MX2008003504A - Inhibition of viral gene expression using small interfering rna - Google Patents

Abstract

The invention provides methods, compositions, and kits comprising small interfering RNA (shRNA or siRNA) that are useful for inhibition of viral-mediated gene expression. Small interfering RNAs as described herein can be used in methods of treatment of HCV infection. ShRNA and siRNA constructs targetING the internal ribosome entry site (IRES) sequence of HCV are described.

Description

INHIBITION OF VIRAL GENE EXPRESSION USING RIBONUCLEIC ACID OF SMALL INTERFERENCE FIELD OF THE INVENTION The invention relates to the inhibition of viral gene expression, for example, of hepatitis C IRES-mediated gene expression, with small interfering RNA (siRNA and siRNA).

BACKGROUND OF THE INVENTION The treatment and prevention of hepatitis C virus (HCV) infections remains a major challenge to control this global health problem; existing therapies are only partially effective and no vaccine is currently available. The hepatitis C virus (HCV) infects more than 170 million people worldwide and is the main cause of liver transplants. Existing treatments, including ribavirin and pegylated interferon-alpha, are only effective in approximately 50 percent of patients and have substantial side effects. The development of more effective treatments against HCV is hampered by the lack of a good model in small animals, the inability to stably culture the virus in tissue culture cells, and the high mutation rate REF. : 191192 viral [1-3]. The availability of a HCV replicon system has allowed the study of HCV replication, host-cell interactions and the evaluation of antiviral agents, and more recently, a transgenic humanized chimeric murine hepatic model was developed that allows complete infection by HCV [4-7]. In addition, the use of in vivo imaging of HCV IRES-dependent indicator systems has facilitated the efficient assessment of distribution and inhibition by anti-HCV agents in murine liver over multiple time points using the same animals [8] . RNA interference is an evolutionarily conserved pathway that leads to the reduction of gene expression. The discovery that synthetic short interfering RNA (siRNA) of approximately 19-29 base pairs can effectively inhibit gene expression in mammalian and animal cells without activating an immune response has led to a flurry of activity to develop these inhibitors as therapeutic products [9]. The chemical stabilization of siRNA results in increased serum half-life [10], suggesting that intravenous administration can achieve positive therapeutic results if distribution issues can be overcome. Additionally, small hairpin RNAs (shRNA) have also shown strong inhibition of target genes in mammalian cells and can be expressed easily from bacteriophage (e.g., T7, T3 or SP6) or mammalian (pol III such as U6 or Hl) promoters. or pol II), making them excellent candidates for viral distribution [11]. Efforts have been made to find effective inhibitors based on nucleic acid against HCV, since existing treatments are not completely effective (reviewed in [4, 12]). These efforts include traditional antisense oligonucleotides, phosphorodiamidate-morpholino oligomers [8], ribozymes, and more recently SiRNA. It has been shown that siRNAs can effectively target HCV in human tissue culture cells [13-19] and in animal systems [20].

BRIEF DESCRIPTION OF THE INVENTION The invention provides methods, compositions, and kits for the inhibition of IRES-mediated gene expression in a virus, eg, hepatitis C virus (HCV). For the inhibitory RNA sequences listed in Figures 4A and 10 and Table 1 (for example, SEQ ID NO: 19-26), a complementary sequence is involved, since they are sequences unrelated to the target that can be attached in one or both ends of each strand, for example the 3 'ends, as will be known to the person skilled in the art. The inhibitory sequences (antisense recognition) shown in Figure 4A, Figure 10 and Table 1 can be incorporated into either siRNA or siRNA. In the case of ARNsh, the sequence shown is linked in addition to its complementary sequence by a loop that includes nucleotide residues not usually related to the target. An example of this loop is shown in the shRNA sequences shown in Figure IB and Figure 1C as well as in Figures 16A-B. In the case of both siRNA and shRNA, the strand complementary to the target in general is completely complementary, but in some embodiments, the strand complementary to the target may contain bad correspondences (for example, see SEQ ID NO: 13, 14 and 15) . The sequence can be varied to target one or more variants or genetic phenotypes of the target virus by altering the target selection sequence to be complementary to the sequence of the genetic variant or phenotype. The strand homologous to the target can differ by about 0 to about 5 sites by having poor matches, insertions, or deletions from about 1 to about 5 nucleotides, as the case may be, for example, with naturally occurring microRNAs. In some embodiments, a sequence may target multiple viral strains, eg, of HCV, although the sequence differs from the target of a strain by at least one nucleotide (eg, one, two or three nucleotides) of a selection sequence. of objective. In one aspect, the invention provides a composition comprising at least one small interfering RNA that is at least partially complementary to, and is capable of interacting with, a polynucleotide sequence of a virus, such that inhibition of viral gene expression results in of the interaction of small interfering RNA with the viral target sequence. In one embodiment, the composition includes at least one shRNA, for example, comprising, consisting, or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, or comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33. In one embodiment, the shRNA comprises , consists of, or consists essentially of, the sequence depicted in SEQ ID NO: 12. In another embodiment, the composition includes at least one siRNA. In one embodiment, the composition includes at least one siRNA or siRNA, for example, comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32 and SEQ ID NO: 33. In some embodiments, the small interfering RNA, for example, siRNA or siRNA, interacts with a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. In some embodiments, the small interference RNA binds to a hepatitis C virus sequence. In one embodiment, the small interfering RNA binds to a sequence within the internal ribosomal entry site (IRES) sequence of a virus of hepatitis C, for example, the sequence depicted in SEQ ID NO: 26 (residues 344-374 of SEQ ID NO: 11). In one embodiment, the hepatitis C virus is the genotype of HCV. In some embodiments, a composition of the invention comprises a pharmaceutically acceptable excipient, e.g., water or saline, and optionally, are provided in a therapeutically effective amount, for example, to treat HCV infection in a human or primate not human like a chimpanzee or a new world monkey. In one embodiment, the composition is a pharmaceutical composition comprising, consisting of, or consisting essentially of, at least one siRNA or siRNA as described herein and a pharmaceutically acceptable excipient. In another aspect, the invention relates to a kit that includes any of the compositions described above, and optionally, further includes instructions for use in a method for inhibiting gene expression in a virus or for treating a viral infection in an individual as described in the present. In one embodiment, the kit is for use in a method for treating HCV infection in an individual, such as a human, and comprises a shRNA comprising, consisting of, or consisting essentially of, a sequence selected from the group that consists of SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18; or comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 32 and SEQ ID NO: 33, or an siRNA comprising or consisting essentially of a sequence selected from the group consisting of consists of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33, and optionally further comprises instructions for use in a method for inhibiting gene expression in a hepatitis C virus, such as the HCV genotype, or instructions for use in a method for treating a viral infection of hepatitis C (such as the HCV genotype) in an individual, such as a human, or a non-human primate such as a chimpanzee. In another aspect, the invention provides a method for treating a viral infection in an individual, such as a mammal, for example, a human or a non-human primate. The method includes administering to the individual a therapeutically effective amount of a small interfering RNA, such as siRNA or siRNA, which is at least partially complementary to, and capable of binding to, a polynucleotide sequence of the virus and a pharmaceutically acceptable excipient, such that binding of small interfering RNA to the viral polynucleotide sequence inhibits gene expression in the virus, for example, decreases the amount of viral expression in the individual or decreases the amount of viral expression that would be expected in an individual who does not receive the RNA of small interference. In one embodiment, the viral infection comprises a hepatitis C virus, such as the HCV genotype. In some embodiments, the virus is selected from the group consisting of the hepatitis C, Ib, 2a and 2b genotypes. In some embodiments, the small interference RNA comprises, consists of, or consists essentially of, any of the sequences of SiRNA or siRNA described herein as well as sequences located within the five nucleotides of one of the siRNA or shRNA sequences described herein. In some embodiments, the small interfering RNA is complementary to a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29 or 30 nucleotides. In one embodiment, the virus is a hepatitis C virus, such as the HCV genotype. In one embodiment, the small interference RNA binds to a sequence of about 19 to about 25 nucleotides within the IRES region of HCV as represented in SEQ ID NO: 26. Treatment may include therapy (e.g., improvement or decrease in at least one symptom of infection) or healing. In some embodiments, the shRNA is administered parenterally, for example, by injection or intravenous infusion. In another aspect, the invention provides a method for inhibiting gene expression in a virus, comprising contacting the viral RNA or viral mRNA with a small interfering RNA or introducing a small interfering RNA into a cell containing the virus. , such that small interfering RNA, eg, shRNA or siRNA, contains a sequence that is at least partially complementary to a virus polynucleotide sequence and capable of inhibiting viral gene expression, for example, by inhibiting cleavage the viral polynucleotide sequences. In some embodiments, the small interference RNA comprises, consists of, or consists essentially of, any of the siRNA or siRNA sequences described herein. In some embodiments, the small interfering RNA binds to a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. In one embodiment, the virus is a hepatitis C virus, such as HCV la. In one embodiment, the small interference RNA interacts with a sequence of about 19 to about 30 nucleotides within the IRES region of the HCV genotype depicted in SEQ ID NO: 26, as well as in the sequence located within the five nucleotides of one of the siRNA or shRNA sequences described herein. In still other embodiments, at least two small interfering RNAs are introduced into a cell. The invention also relates to an RNA sequence consisting of (a) a first RNA sequence, such that the first RNA sequence is a sequence illustrated in Figure 10 or Figure 16A-B, eg, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, or a sequence that differs from a foreign sequence by one, two or three nucleotides; (b) a second RNA sequence that is a complement to the first sequence; (c) a loop sequence positioned between the first and second nucleic acid sequence, the loop sequence consisting of 4-10 nucleotides; and (d) optionally, a projection of two nucleotides. In some embodiments of the invention, the first RNA sequence is SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO : 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56. The RNA sequence may include, in some cases, at least one modified nucleotide. The loop sequence of an RNA sequence of the invention may be, for example, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, or at least ten nucleotides. In some embodiments, the RNA sequence is a shRNA and includes an HCV target sequence as described herein and a complementary sequence, linked by a loop that includes at least one molecule without a nucleotide. In certain embodiments, the loop of the RNA sequence is 3 'to one strand homosentide and 5' to the antisense strand complementary to the shRNA. In other embodiments, the loop of the RNA sequence is 3 'to a 5' antisense strand to the complementary sense strand of the shRNA. In some cases, the RNA sequence includes a projection of two nucleotides and the projection of two nucleotides is a 3'UU. In some cases, the protrusion is one nucleotide, two nucleotides, three nucleotides, or more. In some embodiments, the first RNA sequence is any of SEQ ID NO: 57-79, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18. In some embodiments, the RNA sequence is a sequence illustrated in Figures 16A-16B. The invention also relates to a DNA sequence that includes a sequence encoding an RNA sequence described herein (for example, an RNA sequence illustrated in Figure 10 or in Figures 16A-16B). The invention also includes an expression vector comprising this DNA sequence. Also included is a retroviral vector that includes a DNA sequence, for example, a retroviral vector that, in infection of a cell with the vector, can produce a provirus that can express an RNA sequence of the invention, for example, without limitation, a shRNA sequence illustrated in Figures 16A-16B. In some aspects, the invention relates to a composition that includes an RNA sequence as described herein (eg, without limitation, a shRNA as illustrated by Figures 16A-16B) and a pharmaceutically acceptable excipient. In some embodiments, the composition comprises a vector as described herein and a pharmaceutically acceptable excipient. In certain embodiments, a composition of the invention includes at least two RNA sequences as described herein. In another aspect, the invention includes a method for inhibiting the expression or activity of a hepatitis C virus. The method includes providing a cell that can express a hepatitis C virus, and contacting the cell with an RNA sequence as described in FIG. described herein (non-limiting examples of which are illustrated in Figures 16A-16B). The cell can be in a mammal, for example, a human or a non-human primate such as a chimpanzee. In certain embodiments, the cell is contacted with at least two different RNA sequences. In some aspects, the invention relates to a method that includes identifying a subject infected with or suspected of being infected with a hepatitis C virus, providing the subject with a therapeutically effective amount of a composition containing one or more different RNA sequences. described in the present. In some modalities, the method also includes determining if the viral load of the subject is subsequently decreased by providing the composition to the subject. In some embodiments, the method also includes determining whether at least one viral protein or viral nucleic acid sequence is decreased in the subject subsequent to the provision of the composition to the subject. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used, in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods and examples are illustrative only and are not intended to be limiting. Other features and advantages of the invention will be apparent from the detailed description, figures, and claims.

BRIEF DESCRIPTION OF THE FIGURES Figure IA is a representation of the nucleotide sequence of IRES of the hepatitis C genotype (see, access GenBank number AJ242654). The nucleotides of a target region, 344-374, are underlined. The various regions (indicated in bold) have been selected successively as targets by the inhibitors, including the ribozyme Heptazyma ™ (siRNA.com, positions 189-207), Chiron ™ 5U5 siRNA [25] (positions 286-304), phosphorothioate antisense oligonucleotide ISIS 14803 [34] (positions 330-34), Mizusawa siRNA 331 [15] (positions 322-340) and an oligomer of phosphorodiamidate-morpholino [8, 35] (positions 344-363). A more complete list of siRNAs that have been tested to reduce IRES expression of HCV and other elements of HCV can be found in [2, 3]. Figure IB is a representation of the HCVa-wt RNA sequences of shRNAs (shRNAs) and assembled variants thereof resulting from the transcription of pol III of a U6 promoter from the corresponding DNA templates. Two base pairs (underlined) of HCVa-wt were altered to create versions of HCVa-wt containing 1 HCVSNP1 or HCVSNP2) or 2 mismatches (HCVa-mut) of the shRNAs as shown. Figure 1C is a representation of the sequences of (HCVb-wt (sh9), HCVc-wt (shlO), and HCVd-wt (shll) of shRNA. Figure ID is a representation of the secondary structure of the IRES of HCV with target sites indicated for HCVa-wt, HCVb-wt, HCVc-wt, and HCVd-wt for shRNA Figure 1E is a schematic representation of the IRES dual luciferase indicator construction of pCDNA3 / HCV used to produce the IRES target of HCV as well as the IRES control of EMCV, in which the IRES of the encephalomyocarditis virus replaces the HCV IRES and therefore lacks any target for the HCV-directed shRNAs.In each case, the expression of firefly luciferase it is dependent on the start of translation of the IRES sequence, while Renilla luciferase is expressed in a cap-dependent manner Figure 1F is a bar graph representing the results of a detection of the shRNAs for the ability to inhibit gene expression I IRS of HCV in 293FT cells. 293FT cells were co-transfected with IRES dual luciferase indicator construction of pCDNA3 / HCV, pSEAP2 (as a transfection control and specificity), and a shRNA (atl nM) in a concavity of a tissue culture plate of 24 concavities . Plasmid pUC18 was added to provide a total of 800 ng nucleic acid per concavity. 48 hours after transfection, the cells were used and the firefly luciferase activity was measured by a luminometer. All data are the result of individual independent experiments performed in triplicate, and normalized to SEAP. Figure 2A is a bar graph depicting the results of experiments demonstrating the inhibition of HCV-IRES activated gene expression in 293FT cells that co-transfected into dual luciferase indicator and plasmids expressing SEAP and 1 pmol of the ShRNAs transcribed in vi tro. The target plasmid was an IRES dual luciferase indicator of pCDNA3 / HCV (HCV IRES, as shown in Figure 1E). The firefly luciferase activity measured as described in Example 1. The firefly luciferase and SEAP activities are normalized to 100. Figure 2B is a bar graph depicting the results of the experiments using inhibition of HCV versus EMCB in 293FT cells. The data are presented as luciferase activity divided by SEAP activity normalized to 100. FIG. 2C is a bar graph depicting the results of experiments demonstrating the effect of poor single base correspondences on the potency of the ARNsh. The experimental conditions were as described for Figure 2A. SNP1 and SNP2 contained mutated base pairs as shown in Figure IB. Figure 2D is a line graph representing the results of the experiments that test the response to the inhibition dose of gene expression activated by HCV-IRES by HCVa-wt and the mutated shRNAs (HCVa-mut) or control (229) The experimental conditions were as described for Figure 2A. The data is represented as luciferase divided by SEAP normalized to 100. All data are the results of individual independent experiments performed in triplicate. Figure 2E is a line graph representing the result of the experiments that test the dose response of HCVa-wt shRNAs, HCVa-mut), and 229, on the gene expression of a dual luciferase indicator that lacks target sites for the shRNAs. The procedure was as described for Figure 2D, except that the target was firefly luciferase activated by EMCV IRES instead of HCV IRES. Figure 2F is a reproduction of a Northern blot analysis of co-transfected 293FT cells treated as follows; 10 μg of total RNA isolated from transfected cells without inhibitor (lane 1), 229 (lane 2), HCVa-wt (lane 3), or HCVa-mut (lane 4) were separated by denaturing gel electrophoresis, transferred into the membrane and sequentially hybridized to fLuc cDNA probes labeled with 32 P, SEAP or ELA (EF1A) elongation factor. The RNA transfer was exposed to a storage phosphorus detection for visualization and quantification (BioRad FX Molecular Image). Figure 3A is a line graph depicting the results of experiments that test the dose response to the hshRNAs of HCVa-wt and HCVa-mut using the human hepatocyte cell line, Huh7. The procedures were as described for Figure 2D, except that Huh7 cells were used. Figure 3B is a line graph representing the results of experiments demonstrating that the HCVa-wt shRNA does not inhibit a similar target lacking the HCV IRES. Cells were transfected as in Figure 3A except that dual IRES luciferase indicator from pCDNA3 / EMCV (IRES from EMCV) was added in place of the IRES dual luciferase indicator from pCDNA3 / HCV (IRES from HCV). All data are presented as luciferase activity divided by SEAP. All data were generated from individual independent experiments performed in triplicate. Figure 4A depicts sequences of seven 19-base pair viral recognition sequences of synthetic siRNAs and synthetic siRNAs contained within the target site of 25 nucleotides of the HCV genotype (SEQ ID NO: 26) and analysis of its purity in 10% native polyacrylamide gel stained with ethidium bromide.

SiRNA: homosense and antisense strands contained 3'-UU overhangs; ARNsh: loop sequences and projections from the 3 ', 5' ends were identical to those from the 25 base pair sshsh. Figure 4B is a bar graph depicting the results of the experiments in which the RNA inhibitors (siRNA and shRNA) were evaluated for the inhibition of HCV IRES-mediated gene expression at a concentration of inhibitor of 1 nM in 293 FT cells. Figure 4C is a bar graph depicting the results of the experiments in which RNA inhibitors were assessed for inhibition of IRV-mediated gene expression of HCV at an inhibitor concentration of 0.1 nM in 293 FT cells. Figure 5A is a reproduction of IVIS images of mice in which the HCV IRES indicator plasmid of dual luciferase (10 μg) and SEAP (added to control injection efficiency and nonspecific inhibition) were co-injected in tail veins of mice as described in Example 1 with 100 μg of the indicated HCV shRNA or control 229 shRNA) directly or in the form of 100 μg of pol III expression plasmids expressing shRNA (or plasmid pUC18 as a control). At several time points (24, 36, 48, 60, 72, 84 and 100 hours) after the injection, luciferin was administered intraperitoneally, and the mice were imaged using the IVIS in vivo imaging system . The images are from mice representative of the 84 hour time point. Figure 5B is a graph depicting the quantified results of experiments described for Figure 5A in which there was direct distribution of RNA. Quantification was performed using the ImageQuant ™ software. Each time point represents the average of 4-5 mice. At the 96-hour time point, the mice were bled and the amount of SEAP activity was determined by the pNPP assay as described in Example 1. The quantified data are presented as luciferase divided by SEAP activity, normalized to pUCld control mice (100% , no error bar shown in the pUC18 control for clarity; the error bars are similar to the others shown). Figure 6 is a bar graph depicting the results of experiments in which the inhibition of shRNA and the phosphorodiamidate-morpholino oligomer was compared to the expression of the HCV IRES-mediated reporter gene in mice. Mice were co-injected as described in the experiments for Figure 5 with the HCV IRES indicator plasmid of dual luciferase and pSEAP with 100 μg of the indicated HCV shRNA inhibitors or 1 nmol of a morpholino-oligonucleotide that previously shows inhibiting the construction of [8] IRES expression of HCV. Mice were imaged at various times (12 hours, 24 hours, 48 hours and 144 hours) after treatment. The data shown is for the time point of 48 hours. The quantified data are presented as luciferase and SEAP activities, normalized to pUCld control mice (no addition). The results presented are 3-5 mice per construct. Figure 7 is a graph depicting the results of experiments in which BHK-21 cells were transfected momentarily with plasmids expressing an inhibitory siRNA that targets the nsp-1 gene.

Twenty-four hours after transfection, the cells were infected with 10 μl of the Semliki forest virus expressing replication-competent GFP (SFV-GFP-VA7, multiplicity of infection (MOI) sufficient for approximately 100% infection) and evaluated for the expression of GFP mediated by virus by flow cytometry 24 hours after infection. The level of suppression mediated by siRNA was approximately 35%. Labels: Nsp 1. Nsp-1 gene that is targeted by shRNA (nsp-l # 2); empty vector, pU6; Simple uninfected BHK cells. Figure 8 is a bar graph depicting the results of experiments in which inhibition of replication-deficient SFV (SFV-PD713P-GFP) by shRNAs was investigated. BHK-21 cells were transfected momentarily with plasmids expressing the inhibitory siRNAs. Forty-six hours after transfection, the cells were infected with the SFV-GFP virus at an MOI of 5 with 8% PEG in serum-free medium for one hour. Then, complete medium was added and the cells were incubated at 37 ° C overnight. The cells were analyzed by flow cytometry at 9, 24, 32, 99 and 125 hours after infection. For clarity, only three time points are shown (9, 24 and 32 hours). The amount of inhibition of each shRNA was normalized to the capsid shRNA. The capsid mRNA is not present in this virus deficient in SFV-GFP replication and therefore the capsid siRNA must not have an effect on the expression of GFP. The transfection efficiency for siRNA expression constructs for this experiment was approximately 70%, suggesting that the actual viral inhibition is significantly higher than the indicated levels. The fifth set of bars (Mixed) refers to a mixture of shRNAs that target nsp 1-4 and capsid. Figure 9 is a line graph depicting the results of experiments testing the inhibition of HCV replicon by the shRNAs. Figure 10 is a table depicting sequences and results of a detection of the shRNAs for the ability to inhibit IRES-mediated gene expression of HCV in 293FT cells. Cells were co-transfected (using Lipofectamine ™ 2000) with IRES dual luciferase indicator construction of pCDNA3 / HCV (40 ng), pSEAP2 (25 ng, as a transfection control and specificity), and a shRNA (a 1 or 5) nM) in a concavity of a tissue culture plate of 48 concavities. Plasmid pUCld was added to provide a total of 400 ng nucleic acid per concavity. Forty-eight hours after transfection, the supernatants were removed for SEAP analysis, the cells were used, and the firefly luciferase activity was measured by a luminometer. All results are the results of at least two independent experiments performed in triplicate. SEAP levels were uniform in all samples. Control experiments to assess the specificity of the shRNAs were also performed in mutated indicator construction of IRES dual luciferase from pCDNA3 / HCV, Count C340 (in IRES) was replaced with U. Figure 11 is a schematic representation of sequence 3 '-terminal of the HCV IRES with segments targeted by the shRNAs. The mutation C340- ^ U (used to assess the specificity of the shRNA) is indicated. Figure 12A is a schematic representation of the '-term of the HCV IRES and selection positions as target for six 19 bp sRNAs. Figure 12B is a bar graph depicting the results of a detection of shRNAs for the ability to inhibit HCV-mediated IRES gene expression in 293FT cells. The experiments were carried out as for Figure 10; concentration of shRNA, 1 nM. Figure 13A is a schematic representation of the sequences of the tested variants of the 25-base pair shRNA, represented, with the various sizes and loop sequences, as well as the 3'-terms that were tested. Figure 13B is a bar graph depicting the results of a detection of the shRNAs depicted in Figure 13A for the ability to inhibit IRES-mediated gene expression of HCV in 293FT cells.

Experiments such as those of Figure 10 were carried out. Concentration of shRNA, 1 nM. (The shRNA sequences are listed in Figures 16A-B). Figure 14A is a schematic representation of the sequences of tested variants of the 19 bp shRNA represented with the various loop sizes and sequences tested, as well as the 3'-terms that were tested. Figure 14B is a bar graph depicting the results of a detection of the shRNAs depicted in Figure 14A for the ability to inhibit IRES-mediated gene expression of HCV in 293FT cells. Experiments were carried out as described for Figure 10. Concentration of shRNA, 1 nM. (The shRNA sequences are listed in Figures 16A-16B). Figure 15 is a bar graph depicting the results of a detection of siRNAs (and siRNA) for inhibitory activity in the HCV replicon system. Transfected with human hepatocyte RNA inhibitors (AVA5, a derivative of the Huh7 cell line) stably expressing HCV subgenomic replicons, and the amount of HCV expression was determined. A variety of concentrations were tested and the concentration of the shRNA / si that resulted in 50% inhibition (EC50) was determined. The light and dark bars represent the results of two independent experiments.

Figures 16A-16B are a table depicting the sequence of shRNAs targeting the HCV IRES as indicated. The handles of shRNA are underlined. The nucleotides indicated by lowercase letters are not complementary to the objective.

DETAILED DESCRIPTION OF THE INVENTION The invention provides compositions, methods and kits for inhibiting viral gene expression (e.g., hepatitis C) and / or for treating viral infection in a mammal. RNA interference offers a new therapeutic approach to treat viral infections. The present invention provides small interference RNA (eg, shRNA and siRNA) that target a viral sequence and inhibit (i.e., reduce or eliminate) viral gene expression, and methods to use these small interfering RNA for treatment of a viral infection in a mammal, such as a human. In some embodiments, the small interference RNA constructs of the invention inhibit gene expression of a virus by inducing cleavage of viral polynucleotide sequences within or close to the target sequence that is recognized by the antisense sequence of the small interfering RNA. .

As used herein, "small interfering RNA" refers to an RNA construct that contains one or more short sequences that are at least partially complementary to, and may interact with, a polynucleotide sequence of a virus. The interaction may be in the form of a direct link between complementary sequences (antisense) of the small interfering RNA and polynucleotide sequences of the viral target, or in the form of a direct interaction by enzymatic machinery (eg, a protein complex) which allows the antisense sequence of the small interfering RNA to recognize the target sequence. In some cases, recognition of the target sequence by the small interference RNA results in cleavage of viral sequences within, or near the target site that is recognized by the recognition sequence (antisense) of the small interfering RNA. The small interfering RNA may exclusively contain ribonucleotide residues, or the small interfering RNA may contain one or more modified residues, particularly at the ends of the small interfering RNA or in the homosense strand of the small interfering RNA. The term "small interference RNA" as used herein embraces siRNA and siRNA, both of which are understood and known to those skilled in the art to refer to RNA constructs with particular characteristics and particular types of configurations. As used in this, "ShRNA" refers to an RNA sequence comprising a double-stranded region and a loop region at one end forming a fork loop. The double-stranded region is typically from about 19 nucleotides to about 29 nucleotides in length on each side of the stem, and the loop region is typically from about three to about ten nucleotides in length (and double-stranded leaving nucleotides are optional 3 '- and 5' -terminals). An example of this shRNA, the shRNA of HCVa-wt, has a double-stranded region of 25 base pairs (SEQ ID NO: 12), a loop of ten nucleotides, a GG extension at the 5 'end, and an extension UU at the 3 'end. Additional examples of the shRNAs suitable for use in, for example, inhibition of HCV expression, are provided throughout the specification, for example, Figures 16A-16B. As used herein, "siRNA" refers to an RNA molecule comprising a double-stranded region with a 3 'overhang of non-homologous residues at each end. The double-stranded region is typically from about 18 to about 30 nucleotides in length, and the overhang can be any length of non-homologous residues, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16 or more nucleotides. The siRNA can also comprise two or more segments of 19-30 base pairs separated by regions without pairs. Without commissioning any specific theory, regions without peers can function to prevent the activation of innate immune pathways. An example of this siRNA is the HCVa-wt siRNA, which has a double-stranded region of 25 base pairs (SEQ ID NO: 12), and a UU extension at each 3 'end. In one embodiment, a small interference RNA as described herein comprises a sequence complementary to an internal ribosomal entry site (IRES) element sequence of hepatitis C ("HCV"). In one embodiment, the virus is the HCV genotype. It has been shown that gene inhibition by siRNA strongly inhibits gene expression in several mammalian systems. Due to its high level of secondary structure, the HCV IRES has been suggested to be a poor target for siRNA or shRNA. Mizusawa reported, however, successful targeting of HCV IRES in tissue culture cells 293 and Huh7, which report 50 and 74 percent gene expression suppression, respectively.

Similarly, Seo and colleagues [25] reported the ability of 100 nM siRNA to inhibit HCV replication (approximately 85% suppression) in 5-2 Huh7 cells. It has now been demonstrated as described herein that small interfering RNAs (shRNA and siRNA) directed against the 3 'end of the HCV IRES, including and in the 5' direction of the translation start site of AUG, can induce 96 percent suppression of HCV IRES-dependent luciferase expression at 0.3 nM in 293FT cells and 75 percent deletion at 0.1 nM in Huh7 cells (see Figures 2D and 3A). Additionally, the direct distribution of the shRNA to mouse liver was shown to potently inhibit the expression of the IRV-dependent indicator of HCV. This is the first demonstration of RNAi-mediated gene inhibition in an animal model after the direct distribution of an RNA hairpin (not expressed in vivo from a plasmid or viral vector). The effectiveness of the shRNA directly distributed to mouse liver after the hydrodynamic injection was surprising in view of the high levels of nucleases found in the blood. The observation that these siRNAs effectively suppressed gene expression in liver, indicates that these (1) inhibitors of shRNA were very potent and not necessary at high levels in the mouse liver to induce gene inhibition, (2) they are distributed from a sufficiently fast to the liver, therefore, before they are cleaved by the nucleases in amounts that prevent an inhibitory effect, or (3) are inherently stable to degradation by nucleases (or a combination of these characteristics).

The reports suggest that transcripts synthesized in vi tro of bacteriophage promoters induce potently inferred (IFN) alpha and beta due to the presence of an unnatural 5 '-triphosphate [26]. Additionally, mRNAs expressed from pol III expression vectors can also induce IFN [27]. It is unclear how this inferred induction may affect the use of shRNAs in a clinical setting for HCV infection. Current HCV therapy includes treatment with interferon-alpha, suggesting that if induced by the shRNA, it can have a positive effect. To date, secondary effects related to inferred animals have not been reported in animals after administration of RNAi [3]. Additional interest has been expressed with respect to targeting effects of the siRNA as well as potential cytotoxic effects when siRNAs or shRNAs were distributed by lentiviral vectors [28]. The present invention also relates to methods for testing siRNA and shRNA that are selected as target HCV IRES sequences to identify those sequences that have high activity (eg, the highest activity among a selected group of these sequences) to be a candidate for use as a treatment. The test may also include detection of small interfering activities that have undesirable effects outside of target or general cytotoxic effects. Out-of-target effects include, without limitation, deletion of non-targeted genes, inhibition of expression of unselected genes, and competition with natural microRNA pathways (Birmingham et al., Nat. Methods. 2006 3 (3) : 199-204; Grimm et al., Nature 2006 441 (7092): 537-541). Methods for identifying cytotoxic effects are known in the art (for example, Marques et al., Nat. Biotechnol 2006 24 (5): 559-565; Robbins et al., Nat. Biotechnol. 2006 24 (5): 566- 571). The IRES region in the 5'-UTR of HCV is highly conserved (92-100% identical [15, 29-31]) and has several segments that appear to be invariant, making IRES a primary target for nucleic acid-based inhibitors. . The region around the translation start codon of AUG in particular is highly conserved, which is invariant at positions +8 to -65 (with the exception of a single nucleotide variation at position -2) as observed in more than 81 isolates from several geographic locations [32]. Despite the conservation of the sequence in the IRES motif, it is unlikely that targeting an individual sequence, even if highly conserved, will be sufficient to prevent the mutants from escaping. RNA viruses are known to have high mutation rates due to the high error ratio of the RNA polymerase and the lack of correction activity of that enzyme. On average, each time the HCV RNA is replicated, an error is incorporated into the new strand. This error ratio is combined by the prodigious production of viral particles in an active infection (approximately one trillion per day in a chronically infected patient) [33]. Therefore, in some embodiments of the invention, several conserved sites are targeted, or alternatively, the shRNAs as described herein are used as a component of a combination treatment, such as with ribavirano and / or they inferred pegylation. As shown herein, poor individual correspondence does not completely block the activity of the shRNA (see Example 2).; Figure 2D); in this way each different shRNA may have some activity against a limited number of mutations. Accordingly, the invention includes methods for inhibiting the expression of HCV using a shRNA that may include poor match to the target sequence. The invention also includes methods for inhibiting HCV expression by administering at least two different shRNAs that target an HCV IRES, such that shRNAs differ in targeting sequences. McCaffrey and colleagues reported that a phosphorodiamidate-morpholino oligonucleotide directed against a conserved HCV IRES site at the translation initiation site of AUG inhibits the expression of the reporter gene [8]. The same morpholino inhibitor was used for comparison against the inhibition by shRNA described herein. It was found that both the morpholine and the shRNA that targets the HCV IRES site strongly and potently inhibited IRES-dependent gene expression. Four mutations were required in the morpholino to block activity, while two changes in the shRNA were sufficient, suggesting greater specificity of the shRNA. This potential advantage, coupled with the lack of unnatural residues in the siRNA inhibitor and presumably less resultant side effects, is counterbalanced by the increased stability of the morpholino oligomer. A dual luciferase reporter plasmid was used in which the expression of firefly luciferase (fLuc) was dependent on the HCV IRES [24]. The expression of renilla luciferase in the 5 'direction is not dependent on IRES of HCV and results in a Cap-dependent process. Direct transfection of the HCV IRES shRNAs, alternatively of the expressed shRNAs of polIII promoter vectors, efficiently blocked HCV IRES-mediated fLuc expression in human 293FT and Huh7 cells. Control siRNAs containing a double mutation have little or no effect on fLuc expression, and siRNAs containing only a single mutation showed partial inhibition. These shRNAs were also evaluated in a mouse model where the DNA constructs were distributed to cells in the liver by hydrodynamic transfection via the tail vein. The dual luciferase expression plasmid, the shRNAs, and the secreted alkaline phosphatase plasmid were used to transfect cells in the liver, and the animals were imaged at the time points for 12 to 96 hours. In vivo imaging training revealed that HCS IRES shRNA expressed directly or alternatively from a polIII plasmid vector, inhibited HCV IRES-dependent indicator gene expression; Mutant or relevant shRNAs have little or no effect. These results indicate that the shRNAs, distributed as RNA or expressed from viral or non-viral vectors, are useful as effective antivirals for the control of HCV and related viruses. The assay of three additional siRNAs targeting different sites in the IV domain of HCV IRES revealed another potent siRNA, HCVd-wt, whose target position is displaced six nucleotides from that of HCVa-wt. HCVb-wt and HCVc-wt are much less efficient inhibitors. To further investigate the effects of the local sequence on the potency, seven shRNA constructs transcribed in vivo comprising a sequence of 19 base pairs complementary to an IRES sequence of HCV and the corresponding synthetic siRNA comprising the same sequences of 19 pairs of base, which have as objective all possible positions within the site of 25 pairs of HCVa-wt (344-368), were assessed for inhibitory activity. A 25-base pair synthetic siRNA corresponding to the HCVa-wt shRNA was also tested. All tested constructions exhibited a high level of activity. In general, the siRNAs of 19 base pairs were more potent than the 19 base pair siRNAs. The most potent, the SÍHCV19-3 was more effective at 1 nM (inhibition >90%), 0.1 nM (approximately 90% inhibition) and still at a concentration of 0.01 mM (approximately 40% inhibition). Thus, siRNAs and siRNAs of 19-25 base pairs designed to target region 344-374 in the HCV IRES are generally potent inhibitors of HCV expression, with some local differences. The small hairpin RNAs of the invention may optionally include structures that result in strong non-covalent linkages between the homosense and antisense strands of the shRNA. Examples of these non-covalent linkages include metal ion-mediated crosslinks. These cross-links may be formed between natural or modified nucleotide residues, including, for example, modified bases, sugars, and terminal groups, as described in Kazakov and Hecht 2005, Nucleic Acid-Metal Ion Interactions. In: King. R.B. (ed.), Encyclopedia of Inorganic Chemistry, 2nd, ed. , Wiley, Chichester, vol. VI, pp. 3690-3724, for example, section 5.4.3. Additional non-limiting examples of the link variants are found in patent application WO 99/09045 (US200607041, for example, Figure 10. In general, the location of the crosslinkable nucleotide residues is at the ends of the strands of Complementary RNAs that are in close proximity in the duplex formation The addition of certain metal ions (or metal ion coordination compounds) can result in the crosslinking of functional groups that have strong affinity for these metal ions, such as -SH, -SCH3, phosphorothioates, imidazolides, o-fentantrolins, and others.These modified nucleotides are introduced during the chemical synthesis of the homosense and antisense strands of RNA.The nucleotides modified in the homosense and antisense strands can form either base pairs or part of the protrusions of 1-3 nucleotides.

Target Selection Sequences Examples of target selection sequences are provided throughout the specification. Non-limiting examples of target selection sequences are provided in, for example, Table 1 and Figure 10. Non-limiting examples of siRNAs and siRNAs incorporating target selection sequences are found throughout the specification, for example, in Figure 1 and Figures 16A-B.

Handles We also investigated the effects of size and sequence of the loop region of the shRNA. The handle region of the stem handle of the shRNA can be as small as two to three nucleotides and does not have a clear upper limit in size; in general, a loop is between four and nine nucleotides, and in general it is a sequence that does not cause non-proposed effects, for example, by being complementary to the non-target gene. Highly structured loop sequences such as a GNRA tetraase can be used in the loop region (such as the loop) in a shRNA. The loop can be at either end of the molecule; that is, the homosentido handle can be either 5 'or 3' in relation to the handle. Also, a non-complementary duplex region (from about one to six base pairs, eg, four CG base pairs) can be placed between the target selection duplex and the handle, for example to serve as a "CG hold". "to strengthen the duplex formation. At least 19 base pairs of the complementary target duplex are needed if a non-complementary duplex is used. A loop structure can also include reversible bonds such as SS bonds, which can be formed by oxidation of -SH groups introduced into the nucleotide residues, for example, as described in (Earnshaw et al., J. Mol. , 1997, 274; 197-212; Sigurdsson et al. (Thiol-Containing RNA for the Study of Structure and Function of Ribozymes, METHODS: A Companion to Methods in Enzymology, 1999, 18: 71-77) A non-limiting example of the location for nucleotide residues with SH groups is at the ends of the complementary RNA strands that are in close proximity in the duplex formation.These modified nucleotides are introduced during the chemical synthesis of the homosense and antisense strands of RNA from the RNA small interference The nucleotides modified in the homosense and antisense strands can form either base pairs or form non-complementary overhangs of one to three nucleotides The additional non-limiting examples of handles and their applications, for example, in siRNA and siRNA targeting HCV, can be found in the Examples.

Terms The 3'-term of a shRNA as described herein may have a non-complementary target salient of two or more nucleotides, for example, UU or dTdT, however, the protrusions may be any nucleotide including chemically modified nucleotides which, for example, promote improved nuclease resistance. In other embodiments, there are one or no nucleotides that protrude at the 3 'end. The 5 'end may have a non-complementary extension, for example, two Gs (as shown in Figure IB), a GAAAAAA sequence, or only one or no nucleotides that extend beyond the duplex region complementary to the target. In the sequence shown in Figure IB, the two 5'-G include primarily for ease of transcription of a T7 promoter.

Additional Features Additional features that can be optionally included in the sshRNAs used to inhibit HCV expression and that are encompassed by the invention are length variations between about 19 base pairs and about 30 base pairs for the complementary duplex region to the target, small shifts in the targeted sequence (in general from zero to about two nucleotides, and shifts as large as about ten nucleotides in any direction along the target may be within the target selectable region). Similarly, mismatches are also tolerated: from about one to about two in the antisense strand and from about one to about nine of the sense strand (the latter which destabilizes the hairpin duplex but does not affect the binding strength of the strand). strand antisense to the target; the tolerated number depends partially on the length of the complementary duplex to the target. As described herein, a shRNA that has at least seven bad GU correspondences within a duplex region complementary to the 29-base pair target can be successfully used to inhibit HCV expression, for example, by using the sequence that selects the HCV IRES as its target. It is noted that the two mutations shown in Figure IB cancel out inhibition quite a bit, but other mutants that have mutations in other positions, particularly if they are closely spaced and / or near the end, can be better tolerated. Certain variations in the art are known or are demonstrated in the present application.

Vectors suitable vectors for producing siRNA and siRNA and are known in the art. In non-limiting examples, shRNAs can be expressed using Pol III promoters such as U6 or Hl, in the context of vectors derived from adeno-associated viruses or lentiviruses. The promoter of human U6 nuclear RNA and the human Hl promoter are among the pol III promoters to express the shRNAs. A characteristic that is generally desirable in a vector is relatively long transgenic expression. The lentiviral vectors are capable of transducing non-dividing cells and maintaining long-term expression of the transgene. Serotype 8 of the adeno-associated virus is considered safe and is characterized for prolonged transgenic expression.

SiRNA and siRNA Candidates In some cases, one or more small interfering RNAs are identified as having activity to inhibit a target selected virus such as HCV. Additional tests may be carried out to further characterize the suitability of these RNAs for use, for example, to inhibit the expression of HCV in an animal. Animal models can be used for this test. A non-limiting example includes a murine model, for example, as illustrated in Example 3 (infra). Other animal models suitable for approving a treatment for HCV are known in the art, for example, using chimpanzees.

Methods The invention relates to methods for inhibiting gene expression in a virus, which comprises contacting the virus with a small interfering RNA, such as a shRNA or siRNA as described herein comprising a sequence that is at least partially complementary to, and is capable of interacting with a polynucleotide sequence of the virus. In some embodiments, contacting the virus comprises introducing the small interfering RNA into a cell containing the virus, i.e., a cell infected with a virus. The "inhibition of gene expression" as used herein refers to a reduction (e.g., reduction in level) or elimination of the expression of at least one gene of a virus. For example, the reduction in expression compared to the corresponding cell or animal infected with the virus. In some embodiments, the inhibition of gene expression is achieved by cleavage of the viral target sequence to which it binds to the small interference RNA. Gene expression can be assessed by evaluating the viral RNA or viral protein. In some cases, the efficiency of a method (e.g., a treatment using a composition described herein) is evaluated when evaluating an infected animal for a decrease in symptoms or a change (e.g., decrease) in expression or activity of a protein associated with viral infection, for example, a viral protein such as p24, or a host protein such as an interferon. The invention also relates to methods for treating a viral infection or for treating a subject suspected of being infected (including a subject exposed to the virus for prophylactic treatment) in a mammal, which comprises administering to the mammal a composition comprising an amount therapeutically effective of a small interfering RNA, such as siRNA or siRNA as described herein that includes a sequence that is at least partially complementary to, and capable of interacting with (eg, hybridizing under physiological conditions, or affecting the activity of the RNAi), a polynucleotide sequence of the virus, for example, the IRES sequence of HCV. In some modalities, the mammal is human. In one embodiment, the mammal is a human and the viral infection is an HCV infection, such as an infection with the HCV genotype, and the small interference RNA comprises a sequence that is at least complementary to an IRES sequence of the HCV. As used in this, a "therapeutically effective amount" is an amount of a small interfering RNA that can produce a desired therapeutic result (eg, reduction or elimination of a viral infection). A therapeutically effective amount may be administered in one or more doses. Non-limiting examples of doses are about 0.1 mg / kg to about 50 mg / kg, for example, about 1 to about 5 mg / kg. Suitable methods of distribution are known in the art and include, for example, intravenous administration (eg, by a peripheral vein via a catheter). Non-limiting examples include distribution by the hepatic artery or the portal vein. In general, in methods for treating a viral infection in a mammal, the small interference RNA is administered with a pharmaceutically acceptable carrier. As used herein, a "pharmaceutically acceptable carrier" (also referred to interchangeably as "pharmaceutically acceptable excipient" herein) is a relatively inert substance that facilitates administration of the RNA or small interfering RNA. For example, a carrier can give shape or consistency to the composition or can act as a diluent. A pharmaceutically acceptable carrier is biocompatible (ie, non-toxic to the host) and suitable for a particular route of administration for a pharmacologically effective substance. Suitable pharmaceutically acceptable carriers include but are not limited to stabilizing agents, wetting and emulsifying agents, salts for varying osmolarity, encapsulating agents, buffers, and skin penetration enhancers. In some embodiments, the pharmaceutically acceptable carrier is water or saline. Examples of pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (Alfonso R. Gennaro, ed., 18th edition, 1990). In methods for treating a viral infection, the small interfering RNAs as described herein are generally administered parenterally, for example, subcutaneously, intravenously or intramuscularly.

Compositions The invention provides compositions for inhibiting viral gene expression and / or for treating a viral infection in a mammal comprising at least a small interfering RNA as described herein. The compositions of the invention may comprise two or more small interference RNAs as described herein. According to the invention, a small interfering RNA, for example, shRNA or siRNA, comprises a sequence that is substantially complementary to a viral polynucleotide sequence of about 19 to about 30 nucleotides, wherein the interaction of the substantially complementary sequence RNA of small interference with the polynucleotide sequence of the virus inhibits viral gene expression, for example, by cleavage of the viral polynucleotide sequences. In some embodiments, the composition comprises a shRNA that includes a sequence selected from the group consisting of SEQ ID NO: 12, 17, 18, 19, 20, 21, 22, 23, 24 and 25. In some embodiments, the composition comprises a shRNA that includes one of the following: SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38; SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 and SEQ ID NO: 56 (Table 10). In some embodiments, the composition comprises one or more siRNA of SEQ ID NO: 57-110. In some embodiments, the composition comprises an siRNA comprising a sequence selected from SEQ ID Nos: 19, 20, 21, 22, 23, 24 and 25. In other embodiments, the composition comprises an siRNA that includes a sequence of SEQ ID NO. : 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38; SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 and SEQ ID NO: 56 (Figure 10). In some embodiments, the composition comprises a siRNA or siRNA that binds, ie, comprises a substantially complementary sequence, a sequence of about 19 to about 30 nucleotides, within the IRES element of HCV, eg, genotype of HCV. A composition may include more than one different shRNA, for example, the ARNSsh that target different sequences of an IRES or different alleles or mutations of a target sequence. A siRNA or siRNA as described herein may include more than one of the identified sequences. Certain compositions contain more than one sequence of different shRNA or siRNA. In some embodiments, the invention provides a pharmaceutical composition comprising a small interfering RNA as described herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for parenteral administration to a mammal, e.g., a human. A pharmaceutical composition that includes a short interfering RNA (eg, an siRNA or a shRNA) is formulated to be compatible with its proposed route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, inhalation, transdermal (topical), transmucosal, and rectal administration; or oral Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may include the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for tonicity adjustment such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where they are soluble in water) or dispersions and sterile powders for extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELMR (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and must be fluid to the extent that there is easy syringability. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol and the like), and mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, for the maintenance of the selected particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some cases, isotonic agents, for example, sugars, or polyalcohols such as mannitol, sorbitol or sodium chloride are included. Prolonged absorption of an injectable composition can be effected by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin. Sterile injectable solutions can be prepared by incorporating the active compound of the specified amount in an appropriate solvent with one or a combination of ingredients listed above, as needed, followed by filtered sterilization. In general, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients selected from those enumerated above or others known in the art. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze drying which produce a powder of the active ingredient plus any additional desired ingredients of a previously sterile filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipient and used in the form of tablets, troches, or capsules, for example, gelatin capsules. The pharmaceutically compatible binding or binding agents can be included as part of the composition. The tablets, pills, capsules, troches and the like may contain any of the following ingredients, or compounds of a similar nature; a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavor. For administration by inhalation, the compounds are distributed in the form of an aerosol spray from a pressurized container or pressurized disperser containing a suitable propellant, for example, a gas such as carbon dioxide, or a nebulizer. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, appropriate penetrants to the barrier to be permeated are used in the formulation. These penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated in ointments, balms, gels or creams as is generally known in the art. The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal distribution. In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. The methods for the preparation of these formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes directed to cells infected with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. It is advantageous to formulate oral or parenteral compositions in the unit dosage form for ease of administration and uniformity of dosage. The unit dosage form as used herein refers to physically discrete units suitable as unit doses for the subject to be treated; each unit containing a predetermined amount of the active compound calculated to produce the desired therapeutic effect in association with the selected pharmaceutical carrier. The toxicity and therapeutic efficacy of the compounds described herein can be determined by pharmaceutical methods known in the art, for example, in cell cultures or experimental animals, for example, to determine LD50 (the lethal dose at 50% of the population ) and LD50 (the therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the Therapeutic Index and can be expressed as the ratio of LD50 / ED50. Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a distribution system that directs these compounds to the site of affected tissue to reduce the minimum potential damage to uninfected cells, and thus, reduce side effects The data obtained from cell culture assays and animal studies can be used in the formulation of a variety of doses for human use. The dose of these compounds is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dose may vary within this range depending on the dosage form employed and the route of administration used. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a plasma concentration range in circulation that includes the IC 50 (ie, the concentration of the test compound that achieves maximum mean inhibition of symptoms) as determined in cell culture. This information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography. The invention also relates to a method for making a medicament for use in the treatment of a subject, for example, for HCV infection. These medications can also be used for the prophylactic treatment of a subject at risk for or suspected of having an HCV infection.

Kits The invention provides kits comprising a small interference RNA as described herein. In some embodiments, the kits also include instructions for use in methods for inhibiting viral gene expression and / or methods for treating a viral infection in a mammal described herein. Instructions may be provided in printed form or in the form of an electronic medium such as a floppy disk, CD, or DVD or in the form of a website address where these instructions may be obtained. In some embodiments, kits include a pharmaceutical composition of the invention, for example, which includes at least one unit dose of at least one small interfering RNA such as a shRNA or siRNA, and instructions that provide information to a care provider of health with respect to use to treat or prevent a viral instruction. Small interference RNA is often included as a sterile aqueous pharmaceutical composition or dry powder composition (eg, lyophilized). Adequate packaging is provided. As used herein, "packaging" refers to a solid matrix or material usually used in a system and capable of retaining within a fixed range a composition of the invention suitable for administration to an individual. These materials include glass and plastic bottles (for example polyethylene, polypropylene or polycarbonate), jars, paper, plastic, and foil-laminated wrappers and the like. If sterilization techniques with electron aces are used, the packaging must have a sufficiently low density to allow the sterilization of the contents. The kits may also optionally include kit for administration of a pharmaceutical composition of the invention, such as for example, syringes or kit for intravenous administration, and / or a sterile solution, for example, a diluent such as water, saline or a solution of dextrose, to prepare a dry powder composition (eg, lyophilized) for administration.

Table 1 List of Target Selection Sequences Described in the Application that Can Be Incorporated into the siRNA or siRNA and Examples of these siRNA and siRNA SEQUENCE Sequence Antisense Position Examples ID # (5'-3 ') Purpose of siRNA or in IRES siRNA of HCV SEQ ID UCUUUGAGGUUUAGGAUUCGUGCUC 344-368 HCVa-WT NO: 27 ARNsh SEQ ID UCUUUGAGGUUUAGGAUUGGUGCUC 344-368 HCVa-SNPl NO: 28 ARNsh SEQ ID UCUUUGAGCUUUAGGAUUCGUGCUC 344-368 HCVa-SNP2 NO: 29 ARNsh SEQ ID UCUUUGAGCUUUAGAUUGGUGCUC 344-368 HCVa-mut NO: 30 ARNsh SEQ ID CCUCCCGGGGCACUCGCAAGCACCC 299-323 HCVb-wt NO: 31 ARNsh SEQ ID UGGUGCACGGUCUACGAGACCUCCC 318-342 HCVc-wt NO: 32 ARNsh SEQ ID GGUUUUUCUUUGAGGUUUAGGAUUC 350-374 HCVd-wt NO: 33 ARNsh SEQ ID AGGUUUAGGAUUCGUGCUC 344-362 ARNsi # l, NO: 19 shRNA # l SEQUENCE Antisense Sequence Position Examples ID # (5'-3 ') Target of shRNA or in IRES siRNA of HCV SEQ ID GAGGUUUAGGAUUCGUGCU 345-363 siRNA # 2, NO: 20 ARNsh # 2 SEQ ID UGAGGUUUAGGAUUCGUGC 346-364 ARNsi # 3, NO: 21 ARNsh # 3 SEQ ID UUGAGGUUUAGGAUUCGUG 347-365 siRNA # 4, NO: 22 ARNsh # 4 SEQ ID UUUGAGGUUUAGGAUUCGU 348-366 ARNsi # 5, NO: 23 ARNsh # 5 SEQ ID CUUUGAGGUUUAGGAUUCG 349-367 ARNsi # 6, NO: 24 ARNsh # 6 SEQ ID UCUUUGAGGUUUAGGAUUC 350-368 ARNsi # 7, NO: 25 shRNA # 7 Figures 16A-16B illustrate examples of shRNAs containing the sequence that targets the HCV IRES, and tested using the methods described herein.

EXAMPLES The invention is further illustrated by the following examples. The examples are provided for illustrative purposes only. They should not be considered as limiting the scope or content of the invention in any way.

Example 1: Design and Construction of ShRNA Expression Cassettes, T7 Transcription Reactions, and Gen assays Indicator Chemically synthesized IDT oligonucleotides were obtained (Coralville, IA), suspended in RNase-free water and pyrogens (Biowhittaker), and fixed as described below. The following pairs of oligonucleotides, to make the shRNA, contain a T7 promoter element (double underlined), HCV IRES antisense and homosense sequence, and a microRNA structure miR-23 (reported to facilitate cytoplasmic localization [21, 22]. ]). T7-HCVa-wt fw: 5 '-taatacgactcactatagggagcacgaatcctaaacctca aagaCTTCCTGTCAtctttgaggtttaggattcgtgctcTT-31 (SEQ ID NO: 1); T7-HCVa-wt rev: 5 '- AAgagcacgaatcctaaacctcaaagaTGACAGGAA Gtctttgaggtttaggattcgtgct ccctatagtgagtcgtatta-3' (SEQ ID NO: 2) (Double-underlined T7 promoter sequence). The T7 transcripts for the hCH shRNA of a-mut HCH were identical with the exception that the nucleotide changes (G-> C and C-> G) were incorporated in the nucleotides synthesized in the residues underlined with a line. The HCVa-wt shRNA (Figure IB) was designed to target region 344-374 in the HCV IRES; the HCVb-wt was designed to target the region 299-323 (Figure 1C); the HCVc-wt was designed to target region 318-342 (Figure 1C); and the HCVd-wt was designed to target the region 350-374 (Figure 1C). The shRNA # 1-7 (target selection positions) 344-362, 345-363, 346-364, 347-365, 348-366, 349-367, 350-368 in the HCV IRES; See Figure 4A, which represents the viral recognition sequences of 19 base pairs) were transcribed in vi tro using the MEGAscript ™ (Ambion) kit and contained the same loop sequences and the 5 ', 3'-overhangs as the HCsh shRNA. -wt. The siRNAs # 1-7 (see Figure 4A, representing the viral recognition sequences of 19 base pairs) were synthesized chemically in Dharmacon (Lafayette, CO) and contained 3'-UU overhangs in both the sense and antisense strands. The pair of oligonucleotides used to prepare the control siRNA 229 (targeting tumor necrosis factor-alpha) is 229-5'-TAATACGACTCACTATAGGGGCGGTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAG AAGAGGCTGAGACATAGGCACCGCC TT-3 '(SEQ ID NO: 3) and 229-3' - AAGGCG GTGCCTATGTC TCAGCC TCT TCTCA TGACAGGAAG TGAGA AGAGGCTGAGACATAGGCACCCCTATAGTGAGTCGTATTA-5 '(SEQ ID NO: 4).

Construction of Vector Expression Pol III U6 shRNA, Expression Vector Design of Small-ShRNA RNAsh Pairs of oligonucleotides were incubated together at 95 ° C for two minutes in RNA-polymerase buffer (eg, 120 μl of each oligonucleotide 100 μM in 60 μl of 5X fixation buffer (Promega, IX = 10 mM Tris-HCl (pH 7.5), 50 mM NaCl) and cooled slowly (fixed) for 1 hour at less than 40 ° C. Oligonucleotides were designed for provide 4-base overhangs for rapid cloning in the plasmid pCRII-U6 digested with Bbsl / BamHl (Bbsl and BamHl recognition sites or projections are underlined on the oligonucleotide sequences.) The expression plasmid pCRII-U6 pol III was prepared at sub-cloning the PCR product obtained from human HT-1080 genomic DNA using primers and huU6-5 'ATCGATCCCCAGTGGAAAGACGCGCAG (SEQ ID NO: 5) and huU6-3'-GGATCCGAATTCGAAGACCACGGTGTTTCGTCCTTTCCACAA-5' (SEQ ID NO: 6) [23] jan The pCRII vector (Invitrogen) using the TA cloning kit (Invitrogen). The cassette consisting of the fixed oligonucleotides (coding for the HCV IRES shRNA) was ligated into the pCRII-U6 plasmid digested with Bbsl / BamHI. The expressed siRNA contains a miRNA-23 microRNA loop structure to facilitate cytoplasmic localization [21,22]. The final constructs of pCRII-U6 were confirmed by sequencing. The pairs of primers used were: pHCVa-wt 5'-ACCGGAGCACGAATCCTAAACCTCAAAGACTTCCTGTCATCTTTGAGGTTTAGGATTCGTGC TCTTTTTTG-3 '(SEQ ID NO: 7) and 5'-GATCCAAAAAAGAGCACGAATCCTAAACCTCAAAGATGACAGGAAGTCTTTGAGGTTTAGGA TTCGTGCTC-5' (SEQ ID NO: 8). Oligonucleotides containing the appropriate sequence changes in the underlined residues (see above) were used to generate pCRII-U6 / HCVa-mut (double mutation), HCVsnpl (individual change on the 5 'side) and HCVsnp2 (individual change at the 3 'end) as depicted in Figure IB and described above. The pCRII-U6 / 229 was prepared similarly using the oligonucleotides 5'ACCGGGCGGTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAGAAGAGGCTGAGACAT AGGCACCGCCTTTTTT-5 '(SEQ ID NO: 9) and 3'-GATCAAAAAAGGCGGTGCCTATGTCTCAGCCTCTTCTCATGACAGGAAGTGAGAAGAGGCTG AGACATAGGCACCGCC-5' (SEQ ID NO: 10).

T7 Transcription Reactions Oligonucleotide pairs were incubated at 95 ° C for two minutes in RNA polymerase buffer (eg, 120 μl of each 100 μm oligonucleotide in 60 μl of 5X transcription buffer (Promega)) and cooled slowly (fixed) for 1 hour at less than 40 ° C. The shRNA was transcribed at 42 ° C for four hours from 5 μM of the resulting double-stranded DNA template using the AmpliScribe ™ T7 Flash transcription kit (Epicenter Technologies) followed by purification on a rotating gel filtration column. (Microspin ™ G-50, Amersham Biosciences) which has been thoroughly washed three times with phosphate buffered saline (PBS) to remove the preservative.

SiRNA SiRNAs were prepared by attaching chemically synthesized (Dharmacon) complementary strands of RNA, each containing the appropriate recognition sequence plus a UU extension (overhang) at the 3 'end.

Transfections and Assays of Indicator Gene 293FT Cells (Invitrogen) and Huh7 (American Type Culture Collection (ATCC), Manassas, VA) were maintained in DMEM (Biowhittaker ™) with 10% fetal bovine serum (HyClone), supplemented with L-glutamine 2 mM and 1 mM sodium pyruvate. The day before transfection, cells were seeded at 1.7 x 10 5 cells / concavity in a plate of 24 concavities, resulting in approximately 80% cell confluence at the time of transfection. The cells were transfected with Lipofectamine ™ 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. For the inhibition experiments, the 293FT or Huh7 cells were co-transfected (in triplicate) with 40 ng of dual luciferase indicator (renilla and firefly) construction of pCDNA3 / HCV IRES, 50 ng of the control plasmid pSEAP2 (BD Clontech Biosciences, as transfection controls), and the amounts indicated in the construction of sshRNA expression (typical amount 1 pmol) generated by T7 or pCRN-p6 of pCRII-U6 (710 ng). The compensatory pUC18 plasmid is added to the transfection mixture to give a final concentration of 800 ng of total nucleic acid per transfection. Forty-eight hours later, the supernatant was removed, heated at 65 ° C for 15-30 minutes, and 5-10 μl of the 150 μl supernatant of the p-nitrophenyl phosphate liquid substrate system (pNPP, Sigma) was added. ). After an incubation of 30-60 minutes at room temperature, the samples were read (405 nm) in a Molecular Devices Thermomax microplate reader and quantified using SOFTmax software (Molecular Devices). The remaining cells were lysed and the luciferase activity was measured using the Luciferase Dual indicator assay system (Promega) and the luminometer MicroLumat LB 96 P (Berthold).

Mice Six-week-old female Balb / c mice were obtained from the Stanford animal facility University. The animals were treated in accordance with the NIH Guidelines for Animal Care and the Guidelines of Stanford University.

Hydrodynamic Injections of Mice and In Vivo Formation of Images Hydrodynamic injections into the tail vein were performed as described by McCaffrey et al with minor modifications including omission of RNasin [24]. A total volume of 1.8 ml of phosphate buffered saline containing the inhibitor (RNA or plasmid), 10 μg of Plasmid of Luciferase Dual of pHCV and 2 μg of plasmid of control pSEAP2 (BD Biosciences Clontech, contains the SV40 early promoter ), was injected in a sustained manner into the vein of the mouse tail for approximately five seconds (N = 4-6 animals per group). At the indicated times, 100 μl of 30 mg / ml luciferin was injected intraperitoneally. Ten minutes after the injection, the live anaesthetized mice were analyzed using the imaging system IVIS7 Xenogen Corp., Alameda, CA) and the resulting light emission data were quantified using the Livinglmage software (Xenogen). Values are reported as obtained as relative detector light per minute and the standard errors of the mean for each group are shown (N = 4-5 animals).

Assay of Segregated Alkaline Phosphatase (SEAP) On day 5, the mice were bled through the retro-orbital vein of the eye. The serum was separated from the blood cells by microcentrifugation, heated at 65 ° C for 30 minutes to inactivate the endogenous alkaline phosphates, and 5-10 μl of the serum was added to 150 μl of the liquid substrate system pNPP (see above). After an incubation of 30-60 minutes at room temperature, the samples were read (405 nm) and quantified as described above.

Example 2: Inhibition by HCS IRES Mediated Gene Expression in Human Tissue Culture Cells In this study, short interfering RNAs (shRNA and siRNA) designed and constructed as in Example 1 to target a conserved region of hepatitis C IRES were tested for their ability to inhibit HCV IRES-mediated indicator expression in human tissue culture cells. Figure IA shows the HCV IRES target site (panel A) as well as the HCV shRNA that results from transcription of T7 from a prepared template of hybridized oligonucleotides containing a T7 promoter sequence and the HCV IRES target (Figure IB). ). The underlined residues are those that were changed to generate the mutant HCV shRNAs. The shRNAs contain a miRNA-23 microRNA structure that was previously suggested to facilitate cytoplasmic localization [21, 22] and an RNA stem at 25 base pairs with two nucleotides at the 5 'ends (two guanines) and 3 '(two uridines) that can also hybridize through Watson-Crick G: U base matings. For the shRNAs distributed to the vector, the overlap oligonucleotides were subcloned into a poIII expression vector (pCRII-U6, see Example 1). Three other siRNAs were also designed with the same stem length and loop sequence that target nearby positions in Domain IV of the HCV IRES (Figure 1C). HCVb-wt shRNA targets a highly structured region (used as a negative control) to compare efficiency), while HCsh-wt shRNA and HCVd-wt target regions that are more "accessible" in accordance to the biochemical printing studies (Figure ID: Brown et al, Nucleic Acids Res., 1992, 20: 5041-5.). All the RNAse were transcribed in vi tro of the dsDNA templates containing a T7 promoter, similar to the siRNA of HCVa-wt.

To test the effectiveness of HCV siRNAs in inhibiting IRES-mediated gene expression of HCV, human 293FT or Huh7 cells from hepatocytes were co-transfected with the IRES Dual Luciferase expression plasmid of pCDNA3 / HCV, expression plasmid of segregated alkaline phosphatase (pSEAP2, to control transfection efficiency) as well as the hsRNAs synthesized in vi tro or alternatively, pol III expression vectors and contain the corresponding cassettes of shRNA. As seen in Figure 1F, both shRNAs of HCVa-wt and HCVd-wt, which target the IRES region immediately in the 5 'direction of the translation start site of AUG (positions 344-368 and 350-374, respectively), strongly inhibit HCV IRES-mediated fLuc expression in human 293FT cells. The HCVc-wt (which targets 318-342) showed moderate inhibition and HCVb-wt (299-323) showed little activity, if any, as expected. In this way, preliminary detection revealed a potent siRNA, HCVawt, which was chosen for further detailed studies.

Specificity and Potency of Inhibition of HCV IRES-mediated Gene Expression by ssh-shRNAs in 293FT Cells To further test the inhibition of HCV-activated IRES gene expression, 293FT cells were co-transfected with dual luciferase indicator and plasmids expressing SEAP as well as 1 pmol of the shRNAs transcribed in vi tro. The target plasmid was the IRES dual luciferase indicator of pCDNA3 / HCV (HCV IRES, as shown in Figure 1E). Plasmid pUCld was added to the transfection mixture to give a final total nucleic acid concentration of 800 ng by concavity transfection (tissue culture plates of 24 concavities). Forty-eight hours later, the supernatant was removed for SEAP analysis, then the cells were used and the firefly and renilla luciferase activity (not shown) was measured as described in Example 1. The activities of firefly luciferase and SEAP were normalized to 100. The results are shown in Figure 2A. HCVa-wt siRNA targeting the IRES region immediately downstream of the translation start site of AUG strongly inhibited HCV IRES mediated expression of HCV in both human 293FT cell lines (Figure 2) and Huh7 of hepatocytes (Figure 3B). Little or no inhibition was observed using either a mutant siRNA (HCVa-mut) containing two changes in RNA hairpin pairing (for mismatch location, see Figure IB) or an unrelated TNF shRNA (229) . The 229-TNF siRNA is highly effective in inhibiting TNF expression (Seyhan et al., RNA, 2005, 11: 837-846), suggesting that this shRNA be used effectively by the RNAi apparatus. The changes of individual nucleotides in the hairpin region, at either the position in the 5 'direction in the 3' direction (SNP1 and SNP2, respectively, see Figure 2C), have a partial effect. Little or no inhibition was observed when the HCV shRNA was directed to a similar dual luciferase construct in which the HCV IRES was replaced by the encephalomyocarditis virus IRES (EMCV) (Figures 2B and 3B). In this way, the data of Figure 2B illustrate that HCVa-wt shRNA does not inhibit a similar target lacking the HCV IRES. In this experiment, the cells were transfected as in Figure 2A except that the pCDNA3 / HCV dual luciferase reporter (EMCV IRES) was used as the target instead of pCDNA3 / HCV. These data are presented in Figure 2B as luciferase activity divided by SEAP activity normalized to 100. To confirm that the shRNAs were acting by degrading their target mRNA, a Northern blot analysis was performed (Figure 2F). Equal amounts of total RNA, isolated from transfected cells without inhibitor or the hshRNAs of HCVa-wt, HCVmutl / 2, or 229, were separated by gel electrophoresis. The separated RNA was transferred to a membrane and hybridized to radiolabeled cDNA probes specific for fLuc, SEAP and elongation factor IA (EF1A). HCsh-wt shRNA (path 3) when corrected for SEAP and EF1A mRNA levels (63% inhibition compared to shRNA 229 (path 2); no inhibition was observed for HCVa-mutl / 2) (compare pathways 3 and 4) after quantification by phosphoformer imaging. These data demonstrate that the shRNAs were degrading the target mRNA. Dose response experiments showed that HCVa-wt siRNA effectively inhibited HCV IRES-dependent gene expression at 0.3 nM in 293FT cells (96 percent inhibition, see Figure 2D) and 0.1 nM in Huh7 cells (75 percent inhibition, see Figure 3A). To further investigate the effects of local sequence on potency, seven 19-base-pair shRNAs transcribed in vi tro and the corresponding 19-base synthetic siRNA were screened, selecting all possible positions within the site of 31 pairs of base of HCVa (344-374; Figure 4A), for inhibitory activity. A 25-base-pair synthetic siRNA corresponding to the HCVa-wt siRNA was also tested. All exhibited a high level of activity (Figure 4B). Most potent were the siRNA and shRNA versions of HCVa as well as siRNA # 3, which was effective at 1 nM (< 90% inhibition, Figure 4B) and 0.1 nM (approximately 90% inhibition, Figure 4C). Thus, siRNAs of 19-25 base pairs and siRNAs designed to target region 344-374 in the HCV IRES are potent, with some local differences.

Example 3: Inhibition by HCS IRES-mediated Gene Expression of HCV in a Mouse Model System The ability of the HCV shRNA expression plasmid and the HCV shRNA to inhibit target gene expression was extended to a murine model system using hydrodynamic injection to distribute the nucleic acids to the mouse liver. Figures 5A-5B show the results of injecting a large volume of PBS (1.8 ml) containing dual Luc of pHCV, pSEAP2 and shRNA (10 times in excess on the target in a mass base of either shRNA or expression vectors pol III expressing the shRNA) in the tail veins of mice (n = 4-5 mice). At the time points shown in Figure 5B, luciferin was injected intraperitoneally and the mice were imaged with a high sensitivity, cooled CCD camera. (Figure 5A shows representative mice chosen from each set (4-5 mice per set) at the time point of 84 hours). At all time points tested, HCV siRNA strongly inhibited luciferase expression ranging from 98% (time point of 84 hours) to 94% (time point of 48 hours) of inhibition compared to mice injected with pUC18 in place of the shRNA inhibitor. Mutant (mut) or control (229) shRNAs have little or no effect.

It should be noted that the luciferase activity decreases with time, possibly due to DNA loss or silencing of the promoter [8] and that the data is normalized within each time point (see description of Figure 5 above). Figure 6 shows a comparison of the siRNA inhibitory activity of HCVa-wt with a phosphoramidite-morpholino oligomer shown above that effectively targets this same site [8].

Both the HCVa-wt shRNA and the morpholino oligomers effectively blocked luciferase expression at all time points tested. Data are shown for the time point of 48 hours, where the inhibition was 99. 95 and 99.88 percent, respectively, for the shRNA of HCVa-wt and morpholino inhibitors.

Example 4: Inhibition of Semliki Forest Virus (SFV) Using the shRNAs SFV has been used as a model system for more virulent positive strand RNA viruses. To examine the inhibitory effect of RNAi on the growth of SFV, the shRNAs that target four SFV genes (nsp-1, nsp-2, and nsp-4, and capsid) and a poorly matched control for the nsp- site 4 were generated and expressed from a U6 promoter. Its proven ability is its ability to inhibit the proliferation of SFV-A7-EGFP, a version of the SFV-A7 strain of replication-competent SFV that expresses an eGFP reporter gene [49]. A modest reduction (approximately 35%) of SFV-GFP replication is seen with the shRNAs that target the nsp-1 region (Figure 7) but not the nsp-2, nsp-4 or coding capsid regions, not with the badly matched siRNA (not shown). A site within the capsid coding region shown above that is effective in the Sindbis virus [50] was not effective in SFV. The homology of the Sindbis-SFV sequence in this site is only 77%. SFV is a very fast-growing virus that produces up to 200,000 cytoplasmic RNAs during its infectious cycle. To see if the cells can better protect from a slower-growing virus, the effects of these siRNAs on a deficient strain of SFV-GFP replication were tested in two separate experiments. Figure 8 shows that the siRNAs expressed in U6 that target this SFV strain can reduce viral expression by = 70% over a period of time of up to five days. This effect is seen with the siRNAs that target non-structural genes nsp-1, nsp-2 and nsp-4 as well as an siRNA with a poor correspondence in nsp-4, but not for the capsid gene (which is lacking in this crippled virus) or other controls (Figure 8). It is noted that the length of the sequence targeted by the shRNAs is 29 nucleotides and the poor individual correspondence used in the shRNA mismatch of nsp-4 is not apparently disruptive to the effect of RNAi. The wide variation in the effectiveness of the several shRNAs accentuates the importance of a library approach to find the best siRNA and shRNA when dealing with rapidly replicating and highly mutagenic viruses such as SFV. Dose response experiments were performed to examine the inhibition of a HCV replicon system in Huh7 cells by the HCVa-wt shRNA and the HCVa-mut shRNA as well as a non-specific control shRNA (229). The antiviral activity of the test compounds was assessed in the line of stably replicating HCV RNA cells, AVA5, derived by transfection of the human hepatoblastoma cell line, Huh7 (Blight, et al., Science, 2000, 290: 1972). The RNA-based inhibitors were co-transfected with the DsRed expression plasmid in cultures that were approximately 80 percent confluent. The HCV RNA values were assessed 48 hours after transfection using dot blot hybridization. The tests were carried out in triplicate cultures. A total of 4-6 untreated control cultures, and triplicate cultures treated with 10, 3 and 1 IU / ml of a-interferon (active antiviral without cytotoxicity), and ribavirin 100, 10 and 1 uM (without antiviral and cytotoxic activity) ) served as positive toxicity and antiviral controls. The transfection efficiency was estimated by fluorescence microscopy (DsRed expression). The levels of both HCV and b-actin RNA in cultures treated in triplicate were determined as a percentage of the mean levels of RNA detected in untreated cultures (6 in total). Beta-actin RNA levels were used both as a measure of toxicity, and to normalize the amount of cellular RNA in each sample. A level of 30% or less of HCV RNA (relative to control cultures) is considered to be a positive antiviral effect, and a level of 50% or less of b-actin RNA is considered (relative to cultures of control) which is a cytotoxic effect. Cytotoxicity is measured using an established neutral red dye uptake assay (Korba, BE and JL Gerin (1992).) Use of a standardized cell culture assay to determine activities of nucleoside analogs against hepatitis B virus replication (Antivir. Res. 19: 55-70) Inhibition of an HCV replicon system in Huh7 cells by HCVa-wt shRNA and HCVa-mut shRNA as well as an irrelevant control shRNA (229); response to the dose. The antiviral activity of the test compounds was assessed in the cell line that stably replicates HCV RNA, AVA5, derived by transfection of the human hepatoblastoma cell line, Huh7 (Blight et al., Science, 2000, 290: 1972). The RNA-based inhibitors were co-transfected with the expression plasmid DsRed in 80% confluent cultures and the HCV RNA levels were measured 48 hours after transfection using dot blot hybridization. Trials were carried out in triplicate cultures. A total of 4-6 untreated control cultures, and triplicate cultures treated with 10, 3 and 1 IU / ml of a-interferon (active antiviral without cytotoxicity), and ribavirin of 100, 10 and 1 uM (without antiviral activity and not cytotoxic) served as positive toxicity and antiviral controls. The transfection efficiency was estimated by fluorescence microscopy (DsRed expression). The levels of both b-actin RNA and HCV were measured in cultures treated in triplicate as a percentage of the mean levels of RNA detected in untreated cultures (6 in total). Beta-actin RNA levels were used as a measure of toxicity, and to normalize the amount of cellular RNA in each sample. A level of 30% or less of HCV RNA (relative to control cultures) was considered to be a positive antiviral effect, and a level of 50% or less of b-actin RNA (relative to control cultures) it was considered to be a cytotoxic effect. Cytotoxicity was measured using an established neutral red dye uptake assay (Korba et al., Antiviral Res., 1992, 19: 55-70). Use of a standardized cell culture assay to determine activities of nucleoside analogs against hepatitis B virus replication (Korba et al., 1992 supra).

Example 5: Identification of shRNAs that Inhibit Gene Expression of HCV IRES in Tissue Culture Cells The ability of small hairpin RNAs in vi tro transcripts (shRNA) to inhibit gene expression dependent on the internal ribosomal entry site of the virus of hepatitis C (HCV IRES) in cultured cells was investigated. As described supra, a 25-base pair shRNA, the HCVa-wt, which targets the 3 'end of the HCV IRES, near the translation start site of AUG (Table 2) was found to be effective for interrupt the expression of HCV. To assess the ability of co-transfected constructs of shRNA to interfere with the function of IRES, an indicator construct (dual luciferase plasmid of pHCV) was used in which the expression of firefly luciferase (fLuc) is dependent on IRES of HCV (Figure 1; Wang et al., Mol.Ther., 2005, 12: 562-568.) In these experiments, 293FT cells were cultured and transfected with an indicator construct and HCVa-wt or one of the other test sequences as described in Wang et al., 2005, supra.

It was found that at a concentration of 1 nM, HCVa-wt caused 90% inhibition of HCV IRES-dependent luciferase expression in 293FT cells (Wang et al., 2005, supra). In subsequent experiments, 26 additional shRNAs were selected and tested (Figure 10, Figures 16A-B) that target several regions of the HCV IRES, 3 of the 26 were duplicated from those described above (HCVb, HCVc, HCVd-wt); 23 were new sequences) to identify additional HCV inhibitors. The objective was to identify the siRNAs that can be used either in combination with HCVa-wt), making it harder for the virus to develop resistance by mutating the HCVa-wt target site, or as alternatives to HCVa-wt. The sshRNAs to be tested were chosen to avoid regions that vary between different HCV genotypes. Some test sequences were selected using the algorithm available from (eg, jura.wi.mit.edu/bioc/siRNAext/, and other test sequences intentionally selected from the HCV IRES sequences which, due to their CG content , and other features, would not be recommended by many algorithms as a rule, such as regions with high GC content or highly structured.ShshRNAs were generated by transcription of the dsDNA templates using T7 RNA polymerase and to promote transcription efficiency, starting with the 5'-pppGGG sequence This 5 'sequence formed a projection of two to three nucleotides, the exact length depending on whether the target site contains one or more guanosine residues at its 5' end ( see Figures 16A-B.) If the last nucleotide of the homosense RNA strand corresponding to an objective sequence was "G", only two more Gs have to be added for efficient transcription, and these G are from Individual bra in the 5 'end of the shRNA, not complementary to the target. If the last nucleotide of the homosense strand of shRNA that corresponds to the target, was not a G, then for efficient transcription in the test systems, we have to add three G that were not complementary to the target. All the shRNAs tested in this set of experiments have a duplex stem length of 21-25 base pairs and a 10 nucleotide loop derived from microRNA-23, as described for HCVa-wt. All shRNAs (27 in total, including HCVa-wt, were assessed for activity as described in Wang, 2005. Briefly, human 293FT cells were co-transfected with the dual-indicator luciferase reporter plasmid of pHCV ( Promega, Madison, Wl), and a segregated alkaline phosphatase expression plasmid (pSEAP2, Clontech, Mountain View, CA) to control the efficiency of transfection and possible out-of-target effects), and shRNA. The results are shown in Figure 10. The SEAP levels were uniform in all samples, indicating efficient transfection and the absence of non-specific inhibitory or toxic effects, at shRNA concentrations of 1 nM to 5 nM. Most of the siRNAs exhibited only moderate activity (less than 60% inhibition at 1 nM). Without associating any particular theory, this effect is probably due to the fact that the target areas in the IRES are highly structured. The exceptions were HCVd-wt, sh37, sh39, hcvl7, which targeted the IRES positions near the HCVa-wt site. These shRNAs elicited 85-90% inhibition of HCV IRES-dependent gene expression at a concentration of 1 nM. The low concentration of 1 nM shRNA was chosen to allow easy identification of the hyper-functional shRNAs. If the detection was performed at 10 nM shRNA, more shRNA showed high activity; however, inhibition was found to not specify significant at that concentration in some cases. In this way, the detection revealed a region of 44 nucleotides (positions 331-374 in the IRES of HCV) where five overlapping shRNAs showed high activity.

Example 6: Effect of Bad Individual Base Mappings on the RNAsh Activity It is desirable that an HCV treatment be effective against mutated HCV. To determine the performance of the RNAs described herein in this regard (for example, shRNAs which target the HCV IRES), and to deal with out-of-target effects, the sensitivity of the targeted shRNA against HCV IRES to indicate mutations in the target sequence. For these experiments, the mutation C340- > U in the HCV IRES using the QuikChange ™ II site-directed mutagenesis kit (Stratagene, La Jolla, CA). Of the 27 shRNAs that were assessed, nine targeted the mutated region (Figure 11), therefore their activity can be theoretically affected by this mutation. All these shRNAs were assessed with the mutated version of pHCV, together with the selected shRNAs that target other sites as controls. For all the tested shRNAs, the activity was found to be unaffected or slightly diminished compared to the activity of the perfectly matched, original target (Figure 10). However, in the replicon system, the shRNAs were surprisingly found to be sensitive to SNP (see below).

Example 7: Fine Correlation of Target Sites Six short shRNAs of 19 base pairs were designed to target a site of 44 nucleotides near the 3'-IRES terminus of HCV; three that target nucleotides 331-353 and three that target nucleotides 354-374. These molecules contained loops of 10 nucleotides and projections of 5'-GG and 3'-UU. Detection was performed to identify non-overlapping candidates that were very effective among these sequences tested for inhibition of HCV expression. All six of the tested shRNAs were able to inhibit activity in the assay system. Three of the six shRNAs (sh52, sh53, and sh54) were identified as the most effective (Figures 12A-12B). This does not preclude the use of these shRNAs that were less effective in a composition, for example, to treat HCV, for example as part of a composition that includes more than one shRNA and / or siRNA.

Example 8: Design of shRNA: Effects of Stem Length, Handle Length and Sequence, and 3 '- Term Additional experiments were performed to test how the design of shRNA affects gene silencing activity. The HCVa-wt contained a stem of 25 base pairs with protrusions of 5'-GG and 3'-UU (which can form non-canonical base pairs) and a miR-23 loop of ten nucleotides. To test the importance of these parameters in the effectiveness for the inhibition of expression, each of these parameters was varied separately (Figure 13A). The microRNA-23 loop sequence was initially selected because it is a naturally occurring sequence (Lagos-Quintana et al., Science, 2001, 293: 854-258) and therefore was unlikely to be toxic . Two alternate ten-nucleotide handles were tested, along with handles of six nucleotides, five nucleotides, and four nucleotides, each in two versions of a sequence. No loop size and no sequence was found to affect the activity of these 25 base pair siRNAs (Figure 13B, see Figures 16A-16B for sequences). Small hairpin RNAs lacking the 3'-UU terminal sequence (single strand protrusion) have the same efficiency as the parental shRNA that contains this feature. The control shRNA with full length (25 nucleotide) but short (13 nucleotide) antisense regions has no activity, confirming the importance of the duplex structure in the target selection sequence. The shRNAs that have a 3'-CC instead of a 3'-UU term (which allows the formation of two additional Watson-Crick base pairs) were more effective than HCVa-wt in decreasing the expression of HCV, but also affected SEAP levels. This non-specific inhibition may be a consequence of the longer stem (27 base pairs), which can induce genes in the sensitive pathway to inferred and inactivate protein kinase R (PKR). Surprisingly, the movement of the loop to the other end of the shRNA resulted in a dramatic reduction in activity (15% inhibition at 1 nM instead of 90%). Possible explanations for this effect include a displacement in the position of the Dicer processing (and therefore the searched sequence) as well as a different GC content in the 5 '-extreme. Because the 19-base pair siRNAs were shown to have similar potency to the 25-base pair siRNA, the effects of loop variations for the 19-base pair RNAs were examined. The results are shown in Figures 14A-14B; see Figure 16A-16B for sequences. The handle sizes of 10, 6, 5, and 4 nucleotides were tested, each in two sequence versions. Sequences containing all loop sizes demonstrated the ability to inhibit gene expression. However, you found the results with 25-base pair shRNAs, the reduction in loop size, especially below 5 nucleotides, resulted in reduced activity for 19-base pair shRNAs for both loop sequences tested. Handles of at least 5-6 nucleotides were shown to be most active. Removal of the 3'-UU also resulted in dramatic activity reduction for the 19-base pair siRNAs as well as 20 base pairs (but of 25 base pairs). Without any particular theory being attached, the 3'-UU and 5'-GG can form non-canonical base pairs and the total size of the shRNA duplex is important such that the duplex can not be less than 25 base pairs for processing efficient. Thus, for the 25-base pair shRNAs, the size of the loop or the presence of a 3'-UU does not matter, while these parameters are important for the power of the short shRNAs, for example, of 19 pairs of base. Without joining any particular theory, it may be that Dicer joins the terms before processing and does not "homosent" to the handle in the case of the longer shRNAs, but for the shRNAs of 19 base pairs, the handle " perceive "since Dicer" measures "19-21 nucleotides from the ends. Therefore, it was found that 19-base pair shRNAs can be as potent as 25-base pair shRNAs and 19-base pair siRNA. It was also found that some shRNA molecules are more active at low concentrations of 0.1-1 nM ("hyper-potent shRNA." Other groups typically use siRNA of 10, 25, 50-100 nM). These data demonstrate that sequences that do not include a 3'-UU that are at least 22 base pairs, eg, 23 base pairs, 24 base pairs, 25 base pairs, may be suitable for inhibition of expression of HCV. Similarly, loop size is not critical for shRNAs that are at least 22 base pairs in length.

Example 9: HCV Replicon System Several siRNA and siRNA inhibitors were used in conjunction with negative controls to transfect human hepatocytes (AVA5, a derivative of the Huh7 cell line) that stably express sub-genomic replicons of HCV (Blight et al. al., Science, 2000, 290: 5498), and the amount of HCV expression was determined. A variety of concentrations were tested and the concentration of RNA resulting in 50% inhibition (IC50 or EC50) was determined. The IC50 of two independent experiments are shown side by side in Figure 15. The results correlated in general with the data obtained using the fLuc / IRES system in 293 FT cells, with the following difference: (1) the shRNAs of 19 pairs of base are more powerful than the 19-base pair siRNAs in the replicon system, whereas with the indicator system, the SiRNA from 19 base pairs were more potent than the shRNAs; (2) the shRNA, HCVa-wt, with point mutations does not demonstrate activity in the replicon system, whereas it was effective in the fLuc / IRES indicator system; (3) in general, the 25-base pair siRNA and 25-base pair shRNA have less activity than other 19-base pair siRNA and siRNA tested. In general, the IRES and replicon systems are useful for identification of candidate sequences. Methods for confirming the efficacy (eg, to inhibit the expression of HCV in a subject) of a selected siRNA or siRNA can be further tested using methods described herein and methods known in the art.

Other Modalities It is to be understood that insofar as the invention has been described in conjunction with the detailed description thereof, the following description is proposed to illustrate and not limit the scope of the invention, which is defined by the scope of the claims annexes. Other aspects, advantages and modifications are within the scope of the following claims.

References 1. Sookoian, S.C., New therapies on the horizon for hepatitis C. Ann Hepatol, 2003. 2: 164-70. 2. Randall, G. and CM. Rice, Interfering with hepatitis C virus RNA replication. Virus Res, 2004. 102: 19-25. 3. Radhakrishnan, S.K., T.J. Layden, and A.L. Gartel, RNA interference as a new strategy against viral hepatitis. Virology, 2004. 323: 173-81. 4. Hugle, T. and A. Cerny, Current therapy and new molecular approaches to antiviral treatment and prevention of hepatitis C. Rev Med Virol, 2003. 13: 361-71. 5. Blight, K.J., A. A. Kolykhalov, and CM. Rice, Efficient initiation of HCV RNA replication in cell culture. Science, 2000. 290: 1972-4. 6. Pietschmann, T. and R. Bartenschlager, Tissue culture and animal models for hepatitis C virus. Clin Liver Dis, 2003. 7: 23-43. 7. Mercer, D.F., D.E. Schiller, J.F. Elliott, D.N. Douglas, C Hao, A. Rinfret, W.R. Addison, K.P. Fischer, T.A. Churchill, J.R. Lakey, D.L. Tyrrell, and N.M. Kneteman, Hepatitis C virus replication in mice with chimeric human livers. Nat Med, 2001. 7: 927-33. 8. McCaffrey, A.P., L. Meuse, M. Karimi, CH. Contag, and M.A. Kay, A potent and specific morpholino antisense inhibitor of hepatitis C translation in mice. Hepatology, 2003. 38: 503-8. 9. Lieberman, J., E. Song, S.K. Lee, and P. Shankar, Interfering with disease: opportunities and roadblocks to harnessing RNA interference. Trends Mol Med, 2003. 9: 397-403. 10. Layzer, J.M., A.P. McCaffrey, A.K. Tanner, Z.

Huang, M.A. Kay, and B.A. Sullenger,. In vivo activity of nuclease-resistant siRNAs. Rna, 2004. 10: 766-71. 11. Rossi, JJ. and GJ. Hannon, Unlocking the potential of the human genome with RNA interference. Nature, 2004. 431: 35-43. 12. McHutchison, J.G. and K. Patel, Future therapy of hepatitis C. Hepatology, 2002. 36: S245-52. 13. Wilson, J.A. , S. Jayasena, A. Khvorova, S. Sabatinos, I.G. Rodrigue-Gervais, S. Arya, F. Sarangi, M. Harris-Brandts, S. Beaulieu, and C.D. Richardson, RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc Nati Acad Sci U S A, 2003. 100: 2783-8. 14. Randall, G., A. Grakoui, and CM. Rice, Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs. Proc Nati Acad Sci U S A, 2003. 100: 235-40. 15. Yokota, T., N. Sakamoto, N. Enomoto, Y. Tanabe, M. Miyagishi, S. Maekawa, L. Yi, M. Kurosaki, K. Taira, M. Watanabe, and H. Mizusawa, Inhibition oi intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs. EMBO Rep, 2003. 4: 602-8. 16. Kapadia, S.B., A. Brideau-Andersen, and F.V. Chisari, Interference of hepatitis C virus RNA replication by short interfering RNAs. Proc Nati Acad Sci U S A, 2003. 100: 2014-8. 17. Kronke, J., R. Kittler, F. Buchholz, M.P. Windisch, T. Pietschmann, R. Bartenschlager, and M. Frese, Alternative approaches for efficient inhibition of hepatitis C virus RNA replication by small interfering RNAs. J Virol, 2004. 78: 3436-46. 18. Sen, A., R. Steele, A.K. Ghosh, A. Basu, R. Ray, and R.B. Ray, Inhibition of hepatitis C virus protein expression by RNA interference. Virus Res, 2003. 96: 27-35. 19. Zhang, J., O. Yamada, T. Sakamoto, H. Yoshida, T. Iwai, Y. Matsushita, H. Shimamura, H. Araki, and K. Shimotohno, Down-regulation of viral replication by adenoviral-mediated expression of siRNA against cellular cofactors for hepatitis C virus. Virology, 2004. 320: 135-43. 20. McCaffrey, A.P., L. Meuse, T.T. Pham, D.S.

Conklin, G.J. Hannon, and M.A. Kay, RNA interference in adult mice. Nature, 2002. 418: 38-9. 21. Kawasaki, H. and K. Taira, Short hairpin type of dsRNAs that are controlled by tRNA (Val) promoter significantly induces RNAi-mediated gene silencing in the cytoplasm of human cells. Nucleic Acids Res, 2003. 31: 700-7. 22. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl, Identification of novel genes coding for small RNAs. Science, 2001. 294: 853-8. 23. Qin, X.F., D.S. An, I.S. Chen, and D. Baltimore, Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Nati Acad Sci U S A, 2003. 100: 183-8. 24. McCaffrey, A.P., K. Ohashi, L. Meuse, S. Shen, A.M. Lancaster, PJ. Lukavsky, P. Sarnow, and M.A. Kay, Determinants of hepatitis C translational initiation in vitro, in cultured cells and mice. Mol Ther, 2002. 5: 676-84. 25. Seo, M. Y., S. Abrignani, M. Houghton, and J.H. Han, Small interfering RNA-mediated inhibition of hepatitis C virus replication in the human hepatoma cell line Huh-7. J Virol, 2003. 77: 810-2. 26. Kim, D.H., M. Longo, Y. Han, P. Lundberg, E. Cantin, and JJ. Rossi, Inferieron induction by siRNAs and ssRNAs synthesized, by phage polymerase. Nat Biotechnol, 2004. 22: 321-5. 27. Bridge, A.J., S. Pebernard, A. Ducraux, A.L. Nicoulaz, and R. Iggo, Induction of an inferred response by RNAi vectors in mammalian cells. Nat Genet, 2003. 34: 263-4. 28. Fish, R.J. and E.K. Kruithof, Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors. BMC Mol Biol, 2004. 5: 9. 29. Han, J.H., V. Shyamala, K.H. Richman, M.J. Brauer, B. Irvine, M.S. Urdea, P. Tekamp-Olson, G. Kuo, Q.L. Choo, and M. Houghton, Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5 'untranslated region and poly (A) tails at the 3' end. Proc Nati Acad Sci U S A, 1991. 88: 1711-5. 30. Choo, Q.L., K.H. Richman, J.H. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, R. Medina-Selby, P.J. Barr, et al., Genetic organization and diversity of hepatitis C virus. Proc Nati Acad Sci U S A, 1991. 88: 2451-5. 31. Okamoto, H., S. Okada, Y. Sugiyama, K. Kurai, H. Iizuka, A. Machida, Y. Miyakawa, and M. Mayumi, Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions. J Gen Virol, 1991. 72 (Pt 11): 2697-704. 32. Bukh, J., R.H. Purcell, and R.H. Miller, Sequence analysis of the 5 'noncoding region of hepatitis C virus. Proc Nati Acad Sci U S A, 1992. 89: 4942-6. 33. Rice, C.M., Virology: fresh assault on hepatitis C. Nature, 2003. 426: 129-31. 34. Zhang, H., R. Hanecak, V. Brown-Driver, R. Azad, B. Conklin, M.C. Fox, and K.P. Anderson, Antisense oligonucleotide inhibition of hepatitis C virus (HCV) gene expression in livers of mice infected with an HCV-vaccinia recombinant virus. Antimicrob Agents Chemother, 1999. 43: 347-53. 35. Jubin, R., N.E. Vantuno, J.S. Kieft, M.G. Murray, J.A. Doudna, J. Y. Lau, and B.M. Baroudy, Hepatitis C virus internal ribosome entry site (IRES) stem loop Illd contains a phylogenetically conserved GGG triplet essential for translation and IRES folding. J Virol, 2000. 74: 10430-7. 36. Seyhan AA, Vlassov AV, Eves H, Egry L, Kaspar RL, Kazakov SA, Johnston BH. Complete, gene-specific siRNA librarles: production and expression in mammalian cells. RNA 2005. 11: 837-46. 37. Wang Q, Contag CH, Uves H, Johnston BH, Kaspar RL. Small hairpin RNAs inhibits hepatitis C IRES-mediated gene expression in human tissue culture cells and a mouse model. Mol Ther. 2005. 12: 562-8 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Claims (61)

1. CLAIMS Having described the invention as above, the content of the following claims is claimed as property: 1. Sequence of Ribonucleic Acid (RNA), characterized in that it consists of a. a first RNA sequence, wherein the first RNA sequence is SEQ ID NO: 34, (SEQ ID NO: 35), (SEQ ID NO: 36), (SEQ ID NO: 37), (SEQ ID NO: 38) (SEQ ID NO: 39), (SEQ ID NO: 40) (SEQ ID NO: 41) (SEQ ID NO: 42), (SEQ ID NO: 43) (SEQ ID NO: 44) (SEQ ID NO:: 45), (SEQ ID NO:: 46) (SEQ ID NO: 47) (SEQ ID NO:: 48), (SEQ ID NO:: 49) (SEQ ID NO: 50) (SEQ ID NO.51); SEQ ID NO: 52) (SEQ ID NO: 53) (SEQ ID NO: 54), SEQ ID NO: 55) (SEQ ID NO: 56) or a sequence that differs from the foreign sequence by one, two or three nucleotides; b. a second RNA sequence that is a complement of the first sequence; c. a loop sequence positioned between the first and second nucleic acid sequences, the loop sequence consisting of 4-10 nucleotides; and d. optionally, a projection of two nucleotides.
2. 2. RNA sequence according to claim 1, characterized in that the first RNA sequence is SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID N0: 51; SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56.
3. 3. RNA sequence according to claim 1, characterized in that the RNA sequence comprises at least one modified nucleotide.
4. 4. RNA sequence according to claim 1, characterized in that the loop sequence is 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, or at least ten nucleotides.
5. 5. ShRNA, characterized in that it comprises a nucleic acid sequence according to claim 1 and a sequence complementary to the sequence according to claim 1, linked by a loop comprising at least one molecule without nucleotides.
6. 6. ShRNA, characterized in that it comprises a nucleic acid sequence according to claim 4, wherein the loop is 3 'to a strand homosentide and 5' to the antisense strand complementary to shRNA.
7. 7. RNAsh, characterized in that it comprises a nucleic acid sequence according to claim 4, wherein the loop is 3 'to the antisense strand and 5' to the complementary sense strand of shRNA.
8. 8. RNA sequence according to claim 1, characterized in that the RNA sequence comprises a projection of two nucleotides which is a 3 'UU.
9. 9. RNA sequence according to any of claims 1 to 8, characterized in that the first sequence is SEQ ID NO: 33, SEQ ID NO: 55, or SEQ ID NO: 56.
10. 10. RNA sequence according to claim 1, characterized in that the sequence is any of SEQ ID NOs: 57-79, SEQ ID NO: 12, SEQ ID N0: 16, SEQ ID N0: 17, or SEQ ID NO: 18
11. 11. DNA sequence, characterized in that it comprises a sequence coding for RNA according to any of claims 1 to 10.
12. 12. Expression vector, characterized in that it comprises the DNA sequence according to claim 11.
13. 13. Vector retroviral, characterized in that it comprises the DNA sequence according to claim 11.
14. 14. Retroviral vector according to claim 13, characterized in that in the infection of a cell with the vector provirus is produced that can express an RNA sequence in accordance with with claim 1.
15. 15. Composition, characterized in that it comprises an RNA sequence according to any of claims 1 to 10, and a pharmaceutically acceptable excipient.
16. 16. Composition, characterized in that it comprises a vector comprising a sequence coding for the RNA sequence according to any of claims 1 to 10.
17. 17. Composition according to claim 15, characterized in that it comprises at least two RNA sequences. according to claim 1.
18. 18. Method for inhibiting the expression or activity of a hepatitis C virus, characterized in that it comprises a. provide a cell that can express a hepatitis C virus; and b. contacting the cell with the RNA sequence according to any of claims 1 to 10.
19. 19. Method according to claim 18, characterized in that the cell is in a mammal.
20. 20. Method according to claim 18, characterized in that the mammal is a human.
21. 21. Method according to claim 18, characterized in that the mammal is a non-human primate.
22. 22. Method according to claim 18, characterized in that the cell is contacted with at least two different RNA sequences according to claim 1.
23. 23. Method, characterized in that it comprises a. identify a subject infected with or suspected of being infected with a hepatitis C virus; b. In addition, the subject is provided with a therapeutically effective amount of a composition according to any one of claims 15, 16, or 17.
24. 24. Method according to claim 23, characterized in that it further comprises determining if the subject's viral load is decreased subsequent to ( b)
25. 25. Method according to claim 23, characterized in that it further comprises, subsequently to (b), determining whether at least one viral protein or a viral nucleic acid sequence is decreased in the subject.
26. 26. Method for inhibiting gene expression in a virus, characterized in that it comprises introducing a small interfering RNA into a cell containing the virus, wherein the small interfering RNA comprises a sequence that is at least partially complementary to a polynucleotide sequence of the virus , wherein the interaction of the sequence at least partially complementary to the RNA of small interference with the polynucleotide sequence of the virus results in the inhibition of gene expression in the virus.
27. 27. Method according to claim 26, characterized in that the small interfering RNA is a shRNA.
28. 28. Method according to claim 26, characterized in that the small interfering RNA is an siRNA.
29. 29. Method according to any of claims 26-28, characterized in that the RNA of small interference recognizes a viral sequence of approximately 19 to approximately 30 nucleotides.
30. Method according to claim 26, characterized in that the virus is a hepatitis C virus.
31. 31. Method according to claim 30, characterized in that the RNA of small interference interacts with a sequence within the sequence of the entry site. Internal ribosomal (IRES) of hepatitis C virus.
32. 32. Method according to claim 31, characterized in that the sequence of IRES comprises the sequence shown in SEQ ID NO: 11.
33. 33. Method according to claim 32, characterized in that the RNA of small interference recognizes a sequence of approximately 19 to about 30 nucleotides within the region depicted in SEQ ID NO: 26.
34. 34. Method according to any of claims 30-33, characterized in that the small interfering RNA is a shRNA.
35. 35. Method according to claim 34, characterized in that the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 27, SEQ ID NO. : 32, and SEQ ID NO: 33.
36. 36. Method according to claim 35, characterized in that the shRNA has the sequence shown in SEQ ID NO: 12.
37. 37. Method according to any of claims 30-33, characterized in that the small interference RNA is an siRNA.
38. 38. Method according to claim 37, characterized in that the siRNA comprises a sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID 'N0: 21, SEQ ID NO: 22, SEQ NO : 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33.
39. 39. Method for treating a viral infection in a mammal, characterized in that it comprises administering to the mammal a composition comprising a therapeutically effective amount of a small interfering RNA comprising a sequence that is at least partially complementary to a polynucleotide sequence of the virus, wherein the interaction of the sequence at least partially complementary to the RNA of small interference with the polynucleotide sequence of the virus results in the inhibition of gene expression in the virus.
40. 40. Method according to claim 39, characterized in that the small interfering RNA is a shRNA.
41. 41. Method according to claim 39, characterized in that the small interfering RNA is an siRNA.
42. 42. Method according to any of claims 39-41, characterized in that the small interference RNAH recognizes a viral sequence of about 19 to about 30 nucleotides.
43. 43. Method according to claim 39, characterized in that the mammal is a human and the viral infection comprises a hepatitis C virus.
44. 44. Method according to claim 43, characterized in that the small interference RNA comprises a sequence that is at least partially complementary to a polynucleotide sequence within the IRES sequence of the hepatitis C virus.
45. 45. Method according to claim 44, characterized in that the sequence of IRES comprises the sequence shown in SEQ ID NO: 11.
46. 46. Method according to claim 45, characterized in that the small interfering RNA recognizes a sequence of approximately 19 to approximately 30 nucleotides within the region represented in SEQ ID NO: 26.
47. 47. Method according to any of claims 43-46, characterized in that the small interfering RNA is a shRNA.
48. 48. Method according to claim 47, characterized in that the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO. : 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33
49. 49. Method according to claim 48, characterized in that the shRNA has the sequence shown in SEQ ID NO: 12.
50. 50. Method according to any of claims 43-46, characterized in that the small interference RNA is an siRNA.
51. 51. Method of conormity with claim 50, characterized in that the siRNA comprises a sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33.
52. 52. Composition, characterized in that it comprises a RNAsh comprising a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO : 22, SEQ NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33.
53. 53. Composition, characterized in that it comprises a siRNA comprising a sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33.
54. 54. Pharmaceutical composition, characterized in that it comprises a siRNA in accordance with claim 52 and a pharmaceutically acceptable excipient.
55. 55. Pharmaceutical composition, characterized in that it comprises an siRNA according to claim 53 and a pharmaceutically acceptable excipient.
56. 56. Kit, characterized in that it comprises a shRNA and instructions for use in a method according to any of claims 26, 30-33, 39, 43-46, and 18-25.
57. 57. Kit according to claim 56, characterized in that the shRNA comprises a sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO. : 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33
58. 58. Kit, characterized in that it comprises an siRNA and instructions for use in a method according to any of claims 25, 29-32, 38, and 42-45.
59. 59. Kit according to claim 58, characterized in that the siRNA comprises a sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 27, SEQ ID NO: 32, and SEQ ID NO: 33.
60. 60. Method according to claim 43, characterized in that the hepatitis virus C is the genotype la.
61. 61. Method according to claim 39, characterized in that the mammal is a human.