WO1999061623A2

WO1999061623A2 - Genetic method for producing riboflavin

Info

Publication number: WO1999061623A2
Application number: PCT/EP1999/003196
Authority: WO
Inventors: Henning ALTHÖFER; Harald Seulberger; Oskar Zelder; Jose Luis Revuelta Doval
Original assignee: Basf Aktiengesellschaft
Priority date: 1998-05-28
Filing date: 1999-05-10
Publication date: 1999-12-02
Also published as: WO1999061623A3; KR20010043867A; AU4140999A; EP1082438A2; DE19823834A1; ID27073A; CN1303434A; RU2000133310A; JP2002516108A

Abstract

The invention relates to a genetic method for producing riboflavin. The production of riboflavin in organisms is increased by specially selecting genes of the riboflavin biosynthesis or of the combination thereof in organisms, especially in bacteria, fungi, yeasts and plants, and of the expression thereof. The invention also relates to a nucleic acid fragment containing genes with the sequences SEQ ID No. 1, SEQ ID No. 3 or SEQ ID No. 5 or the functional equivalents thereof, to expression vectors containing the nucleic acid fragments, and to organisms containing at least one nucleic acid fragment or at least one vector.

Description

Genetic process for the production of riboflavin

description

The present invention relates to a genetic process for the production of riboflavin. The special selection of genes of riboflavin biosynthesis or their combination in organisms, especially in bacteria, fungi, yeasts and plants and their expression, increases the ribofiavin production in these organisms.

The invention further relates to nucleic acid fragments containing genes with the sequences SEQ ID NO. 1, SEQ ID No. 3 or SEQ ID No. 5 or their functional equivalents, expression vectors containing the nucleic acid fragments and organisms containing at least one nucleic acid fragment or at least one vector.

Vitamin B2, also called riboflavin, is produced by all plants and a variety of microorganisms. It is essential for humans and animals as they are unable to synthesize it. Riboflavin plays an important role in metabolism. For example, it is involved in the utilization of carbohydrates. With vitamin B2 deficiency, inflammation of the mucous membranes of the mouth and throat, itching and inflammation in the skin folds and similar skin damage, conjunctivitis, reduced visual acuity and clouding of the cornea occur. Growth and weight loss may occur in infants and children. Vitamin B2 is therefore of great economic importance, for example as a vitamin preparation for vitamin deficiency and as a feed additive. Various foods are added. It is also used as a food coloring, for example in mayonnaise, ice cream, pudding, etc.

Vitamin B2 is produced either chemically or microbially (see e.g. Kurth et al., 1996, Riboflavin, in: Ullmann's Encyclopedia of industrial chemistry, VCH Weinheim). In the chemical production process, riboflavin is usually obtained as a pure end product in multi-stage processes, with relatively expensive starting products, e.g. D-Ribose, must be used.

An alternative to the chemical synthesis of riboflavin is the fermentative production of vitamin B2 by microorganisms. Renewable raw materials such as

Sugar or vegetable oils. The production of riboflavin by fermentation of mushrooms such as Eremothecium ashbyii or Ashbya gossypii is known (The Merck Index, Windholz et al., eds. Merck & Co., page 1183, 1983), but also yeasts such as Candida, Pichia and Saccharomyces or bacteria such as Bacillus, Clostridien or Corynebacteria described as a riboflavin producer. EP-A-0 405 370 and EP-A-0 821 063 describe the production of riboflavin with recombinant bacterial strains, the strains being obtained from Bacillus subtilis by transformation with riboflavin biosynthetic genes.

In patent WO 95/26406 or WO 93/03183 and in DE 44 20 785 the cloning of the genes specific for riboflavin biosynthesis from the eukaryotic organisms Ashbya gossypii or Saccharomyces cerevisiae, as well as microorganisms that have been transformed with these genes, and the use of such microorganisms for riboflavin synthesis.

In both organisms, 6 enzymes catalyze the formation of riboflavin based on guanosine triphosphate (GTP) and ribulose-5-phosphate. Here, the GTP-cyclohydrolase-II (ribl gene product) converts GTP to 2,5-diamino-6- (ribosylamino) -4- (3H) -pyrimidi- non-5-phosphate. This compound is then converted to 2,5-diamino-ribitylamino-2,4- by the 2,5-diamino-6- (ribosylamino) -4- (3H) -pyrimidinone-5-phosphate reductase (rib7 gene product). IH, 3H) - pyrimidine-5-phosphate reduced and then deaminated by a specific deaminase (rib2 gene product) to 5-amino-6-ribitylamino-2, 4- (IH, 3H) -pyrimidinedione-5-phosphate. The phosphate is then split off by an unspecific phosphatase.

Ribulose-5-phosphate, in addition to GTP the second starting product of the last enzymatic steps in riboflavin biosynthesis, is converted to 3,4-dihydroxy by the 3,4-dihydroxy-2-butanone-4-phosphate synthase (rib3 gene product). 2-butanone-4-phosphate (DBP) implemented.

Both DBP and 5-amino-6-ribitylamino-2,4- (IH, 3H) -pyrimidinedione are the educts of the enzymatic synthesis of 6,7-dimethyl-8-ribityllumazine. This reaction is catalyzed by the rib4 gene product (DMRL synthase). DMRL is then converted to riboflavin by riboflavin synthase (rib5 gene product) (Bacher et al. (1993), Bioorg. Chem. Front. Vol. 3, Springer Verlag).

Despite these advances in the production of riboflavin, there is still a need to improve and increase vitamin B2 productivity to meet the increasing demand and to make the production of riboflavin more efficient. The task was therefore to further improve vitamin B2 productivity. This object was characterized by a process for the increased production of riboflavin with an organism which is capable of synthesizing riboflavin, characterized in that the activity of the enzymes 3, 4-dihydroxy-2-butanone-4-phosphate synthase , Dimethyl-8-ribityllumazin synthase and riboflavin synthase or their functional analogs increased in the organism, solved. The process for the increased production of riboflavin is advantageously carried out with an organism which is capable of synthesizing riboflavin and which additionally combines the genes which are responsible for the enzymes 3, 4-dihydroxy-2-butanone-4-phosphate synthase (= rib3 gene product), dimethyl-8-ribityllumazine synthase (= rib4 gene product) and riboflavin synthase (= rib5 gene product) or their functional analogues.

Another advantage of increasing vitamin B2 productivity is the combination of increasing the natural enzyme activity and introducing the above-mentioned gene combination to increase gene expression.

In principle, all organisms which are able to synthesize riboflavin are suitable as organisms or host organisms for the process according to the invention. Organisms that can synthesize riboflavin naturally are preferred. However, organisms which are able to synthesize riboflavin due to the introduction of the complete vitamin B2 synthesis genes are also suitable for the process according to the invention. Organisms such as bacteria, yeast, fungi or plants are suitable for the process according to the invention. Examples include eukaryotic organisms such as fungi, which are described in Indian Chem Engr. Section B. Vol 37, No 1.2 (1995) on page 15, Table 6, such as Ashbya or Eremothecium, yeasts such as Candida, Saccharomyces or Pichia or plants such as Arabidopsis, tomato, potato, corn, soybean, rape, barley , Wheat, rye, rice, millet, cotton, sugar beet, sunflower, flax, hemp, canola, oats, tobacco, alfalfa, lettuce or the various tree, nut and wine species or prokaryotic organisms such as gram-positive or gram- negative bacteria such as Corynebacterium, Brevibacterium, Bacillus, Clostridium, Cyanobacter, Escherichia or Klebsiella. Organisms are preferably selected from the group of the genera Corynebacterium, Brevibacterium, Bacillus, Escherichia, Ashbya, Eremothecium, Candida or Saccharomyces or plants such as corn, soybeans, rape, barley, wheat, potatoes or tomatoes. Organisms of the genus and species Ashbya gossypii, Eremothecium ashbyii, Saccharomyces cerevisiae, Candida flaveri, Candida famata, Corynebacterium ammoniagenes or Bacillus are particularly preferred subtilis. Maize, soybean, rapeseed, barley, wheat, potato and tomato are particularly preferred as plants.

The combination according to the invention of the rib genes rib3, rib4 and rib5 5 and / or the increase in activity of the genes and their gene products leads to a significantly increased riboflavin productivity. The genes mentioned can in principle be introduced into the organisms used by all methods known to the person skilled in the art; they are advantageously introduced into the organisms or their cells via transformation, transfection, electroporation, with the so-called particle gun or via microinjection. For microorganisms, the person skilled in the art can use the corresponding textbooks from Sambrook, J. et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, by F.M. Ausubel 5 et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by D.M. Glover et al. , DNA Cloning Vol.l, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Habor Laboratory Press or Guthrie et al. See Guide to Yeast Genetics and Molecular Biology, Methods in 0 Enzymology, 1994, Academic Press. Methods such as the introduction of the DNA via homologous or heterologous recombination, for example with the aid of the ura-3 gene, especially the ura-3 gene from Ashbya, as described in the German application DE 19801120.2 and / or via the are advantageous

25 REMI method described below (= "Restriction Enzyme-Mediated Integration").

The REMI technique is based on the co-transformation of a linear DNA construct that has the same restriction at both ends.

30 endonuclease was cut into an organism together with the restriction endonuclease used for this restriction of the DNA construct. The restriction endonuclease then cuts the genomic DNA of the organism into which the DNA construct has been introduced together with the restriction enzyme

Was 35. This leads to an activation of the cell's own repair mechanisms. These repair mechanisms repair the strand breaks in the genomic DNA caused by the endonuclease and thereby also incorporate the co-transformed DNA construct into the genome at a certain frequency. As a rule, they remain

40 restriction sites were obtained at both ends of the DNA.

This technique was developed by Bölker et al. (Mol Gen Genet, 248, 1995: 547-552) for the insertion mutagenesis of fungi. Schiestl and Petes (Proc. Natl. Acad. Sei. USA, 88, 1991: 45 7585-7589) used the method to clarify whether there is heterologous recombination in Saccharomyces. For stable transformation and regulated expression of an inducible Reporter gene was the method of Brown et al. (Mol. Gen. Genet. 251, 1996: 75-80). The system has not yet been used as a genetic engineering tool for optimizing metabolic pathways or for commercial overexpression of proteins.

Using the example of riboflavin synthesis, it was shown that the REMI method can be used to integrate biosynthesis genes into the genome of the above-mentioned organisms and thus production processes for the production of metabolic products of primary or secondary metabolism, especially of biosynthetic pathways, for example of amino acids such as lysine, methionine, Threonine or tryptophan, vitamins such as vitamins A, B2, B6 B12, C, D, E, F, S-adenosylmethionine, biotin, pantothenic acid or folic acid, carotenoids such as ß-carotene, lycopene, canthaxanthin, astaxanthin or zeaxanthin or proteins like Hydrolases such as lipases, esterases, amidases, nitrilases, proteases, mediators such as cytokines, for example lymphokines such as MIF, MAP, TNF, interleukins such as interleukin 1, interferons such as γ-interferon, tPA, hormones such as proteohormones, glycohormones, oligo- or polypetid hormones Vassopressin, endorphins, endostatin, angiostatin, growth factors erythropoietin, transcription factors, integrins such as GPH b / Illa or O _v ßlH / receptors such as the various glutamate receptors, angiogenesis factors such as angiotensin can be optimized.

Using the REMI method, the nucleic acid fragments according to the invention or other of the genes mentioned above can be placed at transcriptionally active sites in the genome.

The nucleic acids are advantageously cloned together with at least one reporter gene into a DNA construct which is introduced into the genome. This reporter gene should allow easy detection via a growth, fluorescence, chemo- or bioluminescence assay or via a photometric measurement. Examples of reporter genes are antibiotic resistance genes, hydrolase genes, fluorescence protein genes, bioluminescence genes, glucosidase genes, peroxidase genes or biosynthesis genes such as the riboflaving genes, the luciferase gene, .beta.-galactosidase gene, gfp gene, lipase gene, esterase gene, acoxidase gene, peroxidase gene, peroxidase gene, peroxidase gene Called adenyltransferase gene. These genes enable the transcription activity and thus the expression of the genes to be measured and quantified easily. This enables genome sites to be identified which show a different productivity up to a factor of 2 (see FIG. 1). Figure 1 shows the clones ITA-GS-15.2, ITA-GS-17.1 and ITA-GS-01, which were obtained after integration, with their different vitamin B2 (= riboflavin) productivities. In the event that the biosynthesis genes themselves enable easy detection, as in the case of the riboflavin, for example, an additional reporter gene can be dispensed with.

If several genes are to be introduced into the organism, all of them can be introduced into the organism together with a reporter gene in a single vector or each individual gene with a reporter gene can be introduced into the organism, the different vectors being able to be introduced simultaneously or successively. Gene fragments that code for the respective activities can also be used in REMI technology.

In principle, all known restriction enzymes are suitable for the method according to the invention for integrating biosynthesis genes into the genome of organisms. Restriction enzymes that only recognize 4 base pairs as a restriction site are less preferred because they cut too frequently in the genome or in the vector to be integrated; preference is given to enzymes that recognize 6, 7, 8 or more base pairs as an interface, such as BamHI, EcoRI, Bglll, SphI , Spei, Xbal, Xhol, Ncol, Sall, Clal, Kpnl, Hindlll, Sacl, PstI, Bpnl, Notl, Srfl or Sfil to name just a few of the possible enzymes. It is advantageous if the enzymes used no longer have interfaces in the DNA to be introduced, this increases the efficiency of the integration. As a rule, 5 to 500 U, preferably 10 to 250, particularly preferably 10 to 100 U of the enzymes are used in the REMI approach. The enzymes are advantageously used in an aqueous solution, the substances for osmotic stabilization such as sugar such as sucrose, trehalose or glucose, polyols such as glycerol or polyethylene glycol, a buffer with an advantageous buffering in the range from pH 5 to 9, preferably 6 to 8, particularly preferably contain 7 to 8 such as Tris, MOPS, HEPES, MES or PIPES and / or substances for stabilizing the nucleic acids such as inorganic or organic salts of Mg, Cu, Co, Fe, Mn or Mo. If appropriate, further substances may also be present, such as EDTA, EDDA, DTT, ß-mercaptoethanol or nuclease inhibitors. However, it is also possible to carry out REMI technology without these additives.

The process according to the invention is carried out in a temperature range from 5 to 80 ° C., preferably from 10 to 60 ° C., particularly preferably from 20 to 40 ° C. All known methods for the destabilization of cell membranes such as, for example, electroporation, fusion with loaded vesicles or the destabilization via various alkali or alkaline earth metal salts such as lithium, rubidium or calcium salts are preferred for the method. The lithium salts are preferred. After isolation, the nucleic acids can be used for the reaction according to the invention directly or after purification.

FIGS. 2 and 3 show the method according to the invention in a schematic overview for the integration of the rib gene combination according to the invention. The DNA was cut with the Spei enzyme and in its presence the DNA was introduced into the organisms. For easier selection, a kanamycin resistance gene was incorporated in the fragment, which is flanked by TEF promoter sequences (so-called "direct repeat"). About these

Sequences, the resistance gene is removed by recombination (see Figure 3).

In principle, the combination of the rib genes according to the invention can be introduced into plants by all methods known to those skilled in the art.

The transfer of foreign genes into the genome of a plant is called transformation. The methods described for the transformation and regeneration of plants are used

Plant tissues or plant cells used for transient or stable transformation. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the use of a gene gun, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the gene transfer mediated by Agrobacterium. The methods mentioned are described, for example, in B. Jenes et al. , Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec.Biol. 42 (1991) 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711). The transformation of plants with Agrobacterium tumefaciens is described, for example, by Höfgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877.

Agrobacteria transformed with an expression vector according to the invention can also be used in a known manner to transform plants, in particular crop plants, such as cereals, corn, soybeans, rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, alfalfa , Lettuce and the various tree, nut and wine species and legumes can be used, for example, by wounded leaves or pieces of leaf bathed in an agrobacterial solution and then cultivated in suitable media.

The genetically modified plant cells can be regenerated using all methods known to the person skilled in the art. Appropriate methods can be found in the above-mentioned writings by S.D. Kung and R. Wu, Potrykus or Höfgen and Willmitzer can be found.

There are a number of ways to increase the enzyme activity of the rib gene products in the cell.

One possibility is to change the endogenous rib genes 3, 4 and 5 in such a way that they code for enzymes with increased rib 3, 4 or 5 activity compared to the starting enzymes. Another increase in enzyme activity can be achieved, for example, by changing the catalytic centers to increase substrate conversion or by canceling the action of enzyme inhibitors, that is to say they have an increased specific activity or their activity is not inhibited. In a further advantageous embodiment, an increased enzyme activity can also take place by increasing the enzyme synthesis in the cell, for example by switching off factors which repress the enzyme synthesis or by increasing the activity of factors or regulatory elements which promote increased synthesis, or preferably by introducing further ones Gene copies. These measures increase the overall activity of the gene products in the cell without changing the specific activity. A combination of these methods can also be used, ie increasing the specific activity and increasing the overall activity. In principle, these changes can be introduced into the nucleic acid sequences of the genes, regulatory elements or their promoters by all methods known to the person skilled in the art. For this purpose, the sequences can be subjected, for example, to a mutagenesis such as a "site directed mutagenesis" as described in D.M. Glover et al. , DNA Cloning Vol.l, (1995), IRL Press (ISBN 019-963476-9), Chapter 6, page 193 ff.

By Spee et al. (Nucleic Acids Research, Vol. 21, No. 3, 1993: 777-778) describes a PCR method using dITP for random mutagenesis.

The use of an "in vitro" recombination technique for molecular evolution is described by Stemmer (Proc. Natl. Acad. Sei. USA, Vol. 91, 1994: 10747-10751). By Moore et al. (Nature Biotechnology Vol. 14, 1996: 458-467) describes the combination of the PCR and recombination method.

The modified nucleic acid sequences are then brought back into the organisms via vectors.

To increase the enzyme activities, modified promoter areas can also be placed in front of the natural genes, so that the expression of the genes is increased and the activity is ultimately increased. Sequences can also be introduced at the 3 'end which, for example, increase the stability of the mRNA and thereby enable increased translation. This also leads to higher enzyme activity.

Further gene copies of the rib genes 3, 4 and 5 are preferably introduced into the cell together. These gene copies can be subject to natural regulation, a changed regulation, the natural regulatory regions being changed in such a way that they enable increased expression of the genes, or else regulatory sequences of foreign genes or even genes of other species can be used.

A combination of the above methods is particularly advantageous.

Functional analogs are understood to mean, for example, functional homologs of the rib genes or their enzymatic activities, that is to say enzymes which catalyze the same enzymatic reactions as the rib genes. These genes also lead to an advantageous increase in riboflavin formation. These functional analogues can also advantageously be mutagenized or modified in the manner mentioned above and their activity can thus be increased.

The functional analogs are advantageously genes or gene products which, for example, come from eukaryotic or prokaryotic organisms. Examples of eukaryotic organisms are mushrooms which are described in Indian Chem Engr. Section B. Vol 37, No 1.2 (1995) on page 15, Table 6, such as eremothecium, yeasts such as Candida, Saccharomyces or Pichia or plants such as Arabidopsis, tomato, potato, corn, soybean, rape, barley, wheat , Rye, rice, millet, cotton, sugar beet, sunflower, flax, hemp, canola, oats, tobacco, alfalfa, lettuce or the various tree, nut and wine species. Examples of prokaryotic organisms are Gram-positive or Gram-negative bacteria such as Corynebacterium, Brevibacterium, Bacillus, Clostri- called dium, Cyanobacter or Escherichia. The functional analogs advantageously come from fungi such as Eremothecium, yeasts such as Saccharomyces or Candida, gram-positive bacteria such as Bacillus or Corynebacterium or gram-negative bacteria such as Escherichia 5 coli. The functional analogs preferably originate from the organisms of the genus and species Eremothecium ashbyii, Saccharomyces cerereiaia, Candida flaveri, Candida famata, Escherichia coli, Corynebacterium ammoniagenes or Bacillus subtilis.

The combination of the genes with the sequences SEQ ID No. 1, SEQ ID No.3 and SEQ ID No.5 or their functional equivalents is advantageous in the method according to the invention.

Functional equivalents of the genes used in the combination according to the invention with the sequences SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 are understood to mean, for example, allele variants which have at least 35% homology at the derived amino acid level, preferably at least 40 % Homology, particularly preferably at least 45% homology, very particularly preferably 20 50% homology. The amino acid sequence derived from the nucleic acids mentioned can be found in the sequences SEQ ID No.2, SEQ ID No.4 and SEQ ID No.6. Allelic variants particularly include functional variants which can be obtained by deleting, inserting or substituting nucleotides from the sequence shown in SEQ ID No. 1, SEQ ID 25 No.3 and SEQ ID No.5, the enzymatic activity of the derived synthesized proteins being retained remains.

Such DNA sequences can be prepared starting from the in SEQ ID _ ₀ No.l, SEQ ID No.3 and SEQ ID No .5 described DNA sequences or parts of these sequences, for example by conventional disierungsverfahren Hybri- or the PCR technique from Isolate eukaryotes or prokaryotes other than Ashbya gossypii as mentioned above. These DNA sequences hybridize to the sequences mentioned under standard conditions. For hybridization be advantageous

35 short oligonucleotides of the conserved region, which can be determined in a manner known to the person skilled in the art by comparison with the corresponding genes from E. coli and B. subtilis.

40 Under standard conditions, for example, temperatures between 42 and 58 ° C in an aqueous buffer solution with a concentration between 0.1 to 5 x SSC (1 X SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7 , 2) or additionally in the presence of 50% formamide such as 42 ° C. in 5 x SSC and in the presence of 50% formamide. The experimental conditions for DNA hybridization are relevant textbooks of genetics such as Sambrook et al. , "Molecular Cloning", Cold Spring Harbor Laboratory, 1989.

Furthermore, homologs of the sequences SEQ ID No. 1, SEQ ID No.3 and SEQ ID No.5 are to be understood as, for example, eukaryotic or prokaryotic homologs, shortened sequences or single-stranded DNA.

In addition, homologs of the sequences SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 are to be understood as derivatives such as promoter variants. The promoters which are upstream of the specified nucleotide sequences together or individually can be changed by one or more nucleotide exchanges, by insertion (s) and / or deletion (s), but without impairing the functionality or effectiveness of the promoters are. Furthermore, the effectiveness of the promoters can be increased by changing their sequence, or completely replaced by more effective promoters, including organisms of other species.

Derivatives are also advantageously to be understood as variants whose nucleotide sequence has been changed before the start codon in such a way that the gene expression and / or the protein expression is changed, preferably increased.

Sequences SEQ ID No. 1, SEQ ID No.3 and SEQ ID No.5 or their functional equivalents can be preferably obtained from microorganisms of the genera Clostridium, Corynebacterium, Brevibacterium Cyanobacter, Bacillus, Eremothecium, Escherichia, Pichia, Ashbya or Candida or from plants , particularly preferably from microorganisms of the genus and type Bacillus subtilis, Corynebacterium ammoniagenes, Escherichia coli, Candida flaveri, Candida famata or fungi, which are described in Indian Chem Engr. Section B., Vol. 37, No. 1,2 (1995) on page 15, table 6, e.g. Isolate Eremothecium ashbyii or Ashbya gossypii, particularly preferably from microorganisms of the genus and species Eremothecium ashbyii or Ashbya gossypii. For example, the rib 3, 4, 5 homologous genes rib A, ribH and ribB, or gene fragments from these, from Bacillus subtilis or the rib3, 4, 5 homologous genes rib B, rib E and rib C, or gene fragments these from E. coli can be used advantageously in prokaryotic systems to increase the riboflavin yield in the process according to the invention.

For optimal expression of heterologous genes in organisms, it is advantageous to change the nucleic acid sequences in accordance with the specific "codon usage" used in the organism. The "codon usage" can be based on computer evaluations easily identify other known genes of the organism in question.

The gene expression of the rib genes 3, 4 and 5 can advantageously be increased by increasing the rib3,4,5 gene copy number and / or by strengthening regulatory factors which have a positive effect on the rib3, 4 and 5 gene expression. For example, regulatory elements can preferably be amplified at the transcription level by using stronger transcription signals such as promoters and enhancers. In addition, an increase in translation is also possible, for example, by improving the stability of the rib3, 4 and 5 mRNA, or by increasing the reading efficiency of this mRNA on the ribosomes.

To increase the number of gene copies, the rib genes 3, 4 and 5, or homologous genes, can be incorporated, for example, into a nucleic acid fragment or into a vector which preferably contains the regulatory gene sequences assigned to the respective rib genes or promoter activity acting in an analogous manner.

In particular, those regulatory sequences are used which increase gene expression. Alternatively, each of the genes described can be brought into a single vector and transformed into the respective production organism.

Under the nucleic acid fragment according to the invention, the rib gene sequences SEQ ID No. 1, SEQ ID No.3 and SEQ ID No.5 or their functional equivalents, which have been functionally linked to one or more regulatory signals to increase the gene expression. For example, these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid. In addition to these new regulatory sequences or instead of these sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically modified so that the natural regulation has been switched off and the expression of the genes increased. However, the gene construct can also have a simpler structure, that is to say no additional regulation signals have been inserted in front of the sequences SEQ ID No. 1, SEQ ID No.3 or SEQ ID No .5 or their functional equivalents, and the natural promoter with its regulation has not been inserted away. Instead, the natural regulatory sequence was mutated in such a way that regulation no longer takes place and gene expression is increased. These modified promoters can also be placed in front of the natural genes to increase activity. The gene construct can also advantageously functionally function one or more so-called "enhancer sequences" linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 'end of the DNA sequences. The rib genes can be contained in one or more copies in the gene construct.

Advantageous regulatory sequences for the method according to the invention are, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacI <ϊ- <T7-, T5-, Contain T3, gal, trc, ara, SP6, λ-P _R - or in the λ-P _L promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFα, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters CaMV / 35S [Franck et al., 1980, Cell 21: 285-294], PRPl [Ward et l., Plant Mol. Biol .22 (1993)], SSU, OCS, lib4, usp, STLS1, B33, LEB4, nos or in the ubiquitin or phaseolin promoter, in this connection are also the promoters of pyruvate decarboxylase and methanol oxidase from, for example, Hansenula advantageous. Further advantageous plant promoters are, for example, one that can be induced by benzenesulfonamide (EP 388186), one that can be induced by tetracycline (Gatz et al., (1992) Plant J. 2,397-404), one that can be induced by abscisic acid (EP335528) or one by

Ethanol or cyclohexanone-inducible (W09321334) promoter.

Plant promoters which ensure expression in tissues or parts of plants in which the biosynthesis of purines or its precursors takes place are particularly advantageous. Promoters which ensure leaf-specific expression are to be mentioned in particular. The promoter of the cytosolic FBPase from potatoes or the ST-LSI promoter from potatoes should be mentioned (Stockhaus et al., EMBO J. 8 (1989) 2445-245). The promoter of the phosphoribosyl pyrophosphate amidotransferase from Glycine max (see also Genbank Accession number U87999) or another node-specific promoter as in EP 249676 can also be used advantageously.

In principle, all natural promoters with their regulatory sequences such as those mentioned above can be used for the method according to the invention. In addition, synthetic promoters can also be used advantageously.

As described above, other genes which are to be introduced into the organisms may also be present in the nucleic acid fragment (= gene construct). These genes can be under separate regulation or under the same regulatory region as the rib genes. These genes are, for example other biosynthetic genes that enable increased synthesis.

For expression in the host organism mentioned above, the nucleic acid fragment is advantageously inserted into a vector such as, for example, a plasmid, a phage or other DNA, which enables optimal expression of the genes in the host. Suitable plasmids are, for example, in E. coli pLG338, PACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHSl, pHS2, PPLC236, pMBL24, pLG200, pUR290, pIN-III ¹¹³ -Bl, λgtll or pBdCIIJJl36OlIJJL36OlIJJL36OlPIIJJL36OlIJJL36OlIJJL36OlIJJL36OlIJJL36OlIlJL36OlIlJJ366lPIlJL36OlPIlJJL36OlIJJLL36OlIJJL36OlIJJLL36OlIJJL36364 , pIJ702 or plJ361, in Bacillus pUBHO, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALSl, pIL2 or pBBH6, in yeasts 2 microns, pAG-1, YEp6, YEpl3 pEMBLYe23 or in or plants pLGV23, pGHlac +, pBinl9, pAK2004 or pDH51 or derivatives of the above

Plasmids. The plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are well known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al. Elsevier, A sterdam-New York-Oxford, 1985, ISBN 0 444 904018). Suitable plant vectors are described in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, p.71-119.

Advantageously, the nucleic acid fragment for the expression of the other genes contained additionally contains 3 'and / or 5' terminal regulatory sequences for increasing expression, which are selected for optimal expression depending on the host organism selected and gene or genes.

These regulatory sequences are intended to enable targeted expression of the genes and protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed and / or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors can preferably influence the gene expression of the introduced genes positively and thereby increase. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

In a further embodiment of the vector, the gene construct according to the invention can also advantageously be introduced into the microorganisms in the form of a linear DNA and via heterologous or homologous recombination can be integrated into the genome of the host organism. This linear DNA can consist of a linearized plasmid or only of the nucleic acid fragment as a vector.

Any plasmid (in particular a plasmid that carries the origin of replication of the 2 μm plasmid from S. cerevisiae) that autonomously replicates in the cell, but also, as described above, a linear DNA fragment that enters the genome of the host integrated. This integration can take place via hetero- or homologous recombination. However, as mentioned above, preferred via homologous recombination (Steiner et al., Genetics, Vol. 140, 1995: 973-987). The genes rib3, rib4 and rib5 can be present individually in the genome at different locations or on different vectors or together in the genome or on one vector.

The organisms used in the process according to the invention which contain the combination of the rib genes 3, 4 and 5 or their functional equivalents show increased riboflavin production.

In the process according to the invention, the organisms used for the production of riboflavin are grown in a medium which enables these organisms to grow. This medium can be a synthetic or a natural medium. Depending on the organism, media known to the person skilled in the art are used. For the growth of the microorganisms, the media used contain a carbon source, a nitrogen source, inorganic salts and possibly small amounts of vitamins and trace elements.

Advantageous carbon sources are, for example, sugars such as mono-, di- or polysaccharides such as glucose, fructose, mannose, xylose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose, complex sugar sources such as molasses, sugar phosphates such as fructose-1, 6-bis-phosphate, sugar alcohols such as mannitol, polyols such as glycerol, alcohols such as methanol or ethanol, carboxylic acids such as citric acid, lactic acid or acetic acid, fats such as soybean oil or rapeseed oil, amino acids such as an amino acid mixture, for example so-called casamino acids (Difco) or individual amino acids such as glycine or aspartic acid or aminosugar, the latter can also be used simultaneously as a nitrogen source.

Advantageous nitrogen sources are organic or inorganic nitrogen compounds or materials that contain these compounds. Examples are ammonium salts such as NH ₄ C1 or (NH ₄ ) ₂ S0 ₄ , nitrates urea, or complex nitrogen sources such as corn swell water, beer yeast autolysate, soybean flour, wheat gluten, yeast extract, meat extract, casein hydrolyzate, yeast or potato protein, which can often also serve as a nitrogen source at the same time.

Examples of inorganic salts are the salts of calcium, magnesium, sodium, cobalt, molybdenum, manganese, potassium, zinc, copper and iron. The chlorine, sulfate and phosphate ions are particularly worth mentioning as the anion of these salts. An important factor for increasing productivity in the process according to the invention is the control of the Fe ^{2 + ~} or Fe ³⁺ ion concentration in the production medium.

If necessary, further growth factors are added to the nutrient medium, such as vitamins or growth promoters such as biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate or pyridoxine, amino acids such as alanine, cysteine, proline, aspartic acid, glutamine, serine, phenylalanine, ornithine or valine, carboxylic acids such as Citric acid, formic acid, pimelic acid or lactic acid, or substances such as dithiothreitol.

The mixing ratio of the nutrients mentioned depends on the type of fermentation and is determined in each individual case. The medium components can all be introduced at the beginning of the fermentation, after they have been separately sterilized or sterilized together, if necessary, or they can be added continuously or discontinuously during the fermentation as required.

The breeding conditions are determined in such a way that the organisms grow optimally and that the best possible yields are achieved. Preferred cultivation temperatures are 15 ° C to 40 ° C. Temperatures between 25 ° C and 37 ° C are particularly advantageous. The pH is preferably held in a range from 3 to 9. PH values between 5 and 8 are particularly advantageous. In general, an incubation period of a few hours to a few days, preferably 8 hours to 21 days, particularly preferably 4 hours to 14 days, is sufficient. The maximum amount of product in the medium accumulates within this time.

A person skilled in the art can see, for example, how media can be optimized advantageously from the textbook Applied Microbiol Physiology, "A Practical Approach (Eds. PM Rhodes, PF Stanbury, IRL-Press, 1997, pages 53-73, ISBN 0 19 963577 3). Advantageous Media and growing conditions are special for Bacillus and other organisms, for example the document EP-A-0 405 370 Example 9, for Candida in WO 88/09822 specifically Table 3 and for Ashbya in Schmidt et al. (Microbiology, 142, 1996: 419-426).

The process according to the invention can be carried out continuously or batchwise in batch or fed-batch fashion.

Depending on how high the initial productivity of the organism used is, the riboflavin productivity can be increased by the method according to the invention to different extents. As a rule, the productivity can advantageously be increased by at least 5%, preferably by at least 10%, particularly preferably by 20%, very particularly preferably by at least 100% in each case compared to the starting organism.

Examples:

The isolation of the rib genes 1, 2, 3, 4, 5 and 7 from Ashbya gossypii and Saccharomyces cerevisiae is described in the patents WO 95/26406 and O 93/03183 and specifically in the examples and was carried out accordingly. Reference is expressly made to these writings here.

Sequence 1 shows the DNA construct which carries the gene fragments of rib3, rib4 and rib5 in addition to the selection marker necessary for the transformation.

General nucleic acid methods such as Cloning, restriction cleavage, agarose gel electrophoresis, linking of DNA fragments, transformation of microorganisms, cultivation of

Bacteria and sequence analysis of recombinant DNA were, unless otherwise described, as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed. example 1

Cloning of the DNA construct containing the rib3, rib4 and rib5 gene copies (vector Tef-G418 rib3,4,5)

Expression constructs of the rib genes: rib3 (vector pJR874), rib4 (vector pJR762) and rib5 (vector pJR739) are described in WO95 / 26406. The vector pAG-110 (Steiner and Philipsen (1994) Mol. Gen. Genet., 242; 263-271) was cut with drain, incubated with Klenow polymerase and deoxy nucleotides (filling in the ends), precipitated and then cut with Sall. The DNA fragment containing the Tef promoter and the kanamycin resistance gene was ligated with the Hindlll and Sall cut vector Bluescript KS- (Stratagene), the Hindlll ends of which were filled in by Klenow polymerase. The vector pBS Tef-G418 was created.

pJR874 was cut in the second cloning step with PvuII and Sall. The rib3 gene fragment was then ligated to a Sall cut and dephosphorilated vector pBS Tef-G418. Since only the Sall ends of the fragment and vector could be ligated, the incompatible PvuII and Sall ends were filled in with Klenow polymerase and then ligated. The resulting vector is called Tef-G418-rib3 in the following.

To subclone the rib5 gene into the vector Tef-G418-rib3, the vector pJR739 was cut with Neol and Notl. The ends were filled in with Klenow polymerase. The rib5 gene fragment was then subcloned into the Sall-cut vector Tef-G418-rib3, the ends of which were also filled. The result was vector Tef-G418-Rib3,5.

In the last cloning step, the rib4 gene fragment from vector pJR762 was PCR by means of the primer

5 'GATCGATCGATCGCTAGCTGGGAGGATATGTTCTGGG 3'

5 'TCCAAGCTTGCTAGCATCTCAAATAAGTGATTAGAAGGACAAGCTGCAAG 3'

won. The PCR fragment was cut with Nhel and subcloned into a Nhel cut vector and treated with alkaline phosphatase Tef-G418rib3,5.

The resulting DNA construct is the vector Tef-G418-rib3, 4, 5. Example 2

Transformation of the DNA construct into the Ashbya gossypii fungus The DNA construct described in Example 1 (vector Tef-G418-rib3, 4, 5) was cut completely with the restriction enzyme Spei and the insert which carries the rib gene sequences by agarose gel separation cleaned up. The insert used for the transformation is shown in SEQ ID No.7. The derived amino acid sequences of the rib genes 3, 4 and 5 present in the insert can be found in the sequences SEQ ID No.8 (= rib3), SEQ ID No.9 (= rib5) and SEQ ID No.10 (= rib4).

MA2 medium (10g / l Bacto-Peptone, 1g / 1 yeast extract, 0.3g / l myo-inositol and 10g / l D-glucose) was inoculated with Ashbya gossypii spores. The culture was incubated at 4 ° C for 12 h and then at 28 ° C with shaking for 13 h. The cell suspension was centrifuged off and the cell pellet was taken up in 5 ml of 50 mM potassium phosphate buffer pH 7.5, 25 mM DTT. After a 30-minute heat treatment at 28 ° C., the cells were again centrifuged off and taken up in 25 ml of STM buffer (270 mM sucrose, 10 mM TRIS-HC1 pH 7.5, ImM MgCl). 0.5 ml of this suspension was then mixed with about 3 μg of the above-purified insert and 40 U Spei enzyme and electroporated in a Biorad Gene Pulser (100Ω, 20 μF, 1.5 kV). After electroporation, 1 ml of MA2 medium was added to the cells and spread on MA2 agar culture plates. For antibiotic selection, the plates are overlaid after 5 hours of incubation at 28 ° C. with 5 ml of “low-melting” agarose, which contains the antibiotic G418 (200 μg / ml). The transformants were clonally purified by micromanipulation (Steiner and Philipsen (1995) Genetics, 140; 973-987). The successful integration of the construct was verified by PCR analysis of the genomic DNA of the transformants. The isolation of the genomic DNA was carried out as described by Carle and 01son (Proc.Natl. Acad. Sei, 1985, 82, 3756-3760) and Wright and Philipsen (Gene, 1991, 109.99-105). The PCR with primers specific for the construct was carried out according to R. Saiki (PCR Protocols, 1990, Academic Press, 13-20). The PCR fragments are analyzed by separation using an agarose gel. The successful integration of the DNA into the genome of the transformants was carried out using the following primers:

Primer A 5 '-TCCCTTAATCATTGTCACTGC-3', Primer B 5 '-CCAAGCTTGCTAGCATCTC-3', Primer C 5 '-CTGCCTGAGAAGCTGGAAAGC-3', Primer D 5 '-TGTGAATTAGTAAGCGAAAGG-3', Primer E 5 '-TACAGAGGT Primer F 5 '-GCTGCCACCCCTCTGATTCAC-3', Primer G: 5 '-ATAAGCTTTTGCCATTCTCAC-3', Primer H: 5 '-CTTTTGCTTTGCCACGGAACG-3'.

Successful integration into the 5 genome was demonstrated for all transformants.

Example 3

Riboflavin determination in the recombinant Ashbya gossypii clone

10 Ashbya gossypii lta-GS-01 (Schmidt, G., Stahmann, K.-P., Kaesler, B., & Sahm, H. (1996) Microbiology 142, 419-426) and the results thereof by transformation with that in Example 1 The resulting strain Ita-GS-01 # 17.1 described was grown on agar medium at 28 ° C for 4 days. There were three of this plate

Inoculated 15 100 ml Erlenmeyer flasks with 10 ml medium (27.5 g / 1 yeast extract, 0.5 g / 1 MgSO ₄ , 50 ml / 1 soybean oil, pH 7.0) (17.1-1, 17.1-2, 17.1-3 ). After 40 hours of incubation at 28 ° C, 180 rpm on the shaker, 1 ml of the culture broth was transferred to 250 ml Erlenmeyer flasks with 20 ml of YPD medium (10 g / 1 yeast extract, 20 g / 1

20 bactopeptone, 20 g / 1 glucose). Incubation 28 ° C, 300 rpm. After 190 h, a 1 ml sample was taken from each flask and 1 ml of 1 M perchloric acid was added. The sample was filtered and the riboflavin content was determined using HPLC analysis. A calibration with riboflavin standards (10 mg / 1, 20 mg / 1, 30 mg / 1, 40 mg / 1,

25 50 mg / 1).

Parameters of the HPLC method for riboflavin determination:

Column ODS Hypersil 5mm 200X 2.1mm (HP)

30 eluent A water with 340 ml H ₃ P0 ₄ (89%) to pH 2.3

Eluent B 100% acetonitrile

gradient

Stop time 10 0 - 6 min. : 2% B to 50% B

35 6-6, 5 min: 50% B to 2% BITlin

Flow 0.5 ml / min

Detection 280 nm

Temperature 40 ° C

Injection 2 - 10 μl

40

All three approaches of clone 17, which contain an additional gene copy of rib genes 3, 4 and 5, show a significantly increased riboflavin productivity compared to the parent strain (FIG. 4).

Figure 4 shows the riboflavin yields of the different clones.

45 By introducing the rib3,4 and 5 genes, riboflavin yields could be increased by up to 150% compared to the unmodified strain.

Claims

claims

1. A process for the increased production of riboflavin with an organism which is capable of synthesizing riboflavin, characterized in that the activity of the enzymes 3, 4-dihydroxy-2-butanone-4-phosphate-Synth.ase, Dimethyl-8-ribityllumazine synthase and riboflavin synthase or their functional analogs increased in the organism.

2. The method according to claim 1, characterized in that the combination of the genes for the enzymes 3,4-di-hydroxy-2-butanone-4-phosphate synthase, Dirnethyl-8-ribityl-lumazine synthase and riboflavin Encode synthase or its functional analogs, to increase the activity of the enzymes in the organism.

3. The method according to claim 1 or 2, characterized in that a bacterium, a yeast, a fungus or a plant is used as the organism.

4. Process according to claims 1 to 3, characterized in that organisms selected from the group of the genera Bacillus, Clostridium, Escherichia, Pichia, Candida, Cyanobacter, Corynebacterium, Brevibacterium,

Saccharomyces, Eremothecium or Ashbya or plants such as Arabidopsis, tomato, potatoes, corn, rapeseed, wheat, barley, sunflowers, millet, rye, oats, sugar beet, bean crops or soybeans are used.

5. Process according to claims 1 to 4, characterized in that organisms selected from the group of the genera Bacillus, Corynebacterium, Brevibacterium, Escherichia, Candida, Eremothecium or Ashbya are used.

6. The method according to claims 1 to 5, characterized in that genes with the sequences SEQ ID NO. 1, SEQ ID No. 3 and SEQ ID No. 5 or their functional equivalents can be used.

7. The method according to claims 1 to 6, characterized in that the equivalents have a homology on the amino acid level coded and derived by the sequences of 35%.

Sign.

8. The method according to claims 1 to 7, characterized in that the genes for the enzymes 3, 4-dihydroxy-2-butanone-4-phosphate synthase, Dirnethy1-8-ribityllumazine synthase and riboflavin synthase or their Functional analogs

5 encode, originate from eukaryotic or prokaryotic organisms.

9. The method according to claims 1 to 8, characterized in that the genes or their equivalents from organisms 0 selected from the group Bacillus, Escherichia, Clostridium, Saccharomyces, Candida, Eremothecium or Ashbya.

10. The method according to claims 1 to 9, characterized in that the genes or their equivalents are located together 5 or separately on at least one vector or chromosomally.

11. Nucleic acid fragment containing genes with the sequences SEQ ID NO. 1, SEQ ID No. 3 and SEQ ID No. 5 or their functional 0 equivalents, the genes or their equivalents being functionally linked to one or more regulation signals.

12. Expression vector containing the nucleic acid fragment according to claim 11.

25

13. Expression vector according to claim 11, characterized in that it is a linear nucleic acid.

14. Organism containing at least one nucleic acid fragment 30 according to claim 11 or at least one vector according to

Claim 12.

15. Use of a combination of the genes necessary for the enzymes 3, 4-dihydroxy-2-butanone-4-phosphate synthase, dimethyl-8-

35 encode ribityllumazine synthase and riboflavin synthase or their functional analogs into an organism that is able to synthesize riboflavin for the increased production of riboflavin.

40 16. Use according to claim 15 in Ashbya gossypii.

17. A method for integrating nucleic acids into the genome of organisms, characterized in that at least one riboflavin synthesis gene is introduced into the genome of the organism via a restriction enzyme.