WO2003048367A1

WO2003048367A1 - Genetic strain optimization for improving the production of riboflavin

Info

Publication number: WO2003048367A1
Application number: PCT/EP2002/013660
Authority: WO
Inventors: Henning ALTHÖFER; Jose L. Revuelta Doval
Original assignee: Basf Aktiengesellschaft
Priority date: 2001-12-04
Filing date: 2002-12-03
Publication date: 2003-06-12
Also published as: JP2005511053A; KR20050044861A; CN1599796A; DE10159396A1; AU2002358083A1; EP1456388A1

Abstract

The invention relates to the microbial production of riboflavin by culturing a microorganism of the genus Ashbya that is capable of producing riboflavin and that has at least in two of the genetic products from the group rib1, rib2, rib4 and rib7 higher activities than the wild type ATCC 10895, and subsequently isolating the riboflavin produced from the culture medium.

Description

Genetic strain optimization for improved production of riboflavin

description

The present invention relates to a genetic process for the production of riboflavin. The riboflavin production in these organisms is increased by the special selection of riboflavin biosynthesis genes or their combination in organisms of the genus Ashbya and their expression.

Vitamin B2, also called riboflavin, is produced by all plants and a variety of microorganisms. It is essential for humans and animals as they are unable to synthesize it. Riboflavin plays an important role in metabolism. For example, it is involved in the utilization of carbohydrates. With vitamin B2 deficiency, inflammation of the mucous membranes of the mouth and throat, itching and inflammation in the skin folds and similar skin damage, conjunctivitis, decreased visual acuity and clouding of the cornea occur. Growth and weight loss may occur in infants and children. Vitamin B2 is therefore of great economic importance, for example as a vitamin preparation for vitamin deficiency and as a feed additive. Various foods are added. It is also used as a food coloring, for example in mayonnaise, ice cream, pudding etc. used.

Vitamin B2 is produced either chemically or microbially (see e.g. Kurth et al., 1996, Riboflavin, in: Ulimann's Encyclopedia of industrial chemistry, VCH Weinheim). In the chemical production process, riboflavin is usually obtained as a pure end product in multi-stage processes, with relatively expensive starting products, e.g. D-Ribose, must be used.

An alternative to the chemical synthesis of riboflavin is the fermentative production of vitamin B2 by microorganisms. Renewable raw materials such as sugar or vegetable oils are used as starting materials. The production of riboflavin by fermentation of fungi such as Eremothecium ashbyii or Ashbya gossypii is known (The Merck Index, Windholz et al., Eds. Merck & Co., page 1183, 1983), but also yeasts, e.g. Candida, Pichia and Saccharomyces or bacteria, e.g.

Bacillus, clostridia or corynebacteria are described as riboflavin producers. In EP-A-0 405 370 and EP-A-0 821 063 describes the production of riboflavin with recombinant bacterial strains, the strains being obtained by transformation with riboflavin biosynthetic genes from Bacillus subtilis.

WO 95/26406 and WO 94/11515 describe the cloning of the genes specific for riboflavin biosynthesis from the eukaryotic organisms Ashbya gossypii or Saccharomyces cerevisiae, as well as microorganisms which have been transformed with these genes, and the use of such microorganisms for riboflavin synthesis described.

WO 99/61623 describes the use of the selection of riboflavin biosynthesis genes (rib3, rib4, rib5) for increasing the riboflavin formation.

In both organisms mentioned above, 6 enzymes catalyze the formation of riboflavin starting from guanosine triphosphate (GTP) and from ribulose-5-phosphate. Here, the GTP cyclohydrolase II (ribl gene product) converts GTP to 2,5-diamino-6- (ribosylamino) -4- (3H) -pyrimidinone-5-phosphate. This compound is then replaced by the 2,5-diamino-6- (ribosylamino) -4-

(3H) -pyrimidinone-5-phosphate reductase (rib7 gene product)

2,5-diamino-ribitylamino-2,4- (1H, 3H) -pyrimidine-5-phosphate reduced and then by a specific deaminase (rib2 gene product) to 5-amino-6-ribitylamino-2,4- (1H, 3H) -pyrimidinedione-5-phosphate deaminated. The phosphate is then split off by an unspecific phosphatase.

Ribulose-5-phosphate, in addition to GTP the second starting product of the last enzymatic steps in riboflavin biosynthesis, is converted to 3,4-dihydroxy by the 3,4-dihydroxy-2-butanone-4-phosphate synthase (rib3 gene product). 2-butanone-4-phosphate (DBP) implemented.

Both DBP and 5-amino-6-ribitylamino-2,4- (1H, 3H) -pyrimidinedione are the educts of the enzymatic synthesis of 6, 7-dimethyl-8-ribityllumazine. This reaction is catalyzed by the rib4 gene product (DMRL synthase). DMRL is then converted to riboflavin by ribofavin synthase (rib5 gene product) (Bacher et al. (1993), Bioorg. Chem. Front. Vol. 3, Springer Verlag).

Despite these advances in the production of riboflavin, there is still a need to improve and increase vitamin B2 productivity to meet the increasing demand and to make the production of riboflavin more efficient. The task was therefore to further improve vitamin B2 productivity. This object was achieved by a process for the microbial production of riboflavin by cultivating a capable microorganism of the genus Ashbya which has higher activities than the wild type ATCC 10895 in at least two of the gene products from the group ribl, rib2, rib4 and rib7, and then the riboflavin formed is isolated from the culture medium.

The process for the increased production of riboflavin is advantageously carried out with an organism which is capable of synthesizing riboflavin, in which, for example, the combination of the following rib gene products (the numbers indicate the corresponding rib gene product) have increased activity : 1 + 2, 1 + 4, 1 + 7, 2 + 4, 2 + 7, 4 + 7.

Organisms in which the combination of the following rib gene products (the numbers indicate the corresponding rib gene product) have an increased activity are particularly preferred: 1 + 2 + 4, 1 + 2 + 7, 1 + 4 + 7, 2 + 4 + 7.

The increased activity of the rib gene products is evaluated in comparison to the Ashbya gossypii strain ATCC 10895, which serves as a reference organism. The corresponding methods for measuring the activity of the rib gene products, i.e. the enzyme activities are familiar to the person skilled in the art and are described in the literature.

Another advantage of increasing vitamin B2 productivity is the combination of increasing the natural enzyme activity and introducing the above-mentioned gene combination to increase gene expression.

In principle, all organisms of the genus Ashbya which are able to synthesize riboflavin are suitable as organisms or host organisms for the process according to the invention.

Rib gene products are not only the polypeptide sequences described in the sequence listing in SEQ ID NO: 2, 4, 6, 8, but also those of these sequences by exchange, insertion or deletion of up to 5%, preferably up to 3%, particularly preferably up to 2% of the amino acid codons available polypeptide sequences. Such sequences occur, for example, as natural allele variations or can be treated by mutation of the parent strain, for example by mutagenic substances or electromagnetic radiation and subsequent selection for increased riboflavin productivity can be obtained.

The combination according to the invention of the rib genes ribl, rib2, rib4 and rib7 and / or the increase in activity of the genes and their gene products leads to a significantly increased riboflavin productivity. The genes mentioned can in principle be introduced into the organisms used by all methods known to the person skilled in the art; they are advantageously introduced into the organisms or their cells via transformation, transfection, electroporation, with the so-called particle gun or via microinjection. For microorganisms, the person skilled in the art can use the corresponding textbooks from Sambrook, J. et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, by F.M. Ausubel et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by D.M. Glover et al., DNA Cloning Vol. 1, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Habor Laboratory Press or Guthrie et al. See Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, 1994, Academic Press. Methods such as the introduction of the DNA via homologous or heterologous recombination, for example with the aid of the ura-3 gene, specifically the ura-3 gene from Ashbya, as described in the German application DE 19801120.2 and / or via the following, are advantageous described REMI method (= "restriction-enzyme-mediated integration").

The REMI technique is based on the cotransformation of a linear DNA construct, which was cut at both ends with the same restriction endonuclease, together with the restriction endonuclease, which was used for this restriction of the DNA construct, into an organism. The restriction endonuclease then cuts the genomic DNA of the organism into which the DNA construct was introduced together with the restriction enzyme. This leads to an activation of the cell's own repair mechanisms. These repair mechanisms repair caused by the endonuclease strand ^breaks' of the genomic DNA and build it at a certain frequency and the cotransformed DNA construct into the genome one. As a rule, the restriction sites at both ends of the DNA are preserved.

This technique was developed by Bölker et al. (Mol Gen Genet, 248, 1995: 547-552) for the insertion mutagenesis of fungi. Schiestl and Petes (Proc. Natl. Acad. Sei. USA, 88, 1991: 7585-7589) used the method to clarify whether there is heterologous recombination in saccharomyces. For stable Transformation and regulated expression of an inducible reporter gene was the method of Brown et al. (Mol. Gen. Genet. 251, 1996: 75-80). The system has not yet been used as a genetic engineering tool for optimizing metabolic pathways or for commercial overexpression of proteins.

Using the example of riboflavin synthesis, it was shown that the REMI method can be used to integrate biosynthetic genes into the genome of the above-mentioned organisms and thus production processes for the production of metabolic products of primary or secondary metabolism, especially of biosynthetic pathways, for example of amino acids such as lysine, methionine, threonine or Tryptophan, vitamins such as vitamins A, B2, B6 B12, C, D, E, F, S-adenosylmethionine, biotin, pantothenic acid or folic acid,

Carotenoids such as β-carotene, lycopene, canthaxanthin, astaxanthin or zeaxanthin or proteins such as hydrolases such as lipases, esterases, amidases, nitrilases, proteases, mediators such as cytokines such as lymphokines such as MIF, MAF, TNF, interleukins such as interleukin 1, interferons such as interferons , tPA, hormones such as proteohormones, glycohormones, oligo or polypeptide hormones such as vassopressin, endorphins, endostatin, angiostatin, growth factors erythropoietin, transcription factors, integrins such as GPIIb / IIIa or oC _v ßlll, receptors such as the various glutamate receptors are optimized can.

Using the REMI method, the nucleic acid fragments according to the invention or other of the genes mentioned above can be placed at transcriptionally active sites in the genome.

The nucleic acids are advantageously cloned together with at least one reporter gene into a DNA construct which is introduced into the genome. This reporter gene should allow easy detection via a growth, fluorescence, chemo- or bioluminescence assay or via a photometric measurement. Examples include reporter genes, antibiotic resistance genes, hydrolase genes, fluorescence protein genes, bioluminescence genes, glucosidase genes, peroxidase genes or biosynthesis genes such as the riboflaving genes, the luciferase gene, β-galactosidase gene, gfp gene, lipase gene, esterase gene, acoxidase gene, peroxidase gene, peroxidase gene, peroxidase gene Called adenyltransferase gene. These genes enable the transcription activity and thus the expression of the genes to be measured and quantified easily. This enables genome sites to be identified which show a productivity difference of up to a factor of 2 (see FIG. 1). Figure 1 shows the clones Lu21 # 1 and LU21 # 2, which were obtained after integration, with their different vitamin B2 (= riboflavin) productivities.

In the event that the biosynthetic genes themselves enable easy detection, as in the case of the riboflavin, for example, an additional reporter gene can be dispensed with.

If several genes are to be introduced into the organism, all of them can be introduced into the organism together with a reporter gene in a single vector or each individual gene with a reporter gene can be introduced into the organism, the different vectors being able to be introduced simultaneously or successively. Gene fragments that code for the respective activities can also be used in REMI technology.

In principle, all known restriction enzymes are suitable for the method according to the invention for integrating biosynthesis genes into the genome of organisms. Restriction enzymes that only recognize 4 base pairs as a restriction site are less preferred because they cut too frequently in the genome or in the vector to be integrated; preference is given to enzymes that recognize 6, 7, 8 or more base pairs as an interface, such as BamHI, EcoRI, Bglll, SphI , Spei, Xbal, Xhol, Ncol, Sall, Clal, Kpnl, Hindl l, Sacl, PstI, Bpnl, Notl, Srfl or Sfil to name just a few of the possible enzymes. It is advantageous if the enzymes used no longer have interfaces in the DNA to be introduced, this increases the efficiency of the integration. As a rule, 5 to 500 U, preferably 10 to 250, particularly preferably 10 to 100 U of the enzymes are used in the REMI approach. The enzymes are advantageously used in an aqueous solution, the substances for osmotic stabilization such as sugar such as sucrose, trehalose or glucose, polyols such as glycerol or polyethylene glycol, a buffer with an advantageous buffering in the range from pH 5 to 9, preferably 6 to 8, particularly preferably 7 to 8 such as Tris, MOPS, HEPES, MES or PIPES and / or substances for stabilizing the

Nucleic acids contain such as inorganic or organic salts of Mg, Cu, Co, Fe, Mn or Mo. If appropriate, other substances may also be present, such as EDTA, EDDA, DTT, β-mercaptoethanol or nuclease inhibitors. However, it is also possible to carry out REMI technology without these additives.

The process according to the invention is carried out in a temperature range from 5 to 80 ° C., preferably from 10 to 60 ° C., particularly preferably from 20 to 40 ° C. All known methods for destabilizing cell membranes, such as electroporation, fusion with loaded vesicles or destabilization via various alkali or alkaline earth metal salts such as lithium, rubidium or calcium salts, the lithium salts are preferred.

After isolation, the nucleic acids can be used for the reaction according to the invention directly or after purification.

In principle, the combination of the rib genes according to the invention can be introduced into plants by all methods known to the person skilled in the art.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the use of a gene cannon, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium turne faciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711). The transformation of plants with Agrobacterium tumefaciens is described, for example, by Höfgen and Willuser in Nucl. Acid Res. (1988) 16, 9877.

Agrobacteria transformed with an expression vector according to the invention can also be used in a known manner to transform plants, in particular crop plants, such as cereals, corn, soybeans, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa , Lettuce and the various tree, nut and wine species and legumes can be used, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The genetically modified plant cells can be regenerated using all methods known to the person skilled in the art. Appropriate methods can be found in the above-mentioned writings by SD Kung and R. Wu, Potrykus or Höfgen and Willmitzer. There are a number of ways to increase the enzyme activity of the rib gene products in the cell.

One possibility is to change the endogenous rib genes 1, 2, 4 and 7 in such a way that they code for enzymes with increased rib 1,2,4 or 7 activity compared to the starting enzymes. Another increase in enzyme activity can be achieved, for example, by changing the catalytic centers to increase substrate conversion or by canceling the action of enzyme inhibitors, ie they have an increased specific activity or their activity is not inhibited. In a further advantageous embodiment, an increased enzyme activity can also take place by increasing the enzyme synthesis in the cell, for example by switching off factors which repress the enzyme synthesis or by increasing the activity of factors or regulatory elements which promote increased synthesis, or preferably by introducing further ones gene copies. These measures increase the overall activity of the gene products in the cell without changing the specific activity. A combination of these methods can also be used, ie increasing the specific activity and increasing the overall activity. In principle, these changes can be introduced into the nucleic acid sequences of the genes, regulatory elements or their promoters by all methods known to the person skilled in the art. For this purpose, the sequences can be subjected, for example, to a mutagenesis such as a "site directed mutagenesis" as described in D.M. Glover et al., DNA Cloning Vol. 1, (1995), IRL Press (ISBN 019-963476-9), Chapter 6, page 193 ff.

By Spee et al. (Nucleic Acids Research, Vol. 21, No. 3, 1993: 777-778) describes a PCR method using dITP for random mutagenesis.

The use of an "in vitro" recombination technique for molecular evolution is described by Stemmer (Proc. Natl. Acad. Sei. USA, Vol. 91, 1994: 10747-10751).

By Moore et al. (Nature Biotechnology Vol. 14, 1996: 458-467) describes the combination of the PCR and recombination method.

The modified nucleic acid sequences are then brought back into the organisms via vectors. To increase the enzyme activities, modified promoter regions can also be placed in front of the natural genes, so that the expression of the genes is increased and thus the activity is ultimately increased. Sequences can also be introduced at the 3 'end which, for example, increase the stability of the mRNA and thereby enable increased translation. This also leads to higher enzyme activity.

Further gene copies of the rib genes 1, 2, 7 and 4 are preferably introduced into the cell together. These gene copies can be subject to natural regulation, a changed regulation, the natural regulatory regions being changed in such a way that they enable increased expression of the genes, or else regulatory sequences of foreign genes or even genes of other species can be used.

A combination of the above methods is particularly advantageous.

The combination of the genes with the sequences SEQ ID no. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 or their functional equivalents.

For optimal expression of heterologous genes in organisms, it is advantageous to change the nucleic acid sequences in accordance with the specific "codon usage" used in the organism. The "codon usage" can easily be determined on the basis of computer evaluations of other known genes of the organism in question.

The gene expression of the rib genes 1, 2, 7 and 4 can advantageously be increased by increasing the ribl, 2, 7, 4 gene copy number and / or by strengthening regulatory factors which have a positive effect on the ribl, 2,7 and 4 gene expression become. So one can

Regulatory elements are strengthened preferably at the transcription level by using stronger transcription signals such as promoters and enhancers. In addition, an increase in translation is also possible, for example, by improving the stability of the ribl, 2, 7 and 4 mRNA, or by increasing the reading efficiency of this mRNA on the ribosomes.

To increase the number of gene copies, the rib genes 1, 2, 7 and 4, or homologous genes, can be incorporated, for example, into a nucleic acid fragment or into a vector which preferably contains the regulatory gene sequences assigned to the respective rib genes or promoter activity acting in an analogous manner , In particular, those regulatory sequences are used which increase gene expression. Alternatively, each of the genes described can be brought into a single vector and transformed into the respective production organism.

5

Under the nucleic acid question according to the invention, the rib gene sequences SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 and SEQ ID No. 7 or to understand their functional equivalents which have been functionally linked with one or more regulation signals advantageously to increase gene expression. For example, these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid. In addition to these new regulatory sequences or instead of these sequences 5, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically modified so that the natural regulation has been switched off and the expression of the genes increased. However, the gene construct can also have a simpler structure, which means that no additional regulatory signals have been placed in front of the sequences SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5 or SEQ ID No. 7 or their functional equivalents were inserted and the natural promoter with its regulation was not removed. Instead, the natural regulatory sequence was mutated in such a way that regulation no longer takes place and gene expression is increased. These modified promoters can also be placed in front of the natural genes to increase activity. The gene construct may advantageously also comprise one or more "enhancer sequences" functionally linked to the promoter contain _0, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the DNA sequences. The rib genes can be contained in one or more copies in the gene construct. 5

Advantageous regulatory sequences for the method according to the invention are, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacl ^ - T7, T5, T3 -, gal-, trc-, ara-, SP6-, λ-P _R - or contain in the λ-P _L promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are, for example, in the gram-positive promoters ay and SP02, in the yeast or fungal promoters ADC1, MFα, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters CaMV / 35S [Franck 5 et al., Cell 21 (1980) 285-294], PRPl [Ward et al., Plant. Mol. Biol. 22 (1993)], SSU, OCS, lib4, usp, STLS1, B33, LEB4, nos or in the ubiquitin or phaseolin promoter. In this The promoters of pyruvate decarboxylase and methanol oxidase from, for example, Hansenula are also advantageous. Further advantageous plant promoters are, for example, one that can be induced by benzenesulfonamide (EP 388186), one that can be induced by tetracycline (Gatz et al., (1992) Plant J. 2, 397-404), one that can be induced by abscisic acid (EP335528) or an ethanol or cyclohexanone inducible (W09321334) promoter. Plant promoters which express in tissues or parts of plants are particularly advantageous

10 ensure in which the biosynthesis of purines or their precursors takes place. Promoters that ensure leaf-specific expression should be mentioned in particular. Worth mentioning are the promoter of the cytosolic FBPase from potato or the ST-LSI promoter from potato (Stockhaus et al., EMBO J. 8 (1989)

152445-245). The promoter of the phosphoribosyl pyrophosphate amidotransferase from Glycine max (see also Genbank Accession number U87999) or another node-specific promoter as in EP 249676 can also be used advantageously.

20 In principle, all natural promoters can use their

Regulatory sequences such as those mentioned above can be used for the method according to the invention. In addition, synthetic promoters can also be used advantageously.

25 As described above, the nucleic acid fragment (= gene construct) may also contain further genes which are to be introduced into the organisms. These genes can be under separate regulation or under the same regulatory region as the rib genes. These genes are for example

30 for additional biosynthetic genes that enable increased synthesis.

The nucleic acid fragment is advantageously expressed in a vector such as for expression in the host organism mentioned above

35 for example a plasmid, a phage or other DNA, which enables an optimal expression of the genes in the host. Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHSl, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III ¹¹³ -Bl, λgtll or pBdCI,

40 in Streptomyces pIJlOl, pIJ364, pIJ702 or pIJ361, in Bacillus pUBHO, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in mushrooms pALSl, pIL2 or pBB116, in yeasts 2 «= Y, PE3 or PBB116 in plants pLGV23, pGHlac +, pBIN19, pAK2004 or pDH51 or derivatives of the above

45 plasmids. The plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are well known to the person skilled in the art and can be found, for example, in the book cloning Vectors (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). Suitable plant vectors are described in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, p.71-119.

Advantageously, the nucleic acid fragment for the expression of the other genes contained additionally contains 3 'and / or 5' terminal regulatory sequences for increasing expression, which are selected for optimal expression depending on the host organism selected and gene or genes.

These regulatory sequences are intended to enable targeted expression of the genes and protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed and / or overexpressed after induction, or that it is immediately expressed and / or overexpressed.

The regulatory sequences or factors can preferably influence the gene expression of the introduced genes positively and thereby increase. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

In a further embodiment of the vector, the gene construct according to the invention can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA can consist of a linearized plasmid or only of the nucleic acid fragment as a vector.

Any plasmid (in particular a plasmid which carries the origin of replication of the 2 ° em plasmid from S. cerevisiae) can also be used as the vector, which replicates autonomously in the cell, but also a linear DNA fragment as described above, that integrates into the genome of the host. This integration can take place via hetero- or homologous recombination. However, as mentioned above, preferred via homologous recombination (Steiner et al., Genetics, Vol. 140, 1995: 973-987). The genes ribl, rib2, rib4 and rib7 can be present individually in the genome at different locations or on different vectors or together in the genome or on one vector. The organisms used in the process according to the invention which contain the combination of the rib genes 1, 2, 7 and 4 or their functional equivalents show increased riboflavin production.

In the process according to the invention, the organisms used for the production of riboflavin are grown in a medium which enables these organisms to grow. This medium can be a synthetic or a natural medium. Depending on the organism, media known to the person skilled in the art are used. For the growth of the microorganisms, the media used contain a carbon source, a nitrogen source, inorganic salts and possibly small amounts of vitamins and trace elements.

Advantageous carbon sources are, for example, sugars such as mono-, di- or polysaccharides such as glucose, fructose, mannose, xylose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose, complex sugar sources such as molasses, sugar phosphates such as fructose -1, 6-bis-phosphate, sugar alcohols such as mannitol, polyols such as glycerol, alcohols such as methanol or ethanol, carboxylic acids such as citric acid, lactic acid or acetic acid, fats such as soybean oil or rapeseed oil, amino acids such as an amino acid mixture, for example so-called casamino acids (Difco ) or individual amino acids such as glycine or aspartic acid or aminosugar, the latter can also be used simultaneously as a nitrogen source.

Advantageous nitrogen sources are organic or inorganic nitrogen compounds or materials that contain these compounds. Examples are ammonium salts such as NH ₄ CI or (NH ₄ ) Sθ ₄ , nitrates _, urea, or complex nitrogen sources such as corn steep liquor, brewer's yeast autolysate, soybean meal, wheat gluten, yeast extract, meat extract, casein hydrolyzate, yeast or potato protein, which can often also serve as a nitrogen source at the same time.

Examples of inorganic salts are the salts of calcium, magnesium, sodium, cobalt, molybdenum, manganese, potassium, zinc, copper and iron. The chlorine, sulfate and phosphate ions are particularly worth mentioning as the anion of these salts. An important factor in increasing the productivity in the process according to the invention is the control of the Fe ^{2 + _} or Fe ³⁺ ion concentration in the production medium.

If necessary, further growth factors are added to the nutrient medium, such as vitamins or growth promoters such as biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate or pyridoxine, amino acids such as alanine, cysteine, proline, Aspartic acid, glutamine, serine, phenylalanine, ornithine or valine, carboxylic acids such as citric acid, formic acid, pimelic acid or lactic acid, or substances such as dithiothreitol.

The mixing ratio of the nutrients mentioned depends on the type of fermentation and is determined in each individual case. The medium components can all be introduced at the beginning of the fermentation, after they have been sterilized separately if necessary or sterilized together, or else they can be added continuously or discontinuously during the fermentation as required.

The breeding conditions are determined in such a way that the organisms grow optimally and that the best possible yields are achieved. Preferred cultivation temperatures are 15 ° C to 40 ° C. Temperatures between 25 ° C and 37 ° C are particularly advantageous. The pH is preferably held in a range from 3 to 9. PH values between 5 and 8 are particularly advantageous. In general, an incubation period of a few hours to a few days, preferably 8 hours to 21 days, particularly preferably 4 hours to 14 days, is sufficient. The maximum amount of product in the medium accumulates within this time.

How can media be optimized advantageously?

For example, see the textbook Applied Microbiol Physics, "A Practical Approach (Eds. PM Rhodes, PF Stanbury, IRL-Press, 1997, pages 53-73, ISBN 0 19 963577 3). Advantageous media and cultivation conditions are for Bacillus and Further organisms, for example the document EP-A-0 405 370 specifically example 9, for Candida the document WO 88/09822 specifically table 3 and for Ashbya the document by Schmidt et al. (Microbiology, 142, 1996: 419-426) remove.

The process according to the invention can be carried out continuously or batchwise in batch or fed-batch fashion.

Depending on how high the initial productivity of the organism used is, the riboflavin productivity can be increased to different extents by the method according to the invention. As a rule, productivity can advantageously be increased by at least 5%, preferably by at least 10%, particularly preferably by 20%, very particularly preferably by at least 100% in each case compared to the starting organism. Examples

The isolation of the rib genes 1, 2, 3, 4, 5 and 7 from Ashbya gossypii and Saccharomyces cerevisiae is described in the patents WO 95/26406 and WO 93/03183 and specifically in the examples and was carried out accordingly. Reference is expressly made to these writings here.

Sequence 1 shows the DNA construct which, in addition to the selection marker required for the transformation, bears the gene fragments of ribl, rib2, rib4 and rib7.

General nucleic acid methods such as Cloning, »restriction cleavage, agarose gel electrophoresis, linking of DNA fragments, transformation of microorganisms, cultivation of

Bacteria and sequence analysis of recombinant DNA were, unless otherwise described, as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed.

example 1

Cloning of the DNA construct containing the ribl, rib2, rib4 and rib7 gene copies (vector Tef-G418-Tef ribl, 2, 7, 4)

Expression constructs of the rib genes: The vector TefG418Tefrib3, 4, 5 is described in WO 99/61623. This vector was cut with Kpnl, felled and released again and then partially digested with Nhel. The larger fragment, once cut with Nhel and Kpnl, was purified from an agarose gel. The rib7 gene was amplified from vector pJR765 (described in WO 95/26406) with the aid of PCR (primer: TCGAGGTACCGGGCCCCCCCTCGA; TCGAACTAGTAGACCAGTCAT). The specific PCR product was cut with Kpnl / Spel and ligated with the Kpnl / Nhel cut vector described above. The result was vector TefG418Tefrib7, 4. The rib2 gene was amplified from the vector pJR758 (WO 95/26406) with PCR and the resulting product was cut with Spei and Nhel (primer: CCCAACTAGTCTGCAGGACAATTTAAA; AGTGCTAGCCTACAATTCGCAGCAAAAT). This DNA fragment is with the Cut and phosphatase-treated vector TefG418Tefrib7.4 was ligated. The result was vector TefG418Tef-rib7,4,2.

The ribl gene was amplified from vector pJR765 (WO95 / 26406) by PCR (primer: GTAGTCTAGAACTAGCTCGAAACGTG;

GATTCTAGAACTAGAACTAGTGGATCCG) and was cut with Xbal. This DNA fragment has been ligated with the Nhel cut and phosphatase treated vector TefG418Tefrib7, 4.2.

The resulting DNA construct represents the vector Tef-G418-ribl, 2,7,4.

Example 2

Transformation of the DNA construct into the Ashbya gossypii fungus The DNA construct described in Example 1 (vector Tef-G418-ribl, 2,4,7) was completely cut with the restriction enzyme Xbal and the insert which carries the rib gene sequences purified by agarose gel separation. MA2 medium (10 g / 1 Bacto-Peptone, 1 g / 1 yeast extract, 0.3 g / 1 myo-inositol and 10 g / 1 D-glucose) was inoculated with Ashbya gossypii spores. The culture was incubated for 12 h at 4 C and then with shaking for 13 h at 28 ° C. The cell suspension was centrifuged off and the cell pellet was taken up in 5 ml of 50 mM potassium phosphate buffer pH 7.5, 25 mM DTT. After a 30-minute heat treatment at 28 ° C., the cells were again centrifuged off and taken up in 25 ml of STM buffer (270 mM sucrose, 10 mM TRIS-HC1 pH 7.5, 1 mM MgCl ₂ ). Approx. 3 ° cg of the above-purified insert and 40 U Spei enzyme were then added to 0.5 ml of this suspension and electroporated in a Biorad gene pulser (100Ω, 20 »= F, 1.5kV). After electroporation, 1 ml of MA2 medium was added to the cells and spread on MA2 agar culture plates. For antibiotic selection, the plates are overlaid after 5 hours of incubation at 28 ° C. with 5 ml of “low-melting” agarose, which contains the antibiotic G418 (200 ° eg / ml). The transformants were clonally purified by micromanipulation (Steiner and Philipsen (1995) Genetics, 140; 973-987). The successful integration of the construct was verified by PCR analysis of the genomic DNA of the transformants. The isolation of the genomic DNA was carried out as described by Carle and Olson (Proc. Natl. Acad. Sei, 1985, 82, 3756-3760) and Wright and Philipsen (Gene, 1991, 109, 99-105). The PCR with primers specific for the construct was carried out according to R. Saiki (PCR Protocols, 1990, Academic Press, 13-20). The PCR fragments are analyzed by separation using an agarose gel. Successful integration into the genome by PCR was demonstrated for all transformants.

Example 3

Riboflavin determination in the recombinant Ashbya gossypii clone Ashbya gossypii LU21 (wild-type strain, ATCC 10895) and the strains LU21 # 1 and # 2 resulting therefrom by transformation with the construct described in Example 1 were grown on agar medium at 28 ° C. for 4 days. From this plate, three 100 ml Erlenmeyer flasks were inoculated with 10 ml medium (27.5 g / 1 yeast extract, 0.5 g / 1 MgSO, 50 ml / 1 soybean oil, pH 7.0). After 40 hours of incubation at 28 ° C., 180 rp on the shaker, 1 ml of the culture broth was transferred to 250 ml Erlenmeyer flasks with 20 ml of YPD medium (10 g / 1 yeast extract, 20 g / 1 baetopeptone, 20 g / 1 glucose ). Incubation 28 ° C, 300 rpm. After 190 h, a 1 ml sample was taken from each flask and 1 ml of 1 M perchloric acid was added. The sample was filtered and the riboflavin content determined using HPLC analysis. A calibration with riboflavin standards (10 mg / 1, 20 mg / 1, 30 mg / 1, 40 mg / 1, 50 mg / 1) was carried out.

Parameters of the HPLC method for riboflavin determination:

Column ODS Hypersil 5 mm 200 X 2.1 mm (HP)

Eluent A water with 340 ml H ₃ PO ₄ (89%) to pH 2.3

Eluent B 100% acetonitrile

gradient

Stop time 0 to 6 min .: 2% B to 50% B 6 to 6.5 min: 50% B to 2% B

Flow 0.5 ml / min

Detection 280 nm

Temperature 40 ° C

Injection 2 to 10 «1

The approaches with clone # 1 and # 2, which contain an additional gene copy of the rib genes 1, 2, 4 and 7, show a significantly increased riboflavin productivity compared to the starting strain (FIG. 1).

Figure 1 shows the riboflavin yields of the different clones. By introducing the ribl, 2, 4 and 7 genes, riboflavin yields could be increased by up to 135% compared to the unmodified strain.

Claims

claims

1. A process for the microbial production of riboflavin by cultivating a microorganism of the genus Ashbya capable of producing ribolavin which has higher activities than the wild type ATCC 10895 in at least two of the gene products from the group ribl, rib2, rib4 and rib7, and then that Riboflavin formed isolated from the culture medium.

2. The method according to claim 1, characterized in that three gene products from the group ribl, rib2, rib4 and rib7 have higher activities.

3. The method according to claim 1, characterized in that four gene products from the group ribl, rib2, rib4 and rib7 have higher activities.

4. The method according to any one of claims 1 to 3, characterized in that the higher gene activity of the rib gene products is caused by an increased gene expression.

5. The method according to claim 4, characterized in that the increased gene expression is caused by an increased number of gene copies.

6.Procedure according to one of the above Claims, characterized in that the rib gene product is a polypeptide sequence as shown in SEQ ID NO: 2,4,6,8, or one of these

Has sequences by exchange, insertion or deletion of up to 5% of the amino acid codons available polypeptide sequence.