WO2003095650A1 - Prolyl 4-hydroxylase humaine - Google Patents

Prolyl 4-hydroxylase humaine Download PDF

Info

Publication number
WO2003095650A1
WO2003095650A1 PCT/EP2003/004819 EP0304819W WO03095650A1 WO 2003095650 A1 WO2003095650 A1 WO 2003095650A1 EP 0304819 W EP0304819 W EP 0304819W WO 03095650 A1 WO03095650 A1 WO 03095650A1
Authority
WO
WIPO (PCT)
Prior art keywords
prolyl hydroxylase
polynucleotide
polypeptide
activity
test compound
Prior art date
Application number
PCT/EP2003/004819
Other languages
English (en)
Inventor
Timothy J. Smith
Original Assignee
Bayer Healthcare Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare Ag filed Critical Bayer Healthcare Ag
Priority to AU2003232735A priority Critical patent/AU2003232735A1/en
Publication of WO2003095650A1 publication Critical patent/WO2003095650A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)

Definitions

  • the invention relates to the regulation of human prolyl hydroxylase.
  • Prolyl 4-hydr ⁇ xylases comprise a family of enzymes that are involved in post- translational modification of a variety of proteins.
  • the prolyl 4-hydroxylation of procollagen has been analyzed in most detail. Hydroxylation of proline residues is a prerequisite for the folding of the newly synthesized procollagen polypeptide chain into its typical triple helical structure.
  • Active prolyl 4-hydroxylases have been described as tetramers of 2 alpha and 2 beta subunits.
  • the known beta subunit is identical to the enzyme protein disulfide isomerase (PDI).
  • PDI protein disulfide isomerase
  • Prolyl 4-hydroxylation of collagen is of crucial importance for any pathological process that is related to overproduction of collagen, such as fibrotic alterations of the liver, the heart, the lung, and the skin. Modulation of human prolyl 4-hydroxylases can be useful for the therapy of diseases characterized by fibrotic alterations (Franklin TJ. (1997) Int J
  • Prolyl 4-hydroxylation of certain nuclear factors also is implicated in the regulation of oxygen dependent gene expression.
  • the regulation of tissue oxygen supply is of crucial importance for all processes in human life.
  • the level of tissue oxygenation results from the balance between oxygen supply and oxygen consumption. This balance is exactly tuned in the healthy organism but disturbed under many pathological conditions such as pulmonary and cardiovascular diseases, which are characterized by a decrease in oxygen supply, as well as cancer and inflammations, which both are characterized by an increased demand of oxygen within the diseased tissue.
  • imbalance of tissue oxygenation is followed by modulation of the transcription rate of a multitude of genes.
  • genes include those that encode for important growth factors and hormones (e.g., vascular endothelial growth factor and erythropoietin) and many metabolic enzymes.
  • the transcriptional modulation leads, for example, to a long lasting adaptation of metabolism, growth, or regression of blood vessels and increased or decreased erythropoiesis.
  • hypoxia inducible factors All oxygen regulated genes have been turned out to be target genes for a distinct family of nuclear transcription factors which were termed hypoxia inducible factors (HIFs).
  • the oxygen regulated genes carry distinct binding sites for HLFs in their regulatory elements (i.e., promoters and enhancers) (Wenger RH, Gassmann M. (1997) Biol Chem. 378(7):609-16; " Semenza GL (1999) Annu Rev Cell Dev Biol. 15:551-78; Zhu H, Bum HF (1999) Respir Physiol. 115(2):239-47).
  • hypoxia inducible factors consist of an alpha and a beta subunit.
  • the alpha subunit which was named HIF-lbeta or ARNT, is not regulated in response to changes of tissue oxygen, the alpha subunit is unstable under normoxic or hyperoxic conditions. This is due to the rapid degradation of the constitutively translated alpha subunit via the proteasomal pathway.
  • the alpha subunit becomes ubiquitinylated via an E3 ubiquitin conjugase complex, in which the NHL tumor suppressor protein is the central adaptor protein to the alpha subunit (Ohh M, Park CW, Ivan M, Hoffman MA, Kim TY, Huang LE, Pavletich ⁇ , Chau N, Kaelin WG (2000) Nat Cell Biol. 2(7):423-7; Kondo K, Kaelin WG Jr.
  • the ubiquitin conjugase complex can only bind to the alpha subunit and initiate degradation if the alpha subunit is hydroxylated on a distinct prolme residue, which is highly conserved among HIFs. Under hypoxic conditions (low tissue oxygen), this prolyl 4-hydroxylation does not take place, and HIFs therefore become stable and can activate their target genes.
  • the prolyl 4-hydroxylase(s) involved in prolyl 4- hydroxylation of HTF-alpha have not been identified (Ivan M, Kondo K, Yang H, Kim W, Naliando J, Ohh M, Salic A, Asara JM, Lane WS, Kaelin Jr WG.(2001) Science.
  • any HIF- alpha specific prolyl 4-hydroxylase is a key oxygen sensor for the regulation of oxygen sensitive genes, such as vascular endothelial growth factor, erythropoietin, and i ⁇ OS and therefore is of crucial importance for cardiovascular, neoplastic and inflammatory diseases.
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • amino acid sequences which are at least about 98% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
  • a polynucleotide comprising the sequence of SEQ ID NO: lor 3;
  • e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a prolyl hydroxylase polypeptide.
  • Human prolyl hydroxylase comprises the amino acid sequence shown in SEQ ID NO: 2.
  • a DNA sequence harboring the coding sequence (ORF) for human prolyl hydroxylase is shown in SEQ ID NO: 1.
  • the ORF is shown in SEQ ID NO: 3.
  • ESTs are expressed in primary human renal epithelial cells, neuro- blastoma cells, melanotic melanoma, normal pigmented retinal epithelium, lung (small cell carcinoma), uterus, muscle (rhabdomyosarcoma), pooled lung and spleen, kidney (renal cell adenocarcinoma), lymph (ge ⁇ mnal center B cells), and pancreas (islets of Langerhans).
  • SEQ ID NO: 2 contains a transmembrane sequence, (amino acids 43-65). In a multiple sequence comparison the prolyl 4-hydroxylase domain in SEQ ID NO: 2 shares active site residues with other prolyl hydroxylases, such as the basement membrane-associated proteoglycan, leprecan, and the growth suppressor, GROS1. SEQ ID NO: 2 belongs to a new family of 2-oxoglutarate- and iron-dependent dioxegenases, the same superfamily that contains prolyl 4-hydroxylase. Human prolyl hydroxylase of the invention is expected to be useful for the same purposes as previously identified prolyl hydroxylase.
  • human prolyl hydroxylase is believed to be useful in therapeutic methods to treat disorders such as peripheral and central nervous system disorders, cardiovascular disorders, metabolic diseases, and genitourinary disorders. Human prolyl hydroxylase also can be used to screen for human prolyl hydroxylase activators and inhibitors.
  • One embodiment of the present invention is an expression vector containing any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a host cell containing any expression vector of the present invention.
  • Still another embodiment of the present invention is a substantially purified prolyl hydroxylase polypeptide encoded by any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a method of producing a prolyl hydroxylase polypeptide of the present invention, wherein the method comprises the following steps:
  • Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a prolyl hydroxylase polypeptide in a biological sample comprising the following steps: a. hybridizing any polynucleotide of the present invention to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and
  • Yet another embodiment of the present invention is a diagnostic kit for conducting any method of the present invention.
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a prolyl hydroxylase, comprising the steps of:
  • b detecting binding of the test compound to the prolyl hydroxylase polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a prolyl hydroxylase.
  • Still another embodiment of the present invention is a method of screening for agents which regulate the activity of a prolyl hydroxylase, comprising the steps of: a. contacting a test compound with a prolyl hydroxylase polypeptide encoded by any polynucleotide of the present invention; and
  • a test compound which increases the prolyl hydroxylase activity is identified as a potential therapeutic agent for increasing the activity of the prolyl hydroxylase
  • a test compound which decreases the prolyl hydroxylase activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the prolyl hydroxylase.
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a prolyl hydroxylase, comprising the step of:
  • test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of prolyl hydroxylase.
  • Yet another embodiment of the present invention is a method of reducing the activity of a prolyl hydroxylase, comprising the step of:
  • Still another embodiment of the present invention is a reagent that modulates the activity of a prolyl hydroxylase polypeptide or a polynucleotide wherein said reagent is identified by any methods of the present invention.
  • Even another embodiment of the present invention is a pharmaceutical composition, comprising:
  • an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier is provided.
  • Yet another embodiment of the present invention is the use of an expression vector of the present invention or a reagent of the present invention for modulating the activity of a prolyl hydroxylase in a disease, preferably a peripheral or central nervous system disorder, a cardiovascular disorder, a metabolic disease or a genitourinary disorder.
  • the invention thus provides a human prolyl hydroxylase that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
  • Human prolyl hydroxylase and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
  • Human prolyl hydroxylase polypeptides according to the invention comprise at least
  • a prolyl hydroxylase polypeptide of the invention therefore can be a portion of a prolyl hydroxylase, a full-length prolyl hydroxylase, or a fusion protein comprising all or a portion of a prolyl hydroxylase.
  • Human prolyl hydroxylase polypeptide variants that are biologically active, e.g., retain an enzymatic activity, also are prolyl hydroxylase polypeptides.
  • naturally or non-naturally occurring human prolyl hydroxylase polypeptide variants have amino acid sequences which are at least about 98 or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof. Percent identity between a putative human prolyl hydroxylase polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et ah, Bull. Math.- Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad.
  • the "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
  • the FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Set USA 55:2444(1988), and by Pearson, Meth. Enzymol. 183:63 (1990).
  • the ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score.
  • the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the
  • Needleman-Wunsch- Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:1 %7 (1974)), which allows for amino acid insertions and deletions.
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence.
  • the invention additionally, encompasses prolyl hydroxylase polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the prolyl hydroxylase polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the invention also provides chemically modified derivatives of prolyl hydroxylase polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337).
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Fusion proteins are useful for generating antibodies against prolyl hydroxylase polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human prolyl hydroxylase polypeptide. Protein affinity chromatography or library- based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human prolyl hydroxylase polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, or 331 contiguous amino acids of SEQ ID NO: 2 or of a biologically active variant, such as those described above.
  • the first polypeptide segment also can comprise full-length prolyl hydroxylase.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). .
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
  • a fusion protein also can be engineered to contain a cleavage site located between the prolyl hydroxylase polypeptide-encoding sequence and the heterologous protein sequence, so that the prolyl hydroxylase polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO: 1 in proper reading frame with nucleotides encoding the.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz
  • Species homologs of human prolyl hydroxylase polypeptide can be obtained using prolyl hydroxylase polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of prolyl hydroxylase polypeptide, and expressing the cDNAs as is known in the art.
  • a human prolyl hydroxylase polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a prolyl hydroxylase polypeptide.
  • a coding sequence for human prolyl hydroxylase is shown in SEQ ID NO: 3.
  • nucleotide sequences encoding human prolyl hydroxylase polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65,
  • prolyl hydroxylase polynucleotides 70 preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or 3 or their complements also are prolyl hydroxylase polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer .programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • species homologs, and variants of prolyl hydroxylase polynucleotides that encode biologically active prolyl hydroxylase polypeptides also are prolyl hydroxylase polynucleotides.
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or 3 or their complements also are prolyl hydroxylase polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides,
  • prolyl hydroxylase polynucleotides described above also are prolyl hydroxylase polynucleotides.
  • homologous prolyl hydroxylase polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known prolyl hydroxylase polynucleotides under stringent conditions, as is known in the art.
  • homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the prolyl hydroxylase polynucleotides disclosed herein also can . be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of prolyl hydroxylase polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et ah, J. Mol. Biol. 81, 123 (1973).
  • Variants of human prolyl hydroxylase polynucleotides or prolyl hydroxylase polynucleotides of other species can therefore be identified by hybridizing a putative homologous prolyl hydroxylase polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or 3 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to prolyl hydroxylase polynucleotides or their complements following stringent hybridization and/or wash conditions also are prolyl hydroxylase polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et ah, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated T m of the hybrid under study.
  • polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4 X SSC at 42°C, or 0.5 X SSC, 0.1% SDS at 65°C.
  • Highly stringent wash conditions include, for example, 0.2 X SSC at 65°C.
  • a human prolyl hydroxylase polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated prolyl hydroxylase polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise prolyl hydroxylase nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
  • Human prolyl hydroxylase cDNA molecules can be made with standard molecular biology techniques, using prolyl hydroxylase mRNA as a template. Human prolyl hydroxylase cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et a (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • prolyl hydroxylase polynucleotides can be synthesized.
  • the degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human prolyl hydroxylase polypeptide having, for example, an amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof. Extending polynucleotides
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et ah, Nucleic Acids Res. 16, 8186, 1988; Lagerstrom et ah, PCR Methods Applic. 1, 111-119, 1991; Parker et ah, Nucleic Acids Res. 19, 3055-3060, 1991).
  • PCR, nested primers, and PROMOTERFLNDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA
  • Human prolyl hydroxylase polypeptides can be obtained, for example, by purification from human cells, by expression of prolyl hydroxylase polynucleotides, or by direct chemical synthesis.
  • Human prolyl hydroxylase polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with prolyl hydroxylase polynucleotides.
  • a purified prolyl hydroxylase polypeptide is separated from other compounds that normally associate with the prolyl hydroxylase poly- peptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified prolyl hydroxylase polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding prolyl hydroxylase polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human prolyl hydroxylase polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. See WO 01/98340.
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed prolyl hydroxylase polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and
  • WI38 are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, NA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein. See WO 01/98340.
  • host cells which contain a human prolyl hydroxylase polynucleotide and which express a human prolyl hydroxylase polypeptide can be identified by a variety of procedures known to those of skill in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • a wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays.
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding prolyl hydroxylase polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a human prolyl hydroxylase polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA.
  • RNA polymerase such as T7, T3, or SP6.
  • RNA polymerase such as T7, T3, or SP6.
  • reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a human prolyl hydroxylase polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode prolyl hydroxylase polypeptides can be designed to contain signal sequences which direct secretion of soluble prolyl hydroxylase polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound prolyl hydroxylase polypeptide. See WO 01/98340.
  • Sequences encoding a human prolyl hydroxylase polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et ah, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et a Nucl. Acids Res. Symp. Ser. 225-232, 1980).
  • a human prolyl hydroxylase polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et ah, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer
  • prolyl hydroxylase polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule. See WO 01/98340.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter prolyl hydroxylase polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human prolyl hydroxylase polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • An antibody which specifically binds to an epitope of a human prolyl hydroxylase polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody that specifically binds to a human prolyl hydroxylase polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies that specifically bind to prolyl hydroxylase polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human prolyl hydroxylase polypeptide from solution. See WO 01/98340.
  • Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of prolyl hydroxylase gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et ah, Chem. Rev. 90, 543-583, 1990.
  • Modifications of prolyl hydroxylase gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the prolyl hydroxylase gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et ah, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin.
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et ah, U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human prolyl hydroxylase polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the prolyl hydroxylase polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et a Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et ah, EP 321,201). See WO 01/98340.
  • genes whose products interact with human prolyl hydroxylase may represent genes that are differentially expressed in disorders including, but not limited to, peripheral and central nervous system disorders, cardiovascular disorders, metabolic diseases, and genitourinary disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human prolyl hydroxylase gene or gene product may itself be tested for differential expression.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples.
  • Transcripts within the collected RNA samples that represent RNA. produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et ah, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et ah, N ⁇ twre 308, 149-53; Lee et ah, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human prolyl hydroxylase.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human prolyl hydroxylase.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human prolyl hydroxylase gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human prolyl hydroxylase polypeptide or a human prolyl hydroxylase polynucleotide.
  • a test compound preferably binds to a human prolyl hydroxylase polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See La , Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to prolyl hydroxylase polypeptides or polynucleotides or to affect prolyl hydroxylase activity or prolyl hydroxylase gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et ah, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994): The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
  • Chelsky "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995).
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel.
  • beads carrying combina- torial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the prolyl hydroxylase polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the prolyl hydroxylase polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the prolyl hydroxylase polypeptide can then be accomplished, for example, by direct counting of radio- emmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product. Alternatively, binding of a test compound to a human prolyl hydroxylase polypeptide can be determined without labeling either of the interactants.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a microphysiometer can be used to detect binding of a test compound with a human prolyl hydroxylase polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • LAPS light-addressable potentiometric sensor
  • Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human prolyl hydroxylase polypeptide (McConnell et ah, Science 257, 1906-1912, 1992).
  • Determining the ability of a test compound to bind to a human prolyl hydroxylase polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et ah, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • a human prolyl hydroxylase polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et ah, Cell 72, 223-232, 1993; Madura et ah, J. Biol. Chem.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a human prolyl hydroxylase polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g. , GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. . Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the prolyl hydroxylase polypeptide.
  • a reporter gene e.g., LacZ
  • either the prolyl hydroxylase polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human prolyl hydroxylase polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the prolyl hydroxylase polypeptide is a . fusion protein comprising a domain that allows the prolyl hydroxylase polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed prolyl hydroxylase polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • a human prolyl hydroxylase polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated prolyl hydroxylase polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies which specifically bind to a prolyl hydroxylase polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the prolyl hydroxylase polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the prolyl hydroxylase polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the prolyl hydroxylase polypeptide, and SDS gel electrophoresis under non-reducing conditions. Screening for test compounds which bind to a human prolyl hydroxylase polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a prolyl hydroxylase polypeptide or polynucleotide can be used in a cell-based assay system.
  • a prolyl hydroxylase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a prolyl hydroxylase polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human prolyl hydroxylase polypeptide.
  • Enzymatic activity can be measured, for example, as described in Kivirikko, K.T., Myllyla, T. (1982) Methods - Enzymol. 82, 245-304, or Cuncliffe, C. J., Franklin, T. J., Gaskell, R. M. (1986) Biochem. J. 240, 617-619.
  • Enzyme assays can be ' carried out after . contacting either a purified prolyl hydroxylase polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases enzymatic activity of a human prolyl hydroxylase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing prolyl hydroxylase activity.
  • a test compound which increases enzymatic activity of a human prolyl hydroxylase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human prolyl hydroxylase activity.
  • test compounds that increase or decrease prolyl hydroxylase gene expression are identified.
  • a prolyl hydroxylase polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the prolyl hydroxylase polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of prolyl hydroxylase mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human prolyl hydroxylase polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human prolyl hydroxylase polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human prolyl hydroxylase polynucleotide can be used in a cell-based assay system.
  • the prolyl hydroxylase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a human prolyl hydroxylase polypeptide, prolyl hydroxylase polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a prolyl hydroxylase polypeptide, or mimetics, activators, or inhibitors of a human prolyl hydroxylase polypeptide activity.
  • the compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human prolyl hydroxylase can be regulated to treat peripheral and central nervous system disorders, cardiovascular disorders, metabolic diseases, and genitourinary disorders.
  • peripheral and central nervous system disorders cardiovascular disorders, metabolic diseases, and genitourinary disorders.
  • the novel human prolyl hydroxylase of the invention is highly expressed in the following brain tissues: cerebellum, neuroblastoma IMR32 cells, neuroblastoma SH5Y cells, cerebellum (left), Alzheimer cerebral cortex, cerebellum (right), tonsilla cerebelli, postcentral gyrus, cerebral peduncles, vermis cerebelli, corpus callosum, spinal cord, and Alzheimer brain frontal lobe.
  • cerebellum left
  • Alzheimer cerebral cortex cerebellum
  • cerebellum right
  • tonsilla cerebelli postcentral gyrus
  • cerebral peduncles vermis cerebelli
  • corpus callosum spinal cord
  • Alzheimer brain frontal lobe The expression in brain tissues demonstrates that the novel human prolyl hydroxylase or mRNA can be utilized to diagnose nervous system diseases. Additionally the activity of the novel human prolyl hydroxylase can be modulated to treat nervous system diseases.
  • Peripheral and central nervous system disorders include, but are not limited to, brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease (including ALS), multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, and small- vessel cerebrovascular disease.
  • Dementias such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism linked to chromosome 17, frontotemporal dementias (including Pick's disease), progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld-Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoff s psychosis, also are peripheral and central nervous system disorders.
  • cognitive-related disorders such as mild cognitive impairment, age-associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities also are considered to be peripheral and central nervous system disorders.
  • Pain within the meaning of the invention, is also considered to be a peripheral and central nervous system disorder. Pain can be associated with peripheral and central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • peripheral and central nervous system disorders such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • Non-central neuropathic pain includes that associated with post mastectomy pain, phantom feeling, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIV/ AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia.
  • metabolic neuropathies e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease
  • paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralg
  • Pain is also associated with peripheral nerve damage, central pain (e.g., due to cerebral ischemia) and various chronic pain (e.g., lumbago, back pain (low back pain), inflammatory and/or rheumatic pain.
  • Headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache tension-type like headache, cluster headache, and chronic paroxysmal hemicrania also are peripheral and central nervous system disorders.
  • Visceral pain such as pancreatits, intestinal cystitis, dysmenorrhea, irritable Bowel syndrome, Crohn's disease, biliary colic, ureteral colic, myocardial infarction and pain syndromes of the pelvic cavity, e.g., vulvodynia, orchialgia, urethral syndrome and protatodynia also is a peripheral and central nervous system disorder. Also considered to be disorders of the nervous system are acute pain, for example postoperative pain, and pain after trauma.
  • the novel human prolyl hydroxylase is highly expressed in the following cardiovascular related tissues: heart ventricle (left), HUVEC cells, coronary artery smooth muscle primary cells, aorta, heart atrium (right), and heart atrium (left). Expression in the above mentioned tissues demonstrates that the novel human prolyl hydroxylase or mRNA can be utilized to diagnose of cardiovascular diseases. Additionally the activity of the novel human prolyl hydroxylase can be modulated to treat cardiovascular diseases.
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right- sided or left-sided, systolic or diastolic, independent of the underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
  • vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others).
  • the disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular isorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular isorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • the novel human prolyl hydroxylase is highly expressed in the following metabolic disease related tissues: pancreas, cirrhotic liver, adipose tissues, and pancreas.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue demonstrates that the novel human prolyl hydroxylase or mRNA can be utilized to diagnose of metabolic diseases. Additionally the activity of the novel human prolyl hydroxylase can be modulated to treat metabolic diseases.
  • Metabolic diseases are defined as conditions which result from an abnormality in any of the chemical or biochemical transformations and their regulating systems essential to producing energy, to regenerating cellular constituents, to eliminating unneeded products arising from these processes, and to regulate and maintain homeostasis in a mammal regardless of whether acquired or the result of a genetic transformation.
  • a single defective trans- formation or disturbance of its regulation may produce consequences that are narrow, involving a single body function, or broad, affecting many organs, organ-systems or the body as a whole.
  • Diseases resulting from abnormalities related to the fine and coarse mechanisms that affect each individual transformation, its rate and direction or the availability of substrates such as amino acids, fatty acids, carbohydrates, minerals, cofactors, hormones, regardless whether they are inborn or acquired, are well within the scope of the definition of a metabolic disease according to this application.
  • Metabolic diseases often are caused by single defects in particular biochemical pathways, defects that are due to the deficient activity of individual enzymes or molecular receptors leading to the regulation of such enzymes. Hence, in a broader sense, disturbances of the underlying genes, their products, and their regulation lie well within the scope of this definition of a metabolic disease. .
  • metabolic diseases may affect 1) biochemical processes and tissues ubiquitous all over the body, 2) the bone, 3) the nervous system, 4) the endocrine system, 5) the muscle including the heart, 6) the skin and nervous tissue, 7) the urogenital system, or 8) the homeostasis of body systems (e.g., water and electrolyte balance).
  • Metabolic diseases that affect biochemical processes and tissues of the body include, but are not limited to, obesity, amyloidosis, disturbances of the amino acid metabolism such as branched chain disease, hyperaminoacidemia, hyperamino- aciduria, disturbances of the metabolism of urea, hyperammonemia, mucopoly- saccharidoses, e.g.
  • Maroteaux-Lamy syndrome storage diseases such as glycogen storage diseases and lipid storage diseases, glycogenosis diseases such as Cori's disease, malabsorption diseases such as intestinal carbohydrate malabsorption, oligosaccharidase deficiency such as maltase-, lactase-, sucrase-insufficiency, disorders of the metabolism of fructose, disorders of the metabolism of galactose, galactosemia, disturbances of carbohydrate utilization such as diabetes, hypo- glycemia, disturbances of pyruvate metabolism, hypolipidemia, hypolipoproteinemia, hyperlipidemia, hyperlipoproteinemia, camitine or carnitine acyltransferase deficiency, disturbances of the porphyrin metabolism, porphyrias, disturbances of the purine metabolism, lysosomal diseases, metabolic diseases of nerves and nervous systems such as gangliosidoses, sphingolipidoses, sulfatidoses, leuc
  • Metabolic diseases that affect bone include, but are not limited . to, osteoporosis, osteomalacia such as osteoporosis, osteopenia, osteogenesis imperfecta, osteo- petrosis, osteonecrosis, Paget's disease of bone, and hypophosphatemia.
  • Metabolic diseases that affect the nervous system include, but are not limited to, cerebellar dysfunction, disturbances of brain metabolism such as dementia, Alzheimer's disease, Huntington's chorea, Parkinson's disease, Pick's disease, toxic encephalopathy, demyelinating neuropathies such as inflammatory neuropathy, Guillain-Barre syndrome.
  • Metabolic diseases that affect the endocrine system include, but are not limited to, primary and secondary metabolic disorders associated with hormonal defects, such as any disorder stemming from either a hyperfunction or hypofunction of a hormone- secreting endocrine gland and any combination thereof. These include Sipple's syndrome, pituitary gland dysfunction and its effects on other endocrine glands, such as the thyroid, adrenals, ovaries, and testes, acromegaly, hyper- and hypothyroidism, euthyroid goiter, euthyroid sick syndrome, thyroiditis, and thyroid cancer, over- or underproduction of the adrenal steroid hormones, adrenogenital syndrome, Cushing's syndrome, Addison's disease of the adrenal cortex, Addison's pernicious anemia, primary and secondary aldosteronism, diabetes insipidus , carcinoid syndrome, disturbances caused by the dysfunction of the parathyroid glands, pancreatic islet cell dysfunction, diabetes, disturbances of the endocrine
  • Metabolic diseases that affect muscle include, but are not limited to, muscle weakness, myotonia, Duchenne's and other muscular dystrophies, dystrophia myotonica of Steinert, mitochondrial myopathies such as disturbances of the catabolic metabolism in the muscle, carbohydrate and lipid storage myopathies, glycogenoses, myoglobinuria, malignant hyperthermia, polymyalgia rheumatica, dermatomyositis, primary myocardial disease, and cardiomyopathy.
  • Metabolic diseases that affect the skin and nervous tissue include, but are not limited to, disorders of the ectoderm, neurofibromatosis, scleroderma and polyarteritis, Louis-Bar syndrome, von Hippel-Lindau disease, Sturge- Weber syndrome, tuberous sclerosis, amyloidosis, and porphyria.
  • Metabolic diseases that affect the urogenital system include, but are not limited to, sexual dysfunction of the male and female.
  • Metabolic diseases that affect homeostasis include, but are not limited to, confused states and seizures due to inappropriate secretion of antidiuretic hormone from the pituitary gland, Liddle's syndrome, Bartter's syndrome, Fanconi's syndrome, renal electrolyte wasting, and diabetes insipidus.
  • the novel human prolyl hydroxylase is highly expressed in the following tissues of the genitourinary system: prostate and bladder.
  • the expression in the above mentioned tissues demonstrates that the novel human prolyl hydroxylase or mRNA can be utilized to diagnose of genitourinary disorders. Additionally the activity of the novel human prolyl hydroxylase can be modulated to treat genitourinary disorders.
  • Genitourological disorders comprise benign and malign disorders of the organs constituting the genitourological system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
  • renal diseases such as acute or chronic renal failure
  • immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulo- pathies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge
  • the novel human prolyl hydroxylase is highly expressed in the following cancer tissues: breast tumor and lung tumor.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue breast tumor and healthy tissue breast, between diseased tissue lung tumor and healthy tissue lung demonstrates that the novel human prolyl hydroxylase or mRNA can be utilized to diagnose of cancer. Additionally the activity of the novel human prolyl hydroxylase can be modulated to treat cancer.
  • Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by poorly controlled or uncontrolled multiplication of normal or abnormal cells in that tissue and its effect on the body as a whole.
  • Cancer diseases within the scope of the invention comprise benign neoplasms, dysplasias, hyperplasias as Well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer.
  • Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the surrounding healthy tissue or any other tissues of the body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
  • Cancerous cells and tissues may affect the body as a whole when causing paraneo- plastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results.
  • the ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death of the mammal affected. Cancer tends to spread, and the extent of its spread is usually related to an individual's chances of surviving the disease.
  • Cancers are generally said to be in one of three stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumour have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection. Cancer is said to be malignant because of its tendency to cause death if not treated.
  • Benign tumors usually do not cause death, although they may if they interfere with a no ⁇ nal body function by virtue of their location, size, or paraneoplastic side effects. Hence, benign tumors fall under the definition of cancer within the scope of the invention as well.
  • cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
  • Cancer tissues may express certain molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence.
  • cancer under the scope of the invention is not limited to simple benign neoplasia but includes any other benign and malign neoplasia, such as
  • carcinoma 1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tissues, 5) tumors of nerve tissues including the brain, and 6) cancer of skin cells.
  • Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the genitourinary system.
  • Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcmoma, uterine adenocarcmoma.
  • Cancers of the pavement-cell epithelium of the skin and of certain mucous membranes such as cancers of the tongue, lip, larynx, urinary bladder, uterine cervix, or penis, may be termed epidermoid or squamous-cell carcinomas of the respective tissues and are within the scope of the definition of cancer as well.
  • Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposarcoma, fibrosarcoma, and synovial sarcoma.
  • Carcinosarcoma is cancer that develops in both epithelial and connective tissue.
  • Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer .originated in the tissue where it is found rather than was established as a secondary site through metastasis from another lesion.
  • Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human prolyl hydroxylase polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects prolyl hydroxylase activity can be administered to a human cell, either in vitro or in vivo, to reduce prolyl hydroxylase activity.
  • the reagent preferably binds to an expression product of a human prolyl hydroxylase gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 nmol of liposome delivered to about 10 6 cells.
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a . cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et a Trends in Biotechnol. 11, 202-05 (1993); Chiou et ah, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et ah, J. Biol. Chem. 269, 542-46 (1994); Zenke et ah, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et ah, J. Biol. Chem. 266, 338-42 (1991).
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases enzymatic activity relative to the enzymatic activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 50 /ED 5 o.
  • compositions that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
  • Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human prolyl hydroxylase gene or the activity of a prolyl hydroxylase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human prolyl hydroxylase gene or the activity of a human prolyl hydroxylase polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to prolyl hydroxylase-specific mRNA, quantitative RT-PCR, immunologic detection of a human prolyl hydroxylase polypeptide, or measurement of enzymatic activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • Human prolyl hydroxylase also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding prolyl hydroxylase in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et ah, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et ah, Proc.
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of prolyl hydroxylase also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioi munoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 3 is inserted into the expression vector pCEN4 and the expression vector pCEN4-human prolyl 4-hydroxylase polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and prolyl 4-hydroxylase activity is assayed by a method based on the hydroxylation-coupled decarboxylation of 2-oxo[l- 14 C] glutarate. The reaction is performed in a final volume of 1.0 ml, which contains 10 ⁇ l of the cell extract,
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human prolyl hydroxylase polypeptides in yeast.
  • the prolyl hydroxylase-encoding D ⁇ A sequence is derived from SEQ ID NO: 1.
  • the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography
  • Ni-NTA-Resin Ni-NTA-Resin
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human prolyl hydroxylase polypeptide is obtained.
  • Purified prolyl hydroxylase polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human prolyl hydroxylase polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human prolyl hydroxylase polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human prolyl hydroxylase polypeptide.
  • test compound is administered to a culture of human cells transfected with a prolyl hydroxylase expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et ah, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P -labeled prolyl hydroxylase-specific probe at 65 °C in Express- hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1.
  • a test compound that decreases the prolyl hydroxylase-specific signal relative to the signal obtained in the absence of the test compound is identified as an inliibitor of prolyl hydroxylase gene expression.
  • a test compound is administered to a culture of human cells transfected with a prolyl hydroxylase expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • Enzymatic activity is measured using the method of Kivirikko, K. I., Myllyla, T. (1982) Methods Enzymol. 82, 245-304, or Cuncliffe, C. J., Franklin, T. J., Gaskell, R. M. (1986) Biochem. J. 240, 617-619.
  • a test compound which decreases the enzymatic activity of the prolyl hydroxylase relative to the enzymatic activity in the absence of the test compound is identified as an inhibitor of prolyl hydroxylase activity.
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • prolyl hydroxylase is involved in cancer
  • expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
  • Expression in the following cancer cell lines also is determined: DU- 145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung),
  • NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et ah, BioTechnology 10, 413-17, 1992, and Higuchi et ah, BioTechnology 11, 1026-30, 1993.
  • the principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
  • the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et ah, Proc.
  • the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
  • the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
  • RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
  • RNA samples 50 ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor- (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM
  • RNA is extracted once with 1 volume of phenokchloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is
  • Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy- tetramethyl-rhodamine
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking.
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature.
  • this surface is slowly but constantly heated until the animals begin to lick a hind paw.
  • the temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated. control group.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain. Compounds are tested against a vehicle treated control group.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • application routes i.v., i.p., p.o., i.t, Lev., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
  • the second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, LTTC Inc.-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and Arndt, Universitat zu K ⁇ ln, Cologne, Germany), and by scoring differences in gait (foot print patterns; FOOTPRINTS program, Klapdor et al, 1997. A low cost method to analyze footprint patterns. J. Neurosci. Methods 75, 49-54). Compounds are tested against sham operated and vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., Li, Lev., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., Li, Lev., s.c, intradermal, transdermal
  • Inflammatory Pain Inflammatory Pain is induced mainly in rats by injection of
  • the second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
  • Compounds are tested against uninflamed as well as vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing. Parkinson's disease
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic ni- grostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200 ⁇ 250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
  • Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HC1 (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol.
  • the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction.
  • the number of adjusting steps is counted for both paws in the backhand and forehand direction of movement.
  • the sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions.
  • the test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing.
  • Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
  • Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is r given for a normal forelimb placement.
  • score 1 When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine
  • DAergic mesencephalic dopaminergic
  • MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss of the tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
  • PBS pH 7.4
  • 4% paraformaldehyde Merck
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transferred to a
  • Rotarod Test We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-l . Rotamex system (Columbus Instruments,
  • Columbus, OH comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded. The system also allows a weak current to be passed through the base grid, to aid training. Dementia
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is . reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial pre- dominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours.
  • the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • the guillotine door between the compartments is lowered as soon as the. rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that of the habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is.
  • Scopolamine impairs the memory performance during the retention session 24 hours later. If the test compound increases the enter latency compared with the scopolamine-treated controls, is likely to possess cognition enhancing potential.
  • the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions. A trial is started by placing an animal into the pool, facing the wall of the tank.
  • Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first.
  • the animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds. In the probe trial, all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
  • the T-maze spontaneous alternation task The T-maze spontaneous alternation task.
  • TeMCAT assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
  • a mouse is put into the start arm at the beginning of training.
  • the guillotine door is closed.
  • the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door.
  • the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed.
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
  • Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40- 60 mg/kg i.p. for 5 consecutive days.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hypermsulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
  • Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 U/ ⁇ l) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • the novel human prolyl hydroxylase forward primer sequence was: Primerl tcaccattgctgaggctttt (SEQ ID NO: 14).
  • the novel human prolyl hydroxylase reverse primer sequence was Primer2 agaagaaggtggcttggtc (SEQ ID NO: 15).
  • Probel atcagcgcatcctcgctgcatct (SEQ TD NO: 16), labeled with FAM (carboxyfluorescein succinimidyl ester) as the reporter dye and
  • TAMRA (carboxytetramethylrhodamine) as the quencher, was used as a probe for the novel human prolyl hydroxylase.
  • the following reagents were prepared in a total of 25 ⁇ l: lx TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/ ⁇ l A pliTaq GoldTM, ' 0.01 U/ ⁇ l AmpErase, and Probel tcaccattgctgaggctttt, novel human prolyl hydroxylase forward and reverse primers each at 200 nM, 200 nM , novel human prolyl hydroxylase FAM/TAMRA-labeled probe, and 5 ⁇ l of template cDNA. Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95°C for 15 sec and annealing/extending at
  • the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
  • the CF-value (factor for threshold cycle correction) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CTHKG-values threshold cycle for housekeeping gene
  • CTHKG-mean values CTHKG-mean values
  • CTcDNA-n (CT value of the tested gene for the cDNA n) + CFcDNA-n
  • highest CTcor-cDNA-n 1 40 is defined as CTcor-cDNA [high]
  • cerebellum cerebellum
  • thyroid neuroblastoma
  • IMR32 cells pancreas liver cirrhosis, neuroblastoma SH5Y cells, pancreas, cerebellum (left), Alzheimer cerebral cortex, HEP G2 cells, heart ventricle (left), skeletal muscle, thyroid tumor, HEK 293 cells, spleen liver cirrhosis, cerebellum (right), breast tumor, salivary gland, tonsilla cerebelli , adipose, prostate, postcentral gyrus, HUNEC cells, cerebral peduncles, vermis cerebelli, liver cirrhosis, corpus callosum, fetal lung, spinal cord, cerebral cortex,- interventricular septum, occipital lobe, coronary artery smooth muscle primary cells, trachea, adrenal gland, fetal kidney, pericardium, Alzheimer brain frontal lobe, hippocampus, colon, Alzheimer brain, bladder, lung tumor, frontal lobe, testis, breast, aorta, stomach, pons, ileum, heart atrium (
  • N-MC cells prostate BPH, mammary gland, stomach tumor, placenta, fetal aorta, uterus, liver, kidney, fetal lung fibroblast cells, coronary artery sclerotic, bone marrow CD71+ cells, liver tumor, kidney tumor, spleen, fetal brain, esophagus tumor, uterus tumor, thymus, fetal liver, HeLa cells (cervix tumor), ileum tumor, coronary artery, and substantia nigra.
  • Grosl a potential growth suppressor on chromosome 1: its identity to basement membrane-associated proteoglycan, leprecan, Kaul SC, Sugihara T, Yoshida A, Nomura H, Wadhwa R, Oncogene 2000 Jul 27;19(32):3576-83.
  • DNA-repair protein AlkB, EGL-9, and leprecan define new families of 2- oxoglutarate- and iron-dependent dioxygenases, Aravind L, Koonin EV,

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne des réactifs régulant la prolyl hydroxylase humaine et des réactifs se liant à des produits géniques de la prolyl hydroxylase humaine, ces réactifs pouvant jouer un rôle dans la prévention, l'amélioration ou la correction de dysfonctionnement ou de maladies, notamment, mais sans caractère limitatif, des troubles du système nerveux périphérique et central, des troubles cardio-vasculaires, des maladies métaboliques et des troubles génito-urinaires.
PCT/EP2003/004819 2002-05-08 2003-05-08 Prolyl 4-hydroxylase humaine WO2003095650A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003232735A AU2003232735A1 (en) 2002-05-08 2003-05-08 Human prolyl 4-hydroxylase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US37841202P 2002-05-08 2002-05-08
US60/378,412 2002-05-08

Publications (1)

Publication Number Publication Date
WO2003095650A1 true WO2003095650A1 (fr) 2003-11-20

Family

ID=29420398

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/004819 WO2003095650A1 (fr) 2002-05-08 2003-05-08 Prolyl 4-hydroxylase humaine

Country Status (2)

Country Link
AU (1) AU2003232735A1 (fr)
WO (1) WO2003095650A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006048275A2 (fr) * 2004-11-04 2006-05-11 Roche Diagnostics Gmbh Etablissement d'un profil d'expression pour la leucemie lymphocytaire chronique
WO2013177478A3 (fr) * 2012-05-24 2014-01-16 Glaxosmithkline Intellectual Property (No.2) Limited Méthode de traitement

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL, HEIDELBERG, FRG [online] 1 March 2001 (2001-03-01), WATANABE, K. ET AL.: "Hypothetical protein FLJ22222", XP002253772, Database accession no. Q9H6J2 *
DATABASE EMBL, HEIDELBERG, FRG [online] 1 March 2003 (2003-03-01), STRAUSBERG, R.: "Similar to hypothetical protein FLJ22222", XP002253775, Database accession no. Q8IZ37 *
DATABASE EMBL, HEIDELBERG, FRG [online] 11 February 2001 (2001-02-11), GENOSCOPE: "human full-length cDNA 3-PRIME end of clone CS0DB003YD10 of NEUROBLASTOMA COT 10-NORMALIZED of Homo sapiens (human)", XP002253783, Database accession no. AL521814 *
DATABASE EMBL, HEIDELBERG, FRG [online] 24 September 2002 (2002-09-24), STRAUSBERG, R. ET AL.: "Homo sapiens hypothetical protein FLJ22222, mRNA (cDNA clone MGC: 22927 IMAGE: 4541555), complete cds", XP002253776, Database accession no. BC023602 *
DATABASE EMBL, HEIDELBERG, FRG [online] 29 September 2000 (2000-09-29), SUGANO, S. ET AL.: "Homo sapiens cDNA: FLJ22222 fis, clone HRC01658", XP002253773, Database accession no. AK025875 *
VUORELA, A. ET A.: "Assembly of human prolyl 4-hydroxylase and type III collagen in the yeast Pichia pastoris: formation of a stable enzyme tetramer requires coexpression with collagen and assembly of a stable collagen requires coexpression with prolyl 4-hydroxylase", EMBO JOURNAL, vol. 16, no. 22, 17 November 1997 (1997-11-17), pages 6702 - 6712, XP002153732 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006048275A2 (fr) * 2004-11-04 2006-05-11 Roche Diagnostics Gmbh Etablissement d'un profil d'expression pour la leucemie lymphocytaire chronique
WO2006048275A3 (fr) * 2004-11-04 2006-07-20 Roche Diagnostics Gmbh Etablissement d'un profil d'expression pour la leucemie lymphocytaire chronique
WO2013177478A3 (fr) * 2012-05-24 2014-01-16 Glaxosmithkline Intellectual Property (No.2) Limited Méthode de traitement

Also Published As

Publication number Publication date
AU2003232735A1 (en) 2003-11-11

Similar Documents

Publication Publication Date Title
US20070117142A1 (en) Regulation of novel human asparagine-hydroxylases
WO2002072824A2 (fr) Regulation du canal potentiel humain du recepteur transitoire humain
US7129077B2 (en) Regulation of human aminopeptidase N
US20040253669A1 (en) Regulation of human dcamkl1-like serine/threonine protein kinase
WO2003095650A1 (fr) Prolyl 4-hydroxylase humaine
US7205135B2 (en) Regulation of human adenylate cyclase
US20040171006A1 (en) Regulation of human prostaglandin-f synthase 1-like protein
WO2002088363A2 (fr) Regulation de nouvelles prolyl 4-hydroxylases humaines
WO2003046165A1 (fr) Régulation de la protéine humaine de type aldose réductase
WO2003064470A2 (fr) Regulation de la proteine du canal de potassium humain active par calcium
US20040235094A1 (en) Regulation of human ptpase-like protein
WO2003070927A1 (fr) Regulation de la gtpase humaine
WO2003055909A1 (fr) Regulation de la proteine humaine de liaison des acides gras
WO2002048326A2 (fr) Regulation de la calpaine humaine
WO2002097074A2 (fr) Regulation de l'enzyme de type proteine phosphatase 2c humaine
WO2003106667A2 (fr) Regulation d'une serine protease de type subtilase humaine
WO2002055681A2 (fr) Regulation de la tau-tubuline kinase humaine
WO2003050280A1 (fr) Regulation d'une proteine de liaison aux acides gras d'origine humaine
US20040096865A1 (en) Regulation of human tyrosine-specific protein phosphatase
WO2004007728A1 (fr) Regulation de la tripeptidyl peptidase ii humaine
WO2003076609A1 (fr) Proteine associee au gene rhomboide
WO2003066862A1 (fr) Clonage d'une proteine humaine de type prolylhydroxylase
WO2003025174A2 (fr) Regulation de la proteine humaine de type mrp1
WO2003093466A1 (fr) Proteine humaine associee au rhomboide
WO2003046164A1 (fr) Regulation de la propyl-4-hydroxylase humaine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP