WO2003094973A1

WO2003094973A1 - Agent and method for transporting biologically active molecules in cells

Info

Publication number: WO2003094973A1
Application number: PCT/EP2003/004833
Authority: WO
Inventors: Tobias Restle; Laurent Chaloin
Original assignee: MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date: 2002-05-08
Filing date: 2003-05-08
Publication date: 2003-11-20
Also published as: AU2003233310A1

Abstract

The invention relates to a complex comprising carrier peptide and a nucleic acid. The complex is characterized in that the carrier peptide is a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the nucleus localization sequence of SV 40 T-antigen, wherein the domains are connected to one another by a linker and the nucleic acid is a functional nucleic acid selected from the group consisting of the aptamers, aptazymes, ribozymes and spiegelmers.

Description

Means and methods for the transport of biologically active molecules in cells

The present invention relates to a complex comprising a carrier peptide and a nucleic acid, their use and methods for transporting a functional nucleic acid across a cytoplasmic membrane, methods for transforming cells, methods for identifying and / or validating target molecules and compositions comprising such complexes.

With the development of new active substances based on antibodies, target molecule-binding peptides and functional oligonucleotides, the availability of systems for the administration of such active substances in cells is becoming increasingly important, on the one hand in the size of the active substances and on the other hand in their target molecules or target structures and the mechanism of action of these active ingredients is justified.

Methods for importing biologically active molecules into cells are known in the prior art. For example, US Pat. No. 5,807,746 describes the use of signal peptides to introduce molecules bound to them into cells. U.S. Patent 5,929,042 teaches the use of the Antennapedia polypeptide for this purpose.

However, these methods have in common that they are subject to restrictions with regard to the type of connections to be transported. These restrictions are all the more serious against degradation with regard to nucleic acids which have to be introduced into cells with high efficiency, i.e. must be stabilized and, due to their primary structure, have to take on defined secondary and tertiary structures that enable them to bind specifically to their target molecules. Such nucleic acids are, for example, aptamers and Spiegelmers.

The production of apta eres is described, for example, in European patent EP 0 533 835. There, the so-called SELEX method (systematic evolution of ligands by exponential enrichment) is taught in more detail. With the help of SELEX technology, a large number of aptamers were isolated against different target molecules. An overview can be found, for example, in Gold et al. (Annu. Ev. Biochem, 1995, 64, 763-797). Another form of nucleic acids binding target molecules are the so-called Spiegelmers. Spiegelmers differ from the aptamers consisting of D nucleotides in that they are composed of L nucleotides. As a result of this structure, it is ensured that the nucleases occurring in natural systems such as biological fluids, both exonucleases and endonucleases, cannot degrade these nucleic acids, which leads to an increased half-life, for example in an organism to which such Spiegelmers have been administered. The method for producing such Spiegelmers is described in the international patent application with the publication number WO 98/08856.

The present invention was therefore based on the object of providing an agent which allows nucleic acids, in particular functional nucleic acids, to be introduced into cells.

According to the invention, the object is achieved in a first aspect by a complex comprising a carrier peptide and a nucleic acid, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the Domains are preferably connected to one another by a linker, and the nucleic acid is a functional nucleic acid which is selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers.

In one embodiment it is provided that the carrier protein has an amino acid sequence according to SEQ ID NO. 1 or SEQ ID NO. 2 has.

In a further embodiment it is provided that the stoichiometric ratio of carrier peptide to functional nucleic acid is approximately 25,000: 1 to 5: 1, preferably 500: 1 to 5: 1, more preferably approximately 250: 1 to 5: 1.

An alternative embodiment provides that the charge ratio between positive charges of the carrier peptide and negative charges of the nucleic acid is approximately 50: 1 to 1: 1, preferably 20: 1 to 1: 1, preferably approximately 10: 1 to 1: 1 preferably 5: 1.

A further alternative embodiment provides that the stoichiometric mixing ratio of carrier peptide to functional nucleic acid is approximately 50: 1, preferably approximately 10: 1. In one embodiment it is provided that the bond between the carrier peptide and functional nucleic acid in the complex is a non-covalent bond.

In an alternative embodiment it is provided that in the complex the bond between carrier peptide and functional nucleic acid is a covalent bond.

In a second aspect, the object is achieved according to the invention by using a complex according to the invention for transfection, in particular stabilized transfection, a cell with a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes and Spiegelmers.

In one embodiment it is provided that the cell is selected from the group comprising eukaryotic cells.

In a preferred embodiment it is provided that the eukaryotic cell is selected from the group comprising the cells of humans, monkeys, mice, rats, rabbits, dogs, pigs, cats and guinea pigs.

In a third aspect, the object is achieved according to the invention by the use of a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the domains preferably being linked to one another are connected for transfection, in particular for the stabilized transfection of a cell with a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers.

In a fourth aspect, the object is achieved according to the invention by methods for transporting a functional nucleic acid over a biological membrane comprising the steps

a) providing a biological membrane, in particular a cell with a cytoplasmic membrane, b) providing a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers,

c) providing a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the domains preferably being connected to one another by a linker, and

d) applying a mixture of the functional nucleic acid and the carrier peptide and / or a complex according to the invention to the biological membrane.

In a fifth aspect, the object is achieved according to the invention by methods for transfection, in particular stabilized transfection, of a cell with a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers, comprising the steps

a) providing a cell,

b) providing a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers,

d) contacting the cell with the functional nucleic acid and the carrier peptide.

In one embodiment of the two aforementioned aspects of the invention, it is provided that the stoichiometric ratio of carrier peptide to functional nucleic acid is from approximately 25,000: 1 to 5: 1, preferably 500: 1 to 5: 1, more preferably approximately 250: 1 to 5 : 1 is or the charge ratio between positive charges of the carrier peptide and negative charges of the nucleic acid is about 50: 1 to 1: 1, preferably 20: 1 to 1: 1, more preferably about 10: 1 to 1: 1, even more preferably 5: 1.

In one embodiment of the two aforementioned aspects of the invention, it is provided that the charge ratio between positive charges of the carrier peptide and negative charges of the nucleic acid is approximately 50: 1 to 1: 1, preferably 20: 1 to 1: 1, preferably approximately 10: 1 to 1 : 1 is.

In a further embodiment of the two aforementioned aspects of the invention, it is provided that the stoichiometric mixing ratio of carrier peptide to functional nucleic acid is approximately 50: 1, preferably approximately 10: 1.

In yet another embodiment of the two aforementioned aspects of the invention it is provided that the contacting takes place at a temperature of approximately 4 ° C. to approximately 40 ° C., more preferably approximately 20 ° C. to approximately 37 ° C. he follows.

In one embodiment of the two aforementioned aspects of the invention, the contacting takes place for about 15 to about 120 minutes, preferably for about 30 to 40 minutes.

In one embodiment of the two aforementioned aspects of the invention it is provided that the functional nucleic acid is located in the cytoplasm and / or in the cell nucleus.

In a further embodiment of the two aforementioned aspects of the invention, it is provided that the functional nucleic acid is directed against a target molecule, the target molecule being selected from the group comprising intracellular and nuclear target molecules.

In a sixth aspect, the object is achieved according to the invention by a method for identifying and / or validating a target molecule, in particular an intracellular target molecule, comprising the following steps

a) providing a system which contains a target molecule and / or contains a candidate target molecule, b) providing a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers,

d) Determine whether the phenotype of the system changes under the influence of the functional nucleic acid.

In one embodiment it is provided that the system in step a) is a cell, in particular a eukaryotic cell.

In a preferred embodiment it is provided that the functional nucleic acid from step b) is a library of functional nucleic acids.

In one embodiment it is provided that the library of functional nucleic acids contains a range from 10 ² to 10 ¹⁸ , preferably 10 ⁵ to 10 ¹⁶ and preferably 10 ¹³ to 10 ¹⁵ different functional nucleic acids.

In a seventh aspect, the object is achieved according to the invention by a composition comprising a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers, and a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the nuclear localization sequence of SV 40 is T antigen, the domains preferably being connected to one another by a linker, and / or a complex according to one of claims 1 to 7.

In one embodiment it is provided that the composition is for the detection and / or diagnosis of the target molecule against which the functional nucleic acid is directed. In an eighth aspect, the object is achieved according to the invention by a pharmaceutical composition comprising a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, Ribozmye and Spiegelmere and a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T-antigen, the domains preferably being connected to one another by a linker, and / or a complex according to the invention and at least one pharmaceutically acceptable carrier.

One embodiment provides that it is used to treat a disease, the disease being prevented and / or treatable by influencing the activity and / or the function of the target molecule against which the functional nucleic acid is directed.

In one embodiment of the composition according to the invention it is provided that the composition influences the replication and / or multiplication of viruses, preferably inhibits the replication and / or multiplication of viruses.

In one embodiment of the pharmaceutical composition according to the invention it is provided that the pharmaceutical composition is for the treatment and / or prevention of viral diseases.

In one embodiment of the pharmaceutical composition according to the invention it is provided that the target molecule of the functional nucleic acid is a molecule which is part of the virus particle or the virus.

In a further embodiment of the pharmaceutical composition according to the invention it is provided that the target molecule of the functional nucleic acid is a molecule which is transferred by the virus from a first infected cell to a second infected cell.

In a preferred embodiment of the pharmaceutical composition according to the invention it is provided that the target molecule of the functional nucleic acid is a molecule which is transferred by the virus from a first infected cell to a second infected cell and the functional nucleic acid is bound to its target molecule in the virus, which leads to a reduction in the infectiousness of the virus particle.

In a particularly preferred embodiment of the pharmaceutical composition according to the invention it is provided that the virus is HIV.

The present invention is based on the surprising finding that it is possible to use a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen to inject functional nucleic acids, such as aptamers and Spiegelmers Introduce cells and preferably in eukaryotic cells. Such carrier peptides are generally referred to herein as carrier peptides. A particularly preferred form is the carrier peptide with the amino acid sequence according to SEQ. DD. No. 1. The fact that functional nucleic acids are complex three-dimensional structures that they need for the specific interaction with their target molecules is particularly surprising. The structures formed by functional nucleic acids can also include Watson-Crick base pairings, in particular within the functional nucleic acid itself to form, for example, parent structures, but the interaction with the target molecule typically takes place through hydrophobic interactions, hydrogen bonds, Coulomb interactions and combinations of such Bonds or interactions. Without wishing to be bound below, the present inventors assume that there is an interaction between the functional nucleic acid and the carrier peptide at least during transport or passage across the membrane and the interaction the ability of the functional nucleic acid that is responsible for binding to take - again - the complex spatial structure required for the target molecule, not adversely affected.

With the use of the carrier peptide, the intrinsic permeability of functional nucleic acids is extremely increased, so that the overcoming of a biological membrane such as a cytoplasmic membrane, for example when introducing a functional nucleic acid into a cell, preferably into a eukaryotic cell, with its hydrophobicity and charge specificity and additional enzymatic barriers of the cell surface no longer play a decisive role. This makes it possible to reliably introduce stabilized functional nucleic acids, which are regularly highly effective in vitro, but which, as a rule, evade effective in vivo application due to the above-mentioned restrictions, thus opening up the potential of functional Realize nucleic acids in the fields of analysis, diagnostics and therapy. The carrier peptide, in combination with the functional nucleic acids, moreover satisfies the requirements for a drug delivery system. It is biocompatible and biodegradable, it has no intrinsic toxicity, it shows no accumulation in the body, it has adequate functional groups for chemical fixation, and it maintains the biological activity of the substance to be transported until it reaches the target molecule. ^■

In addition to the high effectiveness of the carrier peptide in overcoming biological membranes and thus, for example, in transferring functional nucleic acids from a first compartment to a second compartment, the first and the second compartment being separated from one another by a biological membrane, the carrier peptide has a protective function for the functional nucleic acid in the sense that it protects it from degradation by nucleases. To this extent, the methods disclosed herein for the transport of functional nucleic acids across biological membranes can also be used to protect functional nucleic acids against degradation processes, such as those mediated by nucleases.

As used herein, the term carrier peptide refers to a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen. The fusion peptide has a total of 27 amino acids and is described, for example, by Morris et al., 1997 [NAR, 25 (14), 2730-2736]. The amino acid sequence of a carrier peptide falling under this definition is the carrier peptide also referred to in the literature as MPG, which reads as follows:

GALFLGFLGAAGSTMGA-WSQP-KSKRKV (SEQ ID NO.1).

Another embodiment of the fusion peptide used according to the invention is that with the amino acid sequence according to SEQ ID NO. 2: GALFLGFLGAAGSTMGA-WSQP-KLKRKV (SEQ ID NO.2).

In both embodiments of the fusion peptide used according to the invention it is provided in a further preferred embodiment that it has the modification Ac at the N-terminus and the modification -NH-CH ₂ -CH -SH at the C-terminus.

The sequence WSQP acts as a linker.

As used herein, the term carrier peptide also includes the derivatives of the general and specifically defined carrier peptides mentioned above. A derivative is thus a carrier peptide which differs from the carrier peptides described here, for example in its structure as a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the domains preferably being via a linker, in particular a linker made of a polypeptide, are connected to one another. However, the difference of the derivative can also be in a different amino acid sequence, in particular compared to the amino acid sequences according to SEQ. ID. No. 1 or SEQ. ID. No. 2, be justified. In any case, a derivative should be considered a derivative of the carrier peptides described herein if it has the property or ability to transfer a functional nucleic acid across a biological membrane like the carrier peptide.

The interaction between the carrier peptide and the functional nucleic acid can be covalent in nature or non-covalent in nature. It is preferred that the interaction is non-covalent in nature and based on hydrophobic interactions, ionic interactions and / or Coulomb interactions, ionic interactions seem to make up the majority of the bond.

The transport of functional nucleic acids across biological membranes, for example the cytoplasmic membrane of cells, takes place very effectively and in a very short time using the carrier peptide. The mechanism underlying the uptake in cells, for example, seems to be the non-dosomal mechanism.

A conformational rearrangement in the peptide seems to be involved, whereby the linker seems to have a certain importance in this context. self Association through intermolecular beta sheets proved to be an important feature to interpret the ability of the carrier peptides for a translocation. Studies using Fourier transform infrared spectroscopy (FTIR) and circular dichroism spectroscopy (CD) were carried out. The carrier peptides used according to the invention can assume both alpha-helical and beta-sheet conformational states. CD and NMR spectroscopy were used to examine the secondary structures of the peptides in "membrane-mimicking" media, such as trifluoroethanol and sodium dodecyl micelles, in the presence of negatively charged and neutral liposomes. While the peptides predominantly contained an alpha -helical structure, intermolecular beta sheets were observed in the presence of the liposomes, and in the case of the primary amphiphatic vectors, these beta sheet structures were made as large-sized filamentous particles by AFM observations on transferred monolayers.

It is within the scope of the present invention that a covalent bond is formed between the functional nucleic acid and the carrier peptide. The SH group introduced by the modification of the carrier peptides is particularly suitable for this, preferably with the formation of an SS bridge.

Functional nucleic acids, as used herein, refer to such nucleic acids, i.e. H. Polynucleotides that specifically bind a target molecule. Examples of such functional nucleic acids are aptamers, aptazymes, Spiegelmers, ribozymes, antisense oligonucleotides, RNAi and siRNA. The oligonucleotides can be those which are composed of D nucleotides or L nucleotides or both. The nucleic acids can be single-stranded or double-stranded. It is further within the scope of the present invention that the nucleic acids have a modification to one or more of the nucleotides that make them up. The modification can relate to the base portion, the ribose portion or the phosphate portion of the nucleotides forming them.

Modified nucleic acids can be, for example, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-ioduracil, hypoxanthine, xanthine, ethenoadenosine, 4-acetylcytosine, 5-

(Carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thio-uridine, 5-carboxymethylaminomethyluracil, dihydrouracil, ß-D-galactosylqueosine, J-nosin, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine -Methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-ethylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7- Methyl guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, ß-D-mannosylqueosine, 5 '-methoxycarbonylmethyluraciL, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl acetate, uracil-5-methoxyacetate , Queosin, 3-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, 3 (3-amino-3-N -2-carboxypropyl) uracil and 2,6-diaminopurine.

In a further embodiment of the nucleic acids according to the invention it is provided that it carries at least one modification or label at the 5 'and / or 3' end, the modification and / or label preferably being selected from the group comprising the biotin group; the digoxygenin group; Fluorescent dyes, especially fluorescein and rhodamine; psoralen; Thiol group (s), amino group (s), ethylene glycol group (s) - or cholesteryl group (s) comprises.

In a still further embodiment of the nucleic acids according to the invention it is provided that the modified connecting group is selected from the group consisting of phosphomono- or phosphodithioates, alkylphosphonates, arylphosphonates, phosphoroamidates, phosphate triesters, preferably P (O) -alkyl derivatives; Linking groups in which oxygen atoms in the bridge between the sugars formed by the phosphate group are replaced by other bonds, preferably NH, CH ₂ or SP compounds, more preferably 3'-NHP (O) - (O ^" ) O-5 'phosphoramidates; dephosphointernucleotide compounds, preferably acetamidate, carbamate compounds or peptide nucleic acids (PNA).

In one embodiment of the nucleic acids according to the invention it is provided that the modified sugar residue is selected from the group consisting of 2'-azido-2'-deoxy, 2'-amino-2'-deoxy, 2'-fluoro-2'- Deoxy, 2'-chloro-2'-deoxy, 2'-O-methyl, 2'-O-allyl, 2'-C-fluoromethyl groups and / or modifications.

In a preferred embodiment of the nucleic acids according to the invention it is provided that the nucleic acid is stabilized. In a particularly preferred embodiment it is provided that at least one cytidine residue by a 2'-amino-2'-deoxycytidine or a 2'-fluoro-2'-deoxycytidine and / or at least one uridine residue by a 2'-amino-2'- deoxyuridine or a 2'-fluoro-2'-deoxyuridine is replaced. Modifications of nucleic acid are well known to the person skilled in the art and are described, for example, in Eaton, BE (1997), Curr. Opin. Chem. Biol. 1: 10-16. It will also be appreciated that the present invention is generally applicable to functional nucleic acids and is not limited to a specific nucleic acid determined by its nucleic acid sequence or a specifically modified nucleic acid.

The synthesis of the nucleic acids as described herein is known to those skilled in the art. The manufacture, d. H. Selection or generation of such functional nucleic acids is also known to those skilled in the art and is described, for example, for aptamers in EP 0 533 838 and for Spiegelmers in WO 98/08856.

Another form of the functional nucleic acids that can be used according to the invention are so-called aptazymes. Aptazymes are described, for example, by Piganeau N. et al. (2000), Angew. Chem. Int. Ed. 39, No. 29, pages 4369 - 4373. This is a specific form of aptamers which are distinguished by the fact that, in addition to the portion of the apmer that specifically binds to the target molecule, they also contain a portion of ribozyme with the result that that after binding of the aptamer portion of the aptazyme to the target molecule, the ribozyme portion is activated or deactivated in another embodiment and, as a result, activation or inhibition of cleavage of a nucleic acid which acts as a substrate of the ribozyme portion of the aptazyme occurs. With a corresponding design of the ribozyme substrate, a change in the fluorescence due to a change in the spatial arrangement of a fluorescence donor relative to a fluorescence acceptor on the ribozyme substrate can be observed, for example. In this respect, aptazymes are particularly suitable for use in the context of target validation or target identification and the determination of the interaction partners of the target molecule against which the functional nucleic acid is directed, and as an analytical or diagnostic agent within the meaning of the present invention, but are not limited to this.

Ribozymes also interact specifically with a target molecule, but here the interaction is mediated by base pairing, in particular Watson-Crick base pairing. For the catalytic activity of ribozymes, the formation of a functional secondary and tertiary structure predetermined by the primary sequence is as important as for aptamers and their binding competence. Ribozymes are known to those skilled in the art and are described, for example, with regard to the construction and functional principles in Do- herty and Doudna (Ribozyme Structures and Mechanism. Annu. Rev. Biophys Biomol Struct 2001, 30: 457-75).

Antisense oligonucleotides, which interact with nucleic acid target molecules by a mechanism similar to that of ribozymes, are also known to those skilled in the art. Such antisense oligonucleotides are described, for example, in US Pat. Nos. 5,849,902 and 5,989,912 and represent functional nucleic acids in the sense of the present invention for the various aspects.

Another class of functional nucleic acids are short interfering ribonucleic acids, which are also referred to as RNAi. This is a double-stranded RNA with a preferred length of 21 to 23 nucleotides, which in the special case is also referred to as siRNA (small interfering RNA) due to its small size, although shorter or longer polynucleotides are also fundamentally suitable are. With regard to its use for target validation or as a diagnostic and therapeutic agent, RNAi is described, for example, in international patent applications WO 00/44895 and WO 01/75164.

When the complex according to the invention was formed from the carrier peptide with the functional nucleic acid described in Example 2, an aptamer, it was found that the stoichiometry of the carrier peptide to functional nucleic acid can be approximately 10: 1. However, there are also mixing ratios in the context of the present invention in which a stoichiometric ratio of 50: 1 (carrier peptide: functional nucleic acid) occurs.

In a further preferred embodiment of the complex according to the invention, the complex can be characterized by the ratio of the charges, ie the ratio of the negative charge of the nucleic acid to positive charges of the peptide. The charge ratio can be from approximately 50: 1 to 1: 1, preferably approximately 20: 1 to 1: 1, preferably approximately 10: 1 to 1: 1. A ratio of 5: 1 appears to be most preferred. If one adjusts to the stoichiometric conditions in the complex itself, the length of the nucleic acid to be transported is of central importance. In this case, the ratio of carrier peptide to functional nucleic acid can be about 25,000: 1 to 5: 1, preferably about 500: 1 to 5: 1, more preferably about 250: 1 to 5: 1. The present system consisting of carrier peptide and functional nucleic acid can be used to overcome biological membranes such as the cytoplasmic membrane of cells. In addition, it can also be used to overcome cellular membranes other than the cytoplasmic membrane, such as, for example, the membranes of cell organelles, such as the cell nucleus and the like. It is also within the scope of the present invention that the carrier peptide mediates the transfer of functional nucleic acids into the cell nucleus.

The question of the location of the functional nucleic acid transferred by the carrier peptide depends on the binding constant of the complex of carrier peptide and functional nucleic acid as well as on the respective ratio of carrier peptide to functional nucleic acid. Typical binding constants for the complex according to the invention are 5 to 50 nM, preferably approximately 15 to 30 nM and preferably approximately 20 nM. In this respect, a higher mixing ratio with the resulting lower stability of the complex can be used in a targeted manner for the localization of the functional nucleic acid after transport by the carrier molecule.

There are basically no restrictions with regard to the biological membranes used or used in the various aspects of the present invention to carry out or detect a carrier peptide-mediated transport of functional nucleic acid. In this context, the biological membrane is preferably understood to mean a two-layer phospholipid membrane (phosphobilayer). It is within the scope of the present invention that such biological membranes can also be technical membranes, as long as they have a structure that is fundamentally comparable to that of the biological membrane.

A biological membrane is understood to mean, in particular, those that occur in prokaryotic and eukaryotic cells. Accordingly, prokaryotic and / or eukaryotic cells are those cells which, according to the various aspects of the present invention, can be used to effect or carry out a carrier peptide-mediated transport of functional nucleic acids. The eukaryotic cells include in particular animal and plant, but also fungal cells. In the case of animal cells, those cells which are derived from mammals are particularly preferred. The mammals are preferably humans, monkeys, mice, rats, rabbits, pigs, guinea pigs, dogs and cats. According to the invention, the carrier peptide can be used together with a functional nucleic acid or the complex of both, also for the transfection and / or transformation of corresponding cells. This means that diverse applications in modern biotechnology and medicine that are basically possible with functional nucleic acids can actually be effectively implemented. It is a known phenomenon that when applied in vivo, ie in cellular systems, functional nucleic acids can only be effectively introduced into the cells under often comparatively unphysiological and toxic conditions. Such effects occur, for example, in the methods known to the person skilled in the art, such as lipofection with cationic lipids or electroporation. Therefore, the desired effect, which is mediated by the functional nucleic acids, is often overlaid by unspecific, toxic effects. Furthermore, the introduction of the functional nucleic acids by carrier peptides according to the invention is distinguished by a substantially higher efficiency even in the case of cell lines which are difficult to transfect.

A further advantage is that the functional nucleic acid is stabilized in the complex by the carrier peptide and is thus protected from, in particular, nucleolytic attacks, with the result that the functional nucleic acid has an increased half-life in such systems and the effect of the functional nucleic acid therefore lasts longer.

In a particularly preferred embodiment, the transfection is a stabilized transfection. Stabilized transfection should be understood to mean one in which the effect mediated by the functional nucleic acid is maintained at least to a certain extent over at least one generation, preferably two or more generations. Up to the present time, the use of functional nucleic acids has only allowed effects that result from the interaction of the functional nucleic acids with their target molecules to be maintained only for a generally short part of the cell's cell cycle. It has now surprisingly been found that the combination of carrier peptide and functional nucleic acid or the complex formed therefrom is present in cells for significantly longer and the functional nucleic acid is functionally active than in other systems. It was quite surprising to find that even after cell division had taken place, the effects mediated by the functional nucleic acids could still be observed in the cells to come. The use of the carrier peptide according to the invention in combination with functional nucleic acids thus provides an effective full alternative to the use of stabilized functional nucleic acids, which are often associated with cytotoxic effects, such as phosphorothioate-modified antisense oligonucleotides. In the various methods according to the invention, a biological membrane is provided in a manner known to those skilled in the art. Typically, this will be done by presenting cells as described herein. These cells are usually present in a buffer solution, preferably in a nutrient solution. Like the functional nucleic acid, the carrier peptide is preferably present in a solution, preferably in a buffer solution.

Contacting the components, i. H. the biological membrane, the functional nucleic acid and the carrier peptide are typically carried out in a reaction vessel. The order of addition of the individual components, either individually or mixed, is irrelevant for the execution of the method according to the invention. Preference is given to mixing the nucleic acid with the carrier peptide before mixing the complex with the biological membranes. With regard to the incubation conditions, it has proven to be particularly advantageous if the incubation is carried out at a temperature of about 25 ° C. to about 37 ° C. Another parameter relevant to incubation, in particular as an alternative to the stoichiometric ratio described above, is the ratio of the charges as outlined above, which should be based on this framework and in particular should be greater than about 5: 1.

The cells to be transfected in the various methods according to the invention are preferably in a state of growth, in particular in a state of active cell division.

The time period in which the biological membrane is brought into contact with the carrier peptide and the functional nucleic acid is about 15 to about 120 minutes, preferably about 30 to 40 minutes. A particularly preferred alternative incubation time is a period of about 120 minutes. It was found that the functional nucleic acid in the presence of the carrier peptide is able to achieve a transfection rate of more than 90% within less than an hour.

With regard to the target molecules against which the functional nucleic acid can be directed, there are in principle no in particular with aptamers, aptazymes and Spiegelmers restrictions. It is known to those skilled in the art that such functional nucleic acids can in principle be generated against virtually any molecule.

The various measures fundamentally discussed in connection with this and the individual methods in particular can also be used to identify and / or validate a target molecule.

In this method according to the invention, the target molecule is preferably an intracellular target molecule. The system which contains the target molecule to be identified, as well as the system which contains the target molecule to be validated, is preferably a cell, as described herein. If target molecules are identified using the carrier peptide according to the invention in conjunction with functional nucleic acids, it is not known in certain embodiments which target molecules are present individually or as a whole in the system. Accordingly, in these cases a library of functional nucleic acids, which due to their primary sequence interact or can interact with different target molecules, is fed into the system. As a rule, the system is then characterized phenotypically and those - functional - nucleic acids are determined that are directly or indirectly involved in the formation of the changed phenotype. The changed phenotype can express itself through the acquisition of additional properties or the loss of properties inherent in the system, i. H. Properties that the system showed before the functional nucleic acid was introduced into the system. For the use according to the invention of functional nucleic acids together with the carrier peptide for the purpose of identifying a target molecule, libraries of functional nucleic acids can be used as are known to those skilled in the art and are described, for example, in European patent application EP 0 533 838. It is remarkable that in this context functional nucleic acids also include those nucleic acids from which it is not known or not necessarily known whether they actually bind to a target molecule. These functional nucleic acids are therefore candidate functional nucleic acids.

Methods to determine how the phenotype of a system has changed are known to those skilled in the art. Changes can be expressed either directly or indirectly, preferably morphologically and / or biochemically. The combination of carrier peptide and functional nucleic acid according to the invention, be it as a mixture or as a complex, can in principle also be used for analytical, diagnostic and therapeutic purposes. In the case of analytical or diagnostic use, the said composition can preferably be used for the detection or diagnosis of the molecule against which the respective functional nucleic acid is directed.

Due to the excellent transfection properties of the combination of carrier peptide and functional nucleic acid according to the invention, intracellular detection is particularly preferred. If the functional nucleic acid is detected, it can be marked. Suitable markings are known to those skilled in the art. Such labels can be, for example, radioactive and non-radioactive labels, such as fluorescent labels. The detection can be done on living or prepared cells, tissues or organs. Even detection in an organism is within the scope of the present invention. The labeling methods can also be used to enable differentiated detection in the sense of the detection of the target molecule in a specific compartment.

It is also within the scope of the present invention that the carrier peptide and a functional nucleic acid form a pharmaceutical composition. As used generally herein, the term functional nucleic acid, i. H. a functional nucleic acid a single functional nucleic acid as well as several, d. H. a large number of functional nucleic acids, which can be nucleic acids of the same class as functional nucleic acids of different classes. Classes of functional nucleic acids are, for example, aptamers, aptazymes, Spiegelmers, antisense oligonucleotides, ribozymes and RNAi. The combination of different classes of functional nucleic acids can be associated with surprising effects, in particular because they are based on different mechanisms of action. The same also applies to the use of the carrier peptide and a functional nucleic acid for the various purposes disclosed herein, in particular for therapeutic use.

A pharmaceutical composition according to the invention, as used herein, is also a medicament which comprises the carrier peptide and at least one functional nucleic acid. The diseases for which the combination of carrier peptide and functional nucleic acid or a complex formed therefrom can be used are in principle not described here. limits. The means described above can be used to address those diseases, disorders or conditions in which the target molecule is changed in its activity, its presence and or concentration by the nucleic acid according to the invention. Both an increase and a decrease in the above parameters can be caused by the functional nucleic acid according to the invention and, depending on the involvement of the target molecule in the mechanisms on which the diseases, conditions and disorders are based, a change thereof can be brought about.

In one embodiment, both of the inventive composition as well as the pharmaceutical composition of the invention or in the inventive use ^"of the complex according to the invention or the inventive use of the carrier peptide with a functional nucleic acid for preparing a medicament may be provided that these or this proliferation and / or replication of a virus, as used herein, in a preferred embodiment means that the multiplication and / or replication of the virus is reduced or inhibited, in particular the pharmaceutical composition is then suitable for the therapy of viral diseases, including the Prevention of the same. This also applies in principle to the compositions according to the invention. Due to the basic suitability of virtually all viral molecules to serve as target molecules against the functional nucleic acids, Accordingly, all viral diseases can be treated according to the invention with the agents described above or treated preventively. It is particularly preferred if the target molecule is a virus molecule for the various aspects of the invention. However, it is also within the scope of the present invention that the target molecule is a molecule which does not originate from the virus, but from the respective host cell in which the virus is contained or multiplies or replicates, and this molecule is involved in the multiplication and / or replication of the virus is involved

In a particularly preferred embodiment, the target molecule of the functional nucleic acids is one which is transferred from the virus from a first cell in which it has replicated or has reproduced to a second cell and this molecule for the replication and / or multiplication of the Virus is significant, that is, for example, by blocking or at least functionally inactivating the said molecule, replication and / or multiplication of the virus is no longer possible or is at least reduced. The molecule thus transferred from the virus can be one that was originally derived from the cellular background. background of the first cell. However, it is also possible for the said molecule itself to be a molecule encoded by the virus. An example of a viral molecule which can be used as a target molecule for the composition, pharmaceutical composition or the medicament in the sense described above is in the case of retroviruses, such as, for example, the HI virus, reverse transcriptase. The present inventors have found that, for example, functional nucleic acids directed against the reverse transcriptase of the HI virus, such as, for example, aptamers, in particular if these bind with a high affinity to the target molecule, together during the transition of the virus from a first cell into a second cell can be transferred with their target molecule and there can influence the viral activity, in particular the replication and / or the multiplication of the virus. This not only inhibits the replication of the virus itself, but the virus particles still formed are less infectious due to the nucleic acid inhibitor carried along.

The invention is now further explained below with reference to the figures and examples from which further features, embodiments and advantages result.

It shows

1A shows an intrinsic fluorescence titration curve of the carrier peptide at a concentration of the carrier peptide of 5 μM as a function of increasing amounts of an ap- tamer as a functional nucleic acid,

2 shows the chromatogram of a gel filtration analysis,

3 A, B and C fluorescence micrographs to demonstrate the colocalization of functional nucleic acid and target molecule thereof,

4 shows an autoradiography which demonstrates the protective influence of the carrier peptide,

5 shows the result of a cytotoxicity study,

6A shows the schematic sequence of an experiment for inhibiting HIV replication, 6B shows a diagram with the RT activity as a function of the time after infection as a result of the experiment shown in FIG. 6A,

7 HeLa cells (human cervix adenocarcinoma, human cervix adenocarcinomas, epithelial cells, 5 × 10 ⁴ cells per cover slip, 24-well format): A + B: cell control in the FITC filter or DAPI filter, C + D : 4μM MPG + 0.4μM 5'FAM-FLOl-DNA (18mer), C: FITC filter, D: DAPI filter,

8 Cos7 cells (african green monkey kidney cells (fibroblast-like cells), 2 × 10 ⁴ cells per well (96-well format): A + B cell control in the FITC filter or Dapi filter, C + D: 8μM MPG + 0.4μM 5'FAM-FLOl-DNA (18mer), C: FITC filter, D: DAPI filter,

9 HS68 cells (primary human foreskin fibroblasts, primary human foreskin fibroblasts), 5 × 10 ³ cells per well (96-well format): A + B cell control: A: FITC, B: DAPI, C + D : 8μM MPG + 0.4μM 5'FAM-FLOl, C: FITC filter, D: DAPI filter,

10 Jurkat cells (human T cell leukemia, 3 × 10 ⁴ cells per well (96-well format): A + B cell control: A: Cy5 filter, B: DAPI filter, C + D: 6μM MPG + 0.3μM 5'CY5-DNA-19mer, C: CY5 filter, D: DAPI filter, and

11 HeLa cells (human cervix adenocarcinoma, human cervix adenocarcinomas, epithelial cells): A: 5μM MPG + 0, lμM 5'HEX pseudo-knot RNA (33mer), B cell control: green filter. Example 1: Materials and methods used here

In vitro RNA preparation

The pseudoknot RNA aptamer (sequence: 5'-

GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA) with a length of 33 nucleotides was prepared in a standard T7 reaction mixture for in vitro transcription in 10 ml and purified by gel electrophoresis. The RNAs were refolded at a concentration of 200 to 300 μM at 65 ° C. for 5 minutes, followed by slow cooling to room temperature in 20 mM cacodylate buffer pH 6.5, 25 mM NaCl and 5 mM MgCl ₂ . The labeling of the RNA at the 5 'end with T4 polynucleotide kinase (New England Biolabs) was carried out according to known techniques. Dephosphorylation of the in vitro transcribed RNA prior to final labeling was carried out according to standard procedures. The fluorescence-labeled 5'-hexachlorofluorescein (HEX) pseudo-knot RNA was synthesized and purified by HPLC. HEX phosphoramidite was obtained from Glen Research (Sterling, VA). The final purity was> 97% as measured by HPLC.

protein purification

Recombinant heterodimeric wild-type HIV was expressed and purified in E. coli. The enzyme concentration was routinely determined using an extinction coefficient at 280 mM of 260450 M ^"1 cm ^'1. The purified reverse transcriptase was free from nuclease contamination.

fluorescence experiments

Fluorescence titrations were performed using an SLM AB2 Spectro-fluorometer at 25 ° C in a buffer containing 50 mM Tris-HCl, pH 8, 50 mM KC1, 1 mM DTT and 10 mM MgCl ₂ . The intrinsic fluorescence from MPG was routinely excited at 290 nm and the emission spectrum between 310 and 400 nm recorded with a spectral bandpass of 2 nm for excitation and emission. A fixed concentration of MPG (5 μM) was titrated with increasing amounts of pseudo-node RNA. Extrinsic fluorescence measurements were made by titrating a fixed concentration of 5'-HEX pseudo-node RNA (100 nM) using increasing amounts of MPG. To the To monitor fluorescence changes after binding MPG to 5'-HEX-RNA, samples were excited at 538 nm and the emission intensity measured at 556 nm. The titration curves were adjusted using a quadratic equation and dissociation constants (K _D ) with a molar ratio of MPG / RNA of 20/1 were calculated using the graphite program (Erithacus Software).

HPLC size exclusion chromatography

The pseudo-node RNA (1 nanomole) was incubated at room temperature for 15 minutes with MPG (10 nanomol) in a buffer containing NaH ₂ PO ₄ 50 nM pH = 6.8, NaCl 150 mM. The resulting MPG / RNA complexes were applied to an HPLC size exclusion column (Superdex 200 HR10 / 30) at a flow rate of 1 ml / min and eluted with the same buffer. The molecular weight was estimated using the calibration curve made with standard proteins.

Removal ZSchutztest

The radiolabelled RNA, either in its free form or in the presence of MPG, was used to determine its stability against degradation. MPG / RNA complexes were formed at room temperature by mixing an equal amount of MPG (2 μM in PBS) and radioactive RNA (0.1 μM in DEPC-treated water), resulting in a final molar ratio of 20/1. The free form of RNA and pre-formed MPG / RNA complexes were incubated for 24 hours in the presence of cell culture medium with or without fetal calf serum (10%). For tests to test degradation by RNAseA, all samples were incubated for one hour at 37 ° C with different concentrations of RNAasA (0.5, 2 and 8 ng). The samples were analyzed directly by acrylamide gel electrophoresis (20%) and then displayed by phosphor imager (Biorad).

cell culture

The adherent human fibroblasts (Hs-68) were obtained from the American Type Culture Collection (ATCC). DMEM, PBS, fetal calf serum, glutamine and antibiotics were purchased from Life Technologies Inc. The cells were in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 1% glutamine (200 mM), 1% antibiotics (streptomycin 10,000 μg / ml, penicillin, 10,000 IU / ml) and 10% (w / v) fetal calf serum at 37 ° C in a humid atmosphere with 5% CO ₂ .

Zytotoxicität

In order to define the potential cytotoxicity of the pseudoknot RNA and the MPG / RNA complexes, Hs-68 cells with a concentration range between 0.1 μM and 0.1 mM RNA or RNA complexed were incubated on MPG. The culture medium with RNA or MPG / RNA was not changed and the cell proliferation was measured over four days. The cytotoxicity was carried out using the colorimetric 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT) test after removing the cell culture medium and replacing it with phosphate-buffered saline containing 5 mg / ml MTT. After dissolving the corresponding converted MTT in formazan with isopropanol, quantification was achieved by measuring the OD at 570 nm.

Polymerase RT test of RT expressing cells

Hs68 cells were transfected with a pcDNA3 vector expressing the p66 subunit of RT using the lipofectAMINE ™ reagent according to the manufacturer's instructions (Life Technologies Inc.). This cellular model of the p66 homodimer is expressed as well as the p66 / p51 heterodimer. After two days of treatment with inhibitors, cellular proteins were isolated by incubation in 100 μl of passive lysis buffer (Promega) at room temperature for one hour. 70 µl of the lysate was used for the RNA-dependent DNA polymerase activity and 30 µl was used for the determination of the total protein contents using a commercial BCA kit reagent (purchased from Pierce). The polymerase activity was measured in standard tests using poly (rA) / oligo (dT) ι _2- ι ₅ as a substrate with the addition of 5 μM actinomycin D (Sigma), which acts as an inhibitor for cellular DNA RNA polymerases, but not for the reverse transcriptase under these conditions.

fluorescence microscopy

Briefly, cells were plated on glass coverslips and grown to confluence of 75%, then overlaid with fluorescent RNA or MPG / RNA complexes in DMEM (10/1 molar ratio) and incubated for various periods of time. The deck vials were then washed off extensively with PBS and the cells fixed with a 10 minute solution containing 2% formaldehyde and 0.2% glutaraldehyde in PBS and then rehydrated in PBS containing Hoechst 33258 to blue stain the cell nuclei to effect. Studies of cellular localization with either RNA or RT and also for the colocalization of both partners were first transiently transfected with the pcDNA3 vector which encoded RT as described above. After 36 hours, the cells were incubated with the fluorescent hex-RNA (0.1 μM) in the presence or absence of MPG (1 μM) for 30 minutes at 37 ° C., washed extensively with PBS and in for one hour in the presence of growth medium Leave culture. The cells were fixed as described above and incubated for 45 minutes with a mouse monoclonal antibody that specifically targeted both subunits of RT (p66 and p51). This antibody was then detected using a FITC-conjugated anti-mouse antibody (developed in goat, Sigma).

The cells were visualized at the CRBM / IFR 24 Integrated Imaging Facility. A DMR B microscope (Leica, Germany) was used with a PL APO 40 x objective, NA 1.00 (Zeiss, Germany) and the illumination was provided by a 100 W HBO 103 W / 2 lamp (OSRAM, Germany). The epifluorescence image was produced using an A4 (Hoechst) or an L5 (fluoresein) or N 2.1 (rhodamine) filter cube. The visual representations obtained in this way were recorded using an ORCA 100 (B / W) 10-bit cooled CCD camera.

Antiviral properties

The CD4 + lymphoblastoid CEM cell line was obtained from the American Type Culture Collection (ATCC). The cells were divided into RPMI 1640 medium, which was subdivided with 10% fetal calf serum, 1% Glutamax and 1% penicillin-streptomycin-antibiotic mixture (Life Technologies Inc.), to a density of 5 × 10 ⁵ cells / ml in a 5th % CO ₂ atmosphere cultivated. For the infection, 10 ⁶ CEM cells were incubated for 30 minutes at 4 ° C. with 100 μl fflV-l _LA ι at a concentration of 100 TCID ₅₀ . The cells were then washed five times and cultured at 5 x 10 ⁵ cells / ml in 24 microplates with various concentrations of RNA and MPG / RNA (2μM to 0.5 nM), AZT (10μM), which were added directly to the growth medium , Viral production was monitored twice a week by measuring the reverse transcriptase activity in 1 ml of cell-free supernatant and each time the cell number was adjusted to 5 10 ⁵ cells / ml with fresh growth medium and inhibitors. Example 2: Biochemical characterization of the complex carrier peptide and functional nucleic acid

The complex characterized and disclosed herein, which was also used in the examples below, is one composed of an RNA aptamer directed against HIV reverse transcriptase, as described by Kensch at al., 2000, reference IBC 275 (24 ) 18271-18278 and the Trägerφeptide, which is also referred to herein as MPG.

The result of the intrinsic fluorescence curve of the carrier phage (5 μM) is shown in FIG. 1. As can be seen from FIG. 2, the fluorescence of the tryptophan is greatly reduced under the influence of the binding of the aptamer to the carrier peptide. The evaluation of the experimental data showed a K _D of approx. 25 nM for the complex of functional nucleic acid and carrier peptide.

The retention time of the complex corresponds approximately to a molecular weight of 40 KDa, which can be assigned to a complex of aptamer / MPG in a molar ratio of approximately 1:10. Under changed mixing ratios between carrier phage and functional nucleic acids, complexes of up to 50 (carrier pheptide): 1 (functional nucleic acid) can also be observed. However, these complexes are less stable under the chosen conditions.

Example 3: Carrier peptide mediated uptake of the functional nucleic acid in human fibroblasts - detection of colocalization

FIG. 3 shows the sequence of the carrier peptide used in the upper region, the amino acid positions 1 to 17 going back to the HIV-1 gp 41 and the amino acid positions 21 to 27 going back to the hydrophilic domain of the SV 40 T antigen.

FIG. 3A shows the distribution of the fluorescence-labeled functional nucleic acid in human fibroblasts after uptake by mediated mediation. Carrier peptide and functional nucleic acids mixed in a ratio of 10: 1, incubated for 30 minutes at room temperature and then mixed with culture medium. The cells in the culture dishes were overlaid with this solution for about 30 to 60 minutes. After about another hour, the cells were examined microscopically.

Figure 3B shows human fibroblasts transformed with a vector encoding HIV-1 reverse transcriptase. The distribution of the recombinant protein was analyzed using a monoclonal antibody.

FIG. 3 C shows the superimposition of FIGS. 3 A and 3 B and clearly shows a colocalization of functional nucleic acid and target molecule, ie. H. Reverse transcriptase.

Example 4: Protection of the functional nucleic acid from nucleolytic degradation

The proof that the functional nucleic acid is protected from nucleolytic degradation by the carrier peptide is shown in FIG. 4. This is an autoradiography of radioactively labeled functional nucleic acid under various incubation conditions in the presence and absence of the carrier peptide. The aptamer is a so-called pseudo-node RNA. If the aptamer is incubated in cell culture medium that also contains fetal calf serum (5%), a complete breakdown of the nucleic acid can be observed (lane 3). This nucleolytic breakdown of the functional nucleic acid is strongly suppressed under the identical incubation conditions, but in the presence of the inert protein (10-fold molar excess) (lane 8). A similar effect is observed when recombinant RNAses are added.

Example 5: Cytotoxicity studies

The result of the cytotoxicity studies is shown in FIG. 5, which shows the survival rate of human lymphocytes as a function of the concentrations of the functional nucleic acid, the carrier peptide or the complex daily peptide / functional nucleic acid. The concentration data relate to the concentration in the culture supernatant. It can be assumed that the actual intracellular concentration is much higher. The survival rate of the Cells were identified 4 days after the addition of the various substances using the MTT (3- (4,5-dimethythiazol-2-yl) -2,5-diphenyltetrazolium bromide) test. No cytotoxic effect could be observed under the selected conditions up to a concentration of 100 μM inert phage / functional nucleic acid.

Example 6: Inhibition of HIV Replication

In a further example, the inhibition of HIV replication in CEM-T cells after carrier-mediated uptake of the aptamer was examined. The result is shown in FIG. 6B under the experimental procedure shown schematically in FIG. 6A.

The basic sequence of the experiment shown is shown schematically in FIG. 6A. Human T lymphocytes (CEM T cells) were incubated with HI viruses for approx. 30 min. Then the aptamer and the Trägerφeptide were added. In contrast to the procedure described in Example 2, the substances were added directly to the culture medium. Virus replication was determined every four days via the reverse transcriptase activity in the culture supernatant. For this purpose, the viruses in the cell-free supernatant (approx. 1 ml) were pelleted from the medium by ultracentrifugation. The removed medium was then replaced by new culture medium. In this step inhibitor, i.e. H. the complex of functional nucleic acid and carrier phage added. In the presence of 2μM MPG / Apamer (10: 1; based on the aptamer), no virus replication was observed over a period of 21 days. This means that with the addition of aptamer in conjunction with the carrier peptide there is a complete inhibition of virus replication. The application of the aptamer alone has no effect. In the case of HIV-2 infection of the cells, no inhibition is observed either, according to the in vitro data.

Example 7: Transfection of adherent and suspension cell lines.

Adherent cells (HeLa, Cos-7, HS68) were plated 24 hours before the transfection experiment on round coverslips in multi-well plates or on slides with wells. To produce the transfection mixtures, MPG and fluorescence-labeled oligonucleotides were each mixed in cell culture medium, both components being individually diluted in half the volume of medium in order to avoid undesired aggregations. After a preincubation time of 5-30 min, the transfection mixture was added to the cells previously washed with PBS and incubated for 30 min to 3 h at 37 ° C in the breast cabinet.

Washing, fixing and dyeing were carried out according to the following scheme:

- wash 2x with PBS,

- Wash Ix with PBS / 0.1% Tween 20

- Wash 2x with PBS

- Fix with PBS / 3.7% formaldehyde, 15 min room temperature

- Staining of the nuclei with DAPI: 0.05 μg / ml in PBS, 5 min room temperature

- Wash with distilled water

- embed

For the suspension cells (Jurkat), the slides had to be coated with fibronectin in order to enable the cells to be adsorbed onto the substrate.

Coating slides with fibronectin:

- 50 μl / well fibronectin (10 μg / ml in H ₂ O), 1 h at 37 ° C

- 50 μl / well BSA (2 mg / ml in PBS), 2 h at 37 ° C

- washing with PBS

The transfection mixtures were prepared in Eppendorf tubes and the Jurkat cells suspended in them. Only after the incubation period were 50 .mu.l of the transfection suspension dropped onto the fibronectin-coated slides (96-well format).

The following adsorption protocol for suspension cells was used: adsorption of the cells for 30 min at 37 ° C. fixation with 1% formaldehyde in PBS at 4 ° C. overnight Dapi staining (see above)

Fig. 7 (HeLa cells), Fig. 8 (Cos-7 cells), Fig. 9 (HS68 cells), Fig. 10 (Jurkat cells) and Fig. 11 (HeLa cells) show fluorescence microscopic images of the transfected cells, which were made with DNA or RNA oligonucleotides of different fluorescent labels (FAM, CY5, HEX at the 5 'or 3' end) in the different cell types. To identify the cells, the cell nuclei were stained with the fluorescent dye DAPI. The staining of the cells in the presence of MPG and fluorescence-labeled oligonucleotides can be clearly seen. The FITC filter was used for FAM-labeled oligonucleotides, and a special filter set matched to CY5 was used for CY5. The core staining was documented in the DAPI filter.

According to the results of the fluorescence microscopic investigations, the MPG carrier phage is able to transport oligonucleotides very efficiently into the cell. By simply combining MPG and fluorescent oligonucleotides in cell culture medium and overlaying the cells with this transfection mixture for approx. 30 min - 3 h, the oligonucleotides can be transferred into the cells. The oligonucleotides reach the cell nucleus. However, co-localization of aptamers with cytoplasmic target proteins was also observed. The results indicate an optimal concentration of MPG between 4 - 8 μM. With a molar ratio of 1:10 - 1:20 (nucleic acid / MPG), corresponding to oligonucleotide concentrations of 0.2 μM - 0.8 μM (determined for 19-20mers), good results can be achieved. An RNA oligonucleotide (33mer) was also successfully transported in HeLa nuclei. The pre-incubation period for the formation of the carge / carrier complex is not essential. There were no significant differences in incubation times between 1 and 30 minutes. Similar results were also achieved in Cos7 cells and HS68 cells. The transfectability of cells which are considered difficult to transfect in the prior art and primary cells is also possible using the techniques and means described herein.

With the system disclosed herein, both DNA and RNA oligonucleotides of different lengths such as 15-100 nucleotides or 15 to 50 nucleotides up to plasmids can be transfected. Therefore, MPG is suitable for a wide range of applications such as B. suitable for the transport of antisense RNA, siRNA, ribozymes, aptazymes, Spiegelmeres or aptamers. After mixing MPG (4 - 10 μM final concentration) with the desired oligonucleotide, the cells are overlaid with the mixture and the oligonucleotides reach the cell nucleus in less than 1 h, cytoplasmic localization also being observed, depending on the target protein. The cell lines tested and described herein include HeLa, Cos7, HS68, 293-T, CEM-T, Jurkat and primary hepatocytes. The trans infection efficiency is generally greater than 90%, ie> 90% of the cells considered are transfected.

The features of the invention disclosed in the preceding description, the claims and the drawings can be essential both individually and in any combination for realizing the invention in its various embodiments.

Claims

Expectations

1. Complex comprising a carrier peptide and a nucleic acid, characterized in that the carrier peptide is a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the domains being preferably linked to one another by a linker , and the nucleic acid is a functional nucleic acid that is selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers.

2. Complex according to claim 1, characterized in that the Trägerφrotein an amino acid sequence according to SEQ ID NO. 1 or SEQ ID NO. 2 has.

3. Complex according to claim 1 or 2, characterized in that the stoichiometric ratio of carrier phage to functional nucleic acid is about 25,000: 1 to 5: 1, preferably 500: 1 to 5: 1, more preferably about 250: 1 to 5: 1 is.

4. Complex according to claim 1 or 2, characterized in that the charge ratio between positive charges of the carrier phage and negative charges of the nucleic acid about 50: 1 to 1: 1, preferably 20: 1 to 1: 1, preferably about 10: 1 to 1 : 1, more preferably 5: 1.

5. Complex according to claim 1 or 2, characterized in that the stoichiometric mixing ratio of carrier phage to functional nucleic acid is about 50: 1, preferably about 10: 1.

6. Complex according to one of claims 1 to 5, characterized in that in the complex, the bond between the carrier phage and functional nucleic acid is a non-covalent bond.

7. Complex according to one of claims 1 to 5, characterized in that in the complex the bond between the carrier phage and functional nucleic acid is a covalent bond.

8. Use of a complex according to one of claims 1 to 7 for transfection, in particular stabilized transfection, of a cell with a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes and Spiegelmers.

9. Use according to claim 8, characterized in that the cell is selected from the group comprising and eukaryotic cells.

10. Use according to claim 9, characterized in that the eukaryotic cell is selected from the group comprising the cells of humans, monkeys, mice, rats, rabbits, dogs, pigs, cats and guinea pigs.

11. Use of a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the domains preferably being connected to one another by a linker, for transfection, in particular for stabilizing Transfection of a cell with a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers.

12. A method for transporting a functional nucleic acid across a biological membrane comprising the steps

a) providing a biological membrane, in particular a cell with a cytoplasmic membrane,

c) Provision of a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of The core localization sequence of SV 40 is T antigen, the domains preferably being connected to one another by a linker, and

d) applying a mixture of the functional nucleic acid and the carrier peptide and / or a complex according to any one of claims 1 to 7 to the biological membrane.

13. A method for transfection, in particular stabilized transfection, of a cell with a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers, comprising the steps

a) providing a cell,

14. The method according to claim 12 or 13, characterized in that the stoichiometric ratio of carrier phage to functional nucleic acid of about 25,000: 1 to 5: 1, preferably 500: 1 to 5: 1, more preferably about 250: 1 to 5: 1 or the charge ratio between positive charges of the carrier phage and negative charges of the nucleic acid is about 50: 1 to 1: 1, preferably 20: 1 to 1: 1, more preferably about 10: 1 to 1: 1, more preferably 5: 1 ,

15. The method according to any one of claims 12 to 14, characterized in that the charge ratio between positive charges of the carrier phage and negative charges of the nucleic acid about 50: 1 to 1: 1, preferably 20: 1 to 1: 1, preferably about 10: 1 is up to 1: 1.

16. The method according to any one of claims 12 to 15, characterized in that the stoichiometric mixing ratio of carrier phage to functional nucleic acid is about 50: 1, preferably about 10: 1.

17. The method according to any one of claims 12 to 16, characterized in that the contacting takes place at a temperature of about 4 ° C to about 40 ° C, more preferably about 20 ° C to about 37 ° C.

18. The method according to any one of claims 12 to 17, characterized in that the contacting takes place for about 15 to about 120 minutes, preferably for about 30 to 40 minutes.

19. The method according to any one of claims 12 to 18, characterized in that the functional nucleic acid is located in the cytoplasm and / or in the cell nucleus.

20. The method according to any one of claims 12 to 19, characterized in that the functional nucleic acid is directed against a target molecule, the target molecule being selected from the group comprising intracellular and nuclear target molecules.

21. A method for identifying and / or validating a target molecule, in particular an intracellular target molecule, comprising the following steps

a) providing a system which contains a target molecule and / or contains a candidate target molecule,

b) providing a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers, c) providing a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of the core localization sequence of SV 40 T antigen, the domains preferably being connected to one another by a linker, and

22. The method according to claim 21, characterized in that the system in step a) is a cell, in particular a eukaryotic cell.

23. The method according to claim 21 or 22, characterized in that the functional nucleic acid from step b) is a library of functional nucleic acids.

24. The method according to any one of claims 21 to 23, characterized in that the library of functional nucleic acids contains a range of 10 ² to 10 ¹⁸ , preferably 10 ⁵ to 10 ¹⁶ and preferably 10 ¹³ to 10 ¹⁵ different functional nucleic acids.

25. A composition comprising a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, ribozymes and Spiegelmers, and a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of The core localization sequence of SV 40 is T antigen, the domains preferably being connected to one another by a linker, and / or a complex according to one of claims 1 to 7.

26. The composition according to claim 25, characterized in that the composition for the detection and / or diagnosis of the target molecule against which the functional nucleic acid is directed.

27. Pharmaceutical composition comprising a functional nucleic acid, the functional nucleic acid being selected from the group comprising aptamers, aptazymes, Ribozmye and Spiegelmere and a carrier peptide, the carrier peptide being a fusion peptide from the hydrophobic domain of HIV gp 41 and a hydrophilic domain of Core localization sequence of SV 40 is T antigen, with the domains preferred are linked together by a linker, and / or a complex according to any one of claims 1 to 7 and at least one pharmaceutically acceptable carrier.

28. Pharmaceutical composition according to claim 27, characterized in that it is used for the treatment of a disease, the disease being prevented and / or treatable by influencing the activity and / or the function of the target molecule against which the functional nucleic acid is directed.

29. Composition according to one of the preceding claims, characterized in that the composition influences the replication and / or multiplication of viruses, preferably inhibits the replication and / or multiplication of viruses.

30. Pharmaceutical composition according to one of the preceding claims, characterized in that the pharmaceutical composition is for the treatment and / or prevention of viral diseases.

31. Pharmaceutical composition according to claim 30, characterized in that the target molecule of the functional nucleic acid is a molecule which is part of the virus particle or the virus.

32. Pharmaceutical composition according to claim 30 or 31, characterized in that the target molecule of the functional nucleic acid is a molecule which is transferred by the virus from a first infected cell into a second infected cell.

33. Pharmaceutical composition according to claim 32, characterized in that the target molecule of the functional nucleic acid is a molecule which is transferred from the virus from a first infected cell to a second infected cell and the functional nucleic acid is bound to its target molecule in the virus, which is what leads to a reduction in the fructosity of the virus particle.

34. Pharmaceutical composition according to one of the preceding claims, characterized in that the virus is HIV.