMC), asparaginase, 5- azacytidine, azathioprine, bleomycin, busulfan, buthionine sulfoximine, camptothecin, carboplatin, carmustine (BSNU), CC-1065, chlorambucil, cisplatin, colchicine, cyclophosphamide, cytarabine, cytidine arabinoside, cytochalasin B, dacarbazine, dactinomycin (formerly actinomycin), daunorubicin, decarbazine, docetaxel, doxorubicin, an estrogen, 5-fluordeoxyuridine, 5-fluorouracil, gramicidin D, hydroxyurea, idarubicin, ifosfamide, irinotecan, lomustine (CCNU), mechlorethamine, melphalan, 6-mercaptopurine, methotrexate, mithramycin, mitomycin C, mitoxanfrone, nitroimidazole, paclitaxel, plicamycin, procarbizine, streptozotocin, tenoposide, 6-thioguanine, thioTEPA, topotecan, vinblastine, vincristine, vinorelbine, VP-16, VM-26, azothioprine, mycophenolate mofetil, methotrexate, acyclovir, gangcyclovir, zidovudine, vidarabine, ribavarin, azidothymidine, cytidine arabinoside, amantadine, dideoxyuridine, iododeoxyuridine, poscamet, and trifluridine.

5.5.1 DOLASTATIN DRUGS

In certain embodiments, the cytotoxic or cytostatic agent is a dolastatin. In more specific embodiments, the dolastatin is of the auristatin class. In a specific embodiment of the invention, the cytotoxic or cytostatic agent is MMAE (MMAE; Formula XI). In another specific embodiment of the invention, the cytotoxic or cytostatic agent is AEFP (Formula XVI).

(XI)

In certain embodiments of the invention, the cytotoxic or cytostatic agent is a dolastatin of formulas XII-XVIII.

(XII)

(XIII)

(XIV)

(XV)

own)

5.5.2 FORMATION OF ANTI-SGA-72M ANTIBODY-DRUG CONJUGATES

The generation of anti-SGA-72M antibody drug conjugates (ADCs) can be accomplished by any technique known to the skilled artisan. Briefly, the anti-SGA-72M

ADCs comprise an anti-SGA-72M antibody, a drug, and a linker that joins the drug and the antibody. A number of different reactions are available for covalent attachment of drugs to antibodies. This is often accomplished by reaction of the amino acid residues of the antibody molecule, including the amine groups of lysine, the free carboxylic acid groups of glutamic and aspartic acid, the sulfhydryl groups of cysteine and the various moieties of the aromatic amino acids. One of the most commonly used non-specific methods of covalent attachment is the carbodiimide reaction to link a carboxy (or amino) group of a compound to amino (or carboxy) groups of the antibody. Additionally, bifunctional agents such as dialdehydes or imidoesters have been used to link the amino group of a compound to amino groups of the antibody molecule. Also available for attachment of drugs to antibodies is the Schiff base reaction. This method involves the periodate oxidation of a drug that contains glycol or hydroxy groups, thus forming an aldehyde which is then reacted with the antibody molecule. Attachment occurs via formation of a Schiff base with amino groups of the antibody molecule. Isothiocyanates can also be used as coupling agents for covalently attaching drugs to antibodies. Other techniques known to the skilled artisan and within the scope of the present invention. Non-limiting examples of such teclmiques are described in, e.g., U.S. Patent Nos. 5,665,358, 5,643,573, and 5,556,623, which are incoφorated by reference in their entireties herein. In certain embodiments, an intermediate, which is the precursor of the linker, is reacted with the drug under appropriate conditions. In certain embodiments, reactive groups are used on the drug and/or the intermediate. The product of the reaction between the drug and the intennediate, or the derivatized drug, is subsequently reacted with the anti- SGA-72M antibody under appropriate conditions. Care should be taken to maintain the stability of the antibody under the conditions chosen for the reaction between the derivatized drug and the antibody.

5.6 USES OF THE SGA-72M GENE, GENE PRODUCTS. AND ANTIBODIES

In various embodiments, the present invention provides various uses of the SGA-72M gene, SGA-72M gene products (e.g., nucleic acids and polypeptides), SGA-

72M-related gene products, and antibodies directed against the SGA-72M polypeptides or

SGA-72M-related polypeptides. Such uses include, for example, prognostic and diagnostic evaluation of cancer, and the identification of subjects with a predisposition to a cancer, as described, below. The invention also includes methods of treating and preventing cancer. The invention includes methods of vaccinating against cancer. The methods of the invention can be used for the freatment, prevention, vaccination, diagnosis, staging and or prognosis of any cancer, or tumor, for example, but not limited to, any of the tumors or cancers listed below in Table 1.

Malignancies and related disorders, cells of which type can be tested in vitro (and/or in vivo), and upon observing the appropriate assay result, treated according to the methods of the present invention, include but are not limited to those listed in Table 1 (for a review of such disorders, see Fishman et al, 1985, Medicine, 2d Ed., J.B. Lippincott Co., Philadelphia): TABLE 1 MALIGNANCIES AND RELATED DISORDERS

Leukemia acute leukemia acute lymphocytic leukemia acute myelocytic leukemia myeloblastic promyelocytic myelomonocytic monocytic erythroleukemia chronic leukemia chronic myelocytic (granulocytic) leukemia chronic lymphocytic leukemia Polycythemia vera Lymphoma

Hodgkin's disease non-Hodgkin's disease Multiple myeloma Waldenstrδm's macroglobulinemia Heavy chain disease Solid tumors sarcomas and carcinomas fibrosarcoma myxosarcoma liposarcoma chondrosarcoma osteogenic sarcoma chordoma angiosarcoma endotheliosarcoma lymphangiosarcoma lymphangioendotheliosarcoma synovioma mesothelioma

Ewing's tumor leiomyosarcoma rhabdomyosarcoma colon carcinoma pancreatic cancer breast cancer ovarian cancer prostate cancer squamous cell carcinoma basal cell carcinoma adenocarcinoma sweat gland carcinoma sebaceous gland carcinoma papillary carcinoma papillary adenocarcinomas cystadenocarcinoma medullary carcinoma bronchogenic carcinoma renal cell carcinoma hepatoma bile duct carcinoma choriocarcinoma seminoma embryonal carcinoma

Wilms' tumor cervical cancer testicular tumor lung carcinoma small cell lung carcinoma bladder carcinoma epithelial carcinoma glioma astrocytoma medulloblastoma craniopharyngioma ependymoma pinealoma hemangioblastoma acoustic neuroma oligodendroghoma menangioma melanoma neuroblastoma retinoblastoma

In a prefened embodiment the methods of the invention are directed at diagnosis, prognosis, treatment and prevention of breast cancer. In other embodiments, the cancer ovarian cancer, skin cancer, or cancer of the lymphoid system

The invention further provides for screening assays to identify antagonists or agonists of the SGA72-M gene, SGA72-M gene product, or SGA72-M-related gene product. Thus, the invention relates to methods to identify molecules that up regulate or down regulate expression of the SGA-72M gene.

The nucleic acid molecules, polypeptides, polypeptide homologs, and antibodies described herein can be used in one or more of the following methods: a) screening assays; b) detection assays (e.g., chromosomal mapping, tissue typing); c) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenomics); and d) methods of freatment (e.g., therapeutic and prophylactic). For example, an SGA-72M gene product can be used to modulate (i) cellular proliferation; (ii) cellular differentiation; and/or (iii) cellular adhesion. Isolated nucleic acid molecules that encode the SGA-72M gene or a fragment or an open reading frame thereof can be used to express polypeptides (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect mRNA (e.g., in a biological sample) or a genetic lesion, and to modulate activity of an SGA-72M polypeptide. In addition, an SGA-72M gene product can be used to screen drugs or compounds which modulate activity or expression of the SGA-72M gene product as well as to treat disorders characterized by insufficient or excessive production of the SGA-72M gene product or production of a form the SGA-72M gene product which has decreased or abenant activity compared to the wild type polypeptide. In addition, the antibodies that bind to an SGA-72M gene product can be used to detect, isolate, and modulate activity of the SGA-72M gene product. In one embodiment, the present invention provides a variety of methods for the diagnostic and prognostic evaluation of cancer, including breast cancer. Such methods may, for example, utilize reagents such as the SGA-72M gene nucleotide sequences described in Sections 5.1, and antibodies directed against SGA-72M gene products, including peptide fragments thereof, as described, above, in Section 5.2. Specifically or selectively, such reagents may be used, for example, for: (1) the detection of the presence of SGA-72M gene mutations, or the detection of either over- or under-expression of SGA- 72M gene mRNA, preneoplastic or neoplastic, relative to normal cells or the qualitative or quantitative detection of other allelic forms of SGA-72M transcripts which may conelate with breast cancer or susceptibility toward neoplastic changes, and (2) the detection of an over-abundance of an SGA-72M gene product relative to the non-disease state or relative to a predetermined non-cancerous standard or the presence of a modified (e.g., less than full- length) SGA-72M gene product which conelates with a neoplastic state or a progression toward neoplasia or metastasis.

The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic test kits comprising at least one specific or selective SGA-72M gene nucleic acid or anti-SGA-72M antibody reagent described herein, which may be conveniently used, e.g., in clinical settings or in home settings, to diagnose patients exhibiting preneoplastic or neoplastic abnormalities, and to screen and identify those individuals exhibiting a predisposition to such neoplastic changes.

Nucleic acid-based detection teclmiques are described, below, in Section 5.6.1. Peptide detection techniques are described, below, in Section 5.6.2.

5.6.1 DETECTION OF SGA-72M GENE NUCLEIC ACID

MOLECULES

In a prefened embodiment, the invention involves methods to assess quantitative and qualitative aspects of SGA-72M gene expression. In one example the increased expression of an SGA-72M gene or gene product indicates a predisposition for the development of cancer. Alternatively, enhanced expression levels of an SGA-72M gene or gene product can indicate the presence of cancer in a subject or the risk of metastasis of said cancer in said subject. Techniques well known in the art, e.g., quantitative or semi- quantitative RT PCR or Northern blot, can be used to measure expression levels of SGA- 72M. Methods that describe both qualitative and quantitative aspects of SGA-72M gene or gene product expression are described in detail in the examples infra. The measurement of SGA-72M gene expression levels can include measuring naturally occurring SGA-72M transcripts and variants thereof as well as non-naturally occurring variants thereof, however for the diagnosis and/or prognosis of cancer in a subject the SGA-72M gene product is preferably a naturally occurring SGA-72M gene product or variant thereof. Thus, the invention relates to methods of diagnosing or predicting cancer in a subject by measuring the expression of the SGA-72M gene in a subject. For example the increased level of mRNA encoded for by the SGA-72M cDNA SEQ ID NO: 1 , or other gene product, as compared to a non-cancerous sample or a non-cancerous predetermined standard would indicate the presence of cancer in said subject or the increased risk of developing cancer in said subject.

In another example the increased level of mRNA encoded for by the SGA- 72M cDNA SEQ DD NO:l, or other gene product, as compared to a non-cancerous sample or a non-cancerous predetermined standard would indicate the risk of metastasis of the cancer in said subject or the likelihood of a poor prognosis in said subject. In another example, RNA from a cell type or tissue known, or suspected, to express the SGA-72M gene, such as breast cancer cells, or other types of cancer cells, including metastases, may be isolated and tested utilizing hybridization or PCR techniques as described, above. The isolated cells can be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step in the assessment of cells to be used as part of a cell-based gene therapy technique or, alternatively, to test the effect of compounds on the expression of the SGA-72M gene. Such analyses may reveal both quantitative and qualitative aspects of the expression pattern of the SGA-72M gene, including activation or inactivation of SGA-72M gene expression and presence of alternatively spliced SGA-72M transcripts.

In one embodiment of such a detection scheme, a cDNA molecule is synthesized from an RNA molecule of interest by reverse transcription. All or part of the resulting cDNA is then used as the template for a nucleic acid amplification reaction, such as a PCR or the like. The nucleic acid reagents used as synthesis initiation reagents (e.g., primers) in the reverse transcription and nucleic acid amplification steps of this method are chosen from among the SGA-72M gene nucleic acid reagents described in Section 5.1. The prefened lengths of such nucleic acid reagents are at least 9-30 nucleotides. For detection of the amplified product, the nucleic acid amplification may be performed using radioactively or non-radioactively labeled nucleotides. Alternatively, enough amplified product may be made such that the product may be visualized by standard ethidium bromide staining or by utilizing any other suitable nucleic acid staining method.

RT-PCR techniques can be utilized to detect differences in SGA-72M transcript size that may be due to normal or abnormal alternative splicing. Additionally, such techniques can be performed using standard techniques to detect quantitative differences between levels of SGA-72M transcripts detected in normal individuals relative to those individuals having cancer or exhibiting a predisposition toward neoplastic changes.

In the case where detection of particular alternatively spliced species is desired, appropriate primers and/or hybridization probes can be used, such that, in the absence of such sequence, no amplification would occur. Alternatively, primer pairs may be chosen utilizing the sequence data depicted in FIG. 1 to choose primers which will yield fragments of differing size depending on whether a particular exon is present or absent from the transcript SGA-72M franscript being utilized. As an alternative to amplification techniques, standard Northern analyses can be performed if a sufficient quantity of the appropriate cells can be obtained. The preferred length of a probe used in a Northern analysis is 9-50 nucleotides. Utilizing such techniques, quantitative as well as size related differences between SGA-72M transcripts can also be detected.

Additionally, it is possible to perform such SGA-72M gene expression assays in situ, i.e., directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Nucleic acid reagents such as those described in Section 5.1 may be used as probes and/or primers for such in situ procedures (see, e.g., Nuovo, G.J., 1992, PCR In Situ Hybridization: Protocols And Applications, Raven Press, NY).

Mutations or polymoφhisms within the SGA-72M gene can be detected by utilizing a number of techniques. Nucleic acid from any nucleated cell can be used as the starting point for such assay techniques, and may be isolated according to standard nucleic acid preparation procedures that are well known to those of skill in the art. For the detection of SGA-72M mutations, any nucleated cell can be used as a starting source for genomic nucleic acid. For the detection of SGA-72M transcripts or SGA-72M gene products, any cell type or tissue in which the SGA-72M gene is expressed, such as, for example, breast cancer cells, including metastases, may be utilized.

Genomic DNA may be used in hybridization or amplification assays of biological samples to detect abnormalities involving SGA-72M gene structure, including point mutations, insertions, deletions and chromosomal rearrangements. Such assays may include, but are not limited to, direct sequencing (Wong, C. et al, 1987, Nature 330:384). single stranded conformational polymoφhism analyses (SSCP; Orita, M. et al, 1989, Proc. Natl. Acad. ScL USA 86:2766), heteroduplex analysis (Keen, TJ. et al, 1991, Genomics 11:199; Perry, DJ. & Canell, R.W., 1992), denaturing gradient gel electrophoresis (DGGE; Myers, R.M. et al, 1985, Nucl Acids Res. 13:3131), chemical mismatch cleavage (Cotton, R.G. et al, 1988, Proc. Natl. Acad. Sci. USA 85:4397) and oligonucleotide hybridization (Wallace, R.B. et al, 1981, Nucl. Acids Res. 9:879; Lipshutz, RJ. et al, 1995, Biotechniques 19:442).

Diagnostic methods for the detection of SGA-72M nucleic acid molecules, in patient samples or other appropriate cell sources, may involve the amplification of particular gene sequences, e.g., by the polymerase chain reaction (PCR; See Mullis, K.B., 1987, U.S. Patent No. 4,683,202), followed by the analysis of the amplified molecules using techniques well known to those of skill in the art, such as, for example, those listed above. Utilizing analysis techniques such as these, the amplified sequences can be compared to those that would be expected if the nucleic acid being amplified contained only normal copies of the SGA-72M gene in order to determine whether an SGA-72M gene mutation exists. Further, well-known genotyping teclmiques can be performed to type polymoφhisms that are in close proximity to mutations in the SGA-72M gene itself. These polymoφhisms can be used to identify individuals in families likely to carry mutations. If a polymoφhism exhibits linkage disequilibrium with mutations in the SGA-72M gene, it can also be used to identify individuals in the general population likely to carry mutations. Polymoφhisms that can be used in this way include restriction fragment length polymoφhisms (RFLPs), which involve sequence variations in restriction enzyme target sequences, single-base polymoφhisms and simple sequence repeat polymoφhisms (SSLPs).

For example, Weber (U.S. Pat. No. 5,075,217) describes a DNA marker based on length polymoφhisms in blocks of (dC-dA)n-(dG-dT)n short tandem repeats. The average separation of (dC-dA)n-(dG-dT)n blocks is estimated to be 30,000-60,000 bp. Markers which are so closely spaced exhibit a high frequency co-inheritance, and are extremely useful in the identification of genetic mutations, such as, for example, mutations within the SGA-72M gene, and the diagnosis of diseases and disorders related to SGA-72M mutations.

Also, Caskey et al. (U.S. Pat.No. 5,364,759), describe a DNA profiling assay for detecting short tri and tetra nucleotide repeat sequences. The process includes extracting the DNA of interest, such as the SGA-72M gene, amplifying the extracted DNA, and labeling the repeat sequences to form a genotypic map of the individual's DNA. An SGA-72M probe could be used to directly identify RFLPs. Additionally, an SGA-72M probe or primers derived from the SGA-72M sequence could be used to isolate genomic clones such as YACs, BACs, PACs, cosmids, phage or plasmids. The DNA contained in these clones can be screened for single-base polymoφhisms or simple sequence length polymoφhisms (SSLPs) using standard hybridization or sequencing procedures.

Alternative diagnostic methods for the detection of SGA-72M gene expression, SGA-72M gene mutations or polymoφhisms can include hybridization teclmiques which involve for example, contacting and incubating nucleic acids including recombinant DNA molecules, cloned genes or degenerate variants thereof, obtained from a sample, e.g., derived from a patient sample or other appropriate cellular source, with one or more labeled nucleic acid reagents including recombinant DNA molecules, cloned genes or degenerate variants thereof, as described in Section 5.1, under conditions favorable for the specific or selective annealing of these reagents to their complementary sequences within the SGA-72M gene. Preferably, the lengths of these nucleic acid reagents are at least 9 to 50 nucleotides. After incubation, all non-annealed nucleic acids are removed from the nucleic acid:SGA-72M molecule hybrid. The presence of nucleic acids that have hybridized, if any such molecules exist, is then detected. Using such a detection scheme, the nucleic acid from the cell type or tissue of interest can be immobilized, for example, to a solid support such as a membrane, or a plastic surface such as that on a microtiter plate or polystyrene beads. In this case, after incubation, non-annealed, labeled nucleic acid reagents of the type described in Section 5.1 are easily removed. Detection of the remaining, annealed, labeled SGA-72M nucleic acid reagents is accomplished using standard techniques well-known to those in the art. The SGA-72M gene sequences to which the nucleic acid reagents have annealed can be compared to the annealing pattern expected from a normal SGA-72M gene sequence in order to determine whether an SGA- 72M gene mutation is present.

5.6.2 DETECTION OF SGA-72M POLYPEPTIDES

Detection of the SGA-72M gene product includes the detection of the polypeptides encoded for by SEQ DD NO:2. Detection of elevated levels of SGA-72M, compared to a non-cancerous sample or a non-cancerous predetermined standard can indicate the presence of, or predisposition to developing cancer in a subject. Detection of elevated levels of said polypeptide, in a subject compared to a non-cancerous sample or a non-cancerous predetermined standard can indicate the likelihood of metastasis of a cancer in the subject, and/or poor prognosis for the subject. The diagnosis and/or prognosis of cancer involves the detection of naturally occurring SGA-72M polypeptides in a subject. Detection of an SGA-72M polypeptide can be by any method known in the art. Antibodies directed against naturally occurring SGA-72M, or naturally occurring variants thereof or peptide fragments thereof, which are discussed, above, in Section 5.2, may be used as diagnostics and prognostics, as described herein. Such diagnostic methods, may be used to detect abnormalities in the level of SGA-72M gene expression, or abnormalities in the structure and/or temporal, tissue, cellular, or subcellular location of the SGA-72M-encoded polypeptide. Antibodies, or fragments of antibodies, such as those described below, may be used to screen potentially therapeutic compounds in vitro to determine their effects on SGA-72M gene expression and SGA-72M-encoded polypeptide production. The compounds that have beneficial effects on cancer, e.g., breast cancer can be identified and a therapeutically effective dose determined.

The tissue or cell type to be analyzed will generally include those which are known, or suspected, to express the SGA-72M gene, such as, for example, cancer cells including breast cancer cells, ovarian cancer cells, skin cancer cells, lymphoid cancer cells, and metastatic forms thereof. The polypeptide isolation methods employed herein may, for example, be such as those described in Harlow and Lane (Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) . The isolated cells can be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step to test the effect of compounds on the expression of the SGA-72M gene.

Prefened diagnostic methods for the detection of SGA-72M gene products or conserved variants or peptide fragments thereof, may involve, for example, immunoassays wherein the SGA-72M gene products or conserved variants, including gene products which are the result of alternatively spliced transcripts, or peptide fragments are detected by their interaction with an anti-SGA-72M gene product-specific or -selective antibody.

For example, antibodies, or fragments of antibodies, such as those described above in Section 5.3, useful in the present invention may be used to quantitatively or qualitatively detect the presence of SGA-72M-encoded polypeptides or naturally occurring variants or peptide fragments thereof. The antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of SGA-72M gene products or conserved variants or peptide fragments thereof. In situ detection may be accomplished by removing a histological specimen from a subject, such as paraffin embedded sections of tissue, e.g., breast tissues and applying thereto a labeled antibody of the present invention. The antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Since the SGA-72M gene product is present in the cytoplasm, it may be desirable to introduce the antibody inside the cell, for example, by making the cell membrane permeable. The SGA-72M polypeptides may also be expressed on the cell surface, thus cells can be directly labeled by applying antibodies that are specific or selective for the SGA-72M polypeptides or fragment thereof to the cell surface.

Through the use of such a procedure, it is possible to determine not only the presence of the SGA-72M gene product, or naturally occurring variants thereof or peptide fragments, but also its distribution in the examined tissue. Using the methods of the present invention, those of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified in order to achieve such in situ detection. Immunoassays for SGA-72M-encoded polypeptides or conserved variants or peptide fragments thereof will typically comprise contacting a sample, such as a biological fluid, tissue or a tissue extract, freshly harvested cells, or lysates of cells which have been incubated in cell culture, in the presence of an antibody that bind to an SGA-72M gene product, e.g., a detectably labeled antibody capable of identifying SGA-72M polypeptides or conserved variants or peptide fragments thereof, and detecting the bound antibody by any of a number of techniques well-known in the art (e.g., Western blot, ELISA, FACS).

The biological sample may be brought in contact with and immobilized onto a solid phase support or carrier such as nitrocellulose, or other solid support that is capable of immobilizing cells, cell particles or soluble polypeptides. The support may then be washed with suitable buffers followed by treatment with the detectably labeled antibody that bind to an SGA-72M-encoded polypeptide. The solid phase support may then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on solid support may then be detected by conventional means.

By "solid phase support or carrier" is intended any support capable of specifically or selectively binding an antigen or an antibody. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the puφoses of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Prefened supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.

The anti-SGA-72M antibody can be detectably labeled by linking the same to an enzyme and using the labeled antibody in an enzyme immunoassay (EIA) (Noller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)", 1978, Diagnostic Horizons 2:1, Microbiological Associates Quarterly Publication, Walkersville, MD); Noller, A. et al, 1978, J. Clin. Pathol. 31:507-520; Butler, J.E., 1981, Meth. Enzymol. 73:482; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, FL,; Ishikawa, E. et al, (eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The enzyme that is bound to the antibody will react with an appropriate substrate, preferably a chromogenic subsfrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotomerric, fluorimetric or by visual means. Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5 -steroid isomerase, yeast alcohol dehydrogenase, alpha- glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. The detection can be accomplished by colorimetric methods that employ a chromogenic subsfrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.

Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibodies or antibody fragments, it is possible to detect SGA-72M-encoded polypeptides through the use of a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography. It is also possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wavelength, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.

The antibody can also be detectably labeled using fluorescence emitting metals such as ¹⁵²Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTP A) or ethylenediaminetetraacetic acid (EDTA).

The antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.

Likewise, a bioluminescent compound may be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in, which a catalytic polypeptide increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent polypeptide is determined by detecting the presence of luminescence. Important bioluminescent compounds for puφoses of labeling are luciferin, luciferase and aequorin.

In various embodiments, the present invention provides methods for the measurement of SGA-72M polyepeptides, and the uses of such measurements in clinical applications using SGA-72M-specific or -selective antibodies.

The measurement of SGA-72M polypeptides of the invention can be valuable in detecting and/or staging breast cancer and other cancers in a subject, in screening of breast cancer and other cancers in a population, in differential diagnosis of the physiological condition of a subject, and in monitoring the effect of a therapeutic freatment on a subject.

The present invention also provides for the detecting, diagnosing, or staging of breast cancer and other cancers, or the monitoring of treatment of breast cancer and other cancers by measuring the level of expression of the SGA-72M polypeptide. In addition to the SGA-72M polypeptide at least one other marker, such as receptors or differentiation antigens can also be measured. For example, serum markers selected from, for example but not limited to, carcinoembryonic antigen (CEA), CA15-3, CA549, CAM26, M29, CA27.29 and MCA can be measured in combination with the SGA-72M polypeptide to detect, diagnose, stage, or monitor treatment of breast cancer and other cancers. In another embodiment, the prognostic indicator is the observed change in different marker levels relative to one another, rather than the absolute levels of the markers present at any one time. These measurements can also aid in predicting therapeutic outcome and in evaluating and monitoring the overall disease status of a subject.

In a specific embodiment of the invention, soluble SGA-72M polypeptide alone or in combination with other markers can be measured in any body fluid of the subject including but not limited to blood, serum, plasma, milk, urine, saliva, pleural effusions, synovial fluid, spinal fluid, tissue infiltrations and tumor infiltrates. In another embodiment the SGA-72M polypeptide is measured in tissue samples or cells directly. The present invention also contemplates a kit for measuring the level of SGA-72M expression in a biological sample and the use of said kit to diagnose a subject with cancer. Alternatively said kit could be used to determine the prognosis of a cancer patient or the risk of metastasis of said cancer.

Any of numerous immunoassays can be used in the practice of the methods of the instant invention, such as those described in Section 5.6.2. Antibodies, or antibody fragments containing the binding domain, which can be employed include but are not limited to suitable antibodies among those in Section 5.3 and other antibodies known in the art or which can be obtained by procedures standard in the art such as those described in Section 5.3.

5.6.2.1 IN VIVO IMAGING USING ANTIBODIES TO AN SGA-72M POLYPEPTIDE

Current diagnostic and therapeutic methods make use of antibodies to target imaging agents or therapeutic substances, e.g., to tumors. Thus, labeled antibodies that bind to an SGA-72M polypeptide or SGA-72M-related polypeptide can be used in the methods of the invention for the in vivo imaging, detection, and freatment of cancer in a subject. IN a specific embodiment, monoclonal antibody 7.3.1 is used in the methods of in vivo imaging of the invention. Antibodies may be linked to chelators such as those described in U.S. Patent

No. 4,741,900 or U.S. Patent No. 5,326,856. The antibody-chelator complex may then be radiolabeled to provide an imaging agent for diagnosis or treatment of disease. The antibodies may also be used in the methods that are disclosed in U.S. Patent No. 5,449,761 for creating a radiolabeled antibody for use in imaging or radiotherapy.

In in vivo diagnostic applications, specific tissues or even specific cellular disorders, e.g., cancer, may be imaged by administration of a sufficient amount of a labeled antibodies using the methods of the instant invention.

A wide variety of metal ions suitable for in vivo tissue imaging have been tested and utilized clinically. For imaging with radioisotopes, the following characteristics are generally desirable: (a) low radiation dose to the patient; (b) high photon yield which permits a nuclear medicine procedure to be performed in a short time period; (c) ability to be produced in sufficient quantities; (d) acceptable cost; (e) simple preparation for administration; and (f) no requirement that the patient be sequestered subsequently. These characteristics generally translate into the following: (a) the radiation exposure to the most critical organ is less than 5 rad; (b) a single image can be obtained within several hours after infusion; (c) the radioisotope does not decay by emission of a particle; (d) the isotope can be readily detected; and (e) the half-life is less than four days (Lamb and Kramer,

"Commercial Production of Radioisotopes for Nuclear Medicine", In Radiotracers For Medical Applications. Vol. 1, Rayudu (Ed.), CRC Press, Inc., Boca Raton, pp. 17-62). Preferably, the metal is technetium-99m.

By way of illustration, the targets that one may image include any solid neoplasm, certain organs such a lymph nodes, parathyroids, spleen and kidney, sites of inflammation or infection (e.g., macrophages at such sites), myocardial infarction or thromboses (neoantigenic determinants on fibrin or platelets), and the like evident to one of ordinary skill in the art. Furthermore, the neoplastic tissue may be present in bone, internal organs, connective tissue, or skin. As is also apparent to one of ordinary skill in the art, one may use the methods of the present invention in in vivo therapeutics (e.g., using radiotherapeutic metal complexes), especially after having diagnosed a diseased condition via the in vivo diagnostic method described above, or in in vitro diagnostic application (e.g., using a radiometal or a fluorescent metal complex). Accordingly, a method of diagnosing cancer by obtaining an image of an internal region of a subject is contemplated in the instant invention which comprises administering to a subject an effective amount of an antibody composition specific or selective for an SGA-72M polypeptide conjugated with a metal in which the metal is radioactive, and recording the scintigraphic image obtained from the decay of the radioactive metal. Likewise, a method is contemplated of enhancing a magnetic resonance (MR) image of an internal region of a subject which comprises admimstering to a subject an effective amount of an antibody composition containing a metal in which the metal is paramagnetic, and recording the MR image of an internal region of the subject.

Other methods include a method of enhancing a sonographic image of an internal region of a subject comprising administering to a subject an effective amount of an antibody composition containing a metal and recording the sonographic image of an internal region of the subject. In this latter application, the metal is preferably any non- toxic heavy metal ion. A method of enhancing an X-ray image of an internal region of a subject is also provided which comprises admimstering to a subject an antibody composition containing a metal, and recording the X-ray image of an internal region of the subject. A radioactive, non-toxic heavy metal ion is prefened.

5.6.3 DETECTING AND STAGING CANCER IN A SUBJECT

The methods of the present invention include measurement of naturally occurring SGA-72M polypeptide, or naturally occurring variants thereof, or fragment thereof, soluble SGA-72M polypeptide or infra-cellular SGA-72M polypeptides to detect breast cancer or other cancers in a subject or to stage breast cancer or other cancers in a subject.

Staging refers to the grouping of patients according to the extent of their disease. Staging is useful in choosing treatment for individual patients, estimating prognosis, and comparing the results of different treatment programs. Staging of breast cancer for example is performed initially on a clinical basis, according to the physical examination and laboratory radiologic evaluation. The most widely used climcal staging system is the one adopted by the International Union against Cancer (UICC) and the American Joint Committee on Cancer (AJCC) Staging and End Results Reporting. It is based on the tumor-nodes-metastases (TNM) system as detailed in the 1988 Manual for Staging of Cancer. Breast cancer diseases or conditions that may be detected and/or staged in a subject according to the present invention include but are not limited to those listed in Table 2. TABLE 2

STAGING OF BREAST CANCER

T PRIMARY TUMORS

TX Primary tumor cannot be assessed

TO No evidence of primary tumor

Tis Carcinoma in situ: intraductal carcinoma, lobular carcinoma, or Paget's disease with no tumor Tl Tumor 2 cm or less in its greatest dimension a. 0.5 cm or less in greatest dimension b. Larger than 0.5 cm, but not larger than 1 cm in greatest dimension c. Larger than 1 cm, but not larger than 2 cm in greatest dimension T2 Tumor more than 2 cm but not more than 5 cm in greatest dimension

T3 Tumor more than 5cm in its greatest dimension

T4 Tumor of any size with direct extension to chest wall or to skin. Chest wall includes ribs, intercostal muscles, and senatus anterior muscle, but not pectoral muscle. a. Extension to chest wall b. Edema (including peau d'orange), ulceration of the skin of the breast, or satellite skin nodules confined to the same breast c. Both of the above d. inflammatory carcinoma

Dimpling of the skin, nipple retraction, or any other skin changes except those in T4b may occur in Tl, T2 or T3 without affecting the classification. N REGIONAL LYMPH NODES

NX Regional lymph nodes cannot be assessed (e.g., previously removed)

NO No regional lymph node metastases

NI Metastasis to movable ipsilateral axillary node(s)

N2 Metastases to ipsilateral axillary nodes fixed to one another or to other structures

N3 Metastases to ipsilateral internal mammary lymph node(s)

M DISTANT METASTASIS

M0 No evidence of distant metastasis

Ml Distant metastases (including metastases to ipsilateral supraclavicular lymph nodes)

Any immunoassay, such as those described in Section 5.6.2 can be used to measure the amount of SGA-72M polypeptide or soluble SGA-72M polypeptide that is compared to a baseline level. This baseline level can be the amount that is established to be normally present in the tissue or body fluid of subjects with various degrees of the disease or disorder. An amount present in the tissue or body fluid of the subject that is similar to a standard amount, established to be normally present in the tissue or body fluid of the subject during a specific stage of cancer or breast cancer, is indicative of the stage of the disease in the subject. The baseline level could also be the level present in the subject prior to the onset of disease or the amount present during remission of the disease.

In specific embodiments of this aspect of the invention, measurements of levels of the SGA-72M polypeptide or soluble SGA-72M polypeptide can be used in the detection of infiltrative ductal carcinoma (DDC) or the presence of metastases or both. Increased levels of SGA-72M polypeptides or soluble SGA-72M polypeptide are associated with metastases.

In another embodiment of the invention, the measurement of soluble SGA- 72M polypeptide, infra-cellular SGA-72M polypeptide, fragments thereof or immunologically related molecules can be used to differentially diagnose in a subject a particular disease phenotype or physiological condition as distinct as from among two or more phenotypes or physiological conditions. For example, measurements of SGA-72M polypeptide or soluble SGA-72M polypeptide levels may be used in the differential diagnosis of infiltrative ductal carcinoma, as distinguished from ductal carcinoma in situ or benign fibroadenomas. To this end, for example, the measured amount of the SGA-72M polypeptide is compared with the amount of the molecule normally present in the tissue, cells or body fluid of a subject with one of the suspected physiological conditions. A measured amount of the SGA-72M polypeptide similar to the amount normally present in a subject with one of the physiological conditions, and not normally present in a subject with one or more of the other physiological conditions, is indicative of the physiological condition of the subject.

As an alternative to measuring levels of SGA-72M polypeptides in the foregoing staging methods, levels of SGA-72M transcript can be measured, for example by the methods described in Section 5.6.1, supra.

5.6.4 MONITORING THE EFFECT OF A THERAPEUTIC TREATMENT

The present invention provides a method for monitoring the effect of a therapeutic treatment on a subject who has undergone the therapeutic treatment. Clinicians very much need a procedure that can be used to monitor the efficacy of cancer treatments. SGA-72M-encoded polypeptides and/or transcripts can be identified and detected in breast cancer patients or other cancer patients with different manifestations of disease, providing a sensitive assay to monitor therapy. The therapeutic treatments which may be evaluated according to the present invention include but are not limited to radiotherapy, surgery, chemotherapy, vaccine administration, endocrine therapy, immunotherapy, and gene therapy, etc. The chemotherapeutic regimens include, but are not limited to administration of drugs such as, for example, methotrexate, fluorouracil, cyclophosphamide, doxorubicin, and taxol. The endocrine therapeutic regimens include, but are not limited to administration of tamoxifen, progestins, etc.

The method of the invention comprises measuring at suitable time intervals before, during, or after therapy, the amount of an SGA-72M franscript or polypeptide (including soluble polypeptide), or any combination of the foregoing. Any change or absence of change in the absolute or relative amounts of the SGA-72M gene products can be identified and conelated with the effect of the treatment on the subject.

In particular, the serum- or cell- associated levels of an SGA-72M-encoded polypeptide can bear a direct relationship with severity of breast cancer, or other cancer, risk of metastasis of said cancer and poor prognosis. Since serum- or cell-associated SGA- 72M polypeptide levels are generally undetectable or negligible in normal individuals, generally, a decrease in the level of detectable SGA-72M polypeptide after a therapeutic freatment is associated with efficacious treatment.

In a prefened aspect, the approach that can be taken is to determine the levels of soluble or cell associated SGA-72M polypeptide levels at different time points and to compare these values with a baseline level. The baseline level can be either the level of the SGA-72M polypeptide present in normal, disease free individuals; and/or the levels present prior to treatment, or during remission of disease, or during periods of stability. These levels can then be conelated with the disease course or freatment outcome.

5.6.5 PROGNOSTIC ASSAYS

The methods described herein can furthermore be utilized as prognostic assays to identify subjects having or at risk of developing cancer or another disease or disorder associated with abenant expression or activity of an SGA-72M polypeptide. For example, the assays described herein, such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing cancer, e.g., breast cancer, or another disorder associated with abenant expression or activity of an SGA-72M polypeptide. Thus, the present invention provides a method in which a test sample is obtained from a subject and an SGA-72M polypeptide or nucleic acid (e.g., mRNA, genomic DNA) of the invention is detected, wherein the presence of the polypeptide or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with abenant expression or activity of the SGA-72M polypeptide, e.g., cancer. As used herein, a "test sample" refers to a biological sample obtained from a subject of interest. For example, a test sample can be a biological fluid (e.g., serum), cell sample, or tissue.

The prognostic assays described herein, for example, can be used to identify a subject having or at risk of developing disorders such as cancers, for example, hormone- sensitive cancer such as breast cancer.

In another example, prognostic assays described herein can be used to identify a subject having or at risk of developing related disorders associated with expression of polypeptides or nucleic acids of the invention.

Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, polypeptide, peptide, nucleic acid, small molecule, or other drug candidate) to treat cancer or another disease or disorder associated with abenant expression or activity of an SGA-72M polypeptide. For example, such methods can be used to determine whether a subject can be effectively treated with a specific agent or class of agents (e.g., agents of a type which decrease activity or expression level of an SGA-72M transcript or polypeptide). Thus, the present invention provides methods for determining whether a subject can be effectively treated with an agent for a disorder associated with abenant expression or activity of the SGA-72M transcript or polypeptide in which a test sample is obtained and the polypeptide or nucleic acid encoding the polypeptide is detected (e.g., wherein the presence of the polypeptide or nucleic acid is diagnostic for a subject that can be administered the agent to treat a disorder associated with abenant expression or activity of the SGA-72M transcript or polypeptide).

The methods of the invention can also be used to detect genetic lesions or mutations in an SGA-72M gene, thereby determimng if a subject with the lesioned gene is at increased or reduced risk for a disorder characterized by abenant expression or activity of a polypeptide of the invention, e.g., cancer. In one embodiment, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion or mutation characterized by at least one of an alteration affecting the integrity of a gene encoding an SGA-72M polypeptide, or the mis-expression of the gene encoding an SGA- 72M polypeptide. For example, such genetic lesions or mutations can be detected by ascertaining the existence of at least one of: 1) a deletion of one or more nucleotides from an SGA-72M gene; 2) an addition of one or more nucleotides to an SGA-72M gene; 3) a substitution of one or more nucleotides of an SGA-72M gene i.e. a point mutation; 4) a chromosomal reanangement of an SGA-72M gene; 5) an alteration in the level of a messenger RNA transcript of an SGA-72M gene; 6) an abenant modification of an SGA- 72M gene, such as of the methylation pattern of the genomic DNA; 7) the presence of a non-wild type splicing pattern of a messenger RNA transcript of an SGA-72M gene; 8) a non- wild type level of the polypeptide encoded by an SGA-72M gene; 9) an allelic loss of an SGA-72M gene; and 10) an inappropriate post-translational modification of a polypeptide encoded by an SGA-72M gene. As described herein, there are a large number of assay techniques known in the art that can be used for detecting lesions in a gene.

In certain embodiments, methods for the detection of the lesion involves the use of a probe/primer in a polymerase chain reaction (PCR) (See, e.g., U.S. Patent Nos. 4,683, 195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077; and Nakazawa et al (1994) Proc Natl Acad Sci. USA 9J_:360), the latter of which can be particularly useful for detecting point mutations in a gene (see, e.g., Abravaya et al. (1995) Nucleic Acids Res. 23 :675). These methods are useful in the diagnosis and prognosis of cancer in a subject. This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically or selectively hybridize to the selected gene under conditions such that hybridization and amplification of the gene or gene product (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein. Mutations in a selected gene from a sample cell or tissue can also be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and confrol DNA indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozymes (see, e.g., U.S. Patent No. 5,498,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.

In other embodiments, methods are provided whereby genetic mutations can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density anays comprising hundreds or thousands of oligonucleotides probes (Cronin et al.1996, Human Mutation 7:244; Kozal et al. 1996, Nature Medicine 2:753). For example, genetic mutations can be identified in two-dimensional anays containing light-generated DNA probes as described in Cronin et al., supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear anays of sequential overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe anays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.

Sequencing reactions known in the art can be used to directly sequence the selected gene and detect mutations in the SGA-72M gene by comparing the sequence of the sample nucleic acids with the conesponding wild-type (control) sequence. Examples of sequencing reactions include those based on techniques developed by Maxim and Gilbert ( Maxim and Gilbert,1977, Proc Natl Acad Sci. USA 74:560) or Sanger (Sanger et al. 1977, Proc Natl Acad Sci. USA 74:5463). Such methods are useful in the diagnosis and prognosis of a subject with cancer. It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Naeve et al, 1995, BioTechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT Publication No. WO 94/16101; Cohen et al. 1996, Adv. Chromatogr. 36:127; and Griffin et al, 1993, Appl. Biochem. Biotechnol. 38:147). Furthermore, the presence of an SGA-72M nucleic acid molecule or polypeptide of the invention can be conelated with the presence or expression level of other cancer-related polypeptides, such as for example, androgen receptor, estrogen receptor, adhesion molecules (e.g., E-cadherin), proliferation markers (e.g., MD3-1), tumor-suppressor genes (e.g., TP53, retinoblastoma gene product), vascular endothelial growth factor (Lissoni et al, 2000, Int. J. Biol. Markers 15(4): 308), Rad51 (Maacke et al, 2000, Int. J. Cancer. 88(6):907), cyclin Dl, BRCA1, BRCA2, or carcinoembryonic antigen.

The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one nucleic acid probe or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a gene encoding a polypeptide of the invention. Furthermore, any cell type or tissue, e.g., preferably cancerous breast cells or tissue, in which the SGA-72M gene is expressed may be utilized in the prognostic assays described herein.

5.7 SCREENING ASSAYS FOR COMPOUNDS

THAT MODULATE SGA-72M ACTIVITY

The present invention further provides methods for the identification of compounds that may, through their interaction with the SGA-72M gene or SGA-72M gene product, affect the onset, progression and metastatic spread of breast cancer and other cancers.

The following assays are designed to identify: (i) compounds that bind to SGA-72M gene products; (ii) compounds that bind to other polypeptides that interact with an SGA-72M gene product; (iii) compounds that interfere with the interaction of the SGA- 72M gene product with other polypeptides; and (iv) compounds that modulate the activity of an SGA-72M gene (i.e., modulate the level of SGA-72M gene expression, including transcription of the SGA-72M gene and/or franslation of its encoded transcript, and/or modulate the level of SGA-72M-encoded polypeptide activity).

Assays may additionally be utilized which identify compounds that bind to SGA-72M gene regulatory sequences (e.g., promoter sequences), which may modulate the level of SGA-72M gene expression (see e.g. , Platt, K.A., 1994, J. Biol. Chem. 269:28558).

Such polypeptides that interact with SGA-72M may be involved in the onset, development and metastatic spread of breast cancer or other cancers. The present invention also provides methods of using isolated SGA-72M nucleic acid molecules, or derivatives thereof, as probes that can be used to screen for DNA-binding polypeptides, including but not limited to proteins that affect DNA conformation or modulate transcriptional activity (e.g., enhancers, transcription factors). In another embodiment, such probes can be used to screen for RNA-binding factors, including but not limited to polypeptides, steroid hormones, or other small molecules. In yet another embodiment, such probes can be used to detect and identify molecules that bind or affect the pharmacokinetics or activity (e.g., enzymatic activity) of the SGA-72M gene or gene product. The polypeptides or nucleic acid binding factors or franscriptional modulators identified by a screening assay would provide an appropriate target for anti-cancer therapeutics.

In one embodiment, a screening assay of the invention can identify a test compound that is useful for increasing or decreasing the translation of one or both SGA- 72M ORFs, for example, by binding to one or more regulatory elements in the 5' untranslated region, the 3' untranslated region, or the coding regions of the mRNA. Compounds that bind to mRNA can, inter alia, increase or decrease the rate of mRNA processing, alter its transport through the cell, prevent or enhance binding of the mRNA to ribosomes, suppressor proteins or enhancer proteins, or alter mRNA stability. Accordingly, compounds that increase or decrease mRNA translation can be used to treat or prevent disease. For example, diseases such as cancer, associated with oveφroduction of polypeptides, such as SGA-72M, can be treated or prevented by decreasing translation of the mRNA that codes for the oveφroduced polypeptide, thus inhibiting production of the polypeptide.

Accordingly, in one embodiment, a compound identified by a screening assay of the invention inhibits the production of an SGA-72M polypeptide. In a further embodiment, the compound inhibits the translation of an SGA-72M mRNA. In yet another embodiment, the compound inhibits transcription of the SGA-72M gene.

The invention provides a method for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) which bind to the SGA-72M gene product or fragments thereof or have a stimulatory or inhibitory effect on, for example, expression or activity of the SGA-72M gene product or fragments thereof. Compounds identified via assays such as those described herein may be useful, for example, in elaborating the biological function of the SGA-72M gene product, and for ameliorating symptoms of breast cancer or other types of cancer. Assays for testing the effectiveness of compounds, identified by, for example, techniques such as those described in Section 5.7.1, are discussed, below, in Section 5.7.3. It is to be noted that the compositions of the invention include pharmaceutical compositions comprising one or more of the compounds identified via such methods. Such pharmaceutical compositions can be formulated, for example, as discussed, below, in Section 5.9.

5.7.1 IN VITRO SCREENING ASSAYS FOR COMPOUNDS THAT BIND TO THE SGA-72M GENE PRODUCT

In vitro systems may be designed to identify compounds capable of interacting with, e.g., binding to, the SGA-72M gene product of the invention. Compounds identified may be useful, for example, in modulating the activity of wild type and/or mutant

SGA-72M gene products, may be useful in elaborating the biological function of the SGA- 72M gene product, may be utilized in screens for identifying compounds that disrupt normal SGA-72M gene product interactions, or may in themselves disrupt such interactions. Thus said compounds would be useful in treating, preventing and diagnosing cancer. In a particular embodiment said compounds are useful in the treatment, prevention and diagnosis of breast cancer. The principle of the assays used to identify compounds that interact with the

SGA-72M gene product involves preparing a reaction mixture of the SGA-72M gene product and the test compound under conditions and for a time sufficient to allow the two components to interact with, e.g., bind to, thus forming a complex, which can represent a transient complex, which can be removed and/or detected in the reaction mixture. These assays can be conducted in a variety of ways. For example, one method to conduct such an assay would involve anchoring SGA-72M gene product or the test substance onto a solid phase and detecting SGA-72M gene product/test compound complexes anchored on the solid phase at the end of the reaction. In one embodiment of such a method, the SGA-72M gene product may be anchored onto a solid surface, and the test compound, which is not anchored, may be labeled, either directly or indirectly.

In practice, microtiter plates may conveniently be utilized as the solid phase. The anchored component may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished by simply coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody, preferably a monoclonal antibody, specific or selective for the polypeptide to be immobilized may be used to anchor the polypeptide to the solid surface. The surfaces may be prepared in advance and stored. In order to conduct the assay, the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously nonimmobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously nonimmobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific or selective for the previously nonimmobilized component (the antibody, in rum, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody).

Alternatively, a reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific or selective for SGA-72M gene product or the test compound to anchor any complexes formed in solution, and a labeled antibody specific or selective for the other component of the possible complex to detect anchored complexes.

5.7.2 ASSAYS FOR POLYPEPTIDES THAT INTERACT WITH THE SGA-72M GENE PRODUCTS

Any method suitable for detecting interactions among polypeptides may be employed for identifying SGA-72M polypeptide-protein interactions. Polypeptides that interact with SGA-72M will be potential therapeutics for the freatment of cancer. Thus the assays described below are useful in identifying polypeptides that can be used in methods to treat cancer. Polypeptides that interact with SGA-72M can also be used in the diagnosis of cancer. Thus the assays described below are also useful in methods to diagnose cancer.

Among the traditional methods that may be employed are co-immunoprecipitation, crosslinking and co-purification through gradients or chromatographic columns (e.g., size exclusion chromatography). Utilizing procedures such as these allows for the isolation of intracellular polypeptides that interact with SGA-72M gene products. Once isolated, such an intracellular polypeptide can be identified and can, in turn, be used, in conjunction with standard teclmiques, to identify additional polypeptides with which it interacts. For example, at least a portion of the amino acid sequence of the intracellular polypeptide which interacts with the SGA-72M gene product can be ascertained using techniques well known to those of skill in the art, such as via the Edman degradation technique (see, e.g., Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., pp.34-49). The amino acid sequence obtained may be used as a guide for the generation of oligonucleotide mixtures that can be used to screen for gene sequences encoding such intracellular polypeptides. Screening may be accomplished, for example, by standard hybridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and the screening are well-known. (See, e.g., Ausubel, supra., and PCR Protocols: A Guide to Methods and Applications, 1990, frinis, M. et al, eds. Academic Press, Inc., New York).

Additionally, methods may be employed which result in the simultaneous identification of genes which encode a polypeptide interacting with the SGA-72M polypeptide. These methods include, for example, probing expression libraries with labeled SGA-72M polypeptide, using SGA-72M polypeptide in a manner similar to the well known technique of antibody probing of gtl 1 libraries.

One method that detects polypeptide interactions in vivo, the two-hybrid system, can be used. One version of this system has been described (Chien et al, 1991, supra) and is commercially available from Clontech (Palo Alto, CA).

5.7.3 ASSAYS FOR COMPOUNDS THAT INTERFERE WITH SGA- 72M GENE PRODUCT/ MACROMOLECULAR INTERACTION The SGA-72M gene product may, in vivo, interact with one or more macromolecules, such as polypeptides or nucleic acids. For puφoses of this discussion, such macromolecules are refened to herein as "interacting partners". Compounds that disrupt SGA-72M interactions in this way may be useful in regulating the activity of the SGA-72M gene product, including mutant SGA-72M gene products. Such compounds may include, but are not limited to molecules such as peptides, and the like, as described, for example, in Section 5.7.1 above, which would be capable of gaining access to the SGA- 72M gene product. Thus the assays described below are useful in identifying polypeptides and or nucleic acids that can be used in methods to treat cancer. Polypeptides and nucleic acids that interact with SGA-72M can also be used in the diagnosis of cancer, e.g., breast cancer. Thus the assays described below are also useful in methods to diagnose cancer, e.g., breast cancer.

The basic principle of the assay systems used to identify compounds that interfere with the interaction between the SGA-72M gene product and its interacting partner or partners involves preparing a reaction mixture containing the SGA-72M gene product, and the interacting partner under conditions and for a time sufficient to allow the two to interact and bind, thus forming a complex. In order to test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound may be initially included in the reaction mixture, or may be added at a time subsequent to the addition of SGA-72M gene product and its intracellular interacting partner. Control reaction mixtures are incubated without the test compound or with a placebo. The formation of any complexes between the SGA-72M polypeptide and the interacting partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the SGA-72M polypeptide and the interacting partner. Additionally, complex formation within reaction mixtures containing the test compound and normal SGA-72M polypeptide may also be compared to complex formation within reaction mixtures containing the test compound and a mutant SGA-72M polypeptide. This comparison may be important in those cases wherein it is desirable to identify compounds that disrupt interactions of mutant but not normal SGA-72M polypeptides.

The assay for compounds that interfere with the interaction of the SGA-72M gene products and interacting partners can be conducted in a heterogeneous or homogeneous format. Heterogeneous assays involve anchoring either the SGA-72M gene product or the binding partner onto a solid phase and detecting complexes anchored on the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the SGA-72M gene products and the interacting partners, e.g., by competition, can be identified by conducting the reaction in the presence of the test substance; i.e., by adding the test substance to the reaction mixture prior to or simultaneously with the SGA-72M polypeptide and intracellular interacting partner. Alternatively, test compounds that disrupt preformed complexes, e.g., compounds with higher binding constants that displace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed. The various formats are described briefly below. In a heterogeneous assay system, either the SGA-72M gene product or the interacting partner, is anchored onto a solid surface, while the non-anchored species is labeled, either directly or indirectly. In practice, microtiter plates are conveniently utilized. The anchored species may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished simply by coating the solid surface with a solution of the SGA-72M gene product or interacting partner and drying. Alternatively, an immobilized antibody specific or selective for the species to be anchored may be used to anchor the species to the solid surface. The surfaces may be prepared in advance and stored.

In order to conduct the assay, the partner of the immobilized species is exposed to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific or selective for the initially non-immobilized species (the antibody, in rum, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody). Depending upon the order of addition of reaction components, test compounds which inhibit complex formation or which disrupt preformed complexes can be detected.

Alternatively, the reaction can be conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific or selective for one of the interacting components to anchor any complexes formed in solution, and a labeled antibody specific or selective for the other partner to detect anchored complexes. Again, depending upon the order of addition of reactants to the liquid phase, test compounds which inhibit complex or which disrupt preformed complexes can be identified. In an alternate embodiment of the invention, a homogeneous assay can be used. In this approach, a preformed complex of the SGA-72M polypeptide and the interacting partner is prepared in which either the SGA-72M gene product or its interacting partner is labeled, but the signal generated by the label is quenched due to complex formation (see, e.g., U.S. Patent No. 4,109,496 by Rubenstein). The addition of a test substance that competes with and displaces one of the species from the preformed complex will result in the generation of a signal above background. In this way, test substances that disrupt SGA-72M polypeptide/intracellular interacting partner interaction can be identified.

In a particular embodiment, the SGA-72M gene product can be prepared for immobilization using recombinant DNA techniques described in Section 5.1, above. For example, the SGA-72M coding region can be fused to a glutathione-S-transferase (GST) gene using a fusion vector, such as pGEX-5X-l, in such a manner that its interacting activity is maintained in the resulting fusion polypeptide. The intracellular interacting partner can be purified and used to raise a monoclonal antibody, using methods routinely practiced in the art and described above, in Section 5.2. This antibody can be labeled with the radioactive isotope I, for example, by methods routinely practiced in the art. In a heterogeneous assay, e.g., the GST-SGA-72M fusion polypeptide can be anchored to glutathione-agarose beads. The intracellular interacting partner can then be added in the presence or absence of the test compound in a manner that allows interaction, e.g., binding, to occur. At the end of the reaction period, unbound material can be washed away, and the labeled monoclonal antibody can be added to the system and allowed to bind to the complexed components. The interaction between the SGA-72M polypeptide and the intracellular interacting partner can be detected by measuring the amount of radioactivity that remains associated with the glutathione-agarose beads. A successful inhibition of the interaction by the test compound will result in a decrease in measured radioactivity.

Alternatively, the GST-SGA-72M fusion polypeptide and the intracellular interacting partner can be mixed together in liquid in the absence of the solid glutathione- agarose beads. The test compound can be added either during or after the species are allowed to interact. This mixture can then be added to the glutathione-agarose beads and unbound material is washed away. Again the extent of inhibition of the SGA-72M gene product/interacting partner interaction can be detected by adding the labeled antibody and measuring the radioactivity associated with the beads. 5.7.4 CELL-BASED ASSAYS FOR SGA-72M ACTIVITY

Cell-based methods are presented herein which identify compounds capable of treating breast cancer and other cancers by modulating SGA-72M activity or expression levels. Specifically or selectively, such assays identify compounds that affect SGA-72M- dependent processes, such as but not limited to changes in cell moφhology, cell division, differentiation, adhesion, motility, or phosphorylation, dephosphorylation of cellular polypeptides. Such assays can also identify compounds that affect SGA-72M expression levels or gene activity directly. Compounds identified via such methods can, for example, be utilized in methods for treating breast cancer and other cancers and metastasis thereof. In one embodiment, an assay is a cell-based assay in which a cell which expresses a membrane-bound form of the SGA-72M gene product, or a biologically active portion thereof, on the cell surface is contacted with a test compound and the ability of the test compound to bind to the polypeptide determined. In another embodiment the SGA- 72M gene product is cytosolic. The cell, for example, can be a yeast cell or a cell of mammalian origin. Determining the ability of the test compound to bind to the polypeptide can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label such that binding of the test compound to the polypeptide or biologically active portion thereof can be determined by detecting the labeled compound in a complex. For example, test compounds can be labeled with 1251, 35S, 14C, or 3H, either directly or indirectly, and the radioisotope detected by direct counting of radio-emission or by scintillation counting. Alternatively, test compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. In a prefened embodiment, the assay comprises contacting a cell which expresses a membrane-bound form of a polypeptide of the invention, or a biologically active portion thereof, on the cell surface with a known compound which binds the polypeptide to form an assay mixture, contacting the assay mixture with a test compound, and determimng the ability of the test compound to interact with the polypeptide, wherein determining the ability of the test compound to interact with the polypeptide comprises determining the ability of the test compound to preferentially bind to the polypeptide or a biologically active portion thereof as compared to the known compound.

In another embodiment, the cell-based assays are based on expression of the SGA-72M gene product in a mammalian cell and measuring the SGA-72M-dependent process. Any mammalian cells that can express the SGA-72M gene and allow the functioning of the SGA-72M gene product can be used, in particular, cancer cells derived from the breast, such as MCF-7, BT483, Hs578T, HTB26, BT20 and T47D. Normal mammary gland cell lines such as, for example, CRL7030 and Hs578Bst, may also be used provided that an SGA-72M gene product is produced. Other mammalian cell lines that can be used include, but are not limited to CHO, HeLa, MH3T3, and Vero. Recombinant expression of the SGA-72M gene in these cells can be achieved by methods described in Section 5.2. In these assays, cells producing functional SGA-72M gene products are exposed to a test compound for an interval sufficient for the compound to modulate the activity of the SGA-72M gene product. The activity of SGA-72M gene product can be measured directly or indirectly through the detection or measurement of SGA-72M- dependent cellular processes. As a control, a cell not producing the SGA-72M gene product may be used for comparisons. Depending on the cellular process, any techniques known in the art may be applied to detect or measure it. In another embodiment a cell or cell line that is capable of expressing SGA-

72M is contacted with a test compound that is believed to modulate expression of the SGA- 72M gene. Expression levels of the SGA-72M gene can be monitored in the presence or absence of the test compound. Alternatively expression levels can be monitored in the presence of a test compound as compared to expression levels of the SGA-72M gene in the presence of a confrol compound or a placebo. Any method known in the art can be used to monitor SGA-72M gene expression. As an example, but not as a limitation, such methods can include Western blot, Northern Blot, and real-time quantitative RT-PCR.

In yet another embodiment cells which express the SGA-72M gene product, e.g., MCF-7 cells are made permeable, e.g., by treatment with a mild detergent and exposed to a test compound. Binding of the test compound can be detected directly (e.g., radioactively labeling the test compound) or indirectly (antibody detection) or by any means known in the art.

Any compound can be used in a cell based assay to test if it affects SGA- 72M activity or expression levels. The compound can be a polypeptide, a peptide, a nucleic acid, an antibody or fragment thereof, a small molecule, an organic molecule or an inorganic molecule, (e.g., steroid, pharmaceutical drug). A small molecule is considered a non-peptide compound with a molecular weight of less than 500 daltons. 5.8 METHODS FOR TREATMENT OF CANCER

Described below are methods and compositions for treating cancer, e.g., breast cancer using the SGA-72M gene or gene product as a therapeutic target. The outcome of a treatment is to at least produce in a treated subject a healthful benefit, which in the case of cancer, including breast cancer, includes but is not limited to remission of the cancer, palliation of the symptoms of the cancer, and/or control of metastatic spread of the cancer.

All such methods comprise methods that modulate SGA-72M gene activity and/or expression which in rum modulate the phenotype of the treated cell. In one embodiment, a method of treating cancer comprises administering to a subject in need thereof an effective amount of a SGA-72M antagonist, wherein said antagonist decreases expression of SGA-72M, decreases activity of SGA-72M and/or decreases the viability of a cell overexpressing SGA-72M. In a specific embodiment, the SGA-72M antagonist for use in the methods of the invention is an antibody, preferably a monoclonal antibody, that may or may not be conjugated to a cytotoxic agent. In a more specific embodiment, the SGA-72M antagonist for use in the methods of the invention is monoclonal antibody 7.3.1.

As discussed, above, successful freatment of breast cancer or other cancers can be brought about by techniques that serve to decrease SGA-72M activity. Activity can be decreased by, for example, directly decreasing SGA-72M gene product activity and/or by decreasing the level of SGA-72M gene expression. Thus the invention provides methods of treating a subject with cancer by administering to said subject an effective amount of a compound that antagonizes an SGA-72M gene product.

For example, compounds such as those identified through assays described, above, in Section 5.7, above, which decrease SGA-72M activity can be used in accordance with the invention to treat breast cancer or other cancers. As discussed in Section 5.7, above, such molecules can include, but are not limited to polypeptides, nucleic acids, peptides, including soluble peptides, and small organic or inorganic molecules, and can be referred to as SGA-72M antagonists. Techniques for the determination of effective doses and administration of such compounds are described, below, in Section 5.7.

Further, antisense and ribozyme molecules which inhibit SGA-72M gene expression can also be used in accordance with the invention to reduce the level of SGA- 72M gene expression, thus effectively reducing the level of SGA-72M gene product present, thereby decreasing the level of SGA-72M activity. The invention therefore relates to a pharmaceutical composition comprising an SGA-72M gene product. Still further, triple helix molecules can be utilized in reducing the level of SGA-72M gene activity. Such molecules can be designed to reduce or inhibit either wild type, or if appropriate, mutant target gene activity. Small organic or inorganic molecules can also be used to inhibit SGA- 72M gene expression and/or inhibit production or activity of an SGA-72M gene product. Techniques for the production and use of such molecules are well known to those of skill in the art.

5.8.1 ANTISENSE MOLECULES

Anti-sense nucleic acid molecules which are complementary to nucleic acid sequences contained within the SGA-72M gene as shown in FIG. 1 SEQ DD NO:l, including but not limited to anti-sense nucleic acid molecules complementary to SEQ DD NO:l and SEQ DD NO:2, can be used to treat any cancer, in which the expression level of the SGA-72M gene is elevated in cancerous cells or tissue as compared to normal cells or tissue or a predetermined non-cancerous standard. Thus in one embodiment of the invention a method of treating breast cancer is provided whereby a patient suffering from breast cancer is treated with an effective amount of an SGA-72M anti-sense nucleic acid molecule. Antisense approaches involve the design of oligonucleotides (either DNA or

RNA) that are complementary to SGA-72M gene mRNA. The antisense oligonucleotides will bind to the complementary SGA-72M gene mRNA transcripts and prevent translation. Absolute complementarity, although prefened, is not required. A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the non-poly A portion of the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. Oligonucleotides that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' unfranslated sequences of mRNAs have also been shown to be effective at inhibiting translation of mRNAs as well. ( See generally, Wagner, R., 1994, Nature 372:333). Thus, oligonucleotides complementary to the 5 '-non-translated region, the 3'-non-translated region, or the non-translated, non-coding region between the SGA-72M open reading frame of the SGA-72M gene (refened to herein after as the "intervening region", as shown, for example, in FIG. 1, could be used in an antisense approach to inhibit franslation of endogenous SGA-72M gene mRNA.

Oligonucleotides complementary to the 5' unfranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'-, intervening, or coding region of SGA-72M gene mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

Regardless of the choice of target sequence, it is prefened that in vitro studies are first performed to quantitate the ability of the antisense oligonucleotide to inhibit gene expression. It is prefened that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also prefened that these studies compare levels of the target RNA or polypeptide with that of an internal control RNA or polypeptide. Additionally, it is envisioned that results obtained using the antisense oligonucleotide are compared to those obtained using a control oligonucleotide. It is prefened that the control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence. The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. ScL USA 86:6553; Lemaifre et al, 1987, Proc. Nat Acad. Sci. USA 84:648; PCT Publication No. WO88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published April 25,

1988), hybridization-triggered cleavage agents, (see, e.g., Krol et al, 1988, BioTechniques 6:958) or intercalating agents, (see, e.g., Zon, 1988, Pharm. Res. 5:539). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc. The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,

2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5 -methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil- 5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.

The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, confrary to the usual β-units, the sfrands run parallel to each other (Gautier et al, 1987, Nucl Acids Res. 15:6625). The oligonucleotide is a 2 -0- methylribonucleotide (Inoue et al, 1987, Nucl. Acids Res. 15:6131), or a chimeric RNA- DNA analogue (Inoue et al, 1987, FEBSLett. 215:327).

The SGA-72M antisense nucleic acid sequence can comprise the complement of any contiguous segment within the sequence of the SGA-72M gene SEQ DD NO:l.

In one embodiment of the present invention, the SGA-72M antisense nucleic acid sequence is about 50 bp in length.

In another embodiment the SGA-72M antisense nucleic acid sequence is about 100 bp in length. In certain specific embodiments, the SGA-72M antisense nucleic acid sequence comprises the sequence from nucleotides 1-100, 51-150, 101-200, 151-250, 201-300, 251-350, 301-400, 351-450, 401-500, 451-550, 501-600, 551-650, 601-700, 651- 750, 701-800, 75-850, 801-900, 851-950, 901-1000, 951-1050, 1001-1100, 1051-1150, 1101-1200, 1151-1250, 1201-1300, 1251-1350, 1301-1400, 1351-1450, 1401-1500, 1451- 1550, 1501-1600, 1551-1650, 1601-1700, 1651-1750, 1701-1800, 1751-1850, 1801-1900, 1951-2050, 2001-2100, 2051-2150, 2101-2200, 2151-2250, 2201-2300, 2251-2350, 2301- 2400, 2351-2450, 2401-2500, 2451-2550, 2501-2600, 2551-2650, 2601-2700, 2651-2750, 2701-2800, 2751-2850, 2801-2900, 2951-3050, 3001-3100, 3051-3150, 3101-3200, 3151- 3250, 3201-3300, 3251-3350, 3301-3400, 3351-3450, 3401-3500, 3451-3550, 3501-3600, 3551-3650, 3601-3700, 3651-3750, 3701-3800, 3751-3850, 3801-3900, 3951-4050, 4001- 4100, 4051-4150, 4101-4200, 4151-4250 of SEQ ID NO:l.

In another embodiment the SGA-72M antisense nucleic acid sequence is about 200 bp in length. In a particular embodiment, the SGA-72M antisense nucleic acid sequence comprises the sequence from nucleotides 1-200, 101-300, 201-400, 301-500, 401- 600, 501-700, 601-800, 701-900, 801-1000, 901-1100, 1001-1200, 1101-1300, 1201-1400, 1301-1500, 1401-1600, 1501-1700, 1601-1800, 1701-1900, 1801-2000, 1901-2100, 2001- 2200, 2101-2300, 2201-2400, 2301-2500, 2401-2600, 2501-2700, 2601-2800, 2701-2900, 2801-3000, 2901-3100, 3001-3200, 3101-3300, 3201-3400, 3301-3500, 3401-3600, 3501- 3700, 3601-3800, 3701-3900, 3801-4000, 3901-4100, 4001-4200, 4101-4300 of SEQ DD NO:l.

In another embodiment the SGA-72M antisense nucleic acid sequence is about 400 bp in length. In a particular embodiment, the SGA-72M antisense nucleic acid sequence comprises the sequence from nucleotides 1-400, 101-500, 201-600, 301-700, 401- 800, 501-900, 601-1000, 701-1100, 801-1200, 901-1300, 1001-1400, 1101-1500, 1201- 1600, 1301-1700, 1401-1800, or 1501-1900, 1601-2000, 1701-2100, 1801-2200, 1901- 2300, 2001-2400, 2101-2500, 2201-2600, 2301-2700, 2401-2800, 2501-2900, 2601-3000, 2701-3100, 2801-3200, 2901-3300, 3001-3400, 3101-3500, 3201-3600, 3301-3700, 3401- 3800, 3501-3900, 3601-4000, 3701-4100, 3801-4200, 3901-4300, 4001-4400, 4101-4500 of SEQ ID NO:l.

Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al, 1988, Proc. Natl. Acad. ScL U.S.A. 85:7448), etc.

While antisense nucleotides complementary to the SGA-72M coding region could be used, those complementary to the transcribed untranslated region are most prefened.

The antisense molecules should be delivered to cells that express the SGA- 72M gene in vivo. A number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that are capable of binding specifically or selectively to receptors or antigens expressed on the target cell surface) can be administered systemically.

However, it is often difficult to achieve intracellular concentrations of the antisense sufficient to suppress franslation of endogenous mRNAs. Therefore a prefened approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter. The use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous SGA- 72M gene transcripts and thereby prevent translation of the SGA-72M gene mRNA. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bemoist and Chambon, 1981, Nature 290:304), the promoter contained in the 3' long terminal repeat of Rous sarcoma vims (Yamamoto et al, 1980, Cell 22:787), the heφes thymidine kinase promoter (Wagner et al, 1981, Proc. Natl. Acad. Sci. USA 78:1441), the regulatory sequences of the metallothionein gene (Brinster et al. , 1982, Nature 296:39), etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site. Alternatively, viral vectors can be used which selectively infect the desired tissue.

The effective dose of SGA-72M antisense oligonucleotide to be administered during a treatment cycle ranges from about 0.01 to 0.1, 0.1 to 1, or 1 to 10 mg/kg/day. The dose of SGA-72M antisense oligonucleotide to be administered can be dependent on the mode of adminisfration. For example, intravenous administration of an SGA-72M antisense oligonucleotide would likely result in a significantly higher full body dose than a full body dose resulting from a local implant containing a pharmaceutical composition comprising SGA-72M antisense oligonucleotide. In one embodiment, an

SGA-72M antisense oligonucleotide is administered subcutaneously at a dose of 0.01 to 10 mg/kg/day. In another embodiment, an SGA-72M antisense oligonucleotide is administered intravenously at a dose of 0.01 to 10 mg/kg/day. In yet another embodiment, an SGA-72M antisense oligonucleotide is administered locally at a dose of 0.01 to 10 mg/kg/day. It will be evident to one skilled in the art that local administrations can result in lower total body doses. For example, local administration methods such as intratumor administration, intraocular injection, or implantation, can produce locally high concentrations of SGA-72M antisense oligonucleotide, but represent a relatively low dose with respect to total body weight. Thus, in such cases, local adminisfration of an SGA-72M antisense oligonucleotide is contemplated to result in a total body dose of about 0.01 to 5 mg/kg/day. In another embodiment, a particularly high dose of SGA-72M antisense oligonucleotide, which ranges from about 10 to 50 mg/kg/day, is administered during a treatment cycle.

Moreover, the effective dose of a particular SGA-72M antisense oligonucleotide may depend on additional factors, including the type of disease, the disease state or stage of disease, the oligonucleotide' s toxicity, the oligonucleotide 's rate of uptake by cancer cells, as well as the weight, age, and health of the individual to whom the antisense oligonucleotide is to be admimstered. Because of the many factors present in vivo that may interfere with the action or biological activity of an SGA-72M antisense oligonucleotide, one of ordinary skill in the art can appreciate that an effective amount of an SGA-72M antisense oligonucleotide may vary for each individual.

In another embodiment, an SGA-72M antisense oligonucleotide is at a dose which results in circulating plasma concentrations of an SGA-72M antisense oligonucleotide which is at least 50 nM (nanomolar). As will be apparent to the skilled artisan, lower or higher plasma concentrations of an SGA-72M antisense oligonucleotide may be prefened depending on the mode of administration. For example, plasma concentrations of an SGA-72M antisense oligonucleotide of at least 50 nM can be appropriate in connection with intravenous, subcutaneous, intramuscular, controlled release, and oral administration methods, to name a few. In another example, relatively low circulating plasma levels of an SGA-72M antisense oligonucleotide can be desirable, however, when using local administration methods such as, for example, intratumor administration, intraocular adminisfration, or implantation, which nevertheless can produce locally high, clinically effective concentrations of SGA-72M antisense oligonucleotide.

The high dose may be achieved by several administrations per cycle. Alternatively, the high dose may be admimstered in a single bolus adminisfration. A single administration of a high dose may result in circulating plasma levels of SGA-72M antisense oligonucleotide that are transiently much higher than 50 nM.

Additionally, the dose of an SGA-72M antisense oligonucleotide may vary according to the particular SGA-72M antisense oligonucleotide used. The dose employed is likely to reflect a balancing of considerations, among which are stability, localization, cellular uptake, and toxicity of the particular SGA-72M antisense oligonucleotide. For example, a particular chemically modified SGA-72M antisense oligonucleotide may exhibit greater resistance to degradation, or may exhibit higher affinity for the target nucleic acid, or may exhibit increased uptake by the cell or cell nucleus; all of which may permit the use of low doses. In yet another example, a particular chemically modified SGA-72M antisense oligonucleotide may exhibit lower toxicity than other antisense oligonucleotides, and therefore can be used at high doses. Thus, for a given SGA-72M antisense oligonucleotide, an appropriate dose to administer can be relatively high or relatively low. Appropriate doses would be appreciated by the skilled artisan, and the invention contemplates the continued assessment of optimal freatment schedules for particular species of SGA-72M antisense oligonucleotides. The daily dose can be administered in one or more treatments. A "low dose" or "reduced dose" refers to a dose that is below the normally admimstered range, i.e., below the standard dose as suggested by the Physicians' Desk rh

Reference, 54 Edition (2000) or a similar reference. Such a dose can be sufficient to inhibit cell proliferation, or demonstrates ameliorative effects in a human, or demonstrates efficacy with fewer side effects as compared to standard cancer treatments. Normal dose ranges used for particular therapeutic agents and standard cancer treatments employed for specific diseases can be found in the Physicians' Desk Reference, 54^th Edition (2000) or in Cancer: Principles & Practice of Oncology, DeVita, Jr., Hellman, and Rosenberg (eds.) 2nd edition, Philadelphia, PA: J.B. Lippincott Co., 1985.

Reduced doses of SGA-72M nucleic acid molecule, SGA-72M polypeptide, SGA-72M antagonist, and or combination therapeutic can demonstrate reduced toxicity, such that fewer side effects and toxicities are observed in connection with admimstering an SGA-72M antagonist and one or more cancer therapeutics for shorter duration and/or at lower dosages when compared to other treatment protocols and dosage formulations, including the standard freatment protocols and dosage formulations as described in the Physicians' Desk Reference, 54^th Edition (2000) or in Cancer: Principles & Practice of Oncology, DeVita, Jr., Hellman, and Rosenberg (eds.) 2nd edition, Philadelphia, PA: J.B. Lippincott Co., 1985.

A "treatment cycle" or "cycle" refers to a period during which a single therapeutic or sequence of therapeutics is administered. In some instances, one treatment cycle may be desired, such as, for example, in the case where a significant therapeutic effect is obtained after one treatment cycle. The present invention contemplates at least one treatment cycle, generally preferably more than one treatment cycle. Other factors to be considered in determimng an effective dose of an SGA- 72M antisense oligonucleotide include whether the oligonucleotide will be administered in combination with other therapeutics. In such cases, the relative toxicity of the other therapeutics may indicate the use of an SGA-72M antisense oligonucleotide at low doses. Alternatively, freatment with a high dose of SGA-72M antisense oligonucleotide can result in combination therapies with reduced doses of therapeutics. In a specific embodiment, freatment with a particularly high dose of SGA-72M antisense oligonucleotide can result in combination therapies with greatly reduced doses of cancer therapeutics. For example, freatment of a patient with 10, 20, 30, 40, or 50 mg/kg/day of an SGA-72M antisense oligonucleotide can further increase the sensitivity of a subject to cancer therapeutics. In such cases, the particularly high dose of SGA-72M antisense oligonucleotide is combined with, for example, a greatly shortened radiation therapy schedule. In another example, the particularly high dose of an SGA-72M antisense oligonucleotide produces significant enhancement of the potency of cancer therapeutic agents.

Additionally, the particularly high doses of SGA-72M antisense oligonucleotide may further shorten the period of administration of a therapeutically effective amount of SGA-72M antisense oligonucleotide and/or additional therapeutic, such that the length of a freatment cycle is much shorter than that of the standard freatment. The invention contemplates other freatment regimens depending on the particular SGA-72M antisense oligonucleotide to be used, or depending on the particular mode of administration, or depending on whether an SGA-72M antisense oligonucleotide is admimstered as part of a combination therapy, e.g., in combination with a cancer therapeutic agent. The daily dose can be administered in one or more treatments.

5.8.2 RIBOZYME MOLECULES

Ribozyme molecules that are complementary to RNA sequences coded for by the SGA-72M gene as shown in FIG. 1 can be used to treat any cancer, including breast cancer.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA (For a review see, for example Rossi, J., 1994, Current Biology 4:469). The mechanism of ribozyme action involves sequence specific or selective hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage. The composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage (See U.S. Pat. No. 5,093,246). As such, within the scope of the invention are engineered hammerhead motif ribozyme molecules that specifically or selectively and efficiently catalyze endonucleolytic cleavage of RNA sequences encoding target polypeptides. Ribozyme molecules designed to catalytically cleave SGA-72M mRNA transcripts can also be used to prevent translation of SGA-72M mRNA and expression of target or pathway gene. (See, e.g., PCT International Publication WO90/11364, published October 4, 1990; Sarver et al, 1990, Science 247:1222). While ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy SGA-72M mRNAs, the use of hammerhead ribozymes is prefened. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature 334:585. Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the SGA-72M mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts. The ribozymes of the present invention also include RNA endoribonucleases

(hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tefrahymena Thermophila (known as the INS, or L-19 INS RΝA) and which has been extensively described by Thomas Cech and collaborators (Zaug et al, 1984, Science 224:574; Zaug and Cech, 1986, Science 231:470; Zaug et al, 1986, Nature 324:429; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech, 1986, Cell 47:207). The Cech-type ribozymes have an eight base pair active site that hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes that target eight base-pair active site sequences that are present in an SGA-72M gene. As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g., for improved stability, targeting, etc.) and should be delivered to cells that express the SGA-72M gene in vivo. A prefened method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol DI or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous SGA-72M gene messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency. Anti-sense RNA and DNA, ribozyme, and triple helix molecules of the invention can be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing ohgodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules can be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences can be incoφorated into a wide variety of vectors that incoφorate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.

Various well-known modifications to the DNA molecules can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy- nucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.

5.8.3 THERAPEUTIC ANTIBODIES

An antibody to a SGA-72M polypeptide or a SGA-72M-related polypeptide, e.g., one that exhibits the capability to downregulate SGA-72M gene product activity can be utilized to treat breast cancer and other cancers, particularly wherein the SGA-72M expression levels are elevated. Such antibodies can be generated using standard techniques described in Section 5.3, above, against wild type or mutant SGA-72M polypeptides or SGA-72M-related polypeptides, or against peptides conesponding to portions of the polypeptides. The antibodies include but are not limited to polyclonal, monoclonal, Fab fragments, single chain antibodies, chimeric antibodies, and the like. Antibodies that recognize any epitope on the SGA-72M polypeptide can be used as therapy against cancer. The SGA-72M polypeptide appears to be associated with the plasma membrane (see Simpson et al, 2000, EMBO reports. 3:287-292), as illustrated in FIG. 11 and described in Section 6.3.3. Thus, antibodies that recognize surface expressed epitopes of SGA-72M are useful to treat or prevent cancer.

Because SGA-72M can also be expressed as an intracellular polypeptide, it is preferred that internalizing antibodies be used. However, lipofectin or liposomes can be used to deliver the antibody or a fragment of the Fab region that binds to the SGA-72M epitope into cells. Where fragments of the antibody are used, the smallest inhibitory fragment that binds to the SGA-72M is prefened. For example, peptides having an amino acid sequence conesponding to the domain of the variable region of the antibody that binds to SGA-72M can be used. Such peptides can be synthesized chemically or produced via recombinant DNA technology using methods well known in the art (e.g. , see Creighton, 1983, supra; and Sambrook et al, 1989, supra). Alternatively, single chain antibodies, such as neutralizing antibodies, which bind to intracellular epitopes can also be admimstered. Such single chain antibodies can be administered, for example, by expressing nucleotide sequences encoding single-chain antibodies within the target cell population by utilizing, for example, techmques such as those described in Marasco et al. (Marasco,, et al, 1993, Proc. Natl. Acad. Sci. USA 90:7889).

The invention also contemplates the use of antibodies that are conjugated to a cytostatic and/or a cytotoxic agent in the methods of the invention, e.g., the freatment of cancer. A useful class of cytotoxic or cytostatic agents for practicing the therapeutic regimens of the present invention, by conjugation to an antibody, include, but are not limited to, the following non-mutually exclusive classes of agents: alkylating agents, anthracyclines, antibiotics, antifolates, antimetabolites, antitubulin agents, auristatins, chemotherapy sensitizers, DNA minor groove binders, DNA replication inhibitors, duocarmycins, etoposides, fluorinated pyrimidines, lexitropsins, nifrosoureas, platinols, purine antimetabolites, puromycins, radiation sensitizers, steroids, taxanes, topoisomerase inhibitors, and vinca alkaloids.

Individual cytotoxic or cytostatic agents encompassed by the invention include but are not limited to an androgen, anthramycin (AMC), asparaginase, 5- azacytidine, azathioprine, bleomycin, busulfan, buthionine sulfoximine, camptothecin, carboplatin, carmustine (BSNU), CC-1065, chlorambucil, cisplatin, colchicine, cyclophosphamide, cytarabine, cytidine arabinoside, cytochalasin B, dacarbazine, dactinomycin (formerly actinomycin), daunorubicin, decarbazine, docetaxel, doxorubicin, an estrogen, 5-fluordeoxyuridine, 5-fluorouracil, gramicidin D, hydroxyurea, idarubicin, ifosfamide, irinotecan, lomustine (CCNU), mechlorethamine, melphalan, 6-mercaptopurine, methotrexate, mithramycin, mitomycin C, mitoxanfrone, nifroimidazole, paclitaxel, plicamycin, procarbizine, streptozotocin, tenoposide, 6-thioguanine, thioTEPA, topotecan, vinblastine, vincristine, vinorelbine, VP-16 and VM-26. In a preferred embodiment, the cytotoxic or cytostatic agent is an antimetabohte. The antimetabohte can be a purine antagonist (e.g., azothioprine) or mycophenolate mofetil), a dihydrofolate reductase inhibitor (e.g., methotrexate), acyclovir, gangcyclovir, zidovudine, vidarabine, ribavarin, azidothymidine, cytidine arabinoside, amantadine, dideoxyuridine, iododeoxyuridine, poscarnet, and trifluridine. Techniques for conjugating such therapeutic moieties to polypeptides, and in particular to antibodies, are well known, .see, e.g., Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc., 1985); Hellsfrom et al, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc., 1987); Thoφe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303- 16 (Academic Press 1985), and Thoφe et al , 1982, Immunol. Rev. 62:119-58.

5.8.4 TARGETED DISRUPTION OF SGA-72M EXPRESSION

As briefly described in Section 5.2.3, supra, endogenous SGA-72M gene expression can also be reduced by inactivating or "knocking out" the gene or its promoter using targeted homologous recombination, (e.g., see Smithies et al, 1985, Nature 317:230; Thomas & Capecchi, 1987, Cell 51:503; Thompson et al, 1989 Cell 5:313). For example, a mutant, non-functional SGA-72M gene (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous SGA-72M gene (either the coding regions or regulatory regions of the SGA-72M gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express SGA-72M gene in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the SGA-72M gene. Such approaches are particularly suited where modifications to ES (embryonic stem) cells can be used to generate animal offspring with an inactive SGA-72M gene homolog (e.g., see Thomas & Capecchi 1987 supra and Thompson 1989, supra). Such techniques can also be utilized to generate animal models of breast cancer and other types of cancer. It should be noted that this approach can be adapted for use in humans provided the recombinant DNA constructs are directly admimstered or targeted to the required site in vivo using appropriate vectors, e.g., heφes vims vectors, retrovirus vectors, adenovirus vectors, or adeno associated vims vectors.

Alternatively, endogenous SGA-72M gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the SGA-72M gene (L e. , the SGA-72M gene promoter and/or enhancers) to form triple helical structures that prevent transcription of the SGA-72M gene in target cells in the body. (See generally, Helene, 1991, Anticancer Drug Des. 6(6):569; Helene et al, 1992, Ann, N.Y. Acad. Sci. 660:27; and Maher, 1992, Bioassays 14(12):807).

5.8.5 COMBINATION THERAPIES The administration of an SGA-72M antagonist can potentiate the effect of anti-cancer agents. In a prefened embodiment, the invention further encompasses the use of combination therapy to prevent or treat cancer. In one embodiment, the SGA-72M antagonist selectively or specifically or selectively antagonizes SGA-72M expression or activity. In another embodiment, the SGA-72M antagonist selectively or specifically or selectively antagonizes SGA-72M expression or activity. In yet another embodiment, the SGA-72M antagonist antagonizes both SGA-72M expression or activity.

In one embodiment, breast cancer and other cancers (e.g., ovarian, lymphoid or skin cancer) can be treated with a pharmaceutical composition comprising an SGA-72M antagonist in combination with 5-fluorouracil, cisplatin, docetaxel, doxorubicin, Herceptin®, gemcitabine (Seidman, 2001, Oncology 15:11-14), IL-2, paclitaxel, and/or VP-16 (etoposide).

These combination therapies can also be used to prevent cancer, prevent the recurrence of cancer, or prevent the spread or metastasis or cancer.

Combination therapy also includes, in addition to administration of an SGA- 72M antagonist, the use of one or more molecules, compounds or treatments that aid in the prevention or treatment of cancer (i.e., cancer therapeutics), which molecules, compounds or freatments includes, but is not limited to, chemoagents, immunotherapeutics, cancer vaccines, anti-angiogenic agents, cytokines, hormone therapies, gene therapies, and radiotherapies.

In one embodiment, one or more chemoagents, in addition to an SGA-72M antagonist, is administered to treat a cancer patient. A chemoagent (or "anti-cancer agent" or "anti-tumor agent" or "cancer therapeutic") refers to any molecule or compound that assists in the freatment of tumors or cancer. Examples of chemoagents contemplated by the present invention include, but are not limited to, cytosine arabinoside, taxoids (e.g., paclitaxel, docetaxel), anti-tubulin agents (e.g., paclitaxel, docetaxel, epothilone B, or its analogues), macrolides (e.g., rhizoxin ) cisplatin, carboplatin, adriamycin, tenoposide, mitozantron, discodermolide, eleutherobine, 2-chlorodeoxyadenosine, alkylating agents (e.g., cyclophosphamide, mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (D) (DDP) cisplatin, thio- tepa), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, anthramycin), antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, flavopiridol, 5-fluorouracil, fludarabine, gemcitabine, dacarbazine, temozolamide), asparaginase, Bacillus Calmette and Guerin, diphtheria toxin, hexamethylmelamine, hydroxyurea, LYSODREN®, nucleoside analogues, plant alkaloids (e.g., Taxol, paclitaxel, camptothecin, topotecan, irinotecan (CAMPTOSAR, CPT- 11), vincristine, vinca alkyloids such as vinblastine), podophyllotoxin (including derivatives such as epipodophyllotoxin, VP-16 (etoposide), VM-26 (teniposide), cytochalasin B, colchine, gramicidin D, ethidium bromide, emetine, mitomycin, procarbazine, mechlorethamine, anthracyclines (e.g., daunorubicin (formerly daunomycin), doxorubicin, doxombicin liposomal), dihydroxyanthracindione, mitoxanfrone, mithramycin, actinomycin D, procaine, tetracaine, lidocaine, propranolol, puromycin, anti-mitotic agents, abrin, ricin A, pseudomonas exotoxin, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, aldesleukin, allutamine, anasfrozle, bicalutamide, biaomycin, busulfan, capecitabine, carboplain, chlorabusil, cladribine, cylarabine, daclinomycin, esframusine, floxuridhe, gamcitabine, gosereine, idarubicin, itosfamide, lauprolide acetate, levamisole, lomusline, mechlorethamine, magesfrol, acetate, mercaptopurino, mesna, mitolanc, pegaspergase, pentoslatin, picamycin, riuxlmab, campath-1, straplozocin, thioguanine, tretinoin, vinorelbine, or any fragments, family members, or derivatives thereof, including pharmaceutically acceptable salts thereof. Compositions comprising one or more chemoagents (e.g., FLAG, CHOP) are also contemplated by the present invention. FLAG comprises fludarabine, cytosine arabinoside (Ara-C) and G-CSF. CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone.

In one embodiment, said chemoagent is gemcitabine at a dose ranging from 100 to 1000 mg/m /cycle. In one embodiment, said chemoagent is dacarbazine at a dose ranging from 200 to 4000 mg/m²/cycle. In a prefened embodiment, said dose ranges from 700 to 1000 mg/m /cycle. In another embodiment, said chemoagent is fludarabine at a dose ranging from 25 to 50 mg/m²/cycle. In another embodiment, said chemoagent is cytosine arabinoside (Ara-C) at a dose ranging from 200 to 2000 mg/m /cycle. In another embodiment, said chemoagent is docetaxel at a dose ranging from 1.5 to 7.5 mg/kg/cycle. In another embodiment, said chemoagent is paclitaxel at a dose ranging from 5 to 15 mg/kg/cycle. In yet another embodiment, said chemoagent is cisplatin at a dose ranging from 5 to 20 mg/kg/cycle. In yet another embodiment, said chemoagent is 5- fluorouracil at a dose ranging from 5 to 20 mg/kg/cycle. In yet another embodiment, said chemoagent is doxombicin at a dose ranging from 2 to 8 mg/kg/cycle. In yet another embodiment, said chemoagent is epipodophyllotoxin at a dose ranging from 40 to 160 mg/kg/cycle. In yet another embodiment, said chemoagent is cyclophosphamide at a dose ranging from 50 to 200 mg/kg/cycle. In yet another embodiment, said chemoagent is irinotecan at a dose ranging from 50 to 75, 75 to 100, 100 to 125, or 125 to 150 mg/m²/cycle. In yet another embodiment, said chemoagent is vinblastine at a dose ranging from 3.7 to 5.4, 5.5 to 7.4, 7.5 to 11, or 11 to 18.5 mg/m²/cycle. In yet another embodiment, said chemoagent is vincristine at a dose ranging from 0.7 to 1.4, or 1.5 to 2 mg/m²/cycle. In yet another embodiment, said chemoagent is methotrexate at a dose ranging from 3.3 to 5, 5 to 10, 10 to 100, or 100 to 1000 mg/m²/cycle. In a prefened embodiment, the invention further encompasses the use of low doses of chemoagents when administered as part of an SGA-72M antagonist treatment regimen. For example, initial freatment with an SGA-72M antagonist increases the sensitivity of a tumor to subsequent challenge with a dose of chemoagent, which dose is near or below the lower range of dosages when the chemoagent is administered without an SGA-72M antagonist. In one embodiment, an SGA-72M antagonist and a low dose (e.g., 6 to 60 mg/m²/day or less) of docetaxel are admimstered to a cancer patient. In another embodiment, an SGA-72M antagonist and a low dose (e.g., 10 to 135 mg/m²/day or less) of paclitaxel are admimstered to a cancer patient. In yet another embodiment, an SGA-72M antagonist and a low dose (e.g., 2.5 to 25 mg/m /day or less) of fludarabine are admimstered to a cancer patient. In yet another embodiment, an SGA-72M antagonist and a low dose (e.g., 0.5 to 1.5 g/m²/day or less) of cytosine arabinoside (Ara-C) are admimstered to a cancer patient. The invention, therefore, contemplates the use of one or more SGA-72M antagonists, which is administered prior to, subsequently, or concunently with low doses of chemoagents, for the prevention or treatment of cancer.

In one embodiment, said chemoagent is gemcitabine at a dose ranging from 10 to 100mg/m²/cycle. In one embodiment, said chemoagent is cisplatin, e.g., PLATINOL™ or

PLATINOL-AQ™(Bristol Myers), at a dose ranging from 5 to 10, 10 to 20, 20 to 40, or 40 to 75 mg/m²/cycle. In another embodiment, a dose of cisplatin ranging from 7.5 to 75 mg/m²/cycle is administered to a patient with ovarian cancer or other cancer. In another embodiment, a dose of cisplatin ranging from 5 to 50 mg/m /cycle is administered to a patient with bladder cancer or other cnacer.

In another embodiment, said chemoagent is carboplatin, e.g., PARAPLATIN™(Bristol Myers), at a dose ranging from 2 to 4, 4 to 8, 8 to 16, 16 to 35, or 35 to 75 mg/m²/cycle. In another embodiment, a dose of carboplatin ranging from 7.5 to 75 mg/m²/cycle is administered to a patient with ovarian cancer or other cancer. In another embodiment, a dose of carboplatin ranging from 5 to 50 mg/m²/cycle is admimstered to a patient with bladder cancer or other cancer. In another embodiment, a dose of carboplatin ranging from 2 to 20 mg/m²/cycle is administered to a patient with testicular cancer or other cnacer.

In another embodiment, said chemoagent is docetaxel, e.g., TAXOTERE™ (Rhone Poulenc Rorer) at a dose ranging from 6 to 10, 10 to 30, or 30 to 60 mg/m²/cycle.

In another embodiment, said chemoagent is paclitaxel, e.g., TAXOL™ (Bristol Myers Squibb), at a dose ranging from 10 to 20, 20 to 40, 40 to 70, or 70 to 135 mg/kg/cycle.

In another embodiment, said chemoagent is 5-fluorouracil at a dose ranging from 0.5 to 5 mg/kg/cycle. In another embodiment, said chemoagent is doxorubicin, e.g., ADRIAMYCIN™ (Pharmacia & Upjohn), DOXIL (Alza), RTJBEX™ (Bristol Myers Squibb), at a dose ranging from 2 to 4, 4 to 8, 8 to 15, 15 to 30, or 30 to 60 mg/kg/cycle.

In another embodiment, an SGA-72M antagonist is administered in combination with one or more immunotherapeutic agents, such as antibodies and immunomodulators, which includes, but is not limited to, Herceptin®, Retuxan®, OvaRex, Panorex, BEC2, IMC-C225, Vitaxin, Campath ITH, Smart MI95, LymphoCide, Smart I D10, and Oncolym, rituxan, rituximab, gemtuzumab, or trastuzumab.

In another embodiment, an SGA-72M antagonist is admimstered in combination with one or more anti-angiogenic agents, which includes, but is not limited to, angiostatin, thalidomide, kringle 5, endostatin, Seφin (Serine Protease Inhibitor) anti- thrombin, 29 kDa N-terminal and a 40 kDa C-terminal proteolytic fragments of fibronectin, 16 kDa proteolytic fragment of prolactin, 7.8 kDa proteolytic fragment of platelet factor-4 , a 13-amino acid peptide conesponding to a fragment of platelet factor-4 (Maione et al., 1990, Cancer Res. 51 :2077), a 14-amino acid peptide conesponding to a fragment of collagen I (Tolma et al., 1993, J. Cell Biol. 122:497), a 19 amino acid peptide conesponding to a fragment of Thrombospondin I (Tolsma et al., 1993, J. Cell Biol. 122:497), a 20-amino acid peptide conesponding to a fragment of SPARC (Sage et al., 1995, J. Cell. Biochem. 57:1329-), or any fragments, family members, or derivatives thereof, including pharmaceutically acceptable salts thereof.

Other peptides that inhibit angiogenesis and conespond to fragments of laminin, fibronectin, procollagen, and EGF have also been described (See the review by Cao, 1998, Prog. Mol. Subcell Biol. 20:161). Monoclonal antibodies and cyclic pentapeptides, which block certain integrins that bind RGD proteins (i.e., possess the peptide motif Arg-Gly- Asp), have been demonsfrated to have anti-vascularization activities (Brooks et al, 1994, Science 264:569; Harnmes et al, 1996, Nature Medicine 2:529). Moreover, inhibition of the urokinase plasminogen activator receptor by receptor antagonists inhibits angiogenesis, tumor growth and metastasis (Min et al, 1996, Cancer Res. 56:2428-33; Crowley et al, 1993, Proc Natl Acad Sci. USA 90:5021). Use of such anti-angiogenic agents is also contemplated by the present invention.

In another embodiment, an SGA-72M antagonist is admimstered in combination with a regimen of radiation. In another embodiment, an SGA-72M antagonist is administered in combination with one or more cytokines, which includes, but is not limited to, lymphokines, tumor necrosis factors, tumor necrosis factor-like cytokines, lymphotoxin-α, lymphotoxin-jS, interferon- a, interferon- β, macrophage inflammatory proteins, granulocyte monocyte colony stimulating factor, interleukins (including, but not limited to, interleukin- 1, interleukin-2, interleukin-6, interleukin- 12, interleukin-15, interleukin- 18), OX40, CD27, SGA-72M, CD40 or CD 137 ligands, Fas-Fas ligand, 4-1BBL, endothelial monocyte activating protein or any fragments, family members, or derivatives thereof, including pharmaceutically acceptable salts thereof. In yet another embodiment, an SGA-72M antagonist is administered in combination with a cancer vaccine. Examples of cancer vaccines include, but are not limited to, autologous cells or tissues, non-autologous cells or tissues, carcinoembryonic antigen, alpha- fetoprotein, human chorionic gonadotropin, BCG live vaccine, melanocyte lineage proteins (e.g., gplOO, MART-1/MelanA, TRP-1 (gp75), tyrosinase, widely shared tumor-associated, including tumor-specific, antigens (e.g., BAGE, GAGE-1, GAGE-2, MAGE-1, MAGE-3, N-acetylglucosaminyltransferase-V, pi 5), mutated antigens that are tumor-associated (β-catenin, MUM-1, CDK4), nonmelanoma antigens (e.g., HER-2/neu (breast and ovarian carcinoma), human papillomavirus-E6, E7 (cervical carcinoma), MUC- 1 (breast, ovarian and pancreatic carcinoma). For human tumor antigens recognized by T cells, see generally Robbins and Kawakami, 1996, Curr. Opin. Immunol. 8:628. Cancer vaccines may or may not be purified preparations.

In yet another embodiment, an SGA-72M antagonist is used in association with a hormonal freatment. Hormonal therapeutic freatments comprise hormonal agonists, hormonal antagonists (e.g., flutamide, tamoxifen, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, betamethasone, cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), antigestagens (e.g., mifepristone, onapristone), and antiandrogens (e.g., cyproterone acetate). In yet another embodiment, an SGA-72M antagonist is used in association with a gene therapy program in the treatment of cancer. In one embodiment, gene therapy with recombinant cells secreting interleukin-2 is administered in combination with an SGA- 72M antagonist to prevent or treat cancer, particularly breast cancer (See, e.g., Deshmukh et al, 2001, J. Neurosurg. 94:287).

In one embodiment, an SGA-72M antagonist is administered, in combination with at least one cancer therapeutic agent, for a short freatment cycle to a cancer patient to treat cancer. The duration of freatment with the cancer therapeutic agent may vary according to the particular cancer therapeutic agent used. The invention also contemplates discontinuous adminisfration or daily doses divided into several partial administrations. An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan, and the invention contemplates the continued assessment of optimal treatment schedules for each cancer therapeutic agent.

The present invention contemplates at least one cycle, preferably more than one cycle during which a single therapeutic or sequence of therapeutics is admimstered. An appropriate period of time for one cycle will be appreciated by the skilled artisan, as will the total number of cycles, and the interval between cycles. The invention contemplates the continued assessment of optimal treatment schedules for each SGA-72M antagonist and cancer therapeutic agent.

5.9 PHARMACEUTICAL PREPARATIONS AND METHODS OF ADMINISTRATION

The compounds, polypeptides, peptides, nucleic acid sequences and fragments thereof, described herein can be administered to a patient at therapeutically effective doses to treat cancer, e.g., breast cancer wherein the expression level of the SGA- 72M gene is elevated compared to a non-cancerous sample or a predetermined noncancerous standard. A therapeutically effective dose refers to that amount of a compound sufficient to result in a healthful benefit in the treated subject.

5.9.1 EFFECTIVE DOSE

Toxicity and therapeutic efficacy of compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio

LD₅o/ED₅₀. Compounds that exhibit large therapeutic indices are prefened. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to unaffected cells and, thereby, reduce side effects.

The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the EDs₀ with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured by any technique known in the art, for example, by high performance liquid chromatography.

5.9.2 FORMULATIONS AND USE

The invention relates to pharmaceutical compositions, including, but not limited to pharmaceutical compositions comprising an SGA-72M gene product, or antagonists thereof, for the freatment or prevention of cancer.

Pharmaceutical compositions for use in accordance with the present invention, e.g., methods to treat or prevent cancer, can be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients.

Thus, the compounds and their physiologically acceptable salts and solvents can be formulated for adminisfration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration. For oral administration, the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol symp, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations can also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.

Preparations for oral administration can be suitably formulated to give controlled release of the active compound.

For buccal administration the compositions can take the form of tablets or lozenges formulated in conventional manner.

For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g. , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds can be formulated for parenteral adminisfration (i.e., intravenous or intramuscular) by injection, via, for example, bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. It is prefened that the TH cell subpopulation cells be introduced into patients via intravenous administration. The compounds can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described previously, the compounds can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

5.10 VACCINE THERAPY

SGA-72M peptides and polypeptides or fragments thereof can be used as vaccines by administering to an individual at risk of developing cancer an amount of said polypeptide, peptide, or nucleic acid that effectively stimulates an immune response against an SGA-72M-encoded polypeptide and protects that individual from cancer. The invention thus contemplates a method of vaccinating a subject against cancer wherein said subject is at risk of developing cancer.

Many methods may be used to introduce the vaccine formulations described above, these include but are not limited to intranasal, intratracheal, oral, intradermal, intramuscular, intraperitoneal, intravenous, and subcutaneous route. Various adjuvants may be used to increase the immunological response, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art.

The nucleotides of the invention, including variants and derivatives, can be used as vaccines, e.g., by genetic immunization. Genetic immunization is particularly advantageous as it stimulates a cytotoxic T-cell response but does not utilize live attenuated vaccines, which can revert to a virulent form and infect the host causing complications from infection. As used herein, genetic immunization comprises inserting the nucleotides of the invention into a host, such that the nucleotides are taken up by host cells and the polypeptides encoded by the nucleotides are translated. These translated polypeptides are then either secreted or processed by the host cell for presentation to immune cells and an immune reaction is stimulated. Preferably, the immune reaction is a cytotoxic T cell response, however, a humoral response or macrophage stimulation is also useful in preventing initial or additional tumor growth and metastasis or spread of the cancer. The skilled artisan will appreciate that there are various methods for introducing foreign nucleotides into a host animal and subsequently into cells for genetic immunization, for example, by intramuscular injection of about 50 mg of plasmid DNA encoding the polypeptides of the invention solubilized in 50ml of sterile saline solution, with a suitable adjuvant (See, e.g., Weiner and Kennedy, 1999, Scientific American 7:50-57; Lowrie et al., 1999, Nαtwre 400:269-271).

The invention thus provides a vaccine formulation for the prevention of cancer comprising an immunogenic amount of an SGA-72M gene product. The invention further provides for an immunogenic composition comprising a purified SGA-72M gene product.

5.11 KITS

The invention includes a kit for assessing the presence of cancer cells including breast cancer cells (e.g., in a sample such as a patient sample). The kit comprises a plurality of reagents, each of which is capable of binding with a nucleic acid or polypeptide conesponding to a marker of the invention, e.g., the SGA-72M gene or gene product or fragment thereof. Suitable reagents for binding with a polypeptide conesponding to a marker of the invention include antibodies, antibody derivatives, labeled antibodies, antibody fragments, and the like. Suitable reagents for binding with a nucleic acid (e.g., a genomic DΝA, an mRΝA, a spliced mRΝA, a cDΝA, or the like) include complementary nucleic acids. For example, the nucleic acid reagents may include oligonucleotides (labeled or non-labeled) fixed to a subsfrate, labeled oligonucleotides not bound with a substrate, pairs of PCR primers, molecular beacon probes, and the like.

The kit of the invention may optionally comprise additional components useful for performing the methods of the invention. By way of example, the kit may comprise fluids (e.g., SSC buffer) suitable for annealing complementary nucleic acids or for binding an antibody with a polypeptide with which it are capable of binding, one or more sample compartments, an instmctional material which describes performance of a method of the invention, a sample of normal cells, a sample of cancer cells, and the like.

6. EXAMPLES

The isolation of an uncharacterized breast cancer-associated antigen SGA- 72M (Seattle Genetics Antigen isolated from MCF-7 cells) is described. MCF-7 is an estrogen receptor positive (ER+) breast adenocarcinoma cell-line. Suppression Subtractive Hybridization (SSH) and high-throughput cDNA microaπays were combined in analyzing genes over-expressed in breast cancer. The results detail the effectiveness of combining SSH and cDNA microanays in providing breast cancer-specific expression profiles. Sequence analysis revealed several previously identified cancer-specific genes and additional uncharacterized molecules, including SGA-72M. The SGA-72M cDNA (FIG. 1) was isolated by PCR. SGA-72M, based on its tumor selectivity as described in Section 6.3.2, can be useful as a potential therapeutic target or diagnostic marker in the treatment of breast cancer and other SGA-72M positive cancers

6.1 INTRODUCTION

Breast cancer arises from a malignancy of epithelial cells in the female, and occasionally the male, usually of adenocarcinoma origin initiated in the ductal breast epithelium. The majority of breast cancer cases are estrogen-dependent adenocarcinomas. The MCF-7 breast cancer-derived tumor cell line is an estrogen- dependent example. Breast Cancer is the most common non-dermal malignancy in women and 192,200 cases are anticipated in the U.S. in 2002. Despite recent advances in early diagnosis and treatment, 40,200 U.S. women succumbed to this disease in the year 2000 (Greenlee et al, 2001, Cancer Statistics 51(1):15). Breast cancer, second only to lung cancer in mortality rates annually, requires continued discovery of additional uncharacterized antigens and innovative utility of these molecules to improve overall therapy and intervention.

In total, 10% of all breast cancers are initiated by a genetic mutation similar to BRCA-1 and BRCA-2 (Nathanson et al, 2001, Nature Med. 7(5):552). The transformation of normal epithelium and progression to metastatic breast cancer arises from a cascade of genetic alterations that franslate to global changes in cellular polypeptide composition and expression. Some of these changes, detected in the form of cell-surface markers, comprise important diagnostic and tumor targeting efforts being studied cunently. For example, the HER-2/neu oncogene, which encodes a 185-kDa transmembrane protein, is overexpressed in 10-30% of invasive breast cancers, 40-60% of intraductal breast carcinomas, as well as other cancer types (Koeppen et al, 2001,

Histopathology 38(2):96). Antibodies to HER-2/neu (Herceptin®) have been shown to identify and selectively sensitize antigen positive cells to anti-cancer therapy (Baselga et al, 1998, Cancer Res. 58:2825). The sex steroid estrogen has been shown to play a major role in tissue development as well as other physiological processes. In addition, it has been reported to play a critical role in the progression of both breast and gynecological cancers (Pike et al, 1993, Epidemiol. Rev. 15:17). MCF-7 is a well-established tumor cell-line that is an ER+ adenocarcinoma. Despite its existence in cell-culture for nearly three decades, it remains likely that many durable alterations in gene expression patterns still persist since its isolation and initial characterization in 1973 (Brooks et al, 1973, J. Biol. Chem. 248(17):6251). Some of the above mentioned stable genes provide potential targets for diagnostic or therapeutic strategies for breast cancer. Accordingly, tumor-enriched SSH libraries were constructed and arrayed to selectively screen for tumor-associated genes. SSH is a technique well known in the art for its effectiveness in characterizing and prioritizing differentially expressed genes: (Chu et al, 1997, Proc. Natl. Acad. Sci. 94(19):10057; Gurskaya et al, 1996, Anal. Biochem. 240:90; Kuang et al, 1998, Nuc. Acid Res. 26: 1116; von Stein et al, 1997, Nuc. Acid Res. 25:2598; Wong et al, 1997, J. Biol. Chem. 272(40):25190; and Yokomizo et al, 1997, Nature 387:620). SGA-72M, an uncharacterized breast cancer-associated protein, was discovered utilizing these techniques. The initial tumor-enriched MCF-7-specific SSH libraries were evaluated in a higher density format with minimal redundancy, demonstrating that the overall complexity of the libraries had not been compromised. intensive and systematic evaluation of gene expression patterns is cmcial in understanding the physiological mechanisms associated with cellular fransformation and metastasis. Cunently, several technical platforms are being used to accomplish this goal. They include: Serial Analysis of Gene Expression (SAGE) (Nelculescu et al, 1995, Science 270:484), Restriction Enzyme Analysis of Differentially Expressed Sequences (READS) (Prasher et al, 1999, Methods Enzymol. 303:258), Amplified Fragment Length Polymoφhism (AFLP) (Bachem et al, 1996, Plant J. 9:745), Representational Difference Analysis (RDA) (Hubank et al, 1994, Nucleic Acid Res. 22(25):5640), Differential Display (Liang et al, 1992, Cancer Res. 52(24):6966) and SSH (Diatchenko et al, 1996, Proc. Natl. Acad. Sci. 93:6025) as detailed in this text. SSH is very similar to RDA with the exception of an additional normalization step that is included to increase the relative abundance of rare transcripts. The combination of SSH and cDΝA microarrays offers several advantages over the aforementioned technologies in the discovery of novel tumor-associated proteins and antigens (TAA's). The use of SSH is an attractive approach to identifying novel cancer targets because it does not rely on previously characterized cDNA sets. SSH efficiently normalizes both frequent and rare transcripts at equivalent levels and preferentially amplifies only those which are differentially expressed. The use of expression anays further increases the chances of identifying lead targets by examining thousands of genes in a single experiment.

6.2 MATERIALS AND METHODS

6.2.1 CELL CULTURE

Breast tumor cell-lines MCF-7, T47-D, SKBR-3, MDA-MB-231, MDA- MB-435s, MDA-MB-453, H3396, Hs578T and BT-549 were grown in RPMI 1640 medium® supplemented with 10% fetal bovine serum plus 100 U/mL penicillin G and 100 μg/mL streptomycin sulfate. All tumor cell-lines were passaged once per week by trypsinization and replated at 2500-3000 cells/cm . Normal human mammary epithelial cells (HMEC) were maintained in MEGM® (Clonetics, San Diego, CA). HMECs were passaged once per week by trypsinization and replating at 2500-3000 cells/cm².

6.2.2 RNA ISOLATION

Total RNA was isolated from cultured cells using RNAzol B® (Tel-Test, Inc., Friendswood, TX). Poly A+ RNA was extracted using the Oligotex mRNA Midi® kit (Qiagen, Inc., Valencia, CA).

6.2.3 GENERATION OF TUMOR-ENRICHED SSH cDNA LIBRARIES

MCF-7 breast cancer-specific SSH cDNA libraries were constructed essentially as described by Diatchenko et al, 1996, Proc Natl. Acad. Sci. 93:6025. Library one was constructed using the breast tumor ER+ cell-line MCF-7 (tester) vs. HMEC (driver). Library two was constructed using the breast tumor ER+ cell-line MCF-7 (tester) vs. a pool of 5 ER- cell lines (SKBR-3, MDA-MB-231 , MDA-MB-435s, Hs578T, and BT- 549) (driver).

Driver cDNA was synthesized from 2μg of poly A+ RNA using lμl of lOμM cDNA synthesis primer S'-TTTTGTACAAGCTT^N ' (SEQ DD NO:4) and lμl of 200 u/μl Superscript II Reverse Transcriptase® (Invitrogen, Carlsbad, CA). The resulting cDNA pellet was digested with 1.5μl of 1 Ou/μl of Rsa I restriction enzyme. Driver cDNA's were then precipitated with lOOμl of 10M Ammonium Acetate (Sigma, St. Louis, MO), 3μl of 20 mg/ml glycogen (Roche Molecular Biochemicals, Indianapolis, IN) and 1ml of ethanol (Sigma, St. Louis, MO). The cDNA preparations were then resuspended in 5μl of diethyl pyrocarbonate (DEPC) treated water.

Tester cDNA was synthesized from 2μg of poly A+ RNA as described above for the driver. Rsa I digested tester cDNA was diluted in 5μl of DEPC treated water prior to adaptor ligation. Diluted tester cDNA (2μl) was ligated to 2μl of lOμM adaptor 1 (5'- CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3') (SEQ DD NO:5) and 2μl of lOμM adaptor 2R (5'-

CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT-3') (SEQ DD NO:6) in separate reactions using 0.5 units of T4 DNA ligase (Invitrogen, Carlsbad, CA). Driver cDNA (600ng) was added separately to each of the two tubes containing adaptor- 1 ligated tester (20ng) and adaptor 2R ligated tester (20ng). The samples were mixed, ethanol precipitated as described above, and resuspended in 1.5μl of hybridization buffer (50mM Hepes pH 8.3, 0.5M NaCl 0.0.2mM EDTA pH 8.0). The reaction mixture was placed in hot start PCR tubes, (Molecular BioProducts, San Diego, CA), denatured at 95°C for 1.5 min. and then incubated at 68°C for 8 hrs. After this initial hybridization, the samples were combined and excess heat denatured driver cDNA (150ng) was added. This secondary reaction mixture was incubated overnight at 68°C. The final hybridization mixture was diluted in 200μl of dilution buffer (20mM Hepes pH 8.3, 50mM NaCl, 0.2mM EDTA) and stored at -20°C. Two rounds of PCR amplification were performed for each SSH library. The primary PCR was performed in 25μl. The reaction mixture contained lμl of diluted subtracted cDNA, lμl of 10 μM PCR primer 1 (5'-

CTAATACGACTCACTATAGGGC-3') (SEQ DD NO:6), lOx PCR buffer consisting of (166mM (NH₄)2504, 670mM Tris pH 8.8, 67mM MgCl₂, and lOOmM 2-Mercaptoethanol), 1.5μl of lOmM dNTP's, 1.5μl Dimethyl Sulfoxide (DMSO) (Sigma, St. Louis, MO), and 0.25μl of 5 u/μl of Taq polymerase (Brinkmann, Westbury, NY). PCR was performed with the following cycling conditions: 75°C for 7 min.; 94°C for 2 min.; 27 cycles at 94°C for 30 sec, 66°C for 30 sec, and 72°C for 1.5 min.; and a final extension at 72°C for 5 min. A secondary PCR was performed using lμl of the primary PCR as template with the same reaction components as above. Nested PCR primers NP1 (5'-

TCGAGCGGCCGCCCGGGCAGGT-3') (SEQ DD NO:7) and NP2R (5'- AGCGTGGTCGCGGCCGAGGT-3') (SEQ DD NO:8) were used in place of PCR primer 1. The secondary PCR was performed with the following cycling conditions: 94°C for 2 min.; 15 cycles at 94°C for 30 sec, 68°C for 30 sec, and 72°Cfor 1.5 min.; and a final extension at 72°C for 5 min. The PCR products were analyzed on 1.5% ulfrapure agarose gels (Invitrogen, Carlsbad, C A) and visualized by ethidium bromide (Fisher Chemical, Fair Lawn, NJ). Subtraction efficiency was confirmed by PCR depletion of EF- 1 and

Tubulin. EF-1 primers were EF-1 (5'-CTGTTCCTGTTGGCCGAGTC-3') (SEQ DD NO:9) and EF-2 (5' -CGATGCATTGTTATCATTAAC-3') (SEQ DD NO: 10). Tubulin primers were Tu-1 (5'-CACCCTGAGCAGCTCATCAC-3') (SEQ DD NO:l 1) and Tu-2 (5'- GGCCAGGGTCACATTTCACC-3') (SEQ DD NO:12).

6.2.4 CLONING OF SSH TUMOR-ENRICHED POOLS INTO PCR4-

TOPO

The SSH-cDNA pools were cloned into the ρCR4-TOPO® vector

(Invitrogen, Carlsbad, CA) and transformed into chemically competent TOP 10 cells®

(Invitrogen, Carlsbad, CA). The library was plated on LB agar plates (Becton Dickinson, Sparks, MD) containing 50μg/μl kanamycin (Sigma, St. Louis, MO). Cloning efficiency and size distribution for each library was determined by amplification using Ml 3 (-20) (5'-

GTAAAACGACGGCCAGT-3') (SEQ DD NO:13) and M13R (5' -

CAGGAAACAGCTATGACC-3') (SEQ DD NO: 14) universal primers.

6.2.5 CUSTOM ARRAY GENERATION SSH clones containing cDNA sequences of interest were amplified using

Ml 3 (-20) and M13R universal primers. PCR products were purified using 96-well MultiScreen PCR Purification Plates (Millipore, Bedford, MA). Microanays were prepared by spotting targets in duplicate on positively charged nylon membranes (Hybond-XL®, Amersham Pharmacia Biotech, Piscataway, NJ) at concentrations of 2ng DNA spot using a Biomek 2000 Robot® (Beckman Coulter Inc., Fullerton, CA). For probe constmction, mRNA was isolated from cell lines as described above. Poly A+ RNA (500ng ) was converted to cDNA and labeled with (o;- P) dCTP (Amersham Pharmacia Biotech, Piscataway, NJ) by reverse transcription using Superscript II RT® (Invitrogen, Carlsbad, CA). Hybridizations were performed overnight at 42°C in 6X Saline Sodium Citrate (SSC), 0.1 % Sodium Dodecyl Sulfate (SDS), 50% Deionized Formamide, and 5X Denhardt's solution (1% Ficoll Type 400, 1% polyvinylpyrrolidone, and 1% bovine serum albumin) (Research Genetics, Huntsville, AL). Wash conditions were 4 times in 2X SSC/0.1% SDS for 10 min. each at room temperature, followed by 4 high stringency washes in 0.1 X SSC/0.1%SDS at 65°C for 30 min. each.

6.2.6 ARRAY DATA ANALYSIS

Hybridization Intensities were quantitated on the Phosphorimager SI® (Molecular Dynamics, Sunnyvale, CA) using Array Vision 5.1 Software® (Imaging

Research, St. Catharines, ON, CA). Average signal intensities were determined for each set of duplicate spots. For each membrane analyzed, relative quantitative values were determined based on normalization to multiple housekeeping genes spotted at various locations on each membrane. This enabled us to make blot-to-blot comparisons in determining differential expression. Two independent microarray experiments were performed for each comparison to ensure overall validity and reproducibility of the results. Targets >2 fold over-expressed were considered for further evaluation.

6.2.7 NORTHERN BLOT ANALYSIS

Aliquots of lOμg of total RNA were resolved on 1.2% agarose formaldehyde gels in IX 3-N-moφholino propanesulfonic acid (MOPS) buffer (5X stock of 0.1M MOPS (pH 7.0), 40mM sodium acetate (Sigma, St. Louis, MO), and 5mM EDTA (Ambion, Austin, TX) and then transfened to Hybond-XL Nylon Membranes® (Amersham Pharmacia Biotech, Piscataway, NJ). Universal primers M13F (-20) and M13R were used to amplify the commercially available clone Genbank Accession No. T40408 (Hillier et al, 1995) specific for EF-1 (Incyte Genomics, St. Louis, MO). SGA-72M cDNA, approximately 50ng , was labeled using Ready-To-Go Beads® and α-³²P dCTP at 3000 Ci/mmol (both from Amersham Pharmacia Biotech, Piscataway, NJ). Northern blots were pre-hybridized and hybridized for 1 hour using ExpressHyb® hybridization solution (Clontech, Palo Alto, CA). Blots were washed in 2X SSC and 0.1% SDS for 1 hour at room temperature, followed by an additional hour at 65°C in 0.1 X SSC and 0.1%

SDS. Northern blots were quantified using ImageQuant Software® (Molecular Dynamics, Sunnyvale, CA).

6.2.8 SEMI-QUANTITATIVE RT-PCR cDNA was synthesized from 5μg total RNA using the Superscript First- Strand cDNA Synthesis System for RT-PCR® (Invitrogen, Carlsbad, CA). Gene specific primers were selected for SGA-72M and EF-1 to obtain semi-quantitative mRNA levels. Primers for SGA-72M were as follows: SGA-72M-GSP1 (5'- GACTGTAGAGAAAGTCATTCTTCCAC -3') (SEQ DD NO: 15), and SGA-72M-GSP2 (5'-GGTTCACTTCTCCAGGACCTACTTC-3') (SEQ DD NO: 16). Primers for EF-1 were as follows: EF-1 (5'-CTGTTCCTGTTGGCCGAGTC-3') (SEQ DD NO:9) and EF-2 (5' CGATGCATTGTTATCATTAAC-3') (SEQ DD NO: 10).

6.2.9 MULTIPLE TISSUE EXPRESSION ARRAY (MTE)

The MTE® (Clontech, Palo Alto, CA) array was used to determine relative expression of SGA-72M in various normal populations. 50ng of an SGA-72M PCR product was labeled using Ready-to-go Beads® and a-P32 dCTP at 3000 Ci/mmol. The housekeeping control, EF-1, was used to evaluate the spot-to-spot variability within the experiment.

6.2.10 CANCER PROFILING ARRAY

The cancer profiling array CPA® (Clontech, Palo Alto, CA) was used to determine the expression of SGA-72M in numerous tumor/normal paired patient samples. Fifty ng of an SGA-72M PCR product was labeled using Ready-to-go Beads and α-³²P dCTP at 3000 Ci/mmol. A total of 241 paired cDNA samples were synthesized and spotted onto nylon membranes for 13 different tumor types. The tumor types included: Breast, Cervix, Colon, Kidney, Lung, Ovarian, Pancreas, Prostate, Rectum, Thyroid Gland, Small Intestine, Stomach, and Utems.

6.2.11 BIOINFORMATICS ANALYSIS After completion of the anay data analysis sorting process, interesting novel targets were retained and analyzed further using several computational programs. The derived SGA-72M cDNA was analyzed using Vector NTI Suite 6.0® (InforMax, Inc., Bethesda, MD). Transmembrane domain and protein localization analysis was performed using the ExPASy Proteomics Tools Programs® (Swiss Institute of Bioinformatics, Geneve, Switzerland). Amino acid sequence prediction programs used included:

HMMTOP (Tusnady et al, 1998, J. Mol Bio. 283:489), TM pred (Hofinann et al, 1993, J. Biol. Chem. 347:166), TMHMM vl.O (Sonnhammer et al, 1998, Proc. of Sixth Int. Conf on Intelligent Systems for Mol. Bio., AAAI Press, pp. 175-182), TMAP, and PSORT (Nakai et al, 1999, Trends Biochem. Sci. 24(1):34). 6.2.12 SUBCELLULAR LOCALIZATION OF SGA-72M

The subcellular localization of SGA-72M was determined using an SGA- 72M/green fluorescent protein (GFP) fusion polypeptide construct. An SGA-72M cDNA clone was amplified using the forward primer (5'- AGCTCTCTCGAGATGATTAACAGTTCTTTAAGCATGCTC-3') (SEQ DD NO: 17) and the reverse primer (5'-

AGCTCTAAGCTTTCACTGTGAGTTAAAAAATTTTAAATGCTC-3') (SEQ DD NO: 18). An Xhol restriction site (underlined) and a Hindlll restriction site (underlined) are present in the forward and reverse primers, respectively. The PCR product was cut with the above restriction enzymes and cloned in-frame into XhoVHindlll-cut pGFP²-Cl vector (BioSignal Packard, Montreal, Canada). Expression of this plasmid in eukaryotic cells resulted in the synthesis of an SGA-72M/GFP fusion polypeptide. This construct was transiently transfected into SKBR-3 (breast carcinoma), A-549 (lung adenocarcinoma), and NCI-Η460 (lung large-cell carcinoma) cells by electroporation. The subcellular localization of green fluorescence signals, which indicate the localization of the SGA-72M/GFP polypeptide, was momtored by fluorescence microscopy.

6.2.13 SGA-72M ANTIBODY GENERATION

SGA-72M cDNA (FIG. 2) constmcts spanning the CDS were amplified using gene-specific primers and cloned into pVAC and pBOOST vectors (InvivoGen, San Diego, CA) and used for immunization. Additional SGA-72M cDNA (FIG. 2) constmcts spanning l-936bp (N-terminal) and 3100-4026bp (C-terminal) were cloned and used for protein expression studies. SGA-72M polypeptides (FIG. 3) spanning l-312aa (N-terminal) and 1033-1342aa (C-terminal) were then purified and used for immumzation. Balb/c female mice were immunized using 3 boosts of 25μg SGA-72M cDNA followed by 2 boosts of 25μg each of purified N-terminal or C-terminal SGA-72M polypeptide.

Hybridoma colonies were generated by fusing spleen cells from immumzed animals with the myeloma cell line P3-X63.Ag8.653 (commercially available from ATCC as #CRL- 1580) using standard hybridoma technology (Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1988). ELISA screening was used to identify hybridoma colonies that produced antibodies that bound to purified fusion protein conesponding to either the N- or C-terminal of SGA-72M. Each hybridoma colony went through two rounds of limited dilution cloning (Harlow et al. supra) before being screened by ELISA on either the N- or C-terminal of SGA-72M. After the limited dilution cloning, the homogenous hybridomas conesponding to hybridoma colonies 7.3, 7.21, 8.11, and 8.39 were designated monoclonal antibodies 7.3.1, 7.21.1, 8.11.1, and 8.39.1, respectively.

6.2.14 SGA-72M ANTIBODY BINDING AS ASSAYED BY FACS

Antibodies in hybridoma colony supernatant was used for FACS binding analysis. FACS was performed by methods known in the art. SKBR-3 breast carcinoma cells were cultured and aliquoted (500,000 cells/tube). Cells for FACS analysis were either permeabilized and non-permeabilized. Cells were permeabilized using cytofix/cytoperm solution (BD PharMingen, San Diego, CA). Non-permeabilized cells were left intact and incubated on ice prior to FACS analysis. Antibodies in hybridoma colony supernatant (i.e., 7.3, 7.21, 8.11, or 8.39) were used as a primary reagent. FITC labeled anti-mouse IgG (Jackson ImmunoResearch Labs, West Grove, PA) was used as a secondary reagent.

6.3 RESULTS

6.3.1 ISOLATION OF THE SGA-72M cDNA

The SGA-72M cDNA (FIG. 1) was amplified using gene-specific primers and cloned into the pCR 4.0® TOPO TA vector (Invitrogen, Carlsbad, CA). The SGA- 72M cDNA (FIG. 1) was sequence verified using custom primers (Sigma-Genosys, Woodlands, TX) and automated fluorescent sequencing (PE Applied Biosystems, Foster City, CA).

6.3.2 CANCER SELECTIVITY BY NORTHERN BLOTS. RT-PCR. AND COMMERCIAL ARRAYS

SGA-72M was initially determined to be breast cancer-selective by microanay. After further evaluation, SGA-72M displayed breast tumor-selective expression by semi-quantitative RT-PCR (FIG. 5). SGA-72M also displayed tumor- selective expression in various other ATCC tumor cell-lines (FIG. 6). Significant levels of SGA-72M expression were determined based on semi-quantitative comparison using the housekeeping gene EF-1 as a control.

To confirm minimal normal tissue expression of SGA-72M, the MTE Anay (Clontech, Palo Alto, CA) was hybridized using an SGA-72M cDNA probe. The SGA- 72M transcript was minimally expressed and limited to a few of the normal tissues tested (FIG. 8). Overall, SGA-72M displayed tumor-selective expression in breast cancer, and other cancers (FIG.5, 6, 10) To confirm SGA-72M over-expression in patient tumor isolates, the CPA was hybridized using an SGA-72M cDNA probe. In total, 50 paired breast tumor/normal isolates were analyzed (FIG. 10). SGA-72M displayed elevated breast cancer selectivity at a 5-fold differential (10/50 or 20%), and various other tumor types as listed (Table 3). Of interest, SGA-72M also exhibited elevated expression in a set of patient samples with noted metastases (Table 3). Based on its high percentage of differential expression and potential association with metastases, SGA-72M is potentially useful as a diagnostic marker for breast cancer, or other cancers.

Table 3. A subset of patient samples with elevated tumor-selective expression for SGA- 72M. Differential expression data was calculated using the anay as detailed in FIG. 10.

Tumor Type Sex Age Position T vs. N (fold differential)

Breast Non-infiltrating 39 2A 7.4 Intraductal

Breast Infiltrating intraductal F 66 2E* 24.5 Breast Infiltrating Ductal F 44 2G 4.7 Breast Infiltrating Ductal F 50 2P* 9.3 Breast Infiltrating Ductal F 50 2AA 12.5 Breast Mixed Lobular F 39 2BB 6.3 Breast Infiltrating Lobular F 65 2DD 5.2 Breast Infiltrating Ductal F 58 4A 7.1 Breast Tubular F 47 4C 9.3 Adenocarcinoma Breast Infiltrating Ductal F 71 4G* 3.8 Breast Medullary F 47 4Q 5.7 Adenocarcinoma Colon Adenocarcinoma F 73 14Q 5.0 Lung Adenocarcinoma M 61 28L 3.8 Lung Adenocarcinoma M 62 28N 3.1 Stomach Adenocarcinoma M 61 20S* 3.7 Stomach Adenocarcinoma M 44 20C 6.5 Stomach Adenocarcinoma M 70 20W 3.4 Stomach Adenocarcinoma M 69 20BB 3.0

Symbolizes a metastatic site 6.3.3 SUBCELLULAR LOCALIZATION OF SGA-72M

Subcellular localization of SGA-72M was determined using transient expression of SGA-72M/GFP constmcts in SKBR-3 (breast carcinoma), and 293 (normal human kidney) cells (FIG. 11). Expression of GFP alone resulted in diffused green fluorescence signals throughout the cells (FIG. 11). Expression of SGA-72M/GFP is associated with the plasma membrane (see Simpson et al, 2000, EMBO reports. 3:287- 292). SGA-72M, based on its tumor-selective expression and association with the plasma membrane, is an appropriate candidate for targeting as a therapeutic antibody for breast and other SGA-72M positive cancers.

6.3.4 SGA-72M FACS BINDING DATA

SGA-72M cell-surface specificity was examined by FACS binding analysis using permeabilized and non-permeabilized cells for representative N-terminal and C- terminal SGA-72M antibodies in hybridoma colony supernatant. SGA-72M C-terminal antibodies in supernatant from hybridoma colonies 7.3 and 7.21 displayed good overall binding ( > 150 MFI) on SKBR-3 breast carcinoma cells and minimal binding to negative controls (FIG. 12). In addition, antibodies in supernatant from both 7.3 and 7.21 hybridoma colonies displayed elevated binding on intact/non-permeabilized cells, as noted with solid colored bars (FIG. 12). These data suggest that SGA-72M can be found on the cell-surface of breast carcinoma cells. This finding further supports the potential utility of SGA-72M therapeutic antibodies for breast cancer, and other SGA-72M positive cancers. Antibodies in supernatant from hybridoma colony 8.11 bound to breast carcinoma cell line SKBR-3 under both permeabilized and non-permeabilized conditions. Antibodies in supernatant from hybridoma colony 8.39 bound to the SKBR-3 line only under permeabilized conditions, suggesting that the epitope is either not located on the cell surface or that it is masked.

6.4 DISCUSSION

Gene expression profiling provides a systematic approach to studying the mechanisms associated with progression from normal to metastatic disease. In this application, we have combined SSH and cDNA microanays to identify the uncharacterized breast cancer-associated antigen, SGA-72M. Combimng SSH and cDNA microanays provides a rapid and effective approach to high-throughput screening for novel tumor targets. The principle of SSH allows for the preferential amplification of differentially expressed sequences while suppressing those present at equal abundance within the initial mRNA (Diatchenko et al, 1996, Proc. Natl. Acad. Sci. 93:6025). The high level of enrichment, low level of background, and efficient normalization of sequences makes this an attractive approach for the rapid identification of novel targets. SGA-72M cDNA, identified by this method, provides a new target for breast cancer therapy, as well as a breast cancer marker for diagnosis and prognosis. SGA-72M displays tumor-selective expression in breast cancer, and other cancers, while displaying minimal expression in normal tissues. SGA-72M, based on its elevated level of tumor-selective expression, and association with the plasma membrane make it a strong target for cancer, including breast cancer, therapy and diagnosis. Cell-surface expression of SGA-72M polypeptide, in combination with its tumor-selective expression, makes it a useful therapeutic target, for example by using anti-SGA-72M antibodies and anti-SGA-72M antibody-drug conjugates for the treatment of breast cancer.

7. MICROORGANISM DEPOSIT

Hybridoma 7.3.1 producing monoclonal antibody 7.3.1 has been deposited with the American Type Culture Collection (ATCC, P.O. Box 1549, Manassas, VA 20108) on July 11, 2003 under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Puφoses of Patent Procedures, and assigned accession number _, and is incoφorated by reference.

8. REFERENCES CITED All patents, patent application publications and references cited herein are incoφorated herein by reference in their entirety and for all puφoses to the same extent as if each individual publication or patent or patent application was specifically or selectively and individually indicated to be incoφorated by reference in its entirety for all puφoses.

Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only, and the invention is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

Claims

What is claimed is:

1. A method of diagnosing cancer in a subject comprising detecting or measuring a SGA-72M gene product in a sample derived from said subject, wherein said SGA-72M gene product is: (a) an RNA encoded by SEQ DD NO: 1 , or its complement;

(b) a protein comprising SEQ DD NO:3;

(c) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(d) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(e) a nucleic acid comprising a sequence hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(f) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency; (g) a nucleic acid at least 90% homologous to SEQ ID NO: 1 or its complement as determined using the NBLAST algorithm;

(h) a nucleic acid at least 90% homologous to SEQ ID NO:2 or its complement as determined using the NBLAST algorithm; or

(i) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm, in which elevated levels of the SGA-72M gene product compared to a noncancerous sample or a pre-determined standard value for a noncancerous sample, indicates the presence of cancer in the subject.

2. The method of claim 1 wherein the subject is a human.

3. The method of claim 1 or 2 wherein the cancer is breast cancer.

4. The method of claim 1 or 2 in which the sample is a tissue sample, a plurality of cells or a bodily fluid.

5. A method of staging cancer in a subject comprising detecting or measuring an SGA-72M gene product in a sample derived from said subject, wherein said SGA-72M gene product is:

(a) an RNA encoded by SEQ DD NO: 1 , or its complement; (b) a protein comprising SEQ DD NO:3;

(d) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:l or its complement under conditions of high stringency; (e) a nucleic acid comprising a sequence hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(f) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(g) a nucleic acid at least 90% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm;

(h) a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm; or

(i) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm, in which elevated levels of the SGA-72M gene product compared to a noncancerous sample or a pre-determined standard value for a noncancerous sample, indicates an advanced stage of cancer in the subject.

6. The method of claim 5 wherein the subject is a human.

7. The method of claim 5 or 6 wherein the cancer is breast cancer.

8. The method of claim 5 or 6 in which the sample is a tissue sample, a plurality of cells or a bodily fluid.

9. A method of vaccinating a subject against cancer comprising administering to the subject a molecule that displays antigenicity of a SGA-72M-related gene product, wherein said molecule is: (a) an RNA encoded by SEQ DD NO: 1 , or its complement;

(b) a protein comprising SEQ DD NO:3;

(c) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency; (d) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(g) a nucleic acid at least 90% homologous to SEQ ID NO: 1 or its complement as determined using the NBLAST algorithm;

(h) a nucleic acid at least 90% homologous to SEQ ID NO:2 or its complement as determined using the NBLAST algorithm; or (i) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD

NO:2 or its complement as determined using the NBLAST algorithm;

(j) a DNA molecule comprising SEQ DD NO: 1 ; or

(k) a DNA molecule comprising SEQ DD NO:2.

10. The method of claim 9 wherein said subject is a human.

11. The method of claim 9 or 10, wherein the cancer is breast cancer.

12. The method of claim 9 or 10 wherein the immune response is a cellular immune response.

13. The method of claim 9 or 10 wherein the immune response is a humoral immune response.

14. The method of claim 9 or 10 wherein the immune response is both a cellular and a humoral immune response.

15. A method of determining if a subj ect is at risk of developing cancer, said method comprising: (a) measuring an amount of a SGA-72M-related gene product in a sample derived from the subject, wherein said SGA-72M-related gene product is: (i) an RNA encoded by SEQ DD NO: 1 , or its complement; (ii) a protein comprising SEQ DD NO:3; (iii) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD

NO:l or its complement under conditions of high stringency;

(iv) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(v) a nucleic acid comprising a sequence hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(vi) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(vii) a nucleic acid at least 90% homologous to SEQ ID NO: 1 or its complement as determined using the NBLAST algorithm (viii) a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm; or

(ix) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm, and (b) comparing the amount of said SGA-72M-related gene product from the subject with the amount of SGA-72M-related gene product present in a non-cancerous sample or predetermined standard for a noncancerous sample, wherein an elevated amount of said SGA-72M-related gene product in the subject compared to the amount of SGA- 72M-related gene product in the non-cancerous sample or predetermined standard for a noncancerous sample indicates a risk of developing cancer in the subject.

16. The method of claim 15 wherein said subject is a human.

17. The method of claim 15 or 16 wherein the cancer is breast cancer.

18. The method of claim 15 or 16 in which the sample is a tissue sample, a plurality of cells or a bodily fluid.

19. A method of determining if a subject suffering from cancer is at risk of metastasis of said cancer, said method comprising measuring an amount of an SGA-72M- related gene product in a sample derived from the subject, wherein said SGA-72M-related gene product is: (a) an RNA encoded by SEQ DD NO: 1 , or its complement;

(b) a protein comprising SEQ DD NO:3;

(f) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency; (g) a nucleic acid at least 90% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm;

(i) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm, wherein an elevated amount of the SGA-72M-related gene product in the subject compared to the amount of the SGA-72M-related gene product in a non-cancerous sample, or in the sample from the subject with non-metastasizing cancer, or the amount in the predetermined standard for a noncancerous or non-metastasizing sample, indicates a risk of developing metastasis of said cancer in the subject.

20. The method of claim 19 wherein said subject is a human.

21. The method of claim 19 or 20 wherein the cancer is breast cancer.

22. The method of claim 19 or 20 in which the sample is a tissue sample, a plurality of cells or a bodily fluid.

23. A method of treating cancer comprising admimstering to a subject in need thereof an effective amount of a SGA-72M antagonist, wherein said antagonist decreases expression of SGA-72M, decreases activity of SGA-72M and/or decreases the viability of a cell overexpressing SGA-72M.

24. The method of claim 23 wherein said SGA-72M antagonist comprises an antibody.

25. The method of claim 24 wherein said antibody is a monoclonal antibody.

26. The method of claim 25, wherein said monoclonal antibody is 7.3.1 , as secreted by the hybridoma deposited with the ATCC and assigned accession no. _.

27. The method of claim 25, wherein said monoclonal antibody is conjugated to a cytotoxic agent.

28. The method of claim 23 wherein said subject is a human.

29. The method of claim 23 or 28 wherein the cancer is breast cancer.

30. A method of screening for a compound that binds with an SGA-72M-related gene product, said method comprising:

(a) contacting the SGA-72M-related gene product with a candidate agent, wherein said SGA-72M-related gene product is: (i) an RNA encoded by SEQ DD NO: 1 , or its complement;

(ii) a protein comprising SEQ DD NO:3;

(iii) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(iv) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO: 1 or its complement under conditions of high stringency;

(vi) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency; (vii) a nucleic acid at least 90% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm

(viii) a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm; or (ix) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD

NO:2 or its complement as determined using the NBLAST algorithm, and

(b) determining whether or not the candidate agent binds the SGA-72M-related gene product.

31. The method of claim 30 wherein the screening assay is performed in vitro.

32. The method of claim 29 or 30 wherein the SGA-72M-related gene product is anchored to a solid phase.

33. The method of claim 29 or 30 wherein the candidate agent is anchored to a solid phase.

34. The method of claim 29 or 30 wherein the screening assay is performed in the liquid phase.

35. The method of claim 29 wherein said SGA-72M-related gene product is expressed on the surface of a cell or in the cytosol of a cell in step (a).

36. The method of claim 29 or 35 wherein the cell is engineered to express the SGA-

72M-related gene product.

37. The method of claim 29 or 35 wherein the candidate agent is labeled radioactively or enzymatically.

38. The method of claim 29, 31 or 35, wherein said SGA-72M-related gene product does not consist of the nucleotide sequence of any one of SEQ DD NOs: 19-26.

39. The method of claim29, 31 or 35, wherein said SGA-72M-related gene product is not a protein consisting of the sequence encoded any one of SEQ DD NOs: 19-26.

40. A method of screening for an intracellular protein that interacts with an SGA- 72M-related gene product, said method comprising

(a) immunoprecipitating the SGA-72M-related gene product from a cell lysate, wherein said SGA-72M-related gene product is:

(i) an RNA encoded by SEQ DD NO: 1 , or its complement; (ii) a protein comprising SEQ DD NO:3; (iii) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD

NO:l or its complement under conditions of high stringency;

(vi) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO: 2 or its complement under conditions of high stringency;

(ix) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm, and (b) determining whether or not any intracellular proteins bind to or form a complex with the SGA-72M-related gene product in the immunoprecipitate.

41. A method of screening for a candidate agent that modulates expression level of an SGA-72M-related gene, said method comprising: (a) contacting said SGA-72M-related gene with a candidate agent, wherein said

SGA-72M-related gene is a nucleic acid at least 80% homologous to SEQ DD NO:l as determined using the NBLAST algorithm; and (b) measuring the level of expression of an SGA-72M gene product, said SGA- 72M gene product selected from the group consisting of an mRNA conesponding to SEQ DD NO:l, a protein comprising SEQ DD NO:3, and a protein comprising SEQ DD NO:5, wherein an increase or decrease in said level of expression relative to said level of expression in the absence of said candidate agent indicates that the candidate agent modulates expression of an SGA-72M gene.

42. A method of screening for a compound that is a candidate cancer therapeutic agent, comprising: (a) contacting a SGA-72M-related polypeptide with a compound, wherein said

SGA-72M-related polypeptide is selected from the group consisting of (i) a polypeptide comprising the amino acid sequence of SEQ DD NO:3, (ii) a polypeptide encoded by a nucleic acid that hybridizes under conditions of high stringency to SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, or the antisense sfrand to SEQ DD NO:2, or (iii) a polypeptide encoded by a nucleic acid that is at least 70% homologous to SEQ DD NO:l or SEQ DD NO:2;

(b) determining whether an SGA-72M activity is modulated by the compound; wherein a compound that modulates an SGA-72M activity is a candidate cancer therapeutic agent, thereby identifying a candidate cancer therapeutic agent.

43. The method of claim 42, wherein contacting the SGA-72M-related polypeptide with the compound occurs in vivo in a cell that expresses the SGA-72M-related polypeptide.

44. The method of claim 43, wherein the activity modulated is:

(a) a subcellular localization of the SGA-72M-related polypeptide;

(b) an interaction between the SGA-72M-related polypeptide and a binding partner; (c) a post-franslational modification of the SGA-72M-related polypeptide;

(d) an activity of a protein whose activity is regulated or modulated by the SGA- 72M-related polypeptide.

45. The method of claim 44, wherein the modulation is an increase in said SGA- 72M activity.

46. The method of claim 44, wherein the modulation is an inhibition in said SGA- 72M activity.

47. A vaccine formulation for the prevention of cancer comprising:

(a) an immunogenic amount of a SGA-72M-related gene product, wherein said SGA-72M-related gene product is: (i) an RNA encoded by SEQ DD NO: 1 , or its complement;

(ii) a protein comprising SEQ DD NO:3 ;

(vi) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO: 2 or its complement under conditions of high stringency; (vii) a nucleic acid at least 90% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm

(viii) a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm; or

(ix) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm, and

(b) a pharmaceutically acceptable excipient.

48. An immunogenic composition comprising: (a) a purified SGA-72M-related gene product in an amount effective at eliciting an immune response, wherein said SGA-72M-related gene product is:

(i) an RNA encoded by SEQ DD NO: 1 , or its complement; (ii) a protein comprising SEQ DD NO:3; (iii) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(iv) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:l or its complement under conditions of high stringency; (v) a nucleic acid comprising a sequence hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(vii) a nucleic acid at least 90% homologous to SEQ DD NO: 1 or its complement as determined using the NBLAST algorithm

(viii) a nucleic acid at least 90% homologous to SEQ ID NO:2 or its complement as determined using the NBLAST algorithm; or

(b) an excipient.

49. A pharmaceutical composition comprising:

(a) an isolated antibody or antibody conjugate which binds to a protein of SEQ DD NO:3, in an amount effective to treat cancer; and

(b) a pharmaceutically acceptable carrier.

50. The pharmaceutical composition of claim 49 wherein said monoclonal antibody is 7.3.1, as secreted by the hybridoma deposited with the ATCC and assigned accession no. _.

51. A pharmaceutical composition comprising:

(a) a SGA-72M-related gene product, wherein said SGA-72M-related gene product is: (i) an RNA encoded by SEQ DD NO: 1 , or its complement;

(ii) a protein comprising SEQ DD NO:3;

(iii) a nucleic acid comprising a nucleotide sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency; (iv) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO: 1 or its complement under conditions of high stringency;

(v) a nucleic acid comprising a sequence hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency; (vi) a protein comprising a sequence encoded by a nucleic acid that is hybridizable to SEQ DD NO:2 or its complement under conditions of high stringency;

(ix) a protein encoded by a nucleic acid at least 90% homologous to SEQ DD NO: 2 or its complement as determined using the NBLAST algorithm, and

(b) a pharmaceutically acceptable carrier.

52. The pharmaceutical composition of claim 51 , wherein said gene product is purified.

53. A method of diagnosing cancer in a subject comprising: (a) administering to said subject a compound that binds a protein of SEQ DD

NO:3, wherein said compound is bound to an imaging agent; and

(b) obtaining an internal image of said subject by use of said imaging agent; wherein the localization or amount of said image indicates whether or not cancer is present in said subject.

54. The method of claim 53, wherein the compound is an antibody that binds to a protein of SEQ DD NO:3.

55. The method of claim 54, wherein the antibody is 7.3.1, as secreted by the hybridoma deposited with the ATCC and assigned accession no. _.

56. The method of claim 55, wherein said antibody is conjugated to a radioactive metal and said obtaining step comprises recording a scintographic image obtained from the decay of the radioactive metal.

57. A kit comprising:

(a) in one or more containers, a pair of oligonucleotide primers, each primer comprising an at least 5 nucleotide sequence complementary to a different sfrand of a double-stranded nucleic acid comprising SEQ DD NO:l; and

(b) in a separate container, a purified double-stranded nucleic acid comprising SEQ DD NO:l.

58. An isolated antibody, or a fragment or derivative of said antibody comprising the antigen binding domain thereof, that binds a SGA-72M-related polypeptide, wherein said SGA-72M-related polypeptide is:

(a) SEQ DD NO:3, (b) encoded by a nucleic acid molecule comprising SEQ DD NO: 1 ; or

(c) encoded by a nucleic acid molecule comprising SEQ DD NO:2;

(d) encoded by a nucleic acid molecule comprising a nucleotide sequence hybridizable to SEQ DD NO:l or its complement under conditions of high stringency;

(e) encoded by a nucleic acid molecule comprising a sequence hybridizable to SEQ DD NO: 2 or its complement under conditions of high stringency;

(f) encoded by a nucleic acid that is at least 90% homologous to SEQ DD NO:l or its complement as determined using the NBLAST algorithm; or

(g) encoded by a nucleic acid that is at least 90% homologous to SEQ DD NO:2 or its complement as determined using the NBLAST algorithm.

59. The isolated antibody of claim 58 that binds to a C-terminal fragment of SEQ DD NO:3 of less than 400 amino acids.

60. An isolated antibody which competitively inhibits the binding of monoclonal antibody 7.3.1 , as secreted by the hybridoma deposited with the ATCC and assigned accession no. _, with a SGA-72M polypeptide of SEQ DD NO:3.

61. The isolated antibody of claim 60 which is a monoclonal antibody.

62. The isolated antibody of claim 61 , wherein said antibody is humanized.

63. The isolated antibody of claim 61 wherein said antibody is a human antibody.

64. An antibody that is monoclonal antibody 7.3.1, as secreted by the hybridoma deposited with the ATCC and assigned accession no. _, or a molecule comprising the variable region thereof.

65. A cell line which produces an antibody of any one of claims 58, 60, 61, 62, or 63.

66. Hybridoma 7.3.1 as deposited with the American Type Culture Collection having accession number _.

67. A SGA-72M antibody comprising a light chain variable domain and a heavy chain variable domain of monoclonal antibody 7.3.1, as secreted by the hybridoma deposited with the ATCC and assigned accession no. _.

68. A SGA-72M antibody comprising one or more heavy chain variable domain CDRs of monoclonal antibody 7.3.1, as secreted by the hybridoma deposited with the ATCC and assigned accession no. _, wherein said SGA-72M antibody binds SGA-72M.

69. A SGA-72M antibody comprising one or more VH CDRs that are at least 90% homologous to one or more VH CDRs, respectively, from monoclonal antibody 7.3.1, as secreted by the hybridoma deposited with the ATCC and assigned accession no. _, as determined using the NBLAST algorithm, wherein said SGA-72M antibody binds SGA- 72M.

70. The SGA-72M antibody of claim 67, 68, 69 comprising a human heavy chain framework region and a human light chain framework region.

71. The SGA-72M antibody of claim 70 further comprising a constant region.

72. The SGA-72M antibody of claim 71 wherein said constant region is human.

73. An isolated nucleic acid comprising a nucleotide sequence a encoding a heavy chain variable domain of the SGA-72M antibody of claim 67, 68, or 69.

74. A vector comprising the nucleic acid of claim 73.

75. A host cell comprising the vector of claim 74.

76. The antibody of claim 58, 60, 61, 62, 63, 79, 80, or 81 which is conjugated to a cytotoxic agent.

77. A method of making an antibody comprising immunizing an animal with a molecule comprising (a) SEQ DD NO: 3 or (b) an immunogenic fragment of SEQ DD NO:3.

78. A method of making an antibody comprising: (a) admimstering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ ID NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C, such that an antibody to said SGA-72M polypeptide is produced by said animal; and (b) recovering the antibody.

79. The method of claim 78, in which the SGA-72M-related polypeptide comprises the amino acid sequence of SEQ DD NO:3.

80. A method of making an antibody comprising:

(a) admimstering a immunogenic amount of a fragment of a SGA-72M-related polypeptide to an animal, in which the fragment comprises a domain of the SGA-72M- related polypeptide selected from the group consisting of the N-terminal domain, C- terminal domain, extracellular domain, transmembrane domain, and intracellular domain, in which the SGA-72M-related polypeptide comprises an amino acid sequence encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris- HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C, such that an antibody to said fragment is produced by said animal; and (b) recovering the antibody.

81. The method of claim 80, in which the fragment of the SGA-72M-related polypeptide comprises 20 contiguous amino acids of the SGA-72M-related polypeptide.

82. The method of claim 80, in which the N-terminal domain comprises amino acid residues 1-312 of SEQ DD NO:3.

83. The method of claim 80, in which the C-terminal domain comprises amino acid residues 1033-1342 of SEQ DD NO:3.

84. The method of claim 80, in which the fragment of SGA-72M-related polypeptide is joined via a peptide bond to an amino acid sequence of a second polypeptide, in which the second polypeptide is not the SGA-72M-related polypeptide.

85. The antibody of claim 80 in which the antibody is monoclonal.

86. The antibody of claim 80 in which the antibody is purified.

87. A method of making a monoclonal antibody comprising: (a) administering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense sfrand to SEQ DD NO: 1 , SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) recovering spleen cells from said animal;

(c) fusing the recovered spleen cells with a cell of a myeloma to generate hybridomas;

(e) recovering the antibody.

88. A method of making a monoclonal antibody comprising:

(a) fusing a spleen cell from an animal immunized with an immunogenic amount of a SGA-72M-related polypeptide with a cell of a myeloma to generate hybridomas, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO: 1 , the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense sfrand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C; (b) screening to select a hybridoma producing antibody to said SGA-72M- related polypeptide; and

(c) recovering the antibody.

89. A method of making a monoclonal antibody comprising:

(a) administering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense sfrand to SEQ ID NO: 1 , SEQ DD NO:2, the antisense sfrand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) recovering lymphocytes from said animal;

(c) fusing the recovered lymphocytes with a cell of a myeloma, plastocytoma or lymphoblastoid cell line to generate hybridomas;

(e) recovering the antibody.

90. A method of making a monoclonal antibody comprising:

(a) fusing a lymphocyte from an animal immunized with an immunogenic amount of a SGA-72M-related polypeptide with a cell of a myeloma, plastocytoma or lymphoblastoid cell line to generate hybridomas, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense sfrand to SEQ DD NO:l, SEQ DD NO:2, the antisense sfrand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C; (b) screening to select a hybridoma producing antibody to said SGA-72M- related polypeptide; and

(c) recovering the antibody.

91. A method of making a monoclonal antibody comprising: (a) administering a immunogenic amount of a SGA-72M-related polypeptide to an animal, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense sfrand to SEQ ID NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02%o Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS, for 1.5 hours at 60°C;

(b) recovering lymphocytes from said animal;

(c) immortalizing the recovered lymphocytes with Epstein-Ban vims to generate immortalized cells; (d) screening to select an immortalized cell producing antibody to said SGA-

72M-related polypeptide; and

(e) recovering the antibody.

92. A method of making a monoclonal antibody comprising: (a) immortalizing a lymphocyte from an animal immunized with an immunogenic amount of a SGA-72M-related polypeptide with Epstein-Barr vims to generate immortalized cells, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense strand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ DD NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt/vol) dexfran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) screening to select an immortalized cell producing antibody to said SGA- 72M-related polypeptide; and

(c) recovering the antibody.

93. A method of producing a phage Fab expression library comprising:

(a) isolating spleen cells from an animal immunized with an immunogenic amount of a SGA-72M-related polypeptide, in which the SGA-72M-related polypeptide is encoded by a first nucleic acid that hybridizes under low stringency conditions to a second nucleic acid, or its complement, which second nucleic acid is selected from the group consisting of SEQ DD NO:l, the antisense sfrand to SEQ DD NO:l, SEQ DD NO:2, the antisense strand to SEQ ID NO:2, or a fragment thereof, said low stringency conditions comprising hybridization in a buffer comprising 35% formamide, 5X SSC, 50 mM Tris- HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml denatured salmon sperm DNA, and 10% (wt vol) dextran sulfate, for 18-20 hours at 40°C, washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 55 °C, and washing in a buffer consisting of 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS, for 1.5 hours at 60°C;

(b) amplifying, by polymerase chain reaction, antibody heavy and light chain nucleotide sequences from messenger RNA isolated from the spleen cells;

(c) cloning the amplified heavy chain and light chain nucleotide sequences into a lambda phage vector to produce a heavy chain library and a light chain library, respectively;

(d) combining and ligating the heavy and light chain nucleotide sequences from the heavy chain and light chain libraries to produce a phage Fab expression library that co- expresses antibody heavy and light chains; and (e) screening the expression library for a phage that binds said SGA-72M- related polypeptide.