WO2003093473A1

WO2003093473A1 - A multimeric self-cleaving ribozyme construct

Info

Publication number: WO2003093473A1
Application number: PCT/IB2003/001659
Authority: WO
Inventors: Patrick Arbuthnot; Marc Weinberg
Original assignee: Patrick Arbuthnot; Marc Weinberg
Priority date: 2002-04-30
Filing date: 2003-04-30
Publication date: 2003-11-13
Also published as: AU2003230047A1

Abstract

The invention relates to the inhibition of viral gene expression. More specifically, the invention relates to a multimeric self-cleaving ribozyme construct, which includes a plurality of operably linked self-cleaving monomeric units wherein said monomeric units include at least one first monomeric unit and at least one second monomeric unit. The first and second monomeric units include a first ribozyme and a second ribozyme respectively having trans-cleavage specificity, with the ribozymes functioning both in cis and in trans and having catalytic domains and antisense domains. The ribozymes have cis target recognition sequences including ribozyme cleavage sites recognizable by the antisense domains, wherein the cis target recognition sequences are the same as or similar to target recognition sequences of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage sites and which are recognizable by said antisense domains.

Description

A ULTIMERIC SELF-CLEAVING RIBOZYME CONSTRUCT

THIS INVENTION relates to the inhibition of viral gene expression. More specifically, this invention relates to a method of inhibiting Hepatitis B Virus synthesis and a hammerhead ribozyme and hammerhead ribozyme construct for use in the method.

Chronic Hepatitis B Virus (HBV) infection is a major global cause of illness and mortality and annually accounts for 1.2 million deaths. Chronic infection with HBV is endemic to sub-Saharan Africa, East and South East Asia and the Western Pacific Islands. According to the World Health Organisation, 2 billion people worldwide have been infected with HBV and there are more than 350 million chronic carriers and as many as 40% of these will develop liver cancer (hepatocellular carcinoma (HCC)) and/or cirrhosis as complications. Despite the availability of effective vaccines, the control and treatment of HBV is largely ineffective. New methods of treating HBV are urgently required to manage and combat this disease. The HBV X open reading frame (ORF) encodes a multifunctional 17 kDa protein, HBx, which is required for the establishment of viral infection and is also implicated in hepatocarcinogenesis (Tiollais, Pourcel et al. 1985; Chen, Kaneko et al. 1993; Zoulim, Saputelli et al. 1994).

The HBV X open reading frame (ORF) encodes a multifunctional 17 kDa protein, HBx, which is required for the establishment of viral infection and is also implicated in hepatocarcinogenesis (Tiollais, Pourcel et al. 1985; Chen, Kaneko et al. 1993; Zoulim, Saputelli et al. 1994).

Ribozymes are ribonucleic acid (RNA) molecules that exhibit both antisense binding and catalytic properties. Ribozymes can be designed to cleave naturally occurring RNA transcripts in trans and thereby to inhibit gene expression in a highly specific manner. Ribozymes and antisense molecules are thus examples of hybridising nucleic acid sequences that can be tailored to inhibit expression of specific genes. However, unlike antisense sequences, ribozymes act enzymatically and a single ribozyme is theoretically able to catalyse the irreversible inactivation of multiple substrate molecules (Thomson, Tuschl et al. 1997).

Hammerhead ribozymes are the smallest catalytic RNA molecules that exhibit both antisense binding and catalytic properties and have been used to inhibit the function of target genes. These ribozymes typically comprise a small catalytic core (helix II) and 5' and 3' double- stranded regions (helix I and helix III, respectively).

Functional hammerhead ribozymes can be designed to target foreign sequences in trans by generating RNA molecules with complementary sequences in the helix I and helix III regions that flank the helix II catalytic core. The only sequence constraint in the target RNA is the presence of a cleavable 5' NUH 3' motif (where N represents any nucleotide and H represents C, U or A) (Usman and Stuchcomb 1996). The most common natural cleavage triplet is 5' GUC 3', which is also the site that is most efficiently cleaved by trans-acting hammerhead ribozymes (Shimayama, Nishikawa et al. 1995).

The efficiency of ribozyme action in the complex intracellular environment is difficult to predict. In vitro cleavage experiments do not always yield results that are applicable in vivo, as numerous factors govern RNA-RNA interactions in the intracellular physiological environment. Endogenous ribozymes that target HBV in an intracellular context appear less effective than when studied in vitro. Thus, the development of endogenously expressed ribozymes is often guided empirically by assessing the functional inhibition of target genes and gene products (Usman and Stuchcomb 1996; Thomson, Tuschl et al. 1997).

Terms used herein have their art-recognized meaning unless otherwise indicated. As used herein,

RIBOZYME

An enzyme that has an RNA sequence (including derivatives with modified nucleotides) that is essential for its catalytic function.

Ribozyme cleavage in cis

Endonucleolytic cleavage of RNA that occurs when the ribozyme components are derived from a single RNA molecule (intramolecular endonucleolytic cleavage). Ribozyme cleavage in trans

Endonucleolytic cleavage of RNA that occurs when the ribozyme components are derived from two RNA molecules (intermolecular endonucleolytic cleavage).

MONOMERIC UNIT

A nucleic acid sequence that encodes a ribozyme together with cognate target for cis cleavage.

MULTIMERIC CASSETTE

A tandem arrangement of monomeric units.

IN VITRO

An experiment performed in vitro is one that is undertaken outside of a multicellular living organism and may be conducted in silico or in cell culture.

According to one aspect of the invention there is provided a multimeric self-cleaving ribozyme construct, which includes a plurality of operably linked self-cleaving monomeric units wherein said monomeric units include: a first ribozyme or part thereof having a first fraπs-cleavage specificity, the ribozyme or part thereof functioning both in cis and in trans and including a catalytic domain and an antisense domain; a second ribozyme or part thereof having a second /ra/7s-c!eavage specificity, the further ribozyme or part thereof functioning in cis and in trans and including a catalytic domain and an antisense domain; and each of said first and second ribozymes having a different cis target recognition sequence including a ribozyme cleavage site recognizable by the antisense domain of the first and second ribozymes or parts thereof, wherein the cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which contains said ribozyme cleavage site and is recognizable by said antisense domain.

According to a further aspect of the invention there is provided a multimeric self- cleaving ribozyme construct, which includes a plurality of operably linked self-cleaving monomeric units wherein said monomeric units include at least one first monomeric unit and at least one second monomeric unit: the first monomeric unit including a first ribozyme having a first frans-cleavage specificity, the first ribozyme functioning both in cis and in trans and having a catalytic domain and an antisense domain; said first ribozyme having a first cis target recognition sequence including a ribozyme cleavage site recognizable by the antisense domain of the first ribozyme, wherein the first cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage site and is recognizable by said antisense domain; and the second monomeric unit including a second ribozyme having a second fra/is-cleavage specificity, the second ribozyme functioning both in cis and in trans and having a catalytic domain and an antisense domain; said second ribozyme having a second cis target recognition sequence different to that of the first ribozyme, the second sequence including a ribozyme cleavage site recognizable by the antisense domain of the second ribozyme, wherein the second cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage site and is recognizable by said antisense domain.

The ribozyme construct may include at least one or more further ribozymes in addition to the first and second ribozyme and which differ therefrom. In a preferred embodiment, the ribozyme construct may include said first and second ribozymes and a third ribozyme, with all three ribozymes having different frans-cleavage specificities and different cis- target recognition sequences and ribozyme cleavage sites.

The multimeric self-cleaving ribozyme construct may include at least one third monomeric unit in addition to the first and second monomeric units, the third monomeric unit including a third ribozyme having a third frans-cleavage specificity, the third ribozyme functioning both in cis and in trans and having a catalytic domain and an antisense domain; said third ribozyme having a third cis target recognition sequence different to that of the first and second ribozymes, the third sequence including a ribozyme cleavage site recognizable by the antisense domain of the third ribozyme, wherein the third cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage site and is recognizable by said antisense domain.

The ribozymes may be hammerhead ribozymes.

The target recognition sequences may be derived from Hepatitis B Virus (HBV) X gene (HBx). In other words, the target recognition sequences may be derived from at least two specific sites, preferably three sites, of the Hepatitis B Virus (HBV) X gene (HBx). The multimeric self-cleaving ribozyme construct may include from 4 to 24 monomeric units.

The target recognition sequences may be selected from SEQ ID NO.1, SEQ ID NO. 2, and SEQ ID NO. 3; nucleic acid sequences complementary thereto; nucleic acid sequences which hybridize specifically thereto; homologous sequences of hepadnaviruses; or nucleic acid sequences which have at least 90% sequence identity to said sequences.

Preferably, the nucleic acid sequences may have at least 95 % sequence identity to said sequences.

The target recognition sequences may all be located on the same target RNA transcript.

According to another aspect of the invention there is provided a method of cleaving target RNA transcripts having at least one target recognition sequence, the method including the steps of: providing a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct of the invention, wherein the antisense domains recognize the respective target RNA transcripts; expressing the nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct to produce the multimeric self-cleaving ribozyme construct; c/s-cleaving of the ribozyme construct into its individual monomeric units; and allowing the monomeric units to combine with the target RNA transcripts, whereby the monomeric units recognize and cleave the RNA transcripts.

According to a further aspect of the invention there is provided a method of cleaving a target RNA transcript having a plurality of target recognition sequences, the method including the steps of: providing a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct in accordance with the invention, wherein the antisense domains recognize the target RNA transcript; expressing the nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct to produce the multimeric self-cleaving ribozyme construct; c/s-cleaving of the ribozyme construct into its individual monomeric units; and allowing the monomeric units to combine with the target RNA transcript, whereby the monomeric units recognize and cleave the RNA transcript. The step of expressing the nucleic acid sequence and the step of combining the monomeric units with the target RNA transcript and the cleaving thereof may occur substantially simultaneously.

The expression of the nucleic acid sequence may be controlled by a control sequence selected from the group consisting of a RNA polymerase I promoter sequence, a RNA polymerase II promoter sequence, and a RNA polymerase II promoter sequence.

According to yet another aspect of the invention there is provided a nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct of the invention. The nucleic acid sequence may include at least two of the sequences selected from SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9. The sequences may be joined head-to-tail.

The nucleic acid sequence may include at least two of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; a nucleic acid sequence complementary to one of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; a nucleic acid sequence which hybridizes specifically to one of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; a homologous sequence of a hepadnavirus; or a nucleic acid sequence which has at least 90% sequence identity to one of said sequences.

Preferably, the nucleic acid sequence may have at least 95% sequence identity to said sequence.

The vector may be any suitable vector known to someone skilled in the art, e.g. a viral or non-viral vector.

According to a still further embodiment of the invention there is provided a vector having incorporated therein a nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct of the invention.

According to another embodiment of the invention there is provided a composition which includes the vector of the invention and a physiologically acceptable carrier.

According to another aspect of the invention there is provided a cell which includes the monomeric ribozyme units or the multimeric self-cleaving ribozyme construct of the invention. The invention also extends to a cell including DNA encoding the monomeric ribozyme units or the multimeric self-cleaving ribozyme construct of the invention.

According to a further aspect of the invention there is provided a cell which includes the vector described above.

According to another aspect of the invention there is provided a method of regulating the expression of a gene or a part thereof, the method including the steps of: introducing into a cell a vector having incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct of the invention, wherein at least two antisense domains or parts thereof recognise target RNA transcripts containing at least two target recognition sequences or parts thereof comprising ribozyme cleavage sites transcribed from a gene or a part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct, whereby, upon expression, the ribozyme construct or part thereof is cleaved into its individual monomeric units, and whereby the respective individual monomeric units recognize and cleave the target RNA transcripts transcribed from the gene or a part thereof, thereby regulating the expression of the gene or a part thereof.

According to a further aspect of the invention there is provided a method of regulating the expression of a gene or a part thereof, the method including the steps of: introducing into a cell a vector having incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct in accordance with the invention, wherein the antisense domains recognise a target RNA transcript including a plurality of target recognition sequences comprising ribozyme cleavage sites transcribed from the gene or part thereof to obtain a transformed cell; and maintaining the transformed cell and causing the vector to express the nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the respective individual monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

According to another aspect of the invention there is provided a method of regulating the in vivo expression of a gene or a part thereof, the method including the steps of: introducing a vector within an organism, wherein the vector has incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct according to the invention, wherein at least two antisense domains recognize target RNA transcripts containing target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct or part thereof, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the monomeric units recognize and cleave the target RNA transcripts transcribed from the gene or a part thereof, thereby regulating the expression of the gene or part thereof.

According to a further aspect of the invention there is provided a method of regulating the in vivo expression of a gene or a part thereof, the method including the steps of: introducing a vector within an organism, wherein the vector has incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct in accordance with the invention, wherein the antisense domains recognize a target RNA transcript including a plurality of target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

According to another aspect of the invention there is provided a method of regulating the in vitro expression of a gene or a part thereof, the method including the steps of: introducing a vector within a cell or organism, wherein the vector has incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct according to the invention, wherein at least two antisense domains recognize target RNA transcripts containing target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct or part thereof, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the monomeric units recognize and cleave the target RNA transcripts transcribed from the gene or a part thereof, thereby regulating the expression of the gene or part thereof.

According to a further aspect of the invention there is provided a method of regulating the in vitro expression of a gene or a part thereof, the method including the steps of: introducing a vector within a cell, wherein the vector has incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct in accordance with the invention, wherein the antisense domains recognize a target RNA transcript including a plurality of target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

The multimeric self-cleaving ribozyme construct may include monomeric units in the form of hammerhead ribozymes.

The ribozyme construct may include from 4 to 24 monomeric units.

The target recognition sequences may be derived from the HBx open reading frame of Hepatitis B Virus (HBV). More specifically, the trans recognition sequences may be derived from two, preferably three, regions located within the HBx open reading frame of HBV.

According to a further aspect of the invention, there is provided the use of a multimeric self-cleaving ribozyme construct as described herein in the manufacture of a preparation for treating Hepatitis B Virus (HBV) infection.

According to another aspect of the invention, there is provided a substance or composition for use in a method of treating Hepatitis B Virus (HBV) infection, said substance of composition comprising a multimeric self-cleaving ribozyme construct as described herein, and said method comprising administering a therapeutically effective amount of said substance or composition.

According to a further aspect of the invention there is provided a method of treating Hepatitis B Virus (HBV) infection, said method comprising administering to a subject a therapeutically effective amount of a multimeric self-cleaving ribozyme construct in accordance with the invention.

According to another aspect of the invention there is provided a method of regulating the expression of a gene or a part thereof, the method including the steps of: generating in silico a multimeric self-cleaving ribozyme construct according to the invention, wherein the antisense domains recognize a target RNA transcript including a plurality of target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof, such that, prior to, or upon introduction into a cell, the ribozyme construct is cleaved into its individual monomeric units, and once in the cell the monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

The invention will now be described, by way of non-limiting example, with reference to the accompanying drawings, sequence listings and examples. In the drawings,

Figure 1 shows the organisation of the Hepatitis B Virus (HBV) genome (strain ayw) showing sites targeted by WSx:Rz1₁₄₇₃, - Sx:Rz2₁₆5i, and Hβχ:Rz3₁₆₀₇. Co-ordinates of the genome are given relative to a single EcoRI restriction site on the genome. Partially double stranded HBV DNA comprises plus- and minus-strands with cohesive complementary 5' ends. The c/s-elements that regulate HBV transcription are represented by the circular and rectangular symbols. Immediately surrounding arrows indicate the viral open reading frames (with initiation codons) that encompass the entire genome. Four outer arrows, that give the 5' to 3' polarity, indicate the HBV transcripts. Multiple arrowheads at the 5' ends of the Pre C/Pregenome and Pre S2/S transcripts indicate heterogeneous transcription start sites. A common 3' end of all the HBV transcripts is depicted by an identical termination site. All the HBV mRNA sequences overlap with the X transcript. Thus, all three ribozyme target sites are present on every transcript.

Figure 2 shows the multimeric self-cleavage ribozyme action of the invention. Multiple ribozyme units comprising three different hammerhead ribozymes are present on a single precursor transcript RNA. Twenty-four ribozyme units (only eight are depicted) may be present on a single transcript. The transcript is expressed within a cell or in silico from a constitutively active promoter. Each unit within the primary transcript comprises a hammerhead ribozyme sequence and a downstream cis cleavage target. This allows several single unit ribozymes to be released through internal cis cleavage from the primary multimeric transcript. The monomeric ribozymes that are generated retain their function of cleaving HBV RNA in trans.

Figure 3 shows the plus- and minus-strand sequences of a full-length multimeric unit comprising ribozymes: Hβχ:Rz1ι₄ , Hβχ:Rz2₁₆₅ι and - βχ:Rz3₁₆₀ . The restriction sites used for cloning into a plasmid (pBluescript II (KS+) , Stratagene, CA, USA) vector are depicted at the 5' and 3' ends. Trans- and c/^'s-hybridisation arms (for helices I and III) are shown. The sequence length for each self-cleaving hammerhead ribozyme unit is shown.

Figure 4 shows a schematic diagram of the general structure of a multimeric hammerhead ribozyme expression cassette tetramer of the invention. Sequences encoding multiple ribozymes are cloned into the eukaryotic expression vector pCI neo (Promega, Wl, USA). The expressed transcript undergoes c/s-cleavage to release 5' and 3'-trimmed monomeric ribozymes.

Figure 5 shows the plasmid constructs (A) pCH-9/3091 and (B) pCH-EGFP showing their open reading frames, respective transcripts and sites targeted by ribozymes Wβχ:Rz1ι₄₇₃, HBx:Rz2i65i and HBx:Rz3₁₆o7. A sequence encoding enhanced green fluorescent protein (EGFP) was used to substitute the preS1-S region of pCH-9/3091 and generate pCH-EGFP. The disrupted polymerase ORF is indicated. (C) The pCI neo HBx vector produces HBx (ayw) under control of the CMV promoter in transfected cell culture. (D) The pHBV adw HTD plasmid is a HBV replication-competent vector and includes a head-to-tail dimer of the HBV adw genome. The HBV transcripts (solid arrows) as well as the targets for ribozymes Hβχ:Rz3₁₆₀₇ and /-/βχ:Rz2₁₆5i are indicated (stippled arrows).

Figure 6 shows results from in vitro transcription and c/s-cleavage experiments. (A) C/s- cleavage showing intermediate cleavage products for 4-mer, 8-mer and 24-mer constructs of all three ribozyme species: HSx:Rz1₁₄₇₃, HBx:Rz2₁₆₅₁ and /-/βχ:Rz3 ₆0₇. (B) Schematic illustration of the cleavage products generated for the 4-mer and 8-mer transcripts, and at the junction of ribozymes 1/2 and 2/3 for the 24-mer construct.

Figure 7 shows results from in vitro transcription and frans-cleavage experiments. (A) Trans-cleavage by various single and multimeric ribozymes on T3 RNA polymerase generated run-off transcripts of HBx. (B) Trans-cleavage of a control antisense transcript produced by T7 RNA polymerase run-off expression of HBx fragment. (C) Tra s-cleavage fragments generated by multimeric ribozymes M76Hβχ:Rz1&2 and M24HBx:Rz1,2&3. (D) Schematic illustration of the expected size fragments for the frans-cleavage reaction.

Figure 8 shows the results of co-transfection studies. (A) Combined phase contrast and fluorescence microscopy of Huh-7 cells transfected with pCH-EGFP and either single-unit inactive ribozyme controls or various ribozyme-expressing constructs. (B) Effect of ribozyme co-transfection on the number of GFP-positive fluorescent Huh-7 cells and (C) HBeAg production from Huh-7 cells cotransfected with ribozymes and a replication-competent HBV vector, pHTD adw HBV. HBeAg measurements are given as a mean percentage of the positive control with standard error of the mean (SEM) indicated. The plasmids used in the transfection are indicated below each column. The data is given as the mean from experiments performed in triplicate and is compared to 100% for the control.

Figure 9 shows the construction of single-unit, self-cleaving multimeric ribozyme clones inserted into the pBluescript II (KS+) (Stratagene, CA, USA) vector. A two-step cloning procedure was employed for ribozymes /7βχ:Rz1₁₄₇₃ and Hβ :Rz3-ι₆o₇.

Figure 10 shows the sequences of dimers containing single-unit, c/s-cleaving multimeric ribozymes cloned into a pBluescript II (KS+) cloning vector.

Figure 11 shows a schematic diagram of the treatment of Hepatitis B Virus infection using ribozymes. (1) Hepatitis B Virus (HBV) infects the liver cell, sheds its protein coat, and delivers viral DNA to the cell nucleus. (2) Viral RNA is generated from the DNA and migrates out of the nucleus. (3) Packaged anti-HBV ribozyme genes are delivered to the infected liver cell. Ribozyme units produced in silico may also be delivered. (4) Ribozyme RNAs are produced from the delivered ribozyme genes in the liver cell. (5) Ribozymes attach to target viral RNA species. (6) Viral RNA is cut and inactivated. Ribozymes are then free to catalyse a new cutting reaction.

SEQ. ID. NO. 1 : Oligonucleotide sequence of the HBx ORF target sequence of M7HBx:Rz1₁₄₇₃ (HBV ayw sequence coordinates 1461 to 1485, accession number J02203).

SEQ. ID. NO. 2: Oligonucleotide sequence of the HBx ORF target sequence of M1 HBx:Rz2₁₆₅₁ (HBV ayw sequence coordinates 1639 to 1663, accession number J02203).

SEQ. ID. NO. 3: Oligonucleotide sequence of the HBx ORF target sequence of /W7Λ βχ:Rz3₁₆₀₇ (HBV ayw sequence coordinates 1595 to 1619, accession number J02203).

SEQ. ID. NO. 4: Oligonucleotide sequence of M 1HBx:Rz1₁₄₇₃.

SEQ. ID. NO. 5: Oligonucleotide sequence of M7Hβχ:Rz2₁₆5i-

SEQ. ID. NO. 6: Oligonucleotide sequence of Mf -/βχ:Rz3₁₆₀7-

SEQ. ID. NO. 7: Complementary oligonucleotide sequence of Mϊ -/βχ:Rz1₁₄₇₃. SEQ. ID. NO. 8: Complementary oligonucleotide sequence of M7Hβχ:Rz2₁₆₅₁.

SEQ. ID. NO. 9: Complementary oligonucleotide sequence of M1HBx:Rz3 _∞l.

The invention described herein relates broadly to a nucleotide sequence for a eukaryotic or prokaryotic expression cassette construct that encodes several hammerhead ribozyme units targeting three unique target sites within the Hepatitis B Virus (HBV) X gene (HBx). Each unit comprises a hammerhead ribozyme sequence and its downstream cognate cis cleavage target. This allows individual ribozyme monomers to be released from the multimeric primary RNA transcript through internal cleavage in cis. The monomeric ribozymes that are generated retain their function of cleaving HBV RNA in trans. Results from in vitro investigations confirm that the ribozyme constructs cleave internally to release single ribozyme units, and that the individual ribozyme monomers in turn cleave HBV RNA in trans. More importantly, the multi-ribozymes inhibit HBV gene expression and replication in cell culture models of HBV replication.

Furthermore, the invention relates to a DNA or RNA transfer-based approach to the inhibition of gene expression, more specifically, to inhibit HBV replication. The invention also relates to a DNA sequence that encodes twenty-four individual hammerhead ribozymes that target specific sites on the HBx open reading frame (ORF) of HBV. The DNA sequence is designed to be included in a eukaryotic expression cassette for the expression of a multi- ribozyme precursor RNA transcript from a RNA polymerase I, II or III promoter. Each hammerhead ribozyme unit includes a ribozyme recognition sequence for cleavage of the RNA precursor in cis. Individual hammerhead ribozyme monomers that are released from the full- length transcript retain trans cleavage functions and are therefore capable of inhibiting target gene expression and replication.

5'ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCC

CGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACTCTCTCGTCCC

CTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCG

TCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGG

AGACCACCGTGAACGCCCACCAAATATTGCCCAAGGTCTTACATAAGAGGACTCTTGGAC

TCTCAGCAATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTG

GGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAA

ATTGGTCTGCGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAA 3' HBx ORF (HBV subtype adw, Genbank Accession No. J02203) indicating ribozyme target sites

The multi-ribozyme sequence, which contains twenty-four individual hammerhead ribozyme units orientated head-to-tail from the 5' end to the 3' terminus, is 1856 base pairs (bp) in length (from Xba\ to Spe\) . As shown in Figure 3, each individual ribozyme encoding unit is 78 bp in length for hammerhead ribozymes Hβχ:Rz1₁₄₇₃ and Hβχ:Rz3_{160 )} and 76 bp in length for f/βχ;Rz2₁₆₅ι. The self-cleaving units encode the catalytic sequence of hammerhead ribozymes -/Bx Rz1₁₄₇₃, Hβχ;Rz2 ₆₅₁ and -/βχ;Rz3₁₆₀₇ as well as a downstream target sequence recognised by each ribozyme for self- or c/s-cleavage. For hammerhead ribozyme Hβχ:Rz1_{1 73}, 5' and 3' flanking arms represent hammerhead ribozyme helices I and III respectively and span HBV ayw co-ordinates 1466 to 1479 for internal c/s-cleavage and regions 1461 to 1485 for fr-ans-cleavage. Hammerhead ribozyme Wβχ;Rz2₁₆5i is complementary to HBV ayw coordinates 1644 to 1658 for c/s-cleavage, and co-ordinates 1639 to 1663 for frans-cleavage. Similarly, 5' and 3' flanking arms of HBx;Rz3₁₆₀₇ span regions 1600 to 1613 for cis cleavage and regions 1595 to 1619 for trans cleavage (HBV ayw sequences: GenBank^® accession number J02203) (see Figures. 2, 3 and 10).

The ribozyme expression cassette (Figure 4) was incorporated into the commercial eukaryotic expression plasmid pCI neo (Promega, Wl, USA), where multi-ribozyme RNA is constitutively transcribed by the cytomegalovirus (CMV) promoter/early enhancer. These vectors are suitable for transient co-transfection into liver-derived cell cultures for constitutive expression of RNA encoding the multimeric ribozyme sequences. The multi-ribozyme expression cassette can also be incorporated into non viral (e.g. liposomes) or viral delivery vectors for use in vivo.

A schematic diagram of the general structure of a multimeric hammerhead ribozyme expression cassette tetramer is shown in Figure 4. After inserting sequences encoding multiple ribozymes are cloned into the eukaryotic expression vector pCI neo (Promega, Wl, USA), the expressed transcript is capable of undergoing self-cleavage to release 5' and 3'-trimmed monomeric ribozymes.

In vitro transcription and cis cleavage experiments

Each multimeric ribozyme transcript contains multiples of four, eight or twenty-four c/s-cleaving hammerhead ribozyme monomer units targeted to the three unique HBV sites Hβχ;Rz1ι₄₇₃, HB ;Rz2i65i and HBx:Rz3_W07. To determine the self-cleaving ability of each cis- cleaving hammerhead ribozyme unit, RNAs encoding multi-ribozyme tandems were transcribed in vitro from linearised pBluescript™-derived (Stratagene, CA, USA) vector constructs. Free magnesium ions present in the transcription buffer stimulated ribozyme c/s-cleavage during transcription. At least 80% of the multimeric ribozyme constructs efficiently self-cleaved into monomeric cleavage products after in vitro transcription and before the cleavage reaction step.

To reduce ribozyme c/s-cleavage during transcription, the ribonucleotide concentration was increased in order to absorb Mg²⁺ ions in the transcription buffer. Nevertheless, no full-length transcripts were detectable after transcription indicating efficient cis cleavage. Dimer, trimer and tetramer cleavage products were the only remaining multimeric units present following in vitro transcription (see Figure 6). These products underwent further c/s-cleavage following 60 minutes of additional incubation time during the cleavage reaction.

The most abundant cleavage products were monomer units of individual ribozymes with trimmed 5' and 3' termini. These were observed as a 78 nucleotide (nt) band for ribozymes /7βχ;Rz1₁₄₇₃ and Hβχ Rz3₁₆₀₇, and as a 76 nt band for ribozyme /βχ;Rz2₁₆₅₁. Multimeric constructs containing 8-mer c/s-cleaving hammerhead ribozyme units produced, as expected, a more intense 78 nt (or 76 nt for Hβχ;Rz2₁₆₅i) band of monomer units when compared to the 4- mer constructs. Figure 6A shows the difference in the concentration of monomeric units generated between 8-mer and 4-mer multi-ribozyme transcripts for all three hammerhead ribozymes.

There were additional vector-derived sequences, at the 5' termini of each transcript, that produce single monomer cleavage products of 107 nt in length for c/s-cleaving ribozyme constructs containing 4-mer and 8-mer units of ribozymes Hβχ;Rz1₁₄₇₃ and Hβχ;Rz3₁₆₀₇; and 98 nt in length for constructs containing 4-mer and 8-mer units of ribozyme 7βχ;Rz2ι₆5i- The 107 nt monomeric cleavage product generated by the 24-mer multimeric ribozyme transcript is congruent to the sequence at the 5' terminus of the 8-mer multimeric construct of ribozyme Hβχ:Rz1ι₄₇₃. This unique 107 nt fragment, produced only once per transcription cycle, can serve as an internal control, enabling a quantitative comparison of products generated by different multiribozyme templates.

The 24-mer transcript, which includes multiples of each of the three hammerhead ribozymes, also produced single monomers of 69 and 85 nt in length. These cleavage products represent sequences at the junction between 8-mer units of ribozymes HBx;Rz1ι₄₇₃ and Wβχ;Rz2₁₆₅₁ (69 nt); and between ribozymes Hβχ:Rz2ι₆5i and H^βχ;Rz3₁₆₀7 (85 nt) (Fig. 6). Other cleavage products include an array of incomplete reaction intermediates. One such intermediate, visible as a 103 nt product, may represent a 78 nt self-cleaved monomer of ribozyme HBx:Rz3₁₆o7 with 24 nt of attached, uncleaved 3' terminal vector sequence. Reaction products produced at the 5' terminus were present in greater abundance and represent incomplete RNA polymerisation.

Trans-cleavage activity of monomeric hammerhead ribozymes in vitro

Processed monomeric ribozymes were generated from transcripts containing 1 , 2, 4 and 8-mer ribozyme units as described above. Similarly, multimeric constructs were transcribed and subjected to a cleavage reaction in vitro. Sense and antisense target HBV RNA was produced by T3 or T7 RNA polymerase using a linearised pBluescript-derived vector, pBS-HBx, as template. pBS-HBx encodes the HBx ORF of HBV. To determine the frans-cleavage activity of monomeric ribozymes generated by c/s-cleavage of a multimeric transcript, target transcript RNA was cleaved in trans by each individual processed ribozyme. All multimeric units of each of the three ribozymes were able to cleave target RNA in trans, thereby generating two cleavage products for each ribozyme monomer type: 173 nt and 411 nt for ribozyme HBx;Rz1₁₄₇3; 351 nt and 233 nt for ribozyme HBx;Rz2₁₆₅i; 306 nt and 278 nt for ribozyme Hβχ;Rz3₁₆₀₇ (see Figure 7). Ribozyme Hβχ:Rz3₁₆o₇ proved to be significantly better at cleaving target substrate than either one of ribozyme Hβχ;Rz1₁₄₇₃ or ribozyme Hβχ;Rz2₁₆₅ι. This can be deduced from the intensity of the cleaved products and the lack of substrate RNA, as represented by a 548 nt band. A 16-mer of Hβχ;Rz1_{1 73} and Hβχ;Rz2₁₆₅₁ and a 24-mer containing each of the three ribozyme species also produced all the expected cleavage products as is shown in Figure 7.

Multimeric ribozyme inhibitory effects on HBV gene expression in transfected liver- derived cell cultures

Decreased HBsAg and HBeAg secretion from cells co-transfected with the ribozymes of the invention and a HBV replication competent vector (Figure 5D) indicated an antireplicative effect of the ribozyme on HBV. The vectors expressing multi-ribozyme transcripts proved to be more efficacious when compared to plasmids expressing single unit ribozymes, as is shown in Figure 8. In situ measurement of ribozyme action in transfected Huh7 cells was assessed with an HBV vector, where the preS2/S region was replaced by DNA encoding enhanced green fluorescent protein (EGFP). Detection of EGFP-expressing cells, using fluorescence microscopy, was used as a measure of ribozyme efficacy. The data are shown in Figures 5A and C, and in Figure 8. The self-cleaving multimeric ribozymes inhibited EGFP expression 10-15% more efficiently than their single unit counterparts, with the Hβχ;Rz3₁₆o7 8- mer being the most effective ribozyme species in transfected cell cultures.

Methodology used to generate multimeric hammerhead ribozyme cassettes

Plasmids containing single self-cleaving ribozyme units

The M1HBx:Rz1u73, M1 HBx:Rz2-_i65-_i and M1 HBx:Rz3-[₆₀₇ single unit self cleaving hammerhead ribozyme cassettes respectively encode the catalytic sequence of hammerhead ribozymes HBx:Rz1₁₄₇₃, Wβ ;Rz2₁₆₅i and f/βχ;Rz3ιeo₇ as well as a downstream target sequence recognised by each ribozyme for self- cleavage. For hammerhead ribozyme M1HBx:Rz ₁₄₇₃, 5' and 3' flanking arms represent hammerhead ribozyme helices I and III respectively and span regions 1466 to 1479 for internal c/s-cleavage and regions 1461 to 1484 for frans-cleavage. Hammerhead ribozyme M7 -/βχ:Rz2₁₆5i is complementary to HBV ayw co-ordinates 1644 to 1658 for c/s-cleavage and co-ordinates 1639 to 1663 for frans-cleavage. Similarly, 5' and 3' flanking arms of M7 -/βχ;Rz3₁₆₀₇span regions 1600 to 1613 for cis cleavage and regions 1595 to 1618 for trans cleavage (HBV ayw sequences: GenBank^® accession number J02203) (see Figs. 1 and 3).

pBS-M1HBx:Rz2₁₆₅₁

Two complementary 70-nucleotide oligodeoxynucleotides encoding sense and antisense sequences were synthesized by standard phosphoramadite chemistry using a DNA synthesizer. The annealed, dsDNA fragment with Xba\ and Spel cohesive ends encodes a monomeric unit of Λ//7H^βχ;Rz2₁₆₅ι. Sense (S) and antisense (A) oligonucleotide sequences are represented in Table 1.1.

Oligonucleotides /W βχ;Rz2₁₆₅₁ S and M1 Hβχ;Rz2₁₆5i A were annealed by heating an equimolar mixture (1.3 nmol of each oligonucleotide in 100 μl H₂O) to 95°C for 5 minutes, followed by gradual cooling to room temperature. Once cooled, samples were quantified spectrophotometrically at A₂₆o and brought to a final concentration of 30 pmol/μl.

Table 1.1 Complementary oligonucleotides for single-unit self-cleaving hammerhead ribozyme cassette M7H^βχ;Rz2₁₆₅ι

5' Xba\ and 3' Spel cohesive ends which flank each end of the annealed fragments were used to introduce the single-unit ribozyme cassette into the Xba\ site of cloning vector pBS II KS(+)™ (Stratagene, MA, USA) to generate plasmid pBS-/W7rVβχ;Rz2₁₆₅ι. Xba\ and Spel share compatible cohesive ends resulting in bi-directional insertion into a bal-linearized vector. Cloned plasmids containing the correctly orientated insert were identified by restriction mapping before sequencing.

pBS-M1HBx:Rz1₁₄₇3 and pBS-M1HBx:Rz3₁₆₀7

Plasmids ΌQS-M1HBX:RZ1₁₄₇₃ and pBS-M1HBx:Rz3₁₆o7 containing monomeric units were each derived from vectors containing 'short' and 'long' segments, which together constituted the complete cis- and frans-cleaving unit. pBSII KS(+)-derived plasmids, pBS- 7_/Hβχ:Rz1₁₄₇₃ and pBS-M7{HBx:Rz3₁₆₀₇, contain long Hβχ;Rz1₁₄₇₃ and long Hβχ;Rz3₁₆o₇ hammerhead ribozyme sequences respectively. Similarly, plasmids pBS-M1_sHBx:Rz1₁₄₇₃ and pBS-M7_sHβχ:Rz3₁₆o7 contain the short self-cleaving target sequences of H^βχ;Rz1₁₄₇₃ and Hβχ;Rz3₁₆o₇ respectively.

Two sets of complementary 28-nt oligonucleotides encoding a 'short' ribozyme target sequence for Wβχ;Rz1₁₄₇₃ and Hβχ:Rz3ι₆o₇ were synthesized. The complementary oligonucleotide sets were designated: M7_sHBx;Rz1₁₄₇₃ S and M7_sWBx;Rz:Rz1 i₄₇₃ A; and M1 s - βx.'Rz3₁₆₀7 S and M7_sHβχ;Rz3₁₆o₇ A (see Table 1.2). Similarly, two sets of complementary 52-nt oligonucleotides encoding the 'long' hammerhead ribozyme region for HBx.Rzl ₁₄₇₃ and Hβχ:Rz3₁₆o₇ were synthesized. The complementary oligonucleotide pairs were designated: M1LHBX:RZ1 ₇₃ S and M1_LHBx:Rz1_U73 A; and M7i.HBx:Rz3₁₆₀7 S and M1_LHBx:RzZ_16Q7 A (see Table 1.2). Sequences for both M1_L 'long' and M1_S 'short' oligonucleotide pairs are represented in Table 1.2.

Xoal and Spel restriction sites flank each end of both annealed oligonucleotide sets, allowing for their introduction into the cloning vector pBS II KS(+). Annealed dsDNA fragments M7sHBx:RzRz1₁₄₇₃ and 7_s/-/βχ:Rz3₁₆₀₇ were cloned into the Spel site of pBS KS(+), whilst fragments M1_LHBx:RzRz1₁₄₇₃ and M1_LHBx:RzZ^₀₇ were cloned into the Xba\ site of pBS II KS(+) to generate pBS-M7_sHβχ:Rz1₁₄₇₃, pBS-M7_sHβχ:Rz3₁₆₀₇ pBS-M7_tHβχ;Rz1₁₄₇₃ and pBS- /W7t/-/βχ;Rz3₁₆₀₇. Plasmid clones carrying the correctly oriented insert were identified by restriction mapping before verifying their nucleotide sequences.

Table 1.2 Complementary oligonucleotide sequences for 'long' and 'short' hammerhead ribozyme cassettes of both Hβχ;Rz1₁₄₇₃ and Hβ ;Rz3ιeo₇

An additional Spel site was present in both M1_S annealed fragments. To remove the 8 bp sequence from pBS-M7_sHβχ;Rz1ι₄₇₃ and pBS-M7_sHβχ;Rz3₁₆07. plasmids were digested with Spel, heat inactivated and religated DNA was used to transform DH5α bacteria. The resulting shortened (or truncated) plasmids were designated pBS-M _S7 /^βχ;Rz1_{14 3} and pBS-Λ/ _SτW ;Rz3i607 respectively.

To generate pBS-M7HBx;Rz1₁₄₇₃ and pBS- 7Hβχ:Rz3₁₆₀₇ containing complete single unit self-cleaving hammerhead ribozyme cassettes, plasmids pBS-MlsrHBx.-Rzl ι₄₇₃ and pBS-M7_sτH^βχ;Rz3₁₆₀₇ were digested with Seal and Xibal to produce two fragments of 1863 and 1112 bp respectively. (Initially, pBS-/W7_STHfix.'Rz1₁₄₇₃ would not digest with Xbal due to unexpected methylation of the Xba\ site. The plasmid was then transformed into a DNA adenine methylase negative (dam^") E.coli strain (GM2929) that restored the integrity of the Xbal site.) The 1863 bp fragments, which contained the cis target-encoding sequence of both ribozyme M _srHβχ;Rz1₁₄₇₃ and M7_SrHBx:Rz3₁₆o₇ were purified for further ligation. Plasmids pBS-/W7.Hβχ;Rz1₁₄₇₃ and pBS-M7_/Hβχ;Rz3₁₆₀₇ were digested with Seal and Spel, to produce two fragments of sizes 1170 and 1843 bp. The 1170 bp fragments, which contained the hammerhead ribozyme-encoding sequence for both ribozymes, were purified for further ligation. The 1863 bp fragments from M1_SτHBx:Rr\^₇₃ and M1 s₇/7βχ:Rz3₁₆o7 were ligated to the 1170 bp fragments from pBS-M i.Hβχ:Rz1₁₄₇₃ and pBS-M i/-/^βχ;Rz3₁₆o7 (N.B. cohesive ends of DNA that are produced from Spel and Xbal digestion are compatible and can be ligated efficiently to each other). Following ligation and transformation of DH5a bacteria, correct plasmid clones were identified by restriction mapping followed by manual nucleotide sequencing.

Plasmids encoding multi-unit self-cleaving ribozymes

pBS-M7Hβχ;Rz1₁₄₇₃, pBS-M7Hβχ;Rz2₁₆₅ and pBS- 7Hβ^χ;Rz3₁₆₀₇ were each placed into two separate reaction mixtures. Xbal and Seal restriction enzymes were used in the first reaction to yield two fragments of 1112 bp and 1921 bp (pBS~/W7Hβχ:Rz1₁₄₇₃ and pBS- M1HBx:Rz3ιβo₇) or 1112 bp and 1919 bp (pBS-M7HBx:Rz2₁₆₅i). Spel and Seal restriction enzymes were used in the second reaction to yield fragments of 1190 and 1843 bp (pBS- M1HBx:Rz _U73 and pBS-M1HBx:Rz3₁₆0₇) or 1188 and 1843 bp (pBS-M7H^βχ;Rz2₁₆₅ι) (Table 1.3). The 1921 fragment was ligated to the 1190 bp fragment to generate pBS-M2/-/βχ:Rz1₁₄₇₃ and pBS-/W2Hβχ;Rz3₁₆₀₇ and the 1919 bp fragment was ligated to the 1188 fragment to generate pBS-M2 -/βχ:Rz2ι₆₅₁. Ligation products were used to transform the DH5D strain of bacteria. Colonies containing plasmids with two self-cleaving ribozyme cassettes in a head to tail orientation were identified by restriction mapping. These were designated pBS- M2HBx:Rz^ ■ ₇₃, pBS- 2H^βχ:Rz2₁₆₅ι and pBS-M2HBx:Rz3₁₆₀7-

The same cloning strategy was employed to construct plasmids bearing tetramer (4- mer) and octomer (8-mer) units of each respective hammerhead ribozyme self-cleaving cassette. The 4-mer unit constructs were designated pBS-M4Hβχ:Rz1₁₄₇₃, pBS-M4 3x;Rz2₁₆5i and pBS-M4Hβχ;Rz3₁₆₀₇ while the 8-mer constructs were designated pBS- 8H^βχ:Rz1_{1 3}, pBS- MβH^βχ:Rz2₁₆₅₁ and pBS- 8tfβ^χ;Rz3₁₆₀₇.

A 16-mer construct, pBS-M76;Rz1 ,Rz2, containing 8-mer cassette units of both hammerhead ribozymes Hβχ;Rz1₁₄₇₃ and Hβχ:Rz2₁₆5i was similarly constructed using the enzyme combinations Spel-Xnol and X al-X iol on plasmids pBS-M8H^βχ;Rz1₁₄₇₃ and pBS- /W8Hβχ:Rz2₁₆₅₁ respectively. A 24-mer construct, pBS- 24;Rz1,Rz2,Rz3, containing 8-mer cassette units of hammerhead ribozymes Hβχ:Rz1₁₄₇₃, /-/Bx:Rz2₁₆₅₁ and Hβχ;Rz3ι₆o₇ was constructed by combining the 8-mer fragment of plasmid pBS-M8 - βχ;Rz3ι₆0₇ with the 16-mer fragment of pBS-M76:Rz1,Rz2. (see Table 1.3 and Figure 9 for details on the cloning strategy).

Eukaryotic expression plasmids containing multi-unit self-cleaving ribozymes

Eukaryotic expression vectors pCI-/W8Hβχ:Rz1₁₄₇₃, pCI-/W8Wβχ:Rz2₁₆₅i and pCI- M8HBx Rz3ιβo7 contained 8-mer self-cleaving ribozyme cassettes of hammerhead ribozymes HBx:Rz1₁₄₇₃, Hβχ:Rz2₁₆₅₁ and HBx:Rz3i₆o respectively. A mammalian expression vector containing 24 monomeric units (8 units of each of the self-cleaving ribozyme units Hβχ:Rz1₁₄₇₃, HBx:Rz2₁₆5i and Hβχ:Rz3₁₆0₇) was also constructed. This was named pCI- M24HBx:Rz1,Rz2,Rz3. Plasmids pBS-M8Hβχ:Rz1₁₄₇₃, pBS-M8Hβχ:Rz2₁₆₅ι, pBS-

M8HBx:Rz3ιβo , and pBS-M24HBx;Rz1,Rz2,Rz3 were digested with Xhol and Xbal. Multimeric ribozyme containing fragments were separated from vector backbone then eluted from a 1% agarose gel. pCI neo (Promega, Wl, USA) was digested with Nhe and Xnol yielding a large vector backbone which was similarly eluted from a 1% agarose gel. Ribozyme containing fragments were ligated to the pCI neo vector and the products were used to transform DH5D bacteria. Colonies containing the correct plasmid clones were identified by restriction mapping and sequencing.

In vitro transcription and cleavage reactions

pBS II KS(+)-derived self-cleaving multiribozyme plasmids carrying 1-mer, 2-mer, 4- mer and 8-mer units for ribozymes -/βχ:Rz1₁₄₇₃, HBx:Rz2 ₆₅₁ and HBx:Rz3₁₆o7 were linearised by digestion with Pstl. Single-unit vectors pBS-/W7i Vβχ;Rz1₁₄₇₃ and pBS-M7(Hβx-'Rz3₁₆0 , as well as multimeric vectors pBS-M76HBx;Rz1,Rz2 and pBS-M24 Rz1,Rz2,Rz3 were also linearized with Pstl. To generate control DNA for producing antisense transcripts, the above plasmids were separately linearised by digestion with Xbal. Linearised DNA templates were eluted from a 1% agarose gel, extracted using chlorophorm/phenol and resuspended in H₂O at a final concentration of 1 μg/μl.

Table 1.3 pBS II KS(+)-derived multimeric self cleaving hammerhead ribozyme vectors

fragments selected for cloning are shown in italics.

Multiribozyme c/s-cleavage reaction

Radiolabelled self-cleaving RNA was transcribed at 37°C for 1 hour in a 20 μl reaction mixture containing 2 μg of template DNA, 10 mM dithiothreitol, 40 mM Tris-HCI (pH 8.0), 8 mM MgCI₂, 2 mM spermidine, 20 U RNasin (Promega, Wl, USA), 8 mM ATP, 8 mM CTP, 8 mM UTP, 12.5 μM GTP (Roche, Germany) and 20 μCi of α-³²P GTP (3000 Ci/mmol; NEN du Pont, USA) and, 20 U of T7 RNA Polymerase (Promega, Wl, USA). Twenty U of DNase I (Promega, Wl, USA) was added to the reaction mixture for 10 min at 37°C. RNA fragments were purified using the Qiagen RNeasy (Qiagen, CA, USA) RNA purification kit according to the manufacturer's instructions. The cleavage reaction was carried out in a 40 μl reaction mixture containing radiolabelled self-cleaving multiribozyme transcript RNA. The mixture contained 20 mM MgCI₂ and 50 mM Tris-CI (pH 8.0), and was incubated at 37°C. Aliquots (10 μl) were removed after incubation for 0 minutes, 5 minutes and 30 minutes. Samples were resolved by denaturing polyacrylamide gel electrophoresis and then subjected to autoradiography for 1 to 12 hours.

Trans-cleavage ribozyme reaction

Transcription of radiolabelled target RNA (Xbal-linearized pBS-HBx) was performed as for the multimeric ribozymes described above but using T3 RNA polymerase. In vitro transcription reactions for the multiribozyme templates were performed similarly to the reaction of the single-unit ribozymes. Antisense control HBx target RNA was transcribed using T7 RNA polymerase (Promega, Wl, USA) from a Xnol-linearised pBS-HBx template. The cleavage reaction was carried out at 37°C in a 10 μl reaction mixture containing a five-fold molar excess of ribozyme to radiolabelled target RNA in the presence of 20 mM MgCI₂ and 50 mM Tris-CI (pH 8.0). The cleavage reaction was stopped after 1 hour with the addition of 3 μl of RNA loading buffer (98% deionized formamide, 1 mM EDTA (pH 8.0), 0.25% bromophenol blue and 0.25% xylene cyanol). Samples were resolved by denaturing polyacrylamide gel electrophoresis and then subjected to autoradiography for 1 to 12 hours.

Cell culture and transfections PLC/PRF5, Huh7 and Chang cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% foetal calf serum (FCS), penicillin (50 lU/ml) and streptomycin (50 μg/ml) (Gibco BRL, UK). Primary cultures of malignant hepatocytes were prepared from a resected tumour of a HBV chronic carrier patient with hepatocellular carcinoma. The patient's serum was positive for HBsAg but negative for HBeAg on testing with Ausria™ and Axsym™ kits (Abbott Laboratories, IL, USA). After resection, the tissue was rinsed in HEPES buffered saline containing collagenase (0.025% collagenase (Sigma grade I); 0.075% CaCI₂.2H₂O; 161 mM NaCI; 3.15 mM KCI; 0.7 mM Na₂HPO₄; 33 mM HEPES, pH 7.65). To dissociate the cells and remove fibrous material, the tissue was teased and passed through a fine stainless steel mesh. The cells collected after this treatment were washed and plated at 90% confluence in Ham's F12 medium supplemented with 10% FCS, penicillin (50 lU/ml) and streptomycin (50 μg/ml). Transfections, using a standard calcium phosphate coprecipitation method were carried out in 100 mm culture dishes and contained a combination of 3 μg of pCH- EGFP and 6 μg of plasmids pHβχ:Rz1₁₄₇₃, pHBx:Rz1*₁₄₇₃ (vector expressing catalytically inactive ribozyme 1), pHβχ:Rz2₁₆₅ι, pHβχ:Rz2^* ₁₆₅₁ (vector expressing catalytically inactive ribozyme 2), pCI-M8Hβχ:Rz1₁₄₇₃, pCI-M8Hβχ:Rz2₁₆₅ι, pCI-M8HBx:Rz3₁₆₀₇, pCI- /W24f βχ:Rz1 ,Rz2,Rz3 or pCI neo. Similarly, cells in 100 mm diameter culture dishes were transfected with a combination of 7 μg of pCH-9/3091 and 14 μg of pHβχ:Rz1₁₄₇₃, pHBx:Rz1*₁₄₇₃, ptf^βχ:Rz2₁₆₅ι, pHBx:Rz2^* ₁₆₅i, pCI-M8H^βχ:Rz1₁₄₇₃, pCI-/W8Hβχ:Rz2₁₆₅ι, pCI- M8tfβχ:Rz3₁₆o7, and pCI-M24/-/^βχ:Rz1 ,Rz2,Rz3.

Assay of HBsAg and HBeAg produced by transfected Huh7 cells.

Huh7 cells were transfected as described above. HBsAg and HBeAg secretion into the culture supernatants was measured daily for three days using Axsym™ (ELISA) immunoassay kits (Abbot Laboratories, IL, USA). The means of HBsAg and HBeAg immunoassay measurements were calculated from three independent transfections. The results for HBeAg secretion from transfected cells are given in Fig. 8. Data for HBsAg secretion were similar.

Ribozyme effects in situ

Effects of ribozymes were determined using fluorescence microscopy to detect EGFP expression after cotransfection of pCH-EGFP together with ribozyme expressing vectors. Data that demonstrate improved efficacy of multimeric ribozymes, when compared to single unit expressing vectors, are given in Fig. 8. Conclusions

To achieve a high intracellular ribozyme concentration, the Inventors have developed a self-cleaving multimeric design strategy utilising unique ribozymes targeted simultaneously to three sites on the HBx ORF of HBV. C/s-cleavage of ribozyme recognition sequences, which flank each individual ribozyme domain, results in the release of individual monomeric ribozyme units from a single expressed transcript with defined 5' and 3' termini. Furthermore, the construct of the invention results in three unique sites of HBV being targeted simultaneously in trans by ribozyme units that are released from the cis cleavage of a single transcript. The single transcript RNA contains twenty-four cis cleaving ribozyme units that generate eight multiples of each of three different specific hammerhead ribozymes. In addition, the multiribozyme transcript RNA, when expressed from a eukaryotic expression cassette, has a greater antireplicative effect in cell culture models of HBV replication than individually expressed ribozymes targeting the same three sites on HBV RNA.

The multi-ribozyme sequences used represent an improvement of previously described, single ribozyme constructs, which have been previously targeted to the HBx ORF of HBV (Weinberg, Passman et al., 2000; Passman, Weinberg et al., 2000). The construct of the invention significantly reduces HBV replication and gene expression in cell culture models of HBV replication.

The Inventors believe that the method and ribozyme construct of the invention constitute an effective application of ribozyme technology to the treatment of chronic HBV infection and comprises an improvement on current anti-HBV ribozymes. Moreover, the simultaneous targeting of several sequences is a property that can be applied more generally for the effective inhibition of gene expression. Further advantages of the invention are that the invention provides for generating ribozymes in silico, improved intracellular ribozyme efficacy and increased number of ribozyme units per therapeutic dose. Moreover, the invention provides for a greater variety of ribozyme units thereby reducing the risk of drug resistance, and an increase in ribozyme complexity without altering manufacturing costs. The following references are incorporated herein by reference.

Beck, J. and M. Nassal (1995). "Efficient hammerhead ribozyme-mediated cleavage of the structured hepatitis B virus encapsidation signal in vitro and in cell extracts, but not in intact cells." Nucleic Acids Res 23(24): 4954-62.

Cameron, F. H. and P. A. Jennings (1989). "Specific gene suppression by engineered ribozymes in monkey cells." Proc Natl Acad Sci U S A 86(23): 9139-43.

Chen, C. J., A. C. Banerjea, et al. (1992). "Multitarget-ribozyme directed to cleave at up to nine highly conserved HIV- env RNA regions inhibits HIV-1 replication-potential effectiveness against most presently sequenced HIV-1 isolates." Nucleic Acids Res 20(17): 4581-9.

Chen, H. S., S. Kaneko, et al. (1993). "The woodchuck hepatitis virus X gene is important for establishment of virus infection in woodchucks." J Virol 67(3): 1218-26.

Gotten, M. and M. L. Birnstiel (1989). "Ribozyme mediated destruction of RNA in vivo." Embo J

8(12): 3861-6.

Feng, Y., Y. Y. Kong, et al. (2001). "Inhibition of hepatitis B virus by hammerhead ribozyme targeted to the poly(A) signal sequence in cultured cells." Biol Chem 382(4): 655-60.

He, Y. K., C. D. Lu, et al. (1993). "In vitro cleavage of HPV16 E6 and E7 RNA fragments by synthetic ribozymes and transcribed ribozymes from RNA-trimming plasmids." FEBS Lett

322(1): 21-4.

Kim, Y. K., E. Junn, et al. (1999). "Repression of hepatitis B virus X gene expression by hammerhead ribozymes [published erratum appears in Biochem Biophys Res Commun 1999

May 27:259(1 V2311." Biochem Biophvs Res Commun 257(3): 759-65.

Ohkawa, J., N. Yuyama, et al. (1993). "Importance of independence in ribozyme reactions: kinetic behavior of trimmed and of simply connected multiple ribozymes with potential activity against human immunodeficiency virus." Proc Natl Acad Sci U S A 90(23): 11302-6.

Ohkawa, J., N. Yuyama, et al. (1993). "Multiple site-specific cleavage of HIV RNA by transcribed ribozymes from shotgun-type trimming plasmid." Nucleic Acids Svmp Ser 90(29): 121-2.

Passman, M., M. Weinberg, et al. (2000). "In situ demonstration of inhibitory effects of hammerhead ribozymes that are targeted to the hepatitis Bx sequence in cultured cells."

Biochem Biophvs Res Commun 268(3): 728-33.

Ramezani, A., S. F. Ding, et al. (1997). "Inhibition of HIV-1 replication by retroviral vectors expressing monomeric and multimeric hammerhead ribozymes." Gene Ther 4(8): 861-7.

Ruiz, J., C. H. Wu, et al. (1997). "Design and preparation of a multimeric self-cleaving hammerhead ribozyme." Biotechniques 22(2): 338-45.

Shimayama, T., S. Nishikawa, et al. (1995). "Generality of the NUX rule: kinetic analysis of the results of systematic mutations in the trinucleotide at the cleavage site of hammerhead ribozymes." Biochemistry 34(11): 3649-54. Thomson, J. B., T. Tuschl, et al. (1997). Catalytic RNA. F. Eckstein and D. M. J. Lilley. Berlin, Springer-Verlag: 173-196.

Tiollais, P., C. Pourcel, et al. (1985). "The hepatitis B virus." Nature 317(6037): 489-95. Usman, N. and D. T. Stuchcomb (1996). Design, synthesis, and function of therapeutic hammerhead ribozymes. Catalytic RNA. F. Eckstein and D. M. J. Lilley. Berlin, Springer-Verlag: 243-246. von Weizsacker, F., H. E. Blum, et al. (1992). "Cleavage of hepatitis B virus RNA by three ribozymes transcribed from a single DNA template." Biochem Biophvs Res Commun 189(2): 743-8.

Weinberg, M., M. Passman, et al. (2000). "Hammerhead ribozyme-mediated inhibition of hepatitis B virus X gene expression in cultured cells." J Hepatol 33(1): 142-51. Welch, P. J., R. Tritz, et al. (1997). "Intracellular application of hairpin ribozyme genes against hepatitis B virus." Gene Ther 4(7): 736-43.

Xing, Z., S. Mahadeviah, et al. (1995). "Antiviral activity of RNA molecules containing self- releasing ribozymes targeted to lymphocytic choriomeningitis virus." Antisense Res Dev 5(3): 203-12.

Yuyama, N., J. Ohkawa, et al. (1992). "Construction of a tRNA-embedded-ribozyme trimming plasmid." Biochem Biophvs Res Commun 186(3): 1271-9.

Yuyama, N., J. Ohkawa, et al. (1994). "A multifunctional expression vector for an anti-HIV-1 ribozyme that produces a 5'- and 3'-trimmed trans-acting ribozyme, targeted against HIV-1 RNA, and cis-acting ribozymes that are designed to bind to and thereby sequester trans- activator proteins such as Tat and Rev." Nucleic Acids Res 22(23): 5060-7. Zoulim, F., J. Saputelli, et al. (1994). "Woodchuck hepatitis virus X protein is required for viral infection in vivo." J Virol 68(3): 2026-30. zu Putlitz, J., Q. Yu, et al. (1999). "Combinatorial screening and intracellular antiviral activity of hairpin ribozymes directed against hepatitis B virus." J Virol 73(7): 5381-7.

Claims

CLAIMS:

1. A multimeric self-cleaving ribozyme construct, which includes a plurality of operably linked self-cleaving monomeric units wherein said monomeric units include at least one first monomeric unit and at least one second monomeric unit: the first monomeric unit including a first ribozyme having a first frans-cleavage specificity, the first ribozyme functioning both in cis and in trans and having a catalytic domain and an antisense domain; said first ribozyme having a first cis target recognition sequence including a ribozyme cleavage site recognizable by the antisense domain of the first ribozyme, wherein the first cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage site and is recognizable by said antisense domain; and the second monomeric unit including a second ribozyme having a second frans-cleavage specificity, the second ribozyme functioning both in cis and in trans and having a catalytic domain and an antisense domain; said second ribozyme having a second cis target recognition sequence different to that of the first ribozyme, the second sequence including a ribozyme cleavage site recognizable by the antisense domain of the second ribozyme, wherein the second cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage site and is recognizable by said antisense domain.

2. A multimeric self-cleaving ribozyme construct as claimed in claim 1 , wherein said construct includes at least one third monomeric unit in addition to the first and second monomeric units, the third monomeric unit including a third ribozyme having a third trans- cleavage specificity, the third ribozyme functioning both in cis and in trans and having a catalytic domain and an antisense domain; said third ribozyme having a third cis target recognition sequence different to that of the first and second ribozymes, the third sequence including a ribozyme cleavage site recognizable by the antisense domain of the third ribozyme, wherein the third cis target recognition sequence is the same as or similar to a target recognition sequence of a target transcript or a portion of a target transcript sequence which retains said ribozyme cleavage site and is recognizable by said antisense domain.

3. A multimeric self-cleaving ribozyme construct as claimed in claim 1 or claim 2, wherein the ribozymes are hammerhead ribozymes.

4. A multimeric self-cleaving ribozyme construct as claimed in any one of the preceding claims, wherein the target recognition sequences are derived from Hepatitis B Virus (HBV) X gene (HBx).

5. A multimeric self-cleaving ribozyme construct as claimed in any one of the preceding claims, wherein said construct comprises from 4 to 24 monomeric units.

6. A multimeric self-cleaving ribozyme construct as claimed in any one of the preceding claims, wherein the target recognition sequences are selected from SEQ ID NO.1, SEQ ID NO. 2, and SEQ ID NO. 3; nucleic acid sequences complementary thereto; nucleic acid sequences which hybridize specifically thereto; homologous sequences of hepadnaviruses; or nucleic acid sequences which have at least 90% sequence identity to said sequences.

7. A multimeric self-cleaving ribozyme construct as claimed in any one of the preceding claims, wherein the target recognition sequences are all located on the same target RNA transcript.

8. A method of cleaving a target RNA transcript having a plurality of target recognition sequences, the method including the steps of: providing a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, wherein the antisense domains recognize the target RNA transcript; expressing the nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct to produce the multimeric self-cleaving ribozyme construct; c/s-cleaving of the ribozyme construct into its individual monomeric units; and allowing the monomeric units to combine with the target RNA transcript, whereby the monomeric units recognize and cleave the RNA transcript.

9. A method as claimed in claim 8, wherein the step of expressing the nucleic acid sequence and the step of combining the monomeric units with the target RNA transcript and the cleaving thereof occur substantially simultaneously.

10. A method as claimed in claim 8 or claim 9, wherein the expression of the nucleic acid sequence is controlled by a control sequence selected from the group consisting of a RNA polymerase I promoter sequence, a RNA polymerase II promoter sequence, and a RNA polymerase II promoter sequence.

11. A nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, wherein the nucleic acid sequence includes at least two of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; a nucleic acid sequence complementary to one of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; a nucleic acid sequence which hybridizes specifically to one of SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; a homologous sequence of a hepadnavirus; or a nucleic acid sequence which has at least 90% sequence identity to one of said sequences.

12. A vector having incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7.

13. A composition which includes a vector as claimed in claim 12 and a physiologically acceptable carrier.

14. A cell which includes a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7.

15. A cell including DNA encoding a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7.

6. A cell including a vector as claimed in claim 12.

17. A method of regulating the expression of a gene or a part thereof, the method including the steps of: introducing into a cell a vector having incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, wherein the antisense domains recognise a target RNA transcript including a plurality of target recognition sequences comprising ribozyme cleavage sites transcribed from the gene or part thereof to obtain a transformed cell; and maintaining the transformed cell and causing the vector to express the nucleic acid sequence encoding the multimeric self-cleaving ribozyme construct, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the respective individual monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

18. A method of regulating the in vivo expression of a gene or a part thereof, the method including the steps of: introducing a vector within an organism, wherein the vector has incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, wherein the antisense domains recognize a target RNA transcript including a plurality of target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

19. A method of regulating the in vitro expression of a gene or a part thereof, the method including the steps of: introducing a vector within a cell, wherein the vector has incorporated therein a nucleic acid sequence encoding a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, wherein the antisense domains recognize a target RNA transcript including a plurality of target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof; and causing the vector to express the nucleic acid sequence encoding the multimeric self- cleaving ribozyme construct, whereby, upon expression, the ribozyme construct is cleaved into its individual monomeric units, and whereby the monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

20. A method of regulating the expression of a gene or a part thereof, the method including the steps of: generating in silico a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, wherein the antisense domains recognize a target RNA transcript including a plurality of target recognition sequences comprising at least two trans ribozyme cleavage sites transcribed from a gene or part thereof, such that, prior to, or upon introduction into a cell, the ribozyme construct is cleaved into its individual monomeric units, and once in the cell the monomeric units recognize and cleave the target RNA transcript transcribed from the gene or part thereof, thereby regulating the expression of the gene or part thereof.

21. A method as claimed in any one of claims 8, 9, 10 or 17 to 20, wherein the multimeric self-cleaving ribozyme construct includes hammerhead ribozymes.

22. A method as claimed in any one of claims 8, 9, 10 or 17 to 20, wherein the ribozyme construct comprises from 4 to 24 monomeric units.

23. A method as claimed in any one of claims 8, 9, 10 or 17 to 20, wherein the target recognition sequences are derived from HB open reading frame of Hepatitis B Virus (HBV).

24. Use of a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7 in the manufacture of a preparation for treating Hepatitis B Virus (HBV) infection.

25. A substance or composition for use in a method of treating Hepatitis B Virus (HBV) infection, said substance of composition comprising a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7, and said method comprising administering a therapeutically effective amount of said substance or composition.

26. A method of treating Hepatitis B Virus (HBV) infection, said method comprising administering a therapeutically effective amount of a multimeric self-cleaving ribozyme construct as claimed in any one of claims 1 to 7 to a subject.

27. A multimeric self-cleaving ribozyme construct as claimed in claim 1 , substantially as herein described and illustrated.

28. A method as claimed in any one of claims 8, 17, 18, 19 or 20, substantially as herein described and illustrated.

29. A nucleic acid sequence as claimed in claim 11 , substantially as herein described and illustrated.

30. A vector as claimed in claim 12, substantially as herein described and illustrated.

31. A composition as claimed in claim 13, substantially as herein described and illustrated.

32. A cell as claimed in claim 14 or claim 15 or claim 16, substantially as herein described and illustrated.

33. Use as claimed in claim 24, substantially as herein described and illustrated.

34. A substance or composition for use in a method of treatment as claimed in claim 25, substantially as herein described and illustrated.

35. A method as claimed in claim 26, substantially as herein described and illustrated.

36. A new multimeric self-cleaving ribozyme construct; a new method of cleaving a target RNA transcript; a new nucleic acid; a new vector; a new composition; a new cell; a new method of regulating the expression of a gene or a part thereof; a new method of regulating the in vivo expression of a gene or a part thereof; a new method of regulating the in vitro expression of a gene or a part thereof; a new use of a multimeric self-cleaving ribozyme construct as claimed in claim 1; a substance or composition for a new use in a method of treatment; or a new method of treatment; substantially as herein described.