KR20090003147A - Inhibition of viral gene expression using small interfering rna - Google Patents

Abstract

The invention provides methods, compositions, and kits comprising small interfering RNA (shRNA or siRNA) that are useful for inhibition of viral-mediated gene expression. Small interfering RNAs as described herein can be used in methods of treatment of HCV infection. ShRNA and siRNA constructs targetING the internal ribosome entry site (IRES) sequence of HCV are described.

Description

Inhibition of Viral Gene Expression Using Small Interference RNA {INHIBITION OF VIRAL GENE EXPRESSION USING SMALL INTERFERING RNA}

Cross Reference to Related Application

This application claims U.S. Provisional Application No. 60 / 608,574, filed September 10, 2004, on 35 U.S.C. Priority is claimed by PCT Application No. PCT / US2005 / 032768, filed September 12, 2005, which claims priority under §119, both of which are incorporated herein by reference in their entirety.

Statement on government-funded research or development

The present invention is part of a study made with support from Grant 5R43AI056611 of the National Institutes of Health. The US government may have certain rights in the invention.

Field of invention

The present invention relates to the inhibition of viral gene expression, eg, hepatitis C virus IRES-mediated gene expression using small interfering RNAs (shRNA and siRNA).

Treatment and prevention of hepatitis C virus (HCV) remains a major challenge in managing its health problems worldwide; Current therapies are only partially valid and no vaccine is currently available. More than 170 million people worldwide have been infected with the hepatitis C virus (HCV), a major cause of liver transplantation. Current therapies, including ribavirin and PEGylated interferon alpha, are effective only in about 50% of patients and have significant side effects. The development of more effective HCV therapies is limited by the lack of good small animal models, the ability to reliably culture the virus in tissue culture cells, and the high rate of viral mutation [1-3]. The usefulness of the HCV replicon system has enabled the evaluation of HCV replication, interaction with host cells, and antiviral agents. More recently, a transformed chimeric humanized mouse liver model has been developed to enable total HCV infection [4-7]. ]. In addition, the use of in vivo imaging of the HCV IRES dependent reporter system facilitated the evaluation of delivery and inhibition efficiency by anti-HCV agents in mouse liver for multiple time points using the same animal.

RNA interference is an evolutionarily conserved pathway that causes down regulation of gene expression. The discovery that synthesized short interfering RNAs (siRNAs) of about 19 to 29 base pairs can effectively inhibit gene expression in mammalian cells and animals without activating the immune response has led to active research to develop these inhibitors as therapeutics [ 9]. The chemical stability of the siRNA increased serum half-life [10], which means that intravenous administration can yield positive therapeutic results if delivery problems can be overcome. In addition, small hairpin RNAs (shRNAs) have been shown to strongly inhibit target genes in mammalian cells and are excellent candidates for viral delivery, such as bacteriophages (eg, T7, T3 or SP6) or mammalian promoters (pol III such as U6 or H1 or pol III) can be easily expressed [11].

Since current therapies are not sufficiently effective, efforts have been made to find effective nucleic acid based inhibitors for HCV (see [4, 12]). These efforts include traditional antisense oligonucleotides, phosphorodiamidate morpholino oligomers [8], ribozymes and more recently siRNAs. siRNA has been shown to be able to effectively target HCV in human tissue culture cells [13-19] and animal systems [20].

Summary of the Invention

The present invention provides methods, compositions and kits for inhibiting IRES-mediated gene expression of viruses such as hepatitis C virus (HCV).

4A and 10, and the inhibitory RNA sequences listed in Table 1 (e.g., SEQ ID NOs: 19-26), both ends or one end of each strand, e.g., will be understood by one of ordinary skill in the art. For example, since the 3 'terminus is not related to a target to which it may be added, it includes a complementary sequence. Inhibitory (antisense recognition) sequences shown in FIGS. 4A and 10, Table 1 can be introduced into shRNA or siRNA. In the case of shRNAs, the sequences shown above are additionally linked to their complementary sequences by loops comprising nucleotide residues that are generally unrelated to the target. Examples of such loops are shown in the shRNA sequences shown in FIGS. 1B and 1C and FIGS. 16A-B. In both cases, the strands complementary to the target are generally completely complementary, but in one embodiment, the strands complementary to the target are mismatched (see, e.g., SEQ ID NOs: 13, 14, and 15). It may contain. This sequence may vary depending on the target, which targets one or more genetic variants or phenotypes of the virus by modifying the target sequence to be complementary to the sequence of the genetic variant or phenotype. Strand homology to the target may differ from about 0 to about 5 sites, for example by having a deletion, insertion, or mismatch of about 1 to about 5 nucleotides, such as in naturally occurring microRNAs. In one embodiment, the sequence can target multiple viral lines, eg, HCV, even if the sequence differs from the target of the viral line in one or more nucleotides (eg, 1, 2 or 3 nucleotides) of the target sequence. .

In one aspect, the present invention provides a composition comprising one or more small interfering RNAs at least partially complementary to a polynucleotide sequence of a virus, wherein the small interfering RNAs interact with the polynucleotide sequence of the virus, such that The interaction of RNA with viral target sequences inhibits viral gene expression. In one embodiment, the composition comprises, consists of, or consists essentially of, for example, a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18; Or one or more shRNAs comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 32 and SEQ ID NO: 33. In one embodiment, the shRNA comprises, consists of, or consists essentially of the sequence represented by SEQ ID NO: 12. In another embodiment, the composition comprises one or more siRNAs. In one embodiment, the composition is, for example, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, sequence At least one siRNA or shRNA comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 32 and SEQ ID NO: 33. In some embodiments, the small interfering RNA, eg, shRNA or siRNA, is from about 19 to about 30 nucleotides, or from about 19 to about 25 nucleotides, eg, about 19, 20, 21, 22, 23, 24, Interact with the viral sequence of any of 25, 26, 27, 28, 29 or 30 nucleotides. In some embodiments, the small interfering RNA binds to the hepatitis C virus. In one embodiment, the small interfering RNA binds to a sequence present in the internal ribosomal entry site (IRES) sequence of hepatitis C virus, for example, the sequence represented by SEQ ID NO: 26 (344-373 residues of SEQ ID NO: 11). do. In one embodiment, the hepatitis C virus is 1a genotype HCV.

In some embodiments, the compositions of the present invention are provided in a therapeutically effective amount for treating HCV infection, for example in humans or non-human primates such as chimpanzees or New World monkeys, and optionally, eg, water or saline Pharmaceutically acceptable excipients, and the like. In one embodiment, the composition is a pharmaceutical composition comprising, consisting of, or consisting essentially of one or more shRNAs or siRNAs and pharmaceutically acceptable excipients described herein.

In another aspect, the invention comprises any of the compositions described above for use in a method of treating a viral infection in a subject or inhibiting gene expression of a virus as described herein, optionally further comprising instructions. It relates to a kit. In one embodiment, the kit is for use in treating an HCV infection in an individual, such as a human, and comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18 Or consist essentially of it; Or a shRNA comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33, or SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: A siRNA comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33, and optionally, hepatitis C virus, such as HCV 1a Instructions for use in a method of inhibiting genotype gene expression, or in a method for treating a viral infection of hepatitis C virus (eg, HCV 1a genotype) in an individual, such as a human or non-human primate such as a chimpanzee. Include additional instructions for use.

In another embodiment, the present invention provides a method of treating a viral infection in an individual, such as a mammal, eg, a human or non-human primate. The method comprises administering to the individual a therapeutically effective amount of a small interfering RNA, such as shRNA or siRNA and a pharmaceutically acceptable excipient, which is at least partially complementary to and can bind to the polynucleotide sequence of the virus, wherein the viral polynucleotide sequence The small interfering RNA binds to inhibit gene expression of the virus, e.g., to reduce the amount of viral expression in an individual or to reduce the amount of viral expression predicted in an individual who has not received the small interfering RNA. In one embodiment, the viral infection comprises a type C infection virus, such as the HCV 1a genotype. In some embodiments, the virus is selected from the group consisting of 1a, 1b, 2a, and 2b genotypes of type C infected virus. In some embodiments, the small interfering RNA comprises, consists of, or consists essentially of a sequence located within 5 nucleotides of either the siRNA or shRNA described herein and any shRNA or siRNA sequence described herein. Is done. In some embodiments, the small interfering RNA is about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, eg, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 Or, complementary to the viral sequence of any nucleotide number of 30 nucleotides. In one embodiment, the virus is hepatitis C virus, such as HCV 1a genotype. In one embodiment, the small interfering RNA binds to a sequence of about 19 to about 25 nucleotides present in the IRES region of HCV 1a represented by SEQ ID NO: 26. Treatment includes treatment (eg, reducing or lowering one or more signs or infections) or nursing. In some embodiments, the shRNA is administered parenterally, eg, by intravenous injection or infusion.

In another aspect, the invention provides a method of inhibiting gene expression of a virus, the method comprising contacting viral RNA or viral mRNAs with small interfering RNAs, or introducing small interfering RNAs into a virus containing cell, Small interfering RNAs, such as shRNAs or siRNAs, contain sequences that are at least partially complementary to the polynucleotide sequence of the virus, which sequences induce, for example, cleavage of viral polynucleotide sequences, thereby inhibiting viral gene expression. can do. In some embodiments, the small interfering RNA comprises, consists of, or consists essentially of any of the shRNA or siRNA sequences described herein. In some embodiments, the small interfering RNA is about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, eg, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 Or a viral sequence of any nucleotide number of 30 nucleotides. In one embodiment, the virus is hepatitis C virus, such as HCV 1a. In one embodiment, the small interfering RNA is about 19 to about 30 nucleotides present in the IRES region of the HCV 1a genotype represented by SEQ ID NO: 26 and a sequence present within 5 nucleotides of any of the siRNA or shRNA sequences described herein. Interact with the sequence of. In another embodiment, two or more small interfering RNAs are introduced into a cell.

The invention also relates to (a) the sequences illustrated in FIGS. 10 or 16A-B, for example SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, A first RNA sequence that is SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56 or a sequence that differs by 1, 2, or 3 nucleotides from the sequence; (b) a second RNA sequence complementary to the first sequence; (c) a loop sequence located between the first and second nucleic acid sequences and consisting of 4 to 10 nucleotides; And (d) optionally, a 2 nucleotide overhang. In some embodiments of the invention, the first RNA sequence is SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, sequence SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51; SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56. The RNA sequence, in some cases, includes one or more modified nucleotides. The loop sequence of the RNA sequence of the present invention is, for example, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, or 10 nucleotides or more. In some embodiments, the RNA sequence is a shRNA and comprises the HCV target sequence and complement sequence described herein, which are linked by a loop comprising molecules other than one or more nucleotides. In some embodiments, the loop of the RNA sequence is 3 'to the sense strand and 5' to the complementary antisense strand of shRNA. In another embodiment, the loop of the RNA sequence is 3 'for antisense and 5' for the complementary sense strand of shRNA. In some cases, the RNA sequence comprises a 2 nucleotide overhang, which is 2'UU. In some cases, the overhang is 1 nucleotide, 2 nucleotides, 3 nucleotides or more. In some cases, the first RNA sequence is any one of SEQ ID NOs: 57-79, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. In some cases, the RNA sequence is the sequence illustrated in FIGS. 16A-B.

The invention also relates to a DNA sequence comprising a sequence encoding an RNA sequence disclosed herein (eg, the RNA sequence illustrated in FIGS. 10 or 16A-B). The invention also includes expression vectors comprising such DNA sequences. Also included are retroviral vectors comprising such DNA sequences, e.g., when infecting cells with this vector, the RNA sequences of the present invention, such as, but not limited to, those illustrated in Figures 16A-B. retroviral vectors capable of producing proviruses capable of expressing shRNA sequences.

In some aspects, the present invention relates to a composition comprising an RNA sequence disclosed herein (eg, but not limited to the shRNA sequence illustrated in FIGS. 16A-B) and a pharmaceutically acceptable excipient. In some embodiments, the composition comprises a vector disclosed herein and a pharmaceutically acceptable excipient. In some embodiments, a composition of the present invention comprises two or more RNA sequences disclosed herein.

In another aspect, the invention includes a method of inhibiting the activity or expression of hepatitis C virus. The method includes providing a cell capable of expressing hepatitis C virus and contacting the cell with the RNA sequence disclosed in the present invention (the sequence illustrated in FIGS. 16A-B as a non-limiting example). . The cell can be a mammal, eg, a human or a non-human primate such as a chimpanzee. In certain embodiments, the cell is in contact with two or more RNA sequences.

In some aspects, the present invention provides a method of identifying a subject infected with or suspected of being infected with hepatitis C virus, the subject providing a therapeutically effective amount of a composition containing one or more different RNAs disclosed herein. It provides a method comprising the steps. In some embodiments, the method also includes determining whether the subject's viral population has decreased after providing the subject with the composition. In some embodiments, the method also includes determining whether the subject reduced one or more viral proteins or viral nucleic acid sequences after providing the composition to the subject.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The same or similar methods and materials as those described herein can be used to practice or test the invention, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description, drawings, and claims.

1A shows the IRES nucleotide sequence of the 1a genotype of hepatitis C virus (see GenBank Accession No. AJ242654). Nucleotides of the target region, 344 to 374, are underlined. The various regions (shown in bold) include Heptazyme ™ ribozyme (siRNA.com; positions 189-207), Chiron 5U5 siRNA [25] (positions 286-304), ISIS 14803 phosphorothioate antisense oligonucleotides [34] (positions 330-330). 349), and was successfully targeted by inhibitors including Mizusawa 331 siRNA [15] (positions 322-340) and phosphorodiamidate phosphorolino oligomers [8,35] (positions 344-363). A more detailed list of siRNAs tested for down regulation of HCV IRES and other HCV components can be found in [2,3].

Figure 1b is a diagram showing the RNA sequence of shRNA HCVa-wt (shRNAl) generated by pol III transcription of the corresponding DNA template from the U6 promoter and its mutants. Two base pairs (underlined) of HCVa-wt were altered to produce a form of HCVa-wt containing 1 (HCVSNPl or HCVSNP2) or 2 mismatch (HCVa-mut) shRNA as shown.

Figure 1c is a diagram showing the sequence of shRNA HCVb-wt (sh9), HCVc-wt (shlO) and HCVd-wt (sh11).

1D is a diagram showing the secondary structure of HCV IRES indicating target sites for shRNA HCVa-wt, HCVb-wt, HCVc-wt and HCVd-wt.

1E is a schematic of the pCDNA3 / HCV IRES double luciferase reporter construct used to generate the EMCV IRES control and HCV IRES targets, lacking any targets for HCV-designated shRNA by replacing HCV IRES with brain myocarditis virus-derived IRES. . In each case, firefly luciferase expression was dependent on initiation of translation from the IRES sequence, while Renilla luciferase was expressed in a cap dependent manner.

1F is a bar graph depicting the results of screening shRNAs for their ability to inhibit HCV IRES-mediated gene expression in 293FT cells. 293FT cells were cotransfected with pCDNA3 / HCV IRES double luciferase construct, pSEAP2 (transfection and specificity control) and shRNA (1 nM) in wells of a 24-well tissue culture plate. Plasmid pUC18 was added to provide a total of 800 ng of nucleic acid per well. 48 hours after transfection, cells were lysed and firefly luciferase activity was measured with a luminometer. All data were performed three times individually and independently and normalized to SEAP.

FIG. 2A is a bar graph showing the results of experiments testing inhibition of HCV-IRES driven gene expression in 293FT cells co-transfected with a double luciferase reporter and SEAP expression plasmid and 1 mole of in vitro transcribed shRNA. The target plasmid was pCDNA3 / HCV IRES dual luciferase reporter (HCV IRES as shown in FIG. 1E). Firefly luciferase activity was measured as described in Example 1. Firefly luciferase and SEAP activity were normalized to 100.

2B is a bar graph depicting the results of experiments testing HCV versus EMCB inhibition in 293FT cells. Results are shown as luciferase activity divided by SEAP activity and normalized to 100.

2C is a bar graph depicting the results of experiments verifying the effect of single base mismatch on the efficacy of shRNA. Experimental conditions are as described in FIG. 2A. SNPl and SNP2 contain mutated base pairs as shown in FIG. 1B.

FIG. 2D is a line graph depicting the results of experiments testing dose-responsive inhibition of HCV-IRES-driven gene expression by HCVa-wt and mutant (HCVa-mut) or control (229) shRNAs. Experimental conditions were as described in Figure 2a. Data are shown as luciferase divided by SEAP and normalized to 100. All data are the results of three separate and independent runs.

FIG. 2E is a line graph depicting the results of experiments testing the dose response of HCVa-wt, HCVa-mut and 229 shRNA to gene expression from dual luciferase reporters lacking shRNA target sites. The procedure is as described in FIG. 2D except that the target is a firefly luciferase expressed from EMCV IRES instead of HCV IRES.

FIG. 2F shows denatured gel electrophoresis of 10 μg of total RNA from cells transfected with no inhibitor (lane 1), 229 (lane 2), HCVa-wt (lane 3) or HCVa-mut (lane 4). , A copy of the Northern blot analysis of cotransformed 293FT cells treated with hybridization with ³² P-labeled fLuc, SEAP or elongation factor 1A (EF1A) cDNA probes. This RNA blot was exposed to storage phosphor screens for visualization and quantification (BioRad FX Molecular Imager).

FIG. 3A is a line graph depicting test results of dose response testing for HCVa-wt and HCVa-mut shRNAs using human liver cell line Huh 7. The procedure is as described in FIG. 2D except that Huh7 cells were used.

3B is a line graph depicting the results of experiments verifying that HCVa-wt shRNA did not inhibit analogous targets lacking HCV IRES. Cells were transfected as in FIG. 3A except that pCDNA3 / EMCV IRES dual luciferase reporter (EMCV IRES) was added instead of pCDNA3 / HCV IRES dual luciferase reporter (HCV IRES). All data are shown as luciferase activity divided by SEAP. All data were obtained from three separate and independent experiments.

FIG. 4A shows the sequences for seven 19 base pair virus recognition sequences of synthetic siRNA and shRNA contained within a 25 nucleotide (SEQ ID NO: 26) target site of HCV 1a genotype and on 10% natural polyacrylamide gel stained with ethidium bromide Figure is the analysis of purity. siRNA: antisense and sense strands containing 3'-UU overhangs; shRNA: loop sequence and 3 ', 5'-terminal overhangs are identical to those of 25 base pair shRNAs.

4B is a bar graph depicting the results of experiments analyzing the inhibitory capacity of HCV IRES-mediated gene expression at RNA inhibitors (siRNA and shRNA) at inhibitor concentrations of 1 nM in 293FT cells.

4C is a bar graph depicting the results of an experiment analyzing the inhibitory capacity of HCV IRES-mediated gene expression at an inhibitor concentration of 0.1 nM in 293FT cells for RNA inhibitors.

FIG. 5A shows simultaneous double luciferase HCV IRES reporter plasmid (10 μg) and SEAP (added as control for injection efficiency and nonspecific inhibition) simultaneously with 100 μg of indicated HCV shRNA or control 229 shRNA as described in Example 1. IVIS images of mice co-injected into the tail vein of mice, either in the form of a 100 μg pol III expressing plasmid expressing shRNA expressing (or pUC18 plasmid as a control). Following infusion, luciferin was administered intraperitoneally at various time points (24, 36, 48, 60, 72, 84 and 100 hours) and the mice were imaged using IVIS in an in vivo imaging system. This image is an image of a mouse at 84 hours.

5b is a graph quantifying the experimental results shown in FIG. 5a in which RNA is directly delivered. Quantification was performed using ImageQuant ™ software. Each time point represents an average of 4-5 mice. At 96 hours, the mice were bled and the amount of SEAP activity was measured by pNPP analysis as described in Example 1. Quantified data were divided by SEAP activity and expressed as normalized luciferase for pUC18 control mice (100%, no error bars were shown in the pUC18 control for clarity; error bars are similar to those shown in others).

FIG. 6 is a bar graph showing the results of experiments comparing inhibition of shRNA and phosphorodiamidate phosphorolino oligomers to HCV IRES-mediated reporter gene expression in mice. As described in the experiment of FIG. 5, a double luciferase HCV IRES reporter plasmid and 1 nmole of morpholino oligonucleotides shown to inhibit pSEAP and 100 μg of the indicated HCV shRNA inhibitor or previously HCV IRES expression construct [8] Were co-injected into mice. The mice were imaged at various time points (12 hours, 24 hours, 48 hours and 144 hours) after this treatment. Data shown are results at 48 hours. Quantified data is shown as SEAP activity and luciferase activity, normalized to pUC18 control (no additive) mice. The results shown are from three to five mice per construct.

FIG. 7 is a graph showing the results of experiments in which BHK-21 cells were transiently transfected with plasmids expressing inhibitory shRNAs targeting the nsp-1 gene. 24 hours after transfection, cells were cloned with 10 μl of GFP-expressing Semliki Forest virus (SFV-GFP-VA7; multiplicity of infection (MOI) was sufficient for approximately 100% infection). Virus mediated GFP expression was analyzed by flow cytometry 24 hours after infection. siRNA mediated inhibition was about 35%. Label: Nsp 1. shRNA target Nsp-1 gene (nsp-l # 2); Empty vector, pU6; Naive, uninfected BHK cells.

8 is a bar graph showing the results of experiments that investigated replication deficiency SFV (SFV-PD713P-GFP) inhibition by shRNA. BHK-21 cells were transiently transfected with plasmids expressing inhibitor shRNA. 46 hours after transfection, cells were infected with SFV-GFP virus with 8% PEG in serum-free medium for 1 hour and with MOI of 5. Then complete medium was added and the cells were incubated overnight at 37 ° C. Cells were flow cytometry 9, 24, 32, 99 and 125 hours after infection. For clarity, only 3 hour points are shown (9, 24 and 32 hours). The amount of inhibition of each shRNA was normalized to the capsid shRNA. Capsid shRNA has no effect on GFP expression because capsid mRNA is not present in SFV-GFP replication deficient virus. The transfection efficiency of shRNA expressing constructs in this experiment is about 70%, suggesting that the actual viral inhibition is significantly higher than indicated. The fifth bar (mixed) refers to a mixture of shRNA targets 1-4 and capsid.

9 is a line graph showing experimental results of testing HCV replicon inhibition by shRNA.

FIG. 10 is a table showing the results and sequences of shRNA screening for the ability to inhibit HCV IRES-mediated gene expression in 293FT cells. Cells were cotransfected with pCDNA3 / HCV IRES dual luciferase reporter construct (40 ng), pSEAP2 (25 ng, transfection and specificity control) and shRNA (1 or 5 nM) in wells of a 48 well tissue culture plate. (Using Lipofectamine ™ 2000). Plasmid pUC18 was added to provide a total of 400 ng nucleic acids per well. 48 hours after transfection, supernatants were obtained and used for SEAP analysis, cells were lysed and firefly luciferase activity was measured with a luminometer. All data is the result of at least three separate experiments. SEAP levels were uniform in all samples. Control experiments to analyze the specificity of shRNA were performed on the mutated pCDNA3 / HCV IRES double luciferase reporter construct, with U replaced C340 (in IRES).

FIG. 11 is a schematic representation of the 3 'terminal sequence of HCV IRES with segments targeted by shRNA. Mutant C340 → U (used to analyze specificity of shRNA) is indicated.

12A is a schematic showing the target position for six shRNAs of 19-bp and the 5 ′ end of HCV IRES.

12B is a bar graph showing the results of screening shRNA for the ability to inhibit HCV IRES-mediated gene expression in 293FT cells. The experiment was performed as in FIG. 10; shRNA concentration is 1 nM.

FIG. 13A is a schematic representation of the sequence of test variants of 25 base pair shRNAs shown having various loop sizes and sequences and 3 ′ ends tested.

FIG. 13B is a bar graph showing the results of screening the shRNA shown in FIG. 13A for the ability to inhibit HCV IRES-mediated gene expression in 293FT cells. The experiment was performed as in FIG. shRNA concentration was 1 nM (shRNA sequences are listed in FIGS. 16A-B).

FIG. 14A is a schematic representation of the sequence of test variants of the depicted 19 bp shRNA with various loop sizes and sequences tested, including the 3 ′ end tested.

FIG. 14B is a bar graph showing the results of screening the shRNA shown in FIG. 14A for the ability to inhibit HCV IRES-mediated gene expression in 293FT cells. FIG. The experiment was performed as described in FIG. shRNA concentration, 1 nM (shRNA sequences are listed in FIGS. 16A-B).

15 is a bar graph showing the results of screening shRNA (and siRNA) for inhibitory activity in HCV replicon system. Human hepatocytes (AVA5, Huh7 cell line derivatives) stably expressing HCV subgenomic replicon were transfected with RNA inhibitors and HCV expression levels were measured. The concentration range was tested and the concentration of sh / siRNA showing 50% inhibition (EC50) was measured. Black bars and light bars represent the results of two separate experiments.

16A-B are tables showing the indicated shRNNA sequence target HCV IRES. shRNA loops are underlined. The nucleotides shown below are non-complementary to the target.

The present invention provides compositions, methods and kits for the inhibition of viral (eg, hepatitis C) gene expression in mammals and / or for the treatment of viral infections.

 RNA interference provides a novel therapeutic method for the treatment of viral infections. The present invention uses small interfering RNAs (eg, shRNAs and siRNAs) that target viral sequences and inhibit (ie, reduce or eliminate) viral gene expression and such small interfering RNAs to treat viral infections in mammals such as humans. Provide a way to. In some embodiments, the small interfering RNA constructs of the present invention inhibit gene expression of a virus by inducing cleavage of the viral polynucleotide sequence in or near the target sequence recognized by the antisense sequence of the small interfering RNA.

As used herein, “small interfering RNA” refers to an RNA construct comprising one or more short sequences that are at least partially complementary to or interact with the polynucleotide sequence of a virus. The interaction may be in the form of a direct bond between the complementary (antisense) sequence of the small interfering RNA and the polynucleotide sequence of the viral target or an enzyme mechanism (eg, protein complex) that allows the antisense sequence of the small interfering RNA to recognize the target sequence. It may be in the form of indirect interactions through. In some cases, recognition of the target sequence by the small interfering RNA cleaves the viral sequence in or near the target site recognized by the recognition (antisense) sequence of the small interfering RNA. The small interfering RNA may contain only ribonucleotide residues, or the small interfering RNA may contain one or more modification residues, particularly at the ends of the small interfering RNA or on the sense strand of the small interfering RNA. As used herein, the term “small interfering RNA” includes shRNAs and siRNAs, both of which are understood and known to those skilled in the art to refer to RNA constructs having particular arrangement types and properties.

As used herein, “shRNA” refers to an RNA sequence comprising a double stranded region and a loop region that forms a hairpin loop at one end. The length of the double stranded region is generally about 19 nucleotides to about 29 nucleotides long on each side of the stem and the length of the loop region is generally about 3 to about 10 nucleotides in length (3'- or 5'-terminal single strand overhang) Nucleotides are optional). One example of such shRNA, HCVa-wt shRNA, has a 25 base pair double stranded region (SEQ ID NO: 12), a 10 nucleotide loop, a GG overhang at the 5 'end and a UU overhang at the 3' end. For example, further examples of suitable shRNAs for use in the inhibition of HCV expression are provided throughout the specification, such as in FIGS. 16A-B.

As used herein, "siRNA" refers to an RNA molecule comprising a double stranded region with a 3 'overhang of nonhomologous residues at each end. Double stranded regions are generally about 18 to about 30 nucleotides in length and the overhangs are non-homologous residues, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, It can be any length of 13, 14, 15, 16 or more nucleotides. siRNA may also comprise two or more segments of 19-30 base pairs separated by unpaired regions. Without taking any particular theory, unpaired regions can act to prevent activation of inherent immune pathways. One example of such siRNA is a HCVa-wt siRNA with a 25 base pair double stranded region (SEQ ID NO: 12) and a UU overhang at each 3 'end.

In one embodiment, the small interfering RNA as disclosed herein comprises a sequence that is complementary to the sequence of the internal ribosomal entry site (IRES) component of hepatitis C ("HCV"). In one embodiment, the virus is HCV Ia genotype.

siRNA gene inhibition has been shown to strongly inhibit gene expression in many mammalian families. Because of the high level of secondary structure, HCV IRES has been suggested as a poor target for siRNA or shRNA. However, Mizusawa reported 50% and 74% knockdown of gene expression in 293 and Huh7 tissue culture cells, respectively, and reported successful targeting of HCV IRES. Similarly, Seo and colleagues [25] reported the inhibition of HCV replication of 100 nM siRNA in 5-2 Huh7 cells (about 85% knockdown). Small interfering RNAs (shRNA and siRNA) directed to the 3 ′ end of HCV IRES as disclosed herein, including downstream of the AUG translation initiation site, knock down 96% of HCV IRES-dependent luciferase expression at 0.3 nM in 293FT cells. And 75% knockdown at 0.1 nM in Huh7 cells (see FIGS. 2D and 3A). Furthermore, direct delivery of shRNA to mouse liver has been shown to strongly inhibit HCV IRES-dependent reporter expression. This is the first demonstration of RNAi-mediated gene inhibition in animal models after direct delivery of RNA hairpins (not expressed from plasmids or viral vectors in vivo). The effect of shRNA delivered directly to mouse liver after hydrodynamic injection was surprising given the high concentration of nucleases found in the blood. The observation that these shRNAs effectively knock down gene expression in the liver suggests that these shRNA inhibitors are very effective in causing (1) gene suppression so that large amounts are not needed in the liver of mice, or (2) amounts that prevent inhibitory effects, for example. Or is (3) essentially stable to nuclease degradation (or a combination of these properties) prior to cleavage by the nuclease.

The report suggests that promoters in transcripts from bacteriophages synthesized in vitro strongly induce interferon (IFN) alpha and beta due to the presence of non-natural 5 'triphosphates [26]. In addition, shRNAs expressed from pol III expression vectors can also induce IFN [27]. It is not clear how this interferon induction affects the use of shRNA in clinical measures against HCV infection. Current HCV treatment, including treatment with interferon alpha, suggests that interferon may have a positive effect when induced by shRNA. To date, no interferon-related side effects have been reported in animals after administration of RNAi [3]. When siRNAs or shRNAs are delivered by lentiviral vectors, further concerns have been raised regarding the potential cytotoxic effects as well as the off-target effects of siRNAs [28].

The present invention also relates to methods for identifying siRNAs and shRNAs targeting HCV IRES sequences to identify sequences having sufficient activity (eg, the highest activity among a select group of such sequences) to be candidates for use as therapeutic agents. . The test may also include screening for small interfering activity with undesirable off-target or general cytotoxic effects. Off-target effects include inhibition of expression of nontargeting genes and competition with native microRNA pathways without restriction knockdown of nontargeting genes [Birmingham et al., Nat . Methods . 2006 3 (3): 199-204; Grimm et al., Nature 2006 441 (7092): 537-541). Methods for confirming cytotoxic effects are known in the art [eg, Marques et al., Nat . Biotechnol . 2006 24 (5): 559-565; Robbins et al., Nat . Biotechnol . 200624 (5): 566-571).

In the HCV 5'-UTR, the IRES region is highly conserved (92-100% homology [15, 29-31]) and has several segments that are considered invariant, making IRES a major target for nucleic acid-based inhibitors. . The area around the AUG translation initiation codons is particularly highly conserved and is constant at the positions +8 to -65 (except for single nucleotide modifications at the -2 position) as observed in 81 or more isolates taken from various geographic locations [32 ]. Despite the preservation of sequences in the IRES motifs, even highly conserved targeting of single sequences does not appear to be sufficient to prevent escape variants. RNA viruses are known to have high mutation rates because of the high error rate of RNA polymerase and the lack of corrective activity of the enzyme. On average, each time HCV RNA is replicated, one error is introduced into the new strand. This error rate is compounded by the massive production of viral particles in active infections (about 1 trillion daily in chronically infected patients) [33]. Thus, in some embodiments of the present invention, some conserved sites are targeted or alternatively shRNAs as disclosed herein are used as a component of combination therapy, such as ribaviran and / or PEGylated interferon. As demonstrated herein, since one mismatch does not completely block shRNA activity (see Example 2, FIG. 2D), each different shRNA may have some activity against a limited number of mutations. Thus, the present invention includes methods for inhibiting HCV expression using shRNAs that may include mismatches to target sequences. The invention also includes a method of inhibiting HCV expression by administering two or more different shRNAs that target HCV IRES such that shRNAs differ in the target sequence.

McCaffrey and colleagues reported that phosphorodiamidate morpholino oligonucleotides induced with conserved HCV IRES at the AUG translation initiation site strongly inhibited reporter gene expression [8]. The same morpholino inhibitors were used for comparison to the shRNA inhibition disclosed herein. Both shRNAs and morpholinos targeting the conserved HCV IRES sites have been found to be effective and potently inhibiting IRES-dependent gene expression. Four mutations in morpholino required blocking activity whereas two changes in shRNA were sufficient, suggesting greater shRNA specificity. This potential advantage is balanced by the increased stability of the morpholino oligomers, with the shRNA inhibitor being non-natural residues and consequently having fewer side effects.

A double reporter luciferase plasmid in which firefly luciferase (fLuc) expression is dependent on HCV IRES was used [24]. Expression of upstream Renilla luciferase is not HCV IRES-dependent and is translated in Cap-dependent processes. Direct translation of HCV IRES shRNAs or alternatively shRNAs expressed from pol III-promoter vectors efficiently blocked HCV IRES-mediated fLuc expression in human 293FT and Huh7 cells. Control shRNAs containing double mutations had little or no effect on fLuc expression and shRNAs containing only single mutations showed partial inhibition. These shRNAs were also evaluated in mouse models in which DNA constructs were delivered to intrahepatic cells by hydrodynamic transfection through the tail vein. Dual luciferase expression plasmids, shRNAs and secreted alkaline phosphatase plasmids were used for transfection of intrahepatic cells and the animals were imaged at various time points over 12-96 hours. In vivo imaging has shown that HCV IRES shRNAs are expressed directly or alternatively from polIII-plasmid vectors to inhibit HCV IRES-dependent reporter gene expression, and mutations or inappropriate shRNAs have little or no effect. These results indicate that shRNAs delivered as RNA or expressed from viral or nonviral vectors are useful as effective antiviral agents for controls of HCV and related viruses.

Analysis of three additional shRNAs targeting different sites in HCV IRES domain IV revealed another effective shRNA, HCVd-wt, whose target position was shifted 6 nucleotides from the target position of HCVa-wt. HCVb-wt and HCVc-wt were much less effective inhibitors.

To further investigate the effect of the local sequence on efficacy, it includes 19 base pair sequences complementary to the sequence of HCV IRES, targeting all possible positions within the 25 base pair sites of HCVa-wt (344-368). Corresponding synthetic siRNAs comprising 7 in vitro transcription shRNA constructs and the same 19 base pair sequences were analyzed for inhibitory activity. 25 base pair synthetic siRNAs corresponding to HCVa-wt shRNA were also tested. All of the tested constructs showed high levels of activity. In general, 19 base pair siRNAs were more potent than 19 base pair shRNAs. The strongest siHCV19-3 was effective at concentrations of 1 nM (> 90% inhibition), 0.1 nM (about 90% inhibition) and even 0.01 nM (about 40% inhibition). Thus, 19 to 25 base pair shRNAs and siRNAs designed to target 344-374 regions on HCV IRES are generally potent inhibitors of locally slightly different HCV expression.

The small hairpin RNAs of the present invention may optionally include structures that create strong non-covalent bonds between the sense and antisense strands of shRNA. Examples of such non-covalent bonds include crosslinks mediated by metal ions. Such crosslinking is described in Kazakov and Hecht 2005, Nucleic Acid-Metal Ion Interactions.In: King, RB (ed.), Encyclopedia of Inorganic Chemistry . As described in Second Edition, Wiley, Chichester, Volume VI, pages 3690-3724, such as section 5.4.3), for example, may be formed between natural or modified nucleotide residues including modified bases, sugars and end groups. Further non-limiting examples of variations of this combination are found in patent application WO 99/09045 (US 2006074041; for example FIG. 10). In general, the position of the crosslinkable nucleotide residue is at the end of the complementary RNA strand proximal to the double strand formation. The addition of certain metal ions (or metal ion covalent compounds) may be used to form functional groups with strong affinity for these metal ions such as -SH, -SCH ₃ , phosphorothioate, imidazolide, o-phenanthroline, and the like. Can be crosslinked. These modified nucleotides are introduced during chemical synthesis of the sense and antisense RNA strands. The modified nucleotides in the sense and antisense strands may form base pairs or may be part of 1-3 nucleotide overhangs.

Target sequence

Examples of target sequences are provided in the specification. Non-limiting examples of target sequences are provided, for example, in Table 1 and FIG. 10. Non-limiting examples of shRNAs and siRNAs comprising a target sequence are shown in the specification, such as in FIGS. 1 and 16A-B.

Loop

The effect of the size and sequence of the loop region of shRNA was also investigated. The loop region of the shRNA stem-loop can be as small as 2 to 3 nucleotides and has no apparent upper limit in size, and in general the loop is 4 to 9 nucleotides and generally has unintended effects, for example by complementary to nontarget genes. Is a sequence that does not cause. Highly structured loop sequences, such as GNRA tetraloops, can be used (eg, as loops) in loop regions within shRNAs. The loop can be at either end of the molecule, ie the sense strand can be 5 'or 3' with respect to the loop. In addition, non-complementary double stranded regions (about 1 to 6 base pairs, such as 4 CG base pairs) can be located between the target double strand and the loop to act as a "CG clamp" to enhance double strand formation. When using non-complementary double strands, more than 19 base pairs of target-complementary double strands are required.

Loop structures are also described, for example, in Earnshaw et al., J. MoI . Biol . , 1997, 274: 197-212; Sigurdsson et al. Thiol-Containing RNA for the Study of Structure and Function of Ribozymes. METHODS: A Companion to Methods in Enzymology, 1999, 18: 71-77, as well as reversible bonds, such as SS bonds, which can be formed by oxidation of the -SH group introduced into a nucleotide residue. Non-limiting examples of positions for nucleotide residues with SH groups are at the ends of complementary RNA strands proximal near proximal upon double strand formation. Such modified nucleotides are introduced during chemical synthesis of the sense and antisense RNA strands of small interfering RNA. The modified nucleotides in the sense and antisense strands may form base pairs or form non-complementary overhangs of one to three nucleotides.

Additional non-limiting examples of loops and their applications, such as shRNA and siRNA target HCV, can be found in the Examples.

end

The 3 ′ end of a shRNA as disclosed herein may have a non-target-complementary overhang of two or more nucleotides, such as for example UU or dTdT, but the overhang includes, for example, chemically modified nucleotides that promote increased nuclease resistance. May be any nucleotide. In other embodiments, there are 1 or 0 nucleotide overhangs at the 3 'end.

The 5 'end may have a non-complementary overhang, such as two Gs (as shown in Figure IB), a GAAAAAA sequence, or only one or zero nucleotide overhang beyond the target-complementary double stranded region. In the sequence shown in FIG. IB, two 5 'G's are included mainly for each of the transcriptions from the T7 promoter.

Additional features

Additional measures optionally included in the shRNAs used to inhibit HCV expression and further encompassed by the present invention include, but are not limited to, length modifications from about 19 base pairs to about 30 base pairs in the target complementary double stranded region, in targeted sequences. Small shifts (typically 0 to about 2 nucleotides) and shifts as large as about 10 nucleotides in any direction along the target that may be within the targetable region. Likewise, mismatches are also acceptable and are about 1 to about 2 in the antisense strand and about 1 to about 9 in the sense strand, the latter destabilizing the hairpin double strand but not affecting the binding strength of the antisense strand to the target, The number allowed depends in part on the length of the target-complementary double strands. As disclosed herein, shRNAs having seven or more G-U mismatches in 29 base pair target-complementary double stranded regions, such as sequences targeting HCV IRES, can be used successfully for inhibition of HCV expression. Note that, in particular, the two mutations shown in FIG. 1B greatly inhibit inhibition, but other mutations with mutations in other positions may be more tolerable, especially if they are closely spaced and / or close to the ends. Some variants are known in the art or have been demonstrated in this application.

vector

Suitable vectors for preparing shRNAs and siRNAs are disclosed herein and known in the art. In a non-limiting example, shRNAs can be expressed using Pol III promoters such as U6 or H1 in vectors derived from adeno-associated virus or lentiviruses. Human U6 nuclear RNA promoters and human H1 promoters belong to Pol III promoters for the expression of shRNAs.

In general, one desirable feature in vectors is relatively extended transgene expression. Lentiviral vectors can transduce undivided cells and maintain sustained long-term expression of the transgene. Adeno-associated virus serotype 8 is considered stable and is characterized by prolonged transgene expression.

Canada shRNA  And siRNA

In some cases, one or more small interfering RNAs have been found to have inhibitory activity of targeted viruses such as HCV. Further tests can be conducted to further characterize the stability of such RNA, such as in use to inhibit HCV expression in animals. Animal models can be used for these tests. One non-limiting example includes a mouse model, eg as illustrated in Example 3 ( infra ). Other animal models suitable for HCV treatment tests are known in the art, such as using chimpanzees.

Way

The present invention includes contacting a virus with a small interfering RNA as disclosed herein, such as shRNA or siRNA, comprising a sequence that is at least partially complementary to the polynucleotide sequence of the virus and capable of interacting with the polynucleotide sequence of the virus, A method of inhibiting gene expression in a virus. In some embodiments, contacting the virus comprises introducing small interfering RNA into the cell containing the virus, ie, the virus infected cell. As used herein, "inhibiting gene expression" means reducing (ie, decreasing levels) or eliminating the expression of one or more genes of a virus. For example, reduced expression is compared to the corresponding cell or animal infected with the virus. In some embodiments, inhibition of gene expression is performed by cleaving the target sequence of the virus to which the small interfering RNA is bound. Gene expression can be analyzed by analyzing viral RNA or viral proteins. In some embodiments, the effectiveness of a method (eg, treatment with a composition disclosed herein) may cause an infected animal to alleviate symptoms or to change the expression or activity of a protein associated with a viral infection, such as a viral protein such as p24 or a host protein such as interferon. (E.g., decrease).

The invention also encompasses a polynucleotide sequence of a virus, such as a sequence that is at least partially complementary to the IRES sequence of HCV and capable of interacting with the sequence (eg, exerting hybridization or RNAi activity under physiological conditions). A subject having a treatment or suspected infection of a viral infection in a mammal, comprising administering to the mammal a composition comprising a therapeutically effective amount of a small interfering RNA, such as shRNA or siRNA, as disclosed herein (subject to a virus for prevention treatment) A method of treating an exposed individual). In some embodiments, the mammal is a human. In some embodiments, the mammal is a human and the viral infection is an HCV infection, such as an infection by HCV Ia genotype and the small interfering RNA comprises a sequence that is at least complementary to the sequence of the IRES of HCV.

As used herein, a “therapeutically effective amount” is the amount of small interfering RNA that can produce a desired therapeutic result (eg, alleviation or exclusion of viral infection). The therapeutically effective amount may be administered in one or more doses. Non-limiting examples of doses are about 0.1 mg / kg to about 50 mg / kg, such as about 1 to about 5 mg / kg. Suitable methods of delivery are known in the art and include, for example, intravenous administration (eg, via peripheral vessels using catheters). Non-limiting examples include delivery through the hepatic artery or the portal vein.

In general, in a method for treating a viral infection in a mammal, small interfering RNA is administered with a pharmaceutically acceptable carrier. As used herein, a "pharmaceutically acceptable carrier" (also referred to herein interchangeably as a "pharmaceutically acceptable excipient") is a relatively inert material that facilitates the administration of small interfering RNA (s). For example, the carrier can provide a shape or concentration to the composition or act as a diluent. Pharmaceutically acceptable carriers are suitable for particular routes of administration for materials that are biocompatible (ie, nontoxic to the host) and are pharmacologically effective. Suitable pharmacologically acceptable carriers include, but are not limited to, stabilizers, humectants and emulsifiers, salts for altering osmoticity, capsulating agents, buffers and skin penetration enhancers. In some embodiments, the pharmacologically acceptable carrier is water or saline. Examples of pharmacologically acceptable carriers are described in Remington's. Pharmaceutical Sciences (Alfonso R. Gennaro, ed., 18th edition, 1990).

In methods for the treatment of viral infections, small interfering RNAs as disclosed herein are generally administered parenterally, such as subcutaneously, intravenously or intramuscularly.

Composition

The present invention provides compositions for the inhibition of viral gene expression and / or for the treatment of viral infections in a mammal comprising one or more small interfering RNAs as disclosed herein. Compositions of the invention may comprise two or more small interfering RNAs as disclosed herein. According to the present invention, small interfering RNAs, such as shRNAs or siRNAs, comprise sequences that are substantially complementary to viral polynucleotide sequences of about 19 to about 30 nucleotides, wherein the viral Interaction of polynucleotide sequences inhibits expression of viral genes, for example by cleavage of viral polynucleotide sequences.

In some embodiments, the composition comprises a shRNA comprising a sequence selected from the group consisting of SEQ ID NOs: 12, 17, 18, 19, 20, 21, 22, 23, 24, and 25. In some embodiments, the composition comprises SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 , SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55 or SEQ ID NO 56 (Table 10) shRNA comprising one of the. In some embodiments, the composition comprises one or more shRNAs of SEQ ID NOs: 57-110. In some embodiments, the composition comprises an siRNA comprising a sequence selected from SEQ ID NOs: 19, 20, 21, 22, 23, 24, and 25. In other embodiments, the composition comprises SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 , SEQ ID NO 45, SEQ ID NO 46, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 54, SEQ ID NO 55 or SEQ ID NO 56 (FIG. SiRNA comprising the sequence of 10). In some embodiments, the composition comprises a shRNA or siRNA that binds to a sequence of about 19 to about 30 nucleotides in the IRES component of HCV, such as HCV genotype Ia, ie, comprises a sequence that is substantially complementary to that sequence. The composition may comprise one or more different shRNAs, such as shRNAs that target different alleles or mutations of different sequences or target sequences of the IRES. A shRNA or siRNA as disclosed herein can comprise one or more identified sequences. Some compositions include one or more different shRNA or siRNA sequences.

In some embodiments, the present invention provides a pharmaceutical composition comprising a small interfering RNA as disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for parenteral administration to a mammal, such as a human.

Pharmaceutical compositions comprising short interfering RNAs (eg, siRNAs or shRNAs) are formulated to suit their intended route of administration. Examples of routes of administration include parenteral administration, such as intravenous administration, intradermal administration, subcutaneous administration, aspiration, transdermal (topical) administration, transmucosal administration and rectal or oral administration. The solutions or suspensions used for parenteral, intradermal or subcutaneous application include sterile diluents such as the following components: water for injection, saline solution, nonvolatile perfume oil, polyethylene glycol, glycerin, propylene glycol or other synthetic solvents; Antibacterial agents such as benzyl alcohol or methyl parabens; Antioxidants such as ascorbic acid or sodium bisulfite; Chelating agents such as ethylenediaminetetraacetic acid; Buffers such as acetate, citrate or phosphate and tonicity modulators such as sodium chloride or dextrose. pH can be adjusted using acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be packaged in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water soluble) or dispersions and sterile powders for the instant preparation of sterile injection solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ™ (BASF, Palfeni, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid to the extent that injection is easy. The composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (eg glycerol, propylene glycol and liquid polyethylene glycols, etc.) and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coatings such as lecithin, by the maintenance of selected particle sizes in the case of dispersions and by the use of surfactants. The action of microorganisms can be prevented by various antibacterial and antifungal agents such as, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In some cases, tonicity agents include, for example, sugars or polyhydric alcohols such as mannitol, sorbitol or sodium chloride. Absorption of the injectable composition can be extended by including in the composition an agent that delays absorption, such as aluminum monostearate or gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in a specific amount in an appropriate solvent containing one or a combination of ingredients mentioned above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and other ingredients selected from the aforementioned ingredients or other ingredients known in the art. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and lyophilization, which produce a powder of the active ingredient and any further desired ingredients from a sterile filtered solution.

Oral compositions generally include an inert diluent or an edible carrier. For oral therapeutic administration purposes, the active compounds can be incorporated with excipients and used in the form of tablets, troches or capsules such as gelatin capsules. Pharmaceutically suitable binders may be included as part of the composition. Tablets, pills, capsules, troches, and the like may be any of the following components: binders such as microcrystalline cellulose, tragacanth gum or gelatin; Excipients such as starch or lactose, disintegrants such as alginic acid, primogel or corn starch; Lubricants such as magnesium stearate or steotes; Glidants, such as colloidal silicon dioxide; Sweetening agents such as sucrose or saccharin; Or flavoring agents such as peppermint, methyl salicylate or orange flavor or compounds of similar nature.

For administration by aspiration, the compound is delivered in the form of an aerosol spray from a pressurized vessel or disperser or nebulizer containing a suitable propellant such as carbon dioxide.

Systemic administration may also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants suitable for the barrier to be penetrated are used in the formulation. Such penetrants are generally known in the art and include, for example, detergents, bile salts and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be effected through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are generally prepared in ointments, plasters, gels or creams as known in the art.

The compounds may also be prepared in the form of suppositories (including conventional suppository bases such as cocoa butter and other glycerides) or residual enemas for rectal delivery.

In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid removal from the body, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods of preparing such formulations will be apparent to those skilled in the art. Materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeting infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example as disclosed in US Pat. No. 4,522,811.

It is advantageous to formulate oral or parenteral compositions in unit dosage form to facilitate administration and to uniform the dosage. Unit dosage form as used herein refers to physically discrete units suited as unitary dosages for treating an individual, each unit being of a predetermined amount calculated to be associated with the selected pharmaceutical carrier to produce the desired therapeutic effect. Contains the active compound.

The toxicity and therapeutic efficacy of the compounds disclosed herein are known in the art, for example, by measuring LD50 (lethal dose for 50% of the population) and ED50 (therapeutically effective dose at 50% of the population), for example in cell culture or test animals. It can be measured by an appropriate procedure. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the LD50 / ED50 ratio. Preferred are compounds that exhibit a high therapeutic index. Although compounds with toxic side effects can be used, care must be taken in the design of delivery systems that target these compounds to infiltrated tissue sites in order to minimize potential damage to uninfected cells and thereby reduce side effects.

Data from cell culture assays and animal studies can be used to formulate a series of dosage forms for use in humans. Dosage forms of such compounds preferably belong to a series of circulating concentrates with ED50 with little or no toxicity. Dosage forms may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods of the invention, the therapeutically effective dose can be estimated first from cell culture assays. Doses may be formulated in animal models to obtain a range of circulating plasma concentrations with an IC50 (i.e., the concentration of test compound that results in half the maximal inhibition of symptoms) as measured in cell culture. This information can be used to more accurately determine useful doses in humans. Plasma concentrations can be measured, for example, by high performance liquid chromatography.

The invention also relates to a method for the manufacture of a medicament for use in the treatment of an individual, such as, for example, HCV infection. Such agents may also be used for the prophylactic treatment of individuals at risk of or suspected of having HCV infection.

Kit

The present invention provides a kit comprising a small interfering RNA as disclosed herein. In some embodiments, the kit also includes instructions for use in a method of inhibiting viral gene expression and / or a method of treating a viral infection in a mammal disclosed herein. The instructions may be provided in printed form or in the form of an electronic medium such as a floppy disk, CD or DVD, or in the form of a website address where such instructions are available.

In some embodiments, the kit includes information about a healthcare provider regarding the use of a pharmaceutical composition of the invention comprising one or more unit doses of one or more small interfering RNAs, such as shRNAs or siRNAs, and for use in the treatment or prevention of viral infections. Include instructions provided. Small interfering RNA is often included as a sterile aqueous pharmaceutical composition or as a dry powder (eg, lyophilized) composition.

Proper packaging is provided. As used herein, "packaging" means a solid matrix or material commonly used in a system that can maintain a composition of the present invention suitable for administration to an individual within fixed limits. Such materials include glass and plastic (eg polyethylene, polypropylene and polycarbonate) bottles, vials, paper, plastic and plastic-foil laminating envelopes, and the like. If e-beam sterilization techniques are used, the packaging should have a density low enough so that the contents can be sterilized.

The kit also optionally contains a sterile solution such as water for preparing the device for administration of the pharmaceutical composition of the invention and / or a solid powder (eg lyophilized) composition, such as for example a syringe or equipment for intravenous administration. And diluents such as saline or dextrose solutions.

Table 1 below lists the target sequences disclosed herein and examples of such shRNAs and siRNAs that can be introduced into shRNAs or siRNAs.

16A-B illustrate examples of shRNAs containing sequences targeting HCV IRES tested using the disclosed methods.

The invention is further illustrated by the following examples. This embodiment is provided for illustrative purposes only. These examples should not be construed as limiting the scope or content of the invention in any way.

Example  One

shRNA  Design of Expression Cassettes and Construction , T7  Transcriptional response, and reporter gene analysis

Chemically synthesized oligonucleotides were obtained from IDT (Coralville, Iowa), resuspended in water (Biowhittaker) containing no RNase and pyrogenic factors and annealed as follows. The following oligonucleotide pairs for preparing shRNAs are reported to promote T7 promoter component (two underlined), sense and antisense HCV IRES sequences, and miR-23 microRNA loop structures (21, 22). ]).

(T7 promoter sequence is underlined by two lines). T7 transcripts for HCVa-mut shRNAs were identical except that nucleotide changes (G → C and C → G) were inserted into the synthetic oligonucleotides at the underlined residues.

HCVa-wt shRNA (FIG. 1B) was designed to target regions 344-374 of HCV IRES; HCVb-wt was designed to target regions 299-323 (FIG. 1C); HCVc-wt was designed to target regions 318-342 (FIG. 1C); HCVd-wt was designed to target regions 350-374 (FIG. 1C).

ShRNA 1-7 (target positions 344-362, 345-363, 346-364, 347-365, 348-366, 349-367, 350-368 on HCV IRES; FIG. 4A showing 19 base pair virus recognition sequences ) Was transcribed in vitro using the MEGAscript® kit (Ambion) and included the same loop sequence and 5 ', 3'-protrusion as HCVa-wt shRNA. SiRNA 1-7 (see FIG. 4A showing 19 base pair virus recognition sequences) was chemically synthesized in Dharmacon (Lafayette, Colorado) and included 3′-UU overhangs in the sense and antisense strands.

Oligonucleotide pairs used to prepare a control shRNA 229 (targeting tumor necrosis factor alpha)

to be.

Pol III U6 shRNA  Expression vector Construction  -Small hairpin shRNA  Expression vector design

The oligonucleotide pairs were 95 for 2 minutes in RNA polymerase buffer (e.g. 120 μl each 100 μM oligonucleotide in 60 μl 5X anneal buffer (Promega; IX = 10 mM Tris-HCl, pH 7.5), 50 mM NaCl). Incubated together at ° C. and slowly cooled (annealed) to a temperature below 40 ° C. over 1 h. Oligonucleotides were designed to provide four base overhangs for rapid cloning into Bbs1 / BamH1-digested pCRII-U6 plasmids (Bbs1 and BamH1 recognition sites or overhangs are underlined in the oligonucleotide sequence). pCRII-U6 pol III expression plasmid, the primers and huU6-5 'ATCGATCCCCAGTGGAAAGACGCGCAG (SEQ ID NO: 5) and huU6- 3'- GGATCC GAATTC GAAGAC CACGGTGTTTCGTCCTTTCCACAA-5 ' ( SEQ ID NO: 6) of human HT-1080 genome by using the [23] PCR products obtained from DNA were prepared by subcloning into pCRII vectors (Invitrogen) using a TA cloning kit (Invitrogen). Cassettes of annealed oligonucleotides (coding HCV IRES shRNA) were ligated with Bbs1 / BamH1-digested pCRII-U6 plasmids. The expressed shRNAs contained miR-23 microRNA loop structures that promote cytoplasmic localization [21, 22]. The final pCRII-U6 construct was confirmed by sequencing. The primer pairs used were as follows: pHCVa-wt 5'-ACCG GAGCAC G AATCCTAAA C CTCAAAGA CTTCCTGTCA TCTTTGAG G TTTAGGATT C GTGCTC TTTTTTG-3 '( SEQ ID NO: 7) and 5'-G GATCCAAAAAA GAGCAC AATCCTAAA C CTCAAAGA TGACAGGAAG TCTTTGAG G TTTAGGATT C GTGCTC-3 '(SEQ ID NO: 8). PCRII-U6 / HCVa-mut (double mutation) as shown in FIG. 1B and disclosed above using oligonucleotides (see above) comprising appropriate sequence changes in the underlined residues, and HCVsnp1 (single change on the 5 'side) and HCVsnp2 (single change at the 3 ′ end) was formed. Oligonucleotides 5'- ACCGGGCG GTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAGA AGAGGCTGAGACATAGGCACCGCCTTTTTT-3 '(SEQ ID NO: 9) and 3'-GATCAAAAAAGGCGGTGCCTATGTCTCAGCCTCTTCTCATGACAGGAAGAGAGAAG AG pGGGAGA-5TAG using a control group (SECCICCGAGACATAGU)

T7  Transcriptional reaction

Oligonucleotide pairs are incubated together at 95 ° C. for 2 minutes in RNA polymerase buffer (eg 120 μl each 100 μM oligonucleotide in 60 μl 5X transcription buffer (Promega)) and at a temperature of less than 40 ° C. over 1 hour. It was cooled slowly (annealed). From 5 μM of the annealed double stranded DNA template generated using AmpliScribe ^™ T7 Flash Transcription Kit (Epicentre Technologies), shRNA was transcribed at 42 ° C. for 4 hours and then washed thoroughly three times with phosphate buffered saline (PBS) to remove preservatives. Purification on gel filtration spin column (Microspin ^™ G-50, Amersham Biosciences).

siRNA

SiRNAs were prepared by annealing chemically synthesized (Dharmacon) complementary RNA strands, each comprising an appropriate recognition sequence and a UU extension (projected) at the 3 'end.

Transfection and Reporter Gene Analysis

Human 293FT (Invitrogen) and Huh7 cells (American Microbiological Conservation Center (ATCC), Manassas, VA) were loaded with DMEM (10% fetal bovine serum (HyClone) supplemented with 2 mM L-glutamine and 1 mM sodium pyruvate. Biowhittaker®). The day before transfection, cells were seeded at 1.7 × 10 ⁵ cells / well in 24 well plates to obtain about 80% cell saturation upon transfection. Cells were transfected with Lipofectamine ^™ 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. For inhibition experiments, 293FT or Huh7 cells were cultured with 40 ng pCDNA3 / HCV IRES double luciferase (Renilla and firefly) reporter constructs, 50 ng pSEAP2-control plasmid (BD Biosciences Clontech, transfection control) and a designated amount of T7-generated Was transfected (triple) with shRNA (typically 1 pmole) or pCRII-U6 shRNA expression construct (710 ng). Supplemental pUC18 plasmid was added to the transfection mixture to give a final concentration of 800 ng total nucleic acid per transfection. After 48 hours, the supernatant was removed, heated at 65 ° C. for 15-30 minutes, and 5-10 μl of supernatant was added to 150 μl p-nitrophenyl phosphate liquid substrate system (pNPP, Sigma). After incubation for 30 to 60 minutes at room temperature, samples were read (405 nm) on a Molecular Devices Thermomax microplate reader and quantified using SOFTmax software (Molecular Devices). Remaining cells were lysed and luciferase activity was measured using a dual-luciferase reporter assay system (Promega) and a MicroLumat LB 96 P luminometer (Berthold).

mouse

Six-week-old female Balb / c mice were obtained from Stanford University Animal Lab. Animals were treated in accordance with NIH guidelines for animal care and Stanford University guidelines.

mouse Hydrodynamic injection  And In vivo  Imaging

A few modifications were made, including omission of RNasin, to perform hydrodynamic tail vein injections as described by McCaffrey and his team [24]. Mouse tail vein for approximately 5 seconds with a total volume of 1.8 ml phosphate buffered saline containing inhibitor (RNA or plasmid), 10 μg pHCV double Luc plasmid, and 2 μg pSEAP2-control plasmid (BD Biosciences Clontech, with SV40 early promoter) Injection slowly (N = 4-6 per group). At the indicated time, 100 μl of 30 mg / ml luciferin was injected intraperitoneally. Ten minutes after injection, live anesthetized mice were analyzed using the IVIS7 imaging system (Xenogen Corp., Alameda, CA) and the resulting luminescence data was quantified using LivingImage software (Xenogen). Raw values are reported as relative amounts of light detected per minute and the standard error of the mean for each group (N = 4-5 animals) is shown.

Secreted alkali Phosphatase ( SEAP ) analysis

On day 5 blood was drawn from the mice via the posterior ocular vein. Serum was separated from blood cells by microcentrifugation, heated at 65 ° C. for 30 minutes to inactivate endogenous alkaline phosphatase, and 5-10 μl serum was added to the 150 μl pNPP liquid substrate system (see above). After 30-60 minutes incubation at room temperature, samples were read (405 nm) and quantified as described above.

Example  2: in human tissue culture cells HCV IRES Of mediated gene expression shRNA  control

In this study, small interfering RNAs (shRNA and siRNA) designed as in Example 1 to target the conserved region of hepatitis C IRES were tested for their ability to inhibit HCV IRES-mediated reporter expression in human tissue culture cells. Was tested.

1A depicts HCV shRNA resulting from T7 transcription of a template prepared from a hybridized oligonucleotide comprising an HCV IRES target site (Panel A) and a T7 promoter sequence and an HCV IRES target (FIG. 1B). Underlined residues are those that are modified to form mutant HCV shRNAs. shRNAs can be hybridized through pairing other than Watson-Crick G: U base pairing with the mir-23 microRNA loop structure, which has already been proposed to promote cytoplasm localization [21, 22]. Guanine) and 25 'base pair RNA stems with two oligonucleotides at 3' (two uridines). For vector delivery shRNA, duplicate oligonucleotides were subcloned with polII expression vector (pCRIII-U6, see Example 1).

 Three different shRNAs with the same stem length and loop structure targeting the proximal location in domain IV of HCV IRES were also designed (FIG. 1C). HCVb-wt shRNA targets highly structured regions (used as negative controls for efficiency comparisons), while HCVc-wt and HCVd-wt shRNAs target more "accessible" regions according to biochemical footprinting studies. (FIG. 1D; Brown et al., Nucleic Acids Res., 1992, 20: 5041-5.). Similar to HCVa-wt shRNAs, all RNAs were transcribed in vitro from dsDNA templates containing the T7 promoter.

To test the effectiveness of HCV shRNAs that inhibit HCV IRES-mediated gene expression, human 293FT or hepatocyte Huh7 cells were tested for pCDNA3 / HCV IRES double luciferase expression plasmid, secreted alkaline phosphatase expression plasmid (pSEAP2, transfection efficiency). To polIII expression vectors containing in vitro synthesized shRNAs or alternatively corresponding shRNA cassettes.

As shown in FIG. 1F, both HCVa-wt and HCVd-wt shRNAs target the IRES regions just below the AUG translation initiation site (positions 344-368 and 350-374, respectively) and HCV in human 293FT cells. Strongly inhibits IRES-mediated fLuc expression. As expected, HCVc-wt (targeting 318-342) showed moderate inhibition, and HCVb-wt (299-323) had little to no activity. Thus, preliminary screening revealed that the effective shRNA was HCVa-wt, which was selected for further detailed study.

293 FT  In the cell shRNA On by HCV - IRES  Specificity and Efficacy of Inhibiting Mediated Gene Expression

To further test the inhibition of HCV-IRES induced gene expression, 293FT cells were cotransfected with a double luciferase reporter and SEAP expression plasmid as well as 1 pmol of in vitro transcribed shRNA. Target plasmid was pCDNA3 / HCV IRES dual luciferase reporter (HCV IRES, as shown in FIG. 1E). pUC18 plasmid was added to the transfection mixture to provide a final total nucleic acid concentration of 800 ng per transfection per well (24 well tissue culture plate). After 48 hours, the supernatant was removed for SEAP analysis, then the cells were lysed and firefly and Renilla (not shown) luciferase activity was measured as described in Example 1. Firefly luciferase and SEAP activity were normalized to 100. The results are shown in FIG. 2A.

HCVa-wt shRNA targeting the IRES region just below the AUG translation initiation site strongly inhibited HCV IRES-mediated fLuc expression in human 293FT (FIG. 2) and hepatocyte Huh7 (FIG. 3B) cell lines. Little or no inhibition was observed using mutant shRNAs (HCVa-mut) (inconsistent position, see FIG. 1B) or unrelated TNF (229) shRNAs comprising two changes in RNA hairpin pairing. 229 TNF shRNA was very effective in inhibiting TNF expression (Seyhan et al., RNA, 2005, 11: 837-846), suggesting that shRNA is effectively used by RNAi machinery. Single nucleotide changes in the hairpin region at upstream or downstream positions (SNP1 and SNP2, respectively, see FIG. 2C) have a partial effect.

Little or no inhibition was observed when HCV shRNA targeted a similar double luciferase construct in which HCV IRES was replaced with Brain Myocarditis Virus (EMCV) IRES (FIGS. 2B and 3B). The data in FIG. 2B illustrate that HCVa-wt shRNA does not inhibit similar targets lacking HCV IRES. In this experiment, cells were transfected as in FIG. 2A, except that pCDNA3 / EMCV double luciferase reporter (EMCV IRES) was used instead of pCDNA3 / HCV as a target. These data are shown in FIG. 2B, dividing luciferase activity by SEAP activity and normalizing to 100.

Northern blot analysis was performed to confirm whether shRNA acts by digesting the target mRNA (FIG. 2F). Equal amounts of total RNA isolated from cells without the inhibitor or transfected with HCVa-wt, HCVmut1 / 2, or 229 shRNA were isolated by gel electrophoresis. The isolated RNA was delivered to the membrane and hybridized to radiolabeled cDNA probes specific for fLuc, SEAP and elongation factor 1A (EF1A). HCVa-wt shRNA (lane 3) specifically inhibited fLuc mRNA accumulation after quantification with phosphorimager (63% compared to 229 shRNA (lane 2) when corrected for SEAP and EF1A levels) Inhibition; no inhibition on HCVa-mut1 / 2 was observed) (compare lanes 3 and 4). These data demonstrate that shRNAs degrade target mRNAs.

Dose response experiments showed that HCVa-wt shRNA effectively inhibits HCV IRES-dependent expression at 0.3 nM in 293FT cells (96% inhibition, see FIG. 2D) and 0.1 nM in Huh7 cells (75% inhibition, see FIG. 3A). Confirmed.

To further investigate local sequence effects on efficacy, in vitro transcribed 19 bp shRNA and corresponding synthetic 19 base pair siRNAs targeting all possible positions within the 31-base pair site (344-374; FIG. 4A) of HCVa. Seven were analyzed for inhibitory activity. A 25 base pair synthetic siRNA corresponding to HCVa-wt shRNA was tested. All of these showed high levels of activity (FIG. 4B). The most potent were siRNA 3 and siRNA and shRNA forms of HCV, which were effective at 1 nM (> 90% inhibition, FIG. 4B) and 0.1 nM (about 90% inhibition, FIG. 4C). Thus, 19-25 base pair shRNAs and siRNAs designed to target regions 344-374 on HCV IRES, with some local differences, are efficacious.

Example  3: mouse model system HCV IRES  Mediated gene expression shRNA  control

The ability to inhibit target gene expression of HCV shRNA and HCV shRNA expression plasmids has expanded into mouse model systems using hydrodynamic injections that deliver nucleic acids to the liver of the mouse. FIG. 5 shows mice (n = 4∼) containing large amounts of PBS (1.8 mL) containing pHCV double Luc, pSEAP2, and shRNA (10 fold excess relative to target by mass of pol III expression vector or shRNA expressing shRNA). The results of the injection into the tail vein of 5 mice) are shown. At the time point shown in FIG. 5B, luciferin was injected intraperitoneally and mice were imaged with a high sensitivity cold CCD camera. (FIG. 5A shows representative mice selected from each set (4-5 mice per set) at the 84 hour time point.) At all time points tested, HCV shRNA was compared to mice injected with pUC18 instead of shRNA inhibitors. Luciferase expression was certainly inhibited in the range of 98% (84 hour time point) to 94% (48 hour time point) inhibition. Mutant or control (229) shRNAs had little or no effect. Luciferase activity decreases over time due to amido DNA loss or promoter silencing [8] and the data is normalized at each time point (see description of FIG. 5 above).

FIG. 6 shows the results of comparing HCVa-wt shRNA inhibitory activity with phosphoramidite morpholino oligomers [8] previously found to effectively target the same site. Both HCVa-wt shRNA and morpholino oligomers effectively blocked luciferase expression at all time points tested. Data is shown at the 48 hour time point, with inhibition rates of 99.95% and 99.88% for HCVa-wt shRNA and morpholino inhibitors, respectively.

Example  4: shRNA Using Semliki Forest Virus ( SFV Suppression

SFV has been used as a model system for toxic positive strand RNA viruses. To investigate the inhibitory effect of RNAi on SFV growth, one mismatched to shRNA and nsp-4 sites targeting four SFV genes (nsp-1, nsp-2 and nsp-4 and capsid) Controls were formed and expressed from the U6 promoter. The ability to inhibit SFV-A7-EGFP proliferation, a form of SFV strain SFV-A7 capable of replication expressing the eGFP reporter gene, was tested [49]. A moderate decrease in SFV-GFP replication (approximately 35%) was observed in siRNAs targeting nsp-1 (FIG. 7), but mismatches were also found in siRNAs targeting nsp-2, nsp-4 or capsid coding regions. No decrease was observed in siRNA (not shown)

Sites within the capsid coding region previously identified as effective on Sindbis virus had no effect on SFV. Sindbis-SFV sequence homology at this site was only 77%. SFV is a very fast growing virus that produces up to 200,000 cytoplasmic RNA during the infection cycle. In order to investigate whether cells can be better protected from slower growing viruses, the effect of these siRNAs on replication defective strains of SFV-GFP was tested in two separate experiments. 8 shows that U6 expressed shRNAs targeting SFV strains can reduce virus expression ≧ 70% for a period of up to 5 days. This effect is one for nsp-4 as well as siRNAs targeting the nonstructural genes nsp-1, nsp-2, and nsp-4, except for the capsid gene (which is lacking in this incompetent virus) or other controls. It was confirmed using siRNA having a disagreement of (FIG. 8). The length of the sequence targeted by the shRNA is 29 nucleotides, and the single mismatch used for the nsp-4 mismatch shRNA does not explicitly destroy the RNAi effect. The wide variation in the effectiveness of various shRNAs clearly indicates the importance of a library approach to finding the best siRNAs and shRNAs when dealing with rapidly replicating and highly mutant viruses such as SFV.

Dose response experiments were conducted to investigate the inhibition of HCV replicon system in Huh7 cells by HCVa-wt shRNA and HCVa-mut shRNA and nonspecific control shRNA (229). The antiviral activity of the test compound was analyzed in AVA5, a cell line stably replicating HCV RNA induced by transfection of the human hepatocyte cell line Huh7 (Blight et al., Science, 2000, 290: 1972). RNA-based inhibitors were cotransfected with approximately 80% saturation culture with DsRed expression plasmids. HCV RNA levels were analyzed 48 hours after transfection using dot blot hybridization. Assays were performed in triplicate cultures. A total of 4-6 untreated control cultures, 10, 3, and 1 IU / ml α-interferon (active antiviral without cytotoxicity), and 100, 10, and 1 μM ribavirin (antiviral activity and cytotoxicity 3) cultures were used as positive antiviral and toxic controls. Transfection efficiency was evaluated by fluorescence microscopy (DsRed expression). HCV and b-actin RNA levels in triplicate treated cultures were determined as a percentage of the mean level of RNA detected in untreated cultures (6 total). Beta-actin RNA levels were used as a measure of toxicity and used to normalize the amount of cellular RNA in each sample. HCV RNA at a level of 30% or less (relative to the control culture) has a positive antiviral effect, and b-actin RNA at a level of 50% or less (relative to the control culture) has a cytotoxic effect. Cytotoxicity is measured using established neutral red dye uptake assays (Korba, B. E. and J. L. Gerin (1992)). Use of standardized cell culture assays to determine the activity of nucleoside analogs for hepatitis B virus replication (Antivir. Res. 19: 55-70).

Inhibition of HCV replicon system in Huh7 cells by HCVa-wt shRNA and HCVa-mut shRNA and unrelated control shRNA (229); Dose response. The antiviral activity of the test compound was analyzed in AVA5, a cell line stably replicating HCV RNA induced by transfection of the human hepatocyte cell line Huh7 (Blight et al., Science, 2000, 290: 1972). RNA-based inhibitors were cotransfected with ˜80% saturation culture with DsRed expression plasmids and HCV RNA levels were analyzed 48 hours after transfection using dot blot hybridization. Assays were performed in triplicate cultures. A total of 4-6 untreated control cultures, 10, 3, and 1 IU / ml α-interferon (active antiviral without cytotoxicity), and 100, 10, and 1 μM ribavirin (antiviral activity and cytotoxicity 3) cultures were used as positive antiviral and toxic controls. Transfection efficiency was evaluated by fluorescence microscopy (DsRed expression). HCV and beta-actin RNA levels in triplicate treated cultures were determined as a percentage of the mean level of RNA detected in untreated cultures (6 total). Beta-actin RNA levels were used as a measure of toxicity and used to normalize the amount of cellular RNA in each sample. HCV RNA at levels below 30% (relative to control cultures) have a positive antiviral effect and beta-actin RNA at levels below 50% (relative to control cultures) have a cytotoxic effect. Cytotoxicity was measured using established neutral red dye uptake assays (Korba et al., Antiviral Res., 1992, 19: 55-70). Use of standardized cell culture assays to determine the activity of nucleoside analogs for hepatitis B virus replication (Korba et al., 1992, supra).

Example  5: in tissue culture cells HCV IRES Identification of shRNAs that Inhibit Dependent Gene Expression

The ability of in vitro transcribed small hairpin RNA (shRNA) to inhibit hepatitis C virus ribosomal entry site (HCV IRES) dependent gene expression in cultured cells was investigated. As disclosed above, a 25 base pair shRNA HCVa-wt (Table 2) targeting the HCV IRES 3 'terminus near the AUG translation initiation site (Table 2) has been found to be effective at interfering with HCV expression. To assess the ability of cotransfected shRNA constructs to inhibit the function of IRES, a reporter construct (pHCV double luciferase plasmid) in which firefly luciferase (fLuc) expression is dependent on HCV IRES was used (FIG. 1; Wang et al. Mol Ther., 2005, 12: 562-568). In this experiment, 293FT cells were cultured and transfected with the reporter construct and HCVa-wt or with one of the other test sequences as disclosed in Wang et al. (2005), supra.

HCVa-wt at a concentration of 1 nM was found to inhibit 90% of HCV IRES-dependent luciferase expression at 293FT (Wang et al., 2005, supra). In subsequent experiments, 26 additional shRNAs were designed and tested to target various regions of HCV IRES ((FIGS. 10, 16A-B); 3 of 26 were clones of those mentioned above (HCVb, HCVc, HCVd-wt); 23 were new sequences) Additional inhibitors of HCV were identified. The goal was to identify shRNAs that could be used with HCVa-wt to mutate the HCVa-wt target site to make it difficult for the virus to produce resistance or to be used as an alternative to HCVa-wt. The shRNAs to be tested were chosen to avoid regions that vary in different HCV genotypes. Some test sequences are selected using, for example, algorithms available at jura.wi.mit.edu/bioc/siRNAext/ and are not recommended by most algorithms due to CG content and other properties, such as GC rich or highly structured regions. Other test sequences that intentionally targeted the HCV-IRES sequence were excluded. shRNA was formed from in vitro transcription from dsDNA template using T7 RNA polymerase and disclosed with SEQ ID NO: 5'-pppGGG to promote transcriptional efficacy. This 5 'sequence formed 2-3 oligonucleotide overhangs, the exact length of which depends on whether the target site contains one or more guanosine residues at the 5' end (see Figures 16A-B). If the last nucleotide of the RNA sense strand that matches the target sequence was a 'G', then only two or more Gs that are not complementary to the target should be added for efficient transcription, and these Gs would have a single strand on the 5 'end of shRNA. do. If the last nucleotide of the RNA sense strand that matches the target is not G, then three non-complementary Gs should be added to the target cell for efficient transcription in this test system. All shRNAs tested in this experimental set had a 21 nucleotide base double strand stem length and 10 nucleotide loops derived from microRNA-23 as disclosed for HCVa-wt.

All shRNAs (27 in total, including HCVa-wt) were assayed for activity as disclosed in Wang's literature (2005). In summary, human 293FT cells were transduced with a pHCV double luciferase ^® reporter expression plasmid (Promega, Madison, WI) and secreted alkaline phosphatase expression plasmid (pSEAP2, Clontech, Mau, CA) to control transfection and possible off-target effects. Tynview) and shRNA cotransfected. The results are shown in FIG. SEAP levels were uniform in all samples, indicating an effective transfection and absence of nonspecific inhibitory or toxic effects at shRNA concentrations of 1 nM to 5 nM. Most shRNAs showed only moderate activity (less than 60% inhibition at 1 nM). Without wishing to be bound by a particular theory, this effect is likely due to the highly structured targeted regions on the IRES. The exceptions were HCVd-wt, sh37, sh39 and hcvl7, which target the IRES position near the HCVa-wt site. These shRNAs inhibited 85-90% of HCV IRES dependent gene expression at 1 nM concentration. Low shRNA concentrations of 1 nM were chosen to facilitate identification of high functional shRNAs. When screening at 10 nM shRNA, more shRNAs show higher activity; In some cases, however, significant nonspecific inhibition was observed at this concentration. Therefore, the screening confirmed a 44 nucleotide region (positions 331-374 on HCV IRES), where five overlapping shRNAs show high activity.

Example  6: shRNA  Effect of Single Base Mismatch on Activity

It is desirable that treatment for HCV be effective against mutated HCV. In this regard, in order to determine the performance of the RNAs disclosed herein (eg, shRNAs targeting HCV IRES) and to address whether off-target effects are problematic, selected shRNAs derived for HCV IRES may be point mutations in the target sequence. The sensitivity indicated for was tested. For these experiments, using the QuikChange ^® II site directed mutagenesis kit (Stratagene, La Jolla, CA) introduced the C340 → U mutation in the HCV IRES. Of the 27 shRNAs analyzed, 9 targeted the mutated regions (FIG. 11), so their activity could theoretically be affected by these mutations. All shRNAs were analyzed using mutated forms of pHCV, with selected shRNAs targeting other sites as controls. For all tested shRNAs, the activity was found to be slightly reduced or unaffected compared to the activity of the fully matched original target (FIG. 10).

However, shRNAs in the replicon system have been surprisingly found to be SNP sensitive (see below).

Example  7: precision of the target site Mapping

Six short 19 base pair shRNAs were designed that target 44 nucleotide sites near the 3 'end of HCV IRES; Three targeted nucleotides 331-353 and three targeted nucleotides 354-374. These molecules included a 10 nucleotide loop and 5'-GG and 3'-UU overhangs. Screening was performed to identify the most effective non-redundant candidates among the sequences tested for HCV expression inhibition. All six shRNAs tested were able to inhibit activity in the assay system. Three of the six shRNAs (sh52, sh53, and sh54) were found to be most effective (FIG. 12). This does not preclude the use of shRNAs, for example as part of a composition that is less effective in treating HCV, such as comprising one or more shRNAs and / or siRNAs.

Example  8: shRNA  device: Stem  Length, loop length and sequence, and the effect of the 3'-end

Further experiments were conducted to test the effect of shRNA design on gene silencing activity. HCVa-wt included a 25 base pair stem and a 10 nucleotide miR-23 loop with 5'-GG and 3'-UU overhangs (which may form non-standard base pairs). To test the importance of these parameters in efficacy for suppressing expression, each parameter was changed separately (FIG. 13A). The microRNA-23 loop sequence was initially selected because it is a native sequence (Lagos-Quintana et al., Science, 2001, 293: 854-258) and therefore less likely to be toxic. Two alternative 10 nucleotide loops were tested with 2 forms of sequence, each with 6 nucleotide loops, 5 nucleotide loops and 4 nucleotide loops. Neither loop size nor sequence affected the activity of these 25 base pair shRNAs (FIG. 13B; see FIG. 16A-B for sequences).

Small hairpin RNAs lacking the 3'-UU terminal sequence (single strand overhang) had the same effect as parental shRNAs containing this feature. Control shRNAs with full length (25 nucleotides) sense but short (13 nucleotide) antisense regions showed no activity, confirming the importance of the double stranded structure within the target sequence. ShRNAs carrying 3'-CC instead of the 3'-UU terminus (which allows the formation of two additional Watson-Crick base pairs) were more effective than HCVa-wt for reducing HCV expression, but also affected SEAP levels. Crazy Such nonspecific inhibition can be the result of longer stems (27 base pairs), which can induce genes of the interferon reactive pathway and activate protein kinase R (PKR). Surprisingly, loop shift to the other end of shRNA dramatically reduced activity (15% inhibition instead of 90% inhibition at 1 nM). Possible explanations for this effect include shifts in Dicer processing (and thus targeted sequences) and different GC contents at the 5 'end.

Since 19 base pair shRNAs were found to show similar efficacy as 25 base pair shRNAs, the effect of loop changes on 19 base pair shRNAs was investigated. The results are shown in FIG. 14; See Figures 16A-B for sequences. 10, 6, 5, and 4 nucleotide loop sizes were tested in the form of two sequences each. Sequences containing all loop sizes showed the ability to inhibit gene expression. However, in contrast to the results with 25 base pair shRNAs, a decrease in loop size, especially up to 5 nucleotides, resulted in a decrease in activity in the 19 base pair shRNAs for the tested loop sequence. At least 5-6 nucleotide loops showed the best activity.

In addition, removing 3′-UU dramatically reduced the activity on shRNA as well as 20 base pairs as well as 19 base pairs (but not 25 base pairs). Without wishing to be bound by theory, 3'-UU and 5'-GG can form non-standard base pairs, and since the overall size of shRNA duplexes is important, they can be less than 21 base pairs for effective processing. none. Thus, for 25 base pair shRNAs neither loop size nor the presence of 3′-UU matters, but these parameters are important for the efficacy of short, eg 19 base pair shRNAs. Without wishing to be bound by a particular theory, this means that the dicer binds to the end before processing and does not "detect" the loop for longer shRNAs, but for 19 base pair shRNAs the dicer "measures 19-21 nucleotides from the end." "The loop may be" detected ".

Thus, it was found that 19 base pair shRNAs could be as effective as 25 base pair shRNAs and 19 base pair siRNAs. In addition, it was confirmed that some shRNA molecules work at low concentrations of 0.1-1 nM (“high potency shRNA”, other groups typically use 10-25-50-100 nM siRNA).

These data demonstrate that sequences that do not contain 3'-UU, which are at least 22 base pairs, such as 23 base pairs, 24 base pairs, or 25 base pairs, may be suitable for inhibiting HCV expression. Similarly, loop size is not critical for shRNAs that are at least 22 base pairs in length.

Example  9: HCV Replicon  system

Numerous shRNA and siRNA inhibitors with negative control were used to transfect human hepatocytes (derivatives of AVA5, Huh7 cell line) to stably express HCV subgenomic replicons (Blight et al., Science, 2000, 290: 5498) , HCV expression level was measured. A range of concentrations were tested and RNA concentrations (IC50 or EC50) were determined to yield 50% inhibition. The IC 50 obtained from two independent experiments is shown side by side in FIG. 15. This result is generally correlated with data obtained using the fLuc / IRES system in 293 FT cells, with the following differences: (1) 19 base pair shRNAs are more effective than 19 base pair siRNAs in the replicon system. , 19 base pair siRNA is more effective than shRNA when using a reporter system; (2) shRNA HCVa-wt with point mutations shows no activity in the replicon system, but is effective in the fLuc / IRES reporter system; (3) Generally, 25 base pair siRNAs and 25 base pair shRNAs are less active than the other 19 base pair shRNAs and siRNAs tested. In general, IRES and replicon systems are useful for identifying candidate sequences. Methods of confirming the efficacy of a selected shRNA or siRNA (eg, inhibition of expression of HCV in a subject) can be further tested using the methods disclosed herein and methods known in the art.

Other Embodiments

While the invention has been described in detail with the description, it should be understood that the foregoing description is intended to illustrate the invention and does not limit the scope of the invention as defined by the claims. Other aspects, advantages and modifications fall within the scope of the following claims.

References

                               SEQUENCE LISTING <110> SOMAGENICS INC.   <120> INHIBITION OF VIRAL GENE EXPRESSION USING SMALL       INTERFERING RNA <130> 2000849.00122WO1 <140> PCT / US06 / 021253 <141> 2006-06-01 <150> PCT / US05 / 32768 <151> 2005-09-12 <150> 60 / 608,574 <151> 2004-09-10 <160> 113 <170> PatentIn version 3.3 <210> 1 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 1 taatacgact cactataggg agcacgaatc ctaaacctca aagacttcct gtcatctttg 60 aggtttagga ttcgtgctct t 81 <210> 2 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 2 aagagcacga atcctaaacc tcaaagatga caggaagtct ttgaggttta ggattcgtgc 60 tccctatagt gagtcgtatt a 81 <210> 3 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 3 taatacgact cactataggg gcggtgccta tgtctcagcc tcttctcact tcctgtcatg 60 agaagaggct gagacatagg caccgcctt 89 <210> 4 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 4 attatgctga gtgatatccc cacggataca gagtcggaga agagtgaagg acagtactct 60 tctccgactc tgtatccgtg gcggaa 86 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 5 atcgatcccc agtggaaaga cgcgcag 27 <210> 6 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 6 aacacctttc ctgctttgtg gcaccagaag cttaagccta gg 42 <210> 7 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 7 accggagcac gaatcctaaa cctcaaagac ttcctgtcat ctttgaggtt taggattcgt 60 gctctttttt g 71 <210> 8 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 8 gatccaaaaa agagcacgaa tcctaaacct caaagatgac aggaagtctt tgaggtttag 60 gattcgtgct c 71 <210> 9 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 9 accgggcggt gcctatgtct cagcctcttc tcacttcctg tcatgagaag aggctgagac 60 ataggcaccg cctttttt 78 <210> 10 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 10 ccgccacgga tacagagtcg gagaagagtg aaggacagta ctcttctccg actctgtatc 60 cgtggcggaa aaaactag 78 <210> 11 <211> 393 <212> RNA <213> Hepatitis C Virus <400> 11 gccagccccc gauugggggc gacacuccac cauagaucac uccccuguga ggaacuacug 60 ucuucacgca gaaagcgucu agccauggcg uuaguaugag ugucgugcag ccuccaggac 120 ccccccuccc gggagagcca uaguggucug cggaaccggu gaguacaccg gaauugccag 180 gacgaccggg uccuuucuug gaucaacccg cucaaugccu ggagauuugg gcgugccccc 240 gcgagacugc uagccgagua guguuggguc gcgaaaggcc uugugguacu gccugauagg 300 gugcuugcga gugccccggg aggucucgua gaccgugcac caugagcacg aauccuaaac 360 cucaaagaaa aaccaaacgu aacaccaacc gcc 393 <210> 12 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 12 gggagcacga auccuaaacc ucaaagacuu ccugucaucu uugagguuua ggauucgugc 60 ucuu 64 <210> 13 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 13 gggagcacca auccuaaacc ucaaagacuu ccugucaucu uugagguuua ggauuggugc 60 ucuu 64 <210> 14 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 14 gggagcacga auccuaaagc ucaaagacuu ccugucaucu uugagcuuua ggauucgugc 60 ucuu 64 <210> 15 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 15 gggagcacca auccuaaagc ucaaagacuu ccugucaucu uugagcuuua ggauuggugc 60 ucuu 64 <210> 16 <211> 60 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 16 gggugcuugc gagugccccg ggaggcuucc ugucaccucc cggggcacuc gcaagcaccc 60 <210> 17 <211> 60 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 17 gggaggucuc guagaccgug caccacuucc ugucauggug cacggucuac gagaccuccc 60 <210> 18 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 18 gggaaugcua aaccucaaag aaaaacccuu ccugucaggu uuuucuuuga gguuuacgau 60 uc 62 <210> 19 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 19 cucgugcuua ggauuugga 19 <210> 20 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 20 ucgugcuuag gauuuggag 19 <210> 21 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 21 cgugcuuagg auuuggagu 19 <210> 22 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 22 gugcuuagga uuuggaguu 19 <210> 23 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 23 ugcuuaggau uuggaguuu 19 <210> 24 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 24 gcuuaggauu uggaguuuc 19 <210> 25 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 25 cuuaggauuu ggaguuucu 19 <210> 26 <211> 31 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 26 gagcacgaau ccuaaaccuc aaagaaaaac c 31 <210> 27 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 27 ucuuugaggu uuaggauucg ugcuc 25 <210> 28 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 28 ucuuugaggu uuaggauugg ugcuc 25 <210> 29 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 29 ucuuugagcu uuaggauucg ugcuc 25 <210> 30 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 30 ucuuugagcu uuaggauugg ugcuc 25 <210> 31 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 31 ccucccgggg cacucgcaag caccc 25 <210> 32 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 32 uggugcacgg ucuacgagac cuccc 25 <210> 33 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 33 gguuuuucuu ugagguuuag gauuc 25 <210> 34 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 34 cucacagggg agugaucuau ggu 23 <210> 35 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 35 aguaguuccu cacaggggag ugauc 25 <210> 36 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 36 cuuucugcgu gaagacagua guucc 25 <210> 37 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 37 auggcuagac gcuuucugcg ug 22 <210> 38 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 38 cuaacgccau ggcuagacgc uu 22 <210> 39 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 39 ucauacuaac gccauggcua gacgc 25 <210> 40 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 40 acgacacuca uacuaacgcc auggc 25 <210> 41 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 41 ccgguuccgc agaccacuau ggcuc 25 <210> 42 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 42 caauuccggu guacucaccg guucc 25 <210> 43 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 43 cauugagcgg guugauccaa ga 22 <210> 44 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 44 cuccaggcau ugagcggguu g 21 <210> 45 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 45 agucucgcgg gggcacgccc aaauc 25 <210> 46 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 46 cuuucgcgac ccaacacuac ucggc 25 <210> 47 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 47 acccuaucag gcaguaccac aaggc 25 <210> 48 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 48 cgcaagcacc cuaucaggca gu 22 <210> 49 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 49 uggugcacgg ucuacgagac cuc 23 <210> 50 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 50 uggugcacgg ucuacgagac c 21 <210> 51 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 51 cucauggugc acggucuacg agac 24 <210> 52 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 52 cucauggugc acggucuacg a 21 <210> 53 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 53 uucgugcuca uggugcacgg ucuac 25 <210> 54 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 54 ggauucgugc ucauggugca cgguc 25 <210> 55 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 55 uuuaggauuc gugcucaugg ugcac 25 <210> 56 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 56 uuuaggauuc gugcucaugg ugc 23 <210> 57 <211> 59 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 57 gggaccauag aucacucccc ugugagcuuc cugucacuca caggggagug aucuauggu 59 <210> 58 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 58 gggaucacuc cccugugagg aacuacucuu ccugucaagu aguuccucac aggggaguga 60 uc 62 <210> 59 <211> 61 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 59 gggaacuacu gucuucacgc agaaagcuuc cugucacuuu cugcgugaag acaguaguuc 60 c 61 <210> 60 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 60 gggcacgcag aaagcgucua gccaucuucc ugucaauggc uagacgcuuu cugcgug 57 <210> 61 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 61 gggaagcguc uagccauggc guuagcuucc ugucacuaac gccauggcua gacgcuu 57 <210> 62 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 62 gggcgucuag ccauggcguu aguaugacuu ccugucauca uacuaacgcc auggcuagac 60 gc 62 <210> 63 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 63 gggccauggc guuaguauga gugucgucuu ccugucaacg acacucauac uaacgccaug 60 gc 62 <210> 64 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 64 gggagccaua guggucugcg gaaccggcuu ccugucaccg guuccgcaga ccacuauggc 60 uc 62 <210> 65 <211> 61 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 65 gggaaccggu gaguacaccg gaauugcuuc cugucacaau uccgguguac ucaccgguuc 60 c 61 <210> 66 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 66 gggucuugga ucaacccgcu caaugcuucc ugucacauug agcggguuga uccaaga 57 <210> 67 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 67 gggcaacccg cucaaugccu ggagcuuccu gucacuccag gcauugagcg gguug 55 <210> 68 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 68 gggauuuggg cgugcccccg cgagacucuu ccugucaagu cucgcggggg cacgcccaaa 60 uc 62 <210> 69 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 69 gggccgagua guguuggguc gcgaaagcuu ccugucacuu ucgcgaccca acacuacucg 60 gc 62 <210> 70 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 70 gggccuugug guacugccug auagggucuu ccugucaacc cuaucaggca guaccacaag 60 gc 62 <210> 71 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 71 gggacugccu gauagggugc uugcgcuucc ugucacgcaa gcacccuauc aggcagu 57 <210> 72 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 72 gggaggucuc guagaccgug caccacuucc ugucauggug cacggucuac gagaccuc 58 <210> 73 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 73 gggucucgua gaccgugcac cacuuccugu cauggugcac ggucuacgag acc 53 <210> 74 <211> 60 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 74 gggucucgua gaccgugcac caugagcuuc cugucacuca uggugcacgg ucuacgagac 60 <210> 75 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 75 gggucguaga ccgugcacca ugagcuuccu gucacucaug gugcacgguc uacga 55 <210> 76 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 76 ggguagaccg ugcaccauga gcacgaacuu ccugucauuc gugcucaugg ugcacggucu 60 ac 62 <210> 77 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 77 gggaccgugc accaugagca cgaaucccuu ccugucagga uucgugcuca uggugcacgg 60 uc 62 <210> 78 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 78 gggugcacca ugagcacgaa uccuaaacuu ccugucauuu aggauucgug cucauggugc 60 ac 62 <210> 79 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 79 gggcaccaug agcacgaauc cuaaacuucc ugucauuuag gauucgugcu cauggugc 58 <210> 80 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 80 gggaccgugc accaugagca ccuuccuguc agugcucaug gugcacgguc uu 52 <210> 81 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 81 gggcgugcac caugagcacg aacuuccugu cauucgugcu cauggugcac guu 53 <210> 82 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 82 gggugcacca ugagcacgaa ucuuccuguc aauucgugcu cauggugcac uu 52 <210> 83 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 83 gggccuaaac cucaaagaaa aacuuccugu cauuuuucuu ugagguuuag guu 53 <210> 84 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 84 gggcuaaacc ucaaagaaaa accuuccugu caguuuuucu uugagguuua guu 53 <210> 85 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 85 ggguaaaccu caaagaaaaa cccuuccugu cagguuuuuc uuugagguuu auu 53 <210> 86 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 86 gggcacgaau ccuaaaccuc acuuccuguc augagguuua ggauucgugc uu 52 <210> 87 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 87 gggcacgaau ccuaaaccuc acaacaacaa cugagguuua ggauucgugc uu 52 <210> 88 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 88 gggcacgaau ccuaaaccuc acuuccuuga gguuuaggau ucgugcuu 48 <210> 89 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 89 gggcacgaau ccuaaaccuc aaacaacuga gguuuaggau ucgugcuu 48 <210> 90 <211> 47 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 90 gggcacgaau ccuaaaccuc auucuuugag guuuaggauu cgugcuu 47 <210> 91 <211> 47 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 91 gggcacgaau ccuaaaccuc acaauaugag guuuaggauu cgugcuu 47 <210> 92 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 92 gggcacgaau ccuaaaccuc agaaaugagg uuuaggauuc gugcuu 46 <210> 93 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 93 gggcacgaau ccuaaaccuc acucuugagg uuuaggauuc gugcuu 46 <210> 94 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 94 gggcacgaau ccuaaaccuc acuuccuguc augagguuua ggauucgugc 50 <210> 95 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 95 gggcacgaau ccuaaaccuc aacuuccugu cauugagguu uaggauucgu gc 52 <210> 96 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 96 gggagcacga auccuaaacc ucaaagacaa caacaacucu uugagguuua ggauucgugc 60 ucuu 64 <210> 97 <211> 60 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 97 gggagcacga auccuaaacc ucaaagaaac aacucuuuga gguuuaggau ucgugcucuu 60 <210> 98 <211> 60 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 98 gggagcacga auccuaaacc ucaaagacuu ccuucuuuga gguuuaggau ucgugcucuu 60 <210> 99 <211> 59 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 99 gggagcacga auccuaaacc ucaaagacaa uaucuuugag guuuaggauu cgugcucuu 59 <210> 100 <211> 59 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 100 gggagcacga auccuaaacc ucaaagauuc uuucuuugag guuuaggauu cgugcucuu 59 <210> 101 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 101 gggagcacga auccuaaacc ucaaagacuc uucuuugagg uuuaggauuc gugcucuu 58 <210> 102 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 102 gggagcacga auccuaaacc ucaaagagaa aucuuugagg uuuaggauuc gugcucuu 58 <210> 103 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 103 gggagcacga auccuaaacc ucaaagacuu ccugucaucu uugagguuua ggauucgugc 60 uc 62 <210> 104 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 104 gggagcacga auccuaaacc ucaaagacuu ccugucaucu uugagguuua 50 <210> 105 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 105 gggagaaacu ccaaauccua agcacgagcu uccugucacu cgugcuuagg auuuggaguu 60 ucuuu 65 <210> 106 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 106 gggagcacga auccuaaacc ucuuccuguc aagguuuagg auucgugcuc uu 52 <210> 107 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 107 gggagcacga auccuaaacc uccuuccugu cagagguuua ggauucgugc uuu 53 <210> 108 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 108 gggcacgaau ccuaaaccuc acuuccuguc augagguuua ggauucgugc uu 52 <210> 109 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 109 gggcacgaau ccuaaaccuc aacuuccugu cauugagguu uaggauucgu guu 53 <210> 110 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 110 gggacgaauc cuaaaccuca aacuuccugu cauuugaggu uuaggauucg uuu 53 <210> 111 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 111 cuuccuguca 10 <210> 112 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 112 caacaacaac 10 <210> 113 <211> 52 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       oligonucleotide <400> 113 gggcacgaau ccuaaaccuc acuuccuguc augagguuua ggauucgugc uu 52  

Claims (61)

a. SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, or 1, 2, or 3 A first RNA sequence in which nucleotides are different sequences; b. A second RNA sequence complementary to the first sequence; c. A loop sequence located between the first nucleic acid sequence and the second nucleic acid sequence and composed of 4 to 10 nucleotides; And d. Optionally, 2 nucleotide overhang RNA sequence consisting of. The method of claim 1, wherein the first RNA sequence is SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 , SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: RNA sequence at number 56. The RNA sequence of claim 1, wherein the RNA sequence comprises one or more modified nucleotides. The RNA sequence of claim 1, wherein the loop sequence is 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides or 10 nucleotides or more. A shRNA comprising a nucleic acid sequence of claim 1 and a sequence complementary to the sequence of claim 1, linked by a loop comprising molecules other than one or more nucleotides. The shRNA comprising the nucleic acid sequence of claim 4, wherein the loop is 3 ′ to the sense strand and 5 ′ to the complementary antisense strand of shRNA. The shRNA comprising the nucleic acid sequence of claim 4, wherein the loop is 3 ′ to the antisense strand and 5 ′ to the complementary sense strand of shRNA. The RNA sequence of claim 1 comprising a 3'UU two nucleotide overhang. The RNA sequence of claim 1, wherein the first sequence is SEQ ID NO: 33, SEQ ID NO: 55 or SEQ ID NO: 56. 10. The RNA sequence of claim 1, which is any one of SEQ ID NOs: 57-79, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. 3. A DNA sequence comprising a sequence encoding the RNA of any one of claims 1 to 10. An expression vector comprising the DNA sequence of claim 11. Retroviral vector comprising the DNA sequence of claim 11. The retroviral vector of claim 13, wherein when infecting a cell with the vector, a provirus capable of expressing the RNA sequence of claim 1 is generated. A composition comprising the RNA sequence of any one of claims 1 to 10 and a pharmaceutically acceptable excipient. A composition comprising a vector comprising a sequence encoding an RNA sequence of any one of claims 1 to 10. The composition of claim 15 comprising at least two RNA sequences of claim 1. As a method of inhibiting the activity or expression of hepatitis C virus, a. Providing a cell capable of expressing hepatitis C virus; And b. 12. The method comprising contacting said cell with the RNA sequence of any one of claims 1-10. The method of claim 18, wherein the cell is in a mammal. The method of claim 18, wherein the mammal is a human. The method of claim 18, wherein the mammal is a primate other than a human. The method of claim 18, wherein the cell is contacted with two or more different RNA sequences of claim 1. a. Identifying a subject infected with or suspected of being infected with the hepatitis C virus; b. 18. A method comprising providing to a subject a therapeutically effective amount of the composition of any one of claims 15 to 17. 24. The method of claim 23, further comprising determining, after step (b), whether the subject has a reduced viral population. The method of claim 23, further comprising, after step (b), determining whether one or more viral proteins or viral nucleic acid sequences have decreased in the subject. As a method for inhibiting gene expression of a virus, Introducing small interfering RNA into the virus-containing cell, wherein the small interfering RNA comprises a sequence at least partially complementary to the polynucleotide sequence of the virus and at least partially complementary to the polynucleotide of the virus and the small interfering RNA Gene expression of the virus is inhibited by interaction of gene sequences. The method of claim 26, wherein the small interfering RNA is shRNA. The method of claim 26, wherein the small interfering RNA is siRNA. 29. The method of any one of claims 26-28, wherein the small interfering RNA recognizes a viral sequence of about 19 to about 30 nucleotides. The method of claim 26, wherein the virus is hepatitis C virus. The method of claim 30, wherein the small interfering RNA interacts with the sequence within the internal ribosomal entry site (IRES) sequence of the hepatitis C virus. The method of claim 31, wherein the IRES sequence comprises the sequence represented by SEQ ID NO: 11. 33. The method of claim 32, wherein the small interfering RNA recognizes a sequence of about 19 to about 30 nucleotides in the region represented by SEQ ID NO: 26. 34. The method of any one of claims 30-33, wherein the small interfering RNA is shRNA. The method of claim 34, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33. The method of claim 35, wherein the shRNA has the sequence represented by SEQ ID NO: 12. 37. 34. The method of any one of claims 30-33, wherein the small interfering RNA is siRNA. The group of claim 37, wherein the siRNA consists of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33. A method comprising a sequence selected from. As a method of treating viral infections in mammals, Administering to the mammal a composition comprising a therapeutically effective amount of a small interfering RNA comprising a sequence at least partially complementary to a polynucleotide sequence of a virus, Wherein the interaction of said polynucleotide sequence of said virus with at least partially complementary sequence of small interfering RNA inhibits gene expression of said virus. The method of claim 39, wherein the small interfering RNA is shRNA. The method of claim 39, wherein the small interfering RNA is siRNA. 42. The method of any one of claims 39-41, wherein the small interfering RNA recognizes a viral sequence of about 19 to about 30 nucleotides. The method of claim 39, wherein the mammal is a human and the viral infection comprises hepatitis C virus. The method of claim 43, wherein the small interfering RNA comprises a sequence that is at least partially complementary to the polynucleotide sequence within the IRES sequence of the hepatitis C virus. 45. The method of claim 44, wherein the IRES sequence comprises the sequence represented by SEQ ID NO: 11. The method of claim 45, wherein the small interfering RNA recognizes a sequence of about 19 to about 30 nucleotides in the region represented by SEQ ID NO: 26. 46. 47. The method of any one of claims 43-46, wherein the small interfering RNA is shRNA. The shRNA of claim 47, wherein the shRNA is SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32 and SEQ ID NO: 33. The method of claim 48, wherein the shRNA has the sequence represented by SEQ ID NO: 12. 49. 47. The method of any one of claims 43-46, wherein the small interfering RNA is siRNA. The group of claim 50, wherein the siRNA consists of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33. A method comprising a sequence selected from. SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: A composition comprising a shRNA comprising a sequence selected from the group consisting of 33. SiRNA comprising a sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33 A composition comprising. A pharmaceutical composition comprising the shRNA according to claim 52 and a pharmaceutically acceptable excipient. A pharmaceutical composition comprising an siRNA according to claim 53 and a pharmaceutically acceptable excipient. 47. A kit comprising shRNAs and instructions for use in a method according to any one of claims 18-26, 30-33, 39, 43-46. The shRNA of claim 56, wherein the shRNA is SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32 and SEQ ID NO: 33 comprising a sequence selected from the group consisting of. A kit comprising an siRNA and instructions for use in a method according to any one of claims 25, 29-32, 38 and 42-45. The group of claim 58, wherein the siRNA consists of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33 Kit comprising a sequence selected from. The method of claim 43, wherein the hepatitis C virus is 1a genotype. The method of claim 39, wherein the mammal is a human.

Images