WO2003102186A1

WO2003102186A1 - Dna inducing cancer cell-specific expression and cancer cell-specific expression vector

Info

Publication number: WO2003102186A1
Application number: PCT/JP2003/006844
Authority: WO
Inventors: Kohji Egawa; Katsuo Noguchi; Eri Kuwada
Original assignee: Medinet Co., Ltd.
Priority date: 2002-05-31
Filing date: 2003-05-30
Publication date: 2003-12-11
Also published as: JPWO2003102186A1; AU2003241985A1

Abstract

It is intended to provide a DNA inducing cancer cell-specific expression which causes gene expression specifically in cancer cells and a recombinant vector containing this DNA. More specifically speaking, a DNA containing at least a part of a DNA having +22 bases from the 5’-upper 2667 base starting with the transcription initiation point of Q5 antigen gene of a mouse non-classical histocompatible antigen gene (MHC class Ib gene) (SEQ ID NO:1), and a vector containing the same. It is also ntended to provide a method which comprises transferring a vector containing the above DNA together with a nucleotide sequence encoding a target protein, a target polypeptide or RNA into cancer cells and expressing the target polypeptide or RNA specifically in the cancer cells. The above vector is applicable to the prevention, treatment and diagnosis of cancer. It is also possible to develop a novel gene therapy method for cancer and a cancer vaccine.

Description

Cancer cell-specific expression induction DNA and cancer cell-specific expression vector

The present invention relates to a cancer cell-specific expression-inducing DNA which specifically causes gene expression in cancer cells, a recombinant vector containing this DNA, and particularly, this DNA and a target protein or a target polypeptide or R A method of introducing a vector containing a nucleotide sequence encoding NA into a cancer cell and expressing the desired polypeptide or RNA specifically in the cancer cell; a transformant by introducing the vector; And a method for preventing or treating cancer using the above-mentioned DNA-containing vector. Background art

MAGE peptides identified from melanoma cells in cancer immunology in recent years have been the starting point, and cancer antigens are being identified actively. The name of the antigen is that the abnormal protein produced by cell carcinogenesis appears on the cell surface following the flow of the antigen presenting mechanism. Sex is also specific to individual cancers. In the living body, no detailed studies have been made on antigens that are strictly specific and commonly produced in cancer and on the mechanism by which such substances are expressed specifically in cancer cells.

The present inventor studied the intrinsic anti-cancer reactivity of a living body using mice. As a result of the study, it was revealed that there are T cells that respond commonly to various cancer cells in the immune response related to the anticancer response. Therefore, assuming that these T cells recognize antigens commonly present on the surface of various cancer cells, we sought what the antigens are.

First, a study of mouse cancer cells revealed that cell surface molecules, which can be detected by anti-Qa-2 monoclonal antibodies, are commonly expressed regardless of the type of cancer. (T. Tanino, N. Seo, T. Okazaki, C. Nakanishi-Ito, M. Sekimata and K. Egawa, Cancer Immunol. Immunother, Vol. 35, pp. 230 (1992)).

The Qa-2 antigen is an antigen expressed on the surface of normal lymphocytes of a mouse strain, and is one of the non-classical MHC class I antigen genes on the chromosome 17 QaZT1a region of the mouse. It is known that the gene encodes a Q9 gene having almost the same structure as that of Q7. However, the cancer cell surface molecule detected by the Qa-2 antibody is a different molecule from the Qa-2 antigen, which is the non-classical MHC class I antigen gene on mouse chromosome 17 QaZT1a region. One of the groups, the Q5 antigen gene, was shown to encode. In addition, the mouse experimental cancer cells must express the Q5 antigen, a product of the Q5 gene, in all experimental cancers examined, regardless of the mouse strain, organ, or cause of canceration. It was confirmed.

(N. Seo, T. Okazaki, C. akanishi-Iio, T. Tanino, Y. Matsudaira, T. Takahashi and K. Egawa, J. Exp. Med., Vol. 17, No. 5, pp. 647 (1992)).

The Q5 antigen partially shares antigenicity with Qa-2 mice (mice that do not express the Qa-2 antigen). By taking advantage of this fact, Qa-2 ⁺ mice can be treated with lymphocytes of Qa-2 ⁺ mice (mice expressing the Qa-2 antigen) as antigens. After administration and anti-Qa-2 immunization, an experiment was performed to transplant Q5 ⁺ Qa-2 cancer cells (cancer cells that express the Q5 antigen and do not express the Qa-2 antigen). Resistance to transplantation was induced. In addition, anti-Qa-2 immunization was performed after transplantation of cancer cells, and it was revealed that resistance to metastasis of Q5 ⁺ Qa-2 · cancer cells was also induced. From these facts, the fact that the adult mouse is not tolerant to the Q5 antigen, that is, the normal adult hardly expresses the Q5 antigen, and that the expression of the Q5 antigen is cancer cell-specific (LEgawa, N. Seo, T. Tanino and T. Tsukiyama, Cancer Immunol. Immunometer, Vol. 1, p.384 (1995)).

The Q5 antigen is not an antigen produced by gene mutation or an abnormal peptide derived therefrom, but an expression of the original Q5 gene which is also present in normal cells. However, the mechanism by which the Q5 antigen gene is specifically expressed in cancer cells was unknown. Disclosure of the invention

The present invention focuses on the mechanism by which the Q5 antigen gene is specifically and commonly expressed in cancer cells, and elucidates the DNA that specifically induces the expression of the Q5 antigen gene in cancer cells. The purpose of the present invention is to provide diagnostic methods, immunotherapy methods, prophylactic methods, recurrence prevention methods, cancer gene therapy methods, and drugs useful for these methods. The above-mentioned cancer includes not only a state of cancer but also a state in which cells mutated due to a virus infection or the like, that is, a “pre-cancerous state”. The term "pre-cancerous state" refers to a state in which, for example, a certain gene is mutated, but has not become an infinitely proliferating state.

The present inventors have studied the mechanism by which the Q5 antigen gene is specifically expressed in cancer cells. In the meantime, if the Q5 antigen is specifically expressed in cancer cells, the Q5 antigen gene is not transcribed in normal cells, but is transcribed only as the cells become cancerous. The idea was that there should be a regulatory mechanism that governs transcription. If there is expression-inducing DNA in the living body that causes gene expression in a cancer cell-specific and common manner, this DNA can be used to develop gene therapy for cancer, and develop immunotherapy and immunoprevention methods. It is considered to be extremely useful because it can be used for the development of diagnostic drugs for cancer and general cancer.

Based on this, as shown in) to (vi) below, we focused on the vicinity of the mouse Q5 antigen gene, which is a cancer cell-specific antigen, and in particular, the 3.9 kbp region upstream from the translation initiation codon, 5, Investigation into the existence of a region involved in such a regulatory mechanism revealed that it corresponds to 2669 bp from 1 667 bases to +22 bases 5 'upstream from the transcription start site of the Q5 antigen gene. It has been confirmed that, if a vector containing DNA to be introduced is introduced into a cell, any foreign gene linked downstream can be expressed only when the cell is a cancer cell. That is, we obtained the knowledge that the DNA in the above region is a DNA that specifically induces expression in cancer cells, elucidated that it corresponds to the regulatory mechanism governing transcription of the Q5 antigen gene, and completed the present invention. I came to.

The present invention provides a cancer cell-specific expression-inducing DNA that induces gene expression in a cancer cell-specific manner as described below, a cancer cell-specific expression vector containing the same, The present invention provides a transformant by introduction, and further provides these uses, for example, a method for detecting cancer, a diagnostic agent, a therapeutic method, a preventive method, a method for preventing recurrence, a cancer gene therapeutic method, and the like. Hereinafter, the present invention will be described in detail. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagram showing a band obtained by examining the expression of a group of MHC class Ib genes in a mouse tumor cell line by RT-PCR.

FIG. 2 is a diagram showing bands obtained as a result of examining a Q5 transcript (mRNA) for each organ of a normal AKR (H-2 ^k ) mouse.

FIG. 3 is a view showing a band as a result of examining a Q5 transcript (mRNA) for each organ of a normal BALBZc (H-2 ^d ) mouse.

Figure 4 is a diagram showing a band of normal ^{C57BL / 6 (H-2 b} ) Results of examining the Q 5 transcripts for each organ of the mouse (mRNA A).

FIG. 5 is a diagram showing bands as a result of examining the Q5 transcript (mRNA) of each organ of BW5147-carrying AKR mouse.

FIG. 6 is a diagram showing a band as a result of examining the Q5 transcript (mRNA) of each organ of the MH134 tumor-carrying C3HZHe mouse.

FIG. 7 is a diagram showing bands obtained as a result of examining the expression of CAR in healthy human peripheral blood by the RT-PCR method.

FIG. 8 is a diagram showing a restriction map and an adenovirus vector using lacZ for the repo overnight gene.

FIG. 9 shows a restriction enzyme map and a plasmid DNA configuration diagram using luciferase as a reporter gene.

FIG. 10 is a tissue staining diagram (magnification: 200 times) showing the expression of lacZ in the human cancer cell line HeLa.

Figure 11 is a histological staining diagram showing the expression of lacZ in the human cancer cell line DU145 (× The rate is 200 times).

FIG. 12 is a tissue staining diagram (magnification: 200 times) showing the expression of lacZ in the human cancer cell line MDA-MB-231.

FIG. 13 is a tissue staining diagram (magnification: 200 times) showing the expression of lacZ in the human cancer cell line DLD-1.

FIG. 14 is a relative activity diagram showing luciferase expression in the human cancer cell line HeLa.

FIG. 15 is a relative activity diagram showing luciferase expression in human cancer cell line DU145.

FIG. 16 is a relative activity diagram showing the expression of luciferase in the human cancer cell line MDA-MB-231.

FIG. 17 is a histostaining (magnification: 200-fold) showing the expression of lacZ in normal cells (PBMC).

FIG. 18 is a histological staining diagram (magnification: 200 times) showing the expression of lacZ in normal cells (thymus).

FIG. 19 is a histological staining diagram (magnification: 200 times) showing the expression of lacZ in normal cells (testis).

FIG. 20 is a histological staining diagram (magnification: 200 times) showing the expression of lacZ in normal cells (liver).

FIG. 21 is a graph showing the inhibitory effect of local administration of AdZQ5-H-2D ^d on the growth of MH134 liver cancer in mice bearing MH134 liver cancer. BEST MODE FOR CARRYING OUT THE INVENTION

The present inventors focused on the 3.9 kbp region 5 ′ upstream from the translation initiation codon of the mouse Q5 antigen gene as a region considered to induce cancer cell-specific expression of the Q5 antigen. The function of cancer cell-specific expression induction was confirmed as follows (i) to (vi). The plurality of documents described below are cited and incorporated herein.

(i) Confirmation of transcription of Ql, Q2, Q4, Q5, and Q10 antigen genes in cancer cells First, to further assure that cancer cell-specific expressed antigen is Q5 antigen The study at the transcription level was added. Q 1 as Q5 antigen heritage gene highly homologous and gene, Q2, Q3, Q4, Q6 , Q7, Q8, Q9, and Q there are 10 genes, Q 6 with C3HZHe (H- 2 ^k) mice It is known that the gene region from to Q9 is defective, and that the Q3 gene is a pseudogene. Therefore, transcription from the Ql, Q2, Q4, Q5, and Q10 antigen genes was examined using the RT-PCR method.

The sequences of the Ql, Q2, Q4, Q5, Q10 genes have been reported in detail (S. Watts, A C. Davis, B Gaut, C Wheeler, L. Hill and S. Goodenow, The EMBO J., vol.8, pp.1749 (1989)), these gene-specific primers were synthesized. AKR (H-2 ^k) malignant lymphoma cell line derived from murine BW5147 and extracts RN A malignant fibroblast cell line W 2 K, performed RT- PC R using each gene specific primer-synthesized Was. As a result, only a clear transcript from both cancer cells was found in Q5 (Fig. 1), and the nucleotide sequence of the amplified DNA was confirmed. It was consistent with the nucleotide sequence.

Therefore, it is expressed as a cancer cell-specific and common antigen in cancer cells Was the Q5 antigen. The G3 PDH gene in FIG. 1 is a housekeeping gene and is also shown as a positive control.

(ii) Examination of Q5 antigen gene expression suppression level in each organ of normal mouse

Studies on the transcription of the Q5 antigen include S. Cchwemmle et al. (S. Cchwemmle, D. Bevec, G. Brem, MB. Urban, PA Baeuerle and E H. Weiss, Iminunogenetics, vol. 34, p. 28). (1991)) and AR-Engel et al. (AR-Engel, E.L.roy, J.L.DieGues and N.Fe RNAndez, J.Reproductive Iimunology, vol.23, pp.73 (1993)) However, it has been reported that transcripts of the Q5 antigen gene are found only in the adult thymus and testis during embryogenesis. However, the experiments in these reports only performed Northern blotting and PCR using a primer different from the actual sequence, and it is not conclusive evidence of specific expression of the Q5 antigen. No. Therefore, in order to confirm whether the suppression of Q5 antigen expression is performed at the transcription level or translation level, RNA was extracted from each organ of normal mice, and a Q5 antigen-specific primer was extracted. Using RT-PCR, we attempted to detect transcripts (Q5 mRNA).

In normal AKR (H-2 ^K) mouse, slightly peripheral blood mononuclear cells, and was only detected in very slightly thymus (Fig. 2). In order to determine whether the detected band was Q5 or not, the cDNA amplified by PCR was sequenced, and the sequence completely matched the reported sequence of the Q5 antigen. Moreover, normal BALBZCOH- S ¹¹⁾ mice, and normal C57BLZ6 (H - 2 ^b) was not detected in any of the organs unless examined in mice (Fig. 3, Fig. 4).

From these results, the expression control level of the Q5 antigen is basically a transcription level, The results suggest that peripheral blood mononuclear cells and thymus may be suppressed at the translation level.

(iii) Examination of the level of suppression of Q5 antigen gene expression in each organ bearing tumor-bearing mice Similar to normal mice, studies were conducted on BW5147 (lymphoma) bearing AKR mice and MH134 (liver cancer) bearing CSHZHe mice. As a result, it was confirmed that the expression of normal cells in tumor-bearing individuals was similar to that in normal cells (Figs. 5 and 6).

From the above results, it was clarified that the transcription control was performed in normal cells in almost the same way as in normal mice even in the tumor-bearing state.

(iv) Confirmation of adenovirus receptor Yuichi (CAR) expression

Since the expression of adenovirus receptor (CAR), which was recently discovered, is not found in lymphocytes, (R P. Leon, T. Hedlund, S J. Meech, S Li, J. Schaack, SP Hunger, R C. Duke and J. DeGregoli, Pro atl. Acad. Sci. USA.vol. 95, pp. 13159 (1998), S. Huang, RI. Endo and G R. Nemerow, J. Virology, vol. 9 , pp. 2257 (1995)) It is known that adenovirus cannot normally infect lymphocytes. Therefore, combining the transcriptional regulatory region of the Q5 antigen gene with adenovirus may provide a complete cancer cell-specific expression induction vector that is not expressed in normal cells but is expressed in cancer cells. it is conceivable that. Therefore, the expression of CAR in healthy human peripheral blood was confirmed by RT_PCR using CAR-specific primers. As a result of examining the peripheral blood of six healthy volunteers, it was confirmed that none of the six volunteers expressed CAR (Fig. 7).

Based on the above results, the transcriptional regulatory region of Q5 antigen gene and adenovirus vector The possibility of providing a “cancer cell-specific expression induction vector” combining the above was strongly shown.

(V) Cloning of 5 'upstream DNA of Q5 antigen gene

The base sequence of the 5 'upstream DNA of the Q5 antigen gene was only identified up to 210 bp [GenomeNet Accession No. XI 6423, (S. Watts, A C. Davis, B Gaut, C Wheeler, L Hill and RS Goodenow, The EMBO J., vol.8, pp.1749 (198 9))]. Therefore, from the AKR-derived BW5147 cells are first H_2 ^k mice were extracted and purified chromosomal DNA. Then the chromosomal DNA and ^{铸型, Q4 k (S. Cc hwemmle,} D.Bevec, G.Brem, M B. Urban, P A. Baeuerle and E H. Weiss, I Momomo g enetics, vol.34 , pp.28 (1991)) and Q 5 to prepare specific primers of each respective two in ^k coding region, Q 4 ^k by Nested PCR - DNA fragments up Exon 2 - from E xon 5 Q 5 ^k Was amplified. Then, the amplified approximately 8.31 1) 0 NA fragment was ligated to the SmaI site of the pUC118 vector, and then introduced into E. coli and cloned to clone pUC118ZQ5-5 '(8.3 k). Were obtained.

(vi) Determination of nucleotide sequence of 5 'upstream DNA of Q5 ^k gene

Prior to sequencing, pUC118 / Q5-5 'a (8. 3 k) and Sac I digested, by deletion of 4. 2 kbp containing the entire coding region of Q4 ^k you think that the excess relative purposes, Furthermore, a clone pUC118 / Q5-5 '(Sac-E2) was obtained by digesting with SalI and inserting ApaI linker into this site. Using pUC118 / Q5-5 '(Sac_E2), the nucleotide sequence was determined by the Size-fractionated Unidirectional deletion (SUD) method as follows.

5 minutes after digestion of pUC118 / Q5-5 '(Sac-E2) with Apa I and Xba I, 1 Exonuclease III (Exo III) digestions were performed for 0, 15, 20, and 25 minutes, respectively. The ends of these Exo III-digested DNAs were blunted using Mung Bean nuclease and KI enow fragment, subjected to agarose electrophoresis, and then DNA fragments of each size were recovered and purified. The DNA thus obtained was circularized by self-ligation and introduced into E. coli. The length of the insert DNA of the plasmid in the emerged Escherichia coli colony was confirmed by PCR using primers at both ends of the vector multicloning site, and 17 to 25 clones of different sizes were selected. The nucleotide sequence of the insert portion of each selected clone was decoded by the cycle sequence method. Based on the base sequence decoded from each clone, the base sequence of the entire 4. I kbp region of the insert DNA was joined using the overlapping sequence portion.

Actually, the above operation was performed for three clones of the above pUC118 ZQ5-5 '(8.3 k), and the consensus sequence was determined. Since the reported sequence and the consensus sequence were completely identical, the sequence of the Q5 translation region was determined 5 ′ upstream from the translation initiation codon as shown in SEQ ID NO: 5. The sequence of SEQ ID NO: 5 is shown in Table 1 with the 5 'upstream and downstream being numbered with 10 and-, respectively, from the predicted transcription start point. 8 and 9 show the restriction enzyme maps.

Hereinafter, the sequences of SEQ ID NOs: 1, 2, 3, and 4 may be abbreviated as Hind, Bst, Pvu, or Nco at the position of each restriction enzyme.

A homology search of the determined sequence with Genomnet DDBJ FASTA revealed that none of the sequences had a homologous sequence over the entire region.

Table 1 continued

AAGGGGGAGGGGCTCCTACTCAAATATTCTGGATAACAGGTGTGTCTTCCTACCTCAAAG -1741 AGTTCTGGAACTACTGCTCTCTTTGGGCTTTGCAGCTCCTTTTAGCACTCATGGCTCTGC -1681 CTCCTGCCTCCCCTCTTACAGGGAGTTTTCTACCCACGGGTGGAGAAGCACGAAAAGTTT -1621 TTCTGGATGTAAGTTTGATGAGAGCAGGGCGGCCTGAGACCTGAGAGCCCTGGAGAAGTG -1561 CAGACAGGAAGGAGGCCCTGGGGCAGCTCAGCAGCCTGGATCCCCTTTACCCTCAGCTCT -1501 GTGGGCTCAGACGCTGTCATCTTTCTTTCTTCCACCAGGCGGCGCTGTTTGCCAAGAATG -1441 TGATGCTTCTCTTCCCTCTTCAACAGCTGAGACCCTGGAGGGACTCATGGAAACAAGTAC -1381 CTCTGAATCCTGGAGAGGCTGAGGGGTGGCTGTGGACACCTGCATGGGGAAGTGGCTGGA -1321 GTTTACACCTGTGTCACCMCATTTATTGCTGTTGTGTAACATGGGATTGTGAATGAATG -1261 AATCTGCACTAACGTCTGCTCTAATTTTCTAGTTAAGTTACCTGTGTCTCGGATTTGAAG -1200 AGATCAGGTAAAAAAAAAATCCACAGAATCAAAAATGTATGAATTTAAATTTTCCCCACA -1141 TTACTGATCAGGGATGAGCCCTCACATCACCATTGTGTGCTCTCTGGCATGAGAATCATC -1081 TTTCTTCCAGTGTCCAACCTGCACTGCCCTGAGGAACTCTGGGGCCAACTTGGTTATCAG -1021 ATCCAATGTCCCACACAACGTGACATTCATGTCCCTCATCTCATCTGCTCAAAGTAGGAG -961 TGAAGGTCAGAGAGAGAGAGAGTGAGAGGGTCACAGATTACATAACTTCTATGATATTAT -90 1 CATCATTATTCTGTGTTATAATCGGTGACAGCTCCTCTCCTACTGTTATTGAGTCACTAA -841 AGCAACTGCACCATGGAAGTGCAGTCACAGAGAAGTGCAGTGGAGCCAGGGATCAGTGCC -781 CTGCTGTCTGTGGTCTCCACAGGGGTCTCTCTTCAGTGGACAAGGGGGTCTCCTGGGCTG -721 AGACAATGTCCCAGGTCCACTGAGACAAACTGAGAAGGAGGATACTTGTAAAAACAAACC -661 CACCTGGAACCACAGACATTTTGTGTGCAAAAACAAGAGGAGTCTGAGTCTAGGAGGCTG -601 AGAATGTCTGAGGGAAGAGGCAAAGTCTCGTCTTTACAAATGAGGGTCCTGCAGTGACTA -541 CTGGCAGTGTGACCTGCCCTCTGCAGGTGAACAGACCCTGGTCTTTGTGGGGTCCGTGTG -481 GGGCTTGCAGGCCAGCGCCTCTGCTTTAAGGAGAAGCCTATATCCAATGCATCCCCAAGG -421 GCTTGTACTGCCATTGTGTTCCCGGAAGTGGCTTTTCTTTCAGAAGACTCCAGGGTCTGA -361 CTTCTGAAGCAAAGAAGGAAGAGGAAGGGTGGAGGAGAGGACACAGAGAGTTTGGCTGCG -301 GGTCTCTCTGGTGCCCAGACAGCTTCTGGGTCAGAACTCGGTGACATCATGACAAACAGC -241 TCTCTGTCCAAAGCACAGGGTTCAGGAAAATCTTAGTCTCCAGGCGGTGAGGTCAGGGGT -181 GGGGAAGCCCAGGGCTAGGGATTCCCCATCTCCCCAGTTTCACTTTTGCTCCTGAGTCAT -121 GTCCTTCTGCCCAGACACTGATGACTTGATGGCAGCTCTCACCCCCATTGGCTGGTGCGA -61 TCCTGGGTAACCAATCCGCGTCGCTACGGCCCTGGTTATAAAATCCACACAGCCCGCGGG -1 ACTCAGAGGCA CCGGATCCCAG (ATG) 22 (25)

(vii) Transcriptional regulation in human cancer cells

In order to apply the transcription regulatory region of the Q5 gene to human cancer gene therapy, it is essential to cause transcription in human cancer cells. Therefore, four types of adenovirus vectors were constructed using lacZ as the reporter gene and having the 5 'upstream region of the Q5 gene upstream (Figure 8), purified, and transcribed in human cancer cells. It was investigated. 4 When examined using the human cancer cell lines HeLa (cervical cancer), DU145 (prostate cancer), MDA-MB-231 (breast cancer), and DLD-1 (colorectal cancer), repo was found in all cancer cells. Gene expression was observed overnight (Figures 10, 11, 12, and 13). Furthermore, using luciferase as the reporter gene, a plasmid DNA having a 5 'upstream region of the Q5 gene upstream thereof was constructed (Fig. 9), and its transcription activity was quantified. Examination using human cancer cell lines HeLa (cervical cancer), DU145 (prostate cancer), and ViDA-MB-231 (breast cancer) revealed expression of the reporter gene in all cancer cells (Figures 14, 15, 16). In addition, when the SV40 promoter was compared with pGL3Q5. Hind, the expression was 50% or more (Table 2). These results revealed that the 5 'upstream region of the Q5 gene can induce sufficient transcription even in human cancer cells. Table 2 Transcription inducing activity of Q5-5 '

(vi) Examination of transcription control region in normal cells

There are cell lines that can be cultured in / 'or primary cells that are called normal cells S, but there is no guarantee that they are truly normal. Therefore, the inventors used normal cells of the tumor-bearing mouse //? Vivo system for evaluation in normal cells.

2 x 10 ⁵ MH134 hepatoma cells in the abdominal skin of C3H / He (8-week-old, male) mice One week after transplantation, a cancer tissue having a diameter of about Ί mm was used.

Recombinant adenovirus comprising a D NA of the structure shown in FIG. 8, AdZHind-lacZ, A d / Bst-lacZ, was purified Ad / Pvu-lacZ ^ AdZNco- lacZ, respectively 3 X 1 0 ⁹ pfu / mouse Each group was administered to 2 to 4 animals, and 3 days later, each organ was taken out and frozen sections were prepared. When these sections were examined by lacZ staining, various normal cells were stained with AdZCAG-IacZ used as a positive control (Table 3 below), but Ad / Hind-lacZ, Ad / Bst-lacZs Ad / Pvu_lacZ, Ad All four types of / Nco'lac Z showed no staining in normal cells other than cancer tissues (Table 3, Figures 17, 18, 19, 20). Here, CAG indicates the promoter as a positive control.

Table 3 Expression of lacZ reporter gene

〇: lacZ positive, X: lacZ negative The corresponding DNA is DNA that induces expression in a cancer cell-specific manner.If a vector containing the DNA is introduced into a cell, any foreign gene linked downstream can be used only when the cell is a cancer cell. To express The inventors have found that the present invention can be performed and completed the present invention.

Accordingly, the present invention provides a cancer cell-specific expression-inducing DNA that induces gene expression in a cancer cell-specific manner, and a cancer cell-specific expression vector containing the same. (1) Cancer cell-specific expression induction DNA

(1-1) The DNA of the present invention contains the predicted transcription initiation site of the Q5 antigen gene of the mouse non-classical histocompatibility antigen gene (MHC class Ib gene). Is a DNA having

(1-2) Specific examples of the DNA of the present invention include the following A to E.

A: DNA consisting of at least a portion of the DNA (SEQ ID NO: 1) from 2667 bases to 22 bases 5 'upstream from the transcription start point of the Q5 antigen gene of the mouse nonclassical histocompatibility complex gene (MHC class Ib gene) .

B: DNA represented by the nucleotide sequence described in at least SEQ ID NO: 2 (5 'upstream of the transcription start point—2042 bases to +22 bases) in the sequence listing).

C: DNA represented by at least the nucleotide sequence described in SEQ ID NO: 3 (= 5 ′ upstream from the transcription start point—1414 bases to +22 bases) in the sequence listing.

D: DNA represented by at least the nucleotide sequence described in SEQ ID NO: 4 (== 5 from the transcription start point, +22 bases from 829 bases upstream) from the sequence listing.

E: DNA consisting of at least a part of DNA (SEQ ID NO: 1) from 3901 bases to 22 bases 5 'upstream of the transcription start point of the Q5 antigen gene of the mouse nonclassical histocompatibility complex gene (MHC class Ib gene) .

(1-3) Further, the following A, to D, are exemplified as the DN A of the present invention. A ': a DNA in which an arbitrary number of consecutive base sequences of 1 to 1236 bases from 5 to 3,903 bases are added to the DNA of SEQ ID NO: 1;

B ': A DNA in which an arbitrary number of consecutive base sequences of 1 to 624 bases from 1 2043 bases to 1666 bases are further added to the DNA of SEQ ID NO: 2 from 5' upstream 12043 bases to 12666 bases.

C: DNA in which an arbitrary number of consecutive base sequences of 1 to 627 bases from 1,415 bases to 1,204 bases are added to the DNA of SEQ ID NO: 3.

D,: A DNA in which an arbitrary number of consecutive base sequences of 1 to 584 bases from 5 'upstream to 830 bases to 1,413 bases are further added to the DNA of SEQ ID NO: 4 from 830 bases to 1,413 bases.

(1-4) In general, DNA retains its main function even if one, two or less, or three or less, or several or fewer bases in the sequence are added, deleted, substituted or inserted. Often. Therefore, as long as the DNA of the present invention has the activities (1), (2), and (3) described below, one or several bases or less in the sequences (1-1) to (1-3) described above are included. But also includes added, deleted, substituted or inserted sequences. The DNA of the present invention also includes a sequence in which one or several bases or less in the above-mentioned sequences (1-1) to (1-3) are mutated with a point mutation.

(1-5) The DNA of the present invention includes the above-mentioned sequence portions (1-1) to (1-4) as long as it has the activity (1) or (2) described later.

(1-6) As long as the DNA of the present invention has the activity of (1) or (2) described later, or And sequences having homology to the above-mentioned sequences (1-1) to (1-5). Here, “homology” refers to having a sequence that matches 60% or more of the nucleotide sequence.

(1-7) The DNA of the present invention specifically hybridizes with the complementary strand of the above-mentioned sequence (1-1) to (1-6) as long as it has the activity of (1) or (2) described later. To include.

The term “specifically hybridize” as used herein refers to hybridization in 0.1 XSSC and 0.1% SDS for at least 68 ° C for 2 hours.

'(1) The DNA of the present invention has an activity of inducing gene expression downstream thereof in a cancer cell-specific manner.

(2) The DNA of the present invention has an activity of inducing gene expression downstream thereof in a cancer cell-specific manner regardless of the type of cancer.

Further, the DNA of another embodiment of the present invention is a nucleotide sequence complementary to the above-mentioned DNA of (1-1) to (1-7).

These antisense sequences may function to inhibit the expression of genes downstream of cancer cell-specific expression-inducing DNA.

In the present invention, the “nucleotide sequence” is a sequence consisting of a nucleotide having a base of a pyrimidine base or a purine base, and includes DNA, RNA and derivatives thereof.

In addition, “DNA” refers to adenine, guanine, cytosine, and thymine as bases, as well as small amounts of methylated bases such as 5-methylcytosine and 6-methylaminopurine. And so on.

The DNA of the present invention may be one obtained by screening and isolating a chromosomal DNA library, one obtained by the PCR method, or one synthesized. (2) S-cell specific expression vector for cancer cells

(2-1) Vector one

The vector used in the method for producing DNA of the present invention is not particularly limited as long as it can introduce a gene into a known host such as Escherichia coli. A shuttle vector having a cloning site for a restriction enzyme having no recognition site is selected, and the DNA of the present invention is ligated at this cloning site. This is introduced into an appropriate host such as Escherichia coli, a desired clone is selected, and vector DNA is extracted and purified from the obtained clone.

The vector into which the DNA of the present invention is incorporated and specifically expressed in cancer cells is not particularly limited as long as it is a vector used for gene transfer into animal cells. For example, a plasmid vector, a retrovirus vector, an adenovirus Vectors, adeno-associated virus vectors, simple herpes virus vectors, HIV vectors, ribosome vectors and the like can be used. After insertion into the virus vector production shuttle vector, it can be incorporated into the virus vector. Among these, adenovirus vectors are preferred in that they are introduced into cancer cells. If the vector contains a promoter sequence for expression of the vector itself, it is preferable to delete that region.

(2-2) Encoding the target protein or target polypeptide or RNA Nucleotide sequence

The nucleotide sequence encoding the target protein or polypeptide sequence to be incorporated and expressed in the cancer cell-specific expression vector of the present invention may be any nucleotide sequence that can be expressed by the vector (2-1). Although not particularly limited, from the viewpoint of availability, a nucleotide sequence encoding at least a part of a non-self MHC class I molecule, a nucleotide sequence encoding at least a part of a non-self MHC class II molecule, a site force Nucleotide sequence encoding ins, nucleotide sequence encoding site force receptor, nucleotide sequence encoding a polypeptide that induces cell death, nucleotide sequence encoding costimulatory molecules (CD80, CD86, etc.), cancer antigen Nucleotide sequence encoding a tumor suppressor gene Preferred is an antisense nucleotide sequence of an oncogene. Specifically, at least a part of the extracellular domain of each of human non-self MHCs, HLA_A, 1B and 1C, IFN-α, IL-12, Fas, TNF receptor, Nucleotide sequences encoding lymphotoxin receptor, TRAI L receptor, GM-CSF, M_CSF, G-CSF, Ras, p53, LI GHT, viral proteins and the like.

As the nucleotide sequence encoding the RNA sequence, a nucleotide sequence encoding lipozyme (RNA having enzymatic activity) or RNAi (RNA interference) against an oncogene or a mutant gene is preferable.

Since all of the above nucleotide sequences are known, they can be obtained by cloning from a DNA library by a general method. These nucleotide sequences are chemically synthesized using known methods such as the phosphotriester method and the amidite method. You can also get. It can also be obtained from GeneBank.

(2-3) Construction of cancer cell-specific expression vector

The cancer cell-specific expression-inducing DNA and the nucleotide sequence encoding the desired protein, polypeptide or RNA are integrated into the vector's cloning site. The method for constructing a cancer cell-specific expression vector using a commercially available adenovirus vector (Adenovirus Expression Vector Kit (Takara Shuzo)) is described below. A shuttle vector having a restriction enzyme cloning site where no recognition site is present in the cancer cell-specific expression induction DNA is selected, and the cancer cell-specific expression induction DNA is ligated at the cloning site. This is introduced into E. coli, a desired clone is selected, and vector DNA is extracted and purified from the obtained clone. Then, a nucleotide encoding the protein, polypeptide or RNA of interest was ligated to the cloning site downstream of the cancer cell-specific expression-inducing DNA, and this was introduced into Escherichia coli, and the desired clone was selected and obtained. Extract and purify vector DNA from clones. From the obtained vector DNA, a region containing the cancer cell-specific expression induction DNA and the above-mentioned nucleotide sequence is cut out with a restriction enzyme (a cut surface having a blunt end) and taken out. Thus, the desired DNA was amplified in E. coli. This fragment is inserted into a cosmid vector Yuichi pAxcw, which is an adenovirus vector dephosphorylated after digestion with a restriction enzyme (Swal), and packaged using a packaging kit (GigapacklllXL (Stratagene)). . This is infected to VCS-257 E. coli or the like, and cosmid DNA is purified from the resulting colonies according to a conventional method, and a desired vector is selected.

The obtained vector was used together with DNA-TPC for 293 cells by the calcium phosphate method. The cells are infected and cultured for 7 to 15 days in a 96-well plate. Collect the dead cells and their medium from the wells in which 293 cells have died, freeze-thaw six times, and centrifuge. The supernatant is used as the primary virus solution. The virus fluid contains "recombinant adenovirus particles" consisting of cancer cell-specific expression-inducing DNA + adenovirus vector DNA incorporating DNA encoding the desired protein / polypeptide or RNA. .

The primary virus solution is added to the culture supernatant of 293 cells and HeLa cells, and 293 cells are completely killed and HeLa cells are selected not to die. In this step, those contaminated with wild-type adenovirus are eliminated, and the target recombinant adenovirus amplification product is selected. Dead cells and their medium are collected, freeze-thawed six times, and then centrifuged as in the preparation of the primary virus solution, and the resulting supernatant is used as the secondary virus solution. . On the other hand, DNA is prepared from dead cells, and it is confirmed whether or not the desired vector DNA is obtained. If the DNA is confirmed, a tertiary virus solution and a quaternary virus solution are further prepared.

The tertiary virus solution is used to infect 293 cells, and the vector whose desired structure can be confirmed is designated as a cancer cell-specific expression vector. If a desired amount of virus particles is obtained, it is not necessary to prepare a quaternary virus solution, and if necessary, a higher-order virus solution may be prepared. After confirming that no natural virus is contaminated, the quaternary virus solution is purified by density gradient centrifugation or the like, and the titer is determined. The virus solution prepared as described above is applied to gene therapy.

As described above, a gene therapy method for cancer and a cancer vaccine can be developed by using the cancer cell-specific expression vector of the present invention. (3) Cell processing method (Transformant production method)

The cancer cell-specific vector of the present invention is introduced into a cancer cell, and the integrated target nucleotide is expressed. The cancer cells are not particularly limited as long as they are eukaryotic cells, but mammalian cells such as humans and mice are preferable from the viewpoint of usefulness. The cancer cells may be present in the living body or may be taken out of the living body. When cancer cells are prepared from cancer tissue directly collected from a living body, it is highly possible that the cells are contaminated with bacteria or the like. Therefore, it is preferable to add an antibiotic to the culture solution. In addition, it is preferable to prepare a pathological tissue sample or the like in order to confirm that the collected tissue piece is a cancer tissue.

(3-1) Introduction of cancer cell-specific expression vector into cells

Examples of a method for introducing the polar cell-specific expression vector of the present invention into cancer cells ex'ra include a calcium phosphate method, an electroporation method (electroporation method), a liposomal method, a DEAE dextran method, a lipofection method, and a microporous method. A general method such as an injection method can be used. If it is a viral vector, it can be introduced by infecting cancer cells by including it in a medium. In vivo methods for introducing into cancer cells include intravenous injection, arterial injection, intramuscular injection, and local injection of a cancer cell-specific expression vector suspended in physiological saline or the like to obtain an appropriate titer. Examples of the method include introduction by oral administration, transoral administration, and transdermal administration.

(3-2) Culture of cancer cell-specific expression vector-introduced cells

Culture of the cancer cells into which the cancer cell-specific expression vector has been introduced ex vivo is performed according to a conventional cell culture method. For cancerous tissue with strong intercellular junctions, culture the tissue as it is It is preferable to use a conventional method for culturing tissue explants.

(3-3) Confirmation of protein, polypeptide or RNA expression

Expression of the target protein / polypeptide or RNA can be confirmed by a known method for analyzing gene products. For example, a fluorescent antibody method, an enzyme antibody method, a method using flow cytometry, a Western blotting method, an immunoprecipitation method, an RT-PCR method, a cDNA base sequencing method and the like can be mentioned.

(4) Induction of cytotoxic T cells (CTL)

Cytotoxic τ cells can be produced by using a cancer cell-specific expression vector according to the present invention and using a processed cell in which a cancer cell has expressed an antigen molecule such as a non-self MHC class I molecule.

(CTL) can be induced.

Furthermore, by using a processed cell, which is a transformant into which the cancer cell-specific expression vector of the present invention has been introduced and can express a desired protein or polypeptide, not only the expressed antigen molecule but also the cancer cell Cytotoxic T cells (CTL) against the original cancer antigen can also be induced at the same time. The obtained cytotoxic T cells can be returned to a living body and used for treating cancer.

(5) Screening for the presence of cancer cells

The cancer cell-specific expression vector of the present invention is introduced into a cell of a subject such as a human tissue, organ, or body fluid, and a desired protein or polypeptide downstream of the cancer cell-specific expression DNA of the present invention is introduced. If the nucleotide sequence encoding the peptide expresses a desired protein or the like, the cell of the subject is known to be a cancer cell, and the presence of the cancer cell can be determined. 03

2 6

Can be. Therefore, the present invention provides a test method in which a cancer cell-specific expression vector is introduced into a subject to determine the presence of cancer cells based on the presence or absence of expression, and a diagnostic agent for cancer containing cancer cell-specific expression DNA. it can. According to the present invention, cancer can be diagnosed if cancer cells are present, and not only can the cancer be diagnosed, but also cells that have not been sick but have been infected by a virus (hepatitis C, etc.) Is present, and so-called precancerous conditions that gradually progress to cancer can also be diagnosed.

The nucleotide sequence introduced into the vector together with the cancer cell-specific expression DNA of the present invention includes, in addition to the nucleotide sequence encoding the desired protein or polypeptide, LacZ, luciferase, GFP ( A reporter gene such as Green Fluorescent Protein) can be used.

(6) Induction of cancer cell-specific expression Therapeutic / preventive use of DNA and vector cancer Cancer cells are mutations of their own cells, and the immune system cannot be recognized as non-self in vivo. When it grows abnormally, the disease progresses. However, by using the DNA and the vector according to the present invention, a desired protein, polypeptide or RNA can be expressed in a cancer cell-specific manner, so that the immune system expresses a protein or polypeptide that can be recognized as non-self. This makes it possible to recognize cancer cells as non-self and eliminate the cancer cells, thus enabling effective cancer treatment. In addition, if cancer cells are present, not only treatment for clinically developing cancer disease, but also mutant cells that gradually move to cancer, such as viral infections (hepatitis C, etc.) In the case where the condition exists, that is, a so-called precancerous condition, it can be treated using the DNA and the vector according to the present invention. Therefore the above treatment The term includes treatment and prevention and prevention of recurrence.

In addition, for example, a fusion protein may be produced by some mutation, but even if it is not caused by an oncogene, it may cause cancer. Cancer can be treated by using the vector of the present invention containing RNAi capable of causing RNA interference with a mutant gene or DNA encoding lipozyme.

The present invention provides a method for immunologically treating cancer, a method for preventing immunity, and a method for preventing recurrence using a vector containing a cancer cell-specific expression-inducing DNA.

Also effective is a method for treating a cancer in which the cytotoxic T cells (CTL) induced along with the expression of the antigen molecule are returned to the living body using the transformant described in (4) above.

Furthermore, the cancer cell-specific expression induction vector of the present invention may be used for studies on cancer cell-specific transcription factors and studies on inhibition of the transcription factors.

Example

Hereinafter, the present invention will be described more specifically with reference to Examples, but the present invention is not limited to these Examples. Unless otherwise specified, the operations in the examples were performed according to the method described in "Molecular Cloning, Alaboratory Manual. DW. Russell et al., 3rd edition (2001), Cold Spring Harbor Laboratory".

Example 1

Normal AKR (H-2 ^k) mice, normal ^{BALB / c (H - 2 d} ) mice and normal C57BL / 6 (H- 2 ^b) mice, each 10 weeks of age, were used by two males. Heart blood was collected from each mouse under ether anesthesia to obtain about 1 ml of peripheral blood. This peripheral blood was diluted to 7.5 ml each with physiological saline (saline), layered on 3 ml of lymphoprep (manufactured by NYC0MED), centrifuged at room temperature at 2,500 rpm for 30 minutes, and centrifuged. A blood mononuclear cell (PBMC) fraction was obtained. Each PBMC fraction was diluted to 1 Om1 with a saline solution, centrifuged at 1500 rpm at 4 ° C for 5 minutes, and washed by sedimenting PBMC. After this washing was performed twice, the precipitate was recovered, dissolved in 1 ml of Isogen (Nippongene: Nippongene), and immediately stored at 180 ° C. Separately, each organ of each mouse was excised, thoroughly washed with a saline solution, homogenized in lm1 Isogen, and immediately stored at -80 ° C.

After each organ temporarily stored at 80 ° C was returned to room temperature, it was immediately centrifuged at 4 ° C for 3000 rpm for 10 minutes, and the supernatant was collected. RNA was recovered from the supernatant according to the method attached to the instruction manual of Isogen. In order to further degrade trace amounts of DNA, digestion with DNase I was performed at 37 ° C for 30 minutes. After extraction with ethanol and ethanol, ethanol precipitation, and ethanol rinsing, the resultant was dissolved in 0.15 ml of RNase-free distilled water, and the amount of purified and recovered RNA was quantified by a spectrophotometer.

Based on the quantitative value of each RNA, 50 ng of each was used for the reverse transcription reaction. It was evaluated by PCR method using -3 '. At this time, G3PDH-specific primers, 5'-ACCACAGTCCATGCCATCAC-3 ', and 5'-TCCACCACCCTGTTGCTGTA-3' were used as positive controls. From each RNA sample, PCR was performed using a Q5-specific primer without a reverse transcription reaction, and it was confirmed that DNA amplification did not occur. The results are shown in Figures 2, 3, and 4. As shown in Figure 2, it was only very slight transcripts slightly To thymus peripheral blood lymphocytes were detected in normal AKR (H-2 ^k) mice. In order to determine whether or not the detected band was derived from the Q5 antigen gene, the cDNA amplified by PCR was sequenced and found to be consistent with the reported Q5 antigen gene. Normal BALBZc (H -2 ^d) mice (Fig. 3), Oyobi normal Rei_578 6 (11-2 ¹⁾⁾ Mausu (4), the have transcripts of Q 5 antigen genes in organs of deviation is detected Did not.

These results suggested that the expression control level of the Q5 antigen was basically at the transcriptional level, and that peripheral blood mononuclear cells and the thymus could be suppressed at the translational level.

Example 2

BW5147 lymphoma that had been passaged in the abdominal cavity of AKR mice was collected and After washing twice, it was transplanted into the abdominal skin of another AKR mouse at 2 × 10 ⁵ cells / 501 / mouse. One week later, when the tumor diameter became about 7 mm, each organ was collected in the same manner as in a normal mouse. Similarly, MH134 J3 dried cancer was transplanted into C3HZHe mice, and each organ was recovered. RNA was extracted and purified from each organ collected as in normal mice, and analyzed by RT-PCR. In BW5147 tumor-bearing AKR mice, transcripts were detected only in peripheral blood mononuclear cells (Fig. 5). In MH134 tumor-bearing C3H / He mice, it was not detected in any organ (Fig. 6).

From Examples 1 and 2, it was clarified that the transcription control was performed in the tumor-bearing state in the same manner as in the normal mouse.

Example 3

Confirmation of Adenovirus Receptor Yuichi (CAR) Expression>

RNA was extracted and purified from HeLa (human cervical cancer) cell line in which CAR was clearly expressed, and peripheral blood mononuclear cells from eight healthy subjects, in the same manner as in normal mice. After quantifying the amount of the recovered RNA, RT-PCR using CAR-specific primers 5′-CTTGTT AAGCCTTCAGGTGC-3 ′ and 5′-CTGATATCGTGATGAACTTCC-3 ′ was performed to confirm the expression of the transcription level. As shown in FIG. 7, CAR expression was observed in HeLa cells, but CAR expression was not observed in all of the eight healthy subjects.

The above results suggested the specificity and usefulness of a cancer cell-specific expression induction vector obtained by combining the transcription regulatory region of the Q5 gene with an adenovirus vector. Example 4 Ku Q5 ^k gene 5, the cloning of the upstream DNA> - from AKR-derived BW5147 cells initially H- 2 ^¾ mice were extracted and purified chromosomal DNA according to a conventional method. Next, nested PCR was performed using this chromosomal DNA as type I. The base sequence of the primers used was S. Cchwe mardle, D. Bevec, G. Brem, MB Urban, PA Baeuerle and E. Refer to the nucleotide sequence of chromosomal DNA reported in H. Weiss, I Thouga genetics, vol. 34, pp. 28 (1991), and refer to the region corresponding to the 3 ^ and (35 ^{) 1} translation regions. The primer sequence for 1st—PCR is 5′-ATCCT CCAAAGGCACATGTGACATG-3 ′ and 5′-CCACTGCTTGTTGTTTTTGGCGATCTT-3 ′, and the second primer sequence for PCR is 5′-TCCACTGTCTCCMCATGGCGAACG- The nested PCR yielded a PCR product containing a DNA fragment of about 8.3 kbp. 3, 5, and 5'-CGCGCACGGCTTCGCACTTGCATT-3 '.

The above nested PCR product was treated with T4 DNA polymerase to make the DNA ends blunt and purified, and then phosphorylated at the ends by T4 polynucleotide kinase treatment. Separately, pUC118 was digested with SmaI, the terminal phosphate was removed by alkaline phosphatase treatment, and purified vector DNA was prepared. These 8.3 kb pDNA fragment and vector DNA were ligated by a ligation reaction, and introduced into E. coli JM-109 by electroporation. The size of the insert DNA of the emerging colonies was examined, and the desired clone having 8.3 kbp was selected. Further, by selecting those which the nucleotide sequence of the selected clones universal primer 5'_CGCCAGGGTTTTCCCAGTCACGAC- 3 of pUC 118, is decoded by cycles Sequence method using, DNA sequences of the primer near the Q 5 ^k was confirmed Q 5 ^k gene 5, and succeeded in black-learning upstream DN a (pUC 118 / Q5-5 ' (8. 3k)).

Example 5

Q5 ^k gene 5, base sequence determination of upstream DNA>

The coding region of Q 5 ^k from Q 4 ^k cloned according to Example 4 from including clones, for deleting the Q4 ^k coding region of which is considered irrelevant to the purpose, pUC118ZQ5-5 '(8. 3 k ) was digested with Sac I, the once Serufurai gate one Chillon, the insert size DNA 4. and sub black-learning what you _{l kbp (P UC 118 / Q5-5} '(4. 1 k)). Next, pUC118 / Q5-5 '(4.Ik) was digested with Sail to obtain a clone pUC118 / Q5-5' (Sac-E2) into which ApaI linker was inserted at this site.

For decoding, pUC 118 ZQ5-5 '(Sac-E2) was used, and the nucleotide sequence was determined as follows by the Size-fractionated Uni-directional deletion (SUD) method. pUC118 / Q5-5 '(Sac-E2) was digested with Apa I and Xba I, followed by Exonuclease III (Exoffl) digestion for 5, 10, 15, 20 or 25 minutes. The ends of these これら οΙΙΙ-digested DNAs were blunted with Mung Bean nuclease and Klenow fragmaent, and after agarose gel electrophoresis, DNA fragments of each size were recovered and purified. The DNA thus obtained was circularized by self-ligation and introduced into E. coli. The size of the insert DNA of the plasmid in the emerging Escherichia coli colony was confirmed by PCR reaction using universal primers at both ends of the vector cloning site, and 17 to 25 clones having different sizes were selected. The nucleotide sequence of the insert portion of each selected clone was decoded by the cycle sequence method. Base sequence decoded from each clone Based on the sequence, the nucleotide sequence of the entire 4.1 kb region of the insert DNA was joined using the overlapping sequence portion.

The three clones of pUC118ZQ5-5 '(8.3 k) initially cloned above were similarly treated, and the consensus sequence was determined. For the Q5 translation region, the sequence reported 5 'upstream from the translation initiation codon was determined as shown in SEQ ID NO: 5, since the reported sequence and this consensus sequence were completely identical. Fig. 8 shows the restriction map.

Example 6

3 'downstream of DNA from Hind III (-2667) site, BstXI site, PvuII (-1414) site, Ncol site to the translation start codon (+22) immediately before the Q5 gene in the restriction enzyme map shown in Fig. 8 An adenovirus vector in which the LacZ gene and the BGH polyA site were placed was prepared and purified, and the virus titer was determined (the method was according to the manual attached to the kit of Takara). These recombinant adenovirus vectors were used to infect human cancer cell lines at m.0.i. = 10, 100, and 1000, and the expression of LacZ of the repo overnight gene was examined by color development. Staining was confirmed in all HeLa, DU145, MDA-MB-231 and DLD-1 cells. The results for m.o.i. = 1000 are shown in FIGS. 10, 11, 12, and 13.

Furthermore, Hind III (-2667), BstXL Pvu II (-1414), and DNA from Ncol to immediately before the translation initiation codon (+22) in the restriction enzyme map shown in FIG. Into the cloning site of the pGL3—basic vector (Promega) After confirming the sequence, a repo overnight plasmid was prepared. These reporter plasmids were introduced into HeLa, DU145 and MDA-MB-231 cells together with the internal standard plasmid pRL-TK (Promega) by the lipofection method. Two days later, the reporter plasmid was prepared using the dual luciferase assay kit (Promega). The expression level of the overnight gene (luciferase) was quantified. From the results shown in Fig. 14, Fig. 15 and Fig. 16, expression of all reporter genes was observed in all cells, and in comparison between reporter plasmids, the expression level was lower with pGL3 / Q5.NcoI. However, the other expression levels were similar. In addition, as shown in Table 2, comparison of the SV40 promoter (pGL3-control vector (Promega)) used as a positive control with pGL3 / Q5. HindIII showed that pGL3ZQ5. % Or more. These results confirmed that the Q5-5 'upstream transcriptional regulatory region DNA induced sufficient transcription in human cancer cells. Example 7

In cancer cells, it was clarified that the transcription inducing activity could be maintained high if the region was 14 'bases to 1422 bases (Pvu II site) to +22 bases or more, 5' upstream from the expected transcription start site. It is unclear whether the region matches the region required for transcriptional repression in E. coli, and it is necessary to examine transcriptional regulation in normal cells. However, there are some cell lines that can be cultured in ^ 0 and primary cultured cells, but there is no guarantee that they are truly normal at the time of examination. Therefore, the present inventors carried out in an in vivo system using tumor-bearing mice.

C3H / He (10-week-old, male) 2 x 10 ⁵ After transplantation, one week later, a cancer tissue having a diameter of about 7 mm was used. Purification was used to study transcriptional control of the human GanHoso vesicles A (i Hind-lacZ, Ad / Bst-lacZ, Ad / Pv u-lacZ AdZNco-lacZ each 3 X 1 0 ⁹ pfu / mouse per group 2 3 days later, each organ was removed, and frozen sections were prepared.The sections were examined by lacZ staining, and various normal cells were stained with AdZCAG-lacZ used as a positive control. However, AdZHind-lacZ, Ad / Bst-lacZ, Ad / Pvu-lacZ, and AdZNco-lacZ did not stain normal cells other than cancer tissues at all (Fig. 17, Fig. 18, Figure 19, Figure 20, Table 3).

From the above results, it was clarified that the 5 ′ upstream transcription regulatory region DNA of the Q5 antigen gene induces transcription in cancer cells and suppresses transcription in most normal cells. Furthermore, they discovered that a cancer cell-specific expression induction vector can be provided by combining with a vector that does not introduce a gene into PBMC like an adenovirus vector.

Example 8

(1) Preparation of recombinant adenovirus expressing non-self MH C class I molecule The use of C3H ZHe (H-2D ^k ) mouse and C57BL Z 6 (H-2 D ^b ) mouse as tumor-bearing model mice As a premise, preparation of a recombinant adenovirus expressing H-2D ^d antigen was planned. At this time, expression of the H-2D ^d antigen was controlled using the sequence of the transcription regulatory DNA of Q5 (Pvu).

The thymus was excised from the BALBXc (H-2D ^d ) mouse and ground with a sterilized slide glass to collect thymocytes. The separated cells ^{1 X 1 0 6 cel ls /} m The suspension was suspended in RPMI-1640 medium containing 10% FBS, 50 gZm1 streptomycin and 50 ii g / ml kanamycin so as to give a value of 1, and seeded on a petri dish. The cell suspension in the I FN- § added to a 50 n gZm 1, were cultured overnight in C_〇 ₂ I Nkyube Isseki scratch. After the culture, the cells were collected, washed with PBS, and lysed with Isogen-LS (Futtsubon Gene). Total RNA was obtained according to the protocol attached to Isogen-LS.

Using this total RNA as type I, a reverse transcription reaction was performed using oligodT as a primer to prepare cDNA. A PCR reaction was carried out using this cDNA as type II, with the H-2D ^d- specific primer—5′-ACTAAGCTTAAAATGGGGGCGATGGCTCCGC-3 ′ and 5′-AGTTCTAGACTTCACACTTTA CMTCTGGGAG-3 ′. After the reaction, when a part of the PCR product was examined by agarose gel electrophoresis, a band was observed at the expected position of 1.I kbp.

The remaining PCR product was digested with restriction enzymes HindIII and XbaI, and pUC19 was inserted into the DNA fragment digested with HindIII and XbaI by a ligation reaction. E. coli JM109 was transformed with this ligation product, and a clone having an insert DNA of 1.1 kbp was selected from the colonies that appeared. Plasmids were extracted and purified from the selected clones, and their nucleotide sequences were confirmed. A plasmid (pUC 19 / H-2D ^d ) completely matching the nucleotide sequence of GenomeNet DDBJ Accession No. U47326 was selected.

pUC 19 / H-2D ^d was digested with 1¾11 (with 1111) ¾ & 1, and the insert DNA of 1.1 kbp was recovered and purified. This 1.1 kbp DNA fragment was ligated to the pRc-CMV vector digested with Hind III and Xba I. The ligation product was used to transform E. coli JM109 with this ligation product. A clone having 1.1 kbp DNA was selected from the appeared colonies. Extraction of plasmids from selected clones, purified, confirms the nucleotide sequence, 11 Nai black Ichin problems (; - 0] ^ / ^/ 11-20 was selected as ^4.

pRc - CMV / H - a 2D ^d, digested with Nru I and Hind III, H - and the 2D ^d c DNA was recovered including DNA fragments. This was blunt-ended by T4 DNA polymerase treatment. Separately, pUC118 ZQ5-5 '(Sac-E2) was digested with PvuII and BamHI, and the: ΡνχιΠ-BamHIDNA fragment of Q5-5' DNA was recovered. This was blunt-ended by T4 DNA polymerase treatment, and a kinase reaction was performed to add a phosphate group to the end. These DNA fragments were ligated by a ligation reaction, and E. coli JM109 was transformed with the ligation product. Plasmid DNA was extracted from the emerged colonies, and a clone (pRc-CMVZQ5-H-2D ^d ) in which PvuII-BamHIDNA of Q5-5 ′ was ligated in the correct direction upstream of H-2D ^d cDNA was selected.

pAxcw was digested with Swal to prepare a cosmid vector treated with CIAP. Separately, pRc-CMVZQ5-H-2D ^d is digested with Bglll and XhoI to recover a DNA fragment containing 0: ^ 8 sites of ^ -0 \ 1 \ from the PvuII site of Q5-5 ' did. The end of this DNA was flattened and slid by T4 DNA polymerase treatment, and a phosphate reaction was further performed to add a phosphate group to the end. This DNA fragment was subjected to a ligation reaction between the cosmid vector prepared above and a packaging reaction, followed by infection of Escherichia coli VCS-257. Cosmid DNA was extracted from the colonies that appeared, and clones containing the insert DNA were selected. Inn After the cosmid DNA containing the desert DNA was removed from the adeno, the nucleotide sequence of the insert DNA was confirmed. The clones which did not have problems were transfected into HeLa cells, and the cells were collected two days later. The recovered cells were reacted with an anti-H-2D ^d monoclonal antibody (CEDA LANE) as a primary antibody and FITC-labeled anti-mouse IgG as a secondary antibody, and analyzed using a fluorescence microscope and a flow cytometer. A clone whose fluorescence was confirmed was selected. The cosmid DNA (pAxcw / Q5-H-2D ^d ) selected in the analysis with the adeno-dropping DNA was transfected into 293, and AdZQ5-H-2D ^d was prepared and purified using a conventional method. Q5-H-2D ^d was obtained.

(2) Examination using MH134 tumor-bearing mouse

C3HZHe male mice were purchased at the age of 7 weeks, and after cultivation for one week, 210 ⁵ ] \ 1 H134 hepatoma cells were transplanted into the abdominal skin. After 5 days, at Toko filtration tumor diameter became approximately 7 mm, divided into three groups each group for 5-7 mice, purified group Ad / Q5 - H - a ^{^{2D d 3 X 1 0 9 pfu}} / 50 / l The other group received 3 × 10 ⁹ pfu / 50 II 1 of AdZAxcw similarly prepared as a negative control, and the other group received saline at the site of 501 tumors. Two days later, the administration was repeated once again. Subsequently, the tumor diameter was measured and the survival or death was confirmed.

FIG. 21 shows the results of measuring the tumor diameter. Compared with the other two groups, a significant tumor growth inhibitory effect was observed in the AdZQ5-H-2D ^d- administered group (P <0.01).

This therapeutic effect is due to the fact that non-self MHC expressed specifically in cancer cells induces an immune response in the mouth in a cancer cell-specific manner, thereby eliminating cancer cells. In other words, cancer cells are generally not recognized as non-self in vivo and are immune from exclusion by immune function. However, as mentioned above, even cancer cells express the ara antigen, which the immune system can recognize very strongly. It was thought that cancer cells would be eliminated because the immune system could recognize it as non-self. As described above, the use of the Q5 gene upstream transcriptional regulatory region can provide a gene therapy agent and a treatment method in which non-self MHC molecules are expressed in a cancer cell-specific manner. The method was expected to produce high therapeutic effects with few side effects. Furthermore, since the Q5 gene upstream transcription regulatory region can express various genes in a cancer cell-specific manner, it was considered to be applicable to various cancer gene therapy / prevention agents. Industrial applicability

The cancer cell-specific expression-inducing DNA of the present invention is a novel cancer cell-specific expression-inducing DNA that exhibits an expression-inducing activity only in undifferentiated and abnormal cells such as cancer cells. The first vector is a cancer cell-specific expression induction vector having a function of expressing a gene linked downstream in a cancer cell.

By using such DNA and vector according to the present invention, a desired protein, polypeptide or RNA can be expressed in a cancer cell-specific manner. By expressing the polypeptide, it is possible to recognize cancer cells as non-self and to eliminate the cancer cells, thereby enabling effective cancer treatment. The cancer cell-specific expression-inducing DNA and the vector according to the present invention can be suitably used for cancer treatment. Furthermore, this vector can be used to develop novel cancer gene therapy and cancer vaccines.

In addition to the treatment of cancer, it can be applied to the diagnosis of cancer, to the study of cancer cell-specific transcription factors, and to the study of inhibition of the transcription factors.

Claims

The scope of the claims

1. 5 'upstream from the transcription start site of the Q5 antigen of the mouse non-classical histocompatibility 遺伝子 protogene (MHC class Ib gene)-at least a portion of the DNA from SEQ ID NO: 2667 to +22 DNA containing.

2. The DNA according to claim 1, wherein the DNA has at least the nucleotide sequence of SEQ ID NO: 2 (from 2042 nucleotides to +22 nucleotides 5 ′ upstream from the transcription start point).

3. The DNA according to claim 1, wherein the DNA has at least the nucleotide sequence of SEQ ID NO: 3 (5 ′ upstream from the transcription start site—1414 bases to +22 bases).

4. The DNA according to claim 1, wherein the DNA has at least the nucleotide sequence of SEQ ID NO: 4 (+22 bases from the 829 base 5 ′ upstream from the transcription start point).

5. A vector containing the DNA according to any one of claims 1 to 4.

6. The vector according to claim 5, wherein the vector is an adenovirus vector.

7. A vector according to claim 5 or 6, comprising the DNA according to any one of claims 1 to 4, and a nucleotide sequence encoding a desired protein, polypeptide or RNA. .

8. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding at least a part of a non-self MHC class I molecule. Evening ''

9. The nucleotide sequence is non-self MH C Class: base pin definition ^¾ of claim 7, characterized in that the nucleotide sequence encoding at least a portion of the II molecules

10. The vector according to claim 7, wherein the nucleotide sequence is a DNA coding for cytoforce.

11. The vector according to claim 7, wherein the nucleotide sequence is a DNA encoding a cytoforce receptor.

12. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding a protein or polypeptide that induces cell death.

13. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding a costimulatory molecule.

14. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding a cancer antigen.

15. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding a tumor suppressor gene.

16. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding an antisense of an oncogene.

17. The vector according to claim 7, wherein the nucleotide sequence is a nucleotide sequence encoding a lipozyme or RNAi for an oncogene or a mutant gene.

18. A method for introducing the vector according to any one of claims 5 to 17 into a cancer cell and expressing a desired protein, polypeptide or RNA.

19. A transformant into which the vector according to any one of claims 5 to 17 has been introduced, and which can express a desired protein or polypeptide.

20. A method for inducing cytotoxic T cells (CTL) using the transformant according to claim 19.

21. A test method wherein the vector according to any one of claims 5 to 7 is introduced into a subject, and the presence or absence of expression is used to determine the presence of cancer cells.

22. A method for treatment or prevention using the vector according to any one of claims 5 to 17.

23. The method according to claim 22, which is a method for treating or preventing cancer.

24. A method for treating cancer using cytotoxic T cells (CTL) induced by the method according to claim 20.