WO2003070972A2 - RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - Google Patents

RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) Download PDF

Info

Publication number
WO2003070972A2
WO2003070972A2 PCT/US2003/005234 US0305234W WO03070972A2 WO 2003070972 A2 WO2003070972 A2 WO 2003070972A2 US 0305234 W US0305234 W US 0305234W WO 03070972 A2 WO03070972 A2 WO 03070972A2
Authority
WO
WIPO (PCT)
Prior art keywords
sina
sina molecule
nucleotides
bcr
molecule
Prior art date
Application number
PCT/US2003/005234
Other languages
French (fr)
Other versions
WO2003070972A3 (en
WO2003070972A9 (en
Inventor
James Mcswiggen
Leonid Beigelman
Bharat Chowrira
Original Assignee
Sirna Therapeutics Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sirna Therapeutics Inc. filed Critical Sirna Therapeutics Inc.
Priority to EP03716110A priority Critical patent/EP1476459A4/en
Priority to AU2003219833A priority patent/AU2003219833A1/en
Publication of WO2003070972A2 publication Critical patent/WO2003070972A2/en
Publication of WO2003070972A9 publication Critical patent/WO2003070972A9/en
Publication of WO2003070972A3 publication Critical patent/WO2003070972A3/en
Priority to US10/923,522 priority patent/US20050159381A1/en
Priority to US12/205,558 priority patent/US20090093439A1/en
Priority to US12/717,511 priority patent/US20100227911A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/317Chemical structure of the backbone with an inverted bond, e.g. a cap structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/318Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/332Abasic residue
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed

Definitions

  • the present invention concerns compounds, compositions, and methods for the study, diagnosis, and treatment of conditions and diseases that respond to the modulation of fusion gene expression and/or activity.
  • the present invention also concerns compounds, compositions, and methods relating to conditions and diseases that respond to the modulation of expression and/or activity of genes involved in fusion gene (e.g., BCR-ABL, and EWS- ERG) pathways.
  • the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against fusion gene expression, such as BCR-ABL and EWS-ERG expression.
  • siNA short interfering nucleic acid
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al, 1998, Nature, 391, 806). The corresponding process in plants is commonly referred to as post- transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi.
  • the process of post-transcriptional gene silencing is thought to be an evolutionarily- conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al, 1999, Trends Genet, 15, 358).
  • Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
  • dsRNAs double-stranded RNAs
  • the presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2',5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
  • dsRNAs short interfering RNAs
  • Short interfering RNAs derived from dicer activity are typically about 21 to about
  • RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al, 2001, Genes Dev., 15, 188).
  • RISC RNA-induced silencing complex
  • RNAi has been studied in a variety of systems. Fire et al, 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol, 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al, 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al, 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21- nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • RNAi activity Single mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity.
  • these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5'-end of the siRNA guide sequence rather than the 3'-end of the guide sequence (Elbashir et al, 2001, EMBO , 20, 6877).
  • Other studies have indicated that a 5'-phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5'-phosphate moiety on the siRNA (Nykanen et al, 2001, Cell, 107, 309).
  • siRNA may include modifications to either the phosphate-sugar backbone or the nucleoside to include at least one of a nitrogen or sulfur heteroatom, however, neither application postulates to what extent such modifications would be tolerated in siRNA molecules, nor provides any further guidance or examples of such modified siRNA. Kreutzer et al, Canadian Patent Application No.
  • 2,359,180 also describe certain chemical modifications for use in dsRNA constructs in order to counteract activation of double-stranded RNA-dependent protein kinase PKR, specifically 2'-amino or 2'-O-methyl nucleotides, and nucleotides containing a 2'-O or 4'-C methylene bridge.
  • PKR double-stranded RNA-dependent protein kinase
  • 2'-amino or 2'-O-methyl nucleotides specifically 2'-amino or 2'-O-methyl nucleotides, and nucleotides containing a 2'-O or 4'-C methylene bridge.
  • Kreutzer et al. similarly fails to provide examples or guidance as to what extent these modifications would be tolerated in siRNA molecules.
  • the authors describe the introduction of thiophosphate residues into these siRNA transcripts by incorporating thiophosphate nucleotide analogs with T7 and T3 RNA polymerase and observed that RNAs with two phosphorothioate modified bases also had substantial decreases in effectiveness as RNAi.
  • Parrish et al. reported that phosphorothioate modification of more than two residues greatly destabilized the RNAs in vitro such that interference activities could not be assayed. Id. at 1081.
  • the authors also tested certain modifications at the 2'-position of the nucleotide sugar in the long siRNA transcripts and found that substituting deoxynucleotides for ribonucleotides produced a substantial decrease in interference activity, especially in the case of Uridine to Thymidine and/or Cytidine to deoxy-Cytidine substitutions. Id.
  • the authors tested certain base modifications, including substituting, in sense and antisense strands of the siRNA, 4-thiouracil, 5- bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil, and inosine for guanosine.
  • Parrish reported that inosine produced a substantial decrease in interference activity when incorporated in either strand. Parrish also reported that incorporation of 5-iodouracil and 3- (aminoallyl)uracil in the antisense strand resulted in a substantial decrease in RNAi activity as well.
  • WO 01/68836 describes specific methods for attenuating gene expression using endogenously-derived dsRNA.
  • Tuschl et al International PCT Publication No. WO 01/75164, describe a Drosophila in vitro RNAi system and the use of specific siRNA molecules for certain functional genomic and certain therapeutic applications; although Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be used to cure genetic diseases or viral infection due to the danger of activating interferon response.
  • Li et al International PCT Publication No. WO 00/44914, describe the use of specific dsRNAs for attenuating the expression of certain target genes.
  • Zernicka-Goetz et al International PCT Publication No. WO 01/36646, describe certain methods for inhibiting the expression of particular genes in mammalian cells using certain dsRNA molecules.
  • Fire et al International PCT Publication No. WO 99/32619, describe particular methods for introducing certain dsRNA molecules into cells for use in inhibiting gene expression.
  • Plaetinck et al International PCT Publication No. WO 00/01846, describe certain methods for identifying specific genes responsible for conferring a particular phenotype in a cell using specific dsRNA molecules.
  • Mello et al International PCT Publication No. WO 01/29058, describe the identification of specific genes involved in dsRNA-mediated RNAi.
  • Deschamps Depaillette et al International PCT Publication No. WO 99/07409, describe specific compositions consisting of particular dsRNA molecules combined with certain anti-viral agents.
  • Waterhouse et al International PCT Publication No. 99/53050, describe certain methods for decreasing the phenotypic expression of a nucleic acid in plant cells using certain dsRNAs.
  • Driscoll et al International PCT Publication No. WO 01/49844, describe specific DNA constructs for use in facilitating gene silencing in targeted organisms.
  • WO 01/04313 describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain dsRNAs.
  • Echeverri et al, International PCT Publication No. WO 02/38805 describe certain C. elegans genes identified via RNAi.
  • Kreutzer et al, International PCT Publications Nos. WO 02/055692, WO 02/055693, and EP 1144623 Bl describes certain methods for inhibiting gene expression using RNAi.
  • Graham et al, International PCT Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501 describe certain vector expressed siRNA molecules.
  • Fire et al, US 6,506,559 describe certain methods for inhibiting gene expression in vitro using certain long (greater than 25 nucleotide) dsRNA constructs that mediate RNAi.
  • BCR-ABL RNA and protein were down-regulated following siRNA treatment as shown by real-time quantitative PCR and Western blots.
  • RNA interference RNA interference
  • siNA short interfering nucleic acid
  • This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of fusion genes and transcriptional deregulation genes, or genes involved in fusion gene and transcriptional deregulation gene pathways of gene expression by RNA interference (RNAi) using small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro- RNA (miRNA), and short hairpin RNA (shRNA) molecules.
  • siNA short interfering nucleic acid
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro- RNA
  • shRNA short hairpin RNA
  • the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of BCR-ABL and/or ERG genes.
  • siNA short interfering nucleic acid
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • the instant invention also features various chemically- modified synthetic short interfering nucleic acid (siNA) molecules capable of modulating fusion gene (e.g., BCR-ABL, ERG) expression or activity in cells by RNA interference (RNAi).
  • siNA synthetic short interfering nucleic acid
  • RNAi RNA interference
  • the use of chemically-modified siNA improves various properties of native siNA molecules through increased resistance to nuclease degradation in vivo and/or through improved cellular uptake. Further, contrary to earlier published studies, siNA having multiple chemical modifications retains its RNAi activity.
  • the siNA molecules of the instant invention provide useful reagents and methods for a variety of therapeutic, diagnostic, target validation, genomic discovery, genetic engineering, and pharmacogenomic applications.
  • the invention features one or more siNA molecules and methods that independently or in combination modulate the expression of gene(s) encoding proteins associated with chromosomal translocation events, such as BCR-ABL, TEL-AML1, EWS- FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO fusion proteins.
  • gene(s) encoding proteins associated with chromosomal translocation events such as BCR-ABL, TEL-AML1, EWS- FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO fusion proteins.
  • the present invention features siNA molecules that modulate the expression of chromosomal translocation genes, for example the BCR-ABL, TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO genes encoding sequences comprising those sequences referred to by GenBank Accession Nos. shown in Table I.
  • chromosomal translocation genes for example the BCR-ABL, TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO genes encoding sequences comprising those sequences referred to by GenBank Accession Nos. shown in Table I.
  • GenBank Accession Nos. shown in Table I.
  • the various aspects and embodiments are also directed to other chromosomal translocation genes, such as TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO and any other fusion gene or transcriptional deregulation genes.
  • the various aspects and embodiments are also directed to other genes that are involved in the progression, development, or maintenance of leukemias and lymphomas. Those additional genes can be analyzed for target sites using the methods described for BCR-ABL and ERG herein. Thus, the inhibition and the effects of such inhibition of the other genes can be performed as described herein.
  • the invention features a siNA molecule that down-regulates expression of a BCR-ABL gene, for example, wherein the BCR-ABL gene comprises BCR- ABL encoding sequence.
  • the invention features a siNA molecule that down-regulates expression of an ERG gene, for example, wherein the ERG gene comprises ERG encoding sequence.
  • the invention features a siNA molecule having RNAi activity against BCR-ABL and/or ERG RNA, wherein the siNA molecule comprises a sequence complementary to any RNA having BCR-ABL and/or ERG or other BCR-ABL and/or ERG encoding sequence, such as those sequences having GenBank Accession Nos. shown in Table I. Chemical modifications as shown in Tables III and IV or otherwise described herein can be applied to any siNA construct of the invention.
  • the invention features a siNA molecule having RNAi activity against polynucleotides encoding BCR-ABL and/or ERG, wherein the siNA molecule comprises a sequence complementary to any polynucleotide having BCR-ABL and/or ERG encoding sequence, such as those sequences having BCR-ABL and or ERG GenBank Accession Nos. shown in Table I. Chemical modifications as shown in Tables III and IV or otherwise described herein can be applied to any siNA construct of the invention.
  • the invention features a siNA molecule having RNAi activity against a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises nucleotide sequence complementary to nucleotide sequence of a BCR-ABL and/or ERG gene, such as those BCR-ABL and or ERG sequences having GenBank Accession Nos. shown in Table I.
  • a siNA molecule of the invention includes nucleotide sequence that can interact with nucleotide sequence of a BCR-ABL and/or ERG gene and thereby mediate silencing of BCR-ABL and or ERG gene expression, for example, wherem the siNA mediates regulation of BCR-ABL and/or ERG gene expression by cellular processes that modulate the chromatin structure of the BCR-ABL and/or ERG gene and prevent transcription of the BCR-ABL and/or ERG gene.
  • the invention features a siNA molecule comprising nucleotide sequence, for example, nucleotide sequence in the antisense region of the siNA molecule that is complementary to a nucleotide sequence or portion of sequence of a BCR-ABL and/or ERG gene.
  • the invention features a siNA molecule comprising a region, for example, the antisense region of the siNA construct, complementary to a sequence or portion of sequence comprising a BCR-ABL and/or ERG gene sequence.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
  • siNA short interfering nucleic acid
  • a siNA molecule of the invention comprises no ribonucleotides. In another embodiment, a siNA molecule of the invention comprises ribonucleotides.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the BCR- ABL and/or ERG gene, and wherein the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the BCR-ABL and/or ERG gene.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein each strand of the siNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the BCR-ABL and/or ERG gene, and wherein the siNA further comprises a sense region, wherein the sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the BCR-ABL and/or ERG gene.
  • siNA double-stranded short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the antisense region and the sense region each comprise about 19 to about 23 nucleotides, and wherein the antisense region comprises at least about 19 nucleotides that are complementary to nucleotides of the sense region.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the BCR-ABL and or ERG gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
  • siNA double-stranded short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule.
  • the sense region can be connected to the antisense region via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the BCR-ABL and/or ERG gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region, and wherein pyrimidine nucleotides in the sense region are 2'-O-methyl pyrimidine nucleotides, 2'-deoxy purine nucleotides, or 2'-deoxy-2'-fluoro pyrimidine nucleotides.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein the fragment comprising the sense region includes a terminal cap moiety at the 5'-end, the 3'-end, or both of the 5' and 3' ends of the fragment comprising the sense region.
  • the terminal cap moiety is an inverted deoxy abasic moiety or glyceryl moiety.
  • each of the two fragments of the siNA molecule comprise about 21 nucleotides.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the BCR-ABL and/or ERG gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region, and wherein the purine nucleotides present in the antisense region comprise 2'-deoxy- purine nucleotides.
  • siNA short interfering nucleic acid
  • the antisense region comprises a phosphorothioate internucleotide linkage at the 3' end of the antisense region. In another embodiment, the antisense region comprises a glyceryl modification at the 3' end of the antisense region.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule and wherem at least two 3' terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule.
  • siNA short interfering nucleic acid
  • each of the two 3 ' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine.
  • all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
  • about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the BCR-ABL and/or ERG gene.
  • 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the BCR-ABL and/or ERG gene.
  • the 5 '-end of the fragment comprising said antisense region optionally includes a phosphate group.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits the expression of a BCR-ABL and/or ERG RNA sequence (e.g., wherein said target RNA sequence is encoded by a BCR-ABL and/or ERG gene), wherein the siNA molecule comprises no ribonucleotides and wherem each strand of the double-stranded siNA molecule is about 21 nucleotides long.
  • siNA short interfering nucleic acid
  • the invention features a medicament comprising a siNA molecule of the invention.
  • the invention features an active ingredient comprising a siNA molecule of the invention.
  • the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule to down-regulate expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense strand of the double-stranded siNA molecule is complementary to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof which encodes an protein or a portion thereof.
  • siNA short interfer
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each strand of the siNA molecule comprises about 19 to about 29 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the siNA molecule is assembled from two oligonucleotide fragments wherein one fragment comprises the nucleotide sequence of the antisense sfrand of the siNA moleculeand a second fragment comprises nucleotide sequence of the sense region of the siNA molecule.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the sense strand is connected to the antisense strand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
  • a linker molecule such as a polynucleotide linker
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein purine nucleotides present in the sense region are 2'-deoxy purine nucleotides.
  • siNA
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the sense strand comprises a 3'-end and a 5'- end, and wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety) is present at the 5'-end, the 3'-end, or both of the
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense strand comprises one or more 2'- deoxy-2'-fluoro pyrimidine nucleotides and one or more 2'-O-methyl purine nucleotides.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the pyrimidine nucleotides present in the antisense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein any purine nucleotides present in the antisense strand are 2'-O-methyl pur
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense sfrand comprises a phosphorothioate intemucleotide linkage at the 3' end of the antisense sfrand.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-stranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense sfrand comprises a glyceryl modification at the 3' end.
  • siNA short interfering nucleic acid
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-stranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each of the two strands of the siNA molecule comprises 21 nucleotides.
  • siNA short interfering nucleic acid
  • each strand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule and wherein at least two 3' terminal nucleotides of each sfrand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule.
  • each of the two 3 ' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine.
  • each sfrand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule.
  • nucleotides of the antisense sfrand are base-paired to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof. In another embodiment, 21 nucleotides of the antisense sfrand are base-paired to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof.
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the 5 '-end of the antisense strand optionally includes a phosphate group.
  • siNA short interfering nucleic acid
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence or a portion thereof of the antisense sfrand is complementary to a nucleotide sequence of the 5 '-untranslated region or a portion thereof of the BCR-ABL and/or ERG RNA.
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof that is present in the BCR-ABL and/or
  • the invention features a pharmaceutical composition comprising a siNA molecule of the invention in an acceptable carrier or diluent.
  • the invention features a medicament comprising an siNA molecule of the invention.
  • the invention features an active ingredient comprising an siNA molecule of the invention.
  • the invention features the use of a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR- ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double- stranded siNA molecule comprises a sugar modification.
  • siNA short interfering nucleic acid
  • the antisense region of BCR-ABL siRNA constmcts can comprise a sequence complementary to sequence having any of SEQ ID NOs. 1-263, 527-845, 1165- 1182, 1201-1218 or 1589-1596.
  • the antisense region can also comprise sequence having any of SEQ ID NOs. 264-526, 846-1164, 1183-1200, 1219-1236, 1605-1608, 1613-1616, 1621-1624, 1629-1631, 1637-1640, 1645-1648, 1685, 1687, 1689, 1691, 1693, or 1694.
  • the sense region of BCR-ABL siRNA constmcts can comprise sequence having any of SEQ ID NOs.
  • the sense region can comprise a sequence of SEQ ID NO. 1673 and the antisense region can comprise a sequence of SEQ ID NO. 1674.
  • the sense region can comprise a sequence of SEQ ID NO. 1675 and the antisense region can comprise a sequence of SEQ ID NO. 1676.
  • the sense region can comprise a sequence of SEQ ID NO. 1677 and the antisense region can comprise a sequence of SEQ ID NO. 1678.
  • the sense region can comprise a sequence of SEQ ID NO.
  • the sense region 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1680.
  • the sense region can comprise a sequence of SEQ ID NO. 1681 and the antisense region can comprise a sequence of SEQ ID NO. 1682.
  • the sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1683.
  • the antisense region of ERG siRNA constmcts can comprise a sequence complementary to sequence having any of SEQ ID NOs. 1237-1412 or 1597-1600.
  • the antisense region can also comprise sequence having any of SEQ ID NOs. 1413-1588, 1653-1656, 1661-1664, 1669-1672, 1696, 1698, 1700, 1702, 1704, or 1705.
  • the sense region of ERG siRNA constmcts can comprise sequence having any of SEQ ID NOs. 1237-1412, 1597-1600, 1649-1652, 1657-1660, 1665- 1668, 1695, 1697, 1699, 1701, or 1703.
  • the sense region can comprise a sequence of SEQ ID NO. 1673 and the antisense region can comprise a sequence of SEQ ID NO. 1674.
  • the sense region can comprise a sequence of SEQ ID NO. 1675 and the antisense region can comprise a sequence of SEQ ID NO. 1676.
  • the sense region can comprise a sequence of SEQ ID NO. 1677 and the antisense region can comprise a sequence of SEQ ID NO. 1678.
  • the sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1680.
  • the sense region can comprise a sequence of SEQ ID NO. 1681 and the antisense region can comprise a sequence of SEQ ID NO. 1682.
  • the sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1683.
  • a siNA molecule of the invention comprises any of SEQ ID NOs. 1-1705.
  • the sequences shown in SEQ ID NOs: 1-1705 are not limiting.
  • a siNA molecule of the invention can comprise any contiguous BCR-ABL and/or ERG sequence (e.g., about 19 to about 25, or about 19, 20, 21, 22, 23, 24 or 25 contiguous BCR-ABL and/or ERG nucleotides).
  • the invention features a siNA molecule comprising a sequence, for example, the antisense sequence of the siNA constmct, complementary to a sequence or portion of sequence comprising sequence represented by GenBank Accession
  • a siNA molecule comprises an antisense strand having about 19 to about 29 nucleotides, wherein the antisense strand is complementary to a RNA sequence encoding a BCR-ABL and/or ERG protein, and wherein said siNA further comprises a sense sfrand having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences with at least about 19 complementary nucleotides.
  • a siNA molecule of the invention comprises an antisense region having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, wherein the antisense region is complementary to a RNA sequence encoding a BCR-ABL and/or ERG protein, and wherein said siNA further comprises a sense region having about 19 to about 29 nucleotides, wherein said sense region and said antisense region comprise a linear molecule with at least about 19 complementary nucleotides.
  • a siNA molecule comprises an antisense sfrand comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof encoding a BCR-ABL and/or ERG protein.
  • the siNA further comprises a sense strand, wherem said sense sfrand comprises a nucleotide sequence of a BCR-ABL and/or ERG gene or a portion thereof.
  • a siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof encoding a BCR-ABL and/or ERG protein.
  • the siNA molecule further comprises a sense region, wherein said sense region comprises a nucleotide sequence of a BCR-ABL and/or ERG gene or a portion thereof.
  • a siNA molecule of the invention has RNAi activity that modulates expression of RNA encoded by a BCR-ABL and/or ERG gene. Because BCR- ABL and/or ERG genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of BCR-ABL and/or ERG genes (and associated receptor or ligand genes) or alternately specific BCR-ABL and/or ERG genes by selecting sequences that are either shared amongst different BCR-ABL and/or ERG targets or alternatively that are unique for a specific BCR-ABL and/or ERG target.
  • the siNA molecule can be designed to target conserved regions of BCR-ABL and/or ERG RNA sequence having homology between several BCR-ABL and/or ERG receptor genes so as to target several BCR-ABL and/or ERG genes (e.g., different BCR-ABL and/or ERG subunits, isoforms, splice variants, mutant genes etc.) with one siNA molecule.
  • the siNA molecule can be designed to target a sequence that is unique to a specific BCR-ABL and/or ERG RNA sequence due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
  • nucleic acid molecules of the invention that act as mediators of the RNA interference gene silencing response are double-sfranded nucleic acid molecules.
  • the siNA molecules of the invention consist of duplexes containing about 19 base pairs between oligonucleotides comprising about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24 or 25) nucleotides.
  • siNA molecules of the invention comprise duplexes with overhanging ends of about about 1 to about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about 21 -nucleotide duplexes with about 19 base pairs and 3 '-terminal mononucleotide, dinucleotide, or trinucleotide overhangs.
  • about 1 to about 3 e.g., about 1, 2, or 3
  • nucleotides for example, about 21 -nucleotide duplexes with about 19 base pairs and 3 '-terminal mononucleotide, dinucleotide, or trinucleotide overhangs.
  • the invention features one or more chemically-modified siNA constracts having specificity for BCR-ABL and/or ERG expressing nucleic acid molecules, such as RNA encoding a BCR-ABL and/or ERG protein.
  • Non-limiting examples of such chemical modifications include without limitation phosphorothioate intemucleotide linkages, 2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base” nucleotides, "acyclic” nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation.
  • These chemical modifications when used in various siNA constmcts, are shown to preserve RNAi activity in cells while at the same time, dramatically increasing the semm stability of these compounds.
  • a siNA molecule of the invention comprises modified nucleotides while maintaining the ability to mediate RNAi.
  • the modified nucleotides can be used to improve in vitro or in vivo characteristics such as stability, activity, and/or bioavailability.
  • a siNA molecule of the invention can comprise modified nucleotides as a percentage of the total number of nucleotides present in the siNA molecule.
  • a siNA molecule of the invention can generally comprise about 5% to 100% modified nucleotides (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% modified nucleotides).
  • the actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA. If the siNA molecule is single sfranded, the percent modification can be based upon the total number of nucleotides present in the single stranded siNA molecules. Likewise, if the siNA molecule is double stranded, the percent modification can be based upon the total number of nucleotides present in the sense sfrand, antisense strand, or both the sense and antisense strands.
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • siNA short interfering nucleic acid
  • the BCR-ABL and/or ERG gene encodes sequence comprising Genbank Accession number NM_004327 (BCR). In one embodiment, the BCR-ABL and/or ERG gene encodes sequence comprising Genbank Accession number NM_005157 (ABL).
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense sfrand of the double-sfranded siNA molecule is complementary to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof which encode
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each sfrand of the siNA molecule comprises about 19 to about 29 nucleotides, and wherein each sfrand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other sfrand.
  • siNA short interfering
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the siNA molecule is assembled from two oligonucleotide fragments wherein one fragment comprises the nucleotide sequence of the antisense sfrand of the siNA moleculeand a second fragment comprises nucleotide sequence
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the sense sfrand is connected to the antisense sfrand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
  • a linker molecule such as a poly
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein purine nucleotides present in the sense region are 2'-deoxy purine nu
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the sense strand comprises a 3'-end and a 5'- end, and wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety) is present at the 5'-end, the 3'-end, or both
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the antisense strand comprises one or more 2'- deoxy-2'-fluoro pyrimidine nucleotides and one or more 2'-O-methyl purine nucleotides.
  • siNA short interfering nucleic acid
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the pyrimidine nucleotides present in the antisense sfrand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein any purine nucleotides present in the antisiNA
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense sfrand comprises a phosphorothioate intemucleotide linkage at the 3' end of the antisense sfrand.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense strand comprises a glyceryl modification at the 3' end.
  • siNA short interfering nucleic acid
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each of the two sfrands of the siNA molecule comprises 21 nucleotides.
  • siNA short interfering nucleic acid
  • each sfrand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule and wherein at least two 3 ' terminal nucleotides of each sfrand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule.
  • each of the two 3 ' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine.
  • each strand of the siNA molecule are base-paired to the complementary nucleotides of the other sfrand of the siNA molecule.
  • nucleotides of the antisense strand are base-paired to the nucleotide sequence of the RNA or a portion thereof of BCR-ABL and/or ERG RNA.
  • 21 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof.
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherem one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the 5 '-end of the antisense sfrand optionally includes a phosphate group.
  • siNA short interfering nucleic acid
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherem the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the 5 '-untranslated region or a portion thereof of the BCR-ABL and/or ERG RNA.
  • the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherem the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof that is present in the BCR-ABL and/or
  • the invention features a pharmaceutical composition comprising a siNA molecule of the invention in an acceptable carrier or diluent.
  • the invention features a medicament comprising an siNA molecule of the invention.
  • the invention features an active ingredient comprising an siNA molecule of the invention.
  • the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR- ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double- sfranded siNA molecule comprises a sugar modification.
  • siNA short interfering nucleic acid
  • the introduction of chemically-modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously.
  • the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in semm.
  • certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule.
  • the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule.
  • chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
  • the antisense region of a siNA molecule of the invention can comprise a phosphorothioate intemucleotide linkage at the 3 '-end of the antisense region.
  • the antisense region can comprise about one to about five phosphorothioate intemucleotide linkages at the 5'-end of the antisense region.
  • the 3 '-terminal nucleotide overhangs of a siNA molecule of the invention can comprise ribonucleotides or deoxyribonucleotides that are chemically- modified at a nucleic acid sugar, base, or backbone.
  • the 3'-terminal nucleotide overhangs can comprise one or more universal base ribonucleotides.
  • the 3 '-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
  • One embodiment of the invention provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention in a manner that allows expression of the nucleic acid molecule.
  • Another embodiment of the invention provides a mammalian cell comprising such an expression vector.
  • the mammalian cell can be a human cell.
  • the siNA molecule of the expression vector can comprise a sense region and an antisense region.
  • the antisense region can comprise sequence complementary to a RNA or DNA sequence encoding BCR-ABL and/or ERG and the sense region can comprise sequence complementary to the antisense region.
  • the siNA molecule can comprise two distinct sfrands having complementary sense and antisense regions.
  • the siNA molecule can comprise a single sfrand having complementary sense and antisense regions.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides comprising a backbone modified intemucleotide linkage having Formula I: wherein each RI and R2 is independently any nucleotide, non-nucleotide, or polynucleotide which can be naturally-occurring or chemically-modified, each X and Y is independently O, S, N, alkyl, or substituted alkyl, each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, or aralkyl, and wherein W, X, Y, and Z are optionally
  • the chemically-modified intemucleotide linkages having Formula I can be present in one or both oligonucleotide sfrands of the siNA duplex, for example, in the sense sfrand, the antisense sfrand, or both sfrands.
  • the siNA molecules of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically-modified intemucleotide linkages having Formula I at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the sense sfrand, the antisense strand, or both sfrands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified intemucleotide linkages having Formula I at the 5 '-end of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more) pyrimidine nucleotides with chemically-modified intemucleotide linkages having Formula I in the sense strand, the antisense sfrand, or both sfrands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine nucleotides with chemically- modified intemucleotide linkages having Formula I in the sense strand, the antisense sfrand, or both sfrands.
  • a siNA molecule of the invention having intemucleotide linkage(s) of Formula I also comprises a chemically-modified nucleotide or non-nucleotide having any of Formulae I-VII.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula II:
  • each R3, R4, R5, R6, R7, R8, RIO, Rll and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N- alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkly
  • the chemically-modified nucleotide or non-nucleotide of Formula II can be present in one or both oligonucleotide sfrands of the siNA duplex, for example in the sense sfrand, the antisense sfrand, or both sfrands.
  • the siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula II at the 3 '-end, the 5'- end, or both of the 3' and 5'-ends of the sense sfrand, the antisense sfrand, or both sfrands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non- nucleotides of Formula II at the 5'-end of the sense sfrand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non-nucleotides of Formula II at the 3 '-end of the sense sfrand, the antisense strand, or both strands.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula III:
  • siNA short interfering nucleic acid
  • each R3, R4, R5, R6, R7, R8, R10, Rll and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N- alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkly
  • the chemically-modified nucleotide or non-nucleotide of Formula III can be present in one or both oligonucleotide sfrands of the siNA duplex, for example, in the sense sfrand, the antisense sfrand, or both sfrands.
  • the siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula III at the 3 '-end, the 5'- end, or both of the 3' and 5'-ends of the sense strand, the antisense sfrand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide(s) or non- nucleotide(s) of Formula III at the 5 '-end of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide or non-nucleotide of Formula III at the 3 '-end of the sense sfrand, the antisense sfrand, or both sfrands.
  • a siNA molecule of the invention comprises a nucleotide having Formula II or III, wherein the nucleotide having Formula II or III is in an inverted configuration.
  • the nucleotide having Formula II or III is connected to the siNA constmct in a 3'-3', 3'-2', 2'-3', or 5'-5' configuration, such as at the 3'-end, the 5'-end, or both of the 3' and 5 '-ends of one or both siNA sfrands.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a 5'-terminal phosphate group having Formula IV:
  • siNA short interfering nucleic acid
  • each X and Y is independently O, S, N, alkyl, substituted alkyl, or alkylhalo; wherein each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or alkylhalo; and wherein W, X, Y and Z are not all O.
  • the invention features a siNA molecule having a 5 '-terminal phosphate group having Formula TV on the target-complementary strand, for example, a strand complementary to a target RNA, wherein the siNA molecule comprises an all RNA siNA molecule.
  • the invention features a siNA molecule having a 5'- terminal phosphate group having Formula IV on the target-complementary strand wherein the siNA molecule also comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide 3'- terminal nucleotide overhangs having about 1 to about 4 (e.g., about 1, 2, 3, or 4) deoxyribonucleotides on the 3'-end of one or both sfrands.
  • a 5'- terminal phosphate group having Formula IV is present on the target-complementary sfrand of a siNA molecule of the invention, for example a siNA molecule having chemical modifications having any of Formulae I-VII.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more phosphorothioate intemucleotide linkages.
  • siNA short interfering nucleic acid
  • the invention features a chemically-modified short interfering nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in one siNA strand.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate intemucleotide linkages in both siNA strands.
  • the phosphorothioate intemucleotide linkages can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense sfrand, the antisense sfrand, or both strands.
  • the siNA molecules of the invention can comprise one or more phosphorothioate intemucleotide linkages at the 3'-end, the 5'-end, or both of the 3'- and 5'- ends of the sense sfrand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate intemucleotide linkages at the 5'-end of the sense strand, the antisense sfrand, or both sfrands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine phosphorothioate intemucleotide linkages in the sense strand, the antisense strand, or both strands,
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine phosphorothioate intemucleotide linkages in the sense strand, the antisense strand, or both strands.
  • the invention features a siNA molecule, wherein the sense sfrand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5,
  • one or more, for example about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense siNA sfrand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy- 2'-fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present in the same or different sfrand.
  • the invention features a siNA molecule, wherein the sense sfrand comprises about 1 to about 5, specifically about 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) 2'-deoxy, 2'-O- methyl, 2 '-deoxy-2 '-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3-end, the 5'-end, or both of the 3'- and 5'-ends of the sense sfrand; and wherein the antisense sfrand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10 or more) 2'-deoxy, 2'-O
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and or antisense siNA sfrand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy-2'- fluoro nucleotides, with or without about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or more phosphorothioate internucleotide linkages and or a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present in the same or different strand.
  • the invention features a siNA molecule, wherein the antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate intemucleotide linkages, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5'-end, or both of the 3'- and 5 '-ends of the sense sfrand; and wherein the antisense sfrand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate intemucleotide linkages, and/or one or more (e.g.,
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy- 2'-fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3' and 5'-ends, being present in the same or different sfrand.
  • the invention features a siNA molecule, wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of the sense sfrand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages, and/or one or more (e.g, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5'-end, or both of the 3'- and 5'-ends, being present in the same or different sfrand.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule having about 1 to about 5, specifically about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages in each strand of the siNA molecule.
  • siNA short interfering nucleic acid
  • the invention features a siNA molecule comprising 2'-5' intemucleotide linkages.
  • the 2'-5' intemucleotide linkage(s) can be at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of one or both siNA sequence sfrands.
  • the 2'-5' intemucleotide linkage(s) can be present at various other positions within one or both siNA sequence sfrands, for example, about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more including every intemucleotide linkage of a pyrimidine nucleotide in one or both sfrands of the siNA molecule can comprise a 2'-5' intemucleotide linkage, or about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more including every intemucleotide linkage of a purine nucleotide in one or both sfrands of the siNA molecule can comprise a 2'-5' intemucleotide linkage.
  • a chemically-modified siNA molecule of the invention comprises a duplex having two sfrands, one or both of which can be chemically-modified, wherein each sfrand is about 18 to about 27 (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27) nucleotides in length, wherein the duplex has about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the chemical modification comprises a stmcture having any of Formulae I-VII.
  • an exemplary chemically-modified siNA molecule of the invention comprises a duplex having two strands, one or both of which can be chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein each strand consists of about 21 nucleotides, each having a 2- nucleotide 3 '-terminal nucleotide overhang, and wherein the duplex has about 19 base pairs.
  • a siNA molecule of the invention comprises a single stranded hairpin stmcture, wherein the siNA is about 36 to about 70 (e.g., about 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can include a chemical modification comprising a structure having any of Formulae I-VII or any combination thereof.
  • an exemplary chemically-modified siNA molecule of the invention comprises a linear oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the linear oligonucleotide forms a hai ⁇ in structure having about 19 base pairs and a 2-nucleotide 3 '-terminal nucleotide overhang.
  • a linear hairpin siNA molecule of the invention contains a stem loop motif, wherein the loop portion of the siNA molecule is biodegradable.
  • a linear hairpin siNA molecule of the invention is designed such that degradation of the loop portion of the siNA molecule in vivo can generate a double-sfranded siNA molecule with 3 '-terminal overhangs, such as 3'-terminal nucleotide overhangs comprising about 2 nucleotides.
  • a siNA molecule of the invention comprises a circular nucleic acid molecule, wherein the siNA is about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60,
  • nucleotides in length having about 18 to about 23 e.g., about 18, 19, 20, 21, 22, or
  • an exemplary chemically-modified siNA molecule of the invention comprises a circular oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the circular oligonucleotide forms a dumbbell shaped stmcture having about 19 base pairs and 2 loops.
  • a circular siNA molecule of the invention contains two loop motifs, wherem one or both loop portions of the siNA molecule is biodegradable.
  • a circular siNA molecule of the invention is designed such that degradation of the loop portions of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3 '-terminal overhangs, such as 3 '-terminal nucleotide overhangs comprising about 2 nucleotides.
  • a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) abasic moiety, for example a compound having Formula V:
  • each R3, R4, R5, R6, R7, R8, R10, Rll, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
  • each R3, R4, R5, R6, R7, R8, RIO, Rll, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
  • a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) substituted polyalkyl moieties, for example a compound having Formula VII:
  • each RI, R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O- aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino,
  • This modification is referred to herein as "glyceryl" (for example modification 6 in Figure 10).
  • a moiety having any of Formula V, VI or VII of the invention is at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of a siNA molecule of the invention.
  • a moiety having Formula V, VI or VII can be present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sfrand, the sense sfrand, or both antisense and sense sfrands of the siNA molecule.
  • a moiety having Formula VII can be present at the 3 '-end or the 5 '-end of a hairpin siNA molecule as described herein.
  • a siNA molecule of the invention comprises an abasic residue having Formula V or VI, wherein the abasic residue having Formula VI or VI is connected to the siNA constmct in a 3'-3', 3'-2', 2'-3', or 5'-5' configuration, such as at the 3'-end, the 5'- end, or both of the 3 ' and 5'-ends of one or both siNA sfrands.
  • a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acid (LNA) nucleotides, for example at the 5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination thereof, of the siNA molecule.
  • LNA locked nucleic acid
  • a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides, for example at the 5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination thereof, of the siNA molecule.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2 '-deoxy-2 '-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2 '-deoxy-2'- fluoro pyrimidine nucleotides (e.g., wherem all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2'-deoxy purine nucleotides (e.g., wherem all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of purine nucle
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternate
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternate
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the antisense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternately a
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against a BCR-ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2 '-deoxy-2 '-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-de
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against a BCR-ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are purine ribonucleotides (e.g., wherein all purine nucleotides are purine ribonucleotides or alternately
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference
  • siNA short interfering nucleic acid
  • RNAi against a BCR-ABL and/or ERG inside a cell or reconstituted in vitro system
  • the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and for example where one or more purine nucleotides present in the sense region are selected from the group consisting of 2' -deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4 '-thionucleotides, and 2'-O- methyl nucle
  • any modified nucleotides present in the siNA molecules of the invention preferably in the antisense sfrand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense sfrands, comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides.
  • the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer- Verlag ed., 1984).
  • chemically modified nucleotides present in the siNA molecules of the invention preferably in the antisense sfrand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense sfrands, are resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi.
  • Non-limiting examples of nucleotides having a northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2 '-0,4'- C-methylene-(D-ribofuranosyl) nucleotides); 2'-methoxyethoxy (MOE) nucleotides; 2'- methyl-thio-ethyl, 2 '-deoxy-2 '-fluoro nucleotides, 2 '-deoxy-2 '-chloro nucleotides, 2'-azido nucleotides, and 2 ' -O-methyl nucleotides.
  • LNA locked nucleic acid
  • MOE 2'-methoxyethoxy
  • the invention features a chemically-modified short interfering nucleic acid molecule (siNA) capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a conjugate covalently attached to the chemically-modified siNA molecule.
  • the conjugate is covalently attached to the chemically- modified siNA molecule via a biodegradable linker.
  • the conjugate molecule is attached at the 3 '-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule.
  • the conjugate molecule is attached at the 5 '-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule. In yet another embodiment, the conjugate molecule is attached both the 3 '-end and 5 '-end of either the sense sfrand, the antisense strand, or both strands of the chemically-modified siNA molecule, or any combination thereof.
  • a conjugate molecule of the invention comprises a molecule that facilitates delivery of a chemically-modified siNA molecule into a biological system, such as a cell.
  • the conjugate molecule attached to the chemically-modified siNA molecule is a poly ethylene glycol, human semm albumin, or a ligand for a cellular receptor that can mediate cellular uptake.
  • Examples of specific conjugate molecules contemplated by the instant invention that can be attached to chemically-modified siNA molecules are described in Vargeese et al, U.S. Serial No. 10/201,394, incorporated by reference herein.
  • the type of conjugates used and the extent of conjugation of siNA molecules of the invention can be evaluated for improved pharmacokinetic profiles, bioavailability, and or stability of siNA constructs while at the same time maintaining the ability of the siNA to mediate RNAi activity.
  • one skilled in the art can screen siNA constructs that are modified with various conjugates to determine whether the siNA conjugate complex possesses improved properties while maintaining the ability to mediate RNAi, for example in animal models as are generally known in the art.
  • the invention features a short interfering nucleic acid (siNA) molecule of the invention, wherein the siNA further comprises a nucleotide, non-nucleotide, or mixed nucleotide/non-nucleotide linker that joins the sense region of the siNA to the antisense region of the siNA.
  • a nucleotide linker of the invention can be a linker of > 2 nucleotides in length, for example 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
  • the nucleotide linker can be a nucleic acid aptamer.
  • aptamer or “nucleic acid aptamer” as used herein is meant a nucleic acid molecule that binds specifically to a target molecule wherein the nucleic acid molecule has sequence that comprises a sequence recognized by the target molecule in its natural setting.
  • an aptamer can be a nucleic acid molecule that binds to a target molecule where the target molecule does not naturally bind to a nucleic acid.
  • the target molecule can be any molecule of interest.
  • the aptamer can be used to bind to a ligand-binding domain of a protein, thereby preventing interaction of the naturally occurring ligand with the protein.
  • a non-nucleotide linker of the invention comprises abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (e.g. polyethylene glycols such as those having between 2 and 100 ethylene glycol units).
  • polyethylene glycols such as those having between 2 and 100 ethylene glycol units.
  • Specific examples include those described by Seela and Kaiser, Nucleic Acids Res. 1990, 75:6353 and Nucleic Acids Res. 1987, 75:3113; Cload and Schepartz, J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am. Chem. Soc 1991, 773:5109; Ma et al, Nucleic Acids Res.
  • non-nucleotide further means any group or compound that can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity.
  • the group or compound can be abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine, for example at the Cl position of the sugar.
  • the invention features a short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) inside a cell or reconstituted in vitro system, wherein one or both strands of the siNA molecule that are assembled from two separate oligonucleotides do not comprise any ribonucleotides.
  • a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA comprise separate oligonucleotides not having any ribonucleotides (e.g., nucleotides having a 2'-OH group) present in the oligonucleotides.
  • a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA are linked or circularized by a nucleotide or non-nucleotide linker as desrcibed herein, wherein the oligonucleotide does not have any ribonucleotides (e.g., nucleotides having a 2' -OH group) present in the oligonucleotide.
  • ribonucleotides e.g., nucleotides having a 2' -OH group
  • all positions within the siNA can include chemically modified nucleotides and/or non-nucleotides such as nucleotides and or non-nucleotides having Formula I, II, III, IV, V, VI, or VII or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vifro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence.
  • the single sfranded siNA molecule of the invention comprises a 5'-terminal phosphate group. In another embodiment, the single stranded siNA molecule of the invention comprises a 5 '-terminal phosphate group and a 3'- terminal phosphate group (e.g., a 2', 3'-cyclic phosphate). In another embodiment, the single sfranded siNA molecule of the invention comprises about 19 to about 29 nucleotides. In yet another embodiment, the single stranded siNA molecule of the invention comprises one or more chemically modified nucleotides or non-nucleotides described herein.
  • all the positions within the siNA molecule can include chemically-modified nucleotides such as nucleotides having any of Formulae I-VII, or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
  • a siNA molecule of the invention is a single sfranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O
  • a siNA molecule of the invention is a single sfranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vifro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vifro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are locked nucleic acid (LNA) nucleotides (e.g., wherein all purine nucleotides are LNA nucle
  • a siNA molecule of the invention is a single sfranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2 '-methoxyethyl purine nucleotides (e.g., wherein all purine nucleotides
  • any modified nucleotides present in the single stranded siNA molecules of the invention comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides.
  • the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer- Verlag ed., 1984).
  • chemically modified nucleotides present in the single stranded siNA molecules of the invention are preferably resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi.
  • siNA molecules of the invention are used as reagents in ex vivo gene therapy applications.
  • siNA reagents are intoduced into tissue or cells that are transplanted into a subject for therapeutic effect.
  • the cells and/or tissue can be derived from an organism or subject that later receives the explant, or can be derived from another organism or subject prior to transplantation.
  • the siNA molecules can be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype or are able to perform a function when transplanted in vivo.
  • the invention features a method for modulating the expression of a BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the cell.
  • the invention features a method for modulating the expression of a BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene and wherein the sense sfrand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the cell.
  • the invention features a method for modulating the expression of more than one BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG genes; and (b) infroducing the siNA molecules into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the cell.
  • the invention features a method for modulating the expression of more than one BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the cell.
  • the invention features a method of modulating the expression of a BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherem one of the siNA strands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in that organism.
  • the invention features a method of modulating the expression of a BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the tissue explant.
  • the method further comprises infroducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in that organism.
  • the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG genes; and (b) infroducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the tissue explant.
  • the method further comprises infroducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in that organism.
  • the invention features a method of modulating the expression of a BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the BCR-ABL and or ERG gene; and (b) infroducing the siNA molecule into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the organism.
  • the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG genes; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the organism.
  • the invention features a method for modulating the expression of a
  • BCR-ABL and or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the cell.
  • the invention features a method for modulating the expression of more than one BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single sfranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) contacting the siNA molecule with a cell in vifro or in vivo under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the cell.
  • the invention features a method of modulating the expression of a
  • BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) contacting the siNA molecule with a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in that organism.
  • the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single sfranded sequence having complementarity to RNA of the BCR- ABL and/or ERG gene; and (b) infroducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in that organism.
  • the invention features a method of modulating the expression of a
  • BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single sfranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) infroducing the siNA molecule into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the organism.
  • the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the organism.
  • the invention features a method of modulating the expression of a
  • BCR-ABL and/or ERG gene in an organism comprising contacting the organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the BCR- ABL and/or ERG gene in the organism.
  • the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in an organism comprising contacting the organism with one or more siNA molecules of the invention under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the organism.
  • the siNA molecules of the invention can be designed to inhibit target (BCR-ABL and/or ERG) gene expression through RNAi targeting of a variety of RNA molecules.
  • the siNA molecules of the invention are used to target various RNAs corresponding to a target gene.
  • Non-limiting examples of such RNAs include messenger RNA (mRNA), alternate RNA splice variants of target gene(s), post-franscriptionally modified RNA of target gene(s), pre-mRNA of target gene(s), and or RNA templates. If alternate splicing produces a family of franscripts that are distinguished by usage of appropriate exons, the instant invention can be used to inhibit gene expression through the appropriate exons to specifically inhibit or to distinguish among the functions of gene family members.
  • a protein that contains an alternatively spliced transmembrane domain can be expressed in both membrane bound and secreted forms.
  • Use of the invention to target the exon containing the fransmembrane domain can be used to determine the functional consequences of pharmaceutical targeting of membrane bound as opposed to the secreted form of the protein.
  • Non-limiting examples of applications of the invention relating to targeting these RNA molecules include therapeutic pharmaceutical applications, pharmaceutical discovery applications, molecular diagnostic and gene function applications, and gene mapping, for example using single nucleotide polymo ⁇ hism mapping with siNA molecules of the invention.
  • Such applications can be implemented using known gene sequences or from partial sequences available from an expressed sequence tag (EST).
  • the siNA molecules of the invention are used to target conserved sequences co ⁇ esponding to a gene family or gene families such as BCR-ABL and/or ERG family genes.
  • siNA molecules targeting multiple BCR-ABL and/or ERG targets can provide increased therapeutic effect.
  • siNA can be used to characterize pathways of gene function in a variety of applications.
  • the present invention can be used to inhibit the activity of target gene(s) in a pathway to determine the function of uncharacterized gene(s) in gene function analysis, mRNA function analysis, or translational analysis.
  • the invention can be used to determine potential target gene pathways involved in various diseases and conditions toward pharmaceutical development.
  • the invention can be used to understand pathways of gene expression involved in, for example, the progression and/or maintenance of cancer.
  • siNA molecule(s) and/or methods of the invention are used to inhibit the expression of gene(s) that encode RNA refe ⁇ ed to by Genbank Accession, for example BCR-ABL and/or ERG genes encoding RNA sequence(s) refe ⁇ ed to herein by Genbank Accession number, for example Genbank Accession Nos. shown in Table I.
  • the invention features a method comprising: (a) generating a library of siNA consfructs having a predetermined complexity; and (b) assaying the siNA constmcts of (a) above, under conditions suitable to determine RNAi target sites within the target RNA sequence.
  • the siNA molecules of (a) have sfrands of a fixed length, for example, about 23 nucleotides in length.
  • the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • the assay can comprise a reconstituted in vitro siNA assay as described herein.
  • the assay can comprise a cell culture system in which target RNA is expressed.
  • fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence.
  • the target RNA sequence can be obtained as is known in the art, for example, by cloning and/or franscription for in vitro systems, and by cellular expression in in vivo systems.
  • the invention features a method comprising: (a) generating a randomized library of siNA consfructs having a predetermined complexity, such as of 4 N , where N represents the number of base paired nucleotides in each of the siNA constract strands (eg. for a siNA constract having 21 nucleotide sense and antisense strands with 19 base pairs, the complexity would be 4 19 ); and (b) assaying the siNA consfructs of (a) above, under conditions suitable to determine RNAi target sites within the target BCR-ABL and/or ERG RNA sequence.
  • the siNA molecules of (a) have strands of a fixed length, for example about 23 nucleotides in length. In yet another embodiment, the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • the assay can comprise a reconstituted in vitro siNA assay as described in Example 7 herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed.
  • fragments of BCR-ABL and or ERG RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target BCR-ABL and/or ERG RNA sequence.
  • the target BCR-ABL and/or ERG RNA sequence can be obtained as is known in the art, for example, by cloning and/or franscription for in vitro systems, and by cellular expression in in vivo systems.
  • the invention features a method comprising: (a) analyzing the sequence of a RNA target encoded by a target gene; (b) synthesizing one or more sets of siNA molecules having sequence complementary to one or more regions of the RNA of (a); and (c) assaying the siNA molecules of (b) under conditions suitable to determine RNAi targets within the target RNA sequence.
  • the siNA molecules of (b) have strands of a fixed length, for example about 23 nucleotides in length.
  • the siNA molecules of (b) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • the assay can comprise a reconstituted in vitro siNA assay as described herein.
  • the assay can comprise a cell culture system in which target RNA is expressed. Fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel elecfrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence.
  • the target RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by expression in in vivo systems.
  • target site is meant a sequence within a target RNA that is “targeted” for cleavage mediated by a siNA construct which contains sequences within its antisense region that are complementary to the target sequence.
  • detecttable level of cleavage is meant cleavage of target RNA (and formation of cleaved product RNAs) to an extent sufficient to discern cleavage products above the background of RNAs produced by random degradation of the target RNA. Production of cleavage products from 1-5% of the target RNA is sufficient to detect above the background for most methods of detection.
  • the invention features a composition comprising a siNA molecule of the invention, which can be chemically-modified, in a pharmaceutically acceptable carrier or diluent.
  • the invention features a pharmaceutical composition comprising siNA molecules of the invention, which can be chemically-modified, targeting one or more genes in a pharmaceutically acceptable carrier or diluent.
  • the invention features a method for treating or preventing a disease or condition in a subject, comprising administering to the subject a composition of the invention under conditions suitable for the treatment or prevention of the disease or condition in the subject, alone or in conjunction with one or more other therapeutic compounds, hi yet another embodiment, the invention features a method for reducing or preventing tissue rejection in a subject comprising administering to the subject a composition of the invention under conditions suitable for the reduction or prevention of tissue rejection in the subject.
  • the invention features a method for validating a BCR-ABL and/or ERG gene target, comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands includes a sequence complementary to RNA of a BCR-ABL and/or ERG target gene; (b) infroducing the siNA molecule into a cell, tissue, or organism under conditions suitable for modulating expression of the BCR-ABL and/or ERG target gene in the cell, tissue, or organism; and (c) determining the function of the gene by assaying for any phenotypic change in the cell, tissue, or organism.
  • the invention features a method for validating a BCR-ABL and/or ERG target comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands includes a sequence complementary to RNA of a BCR-ABL and/or ERG target gene; (b) introducing the siNA molecule into a biological system under conditions suitable for modulating expression of the BCR-ABL and/or ERG target gene in the biological system; and (c) determining the function of the gene by assaying for any phenotypic change in the biological system.
  • biological system is meant, material, in a purified or unpurified form, from biological sources, including but not limited to human, animal, plant, insect, bacterial, viral or other sources, wherein the system comprises the components required for RNAi acitivity.
  • biological system includes, for example, a cell, tissue, or organism, or extract thereof.
  • biological system also includes reconstituted RNAi systems that can be used in an in vitro setting.
  • phenotypic change is meant any detectable change to a cell that occurs in response to contact or freatment with a nucleic acid molecule of the invention (e.g., siNA).
  • detectable changes include, but are not limited to, changes in shape, size, proliferation, motility, protein expression or RNA expression or other physical or chemical changes as can be assayed by methods known in the art.
  • the detectable change can also include expression of reporter genes/molecules such as Green Florescent Protein (GFP) or various tags that are used to identify an expressed protein or any other cellular component that can be assayed.
  • GFP Green Florescent Protein
  • the invention features a kit containing a siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of a BCR-ABL and/or ERG target gene in a cell, tissue, or organism.
  • the invention features a kit containing more than one siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of more than one BCR-ABL and/or ERG target gene in a cell, tissue, or organism.
  • the invention features a kit containing a siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of a BCR-ABL and/or ERG target gene in a biological system.
  • the invention features a kit containing more than one siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of more than one BCR- ABL and/or ERG target gene in a biological system.
  • the invention features a cell containing one or more siNA molecules of the invention, which can be chemically-modified.
  • the cell containing a siNA molecule of the invention is a mammalian cell.
  • the cell containing a siNA molecule of the invention is a human cell.
  • the synthesis of a siNA molecule of the invention comprises: (a) synthesis of two complementary strands of the siNA molecule; (b) annealing the two complementary sfrands together under conditions suitable to obtain a double-sfranded siNA molecule.
  • synthesis of the two complementary strands of the siNA molecule is by solid phase oligonucleotide synthesis.
  • synthesis of the two complementary sfrands of the siNA molecule is by solid phase tandem oligonucleotide synthesis.
  • the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing a first oligonucleotide sequence sfrand of the siNA molecule, wherein the first oligonucleotide sequence strand comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of the second oligonucleotide sequence sfrand of the siNA; (b) synthesizing the second oligonucleotide sequence strand of siNA on the scaffold of the first oligonucleotide sequence strand, wherein the second oligonucleotide sequence sfrand further comprises a chemical moiety than can be used to purify the siNA duplex; (c) cleaving the linker molecule of (a) under conditions suitable for the two siNA oligonucleotide strands to hybridize and form a stable duplex; and (d) purifying the siNA duplex utilizing the chemical
  • cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example under hydrolysis conditions using an alkylamine base such as methylamine.
  • the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherem the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold.
  • CPG controlled pore glass
  • a cleavable linker such as a succinyl linker
  • the cleavable linker in (a) used as a scaffold for synthesizing the second sfrand can comprise similar reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place concomitantly.
  • the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group, which can be employed in a trityl-on synthesis strategy as described herein.
  • the chemical moiety, such as a dimethoxytrityl group is removed during purification, for example, using acidic conditions.
  • the method for siNA synthesis is a solution phase synthesis or hybrid phase synthesis wherein both sfrands of the siNA duplex are synthesized in tandem using a cleavable linker attached to the first sequence which acts a scaffold for synthesis of the second sequence. Cleavage of the linker under conditions suitable for hybridization of the separate siNA sequence sfrands results in formation of the double-stranded siNA molecule.
  • the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing one oligonucleotide sequence sfrand of the siNA molecule, wherein the sequence comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of another oligonucleotide sequence; (b) synthesizing a second oligonucleotide sequence having complementarity to the first sequence sfrand on the scaffold of (a), wherein the second sequence comprises the other sfrand of the double-sfranded siNA molecule and wherein the second sequence further comprises a chemical moiety than can be used to isolate the attached oligonucleotide sequence; (c) purifying the product of (b) utilizing the chemical moiety of the second oligonucleotide sequence sfrand under conditions suitable for isolating the full-length sequence comprising both siNA oligonucleotide strands connected by the clea
  • cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example under hydrolysis conditions. In another embodiment, cleavage of the linker molecule in (c) above takes place after deprotection of the oligonucleotide.
  • the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherem the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold.
  • CPG controlled pore glass
  • cleavable linker such as a succinyl linker
  • the cleavable linker in (a) used as a scaffold for synthesizing the second sfrand can comprise similar reactivity or differing reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place either concomitantly or sequentially.
  • the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group.
  • the invention features a method for making a double-stranded siNA molecule in a single synthetic process comprising: (a) synthesizing an oligonucleotide having a first and a second sequence, wherein the first sequence is complementary to the second sequence, and the first oligonucleotide sequence is linked to the second sequence via a cleavable linker, and wherein a terminal 5 '-protecting group, for example, a 5'-O- dimethoxytrityl group (5'-O-DMT) remains on the oligonucleotide having the second sequence; (b) deprotecting the oligonucleotide whereby the deprotection results in the cleavage of the linker joining the two oligonucleotide sequences; and (c) purifying the product of (b) under conditions suitable for isolating the double-stranded siNA molecule, for example using a trityl-on synthesis strategy as described herein.
  • the method of synthesis of siNA molecules of the invention comprises the teachings of Scaringe et al, US Patent Nos. 5,889,136; 6,008,400; and 6,111,086, inco ⁇ orated by reference herein in their entirety.
  • the invention features siNA consfructs that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA construct comprises one or more chemical modifications, for example, one or more chemical modifications having any of Formulae I- VII or any combination thereof that increases the nuclease resistance of the siNA constract.
  • the invention features a method for generating siNA molecules with increased nuclease resistance comprising (a) infroducing nucleotides having any of
  • the invention features siNA constracts that mediate RNAi against a BCR-ABL and or ERG, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the sense and antisense sfrands of the siNA construct.
  • the invention features a method for generating siNA molecules with increased binding affinity between the sense and antisense strands of the siNA molecule comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the sense and antisense sfrands of the siNA molecule.
  • the invention features siNA constracts that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target RNA sequence within a cell.
  • the invention features siNA constracts that mediate RNAi against a BCR-ABL and or ERG, wherein the siNA constract comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target DNA sequence within a cell.
  • the invention features a method for generating siNA molecules with increased binding affinity between the antisense sfrand of the siNA molecule and a complementary target RNA sequence comprising (a) infroducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense strand of the siNA molecule and a complementary target RNA sequence.
  • the invention features a method for generating siNA molecules with increased binding affinity between the antisense sfrand of the siNA molecule and a complementary target DNA sequence comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense sfrand of the siNA molecule and a complementary target DNA sequence.
  • the invention features siNA constracts that mediate RNAi against a BCR-ABL and/or ERG, wherem the siNA construct comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically-modified siNA constract.
  • the invention features a method for generating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to a chemically-modified siNA molecule comprising (a) infroducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically- modified siNA molecule.
  • the invention features chemically-modified siNA constructs that mediate RNAi against a BCR-ABL and/or ERG in a cell, wherein the chemical modifications do not significantly effect the interaction of siNA with a target RNA molecule, DNA molecule and/or proteins or other factors that are essential for RNAi in a manner that would decrease the efficacy of RNAi mediated by such siNA constracts.
  • the invention features a method for generating siNA molecules with improved RNAi activity against BCR-ABL and/or ERG comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity.
  • the invention features a method for generating siNA molecules with improved RNAi activity against a BCR-ABL and/or ERG target RNA comprising (a) infroducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target RNA.
  • the invention features a method for generating siNA molecules with improved RNAi activity against a BCR-ABL and or ERG target DNA comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target DNA.
  • the invention features siNA consfructs that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the cellular uptake of the siNA constract.
  • the invention features a method for generating siNA molecules against BCR-ABL and/or ERG with improved cellular uptake comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved cellular uptake.
  • the invention features siNA constracts that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA constract comprises one or more chemical modifications described herein that increases the bioavailability of the siNA constract, for example, by attaching polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the siNA construct, or by attaching conjugates that target specific tissue types or cell types in vivo.
  • polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the siNA construct
  • conjugates that target specific tissue types or cell types in vivo are described in Vargeese et al, U.S. Serial No. 10/201,394 inco ⁇ orated by reference herein.
  • the invention features a method for generating siNA molecules of the invention with improved bioavailability, comprising (a) infroducing a conjugate into the stracture of a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • Such conjugates can include ligands for cellular receptors, such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZTP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; polyamines, such as spermine or spermidine; and others.
  • ligands for cellular receptors such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZTP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; polyamines, such as spermine or spermidine; and others.
  • the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) infroducing an excipient formulation to a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • excipients include polymers such as cyclodextrins, lipids, cationic lipids, polyamines, phospholipids, and others.
  • the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) infroducing nucleotides having any of Formulae I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • polyethylene glycol can be covalently attached to siNA compounds of the present invention.
  • the attached PEG can be any molecular weight, preferably from about 2,000 to about 50,000 daltons (Da).
  • the present invention can be used alone or as a component of a kit having at least one of the reagents necessary to cany out the in vitro or in vivo introduction of RNA to test samples and/or subjects.
  • prefened components of the kit include a siNA molecule of the invention and a vehicle that promotes introduction of the siNA into cells of interest as described herein (e.g., using lipids and other methods of transfection known in the art, see for example Beigelman et al, US 6,395,713).
  • the kit can be used for target validation, such as in determining gene function and/or activity, or in drag optimization, and in drag discovery (see for example Usman et al., USSN 60/402,996).
  • Such a kit can also include instructions to allow a user of the kit to practice the invention.
  • short interfering nucleic acid short interfering nucleic acid
  • siNA short interfering nucleic acid
  • siRNA short interfering nucleic acid molecule
  • short interfering oligonucleotide molecule short interfering oligonucleotide molecule
  • “chemically-modified short interfering nucleic acid molecule” refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression or viral replication, for example by mediating RNA interference "RNAi” or gene silencing in a sequence-specific manner; see for example Bass, 2001, Nature, 411, 428-429; Elbashir et al, 2001, Nature, 411, 494-498; and Kreutzer et al, International PCT Publication No. WO 00/44895; Zemicka-Goetz et al, International PCT Publication No. WO 01/36646; Fire, International PCT Publication No. WO 99/32619; Plaetinck et al, International PCT Publication No.
  • Non limiting examples of siNA molecules of the invention are shown in Figures 4-6, and Tables II, III, and IV herein.
  • the siNA can be a double-sfranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence co ⁇ esponding to the target nucleic acid sequence or a portion thereof.
  • the siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense sfrands are self-complementary (i.e.
  • each sfrand comprises nucleotide sequence that is complementary to nucleotide sequence in the other sfrand; such as where the antisense strand and sense strand form a duplex or double sfranded stmcture, for example wherein the double sfranded region is about 19 base pairs); the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence co ⁇ esponding to the target nucleic acid sequence or a portion thereof.
  • the siNA is assembled from a single oligonucleotide, where the self- complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • the siNA can be a polynucleotide with a hai ⁇ in secondary stmcture, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence co ⁇ esponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi.
  • the siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence co ⁇ esponding to the target nucleic acid sequence or a portion thereof), wherein the single sfranded polynucleotide can further comprise a terminal phosphate group, such as a 5'- phosphate (see for example Martinez et al, 2002, Cell, 110, 563-574 and Schwarz et al, 2002, Molecular Cell, 10, 537-568), or 5',3'-diphosphate.
  • a terminal phosphate group such as a 5'- phosphate (see for example Martinez et al, 2002, Cell, 110, 563-574 and Schwarz et al, 2002, Molecular Cell, 10, 537-568), or 5',3'-diphosphate.
  • the siNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non- nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic intercations, and/or stacking interactions.
  • the siNA molecules of the invention comprise nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the siNA molecule of the invention interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • siNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non- nucleotides.
  • the short interfering nucleic acid molecules of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
  • Applicant describes in certain embodiments short interfering nucleic acids that do not require the presence of nucleotides having a 2'-hydroxy group for mediating RNAi and as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group).
  • siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
  • siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • modified short interfering nucleic acid molecules of the invention can also be refe ⁇ ed to as short interfering modified oligonucleotides "siMON.”
  • siNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double- sfranded RNA (dsRNA), micro-RNA (miRNA), short hai ⁇ in RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • siRNA short interfering RNA
  • dsRNA double- sfranded RNA
  • miRNA micro-RNA
  • shRNA short hai ⁇ in RNA
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or epigenetics.
  • siNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre- franscriptional level.
  • epigenetic regulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure to alter gene expression (see, for example, AUshire, 2002, Science, 297, 1818-1819; Volpe et al, 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al, 2002, Science, 297, 2232-2237).
  • modulate is meant that the expression of the gene, or level of RNA molecule or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator.
  • modulate can mean “inhibit,” but the use of the word “modulate” is not limited to this definition.
  • inhibitor By “inhibit”, “down-regulate”, or “reduce”, it is meant that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, is reduced below that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention.
  • inhibition, down-regulation or reduction with an siNA molecule is below that level observed in the presence of an inactive or attenuated molecule.
  • inhibition, down-regulation, or reduction with siNA molecules is below that level observed in the presence of, for example, an siNA molecule with scrambled sequence or with mismatches.
  • inhibition, down-regulation, or reduction of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
  • RNA nucleic acid that encodes an RNA
  • the target gene can be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes such as genes of a pathogen, for example a viras, which is present in the cell after infection thereof.
  • the cell containing the target gene can be derived from or contained in any organism, for example a plant, animal, protozoan, viras, bacterium, or fungus.
  • Non-limiting examples of plants include monocots, dicots, or gymnosperms.
  • Non- limiting examples of animals include vertebrates or invertebrates.
  • fungi include molds or yeasts.
  • BCR-ABL is meant, a BCR-ABL polypeptide, protein and/or a polynucleotide encoding a BCR-ABL protein (such as BCR-ABL fusion polynucleotides refe ⁇ ed to in Table I or any other BCR-ABL transcript derived from a BCR-ABL fusion gene).
  • BCR-ABL protein is meant, a BCR-ABL peptide or protein or a component thereof, wherein the peptide or protein is encoded by a BCR-ABL gene.
  • ERG is meant, a polypeptide or protein comprising an Ets family type fransciption factor or fusion variant thereof or polynucleotide encoding an Ets family type transcription factor or fusion variant thereof (such as ERG fusion polynucleotides refe ⁇ ed to in Table I or any other ERG transcript derived from an ERG fusion gene).
  • ERG protein is meant, a ERG peptide or protein or a component thereof, wherein the peptide or protein is encoded by a ERG or ERG fusion gene.
  • cancer is meant a group of diseases characterized by uncontrolled growth and spread of abnormal cells, hi certain embodiments, the term cancer as used herein refers to leukemia, such as chronic myelogenous leukemia (CML) resulting from the BCR-ABL fusion gene.
  • CML chronic myelogenous leukemia
  • highly conserved sequence region a nucleotide sequence of one or more regions in a target gene does not vary significantly from one generation to the other or from one biological system to the other.
  • sense region is meant a nucleotide sequence of a siNA molecule having complementarity to an antisense region of the siNA molecule.
  • the sense region of a siNA molecule can comprise a nucleic acid sequence having homology with a target nucleic acid sequence.
  • antisense region is meant a nucleotide sequence of a siNA molecule having complementarity to a target nucleic acid sequence.
  • the antisense region of a siNA molecule can optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule.
  • target nucleic acid is meant any nucleic acid sequence whose expression or activity is to be modulated.
  • the target nucleic acid can be DNA or RNA.
  • nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types.
  • the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al, 1987, CSH Symp. Quant. Biol. LII ⁇ p.123-133; Frier et al, 1986, Proc. Nat. Acad. Sci.
  • a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • the siNA molecules of the invention represent a novel therapeutic approach to freat various diseases and conditions, including cancer (e.g. leukemia such as CML) and any other indications that can respond to the level of BCR-ABL in a cell or tissue.
  • cancer e.g. leukemia such as CML
  • the siRNA molecules of the invention also represent a novel therapeutic approach to freat a treat a broad spectrum of oncology and neovascularization-related indications, including but not limited to cancers of the lung, colon, breast, prostate, cervix, lymphoma, Ewing's sarcoma and related tumors, melanoma, angiogenic disease states such as tumor angiogenesis, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis such as rheumatoid arthritis, psoriasis, verruca vulgaris, angiofibroma of tuberous sclerosis, port-wine stains, Sturge Weber syndrome, Kippel-Trenaunay- Weber syndrome, Osler-Weber-rii syndrome, leukemias such as acute myeloid leukemia, osteoporosis, wound healing and other indications that can respond to the level of ERG in a cell or tissue.
  • each sequence of a siNA molecule of the invention is independently about 18 to about 24 nucleotides in length, in specific embodiments about 18, 19, 20, 21, 22, 23, or 24 nucleotides in length.
  • the siNA duplexes of the invention independently comprise about 17 to about 23 base pairs (e.g., about 17, 18, 19, 20, 21, 22 or 23).
  • siNA molecules of the invention comprising hai ⁇ in or circular structures are about 35 to about 55 (e.g, about 35, 40, 45, 50 or 55) nucleotides in length, or about 38 to about 44 (e.g., 38, 39, 40, 41, 42, 43 or 44) nucleotides in length and comprising about 16 to about 22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base pairs.
  • Exemplary siNA molecules of the invention are shown in Table II.
  • Exemplary synthetic siNA molecules of the invention are shown in Tables III and IV and/or Figures 4-5.
  • cell is used in its usual biological sense, and does not refer to an entire multicellular organism, e.g., specifically does not refer to a human.
  • the cell can be present in an organism, e.g., birds, plants and mammals such as humans, cows, sheep, apes, monkeys, swine, dogs, and cats.
  • the cell can be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell).
  • the cell can be of somatic or germ line origin, totipotent or pluripotent, dividing or non-dividing.
  • the cell can also be derived from or can comprise a gamete or embryo, a stem cell, or a fully differentiated cell.
  • the siNA molecules of the invention are added directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues.
  • the nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their inco ⁇ oration in biopolymers.
  • the nucleic acid molecules of the invention comprise sequences shown in Tables II-III and/or Figures 4-5. Examples of such nucleic acid molecules consist essentially of sequences defined in these tables and figures.
  • the chemically modified consfructs described in Table IV can be applied to any siNA sequence of the invention.
  • the invention provides mammalian cells containing one or more siNA molecules of this invention.
  • the one or more siNA molecules can independently be targeted to the same or different sites.
  • RNA is meant a molecule comprising at least one ribonucleotide residue.
  • ribonucleotide is meant a nucleotide with a hydroxyl group at the 2' position of a ⁇ -D-ribo- furanose moiety. The terms include double-stranded RNA, single-stranded RNA, isolated
  • RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occu ⁇ ing RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA.
  • Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non- naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be refe ⁇ ed to as analogs or analogs of naturally-occurring RNA.
  • subject is meant an organism, which is a donor or recipient of explanted cells or the cells themselves. “Subject” also refers to an organism to which the nucleic acid molecules of the invention can be administered. In one embodiment, a subject is a mammal or mammalian cells. In another embodiment, a subject is a human or human cells.
  • phosphorothioate refers to an intemucleotide linkage having Formula I, wherein Z and/or W comprise a sulfur atom. Hence, the term phosphorothioate refers to both phosphorothioate and phosphorodithioate intemucleotide linkages.
  • universal base refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them.
  • Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nifroazole derivatives such as 3-nifropy ⁇ ole, 4- nitroindole, 5-nitroindole, and 6-nifroindole as known in the art (see for example Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).
  • acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbons (Cl, C2, C3, C4, or C5), are independently or in combination absent from the nucleotide.
  • the nucleic acid molecules of the instant invention can be used to freat diseases or conditions discussed herein (e.g., cancers and othe proliferative conditions).
  • freat diseases or conditions discussed herein e.g., cancers and othe proliferative conditions.
  • the siNA molecules can be administered to a subject or can be administered to other appropriate cells evident to those skilled in the art, individually or in combination with one or more dmgs under conditions suitable for the treatment.
  • the siNA molecules can be used in combination with other known treatments to treat conditions or diseases discussed above.
  • the described molecules could be used in combination with one or more known therapeutic agents to freat a disease or condition.
  • Non-limiting examples of other therapeutic agents that can be readily combined with a siNA molecule of the invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies such as monoclonal antibodies, small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention, in a manner which allows expression of the siNA molecule.
  • the vector can contain sequence(s) encoding both strands of a siNA molecule comprising a duplex.
  • the vector can also contain sequence(s) encoding a single nucleic acid molecule that is self-complementary and thus forms a siNA molecule.
  • Non-limiting examples of such expression vectors are described in Paul et al, 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al, 2002, Nature Biotechnology, 19, 500; and Novina et al, 2002, Nature Medicine, advance online publication doi: 10.1038/nm725.
  • the invention features a mammalian cell, for example, a human cell, including an expression vector of the invention.
  • the expression vector of the invention comprises a sequence for a siNA molecule having complementarity to a RNA molecule refe ⁇ ed to by a Genbank Accession numbers, for example Genbank Accession Nos. shown in Table I.
  • an expression vector of the invention comprises a nucleic acid sequence encoding two or more siNA molecules, which can be the same or different.
  • siNA molecules that interact with target RNA molecules and down-regulate gene encoding target RNA molecules are expressed from transcription units inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated vims, retrovims, adenovirus, or alphavirus.
  • the recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells.
  • viral vectors can be used that provide for transient expression of siNA molecules.
  • siNA molecules can be repeatedly administered as necessary. Once expressed, the siNA molecules bind and down-regulate gene function or expression via RNA interference (RNAi). Delivery of siNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reinfroduction into the subject, or by any other means that would allow for introduction into the desired target cell.
  • RNAi RNA interference
  • vectors any nucleic acid- and/or viral-based technique used to deliver a desired nucleic acid.
  • Figure 1 shows a non-limiting example of a scheme for the synthesis of siNA molecules.
  • the complementary siNA sequence sfrands, sfrand 1 and strand 2 are synthesized in tandem and are connected by a cleavable linkage, such as a nucleotide succinate or abasic succinate, which can be the same or different from the cleavable linker used for solid phase synthesis on a solid support.
  • the synthesis can be either solid phase or solution phase, in the example shown, the synthesis is a solid phase synthesis.
  • the synthesis is performed such that a protecting group, such as a dimethoxytrityl group, remains intact on the terminal nucleotide of the tandem oligonucleotide.
  • the two siNA sfrands spontaneously hybridize to form a siNA duplex, which allows the purification of the duplex by utilizing the properties of the terminal protecting group, for example by applying a trityl on purification method wherein only duplexes/oligonucleotides with the terminal protecting group are isolated.
  • Figure 2 shows a MALDI-TOV mass spectrum of a purified siNA duplex synthesized by a method of the invention. The two peaks shown co ⁇ espond to the predicted mass of the separate siNA sequence sfrands. This result demonstrates that the siNA duplex generated from tandem synthesis can be purified as a single entity using a simple trityl-on purification methodology.
  • Figure 3 shows a non-limiting proposed mechanistic representation of target RNA degradation involved in RNAi.
  • Double-stranded RNA dsRNA
  • RdRP RNA-dependent RNA polymerase
  • siNA duplexes RNA-dependent RNA polymerase
  • synthetic or expressed siNA can be infroduced directly into a cell by appropriate means.
  • An active siNA complex forms which recognizes a target RNA, resulting in degradation of the target RNA by the RISC endonuclease complex or in the synthesis of additional RNA by RNA-dependent RNA polymerase (RdRP), which can activate DICER and result in additional siNA molecules, thereby amplifying the RNAi response.
  • RdRP RNA-dependent RNA polymerase
  • Figure 4A-F shows non-limiting examples of chemically-modified siNA constracts of the present invention.
  • N stands for any nucleotide (adenosine, guanosine, cytosine, uridine, or optionally thymidine, for example thymidine can be substituted in the overhanging regions designated by parenthesis (N N).
  • Various modifications are shown for the sense and antisense strands of the siNA consfructs.
  • the sense sfrand comprises 21 nucleotides having four phosphorothioate 5'- and 3 '-terminal intemucleotide linkages, wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-O- methyl or 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand comprises 21 nucleotides, optionally having a 3'- terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and having one 3 '-terminal phosphorothioate intemucleotide linkage and four 5'-terminal phosphorothioate intemucleotide linkages and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the sense sfrand comprises 21 nucleotides wherein the two terminal 3'- nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-O-methyl or 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the sense sfrand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-O-methyl or 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense sfrand comprises 21 nucleotides, optionally having a 3'-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and having one 3 '-terminal phosphorothioate internucleotide linkage and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the sense sfrand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and wherein and all purine nucleotides that may be present are 2'-deoxy nucleotides.
  • the antisense strand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3'- nucleotides are optionally complementary to the target RNA sequence, and having one 3'- terminal phosphorothioate intemucleotide linkage and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the sense sfrand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense sfrand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the sense strand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense sfrand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and having one 3'-terminal phosphorothioate intemucleotide linkage and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-deoxy nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand of consfructs A-F comprise sequence complementary to any target nucleic acid sequence of the invention.
  • Figure 5A-F shows non-limiting examples of specific chemically-modified siNA sequences of the invention.
  • A-F applies the chemical modifications described in Figure 4A- F to a BCR-ABL siNA sequence.
  • Figure 6 shows non-limiting examples of different siNA constracts of the invention.
  • the examples shown (constructs 1, 2, and 3) have 19 representative base pairs; however, different embodiments of the invention include any number of base pairs described herein.
  • Bracketed regions represent nucleotide overhangs, for example comprising about 1, 2, 3, or 4 nucleotides in length, preferably about 2 nucleotides.
  • Constracts 1 and 2 can be used independently for RNAi activity.
  • Constmct 2 can comprise a polynucleotide or non- nucleotide linker, which can optionally be designed as a biodegradable linker.
  • the loop structure shown in construct 2 can comprise a biodegradable linker that results in the formation of construct 1 in vivo and/or in vitro.
  • constract 3 can be used to generate constract 2 under the same principle wherein a linker is used to generate the active siNA constract 2 in vivo and/or in vitro, which can optionally utilize another biodegradable linker to generate the active siNA constract 1 in vivo and/or in vitro.
  • the stability and/or activity of the siNA constracts can be modulated based on the design of the siNA construct for use in vivo or in vitro and/or in vitro.
  • Figure 7A-C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate siNA hai ⁇ in consfructs.
  • Figure 7A A DNA oligomer is synthesized with a 5 '-restriction site (RI) sequence followed by a region having sequence identical (sense region of siNA) to a predetermined BCR-ABL target sequence, wherein the sense region comprises, for example, about 19, 20,
  • nucleotides (N) in length which is followed by a loop sequence of defined sequence (X), comprising, for example, about 3 to about 10 nucleotides.
  • Figure 7B The synthetic constract is then extended by DNA polymerase to generate a hai ⁇ in stracture having self-complementary sequence that will result in a siNA transcript having specificity for a BCR-ABL target sequence and having self-complementary sense and antisense regions.
  • Figure 7C The construct is heated (for example to about 95 °C) to linearize the sequence, thus allowing extension of a complementary second DNA strand using a primer to the 3 '-restriction sequence of the first sfrand.
  • the double-sfranded DNA is then inserted into an appropriate vector for expression in cells.
  • the construct can be designed such that a 3'- terminal nucleotide overhang results from the transcription, for example by engineering restriction sites and or utilizing a poly-U termination region as described in Paul et al, 2002, Nature Biotechnology, 29, 505-508.
  • Figure 8A-C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate double-sfranded siNA constructs.
  • Figure 8A A DNA oligomer is synthesized with a 5 '-restriction (RI) site sequence followed by a region having sequence identical (sense region of siNA) to a predetermined
  • BCR-ABL target sequence wherein the sense region comprises, for example, about 19, 20,
  • N nucleotides (N) in length, and which is followed by a 3 '-restriction site (R2) which is adjacent to a loop sequence of defined sequence (X).
  • Figure 8B The synthetic construct is then extended by DNA polymerase to generate a hai ⁇ in stracture having self-complementary sequence.
  • FIG 8C The constmct is processed by restriction enzymes specific to RI and R2 to generate a double-sfranded DNA which is then inserted into an appropriate vector for expression in cells.
  • the transcription cassette is designed such that a U6 promoter region flanks each side of the dsDNA which generates the separate sense and antisense strands of the siNA.
  • Poly T termination sequences can be added to the constracts to generate U overhangs in the resulting transcript.
  • Figure 9A-E is a diagrammatic representation of a method used to determine target sites for siNA mediated RNAi within a particular target nucleic acid sequence, such as messenger RNA.
  • Figure 9A A pool of siNA oligonucleotides are synthesized wherein the antisense region of the siNA constracts has complementarity to target sites across the target nucleic acid sequence, and wherein the sense region comprises sequence complementary to the antisense region of the siNA.
  • Figure 9B&C ( Figure 9B) The sequences are pooled and are inserted into vectors such that ( Figure 9C) fransfection of a vector into cells results in the expression of the siNA.
  • Figure 9D Cells are sorted based on phenotypic change that is associated with modulation of the target nucleic acid sequence.
  • Figure 9E The siNA is isolated from the sorted cells and is sequenced to identify efficacious target sites within the target nucleic acid sequence.
  • Figure 10 shows non-limiting examples of different stabilization chemistries (1-10) that can be used, for example, to stabilize the 3 '-end of siNA sequences of the invention, including (1) [3 -3'] -inverted deoxyribose; (2) deoxyribonucleotide; (3) [5'-3']-3'- deoxyribonucleotide; (4) [5'-3']-ribonucleotide; (5) [5'-3']-3 '-O-methyl ribonucleotide; (6) 3'- glyceryl; (7) [3'-5']-3'-deoxyribonucleotide; (8) [3 '-3'] -deoxyribonucleotide; (9) [5'-2'j- deoxyribonucleotide; and (10) [5-3']-dideoxyribonucleotide.
  • stabilization chemistries (1-10) that can be used, for example, to stabilize the 3 '-end of
  • modified and unmodified backbone chemistries indicated in the figure can be combined with different backbone modifications as described herein, for example, backbone modifications having Formula I.
  • the 2'-deoxy nucleotide shown 5' to the terminal modifications shown can be another modified or unmodified nucleotide or non- nucleotide described herein, for example modifications having any of Formulae I-VII or any combination thereof.
  • Figure 11 shows a non-limiting example of a strategy used to identify chemically modified siNA consfructs of the invention that are nuclease resistance while preserving the ability to mediate RNAi activity.
  • Chemical modifications are introduced into the siNA constract based on educated design parameters (e.g. infroducing 2'-mofications, base modifications, backbone modifications, terminal cap modifications etc).
  • the modified constmct in tested in an appropriate system (e.g. human semm for nuclease resistance, shown, or an animal model for PK/delivery parameters).
  • the siNA constract is tested for RNAi activity, for example in a cell culture system such as a luciferase reporter assay).
  • siNA constmcts are then identified which possess a particular characteristic while maintaining RNAi activity, and can be further modified and assayed once again. This same approach can be used to identify siNA-conjugate molecules with improved pharmacokinetic profiles, delivery, and RNAi activity.
  • Figure 12 A-F shows non-limiting examples of specific chemically-modified siNA sequences of the invention.
  • A-F applies the chemical modifications described in Figure 4A- F to a ERG siNA sequence.
  • Figure 13 shows a non-limiting example of reduction of ERG2 mRNA in DLDl cells mediated by siNAs that target ERG2 mRNA.
  • DLDl cells were fransfected with 0.25 ug/well of lipid complexed with 25 nM siNA.
  • a screen of siNA constracts comprising ribonucleotides and 3 '-terminal dithymidine caps was compared to untreated cells, scrambled siNA confrol constructs (Scraml and Scram2), and cells fransfected with lipid alone (transfection control). As shown in the figure, all of the siNA constructs significantly reduce ERG2 RNA expression.
  • RNAi activity measured in vitro and/or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention.
  • the product of these activities can be increased in vitro and/or in vivo compared to an all RNA siRNA or a siNA containing a plurality of ribonucleotides.
  • the activity or stability of the siNA molecule can be decreased (i.e., less than ten-fold), but the overall activity of the siNA molecule is enhanced in vitro and/or in vivo.
  • RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al, 1998, Nature, 391, 806).
  • siRNAs short interfering RNAs
  • the co ⁇ esponding process in plants is commonly refe ⁇ ed to as post- transcriptional gene silencing or RNA silencing and is also refe ⁇ ed to as quelling in fungi.
  • the process of post-transcriptional gene silencing is thought to be an evolutionarily- conserved cellular defense mechanism used to prevent the expression of foreign genes which is commonly shared by diverse flora and phyla (Fire et al, 1999, Trends Genet, 15, 358).
  • Such protection from foreign gene expression may have evolved in response to the production of double-sfranded RNAs (dsRNAs) derived from viral infection or the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
  • dsRNAs double-sfranded RNAs
  • the presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2', 5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
  • Dicer The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme refe ⁇ ed to as Dicer.
  • Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al, 2001, Nature, 409, 363).
  • Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes.
  • Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved stracture that are implicated in translational confrol (Hutvagner et al, 2001, Science, 293, 834).
  • the RNAi response also features an endonuclease complex containing a siRNA, commonly refe ⁇ ed to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA.
  • RISC RNA-induced silencing complex
  • RNA interference can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin stracture and thereby prevent franscription of target gene sequences (see for example AUshire, 2002, Science, 297, 1818-1819; Volpe et al, 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al, 2002, Science, 297, 2232-2237).
  • siNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional level or post-transcriptional level.
  • RNAi has been studied in a variety of systems. Fire et al, 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol, 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al, 2000, Nature, 404, 293, describe RNAi in Drosophila cells fransfected with dsRNA. Elbashir et al, 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21- nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • small nucleic acid motifs (“small” refers to nucleic acid motifs no more than 100 nucleotides in length, preferably no more than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length; e.g., individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) are preferably used for exogenous delivery.
  • the simple structure of these molecules increases the ability of the nucleic acid to invade targeted regions of protein and/or RNA structure.
  • Exemplary molecules of the instant invention are chemically synthesized, and others can similarly be synthesized.
  • Oligonucleotides are synthesized using protocols known in the art, for example as described in Camthers et al, 1992, Methods in Enzymology 211, 3-19, Thompson et al, International PCT Publication No. WO 99/54459, Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al, 1997, Methods Mol. Bio., 74, 59, Brennan et al, 1998, Biotechnol Bioeng, 61, 33-45, and Brennan, U.S. Pat. No. 6,001,311.
  • oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
  • small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 ⁇ mol scale protocol with a 2.5 min coupling step for 2'-O-methylated nucleotides and a 45 sec coupling step for 2'-deoxy nucleotides or 2'-deoxy-2'-fluoro nucleotides.
  • Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle.
  • syntheses at the 0.2 ⁇ mol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, CA) with minimal modification to the cycle.
  • synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10%) acetic anhydride/10% 2,6-lutidine in THF (ABI); and oxidation solution is 16.9 mM I 2 , 49 mM pyridine, 9% water in THF (PERSEPTIVETM). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltefrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc.
  • Beaucage reagent (3H- l,2-Benzodithiol-3-one 1,1 -dioxide, 0.05 M in acetonitrile) is used.
  • Deprotection of the D ⁇ A-based oligonucleotides is performed as follows: the polymer- bound trityl-on oligoribonucleotide is transfe ⁇ ed to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65 °C for 10 min. After cooling to -20 °C, the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeC ⁇ :H2O/3:l:l, vortexed and the supernatant is then added to the first supernatant. The combined supematants, containing the oligoribonucleotide, are dried to a white powder.
  • RNA including certain siNA molecules of the invention follows the procedure as described in Usman et al, 1987, J. Am. Chem. Soc, 109, 7845; Scaringe et al, 1990, Nucleic Acids Res., 18, 5433; and Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684 Wincott et al, 1997, Methods Mol Bio., 74, 59, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5 '-end, and phosphoramidites at the 3'-end.
  • small scale syntheses are conducted on a 394 Applied Biosystems, Inc.
  • synthesizer using a 0.2 ⁇ mol scale protocol with a 7.5 min coupling step for alkylsilyl protected nucleotides and a 2.5 min coupling step for 2'-O-methylated nucleotides.
  • Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle.
  • syntheses at the 0.2 ⁇ mol scale can be done on a 96-well plate synthesizer, such as the instrament produced by Protogene (Palo Alto, CA) with minimal modification to the cycle.
  • Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%.
  • synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6- lutidine in THF (ABI); oxidation solution is 16.9 mM I2, 49 mM pyridine, 9% water in THF (PERSEPTIVETM). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltefrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-l,2-Benzodithiol-3-one l,l-dioxide0.05 M in acetonitrile) is used.
  • Deprotection of the R ⁇ A is performed using either a two-pot or one-pot protocol.
  • the polymer-bound trityl-on oligoribonucleotide is fransfe ⁇ ed to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65 °C for 10 min. After cooling to -20 °C, the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeC ⁇ :H2O/3:l:l, vortexed and the supernatant is then added to the first supernatant.
  • the combined supematants, containing the oligoribonucleotide, are dried to a white powder.
  • the base deprotected oligoribonucleotide is resuspended in anhydrous TEA/HF/NMP solution (300 ⁇ L of a solution of 1.5 mL N- methylpy ⁇ olidinone, 750 ⁇ L TEA and 1 mL TEA ⁇ HF to provide a 1.4 M HF concenfration) and heated to 65 °C. After 1.5 h, the oligomer is quenched with 1.5 M NH4HCO3.
  • the polymer-bound trityl-on oligoribonucleotide is transfe ⁇ ed to a 4 mL glass screw top vial and suspended in a solution of 33% ethanolic methylamine/DMSO: 1/1 (0.8 mL) at 65 °C for 15 min.
  • the vial is brought to rt.
  • TEA-3HF 0.1 mL is added and the vial is heated at 65 °C for 15 min.
  • the sample is cooled at -20 °C and then quenched with 1.5 M NH4HCO3.
  • the quenched NH4HCO3 solution is loaded onto a C-l 8 containing cartridge that had been prewashed with acetonitrile followed by 50 mM TEAA. After washing the loaded cartridge with water, the RNA is detritylated with 0.5% TFA for 13 min. The cartridge is then washed again with water, salt exchanged with 1 M NaCI and washed with water again. The oligonucleotide is then eluted with 30% acetonitrile.
  • the average stepwise coupling yields are typically >98% (Wincott et al, 1995 Nucleic Acids Res. 23, 2677-2684).
  • the scale of synthesis can be adapted to be larger or smaller than the example described above including but not limited to 96-well format.
  • nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al, 1992, Science 256, 9923; Draper et al, hitemational PCT publication No. WO 93/23569; Shabarova et al, 1991, Nucleic Acids Research 19, 4247; Bellon et al, 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al, 1997, Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
  • siNA molecules of the invention can also be synthesized via a tandem synthesis methodology as described in Example 1 herein, wherein both siNA sfrands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate siNA fragments or sfrands that hybridize and permit purification of the siNA duplex.
  • the linker can be a polynucleotide linker or a non- nucleotide linker.
  • the tandem synthesis of siNA as described herein can be readily adapted to both multiwell/multiplate synthesis platforms such as 96 well or similarly larger multi-well platforms.
  • the tandem synthesis of siNA as described herein can also be readily adapted to large scale synthesis platforms employing batch reactors, synthesis columns and the like.
  • a siNA molecule can also be assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the RNA molecule.
  • nucleic acid molecules of the present invention can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, -C- allyl, 2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al, 1994, Nucleic Acids Symp. Ser. 31, 163).
  • siNA constracts can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al, supra, the totality of which is hereby inco ⁇ orated herein by reference) and re-suspended in water.
  • siNA molecules of the invention are expressed from transcription units inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constracted based on, but not limited to, adeno-associated vims, retrovims, adenovims, or alphavims.
  • the recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells.
  • viral vectors can be used that provide for transient expression of siNA molecules.
  • nucleic acid molecules with modifications can prevent their degradation by semm ribonucleases, which can increase their potency (see e.g., Eckstein et al, International Publication No. WO 92/07065; Pe ⁇ ault et al, 1990 Nature 344, 565; Pieken et al, 1991, Science 253, 314; Usman and Cedergren, 1992, Trends in Biochem. Sci. 17, 334; Usman et al, International Publication No. WO 93/15187; and Rossi et al, International Publication No. WO 91/03162; Sproat, U.S. Pat. No.
  • oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-0-methyl, 2'-O- allyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992, TIBS. 17, 34; Usman et al, 1994, Nucleic Acids Symp. Ser.
  • Short interfering nucleic acid (siNA) molecules having chemical modifications that maintain or enhance activity are (provided. Such a nucleic acid is also generally more resistant to nucleases than an unmodified nucleic acid. Accordingly, the in vitro and/or in vivo activity should not be significantly lowered. In cases in which modulation is the goal, therapeutic nucleic acid molecules delivered exogenously should optimally be stable within cells until translation of the target RNA has been modulated long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the disease state. Improvements in the chemical synthesis of RNA and DNA (Wincott et al, 1995, Nucleic Acids Res.
  • nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides.
  • a G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc, 120, 8531-8532.
  • a single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides.
  • nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA "locked nucleic acid" nucleotides such as a 2', 4'-C methylene bicyclo nucleotide (see for example Wengel et al, International PCT Publication No. WO 00/66604 and WO 99/14226).
  • the invention features conjugates and or complexes of siNA molecules of the invention.
  • conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell.
  • the conjugates and complexes provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention.
  • the present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes.
  • molecules including, but not limited to, small molecules, lipids, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes.
  • the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers.
  • Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
  • biodegradable linker refers to a nucleic acid or non-nucleic acid linker molecule that is designed as a biodegradable linker to connect one molecule to another molecule, for example, a biologically active molecule to a siNA molecule of the invention or the sense and antisense strands of a siNA molecule of the invention.
  • the biodegradable linker is designed such that its stability can be modulated for a particular pu ⁇ ose, such as delivery to a particular tissue or cell type.
  • the stability of a nucleic acid- based biodegradable linker molecule can be modulated by using various chemistries, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically-modified nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino, 2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified nucleotides.
  • the biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid molecule, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus-based linkage, for example, a phosphoramidate or phosphodiester linkage.
  • the biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
  • biodegradable refers to degradation in a biological system, for example enzymatic degradation or chemical degradation.
  • biologically active molecule refers to compounds or molecules that are capable of eliciting or modifying a biological response in a system.
  • Non- limiting examples of biologically active siNA molecules either alone or in combination with other molecules contemplated by the instant invention include therapeutically active molecules such as antibodies, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, 2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and analogs thereof.
  • Biologically active molecules of the invention also include molecules capable of modulating the pharmacokinetics and/or pharmacodynamics of other biologically active molecules, for example, lipids and polymers such as polyamines, polyamides, polyethylene glycol and other polyethers.
  • phospholipid refers to a hydrophobic molecule comprising at least one phosphorus group.
  • a phospholipid can comprise a phosphorus- containing group and saturated or unsaturated alkyl group, optionally substituted with OH, COOH, oxo, amine, or substituted or unsubstituted aryl groups.
  • nucleic acid molecules e.g., siNA molecules
  • delivered exogenously optimally are stable within cells until reverse franscription of the RNA has been modulated long enough to reduce the levels of the RNA transcript.
  • the nucleic acid molecules are resistant to nucleases in order to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of nucleic acid molecules described in the instant invention and in the art have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability as described above.
  • siNA molecules having chemical modifications that maintain or enhance enzymatic activity of proteins involved in RNAi are provided.
  • Such nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus, in vitro and/or in vivo the activity should not be significantly lowered.
  • nucleic acid-based molecules of the invention will lead to better freatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes; nucleic acid molecules coupled with known small molecule modulators; or intermittent freatment with combinations of molecules, including different motifs and/or other chemical or biological molecules).
  • the freatment of subjects with siNA molecules can also include combinations of different types of nucleic acid molecules, such as enzymatic nucleic acid molecules (ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys, and aptamers.
  • a siNA molecule of the invention comprises one or more 5' and/or a 3'- cap stracture, for example on only the sense siNA sfrand, the antisense siNA strand, or both siNA strands.
  • cap structure is meant chemical modifications, which have been inco ⁇ orated at either terminus of the oligonucleotide (see, for example, Adamic et al, U.S. Pat. No. 5,998,203, inco ⁇ orated by reference herein). These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and may help in delivery and/or localization within a cell.
  • the cap may be present at the 5'-terminus (5'-cap) or at the 3'- terminal (3 '-cap) or may be present on both termini.
  • the 5 '-cap is selected from the group consisting of glyceryl, inverted deoxy abasic residue (moiety); 4',5'- methylene nucleotide; l-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; tAreo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety; 3 '-3 '-inverted nucleotide mo
  • the 3 '-cap is selected from the group consisting of glyceryl, inverted deoxy abasic residue (moiety), 4', 5 '-methylene nucleotide; l-(beta-D- erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; l,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; t/zre ⁇ -pentofuranosyl nucleotide; acycl
  • non-nucleotide any group or compound which can be inco ⁇ orated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity.
  • the group or compound is abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a base at the 1 '-position.
  • alkyl refers to a saturated aliphatic hydrocarbon, including sfraight-chain, branched-chain, and cyclic alkyl groups.
  • the alkyl group has 1 to 12 carbons. More preferably, it is a lower alkyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • alkenyl groups that are unsaturated hydrocarbon groups containing at least one carbon-carbon double bond, including sfraight-chain, branched-chain, and cyclic groups.
  • the alkenyl group has 1 to 12 carbons. More preferably, it is a lower alkenyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • alkyl also includes alkynyl groups that have an unsaturated hydrocarbon group containing at least one carbon-carbon triple bond, including straight-chain, branched-chain, and cyclic groups.
  • the alkynyl group has 1 to 12 carbons. More preferably, it is a lower alkynyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • alkyl groups can also include aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester groups.
  • An "aryl” group refers to an aromatic group that has at least one ring having a conjugated pi electron system and includes carbocyclic aryl, heterocyclic aryl and biaryl groups, all of which may be optionally substituted.
  • the prefe ⁇ ed substituent(s) of aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino groups.
  • alkylaryl refers to an alkyl group (as described above) covalently joined to an aryl group (as described above).
  • Carbocyclic aryl groups are groups wherein the ring atoms on the aromatic ring are all carbon atoms. The carbon atoms are optionally substituted.
  • Heterocyclic aryl groups are groups having from 1 to 3 heteroatoms as ring atoms in the aromatic ring and the remainder of the ring atoms are carbon atoms.
  • Suitable heteroatoms include oxygen, sulfur, and nifrogen, and include furanyl, thienyl, pyridyl, py ⁇ olyl, N-lower alkyl py ⁇ olo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted.
  • An "amide” refers to an -C(O)-NH-R, where R is either alkyl, aryl, alkylaryl or hydrogen.
  • An “ester” refers to an -C(O)-OR', where R is either alkyl, aryl, alkylaryl or hydrogen.
  • nucleotide as used herein is as recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1' position of a nucleotide sugar moiety. Nucleotides generally comprise a base, sugar and a phosphate group. The nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety, (also refe ⁇ ed to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other; see, for example, Usman and McSwiggen, supra; Eckstein et al, International PCT Publication No.
  • base modifications that can be infroduced into nucleic acid molecules include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3 -methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
  • modified bases in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1' position or their equivalents.
  • the invention features modified siNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, mo ⁇ holino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.
  • phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, mo ⁇ holino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.
  • abasic sugar moieties lacking a base or having other chemical groups in place of a base at the 1' position, see for example Adamic et al, U.S. Pat. No. 5,998,203.
  • unmodified nucleoside is meant one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1' carbon of ⁇ -D-ribo-furanose.
  • modified nucleoside is meant any nucleotide base which contains a modification in the chemical stmcture of an unmodified nucleotide base, sugar and/or phosphate.
  • modified nucleotides are shown by Formulae I-VII and/or other modifications described herein.
  • amino is meant 2'-NH 2 or 2'-0- NH , which can be modified or unmodified. Such modified groups are described, for example, in Eckstein et al, U.S. Pat. No. 5,672,695 and
  • nucleic acid siNA stmcture can be made to enhance the utility of these molecules. Such modifications will enhance shelf-life, half-life in vitro, stability, and ease of introduction of such oligonucleotides to the target site, e.g., to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
  • a siRNA molecule of the invention can be adapted for use to freat for example cancer and other indications that can respond to the level of BCR-ABL and/or ERG in a cell or tissue, alone or in combination with other therapies.
  • a siNA molecule can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations.
  • Methods for the delivery of nucleic acid molecules are described in Akhtar et al, 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al, 1999, Mol. Membr.
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by inco ⁇ oration into other vehicles, such as hydrogels, cyclodextrins (see for example Gonzalez et al, 1999, Bioconjugate Chem., 10, 1068-1074), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722).
  • the nucleic acid/vehicle combination is locally delivered by direct injection or by use of an infusion pump.
  • nucleic acid molecules of the invention can take place using standard needle and syringe methodologies, or by needle-free technologies such as those described in Conry et al, 1999, Clin. Cancer Res., 5, 2330-2337 and Ba ⁇ y et al, International PCT Publication No. WO 99/31262.
  • the molecules of the instant invention can be used as pharmaceutical agents. Pharmaceutical agents prevent, modulate the occunence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a subject.
  • the invention features a pharmaceutical composition
  • a pharmaceutical composition comprising one or more nucleic acid(s) of the invention in an acceptable carrier, such as a stabilizer, buffer, and the like.
  • the polynucleotides of the invention can be administered (e.g., RNA, DNA or protein) and infroduced into a subject by any standard means, with or without stabilizers, buffers, and the like, to form a pha ⁇ naceutical composition.
  • standard protocols for formation of liposomes can be followed.
  • the compositions of the present invention can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for injectable administration, and the other compositions known in the art.
  • the present invention also includes pharmaceutically acceptable formulations of the compounds described.
  • formulations include salts of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
  • a pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, fransdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged nucleic acid is desirable for delivery). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
  • systemic administration in vivo systemic abso ⁇ tion or accumulation of drugs in the blood stream followed by distribution throughout the entire body.
  • Administration routes that lead to systemic abso ⁇ tion mclude, without limitation: intravenous, subcutaneous, infraperitoneal, inhalation, oral, infrapulmonary and intramuscular.
  • Each of these administration routes exposes the siNA molecules of the invention to an accessible diseased tissue.
  • the rate of entry of a drag into the circulation has been shown to be a function of molecular weight or size.
  • the use of a liposome or other drag carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES).
  • RES reticular endothelial system
  • a liposome formulation that can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach can provide enhanced delivery of the drag to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as cells producing excess BCR-ABL and/or ERG.
  • pharmaceutically acceptable formulation is meant, a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity.
  • agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as Pluronic P85), which can enhance entry of drags into the CNS (JoUiet-Riant and Tillement, 1999, Fundam. Clin. Pharmacol, 13, 16-26); biodegradable polymers, such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich, DF et al, 1999, Cell Transplant, 8, 47-58) (Alkermes, Inc.
  • P-glycoprotein inhibitors such as Pluronic P85
  • biodegradable polymers such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich, DF et al, 1999, Cell Transplant, 8, 47-58) (Alkermes, Inc.
  • nanoparticles such as those made of polybutylcyanoacrylate, which can deliver drags across the blood brain barrier and can alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).
  • Other non-limiting examples of delivery sfrategies for the nucleic acid molecules of the instant invention include material described in Boado et al, 1998, J. Pharm. Sci, 87, 1308-1315; Tyler et al, 1999, FEBS Lett, 421, 280-284; Pardridge et al, 1995, PNAS USA., 92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107; Aldrian-Henada et al, 1998, Nucleic Acids Res., 26, 4910-4916; and Tyler et al, 1999, PNAS USA., 96, 7053-7058.
  • the invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes).
  • PEG-modified, or long-circulating liposomes or stealth liposomes These formulations offer a method for increasing the accumulation of drugs in target tissues.
  • This class of drag carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al, Chem. Pharm. Bull. 1995, 43, 1005-1011).
  • liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al, Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Ada, 1238, 86-90).
  • the long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al, J. Biol. Chem. 1995, 42, 24864-24870; Choi et al, International PCT Publication No.
  • WO 96/10391 Ansell et al, hitemational PCT Publication No. WO 96/10390; Holland et al, International PCT Publication No. WO 96/10392).
  • Long-circulating liposomes are also likely to protect drags from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
  • compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent.
  • Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985), hereby inco ⁇ orated by reference herein.
  • preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of />-hydroxybenzoic acid.
  • antioxidants and suspending agents can be used.
  • a pharmaceutically effective dose is that dose required to prevent, inhibit the occunence, or freat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state.
  • the pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concunent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
  • nucleic acid molecules of the invention and formulations thereof can be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles.
  • parenteral as used herein includes percutaneous, subcutaneous, mfravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like.
  • a pharmaceutical formulation comprising a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier.
  • nucleic acid molecules of the invention can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients.
  • the pharmaceutical compositions containing nucleic acid molecules of the invention can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
  • compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations.
  • Tablets contain the active ingredient in admixture with non-toxic phamiaceutically acceptable excipients that are suitable for the manufacture of tablets.
  • excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, com starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
  • the tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and abso ⁇ tion in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
  • Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water or an oil medium for example peanut oil, liquid paraffin or olive oil.
  • Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpy ⁇ olidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monoole
  • the aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p- hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • preservatives for example ethyl, or n-propyl p- hydroxybenzoate
  • coloring agents for example ethyl, or n-propyl p- hydroxybenzoate
  • flavoring agents for example ethyl, or n-propyl p- hydroxybenzoate
  • sweetening agents such as sucrose or saccharin.
  • Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol.
  • Sweetening agents and flavoring agents can be added to provide palatable oral preparations.
  • These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • a dispersing or wetting agent e.g., glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerin, glycerin, glycerin, glycerin, glycerin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol
  • compositions of the invention can also be in the form of oil-in-water emulsions.
  • the oily phase can be a vegetable oil or a mineral oil or mixtures of these.
  • Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions can also contain sweetening and flavoring agents.
  • Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents.
  • the pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above.
  • the sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol.
  • Suitable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono-or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • the nucleic acid molecules of the invention can also be administered in the form of suppositories, e.g., for rectal administration of the drag.
  • suppositories e.g., for rectal administration of the drag.
  • These compositions can be prepared by mixing the drag with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • Such materials include cocoa butter and polyethylene glycols.
  • Nucleic acid molecules of the invention can be administered parenterally in a sterile medium.
  • the drug depending on the vehicle and concenfration used, can either be suspended or dissolved in the vehicle.
  • adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
  • Dosage levels of the order of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the freatment of the above-indicated conditions (about 0.5 mg to about 7 g per subject per day).
  • the amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host freated and the particular mode of administration.
  • Dosage unit forms generally contain between from about 1 mg to about 500 mg of an active ingredient.
  • the specific dose level for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of adminisfration, route of administration, and rate of excretion, drag combination and the severity of the particular disease undergoing therapy.
  • the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
  • nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect.
  • the use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
  • the invention comprises compositions suitable for administering nucleic acid molecules of the invention to specific cell types.
  • ASGPr asialoglycoprotein receptor
  • ASOR asialoorosomucoid
  • the folate receptor is overexpressed in many cancer cells.
  • Binding of such glycoproteins, synthetic glycoconjugates, or folates to the receptor takes place with an affinity that strongly depends on the degree of branching of the oligosaccharide chain, for example, triatennary structures are bound with greater affinity than biatenany or monoatennary chains (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al, 1982, J. Biol. Chem., 257, 939-945).
  • Lee and Lee, 1987, Glycoconjugate J, 4, 317-328 obtained this high specificity through the use of N-acetyl-D-galactosamine as the carbohydrate moiety, which has higher affinity for the receptor, compared to galactose.
  • siNA molecules of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weinfraub, 1985, Science, 229, 345; McGany and Lindquist, 1986, Proc. Natl. Acad. Sci, USA 83, 399; Scanlon et al, 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al, 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al, 1992, J. Virol, 66, 1432-41; Weerasinghe et al, 1991, J.
  • eukaryotic promoters e.g., Izant and Weinfraub, 1985, Science, 229, 345; McGany and Lindquist, 1986, Proc. Natl. Acad. Sci, USA 83, 399; Scanlon et al, 1991, Proc. Natl. Aca
  • nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al, PCT WO 93/23569, and Sullivan et al, PCT WO 94/02595; Ohkawa et al, 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira et al, 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al, 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al, 1994, J. Biol. Chem., 269, 25856.
  • RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al, 1996, TIG., 12, 510) inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constructed based on, but not limited to, adeno- associated viras, retrovirus, adenovirus, or alphavirus.
  • pol III based constracts are used to express nucleic acid molecules of the invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and 6,146,886).
  • the recombinant vectors capable of expressing the siNA molecules can be delivered as described above, and persist in target cells.
  • viral vectors can be used that provide for transient expression of nucleic acid molecules.
  • Such vectors can be repeatedly administered as necessary.
  • the siNA molecule interacts with the target mRNA and generates an RNAi response.
  • Delivery of siNA molecule expressing vectors can be systemic, such as by intravenous or infra-muscular adminisfration, by administration to target cells ex-planted from a subject followed by reinfroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al, 1996, TIG., 12, 510).
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the instant invention.
  • the expression vector can encode one or both sfrands of a siNA duplex, or a single self-complementary strand that self hybridizes into a siNA duplex.
  • the nucleic acid sequences encoding the siNA molecules of the instant invention can be operably linked in a manner that allows expression of the siNA molecule (see for example Paul et al, 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al, 2002, Nature Biotechnology', 19, 500; and Novina et al, 2002, Nature Medicine, advance online publication doi: 10.1038/nm725).
  • the invention features an expression vector comprising: a) a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a franscription termination region (e.g., eukaryotic pol I, II or III termination region); and c) a nucleic acid sequence encoding at least one of the siNA molecules of the instant invention; wherein said sequence is operably linked to said initiation region and said termination region, in a manner that allows expression and/or delivery of the siNA molecule.
  • the vector can optionally include an open reading frame (ORF) for a protein operably linked on the 5' side or the 3 '-side of the sequence encoding the siNA of the invention; and/or an infron (intervening sequences).
  • ORF open reading frame
  • RNA polymerase I RNA polymerase I
  • RNA polymerase II RNA polymerase II
  • RNA polymerase III RNA polymerase III
  • Transcripts from pol II or pol III promoters are expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby.
  • Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad.
  • nucleic acid molecules expressed from such promoters can function in mammalian cells (e.g. Kashani-Sabet et al, 1992, Antisense Res. Dev., 2, 3- 15; Ojwang et al, 1992, Proc. Natl. Acad. Sci.
  • franscription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA (tRNA) and adenovims VA RNA are useful in generating high concentrations of desired RNA molecules such as siNA in cells (Thompson et al, supra; Couture and Stinchcomb, 1996, supra; Noonberg et al, 1994, Nucleic Acid Res., 22, 2830; Noonberg et al, U.S. Pat. No. 5,624,803; Good et al, 1997, Gene Tlier., 4, 45; Beigelman et al, International PCT Publication No. WO 96/18736.
  • siNA franscription units can be inco ⁇ orated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated vims vectors), or viral RNA vectors (such as retroviral or alphavims vectors) (for a review see Couture and Stinchcomb, 1996, supra).
  • plasmid DNA vectors such as adenovirus or adeno-associated vims vectors
  • viral RNA vectors such as retroviral or alphavims vectors
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one of the siNA molecules of the invention in a manner that allows expression of that siNA molecule.
  • the expression vector comprises in one embodiment; a) a transcription initiation region; b) a transcription termination region; and c) a nucleic acid sequence encoding at least one sfrand of the siNA molecule, wherein the sequence is operably linked to the initiation region and the termination region in a manner that allows expression and/or delivery of the siNA molecule.
  • the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an open reading frame; and d) a nucleic acid sequence encoding at least one sfrand of a siNA molecule, wherein the sequence is operably linked to the 3 '-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the open reading frame and the termination region in a manner that allows expression and/or delivery of the siNA molecule.
  • the expression vector comprises: a) a franscription initiation region; b) a transcription termination region; c) an intron; and d) a nucleic acid sequence encoding at least one siNA molecule, wherein the sequence is operably linked to the initiation region, the intron and the termination region in a manner which allows expression and/or delivery of the nucleic acid molecule.
  • the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an intron; d) an open reading frame; and e) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3'-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the infron, the open reading frame and the termination region in a manner which allows expression and/or delivery of the siNA molecule.
  • Transformation is a cumulative process whereby normal confrol of cell growth and differentiation is interrupted, usually through the accumulation of mutations affecting the expression of genes that regulate cell growth and differentiation. More than 70% of hematopoietic malignancies have been shown to possess recunent chromosomal translocations.
  • the underlying mechanism of chromosomal translocation can be classified as either gene fusion or transcriptional deregulation.
  • the gene fusion mechanism involves two genes that are joined into one, resulting in a chimeric RNA transcript which makes a chimeric protein product. Since the chimeric protein is not found in any normal tissue, it can serve as a tumor specific marker in identifying disease. A related change in protein function can confer a growth advantage leading to malignant transformation.
  • Non-limiting examples of gene fusion products include BCR-ABL, PML-RAR-alpha, and MLL/LTG4, 9, 19.
  • the transcriptional deregulation mechanism does not involve the generation of chimeric protein, but rather juxtaposes one gene to a target gene, thereby transcriptionally deregulating the target gene.
  • This type of translocation is frequently found in lymphomas, such as the Myc translocation in Burkitt's lymphoma; the BCL2 translocation in follicular lymphoma; and BCL1 in mantle cell lymphoma.
  • Chronic myelogenous leukemia also called chronic myeloid leukemia or CML
  • CML chronic myeloid leukemia
  • CML is an unstable disease that ultimately progresses to a terminal stage which resembles acute leukemia. This lethal disease affects approximately 16,000 patients a year.
  • Chemotherapeutic agents such as hydroxyurea or busulfan, can reduce the leukemic burden but do not impact the life expectancy of the patient (which is approximately 4 years). Consequently, CML patients are candidates for bone manow transplantation (BMT) therapy.
  • BMT bone manow transplantation
  • the Philadelphia (Ph) chromosome which results from the translocation of the abl oncogene from chromosome 9 to the BCR gene on chromosome 22 is found in greater than
  • the leukemic cells express BCR-ABL fusion mRNAs in which exon 2 (b2-a2 junction) or exon 3
  • BCR-ABL b3-a2 junction
  • Ph-positive ALL the first exon of the BCR gene is spliced to exon 2 of the ABL gene.
  • the b3-a2 and b2-a2 fusion mRNAs encode 210 kd BCR-ABL fusion proteins which exhibit oncogenic activity through increased tyrosine kinase activity.
  • the BCR-ABL tyrosine kinase elicits oncogenic transformation through the constitutive stimulation of specific signal transduction pathways.
  • CML chronic myeloproliferative disorders
  • CMPDs chronic myeloproliferative disorders
  • the chimeric product type of translocation in acute promyelocytic leukemia which has t(15;17)(q22; q21), involves the promyelocytic leukemia (PML) gene.
  • PML promyelocytic leukemia
  • the translocation to the Retinoid receptor A interapts its regulatory region, resulting in deregulation of gene function, most likely through the differentiation block at a stage where this function is required.
  • small interfering nucleic acid molecules targeting chromosomal translocation genes therefore provides a useful class of novel therapeutic agents that can be used in the treatment of leukemias, lymphomas and/or any other disease or condition that can result from chomosomal translocation events.
  • ERG is a member of the Ets oncogene superfamily of transcription factors which share common DNA binding domains yet differ in their fransactivation domains.
  • the Ets family of franscription factors are implicated in the control of the constitutive expression of a wide variety of genes. In hematopoietic cells, the Ets family appears to be important in the early stages of lymphocyte cell-type specification.
  • ERG has been identified during anayed cDNA library screens for genes encoding transcription factors expressed specifically during T cell lineage commitment. ERG expression is induced during T-cell lineage specification and is subsequently silenced permanently (Anderson et al, 1999, Development, 126(14), 3131- 3148).
  • ERG is reananged in human myeloid leukemia with t(16;21) chromosomal translocation. This rea ⁇ angement generates the TLS-ERG oncogene which is associated with poor prognosis human acute myeloid leukemia (AML), secondary AML associated with myelodysplastic syndrom (MDS), and chronic myeloid leukemia (CML) in blast crisis (Kong et al., 1991, Blood, 90, 1192-1199).
  • AML human acute myeloid leukemia
  • MDS myelodysplastic syndrom
  • CML chronic myeloid leukemia
  • TLS-ERG The altered transcriptional activating and DNA-binding activities of the TLS-ERG gene product are implicated in the genesis or progression of t(16;21))-associated human myeloid leukemias (Prasad et al, 1994, Oncogene, 9, 3717- 3729).
  • retroviral transduction of TLS-ERG has been shown to initiate a leukemogenic program in normal human hematopoietic cells (Pereira et al, 1998, PNAS USA, 95, 8239-8244).
  • Ets family of franscription factors co ⁇ elates with the occunence of invasive processes such as angiogenesis, including endothelial cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, during normal and pathological development (for review see Mattot et al, 1999, J. Soc. Biol, 193(2), 147-153 and Soncin et al, 1999, Pathol Biol, 47(4), 358-363).
  • Ets family franscription factors, including ERG have been implicated in the upregulation of human heme oxygenase gene expression.
  • the Ets, Fos, and Jun fransciption factors confrol the expression of stromelysin-1 and collagenase-1 genes that encode two matrix metalloproteinases implicated in normal growth and development, as well as in tumor invasion and metastasis. It has been shown that the Ets transcription factors interact with each other and with the c-Fos/c-Jun complex via distinct protein domains in both a DNA-dependent and independent manner (Basuyaux et al, 1997, J. Biol. Chem., 272(42), 26188-95).
  • ERG activates collagenase-1 gene by physically interacting with c-Fos/c-Jun (Buttice et al, 1996, Oncogene, 13(11), 2297-2306). Altered expression of ERG is associated with genetic translocations on chromosome 21 in immortal and cervical carcinoma cell lines (Simpson et al, 1997, Oncogene, 14(18), 2149- 2157).
  • An additional translocation fusion product of ERG, EWS-ERG has been identified in a large proportion of Ewing family tumors as a transcriptional activator (Sorensen et al, 1994, Nat. Genet, 6(2), 146-151).
  • EWS-ERG fusion protein has been shown to be essential for maintaining the oncogenic and tumorigenic properties of certain human tumor cells via inhibition of apoptosis (Yi et al, 1997, Oncogene, 14(11), 1259- 1268). Hart et al, 1995, Oncogene, 10(7), 1423-30, describe human ERG as a proto- oncogene with mitogenic and transforming activity.
  • the endothelium which lines the blood vessels and acts as a barrier between blood and tissues, plays an important role in maintaining vascular homeostasis.
  • the endothelium regulates processes such as leukocyte infiltration, coagulation, and maintains the integrity of cell-cell junctions.
  • Proliferation of endothelial cells which occurs in angiogenesis, is a tightly controlled process that can occur in a physiological state (e.g. in wound healing and the menstrual cycle) but also occurs in a disease. Endothelial activation is involved in diseases such as cancer and metastasis, rheumatoid arthritis, cataract formation, atherosclerosis, thrombosis and many others.
  • Inflammatory mediators such as the pleiofropic cytokine TNF-alpha alter the resting phenotype of the endothelium such that it becomes pro- inflammatory, pro-thrombotic and often pro-angiogenic.
  • ICAM-1 inflammatory cell adhesion molecules
  • E-selectin and VCAM-1 pro-thrombotic proteins
  • pro-thrombotic proteins such as tissue factor, both in vifro and in vivo
  • TNF-alpha is pro-angiogenic in rabbit comeal and chick chorioallantoic membrane in vivo models (Frater-Schroder et al, 1987, PNAS USA, 84, 5277; Leibovich et al, 1987, Nature, 329, 630) and more recently in rheumatoid arthritis patients, anti-TNF-alpha therapy decreased circulating levels of vascular endothelial growth factor (VEGF) (Paleolog, 1997, Molecular Pathology, 50, 225).
  • VEGF vascular endothelial growth factor
  • TNF-alpha can induce basic fibroblast growth factor (bFGF), platelet activated factor (PAF) and urokinase- type plasminogen activator (u-TPA), all of which are angiogenic and increase transcription of the VEGF receptor (VEGFR-2).
  • bFGF basic fibroblast growth factor
  • PAF platelet activated factor
  • u-TPA urokinase- type plasminogen activator
  • TNF-alpha can also inhibit endothelial cell proliferation in vifro and cause tumor regression (Carswell et al, 1975, PNAS USA, 72, 3666).
  • the mechanisms by which TNF-alpha mediates these effects on cell proliferation/angiogenesis are unclear and may involve regulation of genes which are not involved in the pro-inflammatory mode of action of this cytokine.
  • TNF-alpha down-regulates the transcription factor ERG in human umbilical vein endothelial cells (HUVEC) (McLaughlin et al, 1999, J. of Cell Science, 112, 4695).
  • ERG is a member of the Ets family of franscription factors which play roles in embryonic development, inflammation, and cellular transformation. An 85 amino acid Ets domain is conserved throughout the family and is necessary for binding a GGAA core DNA binding site.
  • ERG is a proto-oncogene as shown by the ability of NIH3T3 cells overexpressing ERG to form solid tumors in nude mice.
  • ERG cDNA can fransactivate the vWF, ICAM-2, VE-Cadherin and collagenase promoters using reporter gene assays and purified ERG/GST protein or ERG from endothelial cell nuclear extracts can bind to the VE- Cadherin, stromelysin and vWF promoter Ets sites (McLaughlin et al, supra).
  • siNA molecules of the invention are synthesized in tandem using a cleavable linker, for example, a succinyl-based linker. Tandem synthesis as described herein is followed by a one-step purification process that provides RNAi molecules in high yield. This approach is highly amenable to siNA synthesis in support of high throughput RNAi screening, and can be readily adapted to multi-column or multi-well synthesis platforms.
  • a cleavable linker for example, a succinyl-based linker.
  • 5'-terminal dimethoxytrityl 5'-O-DMT
  • the oligonucleotides are deprotected as described above.
  • the siNA sequence sfrands are allowed to spontaneously hybridize. This hybridization yields a duplex in which one strand has retained the 5'-O-DMT group while the complementary sfrand comprises a terminal 5'-hydroxyl.
  • the newly formed duplex behaves as a single molecule during routine solid-phase extraction purification (Trityl-On purification) even though only one molecule has a dimethoxytrityl group.
  • this dimethoxytrityl group (or an equivalent group, such as other trityl groups or other hydrophobic moieties) is all that is required to purify the pair of oligos, for example, by using a C18 cartridge.
  • Standard phosphoramidite synthesis chemistry is used up to the point of infroducing a tandem linker, such as an inverted deoxy abasic succinate or glyceryl succinate linker (see Figure 1) or an equivalent cleavable linker.
  • linker coupling conditions that can be used includes a hindered base such as diisopropylethylamme (DIP A) and/or DMAP in the presence of an activator reagent such as Bromotripy ⁇ olidinophosphoniumhexaflurorophosphate (PyBrOP).
  • DIP A diisopropylethylamme
  • PyBrOP Bromotripy ⁇ olidinophosphoniumhexaflurorophosphate
  • standard synthesis chemisfry is utilized to complete synthesis of the second sequence leaving the terminal the 5'-O-DMT intact.
  • the resulting oligonucleotide is deprotected according to the procedures described herein and quenched with a suitable
  • siNA duplex Purification of the siNA duplex can be readily accomplished using solid phase exfraction, for example using a Waters C18 SepPak lg cartridge conditioned with 1 column volume (CV) of acetonitrile, 2 CV H2O, and 2 CV 50mM NaOAc. The sample is loaded and then washed with 1 CV H2O or 50mM NaOAc. Failure sequences are eluted with 1 CV 14% ACN (Aqueous with 50mM NaOAc and 50mM NaCI).
  • CV column volume
  • the column is then washed, for example with 1 CV H2O followed by on-column detritylation, for example by passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) over the column, then adding a second CV of 1% aqueous TFA to the column and allowing to stand for approximately 10 minutes.
  • TFA trifluoroacetic acid
  • the remaining TFA solution is removed and the column washed with H20 followed by 1 CV IM NaCI and additional H2O.
  • the siNA duplex product is then eluted, for example, using 1 CV 20% aqueous CAN.
  • Figure 2 provides an example of MALDI-TOV mass spectrometry analysis of a purified siNA constmct in which each peak co ⁇ esponds to the calculated mass of an individual siNA sfrand of the siNA duplex.
  • the same purified siNA provides three peaks when analyzed by capillary gel elecfrophoresis (CGE), one peak presumably conesponding to the duplex siNA, and two peaks presumably conesponding to the separate siNA sequence strands.
  • Ion exchange HPLC analysis of the same siNA confract only shows a single peak.
  • Testing of the purified siNA constract using a luciferase reporter assay described below demonsfrated the same RNAi activity compared to siNA constracts generated from separately synthesized oligonucleotide sequence strands.
  • RNA target of interest such as a viral or human mRNA franscript
  • sequence of a gene or RNA gene franscript derived from a database is used to generate siNA targets having complementarity to the target.
  • sequences can be obtained from a database, or can be determined experimentally as known in the art.
  • Target sites that are known, for example, those target sites determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or antisense, or those targets known to be associated with a disease or condition such as those sites containing mutations or deletions, can be used to design siNA molecules targeting those sites.
  • Various parameters can be used to determine which sites are the most suitable target sites within the target RNA sequence. These parameters include but are not limited to secondary or tertiary RNA structure, the nucleotide base composition of the target sequence, the degree of homology between various regions of the target sequence, or the relative position of the target sequence within the RNA franscript.
  • any number of target sites within the RNA transcript can be chosen to screen siNA molecules for efficacy, for example by using in vitro RNA cleavage assays, cell culture, or animal models.
  • anywhere from 1 to 1000 target sites are chosen within the franscript based on the size of the siNA construct to be used.
  • High throughput screening assays can be developed for screening siNA molecules using methods known in the art, such as with multi-well or multi-plate assays to determine efficient reduction in target gene expression.
  • Example 3 Selection of siNA molecule target sites in a RNA
  • the following non-limiting steps can be used to cany out the selection of siNAs targeting a given gene sequence or franscript.
  • the target sequence is parsed in silico into a list of all fragments or subsequences of a particular length, for example 23 nucleotide fragments, contained within the target sequence. This step is typically ca ⁇ ied out using a custom Perl script, but commercial sequence analysis programs such as Oligo, Mac Vector, or the GCG Wisconsin Package can be employed as well.
  • the siNAs conespond to more than one target sequence such would be the case for example in targeting different transcripts of the same gene, targeting different franscripts of more than one gene, or for targeting both the human gene and an animal homolog.
  • a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find matching sequences in each list.
  • the subsequences are then ranked according to the number of target sequences that contain the given subsequence; the goal is to find subsequences that are present in most or all of the target sequences. Alternately, the ranking can identify subsequences that are unique to a target sequence, such as a mutant target sequence. Such an approach would enable the use of siNA to target specifically the mutant sequence and not effect the expression of the normal sequence.
  • the siNA subsequences are absent in one or more sequences while present in the desired target sequence; such would be the case if the siNA targets a gene with a paralogous family member that is to remain untargeted.
  • a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find sequences that are present in the target gene but are absent in the untargeted paralog.
  • the ranked siNA subsequences can be further analyzed and ranked according to GC content. A preference can be given to sites containing 30-70% GC, with a further preference to sites containing 40-60% GC.
  • the ranked siNA subsequences can be further analyzed and ranked according to self- folding and internal hai ⁇ ins. Weaker internal folds are prefened; strong hai ⁇ in structures are to be avoided.
  • the ranked siNA subsequences can be further analyzed and ranked according to whether they have runs of GGG or CCC in the sequence.
  • GGG or even more Gs in either sfrand can make oligonucleotide synthesis problematic and can potentially interfere with RNAi activity, so it is avoided whenever better sequences are available.
  • CCC is searched in the target strand because that will place GGG in the antisense strand.
  • the ranked siNA subsequences can be further analyzed and ranked according to whether they have the dinucleotide UU (uridine dinucleotide) on the 3 '-end of the sequence, and/or AA on the 5'-end of the sequence (to yield 3' UU on the antisense sequence). These sequences allow one to design siNA molecules with terminal TT thymidine dinucleotides.
  • UU uridine dinucleotide
  • target sites are chosen from the ranked list of subsequences as described above. For example, in subsequences having 23 nucleotides, the right 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the upper (sense) sfrand of the siNA duplex, while the reverse complement of the left 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the lower (antisense) strand of the siNA duplex (see Tables II and III). If terminal TT residues are desired for the sequence (as described in paragraph 7), then the two 3' terminal nucleotides of both the sense and antisense sfrands are replaced by TT prior to synthesizing the oligos.
  • siNA molecules are screened in an in vitro, cell culture or animal model system to identify the most active siNA molecule or the most prefened target site within the target RNA sequence.
  • a pool of siNA consfructs specific to a BCR-ABL and/or ERG target sequence is used to screen for target sites in cells expressing BCR-ABL and/or ERG RNA, such as human cultured chronic myelogenous leukemic cells (e.g., K562, HUVEC or HeLa cells).
  • BCR-ABL and/or ERG RNA such as human cultured chronic myelogenous leukemic cells (e.g., K562, HUVEC or HeLa cells).
  • K562, HUVEC or HeLa cells chronic myelogenous leukemic cells
  • K562, HUVEC or HeLa cells expressing BCR-ABL and/or ERG are fransfected with the pool of siNA consfructs and cells that demonstrate a phenotype associated with BCR-ABL and/or ERG inhibition are sorted.
  • the pool of siNA constructs can be expressed from transciption cassettes inserted into appropriate vectors (see for example Figure 7 and Figure 8).
  • the siNA from cells demonstrating a positive phenotypic change e.g., decreased proliferation, decreased BCR-ABL and/or ERG mRNA levels or decreased BCR-ABL and/or ERG protein expression, are sequenced to determine the most suitable target site(s) within the target BCR-ABL and/or ERG RNA sequence.
  • siNA target sites were chosen by analyzing sequences of the BCR-ABL and/or ERG
  • RNA target and optionally prioritizing the target sites on the basis of folding by using a library of siNA molecules as described in Example 3, or alternately by using an in vitro siNA system as described in Example 6 herein.
  • siNA molecules were designed that could bind each target and are optionally individually analyzed by computer folding to assess whether the siNA molecule can interact with the target sequence. Varying the length of the siNA molecules can be chosen to optimize activity. Generally, a sufficient number of complementary nucleotide bases are chosen to bind to, or otherwise interact with, the target RNA, but the degree of complementarity can be modulated to accommodate siNA duplexes or varying length or base composition.
  • siNA molecules can be designed to target sites within any known RNA sequence, for example those RNA sequences conesponding to the any gene franscript.
  • Chemically modified siNA consfructs are designed to provide nuclease stability for systemic administration in vivo and/or improved pharmacokinetic, localization, and delivery properties while preserving the ability to mediate RNAi activity. Chemical modifications as described herein are infroduced synthetically using synthetic methods described herein and those generally known in the art. The synthetic siNA constructs are then assayed for nuclease stability in serum and/or cellular/tissue extracts (e.g. liver extracts). The synthetic siNA constracts are also tested in parallel for RNAi activity using an appropriate assay, such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity.
  • an appropriate assay such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity.
  • Synthetic siNA constructs that possess both nuclease stability and RNAi activity can be further modified and re-evaluated in stability and activity assays.
  • the chemical modifications of the stabilized active siNA constracts can then be applied to any siNA sequence targeting any chosen RNA and used, for example, in target screening assays to pick lead siNA compounds for therapeutic development (see for example Figure 11).
  • siNA molecules can be designed to interact with various sites in the RNA message, for example, target sequences within the RNA sequences described herein.
  • the sequence of one strand of the siNA molecule(s) is complementary to the target site sequences described above.
  • the siNA molecules can be chemically synthesized using methods described herein.
  • Inactive siNA molecules that are used as confrol sequences can be synthesized by scrambling the sequence of the siNA molecules such that it is not complementary to the target sequence.
  • siNA constracts can by synthesized using solid phase oligonucleotide synthesis methods as described herein (see for example Usman et al, US Patent Nos.
  • RNA oligonucleotides are synthesized in a stepwise fashion using the phosphoramidite chemisfry as is known in the art.
  • Standard phosphoramidite chemistry involves the use of nucleosides comprising any of 5'-O-dimethoxytrityl, 2'-O-tert- butyldimethylsilyl, 3'-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2- isobutyryl guanosine).
  • exocyclic amine protecting groups e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2- isobutyryl guanosine.
  • 2'-O-Silyl Ethers can be used in conjunction with acid- labile 2 '-O-orthoester protecting groups in the synthesis of RNA as described by Scaringe supra.
  • Differing 2' chemistries can require different protecting groups, for example 2'- deoxy-2' -amino nucleosides can utilize N-phthaloyl protection as described by Usman et al, US Patent 5,631,360, inco ⁇ orated by reference herein in its entirety).
  • each nucleotide is added sequentially (3'- to 5 '-direction) to the solid support-bound oligonucleotide.
  • the first nucleoside at the 3 '-end of the chain is covalently attached to a solid support (e.g., confrolled pore glass or polystyrene) using various linkers.
  • the nucleotide precursor, a ribonucleoside phosphoramidite, and activator are combined resulting in the coupling of the second nucleoside phosphoramidite onto the 5'- end of the first nucleoside.
  • the support is then washed and any unreacted 5 '-hydroxyl groups are capped with a capping reagent such as acetic anhydride to yield inactive 5 '-acetyl moieties.
  • a capping reagent such as acetic anhydride to yield inactive 5 '-acetyl moieties.
  • the trivalent phosphoms linkage is then oxidized to a more stable phosphate linkage.
  • the 5'-O-protecting group is cleaved under suitable conditions (e.g., acidic conditions for trityl-based groups and Fluoride for silyl-based groups). The cycle is repeated for each subsequent nucleotide.
  • Modification of synthesis conditions can be used to optimize coupling efficiency, for example by using differing coupling times, differing reagent/phosphoramidite concentrations, differing contact times, differing solid supports and solid support linker chemistries depending on the particular chemical composition of the siNA to be synthesized.
  • Deprotection and purification of the siNA can be performed as is generally described in Usman et al., US 5,831,071, US 6,353,098, US 6,437,117, and Bellon et al., US 6,054,576, US 6,162,909, US 6,303,773, inco ⁇ orated by reference herein in their entirety or Scaringe supra. Additionally, deprotection conditions can be modified to provide the best possible yield and purity of siNA consfructs.
  • oligonucleotides comprising 2 '-deoxy-2 '-fluoro nucleotides can degrade under inappropriate deprotection conditions. Such oligonucleotides are deprotected using aqueous methylamine at about 35°C for 30 minutes. If the 2 '-deoxy-2 '-fluoro containing oligonucleotide also comprises ribonucleotides, after deprotection with aqueous methylamine at about 35°C for 30 minutes, TEA-HF is added and the reaction maintained at about 65°C for an additional 15 minutes.
  • Example 6 RNAi in vitro assay to assess siNA activity
  • RNAi in vitro assay that recapitulates RNAi in a cell-free system is used to evaluate siNA constmcts targeting BCR-ABL and/or ERG RNA targets.
  • the assay comprises the system described by Tuschl et al, 1999, Genes and Development, 13, 3191-3197 and Zamore et al, 2000, Cell, 101, 25-33 adapted for use with BCR-ABL and/or ERG target RNA.
  • a Drosophila extract derived from syncytial blastoderm is used to reconstitute RNAi activity in vitro.
  • Target RNA is generated via in vitro transcription from an appropriate BCR-ABL and/or ERG expressing plasmid using T7 RNA polymerase or via chemical synthesis as described herein.
  • Sense and antisense siNA sfrands are annealed by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 min. at 90°C followed by 1 hour at 37°C , then diluted in lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2mM magnesium acetate). Annealing can be monitored by gel electrophoresis on an agarose gel in TBE buffer and stained with ethidium bromide.
  • buffer such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate
  • the Drosophila lysate is prepared using zero to two-hour-old embryos from Oregon R flies collected on yeasted molasses agar that are dechorionated and lysed. The lysate is centrifuged and the supernatant isolated.
  • the assay comprises a reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM final concenfration), and 10% [vol/vol] lysis buffer containing siNA (10 nM final concentration).
  • the reaction mixture also contains 10 mM creatine phosphate, 10 ug.ml creatine phosphokinase, 100 urn GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL RNasin (Promega), and 100 uM of each amino acid.
  • the final concentration of potassium acetate is adjusted to 100 mM.
  • the reactions are pre-assembled on ice and preincubated at 25° C for 10 minutes before adding RNA, then incubated at 25° C for an additional 60 minutes. Reactions are quenched with 4 volumes of 1.25 x Passive Lysis Buffer (Promega). Target RNA cleavage is assayed by RT-PCR analysis or other methods known in the art and are compared to control reactions in which siNA is omitted from the reaction.
  • target RNA for the assay is prepared by in vitro transcription in the presence of [alpha- 32 p] CTP, passed over a G 50 Sephadex column by spin chromatography and used as target RNA without further purification.
  • target RNA for the assay is prepared by in vitro transcription in the presence of [alpha- 32 p] CTP, passed over a G 50 Sephadex column by spin chromatography and used as target RNA without further purification.
  • RNA is 5'-32p-end labeled using T4 polynucleotide kinase enzyme. Assays are performed as described above and target RNA and the specific RNA cleavage products generated by RNAi are visualized on an autoradiograph of a gel. The percentage of cleavage is determined by
  • Phosphor Imager® quantitation of bands representing intact control RNA or RNA from control reactions without siNA and the cleavage products generated by the assay.
  • this assay is used to determine target sites the BCR-ABL and or ERG RNA target for siNA mediated RNAi cleavage, wherein a plurality of siNA consfructs are screened for RNAi mediated cleavage of the BCR-ABL and/or ERG RNA target, for example, by analyzing the assay reaction by elecfrophoresis of labeled target RNA, or by northern blotting, as well as by other methodology well known in the art.
  • Example 7 Nucleic acid inhibition of BCR-ABL and/or ERG target RNA in vivo siNA molecules targeted to the human BCR-ABL and or ERG RNA are designed and synthesized as described above. These nucleic acid molecules can be tested for cleavage activity in vivo, for example, using the following procedure.
  • the target sequences and the nucleotide location within the BCR-ABL and or ERG RNA are given in Table II and III.
  • siNAs targeting BCR-ABL and/or ERG Two formats are used to test the efficacy of siNAs targeting BCR-ABL and/or ERG.
  • the reagents are tested in cell culture using, for example, cultured chronic myelogenous leukemic cells (e.g., K562, HUVEC or HeLa cells) to determine the extent of RNA and protein inhibition.
  • siNA reagents e.g.; see Tables II and III
  • RNA inhibition is measured after delivery of these reagents by a suitable transfection agent to, for example, K562, HUVEC or HeLa cells.
  • RNA Relative amounts of target RNA are measured versus actin using real-time PCR monitoring of amplification (eg., ABI 7700 Taqman®).
  • a comparison is made to a mixture of oligonucleotide sequences made to unrelated targets or to a randomized siNA control with the same overall length and chemisfry, but randomly substituted at each position.
  • Primary and secondary lead reagents are chosen for the target and optimization performed. After an optimal transfection agent concenfration is chosen, a RNA time-course of inhibition is performed with the lead siNA molecule.
  • a cell-plating format can be used to dete ⁇ nine RNA inhibition.
  • Cells e.g., K562, HUVEC or HeLa cells
  • EGM-2 BioWhittaker
  • siNA final concenfration, for example 20nM
  • cationic lipid e.g., final concentration 2 ⁇ g/ml
  • the complexed siNA is added to each well and incubated for the times indicated.
  • cells are seeded, for example, at 1x10 ⁇ in 96 well plates and siNA complex added as described. Efficiency of delivery of siNA to cells is determined using a fluorescent siNA complexed with lipid. Cells in 6-well dishes are incubated with siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde for 15 minutes at room temperature. Uptake of siNA is visualized using a fluorescent microscope.
  • Total RNA is prepared from cells following siNA delivery, for example, using Qiagen RNA purification kits for 6-well or Rneasy exfraction kits for 96-well assays.
  • dual-labeled probes are synthesized with the reporter dye, FAM or JOE, covalently linked at the 5 '-end and the quencher dye TAMRA conjugated to the 3 '-end.
  • RT- PCR amplifications are performed on, for example, an ABI PRISM 7700 Sequence Detector using 50 ⁇ l reactions consisting of 10 ⁇ l total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, IX TaqMan PCR reaction buffer (PE-Applied Biosystems), 5.5 mM MgCl 2 , 300 ⁇ M each dATP, dCTP, dGTP, and dTTP, 10U RNase Inhibitor (Promega), 1.25U AmpliTaq Gold (PE-Applied Biosystems) and 10U M-MLV Reverse Transcriptase (Promega).
  • the thermal cycling conditions can consist of 30 min at 48°C, 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C.
  • Quantitation of mRNA levels is determined relative to standards generated from serially diluted total cellular RNA (300, 100, 33, 11 ng/rxn) and normalizing to ⁇ -actin or GAPDH mRNA in parallel TaqMan reactions.
  • an upper and lower primer and a fluorescently labeled probe are designed.
  • Real time inco ⁇ oration of SYBR Green I dye into a specific PCR product can be measured in glass capillary tubes using a lightcyler.
  • a standard curve is generated for each primer pair using control cRNA. Values are represented as relative expression to GAPDH in each sample.
  • Nuclear exfracts can be prepared using a standard micro preparation technique (see for example Andrews and Faller, 1991, Nucleic Acids Research, 19, 2499). Protein extracts from supematants are prepared, for example using TCA precipitation. An equal volume of 20% TCA is added to the cell supernatant, incubated on ice for 1 hour and pelleted by centrifugation for 5 minutes. Pellets are washed in acetone, dried and resuspended in water. Cellular protein exfracts are ran on a 10% Bis-Tris NuPage (nuclear exfracts) or 4-12% Tris- Glycine (supernatant exfracts) polyacrylamide gel and fransfe ⁇ ed onto nifro-cellulose membranes.
  • Non-specific binding can be blocked by incubation, for example, with 5% nonfat milk for 1 hour followed by primary antibody for 16 hour at 4°C. Following washes, the secondary antibody is applied, for example (1:10,000 dilution) for 1 hour at room temperature and the signal detected with SuperSignal reagent (Pierce).
  • Example 8 Models useful to evaluate the down-regulation of BCR-ABL gene expression
  • K562, HUVEC or HeLa cells can be used in cell culture experiments to assess the efficacy of nucleic acid molecules of the invention.
  • K562, HUVEC or HeLa cells treated with nucleic acid molecules of the invention e.g., siNA
  • nucleic acid molecules of the invention e.g., siNA
  • human chronic myelogenous leukemic cells K562, HUVEC or HeLas
  • BCR-ABL expression is quantified, for example by time-resolved immunofluorometric assay.
  • BCR-ABL messenger- RNA expression is quantitated with RT-PCR in cultured K562, HUVEC or HeLas.
  • Unfreated cells are compared to cells freated with siNA molecules fransfected with a suitable reagent, for example a cationic lipid such as lipofectamine, and BCR-ABL protein and RNA levels are quantitated.
  • Dose response assays are then performed to establish dose dependent inhibition of BCR-ABL expression.
  • cell culture experiments are canied out as described by Wilda et al, 2002, Oncogene, 21, 5716.
  • siNA molecules of the invention are complexed with cationic lipids for cell culture experiments.
  • siNA and cationic lipid mixtures are prepared in semm-free DMEM immediately prior to addition to the cells.
  • DMEM plus additives are warmed to room temperature (about 20-25°C) and cationic lipid is added to the final desired concentration and the solution is vortexed briefly.
  • siNA molecules are added to the final desired concenfration and the solution is again vortexed briefly and incubated for 10 minutes at room temperature.
  • the RNA/lipid complex is serially diluted into DMEM following the 10 minute incubation.
  • BCR-ABL transgenic mouse model has been described (Huettner et al, 2000, Nature Genetics, 24, 57-60)
  • BCR-ABL1 fransresponder lines (2, 3, 4 and 27) were established from founder animals.
  • Transgenic mice were bom with the expected mendelian frequency and developed normally, indicating that the tetracycline-responsive expression system conects for BCR-ABLl toxicity in embryonic tissue.
  • No mice transgenic for the transresponder constract developed any haematological disorder with a median follow-up period of 10 months.
  • Double fransgenic mice (BCR- ABLl-tetracycline fransactivator (tTA)) were generated by breeding female transresponder mice with male mouse mammary tumour viras (MMTV)-tTA fransactivator mice under continuous administration of tetracycline (0.5 g/1) in the drinking water, starting five days before mating.
  • the genotypic distribution of double fransgenic mice followed the predicted mendelian frequency in all four lines.
  • Withdrawal of tetracycline adminisfration in double transgenic animals allowed expression of BCR— ABLl and resulted in the development of lethal leukemia in 100% of the mice within a time frame that was consistent within each line.
  • Such transgenic mice are useful as models for cancer and for identifying nucleic acid molecules of the invention that modulate BCR-ABL gene expression and gene function toward the development of a therapeutic for use in treating cancer.
  • nucleic acids of the present invention such as siRNA, directed against Erg RNA
  • the mouse model described by Hart et al, supra can be used to evaluate nucleic acid molecules of the instant invention in vivo for anti-tumorigenic capacity. Additional models can be used to study the anti-angiogenic capacity of the nucleic acid molecules of the instant invention.
  • a corneal model has been used to study angiogenesis in rat and rabbit since recraitment of vessels can easily be followed in this normally avascular tissue (Pandey et al, 1995 Science 268: 567-569).
  • a small Teflon or Hydron disk preheated with an angiogenic compound is inserted into a pocket surgically created in the cornea.
  • Angiogenesis is monitored 3 to 5 days later.
  • siRNA directed against ARNT, Tie-2 or integrin subunit RNAs would be delivered in the disk as well, or dropwise to the eye over the time course of the experiment.
  • hypoxia has been shown to cause both increased expression of VEGF and neovascularization in the retina (Pierce et al, 1995 Proc. Natl. Acad. Sci USA. 92: 905-909; Shweiki et al, 1992 J. Clin. Invest. 91: 2235- 2243).
  • Matrigel an extract of basement membrane that becomes a solid gel when injected subcutaneously (Passaniti et al, 1992 Lab. Invest. 61: 519-528).
  • angiogenesis factors When the Matrigel is supplemented with angiogenesis factors, vessels grow into the Matrigel over a period of 3 to 5 days and angiogenesis can be assessed.
  • siRNA directed against ARNT, Tie-2 or integrin subunit RNAs would be delivered in the Matrigel.
  • the cornea model is the most common and well characterized anti-angiogenic agent efficacy screening model.
  • This model involves an avascular tissue into which vessels are recruited by a stimulating agent (growth factor, thermal or alkalai bum, endotoxin).
  • the comeal model would utilize the intrastromal comeal implantation of a Teflon pellet soaked in a angiogenic compound-Hydron solution to recrait blood vessels toward the pellet which can be quantitated using standard microscopic and image analysis techniques.
  • siRNA is applied topically to the eye or bound within Hydron on the Teflon pellet itself.
  • This avascular cornea as well as the Matrigel provide for low background assays. While the comeal model has been performed extensively in the rabbit, studies in the rat have also been conducted.
  • the mouse model (Passaniti et al., supra) is a non-tissue model which utilizes
  • Matrigel an extract of basement membrane (Kleinman et al., 1986) or Millipore® filter disk, which can be impregnated with growth factors and anti-angiogenic agents in a liquid form prior to injection.
  • Millipore® filter disk forms a solid implant.
  • An angiogenic compound would be embedded in the Matrigel or Millipore® filter disk which would be used to recruit vessels within the matrix of the Matrigel or Millipore® filter disk that can be processed histologically for endothelial cell specific vWF (factor VIII antigen) immunohistochemistry, Trichrome-
  • vWF factor VIII antigen
  • the Matrigel or Millipore® filter disk are avascular; however, it is not tissue.
  • siRNA is administered within the matrix of the Matrigel or Millipore® filter disk to test their anti-angiogenic efficacy.
  • delivery issues in this model as with delivery of siRNA by Hydron- coated Teflon pellets in the rat cornea model, can be less problematic due to the homogeneous presence of the siRNA within the respective matrix.
  • siRNA For a typical systemic study involving 10 mice (20 g each) per dose group, 5 doses (1, 3, 10, 30 and 100 mg/kg daily over 14 days continuous adminisfration), approximately 400 mg of siRNA, formulated in saline would be used. A similar study in young adult rats (200 g) would require over 4 g. Parallel pharmacokinetic studies can involve the use of similar quantities of siRNA further justifying the use of murine models.
  • Identifying a common animal model for systemic efficacy testing of siRNA is an efficient way of screening siRNA for systemic efficacy.
  • the Lewis lung carcinoma and B-16 murine melanoma models are well accepted models of primary and metastatic cancer and are used for initial screening of anti-cancer. These murine models are not dependent upon the use of immunodeficient mice, are relatively inexpensive, and minimize housing concerns. Both the Lewis lung and B-16 melanoma models involve subcutaneous implantation of approximately 10 6 tumor cells from metastatically aggressive tumor cell lines (Lewis lung lines 3LL or D122, LLc-LN7; B-16-BL6 melanoma) in C57BL/6J mice.
  • the Lewis lung model can be produced by the surgical implantation of tumor spheres (approximately 0.8 mm in diameter). Metastasis also can be modeled by injecting the tumor cells directly iv.. In the Lewis lung model, microscopic metastases can be observed approximately 14 days following implantation with quantifiable macroscopic metastatic tumors developing within 21-25 days. The B-16 melanoma exhibits a similar time course with tumor neovascularization beginning 4 days following implantation. Since both primary and metastatic tumors exist in these models after 21-25 days in the same animal, multiple measurements can be taken as indices of efficacy.
  • systemic pharmacotherapy with a wide variety of agents usually begins 1-7 days following tumor implantation/inoculation with either continuous or multiple adminisfration regimens.
  • Concunent pharmacokinetic studies can be performed to determine whether sufficient tissue levels of siRNA can be achieved for pharmacodynamic effect to be expected.
  • primary tumors and secondary lung metastases can be removed and subjected to a variety of in vitro studies (i.e. target RNA reduction).
  • siRNA formulations including cationic lipid complexes which can be useful for inflammatory diseases (e.g. DIMRIE/DOPE, etc.) and RES evading liposomes which can be used to enhance vascular exposure of the siRNA, are of interest in cancer models due to their presumed biodistribution to the lung.
  • liposome formulations can be used for delivering siRNA to sites of pathology linked to an angiogenic response.
  • Example 10 RNAi mediated inhibition of BCR-ABL and/or ERG RNA expression
  • siNA consfructs are tested for efficacy in reducing BCR-ABL and/or ERG RNA expression in, for example, K562, HUVEC or HeLa cells.
  • Cells are plated approximately 24h before fransfection in 96-well plates at 5,000-7,500 cells/well, 100 ⁇ l/well, such that at the time of transfection cells are 10-90% confluent.
  • annealed siNAs are mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 50 ⁇ l/well and incubated for 20 min. at room temperature.
  • siNA fransfection mixtures are added to cells to give a final siNA concenfration of 25 nM in a volume of 150 ⁇ l.
  • Each siNA transfection mixture is added to 3 wells for triplicate siNA treatments.
  • Cells are incubated at 37° for 24h in the continued presence of the siNA fransfection mixture.
  • RNA is prepared from each well of treated cells.
  • the supematants with the fransfection mixtures are first removed and discarded, then the cells are lysed and RNA prepared from each well.
  • Target gene expression following freatment is evaluated by RT-PCR for the target gene and for a confrol gene (36B4, an RNA polymerase subunit) for normalization.
  • the triplicate data is averaged and the standard deviations determined for each freatment. Normalized data are graphed and the percent reduction of target mRNA by active siNAs in comparison to their respective inverted control siNAs is determined.
  • a siNA constract comprising ribonucleotides and 3'- terminal dithymidine caps is assayed along with a chemically modified siNA constract comprising 2 '-deoxy-2 '-fluoro pyrimidine nucleotides and purine ribonucleotides in which the sense sfrand of the siNA is further modified with 5' and 3 '-terminal inverted deoxyabasic caps and the antisense strand comprises a 3 '-terminal phosphorothioate intemucleotide linkage. Additional stabilization chemistries as described in Table IV are similarly assayed for activity.
  • siNA consfructs are compared to appropriate matched chemistry inverted controls.
  • siNA constmcts are also compared to unfreated cells, cells transfected with lipid and scrambled siNA consfructs, and cells fransfected with lipid alone (fransfection confrol).
  • siNA consfructs (Table I) are tested for efficacy in reducing ERG2 RNA expression in, for example in DLDl cells.
  • Cells are plated approximately 24h before transfection in 96-well plates at 5,000-7,500 cells/well, 100 ⁇ l/well, such that at the time of transfection cells are 70- 90%o confluent.
  • annealed siNAs are mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 50 ⁇ l/well and incubated for 20 min. at room temperature.
  • the siNA fransfection mixtures are added to cells to give a final siNA concentration of 25 nM in a volume of 150 ⁇ l.
  • Each siNA fransfection mixture is added to 3 wells for triplicate siNA treatments. Cells are incubated at 37° for 24h in the continued presence of the siNA fransfection mixture. At 24h, RNA is prepared from each well of treated cells. The supematants with the transfection mixtures are first removed and discarded, then the cells are lysed and RNA prepared from each well. Target gene expression following treatment is evaluated by RT-PCR for the target gene and for a confrol gene (36B4, an RNA polymerase subunit) for normalization. The triplicate data is averaged and the standard deviations determined for each treatment. Normalized data are graphed and the percent reduction of target mRNA by active siNAs in comparison to their respective inverted control siNAs was determined.
  • siNA consfructs were screened for activity (see Figure 13) and compared to untreated cells, scrambled siNA control constracts (Scraml and Scram2), and cells transfected with lipid alone (fransfection control). As shown in Figure 13, the siNA constracts significantly reduce ERG2 RNA expression. Leads generated from such a screen are then further assayed.
  • siNA constructs comprising ribonucleotides and 3 '-terminal dithymidine caps are assayed along with a chemically modified siNA consfruct comprising 2 '-deoxy-2 '-fluoro pyrimidine nucleotides and purine ribonucleotides, in which the sense sfrand of the siNA is further modified with 5' and 3'- terminal inverted deoxyabasic caps and the antisense sfrand comprises a 3 '-terminal phosphorothioate internucleotide linkage. Additional stabilization chemistries as described in Table IV are similarly assayed for activity.
  • siNA constmcts are compared to appropriate matched chemisfry inverted confrols.
  • the siNA consfructs are also compared to unfreated cells, cells transfected with lipid and scrambled siNA constmcts, and cells transfected with lipid alone (fransfection control). Additional stabilization chemistries as described in Table IV are similarly assayed for activity.
  • the nucleic acid molecules of the present invention can be used in assays to diagnose disease state related of BCR-ABL levels.
  • the nucleic acid molecules can be used to freat disease state related to BCR-ABL levels.
  • cancer e.g. leukemia, such as CML
  • CML CML
  • Particular conditions and disease states that can be associated with ERG expression modulation include but are not limited to a broad spectrum of oncology and neovascularization-related indications, including but not limited to cancers of the lung, colon, breast, prostate, and cervix, lymphoma, Ewing's sarcoma and related tumors, melanoma, angiogenic disease states such as tumor angiogenesis, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis such as rheumatoid arthritis, psoriasis, verruca vulgaris, angiofibroma of tuberous sclerosis, port-wine stains, Sturge Weber syndrome, Kippel-Trenaunay- Weber syndrome, Osler-Weber-rii syndrome, leukemias such as acute myeloid leukemia, osteoporosis, wound healing and any other diseases or conditions that are related to or will respond to the levels of ERG in a cell
  • Immunomodulators and chemotherapeutics are non-limiting examples of pharmaceutical agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention.
  • the use of radiation treatments and chemotherapeutics, such as Gemcytabine and cyclophosphamide, are non-limiting examples of chemotherapeutic agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention.
  • chemotherapeutic agents such as Gemcytabine and cyclophosphamide
  • chemotherapeutic agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention.
  • Those skilled in the art will recognize that other anti-cancer compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g. siNA molecules) and are hence within the scope of the instant invention.
  • chemotherapeutic compounds that can be combined with or used in conjuction with the nucleic acid molecules of the invention include, but are not limited to, Paclitaxel; Docetaxel; Methofrexate Doxorabin; Edatrexate; Vinorelbine; Tomaxifen; Leucovorin; 5 -fluoro uridine (5-FU) Ionotecan; Cisplatin; Carboplatin; Amsacrine; Cytarabine; Bleomycin; Mitomycin C Dactinomycin; Mithramycin; Hexamethylmelamine; dacarbazine; L-asperginase; Nitrogen mustard; Melphalan, Chlorambucil; Busulfan; Ifosfamide; 4-hydroperoxycyclophosphamide; Thiotepa; Irinotecan (CAMPTOSAR®, CPT-11, Camptothecin- 11, Campto) Tamoxifen; Herceptin; IMC C225; ABX-EG
  • nucleic acid molecules e.g. siNA
  • other drag compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g., siNA molecules) are hence within the scope of the instant invention.
  • siNA molecules of the invention can be used in a variety of diagnostic applications, such as in the identification of molecular targets (e.g., RNA) in a variety of applications, for example, in clinical, industrial, environmental, agricultural and/or research settings.
  • diagnostic use of siNA molecules involves utilizing reconstituted RNAi systems, for example, using cellular lysates or partially purified cellular lysates.
  • siNA molecules of this invention can be used as diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of endogenous or exogenous, for example viral, RNA in a cell.
  • siNA activity allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA.
  • siNA molecules described in this invention one can map nucleotide changes, which are important to RNA stmcture and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with siNA molecules can be used to inhibit gene expression and define the role of specified gene products in the progression of disease or infection. In this manner, other genetic targets can be defined as important mediators of the disease.
  • siNA molecules of this invention include detection of the presence of mRNAs associated with a disease, infection, or related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a siNA using standard methodologies, for example, fluorescence resonance emission transfer (FRET).
  • FRET fluorescence resonance emission transfer
  • siNA molecules that cleave only wild-type or mutant forms of the target RNA are used for the assay.
  • the first siNA molecules i.e., those that cleave only wild-type forms of target RNA
  • the second siNA molecules i.e., those that cleave only mutant forms of target RNA
  • synthetic substrates of both wild-type and mutant RNA are cleaved by both siNA molecules to demonstrate the relative siNA efficiencies in the reactions and the absence of cleavage of the "non-targeted" RNA species.
  • the cleavage products from the synthetic substrates also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population.
  • each analysis requires two siNA molecules, two substrates and one unknown sample, which is combined into six reactions.
  • the presence of cleavage products is determined using an RNase protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired phenotypic changes in target cells.
  • the expression of mRNA whose protein product is implicated in the development of the phenotype is adequate to establish risk.
  • RNA levels are compared qualitatively or quantitatively.
  • BCR Homo sapiens breakpoint cluster region
  • BCR Homo sapiens breakpoint cluster region
  • Homo sapiens mRNA for BCR/ABL (major breakpoint) fusion peptide partial gi
  • Ewings sarcoma EWS-Flil (type 1) oncogene mRNA complete eds gi[l2963354
  • TLS/FUS ...ERG ⁇ translocation ⁇ [human, myeloid leukemia patient, peripheral blood, bone marrow cells, mRNA Partial Mutant, 3 genes, 99 nt] gi
  • Pax3-forkhead fusion protein (Pax3/FKHR) mRNA, complete eds gi
  • AML1-ETO fusion protein AML1-ETO fusion protein (AML1-ETO) mRNA, partial eds gi I 999360
  • Fli-l Friend leukemia integration 1 [human, mRNA, 1673 nt] gi I 257353
  • GI number 628772 references a Protein record; you are currently using the
  • Homo sapiens fusion gene (ERG/EWS) gene partial eds gi
  • EWS/ERG fusion gene ⁇ EWS exon 7 - ERG exon 8, translocation ⁇ [human, left iliac bone, liver, osteolytic tumor patient, MON isolate, Genomic, 74 nt] gi 11703709 I bbm I 387732
  • EWS ... erg ⁇ reciprocal translocation junction site [human, Ewing's sarcoma cell line #5838 cells, Genomic Mutant, 3 genes, 267 nt] gi I 688241 [ bbm [ 352440 I bbs 1156728
  • GI number 2146518 references a Protein record
  • EWS...EWS-erg EWS-erg fusion protein type 9e [human, SK-PN-LI cell line, mRNA
  • GI number 2145741 references a Protein record; you are currently using the
  • EWS-erg EWS-erg fusion protein type 3e ⁇ translocation, type 3e ⁇ [human, T92-60 tumor, mRNA Partial Mutant, 54 nt] gi I 633775 IbbmI 347423
  • EWS/ERG fusion protein EWS/ERG mRNA, partial eds gi I 546447
  • EWS/ERG fusion protein EWS/ERG mRNA, partial eds gi
  • TLS...ERG ⁇ translocation ⁇ [human, acute non-lymphocytic leukemia cell lines
  • IRTA17 and IRTA21 mRNA Partial, 3 genes, 211 nt] gi I 957350 I bbm j 369615 I bs 1165809
  • the 3'-ends of the Upper sequence and the Lower sequence of the siRNA construct can include an overhang sequence, for example about 1 , 2, 3, or 4 nucleotides in length, preferably 2 nucleotides in length, wherein the overhanging sequence of the lower sequence is optionally complementary to a portion of the target sequence.
  • the upper sequence is also referred to as the sense strand, whereas the lower sequence is also referred to as the antisense strand.
  • the upper and lower sequences in the Table can further comprise a chemical modification having Formulae I-VII or any combination thereof.
  • All Stab 1-11 chemistries can comprise 3 '-terminal thymidine (TT) residues
  • All Stab 1-11 chemistries typically comprise 21 nucleotides, but can vary as described herein.
  • Wait time does not include contact time during delivery.
  • Tandem synthesis utilizes double coupling of linker molecule

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention concerns methods and reagents useful in modulating modulating chromosomal translocation gene expression gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against modulating chromosomal translocation gene expression and/or activity. The small nucleic acid molecules are useful in the diagnosis and treatment of cancer, proliferative diseases, and any other disease or condition that responds to modulation of BCR-ABL, TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, and/or AML1-ETO fusion gene expression or activity.

Description

RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING
NUCLEIC ACID (siNA)
This invention claims the benefit of McSwiggen, USSN 60/404,039, filed August 15, 2002; McSwiggen, USSN 60/439,922 filed January 14, 2003, of Beigelman USSN 60/358,580 filed February 20, 2002, of Beigelman USSN 60/363,124 filed March 11, 2002, of Beigelman USSN 60/386,782 filed June 6, 2002, of Beigelman USSN 60/406,784 filed August 29,2002, of Beigelman USSN 60/408,378 filed September 5, 2002, of Beigelman USSN 60/409,293 filed September 9, 2002, and of Beigelman USSN 60/440,129 filed January 15, 2003. These applications are hereby incorporated by reference herein in their entireties, including the drawings.
Field Of The Invention
The present invention concerns compounds, compositions, and methods for the study, diagnosis, and treatment of conditions and diseases that respond to the modulation of fusion gene expression and/or activity. The present invention also concerns compounds, compositions, and methods relating to conditions and diseases that respond to the modulation of expression and/or activity of genes involved in fusion gene (e.g., BCR-ABL, and EWS- ERG) pathways. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against fusion gene expression, such as BCR-ABL and EWS-ERG expression.
Background Of The Invention
The following is a discussion of relevant art pertaining to RNAi. The discussion is provided only for understanding of the invention that follows. The summary is not an admission that any of the work described below is prior art to the claimed invention.
RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al, 1998, Nature, 391, 806). The corresponding process in plants is commonly referred to as post- transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily- conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al, 1999, Trends Genet, 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2',5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al, 2001, Nature,
409, 363). Short interfering RNAs derived from dicer activity are typically about 21 to about
23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al, 2001,
Genes Dev., 15, 188). Dicer has also been implicated in the excision of 21- and 22- nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al, 2001, Science, 293, 834). The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al, 2001, Genes Dev., 15, 188).
RNAi has been studied in a variety of systems. Fire et al, 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol, 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al, 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al, 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21- nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates (Elbashir et al, 2001, EMBO , 20, 6877) has revealed certain requirements for siRNA length, structure, chemical composition, and sequence that are essential to mediate efficient RNAi activity. These studies have shown that 21 -nucleotide siRNA duplexes are most active when containing 3 '-terminal dinucleotide overhangs. Furthermore, complete substitution of one or both siRNA strands with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides abolishes RNAi activity, whereas substitution of the 3'- terminal siRNA overhang nucleotides with 2'-deoxy nucleotides (2'-H) was shown to be tolerated. Single mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5'-end of the siRNA guide sequence rather than the 3'-end of the guide sequence (Elbashir et al, 2001, EMBO , 20, 6877). Other studies have indicated that a 5'-phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5'-phosphate moiety on the siRNA (Nykanen et al, 2001, Cell, 107, 309).
Studies have shown that replacing the 3'-terminal nucleotide overhanging segments of a 21-mer siRNA duplex having two -nucleotide 3 '-overhangs with deoxyribonucleotides does not have an adverse effect on RNAi activity. Replacing up to four nucleotides on each end of the siRNA with deoxyribonucleotides has been reported to be well tolerated, whereas complete substitution with deoxyribonucleotides results in no RNAi activity (Elbashir et al, 2001, EMBO J, 20, 6877). In addition, Elbashir et al, supra, also report that substitution of siRNA with 2'-O-methyl nucleotides completely abolishes RNAi activity. Li et al, International PCT Publication No. WO 00/44914, and Beach et al, International PCT Publication No. WO 01/68836 preliminarily suggest that siRNA may include modifications to either the phosphate-sugar backbone or the nucleoside to include at least one of a nitrogen or sulfur heteroatom, however, neither application postulates to what extent such modifications would be tolerated in siRNA molecules, nor provides any further guidance or examples of such modified siRNA. Kreutzer et al, Canadian Patent Application No. 2,359,180, also describe certain chemical modifications for use in dsRNA constructs in order to counteract activation of double-stranded RNA-dependent protein kinase PKR, specifically 2'-amino or 2'-O-methyl nucleotides, and nucleotides containing a 2'-O or 4'-C methylene bridge. However, Kreutzer et al. similarly fails to provide examples or guidance as to what extent these modifications would be tolerated in siRNA molecules.
Parrish et al, 2000, Molecular Cell, 6, 1977-1087, tested certain chemical modifications targeting the unc-22 gene in C elegans using long (>25 nt) siRNA transcripts. The authors describe the introduction of thiophosphate residues into these siRNA transcripts by incorporating thiophosphate nucleotide analogs with T7 and T3 RNA polymerase and observed that RNAs with two phosphorothioate modified bases also had substantial decreases in effectiveness as RNAi. Further, Parrish et al. reported that phosphorothioate modification of more than two residues greatly destabilized the RNAs in vitro such that interference activities could not be assayed. Id. at 1081. The authors also tested certain modifications at the 2'-position of the nucleotide sugar in the long siRNA transcripts and found that substituting deoxynucleotides for ribonucleotides produced a substantial decrease in interference activity, especially in the case of Uridine to Thymidine and/or Cytidine to deoxy-Cytidine substitutions. Id. In addition, the authors tested certain base modifications, including substituting, in sense and antisense strands of the siRNA, 4-thiouracil, 5- bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil, and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil substitution appeared to be tolerated, Parrish reported that inosine produced a substantial decrease in interference activity when incorporated in either strand. Parrish also reported that incorporation of 5-iodouracil and 3- (aminoallyl)uracil in the antisense strand resulted in a substantial decrease in RNAi activity as well.
The use of longer dsRNA has been described. For example, Beach et al, International
PCT Publication No. WO 01/68836, describes specific methods for attenuating gene expression using endogenously-derived dsRNA. Tuschl et al, International PCT Publication No. WO 01/75164, describe a Drosophila in vitro RNAi system and the use of specific siRNA molecules for certain functional genomic and certain therapeutic applications; although Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be used to cure genetic diseases or viral infection due to the danger of activating interferon response. Li et al, International PCT Publication No. WO 00/44914, describe the use of specific dsRNAs for attenuating the expression of certain target genes. Zernicka-Goetz et al, International PCT Publication No. WO 01/36646, describe certain methods for inhibiting the expression of particular genes in mammalian cells using certain dsRNA molecules. Fire et al, International PCT Publication No. WO 99/32619, describe particular methods for introducing certain dsRNA molecules into cells for use in inhibiting gene expression. Plaetinck et al, International PCT Publication No. WO 00/01846, describe certain methods for identifying specific genes responsible for conferring a particular phenotype in a cell using specific dsRNA molecules. Mello et al, International PCT Publication No. WO 01/29058, describe the identification of specific genes involved in dsRNA-mediated RNAi. Deschamps Depaillette et al, International PCT Publication No. WO 99/07409, describe specific compositions consisting of particular dsRNA molecules combined with certain anti-viral agents. Waterhouse et al, International PCT Publication No. 99/53050, describe certain methods for decreasing the phenotypic expression of a nucleic acid in plant cells using certain dsRNAs. Driscoll et al, International PCT Publication No. WO 01/49844, describe specific DNA constructs for use in facilitating gene silencing in targeted organisms.
Others have reported on various RNAi and gene-silencing systems. For example, Parrish et al, 2000, Molecular Cell, 6, 1977-1087, describe specific chemically-modified siRNA constructs targeting the unc-22 gene of C. elegans. Grossniklaus, International PCT
Publication No. WO 01/38551, describes certain methods for regulating polycomb gene expression in plants using certain dsRNAs. Churikov et al, International PCT Publication
No. WO 01/42443, describe certain methods for modifying genetic characteristics of an organism using certain dsRNAs. Cogoni et al, International PCT Publication No. WO
01/53475, describe certain methods for isolating a Neurospora silencing gene and uses thereof. Reed et al, International PCT Publication No. WO 01/68836, describe certain methods for gene silencing in plants. Honer et al, International PCT Publication No. WO
01/70944, describe certain methods of drug screening using transgenic nematodes as Parkinson's Disease models using certain dsRNAs. Deak et al, International PCT Publication No. WO 01/72774, describe certain Drosophila-denved gene products that may be related to RNAi .in Drosophila. Amdt et al, International PCT Publication No. WO 01/92513 describe certain methods for mediating gene suppression by using factors that enhance RNAi. Tuschl et al, International PCT Publication No. WO 02/44321, describe certain synthetic siRNA constructs. Pachuk et al, International PCT Publication No. WO 00/63364, and Satishchandran et al, International PCT Publication No. WO 01/04313, describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain dsRNAs. Echeverri et al, International PCT Publication No. WO 02/38805, describe certain C. elegans genes identified via RNAi. Kreutzer et al, International PCT Publications Nos. WO 02/055692, WO 02/055693, and EP 1144623 Bl describes certain methods for inhibiting gene expression using RNAi. Graham et al, International PCT Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501 describe certain vector expressed siRNA molecules. Fire et al, US 6,506,559, describe certain methods for inhibiting gene expression in vitro using certain long (greater than 25 nucleotide) dsRNA constructs that mediate RNAi.
Wilda et al, 2002, Oncogene, 21, 5716, describes certain siRNA molecules targeting BCR-ABL RNA in K562 cells. BCR-ABL RNA and protein were down-regulated following siRNA treatment as shown by real-time quantitative PCR and Western blots.
SUMMARY OF THE INVENTION This invention relates to compounds, compositions, and methods useful for modulating the expression of of genes, such as genes resulting from chromosomal translocation events, by RNA interference (RNAi), using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of fusion genes and transcriptional deregulation genes, or genes involved in fusion gene and transcriptional deregulation gene pathways of gene expression by RNA interference (RNAi) using small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro- RNA (miRNA), and short hairpin RNA (shRNA) molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of BCR-ABL and/or ERG genes. A siNA of the invention can be unmodified or chemically- modified. A siNA of the instant invention can be chemically synthesized, expressed from a vector or enzymatically synthesized. The instant invention also features various chemically- modified synthetic short interfering nucleic acid (siNA) molecules capable of modulating fusion gene (e.g., BCR-ABL, ERG) expression or activity in cells by RNA interference (RNAi). The use of chemically-modified siNA improves various properties of native siNA molecules through increased resistance to nuclease degradation in vivo and/or through improved cellular uptake. Further, contrary to earlier published studies, siNA having multiple chemical modifications retains its RNAi activity. The siNA molecules of the instant invention provide useful reagents and methods for a variety of therapeutic, diagnostic, target validation, genomic discovery, genetic engineering, and pharmacogenomic applications.
In one embodiment, the invention features one or more siNA molecules and methods that independently or in combination modulate the expression of gene(s) encoding proteins associated with chromosomal translocation events, such as BCR-ABL, TEL-AML1, EWS- FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO fusion proteins. Specifically, the present invention features siNA molecules that modulate the expression of chromosomal translocation genes, for example the BCR-ABL, TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO genes encoding sequences comprising those sequences referred to by GenBank Accession Nos. shown in Table I. The description below of the various aspects and embodiments of the invention is provided with reference to exemplary BCR-ABL gene. However, the various aspects and embodiments are also directed to other chromosomal translocation genes, such as TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, EWS-ERG, FUS/ERG, TLS/ERG and AML1-ETO and any other fusion gene or transcriptional deregulation genes. The various aspects and embodiments are also directed to other genes that are involved in the progression, development, or maintenance of leukemias and lymphomas. Those additional genes can be analyzed for target sites using the methods described for BCR-ABL and ERG herein. Thus, the inhibition and the effects of such inhibition of the other genes can be performed as described herein.
In one embodiment, the invention features a siNA molecule that down-regulates expression of a BCR-ABL gene, for example, wherein the BCR-ABL gene comprises BCR- ABL encoding sequence.
In one embodiment, the invention features a siNA molecule that down-regulates expression of an ERG gene, for example, wherein the ERG gene comprises ERG encoding sequence.
In one embodiment, the invention features a siNA molecule having RNAi activity against BCR-ABL and/or ERG RNA, wherein the siNA molecule comprises a sequence complementary to any RNA having BCR-ABL and/or ERG or other BCR-ABL and/or ERG encoding sequence, such as those sequences having GenBank Accession Nos. shown in Table I. Chemical modifications as shown in Tables III and IV or otherwise described herein can be applied to any siNA construct of the invention.
In one embodiment, the invention features a siNA molecule having RNAi activity against polynucleotides encoding BCR-ABL and/or ERG, wherein the siNA molecule comprises a sequence complementary to any polynucleotide having BCR-ABL and/or ERG encoding sequence, such as those sequences having BCR-ABL and or ERG GenBank Accession Nos. shown in Table I. Chemical modifications as shown in Tables III and IV or otherwise described herein can be applied to any siNA construct of the invention.
In another embodiment, the invention features a siNA molecule having RNAi activity against a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises nucleotide sequence complementary to nucleotide sequence of a BCR-ABL and/or ERG gene, such as those BCR-ABL and or ERG sequences having GenBank Accession Nos. shown in Table I. In another embodiment, a siNA molecule of the invention includes nucleotide sequence that can interact with nucleotide sequence of a BCR-ABL and/or ERG gene and thereby mediate silencing of BCR-ABL and or ERG gene expression, for example, wherem the siNA mediates regulation of BCR-ABL and/or ERG gene expression by cellular processes that modulate the chromatin structure of the BCR-ABL and/or ERG gene and prevent transcription of the BCR-ABL and/or ERG gene.
In another embodiment, the invention features a siNA molecule comprising nucleotide sequence, for example, nucleotide sequence in the antisense region of the siNA molecule that is complementary to a nucleotide sequence or portion of sequence of a BCR-ABL and/or ERG gene. In another embodiment, the invention features a siNA molecule comprising a region, for example, the antisense region of the siNA construct, complementary to a sequence or portion of sequence comprising a BCR-ABL and/or ERG gene sequence.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
In one embodiment, a siNA molecule of the invention comprises no ribonucleotides. In another embodiment, a siNA molecule of the invention comprises ribonucleotides.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the BCR- ABL and/or ERG gene, and wherein the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the BCR-ABL and/or ERG gene.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein each strand of the siNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand. In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the BCR-ABL and/or ERG gene, and wherein the siNA further comprises a sense region, wherein the sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the BCR-ABL and/or ERG gene.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the antisense region and the sense region each comprise about 19 to about 23 nucleotides, and wherein the antisense region comprises at least about 19 nucleotides that are complementary to nucleotides of the sense region.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the BCR-ABL and or ERG gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule. The sense region can be connected to the antisense region via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the BCR-ABL and/or ERG gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region, and wherein pyrimidine nucleotides in the sense region are 2'-O-methyl pyrimidine nucleotides, 2'-deoxy purine nucleotides, or 2'-deoxy-2'-fluoro pyrimidine nucleotides.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein the fragment comprising the sense region includes a terminal cap moiety at the 5'-end, the 3'-end, or both of the 5' and 3' ends of the fragment comprising the sense region. In another embodiment, the terminal cap moiety is an inverted deoxy abasic moiety or glyceryl moiety. In another embodiment, each of the two fragments of the siNA molecule comprise about 21 nucleotides.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the BCR-ABL and/or ERG gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region, and wherein the purine nucleotides present in the antisense region comprise 2'-deoxy- purine nucleotides. In another embodiment, the antisense region comprises a phosphorothioate internucleotide linkage at the 3' end of the antisense region. In another embodiment, the antisense region comprises a glyceryl modification at the 3' end of the antisense region.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule and wherem at least two 3' terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule. In another embodiment, each of the two 3 ' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine. In another embodiment, all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule. In another embodiment, about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the BCR-ABL and/or ERG gene. In another embodiment, 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the BCR-ABL and/or ERG gene. In another embodiment, the 5 '-end of the fragment comprising said antisense region optionally includes a phosphate group.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits the expression of a BCR-ABL and/or ERG RNA sequence (e.g., wherein said target RNA sequence is encoded by a BCR-ABL and/or ERG gene), wherein the siNA molecule comprises no ribonucleotides and wherem each strand of the double-stranded siNA molecule is about 21 nucleotides long.
In one embodiment, the invention features a medicament comprising a siNA molecule of the invention.
In one embodiment, the invention features an active ingredient comprising a siNA molecule of the invention.
In one embodiment, the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule to down-regulate expression of a BCR-ABL and/or ERG gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense strand of the double-stranded siNA molecule is complementary to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof which encodes an protein or a portion thereof.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each strand of the siNA molecule comprises about 19 to about 29 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the siNA molecule is assembled from two oligonucleotide fragments wherein one fragment comprises the nucleotide sequence of the antisense sfrand of the siNA moleculeand a second fragment comprises nucleotide sequence of the sense region of the siNA molecule.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the sense strand is connected to the antisense strand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein purine nucleotides present in the sense region are 2'-deoxy purine nucleotides.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the sense strand comprises a 3'-end and a 5'- end, and wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety) is present at the 5'-end, the 3'-end, or both of the 5' and 3' ends of the sense strand.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense strand comprises one or more 2'- deoxy-2'-fluoro pyrimidine nucleotides and one or more 2'-O-methyl purine nucleotides.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the pyrimidine nucleotides present in the antisense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein any purine nucleotides present in the antisense strand are 2'-O-methyl purine nucleotides.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense sfrand comprises a phosphorothioate intemucleotide linkage at the 3' end of the antisense sfrand.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-stranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense sfrand comprises a glyceryl modification at the 3' end.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-stranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each of the two strands of the siNA molecule comprises 21 nucleotides. In another embodiment, about 19 nucleotides of each strand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule and wherein at least two 3' terminal nucleotides of each sfrand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule. In another embodiment, each of the two 3 ' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine. In another embodiment, each sfrand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule. In another embodiment, about 19 nucleotides of the antisense sfrand are base-paired to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof. In another embodiment, 21 nucleotides of the antisense sfrand are base-paired to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the 5 '-end of the antisense strand optionally includes a phosphate group.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence or a portion thereof of the antisense sfrand is complementary to a nucleotide sequence of the 5 '-untranslated region or a portion thereof of the BCR-ABL and/or ERG RNA.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof that is present in the BCR-ABL and/or ERG RNA.
In one embodiment, the invention features a pharmaceutical composition comprising a siNA molecule of the invention in an acceptable carrier or diluent.
In one embodiment, the invention features a medicament comprising an siNA molecule of the invention.
In one embodiment, the invention features an active ingredient comprising an siNA molecule of the invention.
In one embodiment, the invention features the use of a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR- ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double- stranded siNA molecule comprises a sugar modification.
In one embodiment, the antisense region of BCR-ABL siRNA constmcts can comprise a sequence complementary to sequence having any of SEQ ID NOs. 1-263, 527-845, 1165- 1182, 1201-1218 or 1589-1596. In another embodiment, the antisense region can also comprise sequence having any of SEQ ID NOs. 264-526, 846-1164, 1183-1200, 1219-1236, 1605-1608, 1613-1616, 1621-1624, 1629-1631, 1637-1640, 1645-1648, 1685, 1687, 1689, 1691, 1693, or 1694. In another embodiment, the sense region of BCR-ABL siRNA constmcts can comprise sequence having any of SEQ ID NOs. 1-263, 527-845, 1165-1182, 1201-1218, 1589-1596, 1601-1604, 1609-1612, 1617-1620, 1625-1628, 1632-1636, 1641- 1644, 1684, 1686, 1688, 1690, or 1692. The sense region can comprise a sequence of SEQ ID NO. 1673 and the antisense region can comprise a sequence of SEQ ID NO. 1674. The sense region can comprise a sequence of SEQ ID NO. 1675 and the antisense region can comprise a sequence of SEQ ID NO. 1676. The sense region can comprise a sequence of SEQ ID NO. 1677 and the antisense region can comprise a sequence of SEQ ID NO. 1678. The sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1680. The sense region can comprise a sequence of SEQ ID NO. 1681 and the antisense region can comprise a sequence of SEQ ID NO. 1682. The sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1683.
In one embodiment, the antisense region of ERG siRNA constmcts can comprise a sequence complementary to sequence having any of SEQ ID NOs. 1237-1412 or 1597-1600. In another embodiment, the antisense region can also comprise sequence having any of SEQ ID NOs. 1413-1588, 1653-1656, 1661-1664, 1669-1672, 1696, 1698, 1700, 1702, 1704, or 1705. In another embodiment, the sense region of ERG siRNA constmcts can comprise sequence having any of SEQ ID NOs. 1237-1412, 1597-1600, 1649-1652, 1657-1660, 1665- 1668, 1695, 1697, 1699, 1701, or 1703. The sense region can comprise a sequence of SEQ ID NO. 1673 and the antisense region can comprise a sequence of SEQ ID NO. 1674. The sense region can comprise a sequence of SEQ ID NO. 1675 and the antisense region can comprise a sequence of SEQ ID NO. 1676. The sense region can comprise a sequence of SEQ ID NO. 1677 and the antisense region can comprise a sequence of SEQ ID NO. 1678. The sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1680. The sense region can comprise a sequence of SEQ ID NO. 1681 and the antisense region can comprise a sequence of SEQ ID NO. 1682. The sense region can comprise a sequence of SEQ ID NO. 1679 and the antisense region can comprise a sequence of SEQ ID NO. 1683.
In one embodiment, a siNA molecule of the invention comprises any of SEQ ID NOs. 1-1705. The sequences shown in SEQ ID NOs: 1-1705 are not limiting. A siNA molecule of the invention can comprise any contiguous BCR-ABL and/or ERG sequence (e.g., about 19 to about 25, or about 19, 20, 21, 22, 23, 24 or 25 contiguous BCR-ABL and/or ERG nucleotides).
In yet another embodiment, the invention features a siNA molecule comprising a sequence, for example, the antisense sequence of the siNA constmct, complementary to a sequence or portion of sequence comprising sequence represented by GenBank Accession
Nos. shown in Table I. Chemical modifications in Tables III and IV and descrbed herein can be applied to any siNA costract of the invention.
In one embodiment of the invention a siNA molecule comprises an antisense strand having about 19 to about 29 nucleotides, wherein the antisense strand is complementary to a RNA sequence encoding a BCR-ABL and/or ERG protein, and wherein said siNA further comprises a sense sfrand having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences with at least about 19 complementary nucleotides.
In another embodiment of the invention a siNA molecule of the invention comprises an antisense region having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, wherein the antisense region is complementary to a RNA sequence encoding a BCR-ABL and/or ERG protein, and wherein said siNA further comprises a sense region having about 19 to about 29 nucleotides, wherein said sense region and said antisense region comprise a linear molecule with at least about 19 complementary nucleotides.
In one embodiment of the invention a siNA molecule comprises an antisense sfrand comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof encoding a BCR-ABL and/or ERG protein. The siNA further comprises a sense strand, wherem said sense sfrand comprises a nucleotide sequence of a BCR-ABL and/or ERG gene or a portion thereof.
In another embodiment, a siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof encoding a BCR-ABL and/or ERG protein. The siNA molecule further comprises a sense region, wherein said sense region comprises a nucleotide sequence of a BCR-ABL and/or ERG gene or a portion thereof.
In one embodiment, a siNA molecule of the invention has RNAi activity that modulates expression of RNA encoded by a BCR-ABL and/or ERG gene. Because BCR- ABL and/or ERG genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of BCR-ABL and/or ERG genes (and associated receptor or ligand genes) or alternately specific BCR-ABL and/or ERG genes by selecting sequences that are either shared amongst different BCR-ABL and/or ERG targets or alternatively that are unique for a specific BCR-ABL and/or ERG target. Therefore, in one embodiment, the siNA molecule can be designed to target conserved regions of BCR-ABL and/or ERG RNA sequence having homology between several BCR-ABL and/or ERG receptor genes so as to target several BCR-ABL and/or ERG genes (e.g., different BCR-ABL and/or ERG subunits, isoforms, splice variants, mutant genes etc.) with one siNA molecule. In another embodiment, the siNA molecule can be designed to target a sequence that is unique to a specific BCR-ABL and/or ERG RNA sequence due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
In one embodiment, nucleic acid molecules of the invention that act as mediators of the RNA interference gene silencing response are double-sfranded nucleic acid molecules. In another embodiment, the siNA molecules of the invention consist of duplexes containing about 19 base pairs between oligonucleotides comprising about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24 or 25) nucleotides. In yet another embodiment, siNA molecules of the invention comprise duplexes with overhanging ends of about about 1 to about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about 21 -nucleotide duplexes with about 19 base pairs and 3 '-terminal mononucleotide, dinucleotide, or trinucleotide overhangs.
In one embodiment, the invention features one or more chemically-modified siNA constracts having specificity for BCR-ABL and/or ERG expressing nucleic acid molecules, such as RNA encoding a BCR-ABL and/or ERG protein. Non-limiting examples of such chemical modifications include without limitation phosphorothioate intemucleotide linkages, 2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation. These chemical modifications, when used in various siNA constmcts, are shown to preserve RNAi activity in cells while at the same time, dramatically increasing the semm stability of these compounds. Furthermore, contrary to the data published by Parrish et al, supra, applicant demonsfrates that multiple (greater than one) phosphorothioate substitutions are well-tolerated and confer substantial increases in semm stability for modified siNA constmcts.
In one embodiment, a siNA molecule of the invention comprises modified nucleotides while maintaining the ability to mediate RNAi. The modified nucleotides can be used to improve in vitro or in vivo characteristics such as stability, activity, and/or bioavailability. For example, a siNA molecule of the invention can comprise modified nucleotides as a percentage of the total number of nucleotides present in the siNA molecule. As such, a siNA molecule of the invention can generally comprise about 5% to 100% modified nucleotides (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% modified nucleotides). The actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA. If the siNA molecule is single sfranded, the percent modification can be based upon the total number of nucleotides present in the single stranded siNA molecules. Likewise, if the siNA molecule is double stranded, the percent modification can be based upon the total number of nucleotides present in the sense sfrand, antisense strand, or both the sense and antisense strands.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification. In one embodiment, the BCR-ABL and/or ERG gene encodes sequence comprising Genbank Accession number NM_004327 (BCR). In one embodiment, the BCR-ABL and/or ERG gene encodes sequence comprising Genbank Accession number NM_005157 (ABL).
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense sfrand of the double-sfranded siNA molecule is complementary to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof which encodes an protein or a portion thereof.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each sfrand of the siNA molecule comprises about 19 to about 29 nucleotides, and wherein each sfrand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other sfrand.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the siNA molecule is assembled from two oligonucleotide fragments wherein one fragment comprises the nucleotide sequence of the antisense sfrand of the siNA moleculeand a second fragment comprises nucleotide sequence of the sense region of the siNA molecule.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the sense sfrand is connected to the antisense sfrand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein purine nucleotides present in the sense region are 2'-deoxy purine nucleotides.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the sense strand comprises a 3'-end and a 5'- end, and wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety) is present at the 5'-end, the 3'-end, or both of the 5' and 3' ends of the sense strand.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the strands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the antisense strand comprises one or more 2'- deoxy-2'-fluoro pyrimidine nucleotides and one or more 2'-O-methyl purine nucleotides.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the pyrimidine nucleotides present in the antisense sfrand are 2'-deoxy-2'-fluoro pyrimidine nucleotides and wherein any purine nucleotides present in the antisense strand are 2'-O-methyl purine nucleotides.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense sfrand comprises a phosphorothioate intemucleotide linkage at the 3' end of the antisense sfrand.
In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the antisense strand comprises a glyceryl modification at the 3' end.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein each of the two sfrands of the siNA molecule comprises 21 nucleotides. In another embodiment, about 19 nucleotides of each sfrand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule and wherein at least two 3 ' terminal nucleotides of each sfrand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule. In another embodiment, each of the two 3 ' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines, such as 2'-deoxy-thymidine. In another embodiment, each strand of the siNA molecule are base-paired to the complementary nucleotides of the other sfrand of the siNA molecule. In another embodiment, about 19 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the RNA or a portion thereof of BCR-ABL and/or ERG RNA. hi another embodiment, 21 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherem one of the sfrands of the double-sfranded siNA molecule is an antisense sfrand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherein the 5 '-end of the antisense sfrand optionally includes a phosphate group.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherem the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the 5 '-untranslated region or a portion thereof of the BCR-ABL and/or ERG RNA.
In one embodiment, the invention features a double-sfranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR-ABL and or ERG RNA or a portion thereof, the other sfrand is a sense sfrand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-sfranded siNA molecule comprises a sugar modification, and wherem the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the BCR-ABL and/or ERG RNA or a portion thereof that is present in the BCR-ABL and/or ERG RNA.
In one embodiment, the invention features a pharmaceutical composition comprising a siNA molecule of the invention in an acceptable carrier or diluent.
In one embodiment, the invention features a medicament comprising an siNA molecule of the invention.
In one embodiment, the invention features an active ingredient comprising an siNA molecule of the invention.
In one embodiment, the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a BCR-ABL and/or ERG gene, wherein one of the sfrands of the double-sfranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of BCR- ABL and/or ERG RNA or a portion thereof, the other sfrand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense sfrand and wherein a majority of the pyrimidine nucleotides present in the double- sfranded siNA molecule comprises a sugar modification.
In a non-limiting example, the introduction of chemically-modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously. For example, the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in semm. Furthermore, certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule. Therefore, even if the activity of a chemically-modified nucleic acid molecule is reduced as compared to a native nucleic acid molecule, for example, when compared to an all-RNA nucleic acid molecule, the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule. Unlike native unmodified siNA, chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
The antisense region of a siNA molecule of the invention can comprise a phosphorothioate intemucleotide linkage at the 3 '-end of the antisense region. The antisense region can comprise about one to about five phosphorothioate intemucleotide linkages at the 5'-end of the antisense region. The 3 '-terminal nucleotide overhangs of a siNA molecule of the invention can comprise ribonucleotides or deoxyribonucleotides that are chemically- modified at a nucleic acid sugar, base, or backbone. The 3'-terminal nucleotide overhangs can comprise one or more universal base ribonucleotides. The 3 '-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
One embodiment of the invention provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention in a manner that allows expression of the nucleic acid molecule. Another embodiment of the invention provides a mammalian cell comprising such an expression vector. The mammalian cell can be a human cell. The siNA molecule of the expression vector can comprise a sense region and an antisense region. The antisense region can comprise sequence complementary to a RNA or DNA sequence encoding BCR-ABL and/or ERG and the sense region can comprise sequence complementary to the antisense region. The siNA molecule can comprise two distinct sfrands having complementary sense and antisense regions. The siNA molecule can comprise a single sfrand having complementary sense and antisense regions.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides comprising a backbone modified intemucleotide linkage having Formula I:
Figure imgf000031_0001
wherein each RI and R2 is independently any nucleotide, non-nucleotide, or polynucleotide which can be naturally-occurring or chemically-modified, each X and Y is independently O, S, N, alkyl, or substituted alkyl, each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, or aralkyl, and wherein W, X, Y, and Z are optionally not all O.
The chemically-modified intemucleotide linkages having Formula I, for example, wherein any Z, W, X, and/or Y independently comprises a sulphur atom, can be present in one or both oligonucleotide sfrands of the siNA duplex, for example, in the sense sfrand, the antisense sfrand, or both sfrands. The siNA molecules of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically-modified intemucleotide linkages having Formula I at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the sense sfrand, the antisense strand, or both sfrands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified intemucleotide linkages having Formula I at the 5 '-end of the sense strand, the antisense strand, or both strands. In another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more) pyrimidine nucleotides with chemically-modified intemucleotide linkages having Formula I in the sense strand, the antisense sfrand, or both sfrands. In yet another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine nucleotides with chemically- modified intemucleotide linkages having Formula I in the sense strand, the antisense sfrand, or both sfrands. In another embodiment, a siNA molecule of the invention having intemucleotide linkage(s) of Formula I also comprises a chemically-modified nucleotide or non-nucleotide having any of Formulae I-VII. In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula II:
Figure imgf000032_0001
wherein each R3, R4, R5, R6, R7, R8, RIO, Rll and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N- alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S=O, CHF, or CF2, and B is a nucleosidic base such as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other non-naturally occurring base that can be complementary or non-complementary to target RNA or a non-nucleosidic base such as phenyl, naphthyl, 3- nitropyrrole, 5-nitroindole, nebularine, pyridone, pyridinone, or any other non-naturally occurring universal base that can be complementary or non-complementary to target RNA.
The chemically-modified nucleotide or non-nucleotide of Formula II can be present in one or both oligonucleotide sfrands of the siNA duplex, for example in the sense sfrand, the antisense sfrand, or both sfrands. The siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula II at the 3 '-end, the 5'- end, or both of the 3' and 5'-ends of the sense sfrand, the antisense sfrand, or both sfrands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non- nucleotides of Formula II at the 5'-end of the sense sfrand, the antisense strand, or both strands. In anther non-limiting example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non-nucleotides of Formula II at the 3 '-end of the sense sfrand, the antisense strand, or both strands.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula III:
Figure imgf000033_0001
wherein each R3, R4, R5, R6, R7, R8, R10, Rll and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N- alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S=O, CHF, or CF2, and B is a nucleosidic base such as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other non-naturally occurring base that can be employed to be complementary or non-complementary to target RNA or a non-nucleosidic base such as phenyl, naphthyl, 3-nifropyπole, 5-nitroindole, nebularine, pyridone, pyridinone, or any other non-naturally occurring universal base that can be complementary or non-complementary to target RNA.
The chemically-modified nucleotide or non-nucleotide of Formula III can be present in one or both oligonucleotide sfrands of the siNA duplex, for example, in the sense sfrand, the antisense sfrand, or both sfrands. The siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula III at the 3 '-end, the 5'- end, or both of the 3' and 5'-ends of the sense strand, the antisense sfrand, or both strands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide(s) or non- nucleotide(s) of Formula III at the 5 '-end of the sense strand, the antisense strand, or both strands. In anther non-limiting example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide or non-nucleotide of Formula III at the 3 '-end of the sense sfrand, the antisense sfrand, or both sfrands.
In another embodiment, a siNA molecule of the invention comprises a nucleotide having Formula II or III, wherein the nucleotide having Formula II or III is in an inverted configuration. For example, the nucleotide having Formula II or III is connected to the siNA constmct in a 3'-3', 3'-2', 2'-3', or 5'-5' configuration, such as at the 3'-end, the 5'-end, or both of the 3' and 5 '-ends of one or both siNA sfrands.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a 5'-terminal phosphate group having Formula IV:
X P- w wherein each X and Y is independently O, S, N, alkyl, substituted alkyl, or alkylhalo; wherein each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or alkylhalo; and wherein W, X, Y and Z are not all O.
In one embodiment, the invention features a siNA molecule having a 5 '-terminal phosphate group having Formula TV on the target-complementary strand, for example, a strand complementary to a target RNA, wherein the siNA molecule comprises an all RNA siNA molecule. In another embodiment, the invention features a siNA molecule having a 5'- terminal phosphate group having Formula IV on the target-complementary strand wherein the siNA molecule also comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide 3'- terminal nucleotide overhangs having about 1 to about 4 (e.g., about 1, 2, 3, or 4) deoxyribonucleotides on the 3'-end of one or both sfrands. In another embodiment, a 5'- terminal phosphate group having Formula IV is present on the target-complementary sfrand of a siNA molecule of the invention, for example a siNA molecule having chemical modifications having any of Formulae I-VII.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more phosphorothioate intemucleotide linkages. For example, in a non-limiting example, the invention features a chemically-modified short interfering nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in one siNA strand. In yet another embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate intemucleotide linkages in both siNA strands. The phosphorothioate intemucleotide linkages can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense sfrand, the antisense sfrand, or both strands. The siNA molecules of the invention can comprise one or more phosphorothioate intemucleotide linkages at the 3'-end, the 5'-end, or both of the 3'- and 5'- ends of the sense sfrand, the antisense strand, or both strands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate intemucleotide linkages at the 5'-end of the sense strand, the antisense sfrand, or both sfrands. In another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine phosphorothioate intemucleotide linkages in the sense strand, the antisense strand, or both strands, hi yet another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine phosphorothioate intemucleotide linkages in the sense strand, the antisense strand, or both strands.
In one embodiment, the invention features a siNA molecule, wherein the sense sfrand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy- 2'-fluoro, and or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of the antisense sfrand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense siNA sfrand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy- 2'-fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present in the same or different sfrand.
In another embodiment, the invention features a siNA molecule, wherein the sense sfrand comprises about 1 to about 5, specifically about 1, 2, 3, 4, or 5 phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) 2'-deoxy, 2'-O- methyl, 2 '-deoxy-2 '-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3-end, the 5'-end, or both of the 3'- and 5'-ends of the sense sfrand; and wherein the antisense sfrand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and or antisense siNA sfrand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy-2'- fluoro nucleotides, with or without about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or more phosphorothioate internucleotide linkages and or a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends, being present in the same or different strand.
In one embodiment, the invention features a siNA molecule, wherein the antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate intemucleotide linkages, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5'-end, or both of the 3'- and 5 '-ends of the sense sfrand; and wherein the antisense sfrand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy- 2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5'-end, or both of the 3'- and 5 '-ends of the antisense sfrand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy- 2'-fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate intemucleotide linkages and/or a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3' and 5'-ends, being present in the same or different sfrand. In another embodiment, the invention features a siNA molecule, wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of the sense sfrand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages, and/or one or more (e.g, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5'-end, or both of the 3'- and 5'-ends, being present in the same or different sfrand.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule having about 1 to about 5, specifically about 1, 2, 3, 4, 5 or more phosphorothioate intemucleotide linkages in each strand of the siNA molecule.
In another embodiment, the invention features a siNA molecule comprising 2'-5' intemucleotide linkages. The 2'-5' intemucleotide linkage(s) can be at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of one or both siNA sequence sfrands. In addition, the 2'-5' intemucleotide linkage(s) can be present at various other positions within one or both siNA sequence sfrands, for example, about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more including every intemucleotide linkage of a pyrimidine nucleotide in one or both sfrands of the siNA molecule can comprise a 2'-5' intemucleotide linkage, or about 1, 2, 3, 4, 5, 6, 1, 8, 9, 10, or more including every intemucleotide linkage of a purine nucleotide in one or both sfrands of the siNA molecule can comprise a 2'-5' intemucleotide linkage. In another embodiment, a chemically-modified siNA molecule of the invention comprises a duplex having two sfrands, one or both of which can be chemically-modified, wherein each sfrand is about 18 to about 27 (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27) nucleotides in length, wherein the duplex has about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the chemical modification comprises a stmcture having any of Formulae I-VII. For example, an exemplary chemically-modified siNA molecule of the invention comprises a duplex having two strands, one or both of which can be chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein each strand consists of about 21 nucleotides, each having a 2- nucleotide 3 '-terminal nucleotide overhang, and wherein the duplex has about 19 base pairs. In another embodiment, a siNA molecule of the invention comprises a single stranded hairpin stmcture, wherein the siNA is about 36 to about 70 (e.g., about 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can include a chemical modification comprising a structure having any of Formulae I-VII or any combination thereof. For example, an exemplary chemically-modified siNA molecule of the invention comprises a linear oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the linear oligonucleotide forms a haiφin structure having about 19 base pairs and a 2-nucleotide 3 '-terminal nucleotide overhang. In another embodiment, a linear hairpin siNA molecule of the invention contains a stem loop motif, wherein the loop portion of the siNA molecule is biodegradable. For example, a linear hairpin siNA molecule of the invention is designed such that degradation of the loop portion of the siNA molecule in vivo can generate a double-sfranded siNA molecule with 3 '-terminal overhangs, such as 3'-terminal nucleotide overhangs comprising about 2 nucleotides.
In another embodiment, a siNA molecule of the invention comprises a circular nucleic acid molecule, wherein the siNA is about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60,
65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or
23) base pairs, and wherein the siNA can include a chemical modification, which comprises a stracture having any of Formulae I-VII or any combination thereof. For example, an exemplary chemically-modified siNA molecule of the invention comprises a circular oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the circular oligonucleotide forms a dumbbell shaped stmcture having about 19 base pairs and 2 loops.
In another embodiment, a circular siNA molecule of the invention contains two loop motifs, wherem one or both loop portions of the siNA molecule is biodegradable. For example, a circular siNA molecule of the invention is designed such that degradation of the loop portions of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3 '-terminal overhangs, such as 3 '-terminal nucleotide overhangs comprising about 2 nucleotides.
In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) abasic moiety, for example a compound having Formula V:
Figure imgf000040_0001
wherein each R3, R4, R5, R6, R7, R8, R10, Rll, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S=O, CHF, or CF2. In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) inverted abasic moiety, for example a compound having Formula VI:
Figure imgf000041_0001
wherein each R3, R4, R5, R6, R7, R8, RIO, Rll, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O- alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S=O, CHF, or CF2, and either R2, R3, R8 or R13 serve as points of attachment to the siNA molecule of the invention.
In another embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) substituted polyalkyl moieties, for example a compound having Formula VII:
Figure imgf000041_0002
wherein each n is independently an integer from 1 to 12, each RI, R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O- aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or a group having Formula I, and RI, R2 or R3 serves as points of attachment to the siNA molecule of the invention.
In another embodiment, the invention features a compound having Formula VII, wherein RI and R2 are hydroxyl (OH) groups, n = 1, and R3 comprises O and is the point of attachment to the 3'-end, the 5'-end, or both of the 3' and 5'-ends of one or both strands of a double-sfranded siNA molecule of the invention or to a single-stranded siNA molecule of the invention. This modification is referred to herein as "glyceryl" (for example modification 6 in Figure 10).
In another embodiment, a moiety having any of Formula V, VI or VII of the invention is at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of a siNA molecule of the invention. For example, a moiety having Formula V, VI or VII can be present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sfrand, the sense sfrand, or both antisense and sense sfrands of the siNA molecule. In addition, a moiety having Formula VII can be present at the 3 '-end or the 5 '-end of a hairpin siNA molecule as described herein.
In another embodiment, a siNA molecule of the invention comprises an abasic residue having Formula V or VI, wherein the abasic residue having Formula VI or VI is connected to the siNA constmct in a 3'-3', 3'-2', 2'-3', or 5'-5' configuration, such as at the 3'-end, the 5'- end, or both of the 3 ' and 5'-ends of one or both siNA sfrands.
In one embodiment, a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acid (LNA) nucleotides, for example at the 5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination thereof, of the siNA molecule.
In another embodiment, a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides, for example at the 5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination thereof, of the siNA molecule. In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2 '-deoxy-2 '-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2'-deoxy purine nucleotides).
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2 '-deoxy-2'- fluoro pyrimidine nucleotides (e.g., wherem all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2'-deoxy purine nucleotides (e.g., wherem all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2'-deoxy purine nucleotides), wherein any nucleotides comprising a 3 '-terminal nucleotide overhang that are present in said sense region are 2'- deoxy nucleotides.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2 '-O-methyl purine nucleotides).
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2'-O-methyl purine nucleotides), wherein any nucleotides comprising a 3 '-terminal nucleotide overhang that are present in said antisense region are 2'-deoxy nucleotides.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the antisense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2'-deoxy purine nucleotides).
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against a BCR-ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2 '-deoxy-2 '-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2'-deoxy purine nucleotides), and inverted deoxy abasic modifications that are optionally present at the 3'- end, the 5'-end, or both of the 3' and 5'-ends of the sense region, the sense region optionally further comprising a 3'-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxyribonucleotides; and wherein the chemically-modified short interfering nucleic acid molecule comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2 '-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein one or more purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2'-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3 '-end, the 5 '-end, or both of the 3' and 5 '-ends of the antisense sequence, the antisense region optionally further comprising a 3 '-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4 ) phosphorothioate intemucleotide linkages. Non-limiting examples of these chemically- modified siNAs are shown in Figures 4 and 5 and Tables III and IV herein.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against a BCR-ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are purine ribonucleotides (e.g., wherein all purine nucleotides are purine ribonucleotides or alternately a plurality of purine nucleotides are purine ribonucleotides), and inverted deoxy abasic modifications that are optionally present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the sense region, the sense region optionally further comprising a 3 '-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxyribonucleotides; and wherein the siNA comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'- deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2'-O- methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3'-end, the 5'-end, or both of the 3' and 5 '-ends of the antisense sequence, the antisense region optionally further comprising a 3'-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4 ) phosphorothioate intemucleotide linkages. Non-limiting examples of these chemically-modified siNAs are shown in Figures 4 and 5 and Tables III and IV herein.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference
(RNAi) against a BCR-ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and for example where one or more purine nucleotides present in the sense region are selected from the group consisting of 2' -deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4 '-thionucleotides, and 2'-O- methyl nucleotides (e.g., wherein all purine nucleotides are selected from the group consisting of 2'-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl nucleotides or alternately a plurality of purine nucleotides are selected from the group consisting of 2 '-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4 '-thionucleotides, and 2'-O- methyl nucleotides), and wherein inverted deoxy abasic modifications are optionally present at the 3 '-end, the 5 '-end, or both of the 3' and 5 '-ends of the sense region, the sense region optionally further comprising a 3'-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxyribonucleotides; and wherein the chemically-modified short interfering nucleic acid molecule comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein one or more purine nucleotides present in the antisense region are selected from the group consisting of 2 '-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4'-thionucleotides, and 2'-O-methyl nucleotides (e.g., wherein all purine nucleotides are selected from the group consisting of 2 '-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4'- thionucleotides, and 2'-O-methyl nucleotides or alternately a plurality of purine nucleotides are selected from the group consisting of 2 '-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2 '-methoxyethyl nucleotides, 4 '-thionucleotides, and 2'-O-methyl nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sequence, the antisense region optionally further comprising a 3 '-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2'-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate intemucleotide linkages.
In another embodiment, any modified nucleotides present in the siNA molecules of the invention, preferably in the antisense sfrand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense sfrands, comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides. For example, the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer- Verlag ed., 1984). As such, chemically modified nucleotides present in the siNA molecules of the invention, preferably in the antisense sfrand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense sfrands, are resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi. Non-limiting examples of nucleotides having a northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2 '-0,4'- C-methylene-(D-ribofuranosyl) nucleotides); 2'-methoxyethoxy (MOE) nucleotides; 2'- methyl-thio-ethyl, 2 '-deoxy-2 '-fluoro nucleotides, 2 '-deoxy-2 '-chloro nucleotides, 2'-azido nucleotides, and 2 ' -O-methyl nucleotides.
In one embodiment, the invention features a chemically-modified short interfering nucleic acid molecule (siNA) capable of mediating RNA interference (RNAi) against a BCR- ABL and/or ERG inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a conjugate covalently attached to the chemically-modified siNA molecule. In another embodiment, the conjugate is covalently attached to the chemically- modified siNA molecule via a biodegradable linker. In one embodiment, the conjugate molecule is attached at the 3 '-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule. In another embodiment, the conjugate molecule is attached at the 5 '-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule. In yet another embodiment, the conjugate molecule is attached both the 3 '-end and 5 '-end of either the sense sfrand, the antisense strand, or both strands of the chemically-modified siNA molecule, or any combination thereof. In one embodiment, a conjugate molecule of the invention comprises a molecule that facilitates delivery of a chemically-modified siNA molecule into a biological system, such as a cell. In another embodiment, the conjugate molecule attached to the chemically-modified siNA molecule is a poly ethylene glycol, human semm albumin, or a ligand for a cellular receptor that can mediate cellular uptake. Examples of specific conjugate molecules contemplated by the instant invention that can be attached to chemically-modified siNA molecules are described in Vargeese et al, U.S. Serial No. 10/201,394, incorporated by reference herein. The type of conjugates used and the extent of conjugation of siNA molecules of the invention can be evaluated for improved pharmacokinetic profiles, bioavailability, and or stability of siNA constructs while at the same time maintaining the ability of the siNA to mediate RNAi activity. As such, one skilled in the art can screen siNA constructs that are modified with various conjugates to determine whether the siNA conjugate complex possesses improved properties while maintaining the ability to mediate RNAi, for example in animal models as are generally known in the art.
In one embodiment, the invention features a short interfering nucleic acid (siNA) molecule of the invention, wherein the siNA further comprises a nucleotide, non-nucleotide, or mixed nucleotide/non-nucleotide linker that joins the sense region of the siNA to the antisense region of the siNA. In one embodiment, a nucleotide linker of the invention can be a linker of > 2 nucleotides in length, for example 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In another embodiment, the nucleotide linker can be a nucleic acid aptamer. By "aptamer" or "nucleic acid aptamer" as used herein is meant a nucleic acid molecule that binds specifically to a target molecule wherein the nucleic acid molecule has sequence that comprises a sequence recognized by the target molecule in its natural setting. Alternately, an aptamer can be a nucleic acid molecule that binds to a target molecule where the target molecule does not naturally bind to a nucleic acid. The target molecule can be any molecule of interest. For example, the aptamer can be used to bind to a ligand-binding domain of a protein, thereby preventing interaction of the naturally occurring ligand with the protein. This is a non-limiting example and those in the art will recognize that other embodiments can be readily generated using techniques generally known in the art. (See, for example, Gold et al, 1995, Annu. Rev. Biochem., 64, 763; Brody and Gold, 2000, J. Biotechnol, 74, 5; Sun, 2000, Curr. Opin. Mol. Ther., 2, 100; Kusser, 2000, J. Biotechnol, 74, 27; Hermann and Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical Chemistry, 45, 1628.)
In yet another embodiment, a non-nucleotide linker of the invention comprises abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (e.g. polyethylene glycols such as those having between 2 and 100 ethylene glycol units). Specific examples include those described by Seela and Kaiser, Nucleic Acids Res. 1990, 75:6353 and Nucleic Acids Res. 1987, 75:3113; Cload and Schepartz, J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am. Chem. Soc 1991, 773:5109; Ma et al, Nucleic Acids Res. 1993, 27:2585 and Biochemistry 1993, 32:1751; Durand et al, Nucleic Acids Res. 1990, 75:6353; McCurdy et al, Nucleosides & Nucleotides 1991, 10:281; Jschke et al, Tetrahedron Lett. 1993, 34:301; Ono et al, Biochemistry 1991, 30:9914; Arnold et al, International Publication No. WO 89/02439; Usman et al, International Publication No. WO 95/06731; Dudycz et al, International Publication No. WO 95/11910 and Ferentz and Verdine, J. Am. Chem. Soc. 1991, 773:4000, all hereby incorporated by reference herein. A "non-nucleotide" further means any group or compound that can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity. The group or compound can be abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine, for example at the Cl position of the sugar.
In one embodiment, the invention features a short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) inside a cell or reconstituted in vitro system, wherein one or both strands of the siNA molecule that are assembled from two separate oligonucleotides do not comprise any ribonucleotides. For example, a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA comprise separate oligonucleotides not having any ribonucleotides (e.g., nucleotides having a 2'-OH group) present in the oligonucleotides. In another example, a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA are linked or circularized by a nucleotide or non-nucleotide linker as desrcibed herein, wherein the oligonucleotide does not have any ribonucleotides (e.g., nucleotides having a 2' -OH group) present in the oligonucleotide. Applicant has surprisingly found that the presense of ribonucleotides (e.g., nucleotides having a 2'-hydroxyl group) within the siNA molecule is not required or essential to support RNAi activity. As such, in one embodiment, all positions within the siNA can include chemically modified nucleotides and/or non-nucleotides such as nucleotides and or non-nucleotides having Formula I, II, III, IV, V, VI, or VII or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained. In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vifro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence. In another embodiment, the single sfranded siNA molecule of the invention comprises a 5'-terminal phosphate group. In another embodiment, the single stranded siNA molecule of the invention comprises a 5 '-terminal phosphate group and a 3'- terminal phosphate group (e.g., a 2', 3'-cyclic phosphate). In another embodiment, the single sfranded siNA molecule of the invention comprises about 19 to about 29 nucleotides. In yet another embodiment, the single stranded siNA molecule of the invention comprises one or more chemically modified nucleotides or non-nucleotides described herein. For example, all the positions within the siNA molecule can include chemically-modified nucleotides such as nucleotides having any of Formulae I-VII, or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
In one embodiment, a siNA molecule of the invention is a single sfranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2'-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2'-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2'-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2'-deoxynucleotides at the 3 '-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4 ) phosphorothioate intemucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5 '-terminal phosphate group. In one embodiment, a siNA molecule of the invention is a single sfranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vifro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2'-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2'-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2'-deoxy purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3 '-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2'-deoxynucleotides at the 3 '-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4 ) phosphorothioate intemucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5 '-terminal phosphate group.
In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vifro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are locked nucleic acid (LNA) nucleotides (e.g., wherein all purine nucleotides are LNA nucleotides or alternately a plurality of purine nucleotides are LNA nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2'-deoxynucleotides at the 3 '-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4 ) phosphorothioate intemucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5 '-terminal phosphate group.
In one embodiment, a siNA molecule of the invention is a single sfranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single sfranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2'-deoxy-2'-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2 '-methoxyethyl purine nucleotides (e.g., wherein all purine nucleotides are 2 '-methoxyethyl purine nucleotides or alternately a plurality of purine nucleotides are 2 '-methoxyethyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in Figure 10, that is optionally present at the 3'-end, the 5'-end, or both of the 3' and 5'-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2'-deoxynucleotides at the 3 '-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4 ) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5 '-terminal phosphate group.
In another embodiment, any modified nucleotides present in the single stranded siNA molecules of the invention comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides. For example, the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer- Verlag ed., 1984). As such, chemically modified nucleotides present in the single stranded siNA molecules of the invention are preferably resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi. In one embodiment, siNA molecules of the invention are used as reagents in ex vivo gene therapy applications. For example, siNA reagents are intoduced into tissue or cells that are transplanted into a subject for therapeutic effect. The cells and/or tissue can be derived from an organism or subject that later receives the explant, or can be derived from another organism or subject prior to transplantation. The siNA molecules can be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype or are able to perform a function when transplanted in vivo. In one embodiment, the invention features a method for modulating the expression of a BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the cell.
In one embodiment, the invention features a method for modulating the expression of a BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene and wherein the sense sfrand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the cell.
In another embodiment, the invention features a method for modulating the expression of more than one BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG genes; and (b) infroducing the siNA molecules into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the cell.
hi another embodiment, the invention features a method for modulating the expression of more than one BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the cell.
In one embodiment, the invention features a method of modulating the expression of a BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherem one of the siNA strands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in that organism.
In one embodiment, the invention features a method of modulating the expression of a BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the tissue explant. In another embodiment, the method further comprises infroducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in that organism.
In another embodiment, the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG genes; and (b) infroducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the tissue explant. In another embodiment, the method further comprises infroducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in that organism.
In one embodiment, the invention features a method of modulating the expression of a BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the BCR-ABL and or ERG gene; and (b) infroducing the siNA molecule into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the organism.
In another embodiment, the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA sfrands comprises a sequence complementary to RNA of the BCR-ABL and/or ERG genes; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the organism.
In one embodiment, the invention features a method for modulating the expression of a
BCR-ABL and or ERG gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the cell.
In another embodiment, the invention features a method for modulating the expression of more than one BCR-ABL and/or ERG gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single sfranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) contacting the siNA molecule with a cell in vifro or in vivo under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the cell.
In one embodiment, the invention features a method of modulating the expression of a
BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) contacting the siNA molecule with a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in that organism.
In another embodiment, the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single sfranded sequence having complementarity to RNA of the BCR- ABL and/or ERG gene; and (b) infroducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in that organism.
In one embodiment, the invention features a method of modulating the expression of a
BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single sfranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) infroducing the siNA molecule into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG gene in the organism.
In another embodiment, the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the BCR-ABL and/or ERG gene; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the organism.
In one embodiment, the invention features a method of modulating the expression of a
BCR-ABL and/or ERG gene in an organism comprising contacting the organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the BCR- ABL and/or ERG gene in the organism.
In another embodiment, the invention features a method of modulating the expression of more than one BCR-ABL and/or ERG gene in an organism comprising contacting the organism with one or more siNA molecules of the invention under conditions suitable to modulate the expression of the BCR-ABL and/or ERG genes in the organism.
The siNA molecules of the invention can be designed to inhibit target (BCR-ABL and/or ERG) gene expression through RNAi targeting of a variety of RNA molecules. In one embodiment, the siNA molecules of the invention are used to target various RNAs corresponding to a target gene. Non-limiting examples of such RNAs include messenger RNA (mRNA), alternate RNA splice variants of target gene(s), post-franscriptionally modified RNA of target gene(s), pre-mRNA of target gene(s), and or RNA templates. If alternate splicing produces a family of franscripts that are distinguished by usage of appropriate exons, the instant invention can be used to inhibit gene expression through the appropriate exons to specifically inhibit or to distinguish among the functions of gene family members. For example, a protein that contains an alternatively spliced transmembrane domain can be expressed in both membrane bound and secreted forms. Use of the invention to target the exon containing the fransmembrane domain can be used to determine the functional consequences of pharmaceutical targeting of membrane bound as opposed to the secreted form of the protein. Non-limiting examples of applications of the invention relating to targeting these RNA molecules include therapeutic pharmaceutical applications, pharmaceutical discovery applications, molecular diagnostic and gene function applications, and gene mapping, for example using single nucleotide polymoφhism mapping with siNA molecules of the invention. Such applications can be implemented using known gene sequences or from partial sequences available from an expressed sequence tag (EST).
In another embodiment, the siNA molecules of the invention are used to target conserved sequences coπesponding to a gene family or gene families such as BCR-ABL and/or ERG family genes. As such, siNA molecules targeting multiple BCR-ABL and/or ERG targets can provide increased therapeutic effect. In addition, siNA can be used to characterize pathways of gene function in a variety of applications. For example, the present invention can be used to inhibit the activity of target gene(s) in a pathway to determine the function of uncharacterized gene(s) in gene function analysis, mRNA function analysis, or translational analysis. The invention can be used to determine potential target gene pathways involved in various diseases and conditions toward pharmaceutical development. The invention can be used to understand pathways of gene expression involved in, for example, the progression and/or maintenance of cancer.
In one embodiment, siNA molecule(s) and/or methods of the invention are used to inhibit the expression of gene(s) that encode RNA refeπed to by Genbank Accession, for example BCR-ABL and/or ERG genes encoding RNA sequence(s) refeπed to herein by Genbank Accession number, for example Genbank Accession Nos. shown in Table I.
In one embodiment, the invention features a method comprising: (a) generating a library of siNA consfructs having a predetermined complexity; and (b) assaying the siNA constmcts of (a) above, under conditions suitable to determine RNAi target sites within the target RNA sequence. In another embodiment, the siNA molecules of (a) have sfrands of a fixed length, for example, about 23 nucleotides in length. In yet another embodiment, the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one embodiment, the assay can comprise a reconstituted in vitro siNA assay as described herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed. In another embodiment, fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence. The target RNA sequence can be obtained as is known in the art, for example, by cloning and/or franscription for in vitro systems, and by cellular expression in in vivo systems.
In one embodiment, the invention features a method comprising: (a) generating a randomized library of siNA consfructs having a predetermined complexity, such as of 4N, where N represents the number of base paired nucleotides in each of the siNA constract strands (eg. for a siNA constract having 21 nucleotide sense and antisense strands with 19 base pairs, the complexity would be 419); and (b) assaying the siNA consfructs of (a) above, under conditions suitable to determine RNAi target sites within the target BCR-ABL and/or ERG RNA sequence. In another embodiment, the siNA molecules of (a) have strands of a fixed length, for example about 23 nucleotides in length. In yet another embodiment, the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one embodiment, the assay can comprise a reconstituted in vitro siNA assay as described in Example 7 herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed. In another embodiment, fragments of BCR-ABL and or ERG RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target BCR-ABL and/or ERG RNA sequence. The target BCR-ABL and/or ERG RNA sequence can be obtained as is known in the art, for example, by cloning and/or franscription for in vitro systems, and by cellular expression in in vivo systems.
In another embodiment, the invention features a method comprising: (a) analyzing the sequence of a RNA target encoded by a target gene; (b) synthesizing one or more sets of siNA molecules having sequence complementary to one or more regions of the RNA of (a); and (c) assaying the siNA molecules of (b) under conditions suitable to determine RNAi targets within the target RNA sequence. In one embodiment, the siNA molecules of (b) have strands of a fixed length, for example about 23 nucleotides in length. In another embodiment, the siNA molecules of (b) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one embodiment, the assay can comprise a reconstituted in vitro siNA assay as described herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed. Fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel elecfrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence. The target RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by expression in in vivo systems.
By "target site" is meant a sequence within a target RNA that is "targeted" for cleavage mediated by a siNA construct which contains sequences within its antisense region that are complementary to the target sequence.
By "detectable level of cleavage" is meant cleavage of target RNA (and formation of cleaved product RNAs) to an extent sufficient to discern cleavage products above the background of RNAs produced by random degradation of the target RNA. Production of cleavage products from 1-5% of the target RNA is sufficient to detect above the background for most methods of detection.
In one embodiment, the invention features a composition comprising a siNA molecule of the invention, which can be chemically-modified, in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a pharmaceutical composition comprising siNA molecules of the invention, which can be chemically-modified, targeting one or more genes in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a method for treating or preventing a disease or condition in a subject, comprising administering to the subject a composition of the invention under conditions suitable for the treatment or prevention of the disease or condition in the subject, alone or in conjunction with one or more other therapeutic compounds, hi yet another embodiment, the invention features a method for reducing or preventing tissue rejection in a subject comprising administering to the subject a composition of the invention under conditions suitable for the reduction or prevention of tissue rejection in the subject.
In another embodiment, the invention features a method for validating a BCR-ABL and/or ERG gene target, comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands includes a sequence complementary to RNA of a BCR-ABL and/or ERG target gene; (b) infroducing the siNA molecule into a cell, tissue, or organism under conditions suitable for modulating expression of the BCR-ABL and/or ERG target gene in the cell, tissue, or organism; and (c) determining the function of the gene by assaying for any phenotypic change in the cell, tissue, or organism.
In another embodiment, the invention features a method for validating a BCR-ABL and/or ERG target comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA sfrands includes a sequence complementary to RNA of a BCR-ABL and/or ERG target gene; (b) introducing the siNA molecule into a biological system under conditions suitable for modulating expression of the BCR-ABL and/or ERG target gene in the biological system; and (c) determining the function of the gene by assaying for any phenotypic change in the biological system.
By "biological system" is meant, material, in a purified or unpurified form, from biological sources, including but not limited to human, animal, plant, insect, bacterial, viral or other sources, wherein the system comprises the components required for RNAi acitivity. The term "biological system" includes, for example, a cell, tissue, or organism, or extract thereof. The term biological system also includes reconstituted RNAi systems that can be used in an in vitro setting.
By "phenotypic change" is meant any detectable change to a cell that occurs in response to contact or freatment with a nucleic acid molecule of the invention (e.g., siNA). Such detectable changes include, but are not limited to, changes in shape, size, proliferation, motility, protein expression or RNA expression or other physical or chemical changes as can be assayed by methods known in the art. The detectable change can also include expression of reporter genes/molecules such as Green Florescent Protein (GFP) or various tags that are used to identify an expressed protein or any other cellular component that can be assayed.
In one embodiment, the invention features a kit containing a siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of a BCR-ABL and/or ERG target gene in a cell, tissue, or organism. In another embodiment, the invention features a kit containing more than one siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of more than one BCR-ABL and/or ERG target gene in a cell, tissue, or organism.
In one embodiment, the invention features a kit containing a siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of a BCR-ABL and/or ERG target gene in a biological system. In another embodiment, the invention features a kit containing more than one siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of more than one BCR- ABL and/or ERG target gene in a biological system.
In one embodiment, the invention features a cell containing one or more siNA molecules of the invention, which can be chemically-modified. In another embodiment, the cell containing a siNA molecule of the invention is a mammalian cell. In yet another embodiment, the cell containing a siNA molecule of the invention is a human cell.
In one embodiment, the synthesis of a siNA molecule of the invention, which can be chemically-modified, comprises: (a) synthesis of two complementary strands of the siNA molecule; (b) annealing the two complementary sfrands together under conditions suitable to obtain a double-sfranded siNA molecule. In another embodiment, synthesis of the two complementary strands of the siNA molecule is by solid phase oligonucleotide synthesis. In yet another embodiment, synthesis of the two complementary sfrands of the siNA molecule is by solid phase tandem oligonucleotide synthesis.
In one embodiment, the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing a first oligonucleotide sequence sfrand of the siNA molecule, wherein the first oligonucleotide sequence strand comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of the second oligonucleotide sequence sfrand of the siNA; (b) synthesizing the second oligonucleotide sequence strand of siNA on the scaffold of the first oligonucleotide sequence strand, wherein the second oligonucleotide sequence sfrand further comprises a chemical moiety than can be used to purify the siNA duplex; (c) cleaving the linker molecule of (a) under conditions suitable for the two siNA oligonucleotide strands to hybridize and form a stable duplex; and (d) purifying the siNA duplex utilizing the chemical moiety of the second oligonucleotide sequence strand. In one embodiment, cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example under hydrolysis conditions using an alkylamine base such as methylamine. In one embodiment, the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherem the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold. The cleavable linker in (a) used as a scaffold for synthesizing the second sfrand can comprise similar reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place concomitantly. In another embodiment, the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group, which can be employed in a trityl-on synthesis strategy as described herein. In yet another embodiment, the chemical moiety, such as a dimethoxytrityl group, is removed during purification, for example, using acidic conditions.
In a further embodiment, the method for siNA synthesis is a solution phase synthesis or hybrid phase synthesis wherein both sfrands of the siNA duplex are synthesized in tandem using a cleavable linker attached to the first sequence which acts a scaffold for synthesis of the second sequence. Cleavage of the linker under conditions suitable for hybridization of the separate siNA sequence sfrands results in formation of the double-stranded siNA molecule. In another embodiment, the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing one oligonucleotide sequence sfrand of the siNA molecule, wherein the sequence comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of another oligonucleotide sequence; (b) synthesizing a second oligonucleotide sequence having complementarity to the first sequence sfrand on the scaffold of (a), wherein the second sequence comprises the other sfrand of the double-sfranded siNA molecule and wherein the second sequence further comprises a chemical moiety than can be used to isolate the attached oligonucleotide sequence; (c) purifying the product of (b) utilizing the chemical moiety of the second oligonucleotide sequence sfrand under conditions suitable for isolating the full-length sequence comprising both siNA oligonucleotide strands connected by the cleavable linker and under conditions suitable for the two siNA oligonucleotide strands to hybridize and form a stable duplex. In one embodiment, cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example under hydrolysis conditions. In another embodiment, cleavage of the linker molecule in (c) above takes place after deprotection of the oligonucleotide. In another embodiment, the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherem the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold. The cleavable linker in (a) used as a scaffold for synthesizing the second sfrand can comprise similar reactivity or differing reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place either concomitantly or sequentially. In one embodiment, the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group.
In another embodiment, the invention features a method for making a double-stranded siNA molecule in a single synthetic process comprising: (a) synthesizing an oligonucleotide having a first and a second sequence, wherein the first sequence is complementary to the second sequence, and the first oligonucleotide sequence is linked to the second sequence via a cleavable linker, and wherein a terminal 5 '-protecting group, for example, a 5'-O- dimethoxytrityl group (5'-O-DMT) remains on the oligonucleotide having the second sequence; (b) deprotecting the oligonucleotide whereby the deprotection results in the cleavage of the linker joining the two oligonucleotide sequences; and (c) purifying the product of (b) under conditions suitable for isolating the double-stranded siNA molecule, for example using a trityl-on synthesis strategy as described herein.
hi another embodiment, the method of synthesis of siNA molecules of the invention comprises the teachings of Scaringe et al, US Patent Nos. 5,889,136; 6,008,400; and 6,111,086, incoφorated by reference herein in their entirety.
In one embodiment, the invention features siNA consfructs that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA construct comprises one or more chemical modifications, for example, one or more chemical modifications having any of Formulae I- VII or any combination thereof that increases the nuclease resistance of the siNA constract.
In another embodiment, the invention features a method for generating siNA molecules with increased nuclease resistance comprising (a) infroducing nucleotides having any of
Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased nuclease resistance.
In one embodiment, the invention features siNA constracts that mediate RNAi against a BCR-ABL and or ERG, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the sense and antisense sfrands of the siNA construct.
In another embodiment, the invention features a method for generating siNA molecules with increased binding affinity between the sense and antisense strands of the siNA molecule comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the sense and antisense sfrands of the siNA molecule. In one embodiment, the invention features siNA constracts that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target RNA sequence within a cell.
In one embodiment, the invention features siNA constracts that mediate RNAi against a BCR-ABL and or ERG, wherein the siNA constract comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target DNA sequence within a cell.
In another embodiment, the invention features a method for generating siNA molecules with increased binding affinity between the antisense sfrand of the siNA molecule and a complementary target RNA sequence comprising (a) infroducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense strand of the siNA molecule and a complementary target RNA sequence.
In another embodiment, the invention features a method for generating siNA molecules with increased binding affinity between the antisense sfrand of the siNA molecule and a complementary target DNA sequence comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense sfrand of the siNA molecule and a complementary target DNA sequence.
In one embodiment, the invention features siNA constracts that mediate RNAi against a BCR-ABL and/or ERG, wherem the siNA construct comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically-modified siNA constract. In another embodiment, the invention features a method for generating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to a chemically-modified siNA molecule comprising (a) infroducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically- modified siNA molecule.
In one embodiment, the invention features chemically-modified siNA constructs that mediate RNAi against a BCR-ABL and/or ERG in a cell, wherein the chemical modifications do not significantly effect the interaction of siNA with a target RNA molecule, DNA molecule and/or proteins or other factors that are essential for RNAi in a manner that would decrease the efficacy of RNAi mediated by such siNA constracts.
In another embodiment, the invention features a method for generating siNA molecules with improved RNAi activity against BCR-ABL and/or ERG comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity.
In yet another embodiment, the invention features a method for generating siNA molecules with improved RNAi activity against a BCR-ABL and/or ERG target RNA comprising (a) infroducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target RNA.
In yet another embodiment, the invention features a method for generating siNA molecules with improved RNAi activity against a BCR-ABL and or ERG target DNA comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target DNA.
In one embodiment, the invention features siNA consfructs that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the cellular uptake of the siNA constract.
In another embodiment, the invention features a method for generating siNA molecules against BCR-ABL and/or ERG with improved cellular uptake comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved cellular uptake.
In one embodiment, the invention features siNA constracts that mediate RNAi against a BCR-ABL and/or ERG, wherein the siNA constract comprises one or more chemical modifications described herein that increases the bioavailability of the siNA constract, for example, by attaching polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the siNA construct, or by attaching conjugates that target specific tissue types or cell types in vivo. Non-limiting examples of such conjugates are described in Vargeese et al, U.S. Serial No. 10/201,394 incoφorated by reference herein.
In one embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability, comprising (a) infroducing a conjugate into the stracture of a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability. Such conjugates can include ligands for cellular receptors, such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZTP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; polyamines, such as spermine or spermidine; and others. In another embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) infroducing an excipient formulation to a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability. Such excipients include polymers such as cyclodextrins, lipids, cationic lipids, polyamines, phospholipids, and others.
In another embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) infroducing nucleotides having any of Formulae I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
In another embodiment, polyethylene glycol (PEG) can be covalently attached to siNA compounds of the present invention. The attached PEG can be any molecular weight, preferably from about 2,000 to about 50,000 daltons (Da).
The present invention can be used alone or as a component of a kit having at least one of the reagents necessary to cany out the in vitro or in vivo introduction of RNA to test samples and/or subjects. For example, prefened components of the kit include a siNA molecule of the invention and a vehicle that promotes introduction of the siNA into cells of interest as described herein (e.g., using lipids and other methods of transfection known in the art, see for example Beigelman et al, US 6,395,713). The kit can be used for target validation, such as in determining gene function and/or activity, or in drag optimization, and in drag discovery (see for example Usman et al., USSN 60/402,996). Such a kit can also include instructions to allow a user of the kit to practice the invention.
The term "short interfering nucleic acid", "siNA", "short interfering RNA", "siRNA", "short interfering nucleic acid molecule", "short interfering oligonucleotide molecule", or
"chemically-modified short interfering nucleic acid molecule" as used herein refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression or viral replication, for example by mediating RNA interference "RNAi" or gene silencing in a sequence-specific manner; see for example Bass, 2001, Nature, 411, 428-429; Elbashir et al, 2001, Nature, 411, 494-498; and Kreutzer et al, International PCT Publication No. WO 00/44895; Zemicka-Goetz et al, International PCT Publication No. WO 01/36646; Fire, International PCT Publication No. WO 99/32619; Plaetinck et al, International PCT Publication No. WO 00/01846; Mello and Fire, International PCT Publication No. WO 01/29058; Deschamps-DepaiUette, International PCT Publication No. WO 99/07409; and Li et al, International PCT Publication No. WO 00/44914; AUshire, 2002, Science, 297, 1818- 1819; Volpe et al, 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215- 2218; and Hall et al, 2002, Science, 297, 2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al, 2002, RNA, 8, 842-850; Reinhart et al, 2002, Gene & Dev., 16, 1616-1626; and Reinhart & Bartel, 2002, Science, 297, 1831). Non limiting examples of siNA molecules of the invention are shown in Figures 4-6, and Tables II, III, and IV herein. For example the siNA can be a double-sfranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence coπesponding to the target nucleic acid sequence or a portion thereof. The siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense sfrands are self-complementary (i.e. each sfrand comprises nucleotide sequence that is complementary to nucleotide sequence in the other sfrand; such as where the antisense strand and sense strand form a duplex or double sfranded stmcture, for example wherein the double sfranded region is about 19 base pairs); the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence coπesponding to the target nucleic acid sequence or a portion thereof. Alternatively, the siNA is assembled from a single oligonucleotide, where the self- complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s). The siNA can be a polynucleotide with a haiφin secondary stmcture, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence coπesponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi. The siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence coπesponding to the target nucleic acid sequence or a portion thereof), wherein the single sfranded polynucleotide can further comprise a terminal phosphate group, such as a 5'- phosphate (see for example Martinez et al, 2002, Cell, 110, 563-574 and Schwarz et al, 2002, Molecular Cell, 10, 537-568), or 5',3'-diphosphate. In certain embodiment, the siNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non- nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic intercations, and/or stacking interactions. In certain embodiments, the siNA molecules of the invention comprise nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the siNA molecule of the invention interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene. As used herein, siNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non- nucleotides. In certain embodiments, the short interfering nucleic acid molecules of the invention lack 2'-hydroxy (2'-OH) containing nucleotides. Applicant describes in certain embodiments short interfering nucleic acids that do not require the presence of nucleotides having a 2'-hydroxy group for mediating RNAi and as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group). Such siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups. Optionally, siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. The modified short interfering nucleic acid molecules of the invention can also be refeπed to as short interfering modified oligonucleotides "siMON." As used herein, the term siNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double- sfranded RNA (dsRNA), micro-RNA (miRNA), short haiφin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or epigenetics. For example, siNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre- franscriptional level. In a non-limiting example, epigenetic regulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure to alter gene expression (see, for example, AUshire, 2002, Science, 297, 1818-1819; Volpe et al, 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al, 2002, Science, 297, 2232-2237).
By "modulate" is meant that the expression of the gene, or level of RNA molecule or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator. For example, the term "modulate" can mean "inhibit," but the use of the word "modulate" is not limited to this definition. By "inhibit", "down-regulate", or "reduce", it is meant that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, is reduced below that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention. In one embodiment, inhibition, down-regulation or reduction with an siNA molecule is below that level observed in the presence of an inactive or attenuated molecule. In another embodiment, inhibition, down-regulation, or reduction with siNA molecules is below that level observed in the presence of, for example, an siNA molecule with scrambled sequence or with mismatches. In another embodiment, inhibition, down-regulation, or reduction of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
By "gene" or "target gene" is meant, a nucleic acid that encodes an RNA, for example, nucleic acid sequences including, but not limited to, structural genes encoding a polypeptide. The target gene can be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes such as genes of a pathogen, for example a viras, which is present in the cell after infection thereof. The cell containing the target gene can be derived from or contained in any organism, for example a plant, animal, protozoan, viras, bacterium, or fungus. Non-limiting examples of plants include monocots, dicots, or gymnosperms. Non- limiting examples of animals include vertebrates or invertebrates. Non-limiting examples of fungi include molds or yeasts.
By "BCR-ABL" is meant, a BCR-ABL polypeptide, protein and/or a polynucleotide encoding a BCR-ABL protein (such as BCR-ABL fusion polynucleotides refeπed to in Table I or any other BCR-ABL transcript derived from a BCR-ABL fusion gene).
By "BCR-ABL protein" is meant, a BCR-ABL peptide or protein or a component thereof, wherein the peptide or protein is encoded by a BCR-ABL gene.
By "ERG" is meant, a polypeptide or protein comprising an Ets family type fransciption factor or fusion variant thereof or polynucleotide encoding an Ets family type transcription factor or fusion variant thereof (such as ERG fusion polynucleotides refeπed to in Table I or any other ERG transcript derived from an ERG fusion gene).
By "ERG protein" is meant, a ERG peptide or protein or a component thereof, wherein the peptide or protein is encoded by a ERG or ERG fusion gene.
By "cancer" is meant a group of diseases characterized by uncontrolled growth and spread of abnormal cells, hi certain embodiments, the term cancer as used herein refers to leukemia, such as chronic myelogenous leukemia (CML) resulting from the BCR-ABL fusion gene.
By "highly conserved sequence region" is meant, a nucleotide sequence of one or more regions in a target gene does not vary significantly from one generation to the other or from one biological system to the other.
By "sense region" is meant a nucleotide sequence of a siNA molecule having complementarity to an antisense region of the siNA molecule. In addition, the sense region of a siNA molecule can comprise a nucleic acid sequence having homology with a target nucleic acid sequence.
By "antisense region" is meant a nucleotide sequence of a siNA molecule having complementarity to a target nucleic acid sequence. In addition, the antisense region of a siNA molecule can optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule.
By "target nucleic acid" is meant any nucleic acid sequence whose expression or activity is to be modulated. The target nucleic acid can be DNA or RNA.
By "complementarity" is meant that a nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. In reference to the nucleic molecules of the present invention, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al, 1987, CSH Symp. Quant. Biol. LII ρp.123-133; Frier et al, 1986, Proc. Nat. Acad. Sci. USA 83:9373-9377; Turner et al, 1987, J. Am. Chem. Soc. 109:3783-3785). A percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
The siNA molecules of the invention represent a novel therapeutic approach to freat various diseases and conditions, including cancer (e.g. leukemia such as CML) and any other indications that can respond to the level of BCR-ABL in a cell or tissue.
The siRNA molecules of the invention also represent a novel therapeutic approach to freat a treat a broad spectrum of oncology and neovascularization-related indications, including but not limited to cancers of the lung, colon, breast, prostate, cervix, lymphoma, Ewing's sarcoma and related tumors, melanoma, angiogenic disease states such as tumor angiogenesis, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis such as rheumatoid arthritis, psoriasis, verruca vulgaris, angiofibroma of tuberous sclerosis, port-wine stains, Sturge Weber syndrome, Kippel-Trenaunay- Weber syndrome, Osler-Weber-rendu syndrome, leukemias such as acute myeloid leukemia, osteoporosis, wound healing and other indications that can respond to the level of ERG in a cell or tissue.
In one embodiment of the present invention, each sequence of a siNA molecule of the invention is independently about 18 to about 24 nucleotides in length, in specific embodiments about 18, 19, 20, 21, 22, 23, or 24 nucleotides in length. In another embodiment, the siNA duplexes of the invention independently comprise about 17 to about 23 base pairs (e.g., about 17, 18, 19, 20, 21, 22 or 23). In yet another embodiment, siNA molecules of the invention comprising haiφin or circular structures are about 35 to about 55 (e.g, about 35, 40, 45, 50 or 55) nucleotides in length, or about 38 to about 44 (e.g., 38, 39, 40, 41, 42, 43 or 44) nucleotides in length and comprising about 16 to about 22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base pairs. Exemplary siNA molecules of the invention are shown in Table II. Exemplary synthetic siNA molecules of the invention are shown in Tables III and IV and/or Figures 4-5.
As used herein "cell" is used in its usual biological sense, and does not refer to an entire multicellular organism, e.g., specifically does not refer to a human. The cell can be present in an organism, e.g., birds, plants and mammals such as humans, cows, sheep, apes, monkeys, swine, dogs, and cats. The cell can be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell). The cell can be of somatic or germ line origin, totipotent or pluripotent, dividing or non-dividing. The cell can also be derived from or can comprise a gamete or embryo, a stem cell, or a fully differentiated cell.
The siNA molecules of the invention are added directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues. The nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their incoφoration in biopolymers. In particular embodiments, the nucleic acid molecules of the invention comprise sequences shown in Tables II-III and/or Figures 4-5. Examples of such nucleic acid molecules consist essentially of sequences defined in these tables and figures. Furthermore, the chemically modified consfructs described in Table IV can be applied to any siNA sequence of the invention.
In another aspect, the invention provides mammalian cells containing one or more siNA molecules of this invention. The one or more siNA molecules can independently be targeted to the same or different sites.
By "RNA" is meant a molecule comprising at least one ribonucleotide residue. By "ribonucleotide" is meant a nucleotide with a hydroxyl group at the 2' position of a β-D-ribo- furanose moiety. The terms include double-stranded RNA, single-stranded RNA, isolated
RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occuπing RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non- naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be refeπed to as analogs or analogs of naturally-occurring RNA.
By "subject" is meant an organism, which is a donor or recipient of explanted cells or the cells themselves. "Subject" also refers to an organism to which the nucleic acid molecules of the invention can be administered. In one embodiment, a subject is a mammal or mammalian cells. In another embodiment, a subject is a human or human cells.
The term "phosphorothioate" as used herein refers to an intemucleotide linkage having Formula I, wherein Z and/or W comprise a sulfur atom. Hence, the term phosphorothioate refers to both phosphorothioate and phosphorodithioate intemucleotide linkages.
The term "universal base" as used herein refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them. Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nifroazole derivatives such as 3-nifropyπole, 4- nitroindole, 5-nitroindole, and 6-nifroindole as known in the art (see for example Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).
The term "acyclic nucleotide" as used herein refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbons (Cl, C2, C3, C4, or C5), are independently or in combination absent from the nucleotide.
The nucleic acid molecules of the instant invention, individually, or in combination or in conjunction with other drags, can be used to freat diseases or conditions discussed herein (e.g., cancers and othe proliferative conditions). For example, to freat a particular disease or condition, the siNA molecules can be administered to a subject or can be administered to other appropriate cells evident to those skilled in the art, individually or in combination with one or more dmgs under conditions suitable for the treatment. In a further embodiment, the siNA molecules can be used in combination with other known treatments to treat conditions or diseases discussed above. For example, the described molecules could be used in combination with one or more known therapeutic agents to freat a disease or condition. Non-limiting examples of other therapeutic agents that can be readily combined with a siNA molecule of the invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies such as monoclonal antibodies, small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
In one embodiment, the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention, in a manner which allows expression of the siNA molecule. For example, the vector can contain sequence(s) encoding both strands of a siNA molecule comprising a duplex. The vector can also contain sequence(s) encoding a single nucleic acid molecule that is self-complementary and thus forms a siNA molecule. Non-limiting examples of such expression vectors are described in Paul et al, 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al, 2002, Nature Biotechnology, 19, 500; and Novina et al, 2002, Nature Medicine, advance online publication doi: 10.1038/nm725.
In another embodiment, the invention features a mammalian cell, for example, a human cell, including an expression vector of the invention.
In yet another embodiment, the expression vector of the invention comprises a sequence for a siNA molecule having complementarity to a RNA molecule refeπed to by a Genbank Accession numbers, for example Genbank Accession Nos. shown in Table I.
hi one embodiment, an expression vector of the invention comprises a nucleic acid sequence encoding two or more siNA molecules, which can be the same or different.
In another aspect of the invention, siNA molecules that interact with target RNA molecules and down-regulate gene encoding target RNA molecules (for example target RNA molecules refeπed to by Genbank Accession numbers herein) are expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated vims, retrovims, adenovirus, or alphavirus. The recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of siNA molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the siNA molecules bind and down-regulate gene function or expression via RNA interference (RNAi). Delivery of siNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reinfroduction into the subject, or by any other means that would allow for introduction into the desired target cell.
By "vectors" is meant any nucleic acid- and/or viral-based technique used to deliver a desired nucleic acid.
Other features and advantages of the invention will be apparent from the following description of the prefeπed embodiments thereof, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows a non-limiting example of a scheme for the synthesis of siNA molecules. The complementary siNA sequence sfrands, sfrand 1 and strand 2, are synthesized in tandem and are connected by a cleavable linkage, such as a nucleotide succinate or abasic succinate, which can be the same or different from the cleavable linker used for solid phase synthesis on a solid support. The synthesis can be either solid phase or solution phase, in the example shown, the synthesis is a solid phase synthesis. The synthesis is performed such that a protecting group, such as a dimethoxytrityl group, remains intact on the terminal nucleotide of the tandem oligonucleotide. Upon cleavage and deprotection of the oligonucleotide, the two siNA sfrands spontaneously hybridize to form a siNA duplex, which allows the purification of the duplex by utilizing the properties of the terminal protecting group, for example by applying a trityl on purification method wherein only duplexes/oligonucleotides with the terminal protecting group are isolated. Figure 2 shows a MALDI-TOV mass spectrum of a purified siNA duplex synthesized by a method of the invention. The two peaks shown coπespond to the predicted mass of the separate siNA sequence sfrands. This result demonstrates that the siNA duplex generated from tandem synthesis can be purified as a single entity using a simple trityl-on purification methodology.
Figure 3 shows a non-limiting proposed mechanistic representation of target RNA degradation involved in RNAi. Double-stranded RNA (dsRNA), which is generated by RNA-dependent RNA polymerase (RdRP) from foreign single-stranded RNA, for example viral, transposon, or other exogenous RNA, activates the DICER enzyme that in turn generates siNA duplexes. Alternately, synthetic or expressed siNA can be infroduced directly into a cell by appropriate means. An active siNA complex forms which recognizes a target RNA, resulting in degradation of the target RNA by the RISC endonuclease complex or in the synthesis of additional RNA by RNA-dependent RNA polymerase (RdRP), which can activate DICER and result in additional siNA molecules, thereby amplifying the RNAi response.
Figure 4A-F shows non-limiting examples of chemically-modified siNA constracts of the present invention. In the figure, N stands for any nucleotide (adenosine, guanosine, cytosine, uridine, or optionally thymidine, for example thymidine can be substituted in the overhanging regions designated by parenthesis (N N). Various modifications are shown for the sense and antisense strands of the siNA consfructs.
Figure 4 A: The sense sfrand comprises 21 nucleotides having four phosphorothioate 5'- and 3 '-terminal intemucleotide linkages, wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-O- methyl or 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand comprises 21 nucleotides, optionally having a 3'- terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and having one 3 '-terminal phosphorothioate intemucleotide linkage and four 5'-terminal phosphorothioate intemucleotide linkages and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
Figure 4B: The sense sfrand comprises 21 nucleotides wherein the two terminal 3'- nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-O-methyl or 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
Figure 4C: The sense sfrand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-O-methyl or 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense sfrand comprises 21 nucleotides, optionally having a 3'-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and having one 3 '-terminal phosphorothioate internucleotide linkage and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
Figure 4D: The sense sfrand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and wherein and all purine nucleotides that may be present are 2'-deoxy nucleotides. The antisense strand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3'- nucleotides are optionally complementary to the target RNA sequence, and having one 3'- terminal phosphorothioate intemucleotide linkage and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
Figure 4E: The sense sfrand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense sfrand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
Figure 4F: The sense strand comprises 21 nucleotides having 5'- and 3'- terminal cap moieties wherein the two terminal 3 '-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense sfrand comprises 21 nucleotides, optionally having a 3 '-terminal glyceryl moiety and wherein the two terminal 3 '-nucleotides are optionally complementary to the target RNA sequence, and having one 3'-terminal phosphorothioate intemucleotide linkage and wherein all pyrimidine nucleotides that may be present are 2'-deoxy-2'-fluoro modified nucleotides and all purine nucleotides that may be present are 2'-deoxy nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand of consfructs A-F comprise sequence complementary to any target nucleic acid sequence of the invention.
Figure 5A-F shows non-limiting examples of specific chemically-modified siNA sequences of the invention. A-F applies the chemical modifications described in Figure 4A- F to a BCR-ABL siNA sequence.
Figure 6 shows non-limiting examples of different siNA constracts of the invention. The examples shown (constructs 1, 2, and 3) have 19 representative base pairs; however, different embodiments of the invention include any number of base pairs described herein. Bracketed regions represent nucleotide overhangs, for example comprising about 1, 2, 3, or 4 nucleotides in length, preferably about 2 nucleotides. Constracts 1 and 2 can be used independently for RNAi activity. Constmct 2 can comprise a polynucleotide or non- nucleotide linker, which can optionally be designed as a biodegradable linker. In one embodiment, the loop structure shown in construct 2 can comprise a biodegradable linker that results in the formation of construct 1 in vivo and/or in vitro. In another example, constract 3 can be used to generate constract 2 under the same principle wherein a linker is used to generate the active siNA constract 2 in vivo and/or in vitro, which can optionally utilize another biodegradable linker to generate the active siNA constract 1 in vivo and/or in vitro. As such, the stability and/or activity of the siNA constracts can be modulated based on the design of the siNA construct for use in vivo or in vitro and/or in vitro.
Figure 7A-C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate siNA haiφin consfructs.
Figure 7A: A DNA oligomer is synthesized with a 5 '-restriction site (RI) sequence followed by a region having sequence identical (sense region of siNA) to a predetermined BCR-ABL target sequence, wherein the sense region comprises, for example, about 19, 20,
21, or 22 nucleotides (N) in length, which is followed by a loop sequence of defined sequence (X), comprising, for example, about 3 to about 10 nucleotides. Figure 7B: The synthetic constract is then extended by DNA polymerase to generate a haiφin stracture having self-complementary sequence that will result in a siNA transcript having specificity for a BCR-ABL target sequence and having self-complementary sense and antisense regions.
Figure 7C: The construct is heated (for example to about 95 °C) to linearize the sequence, thus allowing extension of a complementary second DNA strand using a primer to the 3 '-restriction sequence of the first sfrand. The double-sfranded DNA is then inserted into an appropriate vector for expression in cells. The construct can be designed such that a 3'- terminal nucleotide overhang results from the transcription, for example by engineering restriction sites and or utilizing a poly-U termination region as described in Paul et al, 2002, Nature Biotechnology, 29, 505-508.
Figure 8A-C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate double-sfranded siNA constructs.
Figure 8A: A DNA oligomer is synthesized with a 5 '-restriction (RI) site sequence followed by a region having sequence identical (sense region of siNA) to a predetermined
BCR-ABL target sequence, wherein the sense region comprises, for example, about 19, 20,
21, or 22 nucleotides (N) in length, and which is followed by a 3 '-restriction site (R2) which is adjacent to a loop sequence of defined sequence (X).
Figure 8B: The synthetic construct is then extended by DNA polymerase to generate a haiφin stracture having self-complementary sequence.
Figure 8C: The constmct is processed by restriction enzymes specific to RI and R2 to generate a double-sfranded DNA which is then inserted into an appropriate vector for expression in cells. The transcription cassette is designed such that a U6 promoter region flanks each side of the dsDNA which generates the separate sense and antisense strands of the siNA. Poly T termination sequences can be added to the constracts to generate U overhangs in the resulting transcript. Figure 9A-E is a diagrammatic representation of a method used to determine target sites for siNA mediated RNAi within a particular target nucleic acid sequence, such as messenger RNA.
Figure 9A: A pool of siNA oligonucleotides are synthesized wherein the antisense region of the siNA constracts has complementarity to target sites across the target nucleic acid sequence, and wherein the sense region comprises sequence complementary to the antisense region of the siNA.
Figure 9B&C: (Figure 9B) The sequences are pooled and are inserted into vectors such that (Figure 9C) fransfection of a vector into cells results in the expression of the siNA.
Figure 9D: Cells are sorted based on phenotypic change that is associated with modulation of the target nucleic acid sequence.
Figure 9E: The siNA is isolated from the sorted cells and is sequenced to identify efficacious target sites within the target nucleic acid sequence.
Figure 10 shows non-limiting examples of different stabilization chemistries (1-10) that can be used, for example, to stabilize the 3 '-end of siNA sequences of the invention, including (1) [3 -3'] -inverted deoxyribose; (2) deoxyribonucleotide; (3) [5'-3']-3'- deoxyribonucleotide; (4) [5'-3']-ribonucleotide; (5) [5'-3']-3 '-O-methyl ribonucleotide; (6) 3'- glyceryl; (7) [3'-5']-3'-deoxyribonucleotide; (8) [3 '-3'] -deoxyribonucleotide; (9) [5'-2'j- deoxyribonucleotide; and (10) [5-3']-dideoxyribonucleotide. In addition to modified and unmodified backbone chemistries indicated in the figure, these chemistries can be combined with different backbone modifications as described herein, for example, backbone modifications having Formula I. In addition, the 2'-deoxy nucleotide shown 5' to the terminal modifications shown can be another modified or unmodified nucleotide or non- nucleotide described herein, for example modifications having any of Formulae I-VII or any combination thereof.
Figure 11 shows a non-limiting example of a strategy used to identify chemically modified siNA consfructs of the invention that are nuclease resistance while preserving the ability to mediate RNAi activity. Chemical modifications are introduced into the siNA constract based on educated design parameters (e.g. infroducing 2'-mofications, base modifications, backbone modifications, terminal cap modifications etc). The modified constmct in tested in an appropriate system (e.g. human semm for nuclease resistance, shown, or an animal model for PK/delivery parameters). In parallel, the siNA constract is tested for RNAi activity, for example in a cell culture system such as a luciferase reporter assay). Lead siNA constmcts are then identified which possess a particular characteristic while maintaining RNAi activity, and can be further modified and assayed once again. This same approach can be used to identify siNA-conjugate molecules with improved pharmacokinetic profiles, delivery, and RNAi activity.
Figure 12 A-F shows non-limiting examples of specific chemically-modified siNA sequences of the invention. A-F applies the chemical modifications described in Figure 4A- F to a ERG siNA sequence.
Figure 13 shows a non-limiting example of reduction of ERG2 mRNA in DLDl cells mediated by siNAs that target ERG2 mRNA. DLDl cells were fransfected with 0.25 ug/well of lipid complexed with 25 nM siNA. A screen of siNA constracts comprising ribonucleotides and 3 '-terminal dithymidine caps was compared to untreated cells, scrambled siNA confrol constructs (Scraml and Scram2), and cells fransfected with lipid alone (transfection control). As shown in the figure, all of the siNA constructs significantly reduce ERG2 RNA expression.
DETAILED DESCRIPTION OF THE INVENTION
Mechanism of action of Nucleic Acid Molecules of the Invention
The discussion that follows discusses the proposed mechanism of RNA interference mediated by short interfering RNA as is presently known, and is not meant to be limiting and is not an admission of prior art. Applicant demonsfrates herein that chemically-modified short interfering nucleic acids possess similar or improved capacity to mediate RNAi as do siRNA molecules and are expected to possess improved stability and activity in vivo; therefore, this discussion is not meant to be limiting only to siRNA and can be applied to siNA as a whole. By "improved capacity to mediate RNAi" or "improved RNAi activity" is meant to include RNAi activity measured in vitro and/or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention. In this invention, the product of these activities can be increased in vitro and/or in vivo compared to an all RNA siRNA or a siNA containing a plurality of ribonucleotides. In some cases, the activity or stability of the siNA molecule can be decreased (i.e., less than ten-fold), but the overall activity of the siNA molecule is enhanced in vitro and/or in vivo.
RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al, 1998, Nature, 391, 806). The coπesponding process in plants is commonly refeπed to as post- transcriptional gene silencing or RNA silencing and is also refeπed to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily- conserved cellular defense mechanism used to prevent the expression of foreign genes which is commonly shared by diverse flora and phyla (Fire et al, 1999, Trends Genet, 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-sfranded RNAs (dsRNAs) derived from viral infection or the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2', 5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme refeπed to as Dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al, 2001, Nature, 409, 363). Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved stracture that are implicated in translational confrol (Hutvagner et al, 2001, Science, 293, 834). The RNAi response also features an endonuclease complex containing a siRNA, commonly refeπed to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the guide sequence of the siRNA duplex (Elbashir et al, 2001, Genes Dev., 15, 188). In addition, RNA interference can also involve small RNA (e.g., micro-RNA or miRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin stracture and thereby prevent franscription of target gene sequences (see for example AUshire, 2002, Science, 297, 1818-1819; Volpe et al, 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al, 2002, Science, 297, 2232-2237). As such, siNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional level or post-transcriptional level.
RNAi has been studied in a variety of systems. Fire et al, 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol, 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al, 2000, Nature, 404, 293, describe RNAi in Drosophila cells fransfected with dsRNA. Elbashir et al, 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21- nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates has revealed certain requirements for siRNA length, stracture, chemical composition, and sequence that are essential to mediate efficient RNAi activity. These studies have shown that 21 nucleotide siRNA duplexes are most active when containing two 2-nucleotide 3'-terminal nucleotide overhangs. Furthermore, substitution of one or both siRNA strands with 2'-deoxy or 2'-O-methyl nucleotides abolishes RNAi activity, whereas substitution of 3 '-terminal siRNA nucleotides with deoxy nucleotides was shown to be tolerated. Mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5'-end of the siRNA guide sequence rather than the 3'-end (Elbashir et al, 2001, EMBO , 20, 6877). Other studies have indicated that a 5'-phosphate on the target-complementary sfrand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5'- phosphate moiety on the siRNA (Nykanen et al, 2001, Cell, 107, 309); however, siRNA molecules lacking a 5'-phosphate are active when introduced exogenously, suggesting that 5'- phosphorylation of siRNA constracts may occur in vivo.
Synthesis of Nucleic acid Molecules
Synthesis of nucleic acids greater than 100 nucleotides in length is difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. In this invention, small nucleic acid motifs ("small" refers to nucleic acid motifs no more than 100 nucleotides in length, preferably no more than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length; e.g., individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) are preferably used for exogenous delivery. The simple structure of these molecules increases the ability of the nucleic acid to invade targeted regions of protein and/or RNA structure. Exemplary molecules of the instant invention are chemically synthesized, and others can similarly be synthesized.
Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) are synthesized using protocols known in the art, for example as described in Camthers et al, 1992, Methods in Enzymology 211, 3-19, Thompson et al, International PCT Publication No. WO 99/54459, Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al, 1997, Methods Mol. Bio., 74, 59, Brennan et al, 1998, Biotechnol Bioeng, 61, 33-45, and Brennan, U.S. Pat. No. 6,001,311. All of these references are incoφorated herein by reference. The synthesis of oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end. In a non-limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 μmol scale protocol with a 2.5 min coupling step for 2'-O-methylated nucleotides and a 45 sec coupling step for 2'-deoxy nucleotides or 2'-deoxy-2'-fluoro nucleotides. Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle. Alternatively, syntheses at the 0.2 μmol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, CA) with minimal modification to the cycle. A 33-fold excess (60 μL of 0.11 M = 6.6 μmol) of 2'-O-methyl phosphoramidite and a 105- fold excess of S-ethyl tefrazole (60 μL of 0.25 M = 15 μmol) can be used in each coupling cycle of 2'-O-methyl residues relative to polymer-bound 5'-hydroxyl. A 22-fold excess (40 μL of 0.11 M = 4.4 μmol) of deoxy phosphoramidite and a 70-fold excess of S-ethyl tefrazole (40 μL of 0.25 M = 10 μmol) can be used in each coupling cycle of deoxy residues relative to polymer-bound 5'-hydroxyl. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10%) acetic anhydride/10% 2,6-lutidine in THF (ABI); and oxidation solution is 16.9 mM I2, 49 mM pyridine, 9% water in THF (PERSEPTIVE™). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltefrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H- l,2-Benzodithiol-3-one 1,1 -dioxide, 0.05 M in acetonitrile) is used.
Deprotection of the DΝA-based oligonucleotides is performed as follows: the polymer- bound trityl-on oligoribonucleotide is transfeπed to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65 °C for 10 min. After cooling to -20 °C, the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCΝ:H2O/3:l:l, vortexed and the supernatant is then added to the first supernatant. The combined supematants, containing the oligoribonucleotide, are dried to a white powder.
The method of synthesis used for RNA including certain siNA molecules of the invention follows the procedure as described in Usman et al, 1987, J. Am. Chem. Soc, 109, 7845; Scaringe et al, 1990, Nucleic Acids Res., 18, 5433; and Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684 Wincott et al, 1997, Methods Mol Bio., 74, 59, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5 '-end, and phosphoramidites at the 3'-end. In a non-limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 μmol scale protocol with a 7.5 min coupling step for alkylsilyl protected nucleotides and a 2.5 min coupling step for 2'-O-methylated nucleotides. Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle. Alternatively, syntheses at the 0.2 μmol scale can be done on a 96-well plate synthesizer, such as the instrament produced by Protogene (Palo Alto, CA) with minimal modification to the cycle. A 33-fold excess (60 μL of 0.11 M = 6.6 μmol) of 2'-O-methyl phosphoramidite and a 75-fold excess of S-ethyl tetrazole (60 μL of 0.25 M = 15 μmol) can be used in each coupling cycle of 2 '-O-methyl residues relative to polymer-bound 5'-hydroxyl. A 66-fold excess (120 μL of 0.11 M = 13.2 μmol) of alkylsilyl (ribo) protected phosphoramidite and a 150-fold excess of S-ethyl tetrazole (120 μL of 0.25 M = 30 μmol) can be used in each coupling cycle of ribo residues relative to polymer-bound 5'-hydroxyl. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6- lutidine in THF (ABI); oxidation solution is 16.9 mM I2, 49 mM pyridine, 9% water in THF (PERSEPTIVE™). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltefrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-l,2-Benzodithiol-3-one l,l-dioxide0.05 M in acetonitrile) is used.
Deprotection of the RΝA is performed using either a two-pot or one-pot protocol. For the two-pot protocol, the polymer-bound trityl-on oligoribonucleotide is fransfeπed to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65 °C for 10 min. After cooling to -20 °C, the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCΝ:H2O/3:l:l, vortexed and the supernatant is then added to the first supernatant. The combined supematants, containing the oligoribonucleotide, are dried to a white powder. The base deprotected oligoribonucleotide is resuspended in anhydrous TEA/HF/NMP solution (300 μL of a solution of 1.5 mL N- methylpyπolidinone, 750 μL TEA and 1 mL TEAβHF to provide a 1.4 M HF concenfration) and heated to 65 °C. After 1.5 h, the oligomer is quenched with 1.5 M NH4HCO3.
Alternatively, for the one-pot protocol, the polymer-bound trityl-on oligoribonucleotide is transfeπed to a 4 mL glass screw top vial and suspended in a solution of 33% ethanolic methylamine/DMSO: 1/1 (0.8 mL) at 65 °C for 15 min. The vial is brought to rt. TEA-3HF (0.1 mL) is added and the vial is heated at 65 °C for 15 min. The sample is cooled at -20 °C and then quenched with 1.5 M NH4HCO3.
For purification of the trityl-on oligomers, the quenched NH4HCO3 solution is loaded onto a C-l 8 containing cartridge that had been prewashed with acetonitrile followed by 50 mM TEAA. After washing the loaded cartridge with water, the RNA is detritylated with 0.5% TFA for 13 min. The cartridge is then washed again with water, salt exchanged with 1 M NaCI and washed with water again. The oligonucleotide is then eluted with 30% acetonitrile.
The average stepwise coupling yields are typically >98% (Wincott et al, 1995 Nucleic Acids Res. 23, 2677-2684). Those of ordinary skill in the art will recognize that the scale of synthesis can be adapted to be larger or smaller than the example described above including but not limited to 96-well format.
Alternatively, the nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al, 1992, Science 256, 9923; Draper et al, hitemational PCT publication No. WO 93/23569; Shabarova et al, 1991, Nucleic Acids Research 19, 4247; Bellon et al, 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al, 1997, Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
The siNA molecules of the invention can also be synthesized via a tandem synthesis methodology as described in Example 1 herein, wherein both siNA sfrands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate siNA fragments or sfrands that hybridize and permit purification of the siNA duplex. The linker can be a polynucleotide linker or a non- nucleotide linker. The tandem synthesis of siNA as described herein can be readily adapted to both multiwell/multiplate synthesis platforms such as 96 well or similarly larger multi-well platforms. The tandem synthesis of siNA as described herein can also be readily adapted to large scale synthesis platforms employing batch reactors, synthesis columns and the like.
A siNA molecule can also be assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the RNA molecule.
The nucleic acid molecules of the present invention can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, -C- allyl, 2'-fluoro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al, 1994, Nucleic Acids Symp. Ser. 31, 163). siNA constracts can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al, supra, the totality of which is hereby incoφorated herein by reference) and re-suspended in water.
In another aspect of the invention, siNA molecules of the invention are expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constracted based on, but not limited to, adeno-associated vims, retrovims, adenovims, or alphavims. The recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of siNA molecules.
Optimizing Activity of the nucleic acid molecule of the invention.
Chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by semm ribonucleases, which can increase their potency (see e.g., Eckstein et al, International Publication No. WO 92/07065; Peπault et al, 1990 Nature 344, 565; Pieken et al, 1991, Science 253, 314; Usman and Cedergren, 1992, Trends in Biochem. Sci. 17, 334; Usman et al, International Publication No. WO 93/15187; and Rossi et al, International Publication No. WO 91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al, U.S. Pat. No. 6,300,074; and Burgin et al, supra; all of which are incoφorated by reference herein). AU of the above references describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules described herein. Modifications that enhance their efficacy in cells, and removal of bases from nucleic acid molecules to shorten oligonucleotide synthesis times and reduce chemical requirements are desired.
There are several examples in the art describing sugar, base and phosphate modifications that can be infroduced into nucleic acid molecules with significant enhancement in their nuclease stability and efficacy. For example, oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-0-methyl, 2'-O- allyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992, TIBS. 17, 34; Usman et al, 1994, Nucleic Acids Symp. Ser. 31, 163; Burgin et al, 1996, Biochemistry, 35, 14090). Sugar modification of nucleic acid molecules have been extensively described in the art (see Eckstein et al, International Publication PCT No. WO 92/07065; Peπault et al. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314- 317; Usman and Cedergren, Trends in Biochem. Sci. , 1992, 17, 334-339; Usman et al. International Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711 and Beigelman et al, 1995, J. Biol. Chem., 270, 25702; Beigelman et al, Intemational PCT publication No. WO 97/26270; Beigelman et al, U.S. Pat. No. 5,716,824; Usman et al, U.S. Pat. No. 5,627,053; Woolf et al, International PCT Publication No. WO 98/13526; Thompson et al, USSN 60/082,404 which was filed on April 20, 1998; Kaφeisky et al, 1998, Tetrahedron Lett., 39, 1131; Eamshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al, 1997, Bioorg. Med. Chem., 5, 1999-2010; all of the references are hereby incoφorated in their totality by reference herein). Such publications describe general methods and sfrategies to determine the location of incoφoration of sugar, base and/or phosphate modifications and the like into nucleic acid molecules without modulating catalysis, and are incoφorated by reference herein. In view of such teachings, similar modifications can be used as described herein to modify the siNA nucleic acid molecules of the instant invention so long as the ability of siNA to promote RNAi is cells is not significantly inhibited.
While chemical modification of oligonucleotide intemucleotide linkages with phosphorothioate, phosphorodithioate, and/or 5'-methylphosphonate linkages improves stability, excessive modifications can cause some toxicity or decreased activity. Therefore, when designing nucleic acid molecules, the amount of these intemucleotide linkages should be minimized. The reduction in the concenfration of these linkages should lower toxicity, resulting in increased efficacy and higher specificity of these molecules.
Short interfering nucleic acid (siNA) molecules having chemical modifications that maintain or enhance activity are (provided. Such a nucleic acid is also generally more resistant to nucleases than an unmodified nucleic acid. Accordingly, the in vitro and/or in vivo activity should not be significantly lowered. In cases in which modulation is the goal, therapeutic nucleic acid molecules delivered exogenously should optimally be stable within cells until translation of the target RNA has been modulated long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the disease state. Improvements in the chemical synthesis of RNA and DNA (Wincott et al, 1995, Nucleic Acids Res. 23, 2677; Camthers et al, 1992, Methods in Enzymology 211,3-19 (incoφorated by reference herein)) have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability, as described above.
In one embodiment, nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc, 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in nucleic acid molecules of the invention results in both enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands. In another embodiment, nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA "locked nucleic acid" nucleotides such as a 2', 4'-C methylene bicyclo nucleotide (see for example Wengel et al, International PCT Publication No. WO 00/66604 and WO 99/14226).
In another embodiment, the invention features conjugates and or complexes of siNA molecules of the invention. Such conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell. The conjugates and complexes provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention. The present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes. In general, the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers. These compounds are expected to improve delivery and/or localization of nucleic acid molecules of the invention into a number of cell types originating from different tissues, in the presence or absence of serum (see Sullenger and Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
The term "biodegradable linker" as used herein, refers to a nucleic acid or non-nucleic acid linker molecule that is designed as a biodegradable linker to connect one molecule to another molecule, for example, a biologically active molecule to a siNA molecule of the invention or the sense and antisense strands of a siNA molecule of the invention. The biodegradable linker is designed such that its stability can be modulated for a particular puφose, such as delivery to a particular tissue or cell type. The stability of a nucleic acid- based biodegradable linker molecule can be modulated by using various chemistries, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically-modified nucleotides, such as 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino, 2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified nucleotides. The biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid molecule, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus-based linkage, for example, a phosphoramidate or phosphodiester linkage. The biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
The term "biodegradable" as used herein, refers to degradation in a biological system, for example enzymatic degradation or chemical degradation.
The term "biologically active molecule" as used herein, refers to compounds or molecules that are capable of eliciting or modifying a biological response in a system. Non- limiting examples of biologically active siNA molecules either alone or in combination with other molecules contemplated by the instant invention include therapeutically active molecules such as antibodies, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, 2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and analogs thereof. Biologically active molecules of the invention also include molecules capable of modulating the pharmacokinetics and/or pharmacodynamics of other biologically active molecules, for example, lipids and polymers such as polyamines, polyamides, polyethylene glycol and other polyethers.
The term "phospholipid" as used herein, refers to a hydrophobic molecule comprising at least one phosphorus group. For example, a phospholipid can comprise a phosphorus- containing group and saturated or unsaturated alkyl group, optionally substituted with OH, COOH, oxo, amine, or substituted or unsubstituted aryl groups.
Therapeutic nucleic acid molecules (e.g., siNA molecules) delivered exogenously optimally are stable within cells until reverse franscription of the RNA has been modulated long enough to reduce the levels of the RNA transcript. The nucleic acid molecules are resistant to nucleases in order to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of nucleic acid molecules described in the instant invention and in the art have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability as described above.
In yet another embodiment, siNA molecules having chemical modifications that maintain or enhance enzymatic activity of proteins involved in RNAi are provided. Such nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus, in vitro and/or in vivo the activity should not be significantly lowered.
Use of the nucleic acid-based molecules of the invention will lead to better freatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes; nucleic acid molecules coupled with known small molecule modulators; or intermittent freatment with combinations of molecules, including different motifs and/or other chemical or biological molecules). The freatment of subjects with siNA molecules can also include combinations of different types of nucleic acid molecules, such as enzymatic nucleic acid molecules (ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys, and aptamers.
In another aspect a siNA molecule of the invention comprises one or more 5' and/or a 3'- cap stracture, for example on only the sense siNA sfrand, the antisense siNA strand, or both siNA strands.
By "cap structure" is meant chemical modifications, which have been incoφorated at either terminus of the oligonucleotide (see, for example, Adamic et al, U.S. Pat. No. 5,998,203, incoφorated by reference herein). These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and may help in delivery and/or localization within a cell. The cap may be present at the 5'-terminus (5'-cap) or at the 3'- terminal (3 '-cap) or may be present on both termini. In non-limiting examples, the 5 '-cap is selected from the group consisting of glyceryl, inverted deoxy abasic residue (moiety); 4',5'- methylene nucleotide; l-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; tAreo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety; 3 '-3 '-inverted abasic moiety; 3 '-2 '-inverted nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol phosphate; 3 '-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3'-phosphate; 3 '-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety.
In non-limiting examples, the 3 '-cap is selected from the group consisting of glyceryl, inverted deoxy abasic residue (moiety), 4', 5 '-methylene nucleotide; l-(beta-D- erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; l,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; t/zreø-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety; 5 '-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate; 5'-amino; bridging and/or non-bridging 5 '-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging methylphosphonate and 5'-mercapto moieties (for more details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925; incoφorated by reference herein).
By the term "non-nucleotide" is meant any group or compound which can be incoφorated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity. The group or compound is abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a base at the 1 '-position.
An "alkyl" group refers to a saturated aliphatic hydrocarbon, including sfraight-chain, branched-chain, and cyclic alkyl groups. Preferably, the alkyl group has 1 to 12 carbons. More preferably, it is a lower alkyl of from 1 to 7 carbons, more preferably 1 to 4 carbons. The alkyl group can be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, =O, =S, NO2 or N(CH3)2, amino, or SH. The term also includes alkenyl groups that are unsaturated hydrocarbon groups containing at least one carbon-carbon double bond, including sfraight-chain, branched-chain, and cyclic groups. Preferably, the alkenyl group has 1 to 12 carbons. More preferably, it is a lower alkenyl of from 1 to 7 carbons, more preferably 1 to 4 carbons. The alkenyl group may be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, =O, =S, NO2, halogen, N(CH3)2, amino, or SH. The term "alkyl" also includes alkynyl groups that have an unsaturated hydrocarbon group containing at least one carbon-carbon triple bond, including straight-chain, branched-chain, and cyclic groups. Preferably, the alkynyl group has 1 to 12 carbons. More preferably, it is a lower alkynyl of from 1 to 7 carbons, more preferably 1 to 4 carbons. The alkynyl group may be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, =O, =S, NO2 or N(CH3)2, amino or SH.
Such alkyl groups can also include aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester groups. An "aryl" group refers to an aromatic group that has at least one ring having a conjugated pi electron system and includes carbocyclic aryl, heterocyclic aryl and biaryl groups, all of which may be optionally substituted. The prefeπed substituent(s) of aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino groups. An "alkylaryl" group refers to an alkyl group (as described above) covalently joined to an aryl group (as described above). Carbocyclic aryl groups are groups wherein the ring atoms on the aromatic ring are all carbon atoms. The carbon atoms are optionally substituted. Heterocyclic aryl groups are groups having from 1 to 3 heteroatoms as ring atoms in the aromatic ring and the remainder of the ring atoms are carbon atoms. Suitable heteroatoms include oxygen, sulfur, and nifrogen, and include furanyl, thienyl, pyridyl, pyπolyl, N-lower alkyl pyπolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted. An "amide" refers to an -C(O)-NH-R, where R is either alkyl, aryl, alkylaryl or hydrogen. An "ester" refers to an -C(O)-OR', where R is either alkyl, aryl, alkylaryl or hydrogen.
By "nucleotide" as used herein is as recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1' position of a nucleotide sugar moiety. Nucleotides generally comprise a base, sugar and a phosphate group. The nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety, (also refeπed to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other; see, for example, Usman and McSwiggen, supra; Eckstein et al, International PCT Publication No. WO 92/07065; Usman et al, International PCT Publication No. WO 93/15187; Uhlman & Peyman, supra, all are hereby incoφorated by reference herein). There are several examples of modified nucleic acid bases known in the art as summarized by Limbach et al, 1994, Nucleic Acids Res. 22, 2183. Some of the non-limiting examples of base modifications that can be infroduced into nucleic acid molecules include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3 -methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), propyne, and others (Burgin et al, 1996, Biochemistry, 35, 14090; Uhlman & Peyman, supra). By "modified bases" in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1' position or their equivalents.
In one embodiment, the invention features modified siNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, moφholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a review of oligonucleotide backbone modifications, see Hunziker and Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al, 1994, Novel Backbone Replacements for Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-39.
By "abasic" is meant sugar moieties lacking a base or having other chemical groups in place of a base at the 1' position, see for example Adamic et al, U.S. Pat. No. 5,998,203.
By "unmodified nucleoside" is meant one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1' carbon of β-D-ribo-furanose.
By "modified nucleoside" is meant any nucleotide base which contains a modification in the chemical stmcture of an unmodified nucleotide base, sugar and/or phosphate. Non- limiting examples of modified nucleotides are shown by Formulae I-VII and/or other modifications described herein.
In connection with 2'-modified nucleotides as described for the present invention, by
"amino" is meant 2'-NH2 or 2'-0- NH , which can be modified or unmodified. Such modified groups are described, for example, in Eckstein et al, U.S. Pat. No. 5,672,695 and
Matulic-Adamic et al, U.S. Pat. No. 6,248,878, which are both incoφorated by reference in their entireties.
Various modifications to nucleic acid siNA stmcture can be made to enhance the utility of these molecules. Such modifications will enhance shelf-life, half-life in vitro, stability, and ease of introduction of such oligonucleotides to the target site, e.g., to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
Administration of Nucleic Acid Molecules
A siRNA molecule of the invention can be adapted for use to freat for example cancer and other indications that can respond to the level of BCR-ABL and/or ERG in a cell or tissue, alone or in combination with other therapies. For example, a siNA molecule can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. Methods for the delivery of nucleic acid molecules are described in Akhtar et al, 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al, 1999, Mol. Membr. Biol, 16, 129-140; Hofland and Huang, 1999, Handb. Exp. Pharmacol, 137, 165-192; and Lee et al, 2000, ACS Symp. Ser., 752, 184-192, all of which are incoφorated herein by reference. Beigelman et al, U.S. Pat. No. 6,395,713 and Sullivan et al, PCT WO 94/02595 further describe the general methods for delivery of nucleic acid molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incoφoration into other vehicles, such as hydrogels, cyclodextrins (see for example Gonzalez et al, 1999, Bioconjugate Chem., 10, 1068-1074), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722). Alternatively, the nucleic acid/vehicle combination is locally delivered by direct injection or by use of an infusion pump. Direct injection of the nucleic acid molecules of the invention, whether subcutaneous, intramuscular, or intradermal, can take place using standard needle and syringe methodologies, or by needle-free technologies such as those described in Conry et al, 1999, Clin. Cancer Res., 5, 2330-2337 and Baπy et al, International PCT Publication No. WO 99/31262. The molecules of the instant invention can be used as pharmaceutical agents. Pharmaceutical agents prevent, modulate the occunence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a subject.
Thus, the invention features a pharmaceutical composition comprising one or more nucleic acid(s) of the invention in an acceptable carrier, such as a stabilizer, buffer, and the like. The polynucleotides of the invention can be administered (e.g., RNA, DNA or protein) and infroduced into a subject by any standard means, with or without stabilizers, buffers, and the like, to form a phaπnaceutical composition. When it is desired to use a liposome delivery mechanism, standard protocols for formation of liposomes can be followed. The compositions of the present invention can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for injectable administration, and the other compositions known in the art.
The present invention also includes pharmaceutically acceptable formulations of the compounds described. These formulations include salts of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
A pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, fransdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged nucleic acid is desirable for delivery). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
By "systemic administration" is meant in vivo systemic absoφtion or accumulation of drugs in the blood stream followed by distribution throughout the entire body. Administration routes that lead to systemic absoφtion mclude, without limitation: intravenous, subcutaneous, infraperitoneal, inhalation, oral, infrapulmonary and intramuscular. Each of these administration routes exposes the siNA molecules of the invention to an accessible diseased tissue. The rate of entry of a drag into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drag carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES). A liposome formulation that can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach can provide enhanced delivery of the drag to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as cells producing excess BCR-ABL and/or ERG. By "pharmaceutically acceptable formulation" is meant, a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity. Non-limiting examples of agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as Pluronic P85), which can enhance entry of drags into the CNS (JoUiet-Riant and Tillement, 1999, Fundam. Clin. Pharmacol, 13, 16-26); biodegradable polymers, such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich, DF et al, 1999, Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, MA); and loaded nanoparticles, such as those made of polybutylcyanoacrylate, which can deliver drags across the blood brain barrier and can alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999). Other non-limiting examples of delivery sfrategies for the nucleic acid molecules of the instant invention include material described in Boado et al, 1998, J. Pharm. Sci, 87, 1308-1315; Tyler et al, 1999, FEBS Lett, 421, 280-284; Pardridge et al, 1995, PNAS USA., 92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107; Aldrian-Henada et al, 1998, Nucleic Acids Res., 26, 4910-4916; and Tyler et al, 1999, PNAS USA., 96, 7053-7058.
The invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing the accumulation of drugs in target tissues. This class of drag carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al, Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al, Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Ada, 1238, 86-90). The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al, J. Biol. Chem. 1995, 42, 24864-24870; Choi et al, International PCT Publication No. WO 96/10391; Ansell et al, hitemational PCT Publication No. WO 96/10390; Holland et al, International PCT Publication No. WO 96/10392). Long-circulating liposomes are also likely to protect drags from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985), hereby incoφorated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of />-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.
A pharmaceutically effective dose is that dose required to prevent, inhibit the occunence, or freat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state. The pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concunent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
The nucleic acid molecules of the invention and formulations thereof can be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles. The term parenteral as used herein includes percutaneous, subcutaneous, mfravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like. In addition, there is provided a pharmaceutical formulation comprising a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier. One or more nucleic acid molecules of the invention can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients. The pharmaceutical compositions containing nucleic acid molecules of the invention can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
Compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic phamiaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, com starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absoφtion in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyπolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p- hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid
Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.
Pharmaceutical compositions of the invention can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions can also contain sweetening and flavoring agents.
Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents. The pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this puφose, any bland fixed oil can be employed including synthetic mono-or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
The nucleic acid molecules of the invention can also be administered in the form of suppositories, e.g., for rectal administration of the drag. These compositions can be prepared by mixing the drag with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter and polyethylene glycols.
Nucleic acid molecules of the invention can be administered parenterally in a sterile medium. The drug, depending on the vehicle and concenfration used, can either be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
Dosage levels of the order of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the freatment of the above-indicated conditions (about 0.5 mg to about 7 g per subject per day). The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host freated and the particular mode of administration. Dosage unit forms generally contain between from about 1 mg to about 500 mg of an active ingredient.
It is understood that the specific dose level for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of adminisfration, route of administration, and rate of excretion, drag combination and the severity of the particular disease undergoing therapy.
For administration to non-human animals, the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
In one embodiment, the invention comprises compositions suitable for administering nucleic acid molecules of the invention to specific cell types. For example, the asialoglycoprotein receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432) is unique to hepatocytes and binds branched galactose-terminal glycoproteins, such as asialoorosomucoid (ASOR). In another example, the folate receptor is overexpressed in many cancer cells. Binding of such glycoproteins, synthetic glycoconjugates, or folates to the receptor takes place with an affinity that strongly depends on the degree of branching of the oligosaccharide chain, for example, triatennary structures are bound with greater affinity than biatenany or monoatennary chains (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al, 1982, J. Biol. Chem., 257, 939-945). Lee and Lee, 1987, Glycoconjugate J, 4, 317-328, obtained this high specificity through the use of N-acetyl-D-galactosamine as the carbohydrate moiety, which has higher affinity for the receptor, compared to galactose. This "clustering effect" has also been described for the binding and uptake of mannosyl- terminating glycoproteins or glycoconjugates (Ponpipom et al, 1981, J. Med. Chem., 24, 1388-1395). The use of galactose, galactosamine, or folate based conjugates to transport exogenous compounds across cell membranes can provide a targeted delivery approach to, for example, the freatment of liver disease, cancers of the liver, or other cancers. The use of bioconjugates can also provide a reduction in the required dose of therapeutic compounds required for freatment. Furthermore, therapeutic bioavialability, pharmacodynamics, and pharmacokinetic parameters can be modulated through the use of nucleic acid bioconjugates of the invention. Non-limiting examples of such bioconjugates are described in Vargeese et al, USSN 10/201,394, filed August 13, 2001; and Matulic-Adamic et al, USSN 60/362,016, filed March 6, 2002.
Alternatively, certain siNA molecules of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weinfraub, 1985, Science, 229, 345; McGany and Lindquist, 1986, Proc. Natl. Acad. Sci, USA 83, 399; Scanlon et al, 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al, 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al, 1992, J. Virol, 66, 1432-41; Weerasinghe et al, 1991, J. Virol, 65, 5531-4; Ojwang et al, 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen et al, 1992, Nucleic Acids Res., 20, 4581-9; Sarver et al, 1990 Science, 247, 1222-1225; Thompson et al, 1995, Nucleic Acids Res., 23, 2259; Good et al, 1997, Gene Therapy, 4, 45. Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al, PCT WO 93/23569, and Sullivan et al, PCT WO 94/02595; Ohkawa et al, 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira et al, 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al, 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al, 1994, J. Biol. Chem., 269, 25856.
In another aspect of the invention, RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al, 1996, TIG., 12, 510) inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, adeno- associated viras, retrovirus, adenovirus, or alphavirus. In another embodiment, pol III based constracts are used to express nucleic acid molecules of the invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and 6,146,886). The recombinant vectors capable of expressing the siNA molecules can be delivered as described above, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the siNA molecule interacts with the target mRNA and generates an RNAi response. Delivery of siNA molecule expressing vectors can be systemic, such as by intravenous or infra-muscular adminisfration, by administration to target cells ex-planted from a subject followed by reinfroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al, 1996, TIG., 12, 510).
In one aspect the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the instant invention. The expression vector can encode one or both sfrands of a siNA duplex, or a single self-complementary strand that self hybridizes into a siNA duplex. The nucleic acid sequences encoding the siNA molecules of the instant invention can be operably linked in a manner that allows expression of the siNA molecule (see for example Paul et al, 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al, 2002, Nature Biotechnology', 19, 500; and Novina et al, 2002, Nature Medicine, advance online publication doi: 10.1038/nm725).
In another aspect, the invention features an expression vector comprising: a) a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a franscription termination region (e.g., eukaryotic pol I, II or III termination region); and c) a nucleic acid sequence encoding at least one of the siNA molecules of the instant invention; wherein said sequence is operably linked to said initiation region and said termination region, in a manner that allows expression and/or delivery of the siNA molecule. The vector can optionally include an open reading frame (ORF) for a protein operably linked on the 5' side or the 3 '-side of the sequence encoding the siNA of the invention; and/or an infron (intervening sequences).
Transcription of the siNA molecule sequences can be driven from a promoter for eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol III). Transcripts from pol II or pol III promoters are expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby. Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci US A, 87, 6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72; Lieber et al, 1993, Methods Enzymol, 217, 47-66; Zhou et al, 1990, Mol. Cell. Biol, 10, 4529-37). Several investigators have demonstrated that nucleic acid molecules expressed from such promoters can function in mammalian cells (e.g. Kashani-Sabet et al, 1992, Antisense Res. Dev., 2, 3- 15; Ojwang et al, 1992, Proc. Natl. Acad. Sci. U S A, 89, 10802-6; Chen et al, 1992, Nucleic Acids Res., 20, 4581-9; Yu et al, 1993, Proc. Natl. Acad. Sci. USA, 90, 6340-4; L'Huillier et al, 1992, EMBO , 11, 4411-8; Lisziewicz et al, 1993, Proc. Natl. Acad. Sci. U. S. A, 90, 8000-4; Thompson et al, 1995, Nucleic Acids Res., 23, 2259; Sullenger & Cech, 1993, Science, 262, 1566). More specifically, franscription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA (tRNA) and adenovims VA RNA are useful in generating high concentrations of desired RNA molecules such as siNA in cells (Thompson et al, supra; Couture and Stinchcomb, 1996, supra; Noonberg et al, 1994, Nucleic Acid Res., 22, 2830; Noonberg et al, U.S. Pat. No. 5,624,803; Good et al, 1997, Gene Tlier., 4, 45; Beigelman et al, International PCT Publication No. WO 96/18736. The above siNA franscription units can be incoφorated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated vims vectors), or viral RNA vectors (such as retroviral or alphavims vectors) (for a review see Couture and Stinchcomb, 1996, supra).
In another aspect the invention features an expression vector comprising a nucleic acid sequence encoding at least one of the siNA molecules of the invention in a manner that allows expression of that siNA molecule. The expression vector comprises in one embodiment; a) a transcription initiation region; b) a transcription termination region; and c) a nucleic acid sequence encoding at least one sfrand of the siNA molecule, wherein the sequence is operably linked to the initiation region and the termination region in a manner that allows expression and/or delivery of the siNA molecule.
In another embodiment the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an open reading frame; and d) a nucleic acid sequence encoding at least one sfrand of a siNA molecule, wherein the sequence is operably linked to the 3 '-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the open reading frame and the termination region in a manner that allows expression and/or delivery of the siNA molecule. In yet another embodiment, the expression vector comprises: a) a franscription initiation region; b) a transcription termination region; c) an intron; and d) a nucleic acid sequence encoding at least one siNA molecule, wherein the sequence is operably linked to the initiation region, the intron and the termination region in a manner which allows expression and/or delivery of the nucleic acid molecule.
In another embodiment, the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an intron; d) an open reading frame; and e) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3'-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the infron, the open reading frame and the termination region in a manner which allows expression and/or delivery of the siNA molecule.
BCR-ABL biology and biochemistry
Transformation is a cumulative process whereby normal confrol of cell growth and differentiation is interrupted, usually through the accumulation of mutations affecting the expression of genes that regulate cell growth and differentiation. More than 70% of hematopoietic malignancies have been shown to possess recunent chromosomal translocations. The underlying mechanism of chromosomal translocation can be classified as either gene fusion or transcriptional deregulation. The gene fusion mechanism involves two genes that are joined into one, resulting in a chimeric RNA transcript which makes a chimeric protein product. Since the chimeric protein is not found in any normal tissue, it can serve as a tumor specific marker in identifying disease. A related change in protein function can confer a growth advantage leading to malignant transformation. Non-limiting examples of gene fusion products include BCR-ABL, PML-RAR-alpha, and MLL/LTG4, 9, 19. The transcriptional deregulation mechanism does not involve the generation of chimeric protein, but rather juxtaposes one gene to a target gene, thereby transcriptionally deregulating the target gene. This type of translocation is frequently found in lymphomas, such as the Myc translocation in Burkitt's lymphoma; the BCL2 translocation in follicular lymphoma; and BCL1 in mantle cell lymphoma.
Chronic myelogenous leukemia (also called chronic myeloid leukemia or CML) exhibits a characteristic disease course, presenting initially as a chronic granulocytic hypeφlasia, and invariably evolving into an acute leukemia which is caused by the clonal expansion of a cell with a less differentiated phenotype, resulting in the blast crisis stage of the disease. CML is an unstable disease that ultimately progresses to a terminal stage which resembles acute leukemia. This lethal disease affects approximately 16,000 patients a year. Chemotherapeutic agents, such as hydroxyurea or busulfan, can reduce the leukemic burden but do not impact the life expectancy of the patient (which is approximately 4 years). Consequently, CML patients are candidates for bone manow transplantation (BMT) therapy. However, for those patients who survive BMT, disease recuπence remains a major obstacle.
The Philadelphia (Ph) chromosome which results from the translocation of the abl oncogene from chromosome 9 to the BCR gene on chromosome 22 is found in greater than
95% of CML patients and in 10-25% of all cases of acute lymphoblastic leukemia. In virtually all Ph-positive CMLs and approximately 50% of the Ph-positive ALLs, the leukemic cells express BCR-ABL fusion mRNAs in which exon 2 (b2-a2 junction) or exon 3
(b3-a2 junction) from the major breakpoint cluster region of the BCR gene is spliced to exon 2 of the ABL gene. In the remaining cases of Ph-positive ALL, the first exon of the BCR gene is spliced to exon 2 of the ABL gene. The b3-a2 and b2-a2 fusion mRNAs encode 210 kd BCR-ABL fusion proteins which exhibit oncogenic activity through increased tyrosine kinase activity. The BCR-ABL tyrosine kinase elicits oncogenic transformation through the constitutive stimulation of specific signal transduction pathways. Several mechanisms have been proposed to explain how BCR-ABL fransforms cells. For example, BCR-ABL has been shown to block apoptosis, increase cell proliferation, alter cell adhesion and increase cell motility.
With the exception of CML, chronic myeloproliferative disorders (CMPDs) are a heterogeneous spectrum of conditions for which the molecular pathogenesis is not well understood. Most cases have a normal or aneuploid karyotype, but a minority present with a reciprocal translocation that dismpts specific tyrosine kinase genes, most commonly PDGFRB or FGFR1. These translocations result in the production of constitutively active tyrosine kinase fusion proteins that deregulate hemopoiesis in a manner analogous to BCR- ABL. The chimeric product type of translocation in acute promyelocytic leukemia, which has t(15;17)(q22; q21), involves the promyelocytic leukemia (PML) gene. Although the function of PML still remains to be elucidated, the translocation to the Retinoid receptor A interapts its regulatory region, resulting in deregulation of gene function, most likely through the differentiation block at a stage where this function is required.
The use of small interfering nucleic acid molecules targeting chromosomal translocation genes therefore provides a useful class of novel therapeutic agents that can be used in the treatment of leukemias, lymphomas and/or any other disease or condition that can result from chomosomal translocation events.
ERG biology and biochemistry
ERG is a member of the Ets oncogene superfamily of transcription factors which share common DNA binding domains yet differ in their fransactivation domains. The Ets family of franscription factors are implicated in the control of the constitutive expression of a wide variety of genes. In hematopoietic cells, the Ets family appears to be important in the early stages of lymphocyte cell-type specification. ERG has been identified during anayed cDNA library screens for genes encoding transcription factors expressed specifically during T cell lineage commitment. ERG expression is induced during T-cell lineage specification and is subsequently silenced permanently (Anderson et al, 1999, Development, 126(14), 3131- 3148). ERG is reananged in human myeloid leukemia with t(16;21) chromosomal translocation. This reaπangement generates the TLS-ERG oncogene which is associated with poor prognosis human acute myeloid leukemia (AML), secondary AML associated with myelodysplastic syndrom (MDS), and chronic myeloid leukemia (CML) in blast crisis (Kong et al., 1991, Blood, 90, 1192-1199). The altered transcriptional activating and DNA-binding activities of the TLS-ERG gene product are implicated in the genesis or progression of t(16;21))-associated human myeloid leukemias (Prasad et al, 1994, Oncogene, 9, 3717- 3729). In addition, retroviral transduction of TLS-ERG has been shown to initiate a leukemogenic program in normal human hematopoietic cells (Pereira et al, 1998, PNAS USA, 95, 8239-8244).
The expression of several members of the Ets family of franscription factors, including ERG, coπelates with the occunence of invasive processes such as angiogenesis, including endothelial cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, during normal and pathological development (for review see Mattot et al, 1999, J. Soc. Biol, 193(2), 147-153 and Soncin et al, 1999, Pathol Biol, 47(4), 358-363). Ets family franscription factors, including ERG, have been implicated in the upregulation of human heme oxygenase gene expression. Overexpression of human heme oxygenase-1 has been shown to have the potential to promote endothelial cell proliferation and angiogenesis. Ets binding sites in regulatory sequences of heme oxygenase-1 have been identified. As such, Ets family frascriptional regulation of human heme oxygenase may play an important role in coronary collateral circulation, tumor growth, angiogenesis, and hemoglobin induced endothelial cell injury (Deramaudt et al, 1999, J. Cell. Biochem., 72(3), 311-321).
The Ets, Fos, and Jun fransciption factors confrol the expression of stromelysin-1 and collagenase-1 genes that encode two matrix metalloproteinases implicated in normal growth and development, as well as in tumor invasion and metastasis. It has been shown that the Ets transcription factors interact with each other and with the c-Fos/c-Jun complex via distinct protein domains in both a DNA-dependent and independent manner (Basuyaux et al, 1997, J. Biol. Chem., 272(42), 26188-95). Moreover, ERG activates collagenase-1 gene by physically interacting with c-Fos/c-Jun (Buttice et al, 1996, Oncogene, 13(11), 2297-2306). Altered expression of ERG is associated with genetic translocations on chromosome 21 in immortal and cervical carcinoma cell lines (Simpson et al, 1997, Oncogene, 14(18), 2149- 2157). An additional translocation fusion product of ERG, EWS-ERG, has been identified in a large proportion of Ewing family tumors as a transcriptional activator (Sorensen et al, 1994, Nat. Genet, 6(2), 146-151). Expression of the EWS-ERG fusion protein has been shown to be essential for maintaining the oncogenic and tumorigenic properties of certain human tumor cells via inhibition of apoptosis (Yi et al, 1997, Oncogene, 14(11), 1259- 1268). Hart et al, 1995, Oncogene, 10(7), 1423-30, describe human ERG as a proto- oncogene with mitogenic and transforming activity. Transfection of NIH3T3 cells with an ERG expression constract driven by the sheep metallothionein la promoter (sMTERG) results in cells that become moφhologically altered, non-serum and non-anchorage dependant, and result in the formation of solid tumors when injected in nude mice (Hart et al, supra).
The endothelium, which lines the blood vessels and acts as a barrier between blood and tissues, plays an important role in maintaining vascular homeostasis. The endothelium regulates processes such as leukocyte infiltration, coagulation, and maintains the integrity of cell-cell junctions. Proliferation of endothelial cells, which occurs in angiogenesis, is a tightly controlled process that can occur in a physiological state (e.g. in wound healing and the menstrual cycle) but also occurs in a disease. Endothelial activation is involved in diseases such as cancer and metastasis, rheumatoid arthritis, cataract formation, atherosclerosis, thrombosis and many others. Inflammatory mediators such as the pleiofropic cytokine TNF-alpha alter the resting phenotype of the endothelium such that it becomes pro- inflammatory, pro-thrombotic and often pro-angiogenic. The ensuing changes in gene regulation have been extensively studied and involve the up-regulation of inflammatory cell adhesion molecules ICAM-1, E-selectin and VCAM-1 and pro-thrombotic proteins such as tissue factor, both in vifro and in vivo (McEver, 1991, Thrombosis and Haemostasis, 65, 223; Saadi et al, 1995, J. Exp. Med, 182, 1807). The role of TNF-alpha in modulating angiogenesis has been demonstrated in vivo but the evidence of an effect in vitro is less clear and in some cases conflicting. TNF-alpha is pro-angiogenic in rabbit comeal and chick chorioallantoic membrane in vivo models (Frater-Schroder et al, 1987, PNAS USA, 84, 5277; Leibovich et al, 1987, Nature, 329, 630) and more recently in rheumatoid arthritis patients, anti-TNF-alpha therapy decreased circulating levels of vascular endothelial growth factor (VEGF) (Paleolog, 1997, Molecular Pathology, 50, 225). In vitro, TNF-alpha can induce basic fibroblast growth factor (bFGF), platelet activated factor (PAF) and urokinase- type plasminogen activator (u-TPA), all of which are angiogenic and increase transcription of the VEGF receptor (VEGFR-2). On the contrary, TNF-alpha can also inhibit endothelial cell proliferation in vifro and cause tumor regression (Carswell et al, 1975, PNAS USA, 72, 3666). The mechanisms by which TNF-alpha mediates these effects on cell proliferation/angiogenesis are unclear and may involve regulation of genes which are not involved in the pro-inflammatory mode of action of this cytokine.
Studies on the effects of TNF-alpha on endothelial genes have shown that TNF-alpha down-regulates the transcription factor ERG in human umbilical vein endothelial cells (HUVEC) (McLaughlin et al, 1999, J. of Cell Science, 112, 4695). ERG is a member of the Ets family of franscription factors which play roles in embryonic development, inflammation, and cellular transformation. An 85 amino acid Ets domain is conserved throughout the family and is necessary for binding a GGAA core DNA binding site. ERG is a proto-oncogene as shown by the ability of NIH3T3 cells overexpressing ERG to form solid tumors in nude mice. Although downstream targets of ERG have not been clearly identified, in vifro evidence exists which suggests that an ERG cDNA can fransactivate the vWF, ICAM-2, VE-Cadherin and collagenase promoters using reporter gene assays and purified ERG/GST protein or ERG from endothelial cell nuclear extracts can bind to the VE- Cadherin, stromelysin and vWF promoter Ets sites (McLaughlin et al, supra).
Examples:
The following are non-limiting examples showing the selection, isolation, synthesis and activity of nucleic acids of the instant invention.
Example 1 : Tandem synthesis of siNA constracts
Exemplary siNA molecules of the invention are synthesized in tandem using a cleavable linker, for example, a succinyl-based linker. Tandem synthesis as described herein is followed by a one-step purification process that provides RNAi molecules in high yield. This approach is highly amenable to siNA synthesis in support of high throughput RNAi screening, and can be readily adapted to multi-column or multi-well synthesis platforms.
After completing a tandem synthesis of a siNA oligo and its complement in which the
5'-terminal dimethoxytrityl (5'-O-DMT) group remains intact (trityl on synthesis), the oligonucleotides are deprotected as described above. Following deprotection, the siNA sequence sfrands are allowed to spontaneously hybridize. This hybridization yields a duplex in which one strand has retained the 5'-O-DMT group while the complementary sfrand comprises a terminal 5'-hydroxyl. The newly formed duplex behaves as a single molecule during routine solid-phase extraction purification (Trityl-On purification) even though only one molecule has a dimethoxytrityl group. Because the sfrands form a stable duplex, this dimethoxytrityl group (or an equivalent group, such as other trityl groups or other hydrophobic moieties) is all that is required to purify the pair of oligos, for example, by using a C18 cartridge.
Standard phosphoramidite synthesis chemistry is used up to the point of infroducing a tandem linker, such as an inverted deoxy abasic succinate or glyceryl succinate linker (see Figure 1) or an equivalent cleavable linker. A non-limiting example of linker coupling conditions that can be used includes a hindered base such as diisopropylethylamme (DIP A) and/or DMAP in the presence of an activator reagent such as Bromotripyπolidinophosphoniumhexaflurorophosphate (PyBrOP). After the linker is coupled, standard synthesis chemisfry is utilized to complete synthesis of the second sequence leaving the terminal the 5'-O-DMT intact. Following synthesis, the resulting oligonucleotide is deprotected according to the procedures described herein and quenched with a suitable buffer, for example with 50mM NaOAc or 1.5M NH4H2CO3.
Purification of the siNA duplex can be readily accomplished using solid phase exfraction, for example using a Waters C18 SepPak lg cartridge conditioned with 1 column volume (CV) of acetonitrile, 2 CV H2O, and 2 CV 50mM NaOAc. The sample is loaded and then washed with 1 CV H2O or 50mM NaOAc. Failure sequences are eluted with 1 CV 14% ACN (Aqueous with 50mM NaOAc and 50mM NaCI). The column is then washed, for example with 1 CV H2O followed by on-column detritylation, for example by passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) over the column, then adding a second CV of 1% aqueous TFA to the column and allowing to stand for approximately 10 minutes. The remaining TFA solution is removed and the column washed with H20 followed by 1 CV IM NaCI and additional H2O. The siNA duplex product is then eluted, for example, using 1 CV 20% aqueous CAN. Figure 2 provides an example of MALDI-TOV mass spectrometry analysis of a purified siNA constmct in which each peak coπesponds to the calculated mass of an individual siNA sfrand of the siNA duplex. The same purified siNA provides three peaks when analyzed by capillary gel elecfrophoresis (CGE), one peak presumably conesponding to the duplex siNA, and two peaks presumably conesponding to the separate siNA sequence strands. Ion exchange HPLC analysis of the same siNA confract only shows a single peak. Testing of the purified siNA constract using a luciferase reporter assay described below demonsfrated the same RNAi activity compared to siNA constracts generated from separately synthesized oligonucleotide sequence strands.
Example 2: Identification of potential siNA target sites in any RNA sequence
The sequence of an RNA target of interest, such as a viral or human mRNA franscript, is screened for target sites, for example, by using a computer folding algorithm. In a non- limiting example, the sequence of a gene or RNA gene franscript derived from a database, such as Genbank, is used to generate siNA targets having complementarity to the target. Such sequences can be obtained from a database, or can be determined experimentally as known in the art. Target sites that are known, for example, those target sites determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or antisense, or those targets known to be associated with a disease or condition such as those sites containing mutations or deletions, can be used to design siNA molecules targeting those sites. Various parameters can be used to determine which sites are the most suitable target sites within the target RNA sequence. These parameters include but are not limited to secondary or tertiary RNA structure, the nucleotide base composition of the target sequence, the degree of homology between various regions of the target sequence, or the relative position of the target sequence within the RNA franscript. Based on these determinations, any number of target sites within the RNA transcript can be chosen to screen siNA molecules for efficacy, for example by using in vitro RNA cleavage assays, cell culture, or animal models. In a non-limiting example, anywhere from 1 to 1000 target sites are chosen within the franscript based on the size of the siNA construct to be used. High throughput screening assays can be developed for screening siNA molecules using methods known in the art, such as with multi-well or multi-plate assays to determine efficient reduction in target gene expression.
Example 3: Selection of siNA molecule target sites in a RNA
The following non-limiting steps can be used to cany out the selection of siNAs targeting a given gene sequence or franscript.
1. The target sequence is parsed in silico into a list of all fragments or subsequences of a particular length, for example 23 nucleotide fragments, contained within the target sequence. This step is typically caπied out using a custom Perl script, but commercial sequence analysis programs such as Oligo, Mac Vector, or the GCG Wisconsin Package can be employed as well.
2. In some instances the siNAs conespond to more than one target sequence; such would be the case for example in targeting different transcripts of the same gene, targeting different franscripts of more than one gene, or for targeting both the human gene and an animal homolog. In this case, a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find matching sequences in each list. The subsequences are then ranked according to the number of target sequences that contain the given subsequence; the goal is to find subsequences that are present in most or all of the target sequences. Alternately, the ranking can identify subsequences that are unique to a target sequence, such as a mutant target sequence. Such an approach would enable the use of siNA to target specifically the mutant sequence and not effect the expression of the normal sequence.
3. In some instances the siNA subsequences are absent in one or more sequences while present in the desired target sequence; such would be the case if the siNA targets a gene with a paralogous family member that is to remain untargeted. As in case 2 above, a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find sequences that are present in the target gene but are absent in the untargeted paralog. 4. The ranked siNA subsequences can be further analyzed and ranked according to GC content. A preference can be given to sites containing 30-70% GC, with a further preference to sites containing 40-60% GC.
5. The ranked siNA subsequences can be further analyzed and ranked according to self- folding and internal haiφins. Weaker internal folds are prefened; strong haiφin structures are to be avoided.
6. The ranked siNA subsequences can be further analyzed and ranked according to whether they have runs of GGG or CCC in the sequence. GGG (or even more Gs) in either sfrand can make oligonucleotide synthesis problematic and can potentially interfere with RNAi activity, so it is avoided whenever better sequences are available. CCC is searched in the target strand because that will place GGG in the antisense strand.
7. The ranked siNA subsequences can be further analyzed and ranked according to whether they have the dinucleotide UU (uridine dinucleotide) on the 3 '-end of the sequence, and/or AA on the 5'-end of the sequence (to yield 3' UU on the antisense sequence). These sequences allow one to design siNA molecules with terminal TT thymidine dinucleotides.
8. Four or five target sites are chosen from the ranked list of subsequences as described above. For example, in subsequences having 23 nucleotides, the right 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the upper (sense) sfrand of the siNA duplex, while the reverse complement of the left 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the lower (antisense) strand of the siNA duplex (see Tables II and III). If terminal TT residues are desired for the sequence (as described in paragraph 7), then the two 3' terminal nucleotides of both the sense and antisense sfrands are replaced by TT prior to synthesizing the oligos.
9. The siNA molecules are screened in an in vitro, cell culture or animal model system to identify the most active siNA molecule or the most prefened target site within the target RNA sequence. In an alternate approach, a pool of siNA consfructs specific to a BCR-ABL and/or ERG target sequence is used to screen for target sites in cells expressing BCR-ABL and/or ERG RNA, such as human cultured chronic myelogenous leukemic cells (e.g., K562, HUVEC or HeLa cells). The general strategy used in this approach is shown in Figure 9. A non-limiting example of such is a pool comprising sequences having sense sequences comprising SEQ ID NOs. 1-263, 527-845, 1165-1182, 1201-1218, 1589-1596, 1601-1604, 1609-1612, 1617-1620, 1625-1628, 1632-1636, 1641-1644, 1237-1412, 1597-1600, 1649- 1652, 1657-1660, and 1665-1668 and antisense sequences comprising SEQ ID NOs. 264- 526, 846-1164, 1183-1200, 1219-1236, 1605-1608, 1613-1616, 1621-1624, 1629-1631, 1637-1640, 1645-1648, 1413-1588, 1653-1656, 1661-1664, and 1669-1672 respectively. K562, HUVEC or HeLa cells expressing BCR-ABL and/or ERG are fransfected with the pool of siNA consfructs and cells that demonstrate a phenotype associated with BCR-ABL and/or ERG inhibition are sorted. The pool of siNA constructs can be expressed from transciption cassettes inserted into appropriate vectors (see for example Figure 7 and Figure 8). The siNA from cells demonstrating a positive phenotypic change (e.g., decreased proliferation, decreased BCR-ABL and/or ERG mRNA levels or decreased BCR-ABL and/or ERG protein expression), are sequenced to determine the most suitable target site(s) within the target BCR-ABL and/or ERG RNA sequence.
Example 4: BCR-ABL and/or ERG targeted siNA design
siNA target sites were chosen by analyzing sequences of the BCR-ABL and/or ERG
RNA target and optionally prioritizing the target sites on the basis of folding (stmcture of any given sequence analyzed to determine siNA accessibility to the target), by using a library of siNA molecules as described in Example 3, or alternately by using an in vitro siNA system as described in Example 6 herein. siNA molecules were designed that could bind each target and are optionally individually analyzed by computer folding to assess whether the siNA molecule can interact with the target sequence. Varying the length of the siNA molecules can be chosen to optimize activity. Generally, a sufficient number of complementary nucleotide bases are chosen to bind to, or otherwise interact with, the target RNA, but the degree of complementarity can be modulated to accommodate siNA duplexes or varying length or base composition. By using such methodologies, siNA molecules can be designed to target sites within any known RNA sequence, for example those RNA sequences conesponding to the any gene franscript.
Chemically modified siNA consfructs are designed to provide nuclease stability for systemic administration in vivo and/or improved pharmacokinetic, localization, and delivery properties while preserving the ability to mediate RNAi activity. Chemical modifications as described herein are infroduced synthetically using synthetic methods described herein and those generally known in the art. The synthetic siNA constructs are then assayed for nuclease stability in serum and/or cellular/tissue extracts (e.g. liver extracts). The synthetic siNA constracts are also tested in parallel for RNAi activity using an appropriate assay, such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity. Synthetic siNA constructs that possess both nuclease stability and RNAi activity can be further modified and re-evaluated in stability and activity assays. The chemical modifications of the stabilized active siNA constracts can then be applied to any siNA sequence targeting any chosen RNA and used, for example, in target screening assays to pick lead siNA compounds for therapeutic development (see for example Figure 11).
Example 5: Chemical Synthesis and Purification of siNA
siNA molecules can be designed to interact with various sites in the RNA message, for example, target sequences within the RNA sequences described herein. The sequence of one strand of the siNA molecule(s) is complementary to the target site sequences described above. The siNA molecules can be chemically synthesized using methods described herein. Inactive siNA molecules that are used as confrol sequences can be synthesized by scrambling the sequence of the siNA molecules such that it is not complementary to the target sequence. Generally, siNA constracts can by synthesized using solid phase oligonucleotide synthesis methods as described herein (see for example Usman et al, US Patent Nos. 5,804,683; 5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117; 6,469,158; Scaringe et al, US Patent Nos. 6,111,086; 6,008,400; 6,111,086 all incoφorated by reference herein in their entirety). In a non-limiting example, RNA oligonucleotides are synthesized in a stepwise fashion using the phosphoramidite chemisfry as is known in the art. Standard phosphoramidite chemistry involves the use of nucleosides comprising any of 5'-O-dimethoxytrityl, 2'-O-tert- butyldimethylsilyl, 3'-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2- isobutyryl guanosine). Alternately, 2'-O-Silyl Ethers can be used in conjunction with acid- labile 2 '-O-orthoester protecting groups in the synthesis of RNA as described by Scaringe supra. Differing 2' chemistries can require different protecting groups, for example 2'- deoxy-2' -amino nucleosides can utilize N-phthaloyl protection as described by Usman et al, US Patent 5,631,360, incoφorated by reference herein in its entirety).
During solid phase synthesis, each nucleotide is added sequentially (3'- to 5 '-direction) to the solid support-bound oligonucleotide. The first nucleoside at the 3 '-end of the chain is covalently attached to a solid support (e.g., confrolled pore glass or polystyrene) using various linkers. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are combined resulting in the coupling of the second nucleoside phosphoramidite onto the 5'- end of the first nucleoside. The support is then washed and any unreacted 5 '-hydroxyl groups are capped with a capping reagent such as acetic anhydride to yield inactive 5 '-acetyl moieties. The trivalent phosphoms linkage is then oxidized to a more stable phosphate linkage. At the end of the nucleotide addition cycle, the 5'-O-protecting group is cleaved under suitable conditions (e.g., acidic conditions for trityl-based groups and Fluoride for silyl-based groups). The cycle is repeated for each subsequent nucleotide.
Modification of synthesis conditions can be used to optimize coupling efficiency, for example by using differing coupling times, differing reagent/phosphoramidite concentrations, differing contact times, differing solid supports and solid support linker chemistries depending on the particular chemical composition of the siNA to be synthesized. Deprotection and purification of the siNA can be performed as is generally described in Usman et al., US 5,831,071, US 6,353,098, US 6,437,117, and Bellon et al., US 6,054,576, US 6,162,909, US 6,303,773, incoφorated by reference herein in their entirety or Scaringe supra. Additionally, deprotection conditions can be modified to provide the best possible yield and purity of siNA consfructs. For example, applicant has observed that oligonucleotides comprising 2 '-deoxy-2 '-fluoro nucleotides can degrade under inappropriate deprotection conditions. Such oligonucleotides are deprotected using aqueous methylamine at about 35°C for 30 minutes. If the 2 '-deoxy-2 '-fluoro containing oligonucleotide also comprises ribonucleotides, after deprotection with aqueous methylamine at about 35°C for 30 minutes, TEA-HF is added and the reaction maintained at about 65°C for an additional 15 minutes.
Example 6: RNAi in vitro assay to assess siNA activity
An in vitro assay that recapitulates RNAi in a cell-free system is used to evaluate siNA constmcts targeting BCR-ABL and/or ERG RNA targets. The assay comprises the system described by Tuschl et al, 1999, Genes and Development, 13, 3191-3197 and Zamore et al, 2000, Cell, 101, 25-33 adapted for use with BCR-ABL and/or ERG target RNA. A Drosophila extract derived from syncytial blastoderm is used to reconstitute RNAi activity in vitro. Target RNA is generated via in vitro transcription from an appropriate BCR-ABL and/or ERG expressing plasmid using T7 RNA polymerase or via chemical synthesis as described herein. Sense and antisense siNA sfrands (for example 20 uM each) are annealed by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 min. at 90°C followed by 1 hour at 37°C , then diluted in lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2mM magnesium acetate). Annealing can be monitored by gel electrophoresis on an agarose gel in TBE buffer and stained with ethidium bromide. The Drosophila lysate is prepared using zero to two-hour-old embryos from Oregon R flies collected on yeasted molasses agar that are dechorionated and lysed. The lysate is centrifuged and the supernatant isolated. The assay comprises a reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM final concenfration), and 10% [vol/vol] lysis buffer containing siNA (10 nM final concentration). The reaction mixture also contains 10 mM creatine phosphate, 10 ug.ml creatine phosphokinase, 100 urn GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL RNasin (Promega), and 100 uM of each amino acid. The final concentration of potassium acetate is adjusted to 100 mM. The reactions are pre-assembled on ice and preincubated at 25° C for 10 minutes before adding RNA, then incubated at 25° C for an additional 60 minutes. Reactions are quenched with 4 volumes of 1.25 x Passive Lysis Buffer (Promega). Target RNA cleavage is assayed by RT-PCR analysis or other methods known in the art and are compared to control reactions in which siNA is omitted from the reaction.
Alternately, internally-labeled target RNA for the assay is prepared by in vitro transcription in the presence of [alpha-32p] CTP, passed over a G 50 Sephadex column by spin chromatography and used as target RNA without further purification. Optionally, target
RNA is 5'-32p-end labeled using T4 polynucleotide kinase enzyme. Assays are performed as described above and target RNA and the specific RNA cleavage products generated by RNAi are visualized on an autoradiograph of a gel. The percentage of cleavage is determined by
Phosphor Imager® quantitation of bands representing intact control RNA or RNA from control reactions without siNA and the cleavage products generated by the assay.
In one embodiment, this assay is used to determine target sites the BCR-ABL and or ERG RNA target for siNA mediated RNAi cleavage, wherein a plurality of siNA consfructs are screened for RNAi mediated cleavage of the BCR-ABL and/or ERG RNA target, for example, by analyzing the assay reaction by elecfrophoresis of labeled target RNA, or by northern blotting, as well as by other methodology well known in the art.
Example 7: Nucleic acid inhibition of BCR-ABL and/or ERG target RNA in vivo siNA molecules targeted to the human BCR-ABL and or ERG RNA are designed and synthesized as described above. These nucleic acid molecules can be tested for cleavage activity in vivo, for example, using the following procedure. The target sequences and the nucleotide location within the BCR-ABL and or ERG RNA are given in Table II and III.
Two formats are used to test the efficacy of siNAs targeting BCR-ABL and/or ERG. First, the reagents are tested in cell culture using, for example, cultured chronic myelogenous leukemic cells (e.g., K562, HUVEC or HeLa cells) to determine the extent of RNA and protein inhibition. siNA reagents (e.g.; see Tables II and III) are selected against the BCR- ABL and/or ERG target as described herein. RNA inhibition is measured after delivery of these reagents by a suitable transfection agent to, for example, K562, HUVEC or HeLa cells. Relative amounts of target RNA are measured versus actin using real-time PCR monitoring of amplification (eg., ABI 7700 Taqman®). A comparison is made to a mixture of oligonucleotide sequences made to unrelated targets or to a randomized siNA control with the same overall length and chemisfry, but randomly substituted at each position. Primary and secondary lead reagents are chosen for the target and optimization performed. After an optimal transfection agent concenfration is chosen, a RNA time-course of inhibition is performed with the lead siNA molecule. In addition, a cell-plating format can be used to deteπnine RNA inhibition.
Delivery of siNA to Cells
Cells (e.g., K562, HUVEC or HeLa cells) are seeded, for example, at lxl 0^ cells per well of a six-well dish in EGM-2 (BioWhittaker) the day before transfection. siNA (final concenfration, for example 20nM) and cationic lipid (e.g., final concentration 2μg/ml) are complexed in EGM basal media (Biowhittaker) at 37°C for 30 mins in polystyrene tubes.
Following vortexing, the complexed siNA is added to each well and incubated for the times indicated. For initial optimization experiments, cells are seeded, for example, at 1x10^ in 96 well plates and siNA complex added as described. Efficiency of delivery of siNA to cells is determined using a fluorescent siNA complexed with lipid. Cells in 6-well dishes are incubated with siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde for 15 minutes at room temperature. Uptake of siNA is visualized using a fluorescent microscope.
Taqman and Lightcycler quantification of mRNA
Total RNA is prepared from cells following siNA delivery, for example, using Qiagen RNA purification kits for 6-well or Rneasy exfraction kits for 96-well assays. For Taqman analysis, dual-labeled probes are synthesized with the reporter dye, FAM or JOE, covalently linked at the 5 '-end and the quencher dye TAMRA conjugated to the 3 '-end. One-step RT- PCR amplifications are performed on, for example, an ABI PRISM 7700 Sequence Detector using 50 μl reactions consisting of 10 μl total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, IX TaqMan PCR reaction buffer (PE-Applied Biosystems), 5.5 mM MgCl2, 300 μM each dATP, dCTP, dGTP, and dTTP, 10U RNase Inhibitor (Promega), 1.25U AmpliTaq Gold (PE-Applied Biosystems) and 10U M-MLV Reverse Transcriptase (Promega). The thermal cycling conditions can consist of 30 min at 48°C, 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. Quantitation of mRNA levels is determined relative to standards generated from serially diluted total cellular RNA (300, 100, 33, 11 ng/rxn) and normalizing to β-actin or GAPDH mRNA in parallel TaqMan reactions. For each gene of interest an upper and lower primer and a fluorescently labeled probe are designed. Real time incoφoration of SYBR Green I dye into a specific PCR product can be measured in glass capillary tubes using a lightcyler. A standard curve is generated for each primer pair using control cRNA. Values are represented as relative expression to GAPDH in each sample.
Western blotting
Nuclear exfracts can be prepared using a standard micro preparation technique (see for example Andrews and Faller, 1991, Nucleic Acids Research, 19, 2499). Protein extracts from supematants are prepared, for example using TCA precipitation. An equal volume of 20% TCA is added to the cell supernatant, incubated on ice for 1 hour and pelleted by centrifugation for 5 minutes. Pellets are washed in acetone, dried and resuspended in water. Cellular protein exfracts are ran on a 10% Bis-Tris NuPage (nuclear exfracts) or 4-12% Tris- Glycine (supernatant exfracts) polyacrylamide gel and fransfeπed onto nifro-cellulose membranes. Non-specific binding can be blocked by incubation, for example, with 5% nonfat milk for 1 hour followed by primary antibody for 16 hour at 4°C. Following washes, the secondary antibody is applied, for example (1:10,000 dilution) for 1 hour at room temperature and the signal detected with SuperSignal reagent (Pierce).
Example 8: Models useful to evaluate the down-regulation of BCR-ABL gene expression
Cell Culture
There are numerous cell culture systems that can be used to analyze reduction of BCR- ABL levels either directly or indirectly by measuring downstream effects. For example, cultured human chronic myelogenous leukemic cells (e.g., K562, HUVEC or HeLa cells) can be used in cell culture experiments to assess the efficacy of nucleic acid molecules of the invention. As such, K562, HUVEC or HeLa cells treated with nucleic acid molecules of the invention (e.g., siNA) targeting BCR-ABL RNA would be expected to have decreased BCR- ABL expression capacity compared to matched control nucleic acid molecules having a scrambled or inactive sequence. In a non-limiting example, human chronic myelogenous leukemic cells (K562, HUVEC or HeLas) are cultured and BCR-ABL expression is quantified, for example by time-resolved immunofluorometric assay. BCR-ABL messenger- RNA expression is quantitated with RT-PCR in cultured K562, HUVEC or HeLas. Unfreated cells are compared to cells freated with siNA molecules fransfected with a suitable reagent, for example a cationic lipid such as lipofectamine, and BCR-ABL protein and RNA levels are quantitated. Dose response assays are then performed to establish dose dependent inhibition of BCR-ABL expression. In another non-limiting example, cell culture experiments are canied out as described by Wilda et al, 2002, Oncogene, 21, 5716.
In several cell culture systems, cationic lipids have been shown to enhance the bioavailability of oligonucleotides to cells in culture (Bennet, et al, 1992, Mol. Pharmacology, 41, 1023-1033). In one embodiment, siNA molecules of the invention are complexed with cationic lipids for cell culture experiments. siNA and cationic lipid mixtures are prepared in semm-free DMEM immediately prior to addition to the cells. DMEM plus additives are warmed to room temperature (about 20-25°C) and cationic lipid is added to the final desired concentration and the solution is vortexed briefly. siNA molecules are added to the final desired concenfration and the solution is again vortexed briefly and incubated for 10 minutes at room temperature. In dose response experiments, the RNA/lipid complex is serially diluted into DMEM following the 10 minute incubation.
Animal Models
Evaluating the efficacy of anti-BCR-ABL agents in animal models is an important prerequisite to human clinical trials. A BCR-ABL transgenic mouse model has been described (Huettner et al, 2000, Nature Genetics, 24, 57-60) Four BCR-ABL1 fransresponder lines (2, 3, 4 and 27) were established from founder animals. Transgenic mice were bom with the expected mendelian frequency and developed normally, indicating that the tetracycline-responsive expression system conects for BCR-ABLl toxicity in embryonic tissue. No mice transgenic for the transresponder constract developed any haematological disorder with a median follow-up period of 10 months. Double fransgenic mice (BCR- ABLl-tetracycline fransactivator (tTA)) were generated by breeding female transresponder mice with male mouse mammary tumour viras (MMTV)-tTA fransactivator mice under continuous administration of tetracycline (0.5 g/1) in the drinking water, starting five days before mating. The genotypic distribution of double fransgenic mice followed the predicted mendelian frequency in all four lines. Withdrawal of tetracycline adminisfration in double transgenic animals allowed expression of BCR— ABLl and resulted in the development of lethal leukemia in 100% of the mice within a time frame that was consistent within each line. Such transgenic mice are useful as models for cancer and for identifying nucleic acid molecules of the invention that modulate BCR-ABL gene expression and gene function toward the development of a therapeutic for use in treating cancer.
Example 9: Models useful to evaluate the down-regulation of ERG gene expression
Cell Culture
There are several cell-culture models that can be utilized to determine the efficacy of nucleic acid molecules of the instant invention directed against Erg expression. Hart et al, 1995, Oncogene, 10(7), 1423-30, describe the transfection of NIH3T3 cells with an Erg expression consfruct consisting of human Erg cDNA diven by the sheep metallothionein la promoter (sMTERG). Established clonal cell lines overexpressing Erg became moφhologically altered, grew in low-semm and serum free media, and gave rise to colonies in soft agar suspension. These colonies resulted in the formation of solid tumors when injected into nude mice. Yi et al, 1997, Oncogene, 14(11), 1259-1268, describe the expression of Erg and abenant Erg fusion proteins as inhibitory in the induction of apoptosis in NIH3T3 and Ewing's sarcoma cells induced by either serum deprivation or by freatment with calcium ionophore. Inhibition of the expression of the abeπant fusion proteins by antisense RNA techniques resulted in the increased susceptibility of these cells to apoptosis leading to cell death. As such, these cell lines can be used for the evaluation of nucleic acid molecules of the instant invention via Erg RNA knockdown, Erg protein knockdown, and proliferation-based endpoints.
Animal Models
There are several animal models in which the anti-proliferative and anti-angiogenic effect of nucleic acids of the present invention, such as siRNA, directed against Erg RNA can be tested. The mouse model described by Hart et al, supra, can be used to evaluate nucleic acid molecules of the instant invention in vivo for anti-tumorigenic capacity. Additional models can be used to study the anti-angiogenic capacity of the nucleic acid molecules of the instant invention. Typically a corneal model has been used to study angiogenesis in rat and rabbit since recraitment of vessels can easily be followed in this normally avascular tissue (Pandey et al, 1995 Science 268: 567-569). In these models, a small Teflon or Hydron disk preheated with an angiogenic compound is inserted into a pocket surgically created in the cornea. Angiogenesis is monitored 3 to 5 days later. siRNA directed against ARNT, Tie-2 or integrin subunit RNAs would be delivered in the disk as well, or dropwise to the eye over the time course of the experiment. In another eye model, hypoxia has been shown to cause both increased expression of VEGF and neovascularization in the retina (Pierce et al, 1995 Proc. Natl. Acad. Sci USA. 92: 905-909; Shweiki et al, 1992 J. Clin. Invest. 91: 2235- 2243).
Another animal model that addresses neovascularization involves Matrigel, an extract of basement membrane that becomes a solid gel when injected subcutaneously (Passaniti et al, 1992 Lab. Invest. 61: 519-528). When the Matrigel is supplemented with angiogenesis factors, vessels grow into the Matrigel over a period of 3 to 5 days and angiogenesis can be assessed. Again, siRNA directed against ARNT, Tie-2 or integrin subunit RNAs would be delivered in the Matrigel.
Several animal models exist for screening of anti-angiogenic agents. These include comeal vessel formation following comeal injury (Burger et al, 1985 Cornea 4: 35-41; Lepri, et al, 1994 J. Ocular Pharmacol. 10: 273-280; Ormerod et al, 1990 Am. J. Pathol 137: 1243-1252) or infracorneal growth factor implant (Grant et al, 1993 Diabetologia 36: 282-291; Pandey et al. 1995 supra; Zieche et al, 1992 Lab. Invest. 61: 711-715), vessel growth into Matrigel matrix containing growth factors (Passaniti et al, 1992 supra), female reproductive organ neovascularization following hormonal manipulation (Shweiki et al, 1993 Clin. Invest. 91: 2235-2243), several models involving inhibition of tumor growth in highly vascularized solid tumors (O'Reilly et al, 1994 Cell 79: 315-328; Senger et al, 1993 Cancer and Metas. Rev. 12: 303-324; Takahasi et al, 1994 Cancer Res. 54: 4233-4237; Kim et al, 1993 supra), and transient hypoxia-induced neovascularization in the mouse retina (Pierce et al, 1995 Proc. Natl. Acad. Sci. USA. 92: 905-909).
The cornea model, described in Pandey et al. supra, is the most common and well characterized anti-angiogenic agent efficacy screening model. This model involves an avascular tissue into which vessels are recruited by a stimulating agent (growth factor, thermal or alkalai bum, endotoxin). The comeal model would utilize the intrastromal comeal implantation of a Teflon pellet soaked in a angiogenic compound-Hydron solution to recrait blood vessels toward the pellet which can be quantitated using standard microscopic and image analysis techniques. To evaluate their anti-angiogenic efficacy, siRNA is applied topically to the eye or bound within Hydron on the Teflon pellet itself. This avascular cornea as well as the Matrigel (see below) provide for low background assays. While the comeal model has been performed extensively in the rabbit, studies in the rat have also been conducted.
The mouse model (Passaniti et al., supra) is a non-tissue model which utilizes
Matrigel, an extract of basement membrane (Kleinman et al., 1986) or Millipore® filter disk, which can be impregnated with growth factors and anti-angiogenic agents in a liquid form prior to injection. Upon subcutaneous administration at body temperature, the Matrigel or
Millipore® filter disk forms a solid implant. An angiogenic compound would be embedded in the Matrigel or Millipore® filter disk which would be used to recruit vessels within the matrix of the Matrigel or Millipore® filter disk that can be processed histologically for endothelial cell specific vWF (factor VIII antigen) immunohistochemistry, Trichrome-
Masson stain, or hemoglobin content. Like the cornea, the Matrigel or Millipore® filter disk are avascular; however, it is not tissue. In the Matrigel or Millipore® filter disk model, siRNA is administered within the matrix of the Matrigel or Millipore® filter disk to test their anti-angiogenic efficacy. Thus, delivery issues in this model, as with delivery of siRNA by Hydron- coated Teflon pellets in the rat cornea model, can be less problematic due to the homogeneous presence of the siRNA within the respective matrix.
Other model systems to study tumor angiogenesis is reviewed by Folkman, 1985 Adv. Cancer. Res., 43, 175.
Use of murine models
For a typical systemic study involving 10 mice (20 g each) per dose group, 5 doses (1, 3, 10, 30 and 100 mg/kg daily over 14 days continuous adminisfration), approximately 400 mg of siRNA, formulated in saline would be used. A similar study in young adult rats (200 g) would require over 4 g. Parallel pharmacokinetic studies can involve the use of similar quantities of siRNA further justifying the use of murine models.
siRNA and Lewis lung carcinoma and B-16 melanoma murine models
Identifying a common animal model for systemic efficacy testing of siRNA is an efficient way of screening siRNA for systemic efficacy. The Lewis lung carcinoma and B-16 murine melanoma models are well accepted models of primary and metastatic cancer and are used for initial screening of anti-cancer. These murine models are not dependent upon the use of immunodeficient mice, are relatively inexpensive, and minimize housing concerns. Both the Lewis lung and B-16 melanoma models involve subcutaneous implantation of approximately 106 tumor cells from metastatically aggressive tumor cell lines (Lewis lung lines 3LL or D122, LLc-LN7; B-16-BL6 melanoma) in C57BL/6J mice. Alternatively, the Lewis lung model can be produced by the surgical implantation of tumor spheres (approximately 0.8 mm in diameter). Metastasis also can be modeled by injecting the tumor cells directly iv.. In the Lewis lung model, microscopic metastases can be observed approximately 14 days following implantation with quantifiable macroscopic metastatic tumors developing within 21-25 days. The B-16 melanoma exhibits a similar time course with tumor neovascularization beginning 4 days following implantation. Since both primary and metastatic tumors exist in these models after 21-25 days in the same animal, multiple measurements can be taken as indices of efficacy. Primary tumor volume and growth latency as well as the number of micro- and macroscopic metastatic lung foci or number of animals exhibiting metastases can be quantitated. The percent increase in lifespan can also be measured. Thus, these models would provide suitable primary efficacy assays for screening systemically administered siRNA formulations.
In the Lewis lung and B-16 melanoma models, systemic pharmacotherapy with a wide variety of agents usually begins 1-7 days following tumor implantation/inoculation with either continuous or multiple adminisfration regimens. Concunent pharmacokinetic studies can be performed to determine whether sufficient tissue levels of siRNA can be achieved for pharmacodynamic effect to be expected. Furthermore, primary tumors and secondary lung metastases can be removed and subjected to a variety of in vitro studies (i.e. target RNA reduction).
Delivery of siRNA and siRNA formulations in the Lewis lung model
Several siRNA formulations, including cationic lipid complexes which can be useful for inflammatory diseases (e.g. DIMRIE/DOPE, etc.) and RES evading liposomes which can be used to enhance vascular exposure of the siRNA, are of interest in cancer models due to their presumed biodistribution to the lung. Thus, liposome formulations can be used for delivering siRNA to sites of pathology linked to an angiogenic response.
Example 10: RNAi mediated inhibition of BCR-ABL and/or ERG RNA expression
siNA consfructs (Table III) are tested for efficacy in reducing BCR-ABL and/or ERG RNA expression in, for example, K562, HUVEC or HeLa cells. Cells are plated approximately 24h before fransfection in 96-well plates at 5,000-7,500 cells/well, 100 μl/well, such that at the time of transfection cells are 10-90% confluent. For transfection, annealed siNAs are mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 50 μl/well and incubated for 20 min. at room temperature. The siNA fransfection mixtures are added to cells to give a final siNA concenfration of 25 nM in a volume of 150 μl. Each siNA transfection mixture is added to 3 wells for triplicate siNA treatments. Cells are incubated at 37° for 24h in the continued presence of the siNA fransfection mixture. At 24h, RNA is prepared from each well of treated cells. The supematants with the fransfection mixtures are first removed and discarded, then the cells are lysed and RNA prepared from each well. Target gene expression following freatment is evaluated by RT-PCR for the target gene and for a confrol gene (36B4, an RNA polymerase subunit) for normalization. The triplicate data is averaged and the standard deviations determined for each freatment. Normalized data are graphed and the percent reduction of target mRNA by active siNAs in comparison to their respective inverted control siNAs is determined.
In a non-limiting example, a siNA constract comprising ribonucleotides and 3'- terminal dithymidine caps is assayed along with a chemically modified siNA constract comprising 2 '-deoxy-2 '-fluoro pyrimidine nucleotides and purine ribonucleotides in which the sense sfrand of the siNA is further modified with 5' and 3 '-terminal inverted deoxyabasic caps and the antisense strand comprises a 3 '-terminal phosphorothioate intemucleotide linkage. Additional stabilization chemistries as described in Table IV are similarly assayed for activity. These siNA consfructs are compared to appropriate matched chemistry inverted controls. In addition, the siNA constmcts are also compared to unfreated cells, cells transfected with lipid and scrambled siNA consfructs, and cells fransfected with lipid alone (fransfection confrol).
Example 11: RNAi mediated inhibition of ERG2 RNA expression
siNA consfructs (Table I) are tested for efficacy in reducing ERG2 RNA expression in, for example in DLDl cells. Cells are plated approximately 24h before transfection in 96-well plates at 5,000-7,500 cells/well, 100 μl/well, such that at the time of transfection cells are 70- 90%o confluent. For transfection, annealed siNAs are mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 50 μl/well and incubated for 20 min. at room temperature. The siNA fransfection mixtures are added to cells to give a final siNA concentration of 25 nM in a volume of 150 μl. Each siNA fransfection mixture is added to 3 wells for triplicate siNA treatments. Cells are incubated at 37° for 24h in the continued presence of the siNA fransfection mixture. At 24h, RNA is prepared from each well of treated cells. The supematants with the transfection mixtures are first removed and discarded, then the cells are lysed and RNA prepared from each well. Target gene expression following treatment is evaluated by RT-PCR for the target gene and for a confrol gene (36B4, an RNA polymerase subunit) for normalization. The triplicate data is averaged and the standard deviations determined for each treatment. Normalized data are graphed and the percent reduction of target mRNA by active siNAs in comparison to their respective inverted control siNAs was determined.
In a non-limiting example, siNA consfructs were screened for activity (see Figure 13) and compared to untreated cells, scrambled siNA control constracts (Scraml and Scram2), and cells transfected with lipid alone (fransfection control). As shown in Figure 13, the siNA constracts significantly reduce ERG2 RNA expression. Leads generated from such a screen are then further assayed. In a non-limiting example, siNA constructs comprising ribonucleotides and 3 '-terminal dithymidine caps are assayed along with a chemically modified siNA consfruct comprising 2 '-deoxy-2 '-fluoro pyrimidine nucleotides and purine ribonucleotides, in which the sense sfrand of the siNA is further modified with 5' and 3'- terminal inverted deoxyabasic caps and the antisense sfrand comprises a 3 '-terminal phosphorothioate internucleotide linkage. Additional stabilization chemistries as described in Table IV are similarly assayed for activity. These siNA constmcts are compared to appropriate matched chemisfry inverted confrols. In addition, the siNA consfructs are also compared to unfreated cells, cells transfected with lipid and scrambled siNA constmcts, and cells transfected with lipid alone (fransfection control). Additional stabilization chemistries as described in Table IV are similarly assayed for activity.
Example 12: Indications
The present body of knowledge in BCR-ABL research indicates the need for methods to assay BCR-ABL activity and for compounds that can regulate BCR-ABL expression for research, diagnostic, and therapeutic use. As described herein, the nucleic acid molecules of the present invention can be used in assays to diagnose disease state related of BCR-ABL levels. In addition, the nucleic acid molecules can be used to freat disease state related to BCR-ABL levels.
Particular conditions and disease states that can be associated with BCR-ABL expression modulation include including cancer (e.g. leukemia, such as CML) and any other indications that can respond to the level of BCR-ABL in a cell or tissue.
Particular conditions and disease states that can be associated with ERG expression modulation include but are not limited to a broad spectrum of oncology and neovascularization-related indications, including but not limited to cancers of the lung, colon, breast, prostate, and cervix, lymphoma, Ewing's sarcoma and related tumors, melanoma, angiogenic disease states such as tumor angiogenesis, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis such as rheumatoid arthritis, psoriasis, verruca vulgaris, angiofibroma of tuberous sclerosis, port-wine stains, Sturge Weber syndrome, Kippel-Trenaunay- Weber syndrome, Osler-Weber-rendu syndrome, leukemias such as acute myeloid leukemia, osteoporosis, wound healing and any other diseases or conditions that are related to or will respond to the levels of ERG in a cell or tissue, alone or in combination with other therapies.
Immunomodulators and chemotherapeutics are non-limiting examples of pharmaceutical agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention. The use of radiation treatments and chemotherapeutics, such as Gemcytabine and cyclophosphamide, are non-limiting examples of chemotherapeutic agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention. Those skilled in the art will recognize that other anti-cancer compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g. siNA molecules) and are hence within the scope of the instant invention. Such compounds and therapies are well known in the art (see for example Cancer: Principles and Pranctice of Oncology, Volumes 1 and 2, eds Devita, V.T., Hellman, S., and Rosenberg, S.A., J.B. Lippincott Company, Philadelphia, USA; incoφorated herein by reference) and include, without limitation, folates, antifolates, pyrimidine analogs, fluoropyrimidines, purine analogs, adenosine analogs, topoisomerase I inhibitors, anthrapyrazoles, retinoids, antibiotics, anthacyclins, platinum analogs, alkylating agents, nitrosoureas, plant derived compounds such as vinca alkaloids, epipodophyllotoxins, tyrosine kinase inhibitors, taxols, radiation therapy, surgery, nutritional supplements, gene therapy, radiotherapy, for example 3D-CRT, immunotoxin therapy, for example ricin, and monoclonal antibodies. Specific examples of chemotherapeutic compounds that can be combined with or used in conjuction with the nucleic acid molecules of the invention include, but are not limited to, Paclitaxel; Docetaxel; Methofrexate Doxorabin; Edatrexate; Vinorelbine; Tomaxifen; Leucovorin; 5 -fluoro uridine (5-FU) Ionotecan; Cisplatin; Carboplatin; Amsacrine; Cytarabine; Bleomycin; Mitomycin C Dactinomycin; Mithramycin; Hexamethylmelamine; Dacarbazine; L-asperginase; Nitrogen mustard; Melphalan, Chlorambucil; Busulfan; Ifosfamide; 4-hydroperoxycyclophosphamide; Thiotepa; Irinotecan (CAMPTOSAR®, CPT-11, Camptothecin- 11, Campto) Tamoxifen; Herceptin; IMC C225; ABX-EGF; and combinations thereof. The above list of compounds are non-limiting examples of compounds and/or methods that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA) of the instant invention. Those skilled in the art will recognize that other drag compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g., siNA molecules) are hence within the scope of the instant invention.
Example 13: Diagnostic uses
The siNA molecules of the invention can be used in a variety of diagnostic applications, such as in the identification of molecular targets (e.g., RNA) in a variety of applications, for example, in clinical, industrial, environmental, agricultural and/or research settings. Such diagnostic use of siNA molecules involves utilizing reconstituted RNAi systems, for example, using cellular lysates or partially purified cellular lysates. siNA molecules of this invention can be used as diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of endogenous or exogenous, for example viral, RNA in a cell. The close relationship between siNA activity and the stracture of the target RNA allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA. By using multiple siNA molecules described in this invention, one can map nucleotide changes, which are important to RNA stmcture and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with siNA molecules can be used to inhibit gene expression and define the role of specified gene products in the progression of disease or infection. In this manner, other genetic targets can be defined as important mediators of the disease. These experiments will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes, siNA molecules coupled with known small molecule inhibitors, or intermittent treatment with combinations siNA molecules and/or other chemical or biological molecules). Other in vitro uses of siNA molecules of this invention are well known in the art, and include detection of the presence of mRNAs associated with a disease, infection, or related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a siNA using standard methodologies, for example, fluorescence resonance emission transfer (FRET).
In a specific example, siNA molecules that cleave only wild-type or mutant forms of the target RNA are used for the assay. The first siNA molecules (i.e., those that cleave only wild-type forms of target RNA) are used to identify wild-type RNA present in the sample and the second siNA molecules (i.e., those that cleave only mutant forms of target RNA) are used to identify mutant RNA in the sample. As reaction controls, synthetic substrates of both wild-type and mutant RNA are cleaved by both siNA molecules to demonstrate the relative siNA efficiencies in the reactions and the absence of cleavage of the "non-targeted" RNA species. The cleavage products from the synthetic substrates also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population. Thus, each analysis requires two siNA molecules, two substrates and one unknown sample, which is combined into six reactions. The presence of cleavage products is determined using an RNase protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired phenotypic changes in target cells. The expression of mRNA whose protein product is implicated in the development of the phenotype (i.e., disease related or infection related) is adequate to establish risk. If probes of comparable specific activity are used for both transcripts, then a qualitative comparison of RNA levels is adequate and decreases the cost of the initial diagnosis. Higher mutant form to wild-type ratios are conelated with higher risk whether RNA levels are compared qualitatively or quantitatively.
AU patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. All references cited in this disclosure are incoφorated by reference to the same extent as if each reference had been incoφorated by reference in its entirety individually.
One skilled in the art would readily appreciate that the present invention is well adapted to cany out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The methods and compositions described herein as presently representative of prefened embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.
It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. Thus, such additional embodiments are within the scope of the present invention and the following claims. The present invention teaches one skilled in the art to test various combinations and/or substitutions of chemical modifications described herein toward generating nucleic acid constracts with improved activity for mediating RNAi activity. Such improved activity can comprise improved stability, improved bioavailability, and/or improved activation of cellular responses mediating RNAi. Therefore, the specific embodiments described herein are not limiting and one skilled in the art can readily appreciate that specific combinations of the modifications described herein can be tested without undue experimentation toward identifying siNA molecules with improved RNAi activity.
The invention illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of, and "consisting of may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by prefeπed embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the description and the appended claims.
In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.
Table I: BCR-ABL and ERG Accession Numbers
NM_004327
Homo sapiens breakpoint cluster region (BCR) , transcript variant 1, mRNA gi|ll038638 | ref |NM_004327.2 | [11038638]
NM_021574
Homo sapiens breakpoint cluster region (BCR) , transcript variant 2 , mRNA gi [ 11038640 I ef |NM_021574.11 [11038640]
NM_005157
Homo sapiens v-abl Abelson murine leukemia viral oncogene homolog 1 (ABLl) , transcript variant a, mRNA gi I 6382056 I ref I NM_005157.2 | [6382056]
NM_007313
Homo sapiens v-abl Abelson murine leukemia viral oncogene homolog 1 (ABLl) , transcript variant b, mRNA gi I 6382057 I ref |NM_007313.11 [6382057]
AJ131467
Homo sapiens mRNA for BCR/ABL chimeric fusion peptide, partial gi|4033556 | emb | J131467.1 | HSA131467 [4033556]
AJ131466
Homo sapiens mRNA for BCR/ABL (major breakpoint) fusion peptide, partial gi|4033554|emb|AJ131466.l|HSA131466[4033554]
AF044317
Homo sapiens TEL/AML1 fusion gene, partial sequence gi [2920622 | gb |AF044317.1 |AF044317 [2920622]
AF327066
Homo sapiens Ewings sarcoma EWS-Flil (type 1) oncogene mRNA, complete eds gi[l2963354|gb[AF327066.l|AF327066 [12963354].
S71805
TLS/FUS ...ERG {translocation} [human, myeloid leukemia patient, peripheral blood, bone marrow cells, mRNA Partial Mutant, 3 genes, 99 nt] gi|560579|bbm|344598|bbs|l51117|gb|S71805.l|S71805 [560579]
AF178854
Synthetic construct Pax3-forkhead fusion protein (Pax3/FKHR) mRNA, complete eds gi|6636096|gb|AF178854.l[AF178854 [6636096]
S78159
Homo sapiens AML1-ETO fusion protein (AML1-ETO) mRNA, partial eds gi I 999360 |bbm| 371144 |bbs| 166913 | gb | S78159.11 S78159 [999360]
NM_004449
Homo sapiens v-ets erythroblastosis virus E26 oncogene like (avian) (ERG) , mRNA gi I 7657065 I ref |NM_004449.2 | [7657065]
M21535
Human erg protein (ets-related gene) mRNA, complete eds gi|l82182 |gb |M21535.1 [HUMERG11 [182182]
M21536
Human erg protein (ets-related gene) mRNA, 3 ' flank gi[ 182183 |gb|M21536.l|HUMERG12 [182183]
M21535
H Huummaann eerg protein (ets-related gene) mRNA, complete eds gi 1182182 |gb|M21535.l|HUMERGll [182182]
M98833
Homo sapiens ERGB transcription factor mRNA, complete eds gi I 7025922 |gb|M98833.3 | HUMERGBFLI [7025922]
X67001
H H.. ssaappiieens HUMFLI-1 mRNA gi|32529|emb|X67001.l|HSHUMFLI [32529]
M93255
Human FLI-1 mRNA, complete eds for two alternate splicings gi | l82659 | gb [ M93255 . l | HUMFLHA [182659]
NM_002017
Homo sapiens Friend leukemia virus integration 1 (FLU) , mRNA gi|7110592 | ref |NM_002017.2 [ [7110592]
S45205
Fli-l=Friend leukemia integration 1 [human, mRNA, 1673 nt] gi I 257353 | bbm | 246089 | bbs 1 115336 | gb | S45205 . 1 1 S45205 [257353 ]
S45205
GI number 628772 references a Protein record; you are currently using the
Nucleotide database.
S82338
Homo sapiens fusion gene (ERG/EWS) gene, partial eds gi|l70371l|bbm|387740|bbs|l78240|gb|S82338.l|S82338 [1703711]
S82335
EWS/ERG=fusion gene {EWS exon 7 - ERG exon 8, translocation} [human, left iliac bone, liver, osteolytic tumor patient, MON isolate, Genomic, 74 nt] gi 11703709 I bbm I 387732 |bbs 1178239 | gb | S82335.11 S82335 [1703709]
S73762
EWS ... erg {reciprocal translocation junction site} [human, Ewing's sarcoma cell line #5838 cells, Genomic Mutant, 3 genes, 267 nt] gi I 688241 [ bbm [ 352440 I bbs 1156728 | gb | S73762.1 [ S73762 [688241]
S73762
GI number 2146518 references a Protein record; you are currently using the
Nucleotide database.
S72865
EWS...EWS-erg=EWS-erg fusion protein type 9e [human, SK-PN-LI cell line, mRNA
Partial Mutant, 3 genes, 588 nt] gi I 633777 I bbm I 347812 | bbs 1154042 | gb | S72865.11 S72865 [633777]
S72865
GI number 2145741 references a Protein record; you are currently using the
Nucleotide database.
S72622
EWS-erg=EWS-erg fusion protein type 3e {translocation, type 3e} [human, T92-60 tumor, mRNA Partial Mutant, 54 nt] gi I 633775 IbbmI 347423 |bbs 11536111 gb | S72622.11 S72622 [633775]
S72621
EWS... erg {translocation, type le and 9e} [human, SK-PN-LI cell line, mRNA Partial Mutant, 3 genes, 762 nt] gi|633773|bbm|347409|bbs|l53609|gb|S72621.l|S72621[633773]
S70593
Homo sapiens EWS/ERG fusion protein (EWS/ERG) mRNA, partial eds gi I 546447 |bbm| 340883 |bbs 1148946 [ gb | S70593.11 S70593 [546447]
S70579
Homo sapiens EWS/ERG fusion protein (EWS/ERG) mRNA, partial eds gi|546445|bbm|340872|bbs|l48944|gb|S70579.l|S70579[546445]
AB028209
Mus musculus mRNA, up-regulated by FUS-ERG, 3' region, cDNA fragment: C14G220 gi I 6139005 I dbj |AB028209.l| [6139005]
Y10001
H. sapiens DNA fragment containing fusion point of FUS gene and ERG gene, translocation t(16;21) (pll;q22) gi|2181922 |emb|Y10001.l|HSY10001 [2181922]
S7-7574
TLS...ERG {translocation} [human, acute non-lymphocytic leukemia cell lines
IRTA17 and IRTA21, mRNA Partial, 3 genes, 211 nt] gi I 957350 I bbm j 369615 I bs 1165809 |gb | S7757 .11 S7757 [957350]
Figure imgf000150_0001
'Jl
©
Figure imgf000151_0001
Figure imgf000152_0001
Figure imgf000153_0001
Ul
Ui
Figure imgf000154_0001
Figure imgf000155_0001
'Jl Ul
Figure imgf000156_0001
Figure imgf000157_0001
'Jl -4
Figure imgf000158_0001
'Jl oe
Figure imgf000159_0001
'Jl v*
Figure imgf000160_0001
Figure imgf000161_0001
Figure imgf000162_0001
Figure imgf000163_0001
Figure imgf000164_0001
Figure imgf000165_0001
Figure imgf000166_0001
Figure imgf000167_0001
Figure imgf000168_0001
oe
Figure imgf000169_0001
Figure imgf000170_0001
-4
©
Figure imgf000171_0001
Figure imgf000172_0001
The 3'-ends of the Upper sequence and the Lower sequence of the siRNA construct can include an overhang sequence, for example about 1 , 2, 3, or 4 nucleotides in length, preferably 2 nucleotides in length, wherein the overhanging sequence of the lower sequence is optionally complementary to a portion of the target sequence. The upper sequence is also referred to as the sense strand, whereas the lower sequence is also referred to as the antisense strand. The upper and lower sequences in the Table can further comprise a chemical modification having Formulae I-VII or any combination thereof.
Table HI: BCR-ABL and ERG Synthetic Modified siNA constructs
BCR-ABL
-4
Figure imgf000173_0001
-4
Ui
Figure imgf000174_0001
ERG
Figure imgf000175_0001
ERG2:δ37L21 siRNA (619C)
617 AAGGAACUGUGCAAGAUGACCAA 1598 stabl 1 antisense GGucAucuuGcAcAGuuccTsT 1670
ERG2:779L21 siRNA (761 C)
759 GAAAGCUGCUCAACCAUCUCCUU 1699 stabl 1 antisense GGAGAuGGuuGAGcAGcuuTsT 1671
ERG2:787L21 siRNA (769C)
767 CUCAACCAUCUCCUUCCACAGUG 1600 stabl 1 antisense cuGuGGAAGGAGAuGGuuGTsT 1672
B2A2
-4 Ul
Figure imgf000176_0001
Figure imgf000177_0001
Uppercase = ribonucleotide u,c = 2'-deoxy-2'-fluoro U, C T = deoxy T
B = inverted deoxy abasic s = phosphorothioate linkage A = deoxy Adenosine G = deoxy Guanosine
Table IV Non-limiting examples of Stabilization Chemistries for chemically modified siNA constructs
-4 -4
Figure imgf000178_0001
CAP = any terminal cap, see for example Figure 10.
All Stab 1-11 chemistries can comprise 3 '-terminal thymidine (TT) residues
All Stab 1-11 chemistries typically comprise 21 nucleotides, but can vary as described herein.
S = sense strand
AS = antisense strand
Table V
A. 2.5 μmol Synthesis Cycle ABI 394 Instrument
Figure imgf000179_0001
Wait time does not include contact time during delivery.
• Tandem synthesis utilizes double coupling of linker molecule

Claims

CLAIMSWhat we claim is:
1. A double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a BCR-ABL gene, wherein said siNA molecule is about 21 nucleotides long.
2. The siNA molecule of claim 1, wherein said siNA molecule comprises no ribonucleotides.
3. The siNA molecule of claim 1, wherein said siNA molecule comprises ribonucleotides.
4. The siNA molecule of claim 1, wherein one of the strands of said double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of a BCR-ABL gene, and wherein the second strand of said double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of said BCR-ABL gene.
5. The siNA molecule of claim 4, wherein each said strand of the siNA molecule comprises about 19 to about 23 nucleotides, and wherein each said strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
6. The siNA molecule of claim 1, wherein said siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of a BCR-ABL gene, and wherein said siNA further comprises a sense region, wherein said sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of said BCR-ABL gene.
7. The siNA molecule of claim 6, wherem said antisense region and said sense region each comprise about 19 to about 23 nucleotides, and wherein said antisense region comprises at least about 19 nucleotides that are complementary to nucleotides of the sense region.
8. The siNA molecule of claim 1, wherein said siNA molecule comprises a sense region and an antisense region and wherein said antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by a BCR-ABL gene and said sense region comprises a nucleotide sequence that is complementary to said antisense region.
9. The siNA molecule of claim 6, wherein said siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of said siNA molecule.
10. The siNA molecule of claim claim 6, wherein said sense region is connected to the antisense region via a linker molecule.
11. The siNA molecule of claim 10, wherem said linker molecule is a polynucleotide linker.
12. The siNA molecule of claim 10, wherein said linker molecule is a non-nucleotide linker.
13. The siNA molecule of claim 6, wherein pyrimidine nucleotides in the sense region are 2'-O-methyl pyrimidine nucleotides.
14. The siNA molecule of claim 6, wherein purine nucleotides in the sense region are 2'- deoxy purine nucleotides.
15. The siNA molecule of claim 6, wherein the pyrimidine nucleotides present in the sense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides.
16. The siNA molecule of claim 9, wherein the fragment comprising said sense region includes a terminal cap moiety at the 5'-end, the 3'-end, or both of the 5' and 3' ends of the fragment comprising said sense region.
17. The siNA molecule of claim 16, wherein said terminal cap moiety is an inverted deoxy abasic moiety.
18. The siNA molecule of claim 6, wherein the pyrimidine nucleotides of said antisense region are 2'-deoxy-2'-fluoro pyrimidine nucleotides
19. The siNA molecule of claim 6, wherein the the purine nucleotides of said antisense region are 2'-O-methyl purine nucleotides.
20. The siNA molecule of claim 6, wherein the purine nucleotides present in said antisense region comprise 2'-deoxy- purine nucleotides.
21. The siNA molecule of claim 18, wherein said antisense region comprises a phosphorothioate internucleotide linkage at the 3' end of said antisense region.
22. The siNA molecule of claim 6, wherein said antisense region comprises a glyceryl modification at the 3' end of said antisense region.
23. The siNA molecule of claim 9, wherein each of the two fragments of said siNA molecule comprise 21 nucleotides.
24. The siNA molecule of claim 23, wherein about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule and wherein at least two 3 ' terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule.
25. The siNA molecule of claim 24, wherein each of the two 3' terminal nucleotides of each fragment of the siNA molecule are 2'-deoxy-pyrimidines.
26. The siNA molecule of claim 25, wherein said 2'-deoxy-pyrimidine is 2'-deoxy- thymidine.
27. The siNA molecule of claim 23, wherein all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
28. The siNA molecule of claim 23, wherein about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by a BCR-ABL gene.
29. The siNA molecule of claim 23, wherein 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by a BCR-ABL gene.
30. The siNA molecule of claim 9, wherein the 5 '-end of the fragment comprising said antisense region optionally includes a phosphate group.
31. The siNA molecule of claim 1, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number NM_004327 (BCR).
32. The siNA molecule of claim 1, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number NM_005157 (ABL).
33. The siNA molecule of claim 1, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number HSA131467 (b2a2).
34. A double-stranded short interfering nucleic acid (siNA) molecule that inhibits the expression of a BCR-ABL gene, wherein said siNA molecule comprises no ribonucleotides and wherein each strand of said double-stranded siNA molecule is about 21 nucleotides long.
35. The siNA molecule of claim 34, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number NM_004327 (BCR).
36. The siNA molecule of claim 34, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number NM_005157 (ABL).
37. The siNA molecule of claim 34, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number HSA131467 (b2a2).
38. A double-stranded short interfering nucleic acid (siNA) molecule that inhibits the expression of a BCR-ABL gene, wherein said siNA molecule does not require the presence of a ribonucleotide within the siNA molecule for said inhibition of expression of the BCR-ABL gene and wherein each strand of said double-stranded siNA molecule is about 21 nucleotides long.
39. The siNA molecule of claim 38, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number NM_004327 (BCR) .
40. The siNA molecule of claim 38, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number NM_005157 (ABL).
41. The siNA molecule of claim 38, wherein said BCR-ABL gene encodes sequence comprising Genbank Accession number HSA131467 (b2a2).
42. A pharmaceutical composition comprising the siNA molecule of claim 1 in an acceptable carrier or diluent.
43. Medicament comprising the siNA molecule of claim 1.
44. Active ingredient comprising the siNA molecule of claim 1.
45. Use of a double-stranded short interfering nucleic acid (siNA) molecule to down- regulate expression of a BCR-ABL gene, wherein said siNA molecule comprises one or more chemical modifications and each strand of said double-stranded siNA is about 21 nucleotides long.
PCT/US2003/005234 2001-05-18 2003-02-20 RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) WO2003070972A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP03716110A EP1476459A4 (en) 2002-02-20 2003-02-20 RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2003219833A AU2003219833A1 (en) 2002-02-20 2003-02-20 RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US10/923,522 US20050159381A1 (en) 2001-05-18 2004-08-20 RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)
US12/205,558 US20090093439A1 (en) 2002-02-20 2008-09-05 RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US12/717,511 US20100227911A1 (en) 2002-02-20 2010-03-04 RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)

Applications Claiming Priority (18)

Application Number Priority Date Filing Date Title
US35858002P 2002-02-20 2002-02-20
US60/358,580 2002-02-20
US36312402P 2002-03-11 2002-03-11
US60/363,124 2002-03-11
US38678202P 2002-06-06 2002-06-06
US60/386,782 2002-06-06
US40403902P 2002-08-15 2002-08-15
US60/404,039 2002-08-15
US40678402P 2002-08-29 2002-08-29
US60/406,784 2002-08-29
US40837802P 2002-09-05 2002-09-05
US60/408,378 2002-09-05
US40929302P 2002-09-09 2002-09-09
US60/409,293 2002-09-09
US43992203P 2003-01-14 2003-01-14
US60/439,922 2003-01-14
US44012903P 2003-01-15 2003-01-15
US60/440,129 2003-01-15

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/923,522 Continuation-In-Part US20050159381A1 (en) 2001-05-18 2004-08-20 RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)

Publications (3)

Publication Number Publication Date
WO2003070972A2 true WO2003070972A2 (en) 2003-08-28
WO2003070972A9 WO2003070972A9 (en) 2004-03-04
WO2003070972A3 WO2003070972A3 (en) 2004-06-03

Family

ID=27761736

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/005234 WO2003070972A2 (en) 2001-05-18 2003-02-20 RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)

Country Status (3)

Country Link
EP (1) EP1476459A4 (en)
AU (1) AU2003219833A1 (en)
WO (1) WO2003070972A2 (en)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004009815A2 (en) * 2002-07-20 2004-01-29 Anne Josephine Milner Silencing hybrid gene expression
US7196184B2 (en) 2002-01-22 2007-03-27 Alnylam Europe Ag Double-stranded RNA (DSRNA) and method of use for inhibiting expression of the AML-1/MTG8 fusion gene
US7348314B2 (en) 2001-10-12 2008-03-25 Alnylam Europe Ag Compositions and methods for inhibiting viral replication
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
WO2008109376A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting bcr-abl gene expression and uses thereof
US7473525B2 (en) 2001-01-09 2009-01-06 Alnylam Europe Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7994307B2 (en) 2004-11-24 2011-08-09 Alnylam Pharmaceuticals, Inc. RNAi modulation of the BCR-ABL fusion gene and uses thereof
US20110229552A1 (en) * 2006-01-25 2011-09-22 Erno Vreugdenhil NOVEL mRNA SPLICE VARIANT OF THE DOUBLECORTIN-LIKE KINASE GENE AND ITS USE IN DIAGNOSIS AND THERAPY OF CANCERS OF NEUROECTODERMAL ORIGIN
US8101742B2 (en) 1999-01-30 2012-01-24 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8143232B2 (en) * 2009-03-03 2012-03-27 The Regents Of The University Of Michigan Gene fusion targeted therapy
US9074213B2 (en) 2001-01-09 2015-07-07 Alnylam Pharmacuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9243246B2 (en) 2010-08-24 2016-01-26 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
RU2720475C2 (en) * 2018-09-11 2020-04-30 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) Test system for searching for drugs which reduce the risk of secondary leukemia, a method for preparing and using it

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994001550A1 (en) * 1992-07-02 1994-01-20 Hybridon, Inc. Self-stabilized oligonucleotides as therapeutic agents
WO1999032619A1 (en) * 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
WO1999049029A1 (en) * 1998-03-20 1999-09-30 Benitec Australia Ltd Control of gene expression
WO2000001846A2 (en) * 1998-07-03 2000-01-13 Devgen N.V. Characterisation of gene function using double stranded rna inhibition
US6040181A (en) * 1988-12-22 2000-03-21 University Of Pennsylvania Regulation of bcl-2 gene expression
WO2000044914A1 (en) * 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
CA2359180A1 (en) * 1999-01-30 2000-08-03 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
WO2001036646A1 (en) * 1999-11-19 2001-05-25 Cancer Research Ventures Limited Inhibiting gene expression with dsrna

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2323069A1 (en) * 1998-03-12 1999-09-16 Taisho Pharmaceutical Co., Ltd. Nucleic acid enzyme showing allosteric rna-cleaving activity on target rna
AU2001257526B2 (en) * 2000-05-04 2007-07-19 Avi Biopharma, Inc. Splice-region antisense composition and method
AU2003237686A1 (en) * 2002-05-24 2003-12-12 Max-Planck Gesellschaft Zur Forderung Der Wissenschaften E.V. Rna interference mediating small rna molecules

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6040181A (en) * 1988-12-22 2000-03-21 University Of Pennsylvania Regulation of bcl-2 gene expression
WO1994001550A1 (en) * 1992-07-02 1994-01-20 Hybridon, Inc. Self-stabilized oligonucleotides as therapeutic agents
WO1999032619A1 (en) * 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
WO1999049029A1 (en) * 1998-03-20 1999-09-30 Benitec Australia Ltd Control of gene expression
WO2000001846A2 (en) * 1998-07-03 2000-01-13 Devgen N.V. Characterisation of gene function using double stranded rna inhibition
WO2000044914A1 (en) * 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
CA2359180A1 (en) * 1999-01-30 2000-08-03 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
WO2001036646A1 (en) * 1999-11-19 2001-05-25 Cancer Research Ventures Limited Inhibiting gene expression with dsrna

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
KUWABARA T. ET AL.: 'Activities of tRNA-embedded dimeric minizymes' NUCLEIC ACIDS SYMPOSIUM SERIES vol. 37, January 1997, pages 307 - 308, XP002129252 *
SCHERR M. ET AL.: 'Specific inhibition of bcr-abl gene expression by small interfering RNA' BLOOD vol. 101, no. 4, 15 February 2003, pages 1566 - 1569, XP002975208 *
See also references of EP1476459A2 *
WILDA M. ET AL.: 'Killing of leukemic cells with a BCR/ABL fusion gene by RNA interference (RNAi)' ONCOGENE vol. 21, June 2002, pages 5716 - 5724, XP009009806 *
ZHOU J-M. ET AL.: 'Probing of the secondary structure of maxizymes' NUCLEIC ACIDS SYMPOSIUM SERIES no. 42, 1999, pages 219 - 220, XP002975209 *

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8101742B2 (en) 1999-01-30 2012-01-24 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8729037B2 (en) 1999-01-30 2014-05-20 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8183362B2 (en) 1999-01-30 2012-05-22 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8119608B2 (en) 1999-01-30 2012-02-21 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US9133454B2 (en) 1999-01-30 2015-09-15 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US9902955B2 (en) 1999-01-30 2018-02-27 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8114851B2 (en) 1999-01-30 2012-02-14 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8114981B2 (en) 1999-01-30 2012-02-14 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8101584B2 (en) 1999-01-30 2012-01-24 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8168776B2 (en) 1999-01-30 2012-05-01 Alnylam Pharmaceuticals, Inc. Method for making a 21 nucleotide double stranded RNA chemically linked at one end
US8202980B2 (en) 1999-01-30 2012-06-19 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7473525B2 (en) 2001-01-09 2009-01-06 Alnylam Europe Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US9587240B2 (en) 2001-01-09 2017-03-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US9074213B2 (en) 2001-01-09 2015-07-07 Alnylam Pharmacuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7868160B2 (en) 2001-01-09 2011-01-11 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7348314B2 (en) 2001-10-12 2008-03-25 Alnylam Europe Ag Compositions and methods for inhibiting viral replication
US7763590B2 (en) 2001-10-12 2010-07-27 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a mutant gene
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
US7846907B2 (en) 2002-01-22 2010-12-07 Alnylam Pharmaceuticals, Inc. Double-stranded RNA (dsRNA) and method of use for inhibiting expression of a fusion gene
US7196184B2 (en) 2002-01-22 2007-03-27 Alnylam Europe Ag Double-stranded RNA (DSRNA) and method of use for inhibiting expression of the AML-1/MTG8 fusion gene
US10351852B2 (en) 2002-02-20 2019-07-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10000754B2 (en) 2002-02-20 2018-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9738899B2 (en) 2002-02-20 2017-08-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9771588B2 (en) 2002-02-20 2017-09-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10662428B2 (en) 2002-02-20 2020-05-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9957517B2 (en) 2002-02-20 2018-05-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10889815B2 (en) 2002-02-20 2021-01-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9732344B2 (en) 2002-02-20 2017-08-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
WO2004009815A2 (en) * 2002-07-20 2004-01-29 Anne Josephine Milner Silencing hybrid gene expression
WO2004009815A3 (en) * 2002-07-20 2004-03-11 Anne Josephine Milner Silencing hybrid gene expression
US7994307B2 (en) 2004-11-24 2011-08-09 Alnylam Pharmaceuticals, Inc. RNAi modulation of the BCR-ABL fusion gene and uses thereof
US20110229552A1 (en) * 2006-01-25 2011-09-22 Erno Vreugdenhil NOVEL mRNA SPLICE VARIANT OF THE DOUBLECORTIN-LIKE KINASE GENE AND ITS USE IN DIAGNOSIS AND THERAPY OF CANCERS OF NEUROECTODERMAL ORIGIN
WO2008109376A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting bcr-abl gene expression and uses thereof
US8143232B2 (en) * 2009-03-03 2012-03-27 The Regents Of The University Of Michigan Gene fusion targeted therapy
US10584335B2 (en) 2010-08-24 2020-03-10 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US9243246B2 (en) 2010-08-24 2016-01-26 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US9845466B2 (en) 2010-08-24 2017-12-19 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US11932854B2 (en) 2010-10-29 2024-03-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9970005B2 (en) 2010-10-29 2018-05-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US11193126B2 (en) 2010-10-29 2021-12-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
RU2720475C2 (en) * 2018-09-11 2020-04-30 Федеральное государственное бюджетное образовательное учреждение высшего образования "Московский государственный университет имени М.В. Ломоносова" (МГУ) Test system for searching for drugs which reduce the risk of secondary leukemia, a method for preparing and using it

Also Published As

Publication number Publication date
AU2003219833A8 (en) 2003-09-09
WO2003070972A3 (en) 2004-06-03
EP1476459A2 (en) 2004-11-17
EP1476459A4 (en) 2005-05-25
AU2003219833A1 (en) 2003-09-09
WO2003070972A9 (en) 2004-03-04

Similar Documents

Publication Publication Date Title
AU2003213090B2 (en) RNA interference mediated treatment of alzheimer's disease using short interfering nucleic acid ( siNA)
EP2902406A1 (en) RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
WO2003070969A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF BCL2 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2003217550A1 (en) RNA INTERFERENCE MEDIATED INHIBITION OF TNF AND TNF RECEPTOR SUPERFAMILY GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP1476457A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF PROTEIN TYPROSINE PHOSPHATASE-1B (PTP-1B) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (SiNA)
WO2003070912A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF EPIDERMAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003072705A2 (en) Rna interference mediated inhibition of cyclin d1 gene expression using short interfering nucleic acid (sina)
WO2003070972A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003070887A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF POLYCOMB GROUP PROTEIN EZH2 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP1448590A2 (en) Rna interference mediated inhibition of myc and myb genes or genes of their respective pathways
EP1522583A2 (en) RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sina)
EP1432725A1 (en) RNA INTERFERENCE MEDIATED INHIBITION OF TELOMERASE GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003070888A2 (en) Rna interference mediated inhibition of checkpoint kinase-1 (chk-1) gene expression using short interfering nucleic acid
WO2003070896A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF PROLIFERATING CELL NUCLEAR ANTIGEN (PCNA) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP1463842A1 (en) RNA INTERFERENCE MEDIATED INHIBITION OF PROTEIN KINASE C ALPHA (PKC-ALPHA) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003070197A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF TGF-BETA AND TGF-BETA RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US8017765B2 (en) RNA interference mediated treatment of alzheimer's disease using short interfering nucleic acid (siNA)
EP1710307A2 (en) RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
EP1741781A2 (en) RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
WO2003070743A1 (en) RNA INTERFERENCE MEDIATED INHIBITION OF G72 AND D-AMINO ACID OXIDASE (DAAO) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP1501853A2 (en) RNA INTERFERENCE MEDIATED INHIBITION OF EPIDERMAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
COP Corrected version of pamphlet

Free format text: PAGES 175 AND 176, DESCRIPTION, REPLACED BY NEW PAGES 175 AND 176

WWE Wipo information: entry into national phase

Ref document number: 2003716110

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10923522

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 2003716110

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP