WO2003048299A2 - Novel spore wall proteins and genes from microsporidia - Google Patents

Novel spore wall proteins and genes from microsporidia Download PDF

Info

Publication number
WO2003048299A2
WO2003048299A2 PCT/US2001/047182 US0147182W WO03048299A2 WO 2003048299 A2 WO2003048299 A2 WO 2003048299A2 US 0147182 W US0147182 W US 0147182W WO 03048299 A2 WO03048299 A2 WO 03048299A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
fragment
protein
spore wall
wall protein
Prior art date
Application number
PCT/US2001/047182
Other languages
French (fr)
Other versions
WO2003048299A3 (en
Inventor
J. Russell Hayman
Theodore E. Nash
Original Assignee
THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, Office of Technology Transfer
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, Office of Technology Transfer filed Critical THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES, Office of Technology Transfer
Priority to PCT/US2001/047182 priority Critical patent/WO2003048299A2/en
Priority to AU2002226011A priority patent/AU2002226011A1/en
Publication of WO2003048299A2 publication Critical patent/WO2003048299A2/en
Publication of WO2003048299A3 publication Critical patent/WO2003048299A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the field of diagnosis and prevention of infectious diseases. Specifically, the present invention relates to the methods of diagnosing and vaccines for preventing microsporidiosis in a subject.
  • Microsporidia are obligate intracellular organisms that infect a wide variety of animals ranging from insects and fish to mammals, including humans. Of over 1000 microsporidial species identified, at least thirteen are known to infect humans (10). The species more commonly identified in humans are members of the families Enchephalitozoonidae and Ente ocytozoonidae. In humans, microsporidiosis is mostly found in HIV/ AIDS patients and commonly results in severe diarrhea and wasting (3, 20). However, microsporidiosis also occurs in immunocompetent individuals and common farm animals (21, 29, 32).
  • sporonts break away from the edge of the parasitophorous vacuole (PV) and reside internally (7, 12).
  • Sporonts undergo a continuous transition into sporoblasts, after which the organelles organize and become more defined.
  • the cells also begin to form an electron-lucent material, the endospore, immediately inside the outer exospore region.
  • the spore is considered mature when the organelles are localized and fully formed.
  • the present invention provides two spore wall proteins of E. intestinalis, spore wall protein 1 and spore wall protein 2, and the genes from which these two proteins are derived for the purposes of diagnosing microsporidiosis and methods of preventing microsporidiosis in a subject. Also, the immunogenicity of these proteins in a mouse infection model is demonstrated.
  • the present invention provides a method of detecting in a sample an antibody directed to spore wall protein 2 or antigenic fragment thereof, comprising: a) contacting isolated spore wall protein 2 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of the antibody directed to spore wall protein 2 or antigenic fragment thereof in the sample.
  • the present invention also provides a method of detecting spore wall protein 1 or an antigenic fragment thereof in a sample, comprising: a) contacting an antibody directed to spore wall protein 1 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of spore wall protein 1 or antigenic fragment thereof in the sample.
  • the present invention also provides a method of detecting spore wall protein 2 or an antigenic fragment thereof in a sample, comprising: a) contacting an antibody directed to spore wall protein 2 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of spore wall protein 2 or antigenic fragment thereof in the sample.
  • the present invention also provides a method of diagnosing a subject having microsporidiosis, comprising: a) amplifying a nucleic acid of the subject by using primers that specifically hybridize to a protein-specific region of a naturally occurring nucleic acid that encodes spore wall protein 2 and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding spore wall protein 2 or fragment thereof in the subject.
  • the present invention provides a method of identifying a subject having a nucleic acid encoding spore wall protein 2 or a fragment thereof, comprising: a) contacting a nucleic acid from the subject with a probe that specifically hybridizes a nucleic acid encoding spore wall protein 2 and b) detecting hybridization of the nucleic acid from the subject with the probe, whereby the presence of hybridization indicates the presence of a nucleic acid that encodes spore wall protein 2 or a fragment thereof.
  • spore wall protein 1 or an immunogenic fragment thereof in a pharmaceutically acceptable carrier.
  • Also provided by the present invention is a method of producing an immune response in a subject, comprising administering to the subject an effective amount of spore wall protein 2 or an immunogenic fragment thereof in a pharmaceutically acceptable carrier.
  • the present invention also provides a method of treating microsporoidiosis, comprising administering to a subject an effective amount of a ligand directed against spore wall protein 1 , in a pharmaceutically acceptable carrier.
  • the present invention also provides a method of treating microsporoidiosis, comprising administering to a subject an effective amount of a ligand directed against spore wall protein 2, in a pharmaceutically acceptable carrier.
  • the present invention provides an isolated protein complex, comprising spore wall protein 1 and spore wall protein 2. Further, the present invention provides a composition comprising this protein complex in a pharmaceutically acceptable carrier. Also provided by the present invention is a method of producing an immune response in a subject, comprising administering to the subject an effective amount of the protein complex.
  • FIGS 2A-2D Immunoelectron microscopy ofE. intestinalis infected host cells at different developmental stages using either mAb 11B2 or 7 G7 followed by afluoro- nanogold anti-mouse antibody and silver staining enhancement.
  • A Parasitophorous vacuole reacted with the mAb 11B2. Arrows in panel A indicate residual staining along the inside of the PV lining.
  • B Parasitophorous vacuole reacted with the mAb 7G7.
  • C Cross sections of mature spores that were released from the parasitophorous vacuole reacted with mAb 7G7. Arrow indicates a gap in the exospore staining.
  • D is
  • Parasitophorous vacuoles contain cells at different stages of development: meronts (M), sporoblasts (SB), sporonts (SP), and mature spores (S). Also shown are cells that do not have a completely defined dense membrane and are considered in transition from meronts into sporonts (M-SP).
  • FIGS 3A-3F Immunofluorescence and confocal imagery of in vitro infected host cells using mAbs specific for SWPl (11B2) and SWP2 (7G7).
  • Panels A. B, and C Localization of SWPl.
  • Panels D, E, and F Localization ofSWP2.
  • D Immunofluorescent staining using the SWP2 mAb 7G7.
  • E DIC image (Normarski) of the same microscopic field.
  • FIG. 4 Examination of differentially expressed swpl and swp2 transcripts by RT-PCR.
  • RT-PCR was performed using mRNA isolated 12, 24, and 72 hours post infection and primers specific for E. intestinalis beta-tubulin, swpl, or swp2. The data are presented as an inverse image of ethidium bromide stained gel following equal volume loading and electrophoresis of the products. Control PCR without reverse transcriptase yielded no products.
  • FIGS 7A-7B Western blot analyses of reduced E. intestinalis spore protein or infected cell lysate reacted with agarose bound lectins and detected with either mAb 11B2 or 7G7.
  • ConA Concanavalin A
  • WGA Wheat Germ Agglutinin
  • FIG. 8 Immunoprecipitation analysis of protein lysates from infected host cells. Infected cell lysates were immunoprecipitated with mAb to SWPl and protein A (IP 11B2 Lysate) or with mAb to SWP2 and protein A (IP 7G7 Lysate). Following SDS- PAGE, western blotting detection was conducted using mAb 7G7 (anti-SWP2). Negative controls included immunoprecipitations using PBS instead of protein lysate (IP 7G7/PBS and IP 11B2/PBS). The detected bands in these lanes are the reduced antibody proteins. As a positive control for western blotting with 7G7, purified spores were included.
  • nucleic acid includes multiple copies of the nucleic acid and can also include more than one particular species of molecule.
  • Encephalitozoon intestinalis and fragments thereof are provided.
  • the present invention provides an isolated spore wall protein 1, having a molecular weight of about 50 kDa and an estimated isoelectric point of 4.71.
  • spore wall protein 1 of this invention can have the amino acid sequence of any of the naturally occurring variants of spore wall protein 1.
  • the methods used to select conserved specific regions of spore wall protein 1 are routine and can be used to identify other examples of spore wall protein 1 from other sources (e.g., other microsporidium isolates).
  • An example of a spore wall protein 1 has the amino acid sequence of SEQ ID NO:2.
  • Also provided by the present invention is another isolated spore wall protein of
  • the present invention provides an isolated protein complex, comprising spore wall protein 1 and spore wall protein 2.
  • This complex is found in the exospore region of the organism and may contribute to the structural integrity of the spore. It is contemplated that a fragment of SWPl and/or SWP2 or an antibody to a fragment of SWPl and/or SWP2 can be used to disrupt the formation of the complex, thereby destabilizing the spore.
  • isolated protein or fragment thereof of this invention is free of contaminants or cell components with which proteins or fragments thereof normally occur and is present in such concentration as to be the only significant protein or fragment thereof present in the sample. "Isolated” does not require that the preparation is technically pure (homogeneous), but it is sufficiently pure to provide the protein or fragment thereof in a form in which it can be used therapeutically, diagnostically or for research.
  • a “protein” is a chain of amino acids which correspond to those encoded by a nucleic acid.
  • a protein usually describes a chain of amino acids having more than about 30 amino acids.
  • a “fragment” is a specific part of a protein having about 2 to about 30 amino acids.
  • “specific” means that the amino acid sequence is not found identically in any other source. The determination of specificity is made routine, because of the availability of computerized amino acid sequence databases, wherein an amino acid sequence of almost any length can be quickly and reliably checked for the existence of identical sequences. If an identical sequence is not found, the protein is "specific" for the recited source.
  • protein can refer to a linear chain of amino acids, or it can refer to a chain of amino acids which have been processed and folded into a functional protein. It is understood, however, that 30 is an arbitrary number with regard to distinguishing proteins and fragments.
  • the proteins and fragments of the present invention are obtained by isolation and purification of the proteins and fragments from cells where they are produced naturally or by expression of exogenous nucleic acid encoding the protein or fragment.
  • the proteins and fragments of this invention can be obtained by chemical synthesis, by proteolytic cleavage of a protein and/or by synthesis from nucleic acid encoding the proteins and fragments.
  • the present invention provides an isolated antigenic or immunogenic fragment of the spore wall proteins of the invention.
  • Antigenic when used herein means capable of binding specifically to an antibody.
  • Immunogenic means capable of producing an immune response.
  • the immune response can be humoral and/or cellular; specifically, the immune response can be characterized by the raising of antibodies directed to the antigen and/or characterized by delayed type hypersensitivity. Thus, the proteins and fragments thereof are immunoreactive.
  • immunoreactiveity means the ability of a molecule to generate an immune response in a host that reduces the severity of illness when the host is subsequently challenged with the same molecule.
  • Fragments can also be randomly chosen from a spore wall protein sequence and synthesized. Two or more fragments that are contiguous in a spore wall protein can be combined to form another fragment. The purified fragments thus obtained can be tested to determine their antigenicity and specificity by routine methods.
  • a method of determining immunogenicity is provided in the Examples below. A person of skill can determine immunogenicity by using theoretical computer programs and/or by injecting a fragment into an animal and subsequently looking for an antibody response directed to the fragment.
  • the present invention also provides mosaic proteins that can be made, as known by a person of skill in the art, by combining non-contiguous fragments from spore wall protein 1 or spore wall protein 2, or fragments of both spore wall protein 1 and spore wall protein 2 to form a polypeptide. Linkage of fragments preferably does not interfere with the function (e.g., immunoreactivity) of these fragments.
  • the mosaic proteins of the invention can be used for diagnostic purposes, or they can be used in a composition of the invention, for example, a vaccine.
  • Protein fragments of the invention include fragments of spore wall protein 1.
  • the fragments can be antigenic or immunogenic fragments of the spore wall protein defined by SEQ ID NO:2.
  • Further examples of antigenic or immunogenic (immunoreactive) fragments of the spore wall protein include the species-specific protein fragments identified in the sequence listing as SEQ ID NOS: 5-24.
  • Protein fragments of the invention include fragments of spore wall protein 2.
  • the fragments can be antigenic or immunogenic fragments of the spore wall protein defined by SEQ ID NO:4.
  • antigenic or immunogenic (immunoreactive) fragments of the spore wall protein include the species-specific protein fragments identified in the sequence listing as SEQ ID NOS:5-19 and SEQ ID NOS:25-36.
  • Spore wall protein 1 and spore wall protein 2 have some immunoreactive fragments in common, for example, fragments identified in the sequence listing as SEQ ID NOS:5-19.
  • Other protein fragments are either SWPl-specific or SWP2-specific (i.e., protein-specific).
  • Modifications to any of the above proteins or fragments can be made, while preserving the specificity and activity (function) of the naturally occurring protein or fragment thereof.
  • naturally occurring describes a protein that occurs in nature.
  • the modifications contemplated herein can be conservative amino acid substitutions, for example, the substitution of a basic amino acid for a different basic amino acid.
  • Modifications can also include creation of fusion proteins with epitope tags or known recombinant proteins or genes encoding them created by subcloning into commercial or non-commercial vectors (e.g., polyhistidine tags, flag tags, myc tag, glutathione-S-transferase [GST] fusion protein, xylE fusion reporter construct).
  • the modifications contemplated will not affect the function of the protein or the way the protein accomplishes that function (e.g., its secondary structure or the ultimate result of the protein's activity.
  • the means for determining these parameters are well known.
  • These products are equivalent to the spore wall proteins of the present invention.
  • the spore wall proteins of the present invention may have non- essential additions, for example, labels, tags and linkers and may also contain 1, 2, 3, 4, 5 or 6 amino acid additions, substitutions or deletions, while still consisting essentially of the referenced amino acid sequence, and retaining their specificity and function as described herein.
  • Protein variants and derivatives are well understood to those of skill in the art and can involve amino acid sequence modifications.
  • amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants.
  • Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues.
  • Immunogenic fusion protein derivatives such as those described in the examples, are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion.
  • Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule.
  • These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example, Ml 3 primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically of single residues but can occur at a number of different locations at once.
  • Insertions usually will be on the order of about from 1 to 10 amino acid residues, and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions. TABLE 1 : Amino Acid Abbreviations
  • substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
  • substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g.
  • an electropositive side chain e.g., lysyl, arginyl, or histidyl
  • an electronegative residue e.g., glutamyl or aspartyl
  • substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
  • Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
  • Extension of a primer in a sequence specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer.
  • Extension of the primer in a sequence specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription.
  • an SWPl or SWP2 primer or probe can be less than or equal to 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475
  • this product is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950,
  • the SWPl product can be up to 1000 nucleotides long. In another embodiment, the SWPl product can be up to 2000 nucleotides long. Further, in one embodiment, the SWP2 product can be up to 3000 nucleotides long. In another embodiment, the SWP2 product can be up to 4000 nucleotides long.
  • Functional nucleic acids that have a specific function, such as binding a target molecule or catalyzing a specific reaction are also provided.
  • Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting.
  • functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences.
  • the functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
  • Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains.
  • Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing.
  • the interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation.
  • the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication.
  • Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC.
  • aptamers have been isolated that have greater than a 10000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule (United States patent 5,543,293). It is preferred that the aptamer have a k d with the target molecule at least 10 fold lower than the k d with a background binding molecule. It is more preferred that the aptamer have a k ⁇ with the target molecule at least 100 fold lower than the k d with a background binding molecule. It is more preferred that the aptamer have a k d with the target molecule at least 1000 fold lower than the k d with a background binding molecule.
  • Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. Ribozymes are thus catalytic nucleic acids. It is preferred that the ribozymes catalyze intermolecular reactions.
  • ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as hammerhead ribozymes, (for example, but not limited to the following United States patents: 5,334,711, 5,436,330, 5,616,466, 5,633,133, 5,646,020, 5,652,094, 5,712,384, 5,770,715, 5,856,463, 5,861,288, 5,891,683, 5,891,684, 5,985,621, 5,989,908, 5,998,193, 5,998,203, WO 9858058 by Ludwig and Sproat, WO 9858057 by Ludwig and Sproat, and WO 9718312 by Ludwig and Sproat) hai ⁇ in ribozymes (for example, but not limited to the following United States patents : 5 ,631 , 115 ,
  • Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non- canonical base pair interactions. This property makes ribozymes particularly good candidates for target specific cleavage of nucleic acids because recognition of the target substrate is based on the target substrates sequence.
  • the triplex forming molecules bind the target molecule with a k d less than 10 " '°. It is also preferred that the triplex forming molecules bind the target molecule with a k d less than 10" 12 .
  • Representative examples of how to make and use triplex forming molecules to bind a variety of different target molecules can be found in the following non- limiting list of United States patents: 5,176,996, 5,645,985, 5,650,316, 5,683,874, 5,693,773, 5,834,185, 5,869,246, 5,874,566, and 5,962,426.
  • EGSs External guide sequences
  • RNase P RNase P
  • RNAse P aids in processing transfer RNA (tRNA) within a cell.
  • Bacterial RNAse P can be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate.
  • nucleic acids of the invention include those that encode spore wall protein 1.
  • the nucleic acid can encode a protein having an amino acid sequence of SEQ ID NO:2.
  • the present invention further provides a nucleic acid, wherein the nucleic acid comprises the nucleotide sequence of SEQ ID NO: 1 , encoding the spore wall protein 1 having the amino acid sequence of SEQ ID NO:2.
  • nucleic acids of the invention include those that encode a spore wall protein 2.
  • the nucleic acid can encode a protein having an amino acid sequence of SEQ ID NO:4.
  • nucleic acid wherein the nucleic acid comprises the nucleotide sequence of SEQ ID NO:3, encoding the spore wall protein 2 having the amino acid sequence of SEQ ID NO:4.
  • an isolated nucleic acid that encodes a fragment of a protein is also provided.
  • a "fragment of a nucleic acid” is a specific part of a nucleic acid having at least about 6 nucleotides.
  • “specific” means that the nucleic acid sequence is not found identically in any other source. The determination of specificity is made routine because of the availability of computerized nucleic acid sequence databases, wherein a nucleic acid sequence of almost any length can be quickly and reliably checked for the existence of identical sequences.
  • a nucleic acid fragment of the invention can be a nucleic acid that encodes a fragment of spore wall protein 1.
  • the fragment can encode a protein fragment specific for the protein having the amino acid sequence of S ⁇ Q ID NO:2.
  • the fragment can be a fragment specific for S ⁇ Q ID NO: 1 , i.e., not found in any other nucleic acid.
  • a specific example of a fragment of S ⁇ Q ID NO:l that encodes a fragment of spore wall protein 1 is the nucleic acid comprising nucleotides 211 through 240 of S ⁇ Q ID NO:l (S ⁇ Q ID NO:37) that encodes the amino acid sequence of S ⁇ Q ID NO:5.
  • Further examples of nucleic acid fragments of the invention include the nucleic acids (S ⁇ Q ID NOS:38-56) that encode the fragments of the spore wall protein 1 defined as S ⁇ Q ID NOS:6-24.
  • a nucleic acid fragment of the invention can be a nucleic acid that encodes a fragment of spore wall protein 2.
  • the fragment can encode a protein fragment specific for the protein having the amino acid sequence of S ⁇ Q ID NO:4.
  • the fragment can be a fragment specific for S ⁇ Q ID NO:3, i.e., not found in any other nucleic acid.
  • a specific example of a fragment of S ⁇ Q ID NO:3 that encodes spore wall protein 2 is the nucleic acid comprising nucleotides 979 through 1008 of S ⁇ Q ID NO:3 (S ⁇ Q ID
  • nucleic acid fragments of the invention include the nucleic acids (S ⁇ Q ID NOS:37-51 and S ⁇ Q ID NOS:26-68) that encode the fragments of the spore wall protein 2 defined as S ⁇ Q ID NOS:5-19 and 26-36.
  • S ⁇ Q ID NOS:37-51 are species specific but not gene specific because they are found in the gene that encodes SWPl and the gene that encodes SWP2.
  • the present invention provides a nucleic acid of at least 10 nucleotides that hybridizes under stringent conditions to the nucleic acids that encode the spore wall proteins and fragments of the present invention.
  • stringent conditions a combination of solvent and temperature where a perfect double helix is barely stable, two strands of nucleic acids will pair to form a hybrid helix, only if their respective nucleotide sequences are nearly perfectly complementary.
  • the conditions can be polymerase chain reaction conditions and the hybridizing nucleic acid can be a primer consisting of a specific fragment of the reference sequence or a nearly identical nucleic acid that hybridizes only to the exemplified spore wall protein gene or a homolog thereof.
  • washing conditions refers to the washing conditions used in a hybridization protocol.
  • the washing conditions should be a combination of temperature and salt concentration chosen so that the denaturation temperature is approximately 5- 20 °C below the calculated T m of the hybrid under study.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to the probe or protein coding nucleic acid of interest and then washed under conditions of different stringencies. For example, MgCl 2 concentrations used in PCR buffer can be altered to increase the specificity with which the primer binds to the template, but the concentration range of this compound used in hybridization reactions is narrow, and therefore, the proper stringency level is easily determined.
  • the hybridizing nucleic acid can be a probe that hybridizes only to the exemplified spore wall protein gene or a homolog thereof.
  • the hybridizing nucleic acid can be a naturally occurring homolog of the exemplified genes.
  • the hybridizing nucleic acid can also include insubstantial base substitutions that do not prevent hybridization under the stated conditions or affect the function of the encoded protein, the way the protein accomplishes that function (e.g., its secondary structure or the ultimate result of the protein's activity. The means for determining these parameters are well known.
  • Nucleotides 1-1063 encoding SWPl and nucleotides 1-1084 encoding the spore wall protein ofE. cuniculi have 67% similarity.
  • Nucleotides 1-1052 encoding SWP2 and nucleotides 1-1084 encoding the spore wall protein ofE. cuniculi have 65% similarity.
  • the nucleic acids of the invention can exclude any nucleic acid ofE. cuniculi.
  • the nucleic acids can be at least 10, 18, 20, 25, 50, 100, 150, 200, 300, 500, 550, 750, 900, 950, or 1000 nucleotides in length, depending on whether the nucleic acid is to be used as a primer, probe or for protein expression.
  • nucleic acid encoding a particular protein of interest, or a region of that nucleic acid is constructed, isolated, or modified, that nucleic acid can then be cloned into an appropriate vector, which can direct the in vivo or in vitro synthesis of that wild- type and/or modified protein.
  • the vector is contemplated to have the necessary functional elements that direct and regulate transcription of the inserted gene, hybrid gene or cDNA.
  • the nucleic acid of the invention can be a ribozyme or antisense nucleic acid or other functional elements.
  • the nucleic acid of this invention can be in a cell, which can be a cell expressing the nucleic acid whereby a protein or fragment thereof of this invention is produced in the cell.
  • the vector of this invention can be in a cell, which can be a cell expressing the nucleic acid of the vector whereby a protein or fragment thereof of this invention is produced in the cell.
  • the nucleic acids and/or vectors of this invention can be present in a host animal (e.g., a transgenic animal) which expresses the nucleic acids of this invention and produces the proteins or fragments thereof of this invention.
  • the present invention provides a method of detecting in a sample an antibody directed to an SWPl or SWP2 protein of the invention or antigenic fragment thereof, comprising contacting the protein or antigenic fragment thereof with the sample and detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of the antibody directed to the protein or antigenic fragment thereof in the sample.
  • the protein or fragment used to detect the antibody can be spore wall protein 1.
  • the SWPl can have the amino acid sequence of SEQ ID NO:2, or it can have the sequence of a naturally occurring variant of SWPl.
  • the protein or fragment used to detect the antibody can be SWP2.
  • the SWP2 can have the amino acid sequence of SEQ ID NO:4, or it can have the sequence of a naturally occurring variant of SWP2.
  • Examples of fragments of spore wall protein 1 that can be used in this method include proteins with amino acid sequences identified as SEQ ID NOS:5-24.
  • Examples of fragments of spore wall protein 2 that can be used in this method include proteins with amino acid sequences identified as SEQ ID NOS:5-19 and SEQ ID NOS:25-36. Fragments identified in the sequence listing as SEQ ID NOS: 5- 19 are common to both SWPl and SWP2, such that they can be used to detect antibodies against either SWPl or SWP2.
  • the present invention provides a method of detecting in a subject or a sample from a subject a nucleic acid encoding a protein of the invention (e.g., SWPl and/or SWP2) or a fragment thereof, comprising a) amplifying a nucleic acid of the subject by contacting a nucleic acid from the subject with primers that specifically bind to a protein-specific region of a naturally occurring nucleic acid that encodes the protein and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding the protein or fragment thereof in the subject.
  • the nucleic acid of the subject can be obtained from a suitable sample from the subject.
  • a "subject” is meant an individual.
  • the "subject” can include domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) and birds.
  • the subject is a mammal such as a primate, and, more preferably, a human.
  • a sample means a part representative of the subject.
  • a sample includes, but is not limited to, a quantity of the subject's skin, blood, saliva, urine, cerebrospinal fluid, hair, semen or any tissue obtainable for study and examination.
  • the present invention further provides a method of diagnosing a subject having microsporidiosis, comprising a) amplifying a nucleic acid of the subject by contacting a nucleic acid from the subject with primers that specifically bind to a species-specific region of a naturally occurring nucleic acid that encodes a protein of the invention and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding a protein ofE. intestinalis in the subject.
  • the primers can be any nucleic acid that can specifically bind to and amplify a nucleic acid encoding spore wall protein 1, having the amino acid sequence of S ⁇ Q ID NO:2 or a naturally occurring variant of SWPl .
  • the invention teaches a person of skill to detect a subject having a nucleic acid encoding SPWl, SPW2, a protein complex comprising SWPl and SWP2, or a fragment of the proteins by contacting a nucleic acid from the subject with a microchip array comprising a probe that specifically hybridizes a nucleic acid encoding a protein of the invention and b) detecting a signal generated by the nucleic acid hybridizing with the probe, whereby the presence of the signal indicates the presence of a nucleic acid that encodes a protein of the invention or a fragment thereof.
  • a person of skill in the art can use a kit for detection of the nucleic acids as described, for example, by Affymetrix® Co ⁇ oration.
  • the nucleic acid of the subject can be obtained from a suitable sample from the subject.
  • the present invention provides a method of producing an immune response in a subject, comprising administering to the subject an effective amount of at least one composition of the present invention and a pharmaceutically acceptable carrier.
  • a person of skill can administer to a subject a composition comprising spore wall protein land/or spore wall protein 2 and a pharmaceutically acceptable carrier to produce an immune response.
  • a person of skill can administer to a subject a composition comprising a protein complex comprising spore wall protein 1 and spore wall protein 2 and a pharmaceutically acceptable carrier to produce an immune response.
  • an "effective amount" of an agent is that amount needed to achieve the desired result or results.
  • Detection of an immune response in the subject or in the cells of the subject can be carried out according to methods standard in the art, such as detecting antibodies directed against a protein of the invention or fragments thereof and/or detecting the presence of delayed type hypersensitivity activated by the proteins or fragments.
  • the immune response in a subject can be totally protective, whereby infection by E. intestinalis is prevented or partially protective, whereby the pathogen load is decreased and the severity of infection is reduced. Further, the immune response can be therapeutic, whereby a subject infected by E. intestinalis can be treated to partially or totally eradicate the organism, thereby improving the clinical condition of the subject.
  • a composition of the present invention that produces a protective immune response in a subject directed against E. intestinalis can also produce a totally or partially protective immune response in a subject directed against E. cuniculi.
  • SWPl and SWP2 are distinct from the spore wall protein ofE. cuniculi, it is expected that an agent that interferes with an activity or function of SWPl or SWP2 would interfere with an activity or function of the spore wall protein ofE. cuniculi.
  • an antibody that interacts with SWPl or SWP2 is likely to interact with the spore wall protein ofE. cuniculi.
  • the present invention also provides a method of treating microsporoidiosis, comprising administering to a subject an effective amount of a ligand directed against a protein of the invention or fragment thereof, in a pharmaceutically acceptable carrier.
  • a ligand that specifically binds the protein is also contemplated.
  • the ligand can be an antibody, a fragment of an antibody (e.g., a Fab fragment), or a smaller molecule designed to bind an epitope of the protein. Because spore wall protein 1 and spore wall protein 2 are glycosylated, in one embodiment of the invention, it is contemplated that a ligand can be a sugar moiety that inhibits binding of a spore wall protein in the spore wall to a host cell, thereby preventing infection.
  • the antibody or ligand can be bound to a substrate or labeled with a detectable moiety or both bound and labeled.
  • an expression construct is a vector (plasmid or virus) that directs a transfected bacterium, mammalian cell or insect cell to synthesize large amounts of the protein encoded by a foreign DNA insert contained within the vector's DNA.
  • an expression construct can comprise a nucleic acid that encodes spore wall protein 1 or immunogenic fragment thereof and/or a nucleic acid that encodes spore wall protein 2 or fragment thereof.
  • An expression construct described herein can comprise a promoter operably linked to a regulatory sequence as well as a coding sequence that encodes spore wall protein 1 or spore wall protein 2 operably linked to the promoter.
  • Any of the compositions of this invention can comprise in addition to a pharmaceutically acceptable carrier a suitable adjuvant.
  • suitable adjuvant describes an adjuvant capable of being combined with the polypeptide or fragment thereof of this invention to further enhance an immune response without deleterious effect on the subject or the cell of the subject.
  • a suitable adjuvant can be, but is not limited to, MONTANIDE ISA51 (Seppic, Inc., Fairfield, NJ), SYNTEX adjuvant formulation 1 (SAF-1), composed of 5 percent (wt/vol) squalene (DASF, Parsippany, N.J.), 2.5 percent Pluronic, L121 polymer (Aldrich Chemical, Milwaukee), and 0.2 percent polysorbate (Tween 80, Sigma) in phosphate-buffered saline.
  • SAF-1 SYNTEX adjuvant formulation 1
  • DASF 5 percent (wt/vol) squalene
  • Pluronic 5 percent (wt/vol) squalene
  • L121 polymer Aldrich Chemical, Milwaukee
  • Tween 80 polysorbate
  • delivery of the nucleic acid or vector to cells can be via a variety of mechanisms.
  • delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WT), as well as other liposomes developed according to procedures standard in the art.
  • the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc.
  • vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome.
  • the recombinant retrovirus can then be used to infect and thereby deliver to the infected cells nucleic acid encoding the peptide or polypeptide.
  • the exact method of introducing the exogenous nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors.
  • adenoviral vectors adeno-associated viral (AAV) vectors
  • lentiviral vectors lentiviral vectors
  • pseudotyped retroviral vectors vaccinia viral vectors
  • vaccinia viral vectors any other viral vectors now known or developed in the future.
  • Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanisms. This invention can be used in conjunction with any of these or other commonly used gene transfer methods.
  • the dosage for administration of adeno virus to humans can range from about 10 7 to 10 9 plaque forming units (pfu) per injection, but can be as high as 10 12 pfu per injection.
  • a subject will receive a single injection. If additional injections are necessary, they can be repeated at intervals (1-6 months) for an indefinite period and/or until the efficacy of the treatment has been established.
  • the efficacy of treatment can be determined by evaluating the clinical parameters described herein. Efficacy of treatment is measured by absence of disease in subjects exposed to the pathogen.
  • nucleic acid or vector required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every nucleic acid or vector. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
  • Parenteral administration of the polypeptides or fragments thereof, nucleic acids and/or vectors of the present invention, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
  • parenteral administration includes intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous and intratracheal routes.
  • a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is inco ⁇ orated by reference herein.
  • the compositions of the present invention can also be administered transmucosally and by inhalation.
  • a .01 mg/Kg to 10 mg/Kg dosage for example, a 1 mg/Kg dosage of a protein vaccine of the present invention can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect.
  • genomic DNA was isolated from infected host cells and digested with restriction endonucleases. After electrophoresis, DNA was transferred to nylon membrane by alkaline transfer as previously described (26). The blot was hybridized with randomly primed radiolabeled probes.
  • the probe that hybridized with the genes for both spore wall protein 1 (swpl) and spore wall protein 2 (swp2) was a PCR fragment of common sequence representing the predicted amino acids 158-312 of SWPl (SEQ ID NO:72).
  • the swpl specific probe was a PCR fragment that encoded the predicted amino acids 239-387 of SWPl (SEQ ID NO:71).
  • the swp2 specific probe was a nested deletion clone that contained the 3' terminal -500 bases of the swp2 open reading frame (SEQ ID NO:73). The conditions for hybridization were similar to those used, as noted above.
  • clone 46 The flanking regions of clone 46 (swpl) and clone 2.8 (swp2) were amplified by inverse PCR, cloned, and sequenced by primer walking.
  • Inverse PCR is a method by which an unknown sequence upstream and/or downstream of a known sequence (such as a gene) can be identified. Genomic (chromosomal) DNA is digested with a restriction enzyme that cuts the DNA into smaller fragments. The ends of the linear fragments are then ligated or joined to themselves, thus making a circle of DNA.
  • the PCR primers are constructed to a known sequence, but instead of tracking towards each other as is the traditional way PCR is performed, the primers track away from one another into the unknown upstream and downstream sequences.
  • nested deletion clones were constructed using the Erase- A-Base System (Promega; Madison, WI). Based on the size of the deletion clones and overlapping sequence, sequence of the repeated region was determined to be complete. The sequence was confirmed by priming from either end of a modified transposon element randomly inserted into the plasmid insert as described by the manufacturer (EZ: :TN ⁇ TET- 1 > Insertion Kit (Epicentre Technologies; Madison, WI).
  • an infected host cell monolayer from a 75 cm2 flask was lysed in 10 ml of lysis buffer containing 5 mM EDTA, 250 mM NaCl, 25 mM Tris (pH7.5), 1% Triton X-100, and protease inhibitor cocktail (Roche; Indianapolis, IN). Lysates were centrifuged to remove cell debris, and monoclonal antibodies 11B2 and 7G7 (1:500 dilution) were added to the cell lysate on ice for one hour. Fifty micro liters of protein A/agarose beads (Life Technologies; Rockville, MD) were added to the mAb/lysate mixture and incubated on ice for one hour.
  • the beads were then washed with PBS, resuspended in 70 ml of Lammeli sample buffer (BioRad; Madison WI) with 2-mercaptoefhanol, and boiled for 5 min., electrophoresed into a 4-20% Tris-Glycine polyacrylamide gel.
  • SWPl and SWP2 are glycosylated, 50 ⁇ l of Concanavalin A/agarose or Wheat Germ Agglutinin/agarose (Vector, Burlingame, CA) were reacted with 125 ⁇ l of infected cell lysate on ice for one hr..
  • methyl-alpha-mannopyranoside Sigma; St. Louis, MO
  • chitin hydrolysate Vector
  • the beads were processed as above. Following SDS-PAGE, proteins were transferred to nitrocellulose and processed for Western blotting.
  • Cover slips were washed five times in PBS and stored at 4°C in post-fixative (2.5% glutaraldehyde, 4% paraformaldehyde) until use.
  • the cover slips were washed in H2O and reacted for 4 min. in the dark with a solution of HQ silver reagents (Nanoprobes, Yaphank, NY) at an equal ratio of red:blue:white.
  • the cover slips were then washed three times in H20, and one time in 1% aqueous tannic acid for 5 min., followed by an H2O rinse.
  • the cover slips were reacted with a solution of reduced K4(FeCN)6 and 1% osmium tetroxide for 15 min.
  • Host cells grown on glass cover slips in 12 well plates, were infected with E. intestinalis spores. When a majority of cells were infected, cover slips were removed and fixed with acetone/methanol and blocked with 1% FBS in PBS for one hr. at RT. Monoclonal antibodies (11B2 or 7G7) were diluted 1 :500 in blocking solution (1% FBS; Hyclone; Logan, UT). After washing in PBS, fluorescein-conjugated, goat-anti-mouse immunoglobulin (1:500) (Cappel; West Chester, PA) was added.
  • the cover slips were mounted on glass slides with Vectashield (Vector; Burlingame, CA) and viewed with either a Zeiss Axioplan Fluorescence microscope or Leica TCS-NT/SP confocal microscope. Controls included omission of primary antibody and staining of uninfected cells. Confocal images were magnified 100X with a zoom value of 2.7. Differential interference contrast images were collected at the same time as fluorescence images using the transmitted light detector. The images were processed using Leica TCS-NT/SP software (version 1.6.551) and Adobe Photoshop 3.0 (Adobe Systems).
  • RNA STAT-60 Tel-Test, Inc, Friendswood, TX
  • intestinalis beta-Tubulin (S ⁇ Q ID NO:69) 5'- GTTGACTGCAAGCTTCCTAAG, (S ⁇ Q ID NO:70) 5'-CAGAGTCGAGTGACTGCTTG (amplicon is 397 base pairs); swpl (S ⁇ Q ID NO:71) 5'-GTTCCTTCTGTACCCTCATG, (S ⁇ Q ID NO:72)
  • 5'-TCAGGATTCAACCCAGTCTTC (amplicon is 692 base pairs); swp2 (S ⁇ Q ID NO:73) 5-AGTGACCGCTGTAGAAATCA, (S ⁇ Q ID NO:72) 5-TCAGGATTCAACCCAGTCTTC (amplicon is 371 base pairs). Controls included PCR amplification without prior reverse transcriptase elongation.
  • IFN- ⁇ receptor null mice 129-Ifhgr ,ml
  • wild type mice 129S3/SvImJ
  • pooled infected or control sera were collected from each mouse on days 15, 29, 45, and 60 post infection, and used at 1 : 500 in western analysis.
  • the second gene (clone 2.8) was isolated from a conventional cDNA library using a fragment of clone 46 as a probe. Using DNA probes unique to either clone 46 or clone 2.8 in Southern analysis, the two hybridizing bands in figure 1 A were accounted for (Fig. IB and Fig. 1C).
  • EM Immuno-electron microscopy
  • mAb 11B2 localized SWPl to the thickened membrane of cells in transition from meronts to sporonts (Fig.2A). Binding of mAb 11B2 to the cell surface diminished as parasites developed, but some staining was evident on the surface of mature spores. Staining seen on the inside of the PV may represent residual protein from developing meronts that were attached to the PV but have since migrated to the lumen. In mature spores that were released from the PV, SWPl was clearly located in the exospore region of the spore wall and not the endospore or plasma membrane (Fig. 2D). In contrast to the reactivity of mAb 11B2, the 7G7 mAb did not react with developing sporonts (Fig.
  • mAb 7G7 staining was not always uniformly intense around the spore. A gap in the staining was occasionally observed (arrow, Fig. 2C) and may represent the area near the anchoring disk and polar filament.
  • RT-PCR was performed on mRNA from "synchronized" infected host cells (Fig.4). Although infection of host cells was performed so that those cells infected should be infected at the same time, Encephalitozoon species develop in an asynchronzed fashion (7). This results in several developmental stages existing within a single PV and complicates the determination of stage specific expression, but by 48 hours post infection, mature spores are formed (23). RT-PCR was performed using RNA purified from "synchronized" infected host cells at 12, 24, and 72 hours post infection.
  • Transcripts for both swpl and swp2 were first detected 24 hours post infection and increased with time; however, the level of swpl mRNA was higher than that of swp2 at 24 hours. This contrasted with the expression of beta-tubulin, which is first detected 12 hours post infection and increased slightly over time. While differences between RNA stabilities between swpl and swp2 could not be ruled out, these data suggest that the swpl gene is transcribed at a higher level that swp2 early in infection.
  • SWPl and SWP2 N-terminal domain Comparison of the SWPl and SWP2 N-terminal domain with that of the previously identified E. cuniculi SWP showed that the E.c. SWP is 65% and 61% identical to E. . SWPl and SWP2, respectively (5). In addition, ten cysteine residues in this domain are conserved, suggesting similar secondary structures. Tyrosine phosphorylation sites are also conserved in these domains (positions 136-142); however, studies were inconclusive as to whether these sites are phosphorylated. SWPl and SWP2 have N-linked glycosylation sites, but they are in slightly different locations ( Figure 5, stippled boxes).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention provides methods of diagnosing and vaccines for preventing and treating microsporidiosis in a subject. Specifically, the present invention provides spore wall proteins of Encephalitozoon intestinalis, nucleic acids that encode the proteins and compositions for producing an immune response in a subject to microsporidia.

Description

NOVEL SPORE WALL PROTEINS AND GENES FROM MICROSPORIDIA
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates to the field of diagnosis and prevention of infectious diseases. Specifically, the present invention relates to the methods of diagnosing and vaccines for preventing microsporidiosis in a subject.
BACKGROUND ART
Microsporidia are obligate intracellular organisms that infect a wide variety of animals ranging from insects and fish to mammals, including humans. Of over 1000 microsporidial species identified, at least thirteen are known to infect humans (10). The species more commonly identified in humans are members of the families Enchephalitozoonidae and Ente ocytozoonidae. In humans, microsporidiosis is mostly found in HIV/ AIDS patients and commonly results in severe diarrhea and wasting (3, 20). However, microsporidiosis also occurs in immunocompetent individuals and common farm animals (21, 29, 32).
Microsporidia infect cells by a unique mechanism (31). Upon close association of an individual spore with a suitable host cell, a hollow polar filament is extruded from the spore into the cytoplasm of the host cell. The infectious sporoplasm passes by way of the polar filament into the interior of the cell initiating infection (18). Alternatively, the organism may also be internalized by phagocytosis (33). The microsporidia then enter a stage of proliferative growth by nuclear fission called merogony, resulting in large and less structurally defined cells. In the Encephalitozoon family, the transition from meront to the next stage (sporont) is marked by the aggregation of electron dense material on the outer spore membrane. Then, in most cases, fully formed sporonts break away from the edge of the parasitophorous vacuole (PV) and reside internally (7, 12). Sporonts undergo a continuous transition into sporoblasts, after which the organelles organize and become more defined. The cells also begin to form an electron-lucent material, the endospore, immediately inside the outer exospore region. The spore is considered mature when the organelles are localized and fully formed.
The present invention provides two spore wall proteins of E. intestinalis, spore wall protein 1 and spore wall protein 2, and the genes from which these two proteins are derived for the purposes of diagnosing microsporidiosis and methods of preventing microsporidiosis in a subject. Also, the immunogenicity of these proteins in a mouse infection model is demonstrated.
SUMMARY OF THE INVENTION
The present invention provides an isolated spore wall protein 1. The present invention also provides an isolated antigenic or immunogenic fragment of spore wall protein 1.
The present invention provides an isolated spore wall protein 2. The present invention also provides an isolated antigenic or immunogenic fragment of spore wall protein 2.
The present invention provides an isolated nucleic acid, encoding spore wall protein 1. The present invention provides an isolated fragment of the nucleic acid that encodes spore wall protein 1 , wherein the fragment encodes a fragment specific for spore wall protein 1. The present invention provides a nucleic acid that hybridizes to a nucleic acid that encodes spore wall protein 1 under stringent conditions.
The present invention provides an isolated nucleic acid, encoding spore wall protein 2. The present invention provides an isolated fragment of the nucleic acid that encodes spore wall protein 2, wherein the fragment encodes a fragment specific for spore wall protein 2. The present invention provides a nucleic acid that hybridizes to a nucleic acid that encodes spore wall protein 2 under stringent conditions.
Further provided by the present invention is a method of detecting in a sample an antibody directed to spore wall protein 1 or antigenic fragment thereof, comprising: a) contacting isolated spore wall protein 1 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of the antibody directed to spore wall protein 1 or antigenic fragment thereof in the sample.
The present invention provides a method of detecting in a sample an antibody directed to spore wall protein 2 or antigenic fragment thereof, comprising: a) contacting isolated spore wall protein 2 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of the antibody directed to spore wall protein 2 or antigenic fragment thereof in the sample.
The present invention also provides a method of detecting spore wall protein 1 or an antigenic fragment thereof in a sample, comprising: a) contacting an antibody directed to spore wall protein 1 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of spore wall protein 1 or antigenic fragment thereof in the sample. The present invention also provides a method of detecting spore wall protein 2 or an antigenic fragment thereof in a sample, comprising: a) contacting an antibody directed to spore wall protein 2 or antigenic fragment thereof with the sample and b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of spore wall protein 2 or antigenic fragment thereof in the sample.
Further provided by the present invention is a method of detecting in a subject a nucleic acid encoding spore wall protein 1 or a fragment thereof, comprising: a) amplifying a nucleic acid of the subject using primers that specifically hybridize to a protein-specific region of a naturally occurring nucleic acid that encodes spore wall protein 1 and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding spore wall protein 1 or fragment thereof in the subject.
The present invention provides a method of detecting in a subject a nucleic acid encoding spore wall protein 2 or fragment thereof, comprising: a) amplifying a nucleic acid of the subject using primers that specifically hybridize to a protein-specific region of a naturally occurring nucleic acid that encodes spore wall protein 2 and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding spore wall protein 2 or fragment thereof in the subject.
The present invention provides a method of diagnosing a subject having microsporidiosis, comprising: a) amplifying a nucleic acid of the subject using primers that specifically hybridize to a protein-specific region of a naturally occurring nucleic acid that encodes spore wall protein 1 and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding spore wall protein 1 or fragment thereof in the subject. The present invention also provides a method of diagnosing a subject having microsporidiosis, comprising: a) amplifying a nucleic acid of the subject by using primers that specifically hybridize to a protein-specific region of a naturally occurring nucleic acid that encodes spore wall protein 2 and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding spore wall protein 2 or fragment thereof in the subject.
The present invention provides a method of identifying a subject having a nucleic acid encoding spore wall protein 1 or a fragment thereof, comprising: a) contacting a nucleic acid from the subject with a probe that specifically hybridizes a nucleic acid encoding spore wall protein 1 and b) detecting hybridization of the nucleic acid from the subject with the probe, whereby the presence of hybridization indicates the presence of a nucleic acid that encodes spore wall protein 1 or a fragment thereof.
The present invention provides a method of identifying a subject having a nucleic acid encoding spore wall protein 2 or a fragment thereof, comprising: a) contacting a nucleic acid from the subject with a probe that specifically hybridizes a nucleic acid encoding spore wall protein 2 and b) detecting hybridization of the nucleic acid from the subject with the probe, whereby the presence of hybridization indicates the presence of a nucleic acid that encodes spore wall protein 2 or a fragment thereof.
Further provided by the present invention is a method of producing an immune response in a subject, comprising administering to the subject an effective amount of spore wall protein 1 or an immunogenic fragment thereof in a pharmaceutically acceptable carrier.
Also provided by the present invention is a method of producing an immune response in a subject, comprising administering to the subject an effective amount of spore wall protein 2 or an immunogenic fragment thereof in a pharmaceutically acceptable carrier.
The present invention also provides a method of producing an immune response in a subject, comprising administering to the subject an effective amount of an expression construct comprising at least one of the nucleic acids of this invention in a pharmaceutically acceptable carrier.
The present invention also provides a method of treating microsporoidiosis, comprising administering to a subject an effective amount of a ligand directed against spore wall protein 1 , in a pharmaceutically acceptable carrier.
The present invention also provides a method of treating microsporoidiosis, comprising administering to a subject an effective amount of a ligand directed against spore wall protein 2, in a pharmaceutically acceptable carrier.
The present invention provides an isolated protein complex, comprising spore wall protein 1 and spore wall protein 2. Further, the present invention provides a composition comprising this protein complex in a pharmaceutically acceptable carrier. Also provided by the present invention is a method of producing an immune response in a subject, comprising administering to the subject an effective amount of the protein complex.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA-lC. Southern blot analysis of in vitro infected host cell genomic DNA using probes that are either common or specific for swpl or swp2. A. Southern blot using a purified PCR fragment probe common to both swpl and swp2 (predicted amino acid 158-312 of clone 46, see Fig. 5). B. Probed with a PCR fragment specific for swpl. C. Probed with a PCR fragment specific for swp2. Genomic DNA was restriction digested with either EcoR I (E), Hind III (H), or Pst I (P) in triplicate. Uninfected host cell genomic DNA did not hybridize with any of these probes.
Figures 2A-2D. Immunoelectron microscopy ofE. intestinalis infected host cells at different developmental stages using either mAb 11B2 or 7 G7 followed by afluoro- nanogold anti-mouse antibody and silver staining enhancement. A. Parasitophorous vacuole reacted with the mAb 11B2. Arrows in panel A indicate residual staining along the inside of the PV lining. B. Parasitophorous vacuole reacted with the mAb 7G7. C. Cross sections of mature spores that were released from the parasitophorous vacuole reacted with mAb 7G7. Arrow indicates a gap in the exospore staining. D. Cross sections of mature spores that have been released from the parasitophorous vacuole reacted with mAb 11B2. Parasitophorous vacuoles contain cells at different stages of development: meronts (M), sporoblasts (SB), sporonts (SP), and mature spores (S). Also shown are cells that do not have a completely defined dense membrane and are considered in transition from meronts into sporonts (M-SP).
Figures 3A-3F. Immunofluorescence and confocal imagery of in vitro infected host cells using mAbs specific for SWPl (11B2) and SWP2 (7G7). Panels A. B, and C: Localization of SWPl. A. Immuno fluorescent staining using the SWPl specific mAb 11B2. B. DIC image (Normarski) of the same microscopic field. C. Layering of images A and B. Panels D, E, and F: Localization ofSWP2. D. Immunofluorescent staining using the SWP2 mAb 7G7. E. DIC image (Normarski) of the same microscopic field. F. Layering of images D and E. All images are about 16μm in width.
Figure 4. Examination of differentially expressed swpl and swp2 transcripts by RT- PCR. RT-PCR was performed using mRNA isolated 12, 24, and 72 hours post infection and primers specific for E. intestinalis beta-tubulin, swpl, or swp2. The data are presented as an inverse image of ethidium bromide stained gel following equal volume loading and electrophoresis of the products. Control PCR without reverse transcriptase yielded no products.
Figure 5. Predictive amino acid sequence alignment ofE. intestinalis SWPl and SWP2.
The predicted amino acid sequences of SWPl (top) and SWP2 (bottom) are compared. Identical amino acids are indicated by reverse shading, while similarities are boxed. Dashes represent gaps introduced to maximize homology. Arrows denote separation of SWPl and SWP2 into N-terminal and C-terminal domains. The hatched box indicates the predictive signal sequence. Stars denote ten conserved cysteine residues. N- glycosylation sites for swpl and swp2 are indicated by stippled boxes. The C- terminal domain of SWP2 contains a 12 or 15 amino acid repeat that is bracketed and numbered. The repeats containing 15 amino acids are double underlined.
Figures 6A-6B. Nucleotide sequence comparison of the 5 ' and 3 ' flanking regions of swpl and swp2 open reading frames. A. Comparison of the 5' flanking sequence of swpl (top) and swp2 (bottom). Numbering is relative to the translational start (boxed). Bold lettering indicates the putative eukaryotic TATA box promoter. Putative transcriptions start sites for swpl are indicated by an overline. B. Comparison of the 3' flanking sequence of swpl (top) and swp2 (bottom). Numbering of the 3' flanking regions begins at the termination codon (boxed). Bold letters show predicted polyadenylation sites. Asterisks denote sequence identity.
Figures 7A-7B. Western blot analyses of reduced E. intestinalis spore protein or infected cell lysate reacted with agarose bound lectins and detected with either mAb 11B2 or 7G7. A. Purified spores were reduced with 2-mercaptoethanol, run on SDS- PAGE gel, and detected with mAbs to SWPl (11B2) or SWP2 (7G7). B. Cultured infected cell lysate was reacted with agarose bound lectins Concanavalin A (ConA) or Wheat Germ Agglutinin (WGA) with or without the inhibiting sugar (methyl α- mannopyranoside for ConA; chitin hydrolysate for WGA).
Figure 8. Immunoprecipitation analysis of protein lysates from infected host cells. Infected cell lysates were immunoprecipitated with mAb to SWPl and protein A (IP 11B2 Lysate) or with mAb to SWP2 and protein A (IP 7G7 Lysate). Following SDS- PAGE, western blotting detection was conducted using mAb 7G7 (anti-SWP2). Negative controls included immunoprecipitations using PBS instead of protein lysate (IP 7G7/PBS and IP 11B2/PBS). The detected bands in these lanes are the reduced antibody proteins. As a positive control for western blotting with 7G7, purified spores were included.
Figures 9A-9B. Western blot analysis of reduced E. intestinalis spore proteins detected with sera from in vivo infected iNFγ receptor null mice and wild type control mice. A. Sera from six infected iNFγ receptor null mice were collected on day 15, 29, 45, and 60 post infection, pooled at each time point and reacted with reduced E. intestinalis spore proteins in duplicate. B. Sera from six infected wild type control mice were collected on day 15, 29, 45, and 60 post infection, pooled at each time point and reacted with reduced E. intestinalis spore proteins in duplicate. Arrow heads at -50 kDa indicate the expected size of SWPl , and arrow heads at ~150 kDa indicted the expected size of SWP2. SWPl is the bottom band of the triple banding pattern seen at about 52 kDa. Controls included sera from uninfected mice and the anti-SWPl mAb 11B2.
DETAILED DESCRIPTION OF THE INVENTION
It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a nucleic acid" includes multiple copies of the nucleic acid and can also include more than one particular species of molecule.
Proteins The present invention provides an isolated spore wall protein of
Encephalitozoon intestinalis and fragments thereof. Specifically, the present invention provides an isolated spore wall protein 1, having a molecular weight of about 50 kDa and an estimated isoelectric point of 4.71. Moreover, spore wall protein 1 of this invention can have the amino acid sequence of any of the naturally occurring variants of spore wall protein 1. The methods used to select conserved specific regions of spore wall protein 1 are routine and can be used to identify other examples of spore wall protein 1 from other sources (e.g., other microsporidium isolates). An example of a spore wall protein 1 has the amino acid sequence of SEQ ID NO:2.
Also provided by the present invention is another isolated spore wall protein of
Encephalitozoon intestinalis and fragments thereof. Specifically, the present invention provides an isolated spore wall protein 2, having a molecular weight of about 150 kDa and an estimated isoelectric point of 3.66. Moreover, spore wall protein 2 of this invention can have the amino acid sequence of any of the naturally occurring variants of spore wall protein 2. The methods used to select conserved specific regions of spore wall protein 2 are routine and can be used to identify other examples of spore wall protein 2 from other sources (e.g., other microsporidium isolates). An example of a spore wall protein 2 has the amino acid sequence of SEQ ID NO:4.
In another embodiment, the present invention provides an isolated protein complex, comprising spore wall protein 1 and spore wall protein 2. This complex is found in the exospore region of the organism and may contribute to the structural integrity of the spore. It is contemplated that a fragment of SWPl and/or SWP2 or an antibody to a fragment of SWPl and/or SWP2 can be used to disrupt the formation of the complex, thereby destabilizing the spore.
An "isolated" protein or fragment thereof of this invention is free of contaminants or cell components with which proteins or fragments thereof normally occur and is present in such concentration as to be the only significant protein or fragment thereof present in the sample. "Isolated" does not require that the preparation is technically pure (homogeneous), but it is sufficiently pure to provide the protein or fragment thereof in a form in which it can be used therapeutically, diagnostically or for research.
As used herein, a "protein" is a chain of amino acids which correspond to those encoded by a nucleic acid. A protein usually describes a chain of amino acids having more than about 30 amino acids. A "fragment" is a specific part of a protein having about 2 to about 30 amino acids. As used herein to describe an amino acid sequence (protein, polypeptide, peptide, etc.), "specific" means that the amino acid sequence is not found identically in any other source. The determination of specificity is made routine, because of the availability of computerized amino acid sequence databases, wherein an amino acid sequence of almost any length can be quickly and reliably checked for the existence of identical sequences. If an identical sequence is not found, the protein is "specific" for the recited source. The term "protein" can refer to a linear chain of amino acids, or it can refer to a chain of amino acids which have been processed and folded into a functional protein. It is understood, however, that 30 is an arbitrary number with regard to distinguishing proteins and fragments. The proteins and fragments of the present invention are obtained by isolation and purification of the proteins and fragments from cells where they are produced naturally or by expression of exogenous nucleic acid encoding the protein or fragment. The proteins and fragments of this invention can be obtained by chemical synthesis, by proteolytic cleavage of a protein and/or by synthesis from nucleic acid encoding the proteins and fragments.
The present invention provides an isolated antigenic or immunogenic fragment of the spore wall proteins of the invention. "Antigenic" when used herein means capable of binding specifically to an antibody. "Immunogenic" means capable of producing an immune response. The immune response can be humoral and/or cellular; specifically, the immune response can be characterized by the raising of antibodies directed to the antigen and/or characterized by delayed type hypersensitivity. Thus, the proteins and fragments thereof are immunoreactive. As used herein, "immunogenicity" means the ability of a molecule to generate an immune response in a host that reduces the severity of illness when the host is subsequently challenged with the same molecule.
An immunoreactive fragment has an amino acid sequence of at least about 5 consecutive amino acids of a spore wall protein amino acid sequence and binds an antibody. An immunoreactive fragment can be selected by applying the routine technique of epitope mapping to the proteins of the present invention to determine the antigenic regions of the proteins that contain epitopes reactive with serum antibodies or the immunogenic regions that are capable of eliciting an immune response in an animal. Once the epitope is selected, an immunoreactive protein containing the epitope can be synthesized directly, or produced recombinantly by cloning nucleic acids encoding the protein in an expression system, according to the standard methods. Alternatively, an antigenic fragment of the protein can be isolated from the whole protein or a larger fragment by chemical or mechanical disruption. Fragments can also be randomly chosen from a spore wall protein sequence and synthesized. Two or more fragments that are contiguous in a spore wall protein can be combined to form another fragment. The purified fragments thus obtained can be tested to determine their antigenicity and specificity by routine methods. A method of determining immunogenicity is provided in the Examples below. A person of skill can determine immunogenicity by using theoretical computer programs and/or by injecting a fragment into an animal and subsequently looking for an antibody response directed to the fragment.
Having provided fragments of spore wall protein 1 and spore wall protein 2, the present invention also provides mosaic proteins that can be made, as known by a person of skill in the art, by combining non-contiguous fragments from spore wall protein 1 or spore wall protein 2, or fragments of both spore wall protein 1 and spore wall protein 2 to form a polypeptide. Linkage of fragments preferably does not interfere with the function (e.g., immunoreactivity) of these fragments. The mosaic proteins of the invention can be used for diagnostic purposes, or they can be used in a composition of the invention, for example, a vaccine.
Protein fragments of the invention include fragments of spore wall protein 1. The fragments can be antigenic or immunogenic fragments of the spore wall protein defined by SEQ ID NO:2. Further examples of antigenic or immunogenic (immunoreactive) fragments of the spore wall protein include the species-specific protein fragments identified in the sequence listing as SEQ ID NOS: 5-24.
Protein fragments of the invention include fragments of spore wall protein 2.
The fragments can be antigenic or immunogenic fragments of the spore wall protein defined by SEQ ID NO:4. Further examples of antigenic or immunogenic (immunoreactive) fragments of the spore wall protein include the species-specific protein fragments identified in the sequence listing as SEQ ID NOS:5-19 and SEQ ID NOS:25-36. Spore wall protein 1 and spore wall protein 2 have some immunoreactive fragments in common, for example, fragments identified in the sequence listing as SEQ ID NOS:5-19. Other protein fragments are either SWPl-specific or SWP2-specific (i.e., protein-specific). The sequence data for SWPl (SEQ ID NO:2) has been submitted to the DDJ/EMBL/GenBank databases under the accession number "AF355749." The sequence data for SWP2 (SEQ ID NO:4) has been submitted to the DDJ/EMBL/GenBank databases under the accession number "AF355750." Both deposits were addressed to GenBank National Center for Biotechnology Information, National Library of Medicine, Building 38A, Room 8N-803, Bethesda, MD 20894 on March 1, 2001.
Modifications to any of the above proteins or fragments can be made, while preserving the specificity and activity (function) of the naturally occurring protein or fragment thereof. As used herein, "naturally occurring" describes a protein that occurs in nature. The modifications contemplated herein can be conservative amino acid substitutions, for example, the substitution of a basic amino acid for a different basic amino acid. Modifications can also include creation of fusion proteins with epitope tags or known recombinant proteins or genes encoding them created by subcloning into commercial or non-commercial vectors (e.g., polyhistidine tags, flag tags, myc tag, glutathione-S-transferase [GST] fusion protein, xylE fusion reporter construct). Furthermore, the modifications contemplated will not affect the function of the protein or the way the protein accomplishes that function (e.g., its secondary structure or the ultimate result of the protein's activity. The means for determining these parameters are well known. These products are equivalent to the spore wall proteins of the present invention. Thus, the spore wall proteins of the present invention may have non- essential additions, for example, labels, tags and linkers and may also contain 1, 2, 3, 4, 5 or 6 amino acid additions, substitutions or deletions, while still consisting essentially of the referenced amino acid sequence, and retaining their specificity and function as described herein.
Protein variants and derivatives are well understood to those of skill in the art and can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Immunogenic fusion protein derivatives, such as those described in the examples, are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example, Ml 3 primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically of single residues but can occur at a number of different locations at once. Insertions usually will be on the order of about from 1 to 10 amino acid residues, and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions. TABLE 1 : Amino Acid Abbreviations
Amino Acid Abbreviations
alanine Ala A allosoleucine Alle arginine Arg R asparagine Asn N aspartic acid Asp D cysteine Cys C glutamic acid Glu E glutamine Gin K glycine Gly G histidine His H isoleucine He I leucine Leu L lysine Lys K phenylalanine Phe F proline Pro P pyroglutamic acid pGlu serine Ser S threonine Thr T tyrosine Tyr Y tryptophan Trp W valine Val V TABLE 2: Amino Acid Substit
Original Residue Exemplary Conserv art.
Ala ser
Arg lys, gin
Asn gin; his
Asp glu
Cys ser
Gin asn; lys
Glu asp
Gly pro
His asn; gin lie leu; val
Leu ile; val
Lys arg; gin
Met Leu; ile
Phe met; leu; tyr
Ser thr
Thr ser
Trp tyr
Tyr trp; phe
Val ile; leu Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine, in this case, (e) by increasing the number of sites for sulfation and/or glycosylation.
For example, the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another. The substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
Substitutional or deletional mutagenesis can be employed to insert sites for N- glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr). Deletions of cysteine or other labile residues also may be desirable. Deletions or substitutions of potential proteolysis sites, e.g. Arg, are accomplished, for example, by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues. Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o-amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C-terminal carboxyl.
It is understood that one way to define the variants and derivatives of the disclosed proteins herein is through defining the variants and derivatives in terms of homology/identity to specific known sequences. For example, SEQ ID NO:2 sets forth a particular sequence of SWPl and SEQ ID NO:4 sets forth a particular sequence of SWP2. Also disclosed are variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
It is understood that the description of conservative mutations and homology can be combined together in any combination, such as embodiments that have at least 70% homology to a particular sequence wherein the variants are conservative mutations.
As this specification discusses various proteins and protein sequences it is understood that the nucleic acids that can encode those protein sequences are also disclosed. This would include all degenerate sequences related to a specific protein sequence, i.e. all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence.
One method of producing the disclosed proteins, such as SEQ ID NOS:2 and 4, is to link two or more peptides or polypeptides together by protein chemistry techniques. For example, peptides or polypeptides can be chemically synthesized using currently available laboratory equipment using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert -butyloxycarbonoyl) chemistry. (Applied Biosystems, Inc., Foster City, CA). One skilled in the art can readily appreciate that a peptide or polypeptide corresponding to the disclosed proteins, for example, can be synthesized by standard chemical reactions. For example, a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin whereas the other fragment of a peptide or protein can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal group which is functionally blocked on the other fragment. By peptide condensation reactions, these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively, to form an antibody, or fragment thereof. (Grant GA (1992) Synthetic Peptides: A User Guide. W.H. Freeman and Co., N.Y. (1992); Bodansky M and Trost B., Ed. (1993) Principles of Peptide
Synthesis. Springer- Verlag Inc., NY (which is herein incoφorated by reference at least for material related to peptide synthesis). Alternatively, the peptide or polypeptide is independently synthesized in vivo as described herein. Once isolated, these independent peptides or polypeptides may be linked to form a peptide or fragment thereof via similar peptide condensation reactions.
For example, enzymatic ligation of cloned or synthetic peptide segments allow relatively short peptide fragments to be joined to produce larger peptide fragments, polypeptides or whole protein domains (Abrahmsen L et al., Biochemistry, 30:4151 (1991)). Alternatively, native chemical ligation of synthetic peptides can be utilized to synthetically construct large peptides or polypeptides from shorter peptide fragments. This method consists of a two step chemical reaction (Dawson et al. Synthesis of Proteins by Native Chemical Ligation. Science, 266:776-779 (1994)). The first step is the chemoselective reaction of an unprotected synthetic peptide—thioester with another unprotected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate undergoes spontaneous, rapid intramolecular reaction to form a native peptide bond at the ligation site (Baggiolini M et al. (1992) FEBS Lett. 307:97-101; Clark-Lewis I et al., J.Biol.Chem., 269:16075 (1994); Clark-Lewis I et al., Biochemistry, 30:3128 (1991); Rajarathnam K et al., Biochemistry 33:6623-30 (1994)).
Alternatively, unprotected peptide segments are chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non-peptide) bond (Schnolzer, M et al. Science, 256:221 (1992)). This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton RC et al., Techniques in Protein Chemistry IV. Academic Press, New York, pp. 257-267 (1992)).
The present invention provides a composition comprising spore wall protein 1 and a pharmaceutically acceptable carrier. In another embodiment, the present invention also provides a composition comprising spore wall protein 2 and a pharmaceutically acceptable carrier. Further, the present invention provides a composition comprising a protein complex, comprising spore wall protein 1 and spore wall protein 2 and a pharmaceutically acceptable carrier. The present invention also provides a composition comprising immunoreactive fragments of the proteins and a pharmaceutically acceptable carrier. Specifically, the present invention provides a composition comprising immunoreactive fragments of spore wall protein 1 and a pharmaceutically acceptable carrier. The present invention also provides a composition comprising immunoreactive fragments of spore wall protein 2 and a pharmaceutically acceptable carrier. Also provided is a composition comprising the mosaic protein comprising fragments of spore wall protein 1 or spore wall protein 2 or both. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable. Thus, the material may be administered to an individual along with the selected peptide, protein, nucleic acid, vector or cell without causing substantial deleterious biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. The present invention also provides antibodies directed against spore wall protein 1 or fragments thereof, spore wall protein 2 or fragments thereof, or the protein complex comprising spore wall protein 1 and spore wall protein 2 or fragments thereof. An antibody can be a monoclonal antibody directed against spore wall protein 1. Examples of monoclonal antibodies directed against spore wall protein 1 include, but are not limited to, 6F4, 11B2 and 1E4. An antibody can be a monoclonal antibody directed against spore wall protein 2. Examples of monoclonal antibodies directed against spore wall protein 2 include, but are not limited to, 15C7, 3A6, 7G7 and 19F10. (Lujcn, H.D., Conrad, J.T., Clark, C.G., Touz, M.C., Delbac, F., Vivares, C.P., and Nash, T.E. (1998). "Detection of microsporidia spore-specific antigens by monoclonal antibodies." Hybridoma 17(3): 237-243.)
Antibodies can be made according to methods known to a person of skill in the art. Briefly, purified SWPl, SWP2, a complex comprising SWPl and SWP2, or an immunogenic fragment thereof can be injected into an animal in an amount and in intervals sufficient to elicit an immune response. Polyclonal antibodies can be purified directly, or spleen cells from the animal can be fused with an immortal cell line and screened for monoclonal antibody secretion. Thus, purified monospecific polyclonal antibodies that specifically bind the immunoreactive protein or fragment are within the scope of the present invention.
Nucleic acids
The present invention provides an isolated nucleic acid encoding a spore wall protein of Encephalitozoon intestinalis (E. intestinalis). "Nucleic acid" as used herein refers to single- or double-stranded molecules which may be DNA or RNA, comprised of the nucleotide bases A, T (or U), C and G or modified bases. The nucleic acid may represent a coding strand or its complement. Nucleic acids may be identical in sequence to the sequence which is naturally occurring or may include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. Furthermore, nucleic acids may include codons which represent conservative substitutions of amino acids as are well known in the art. Such nucleic acids can be used as probes, primers or expression sequences of the present invention.
As used herein, the term "isolated nucleic acid" means a nucleic acid separated or substantially free from at least some of the other components of the naturally occurring organism, for example, upstream or downstream nucleic acids or the cell structural components commonly found associated with nucleic acids in a cellular environment. The isolation of nucleic acids can therefore be accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention can be isolated from cells according to methods well known in the art for isolating nucleic acids. Modifications to the nucleic acids of the invention are also contemplated, provided that the essential structure and function of the protein or fragment thereof encoded by the nucleic acid are maintained.
The nucleic acid encoding the proteins or fragments thereof of this invention can be part of a recombinant nucleic acid construct comprising any combination of restriction sites and/or functional elements as are well known in the art which facilitate molecular cloning and other recombinant DNA manipulations. Thus, the present invention further provides a recombinant nucleic acid construct (e.g., a vector) comprising a nucleic acid encoding a protein or fragment thereof of this invention.
There are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acids that encode, for example spore wall protein 1, spore wall protein 2 and fragments thereof, as well as various functional nucleic acids. The disclosed nucleic acids are made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non- limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U. Likewise, it is understood that if, for example, an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantageous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.
A nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage. The base moiety of a nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The sugar moiety of a nucleotide is a ribose or a deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. An non-limiting example of a nucleotide would be 3'- AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate).
A nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl (.psi.), hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. A modified base includes but is not limited to 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl,
8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional base modifications can be found for example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain nucleotide analogs, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including
2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine can increase the stability of duplex formation. Often time base modifications can be combined with for example a sugar modification, such as 2'-O-methoxyethyl, to achieve unique properties such as increased duplex stability. There are numerous United States Patent Nos. such as 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, which detail and describe a range of base modifications. Each of these patents is herein incoφorated by reference.
Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted to C10, alkyl or C2 to C10 alkenyl and alkynyl. 2' sugar modifications also include but are not limited to - 0[(CH2)n O]m CH3, -O(CH2)n OCH3, -O(CH2)n NH2, -O(CH2)n CH3, -O(CH2)n -ONH2, and -O(CH2)nON[(CH2)n CH3)]2, where n and m are from 1 to about 10.
Other modifications at the 2' position include but are not limited to: C, to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. There are numerous United States patents that teach the preparation of such modified sugar structures such as Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incoφorated by reference in its entirety.
Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. It is understood that these phosphate or modified phosphate linkage between two nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Numerous United States patents teach how to make and use nucleotides containing modified phosphates and include but are not limited to, 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incoφorated by reference.
It is understood that nucleotide analogs need only contain a single modification, but may also contain multiple modifications within one of the moieties or between different moieties.
Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having moφholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones;formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Numerous United States patents disclose how to make and use these types of phosphate replacements and include but are not limited to 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incoφorated by reference.
It is also understood in a nucleotide substitute that both the sugar and the phosphate moieties of the nucleotide can be replaced, by for example an amide type linkage (aminoethylglycine) (PNA). United States patents 5,539,082; 5,714,33 l;and 5,719,262 teach how to make and use PNA molecules, each of which is herein incoφorated by reference. (See also Nielsen et al., Science, 1991, 254, 1497-1500).
It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance for example, cellular uptake. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937. Numerous United States patents teach the preparation of such conjugates and include, but are not limited to U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726;
5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incoφorated by reference.
A Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute. The Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, Nl, and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.
A Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA. The Hoogsteen face includes the N7 position and reactive groups (NH2 or O) at the C6 position of purine nucleotides.
Spore wall protein-encoding nucleic acids can be isolated from an organism in which they are normally found (e.g., E. intestinalis), using any of the routine techniques. For example, a genomic DNA or cDNA library can be constructed and screened for the presence of the nucleic acid of interest using one of the present spore wall protein nucleic acids as a probe. Methods of constructing and screening such libraries are well known in the art, and kits for performing the construction and screening steps are commercially available (for example, Stratagene Cloning Systems, La Jolla, CA). Once isolated, the nucleic acid can be directly cloned into an appropriate vector, or if necessary, can be modified to facilitate the subsequent cloning steps. Such modification steps are routine, an example of which is the addition of oligonucleotide linkers which contain restriction sites to the termini of the nucleic acid. General methods are set forth in Sambrook et al.
Spore wall protein-encoding nucleic acids can also be synthesized according to any of the available methods. For example, a method of obtaining a DNA molecule encoding a specific spore wall protein is to synthesize a recombinant DNA molecule which encodes the protein. For example, oligonucleotide synthesis procedures are routine in the art and oligonucleotides coding for a particular protein region are readily obtainable through automated DNA synthesis. A nucleic acid for one strand of a double-stranded molecule can be synthesized and hybridized to its complementary strand. One can design these oligonucleotides such that the resulting double-stranded molecule has either internal restriction sites or appropriate 5 ' or 3' overhangs at the termini for cloning into an appropriate vector. Double-stranded molecules coding for relatively large proteins can readily be synthesized by first constructing several different double-stranded molecules that code for particular regions of the protein, followed by ligating these DNA molecules together.
There are a variety of sequences related to the SWPl gene and the SWP2 gene having the following Genbank Accession Numbers AF355749 and AF355750, respectively. These sequences and others are herein incoφorated by reference in their entireties as well as for individual subsequences contained therein. Disclosed are compositions including primers and probes, which are capable of interacting with the SWPl gene and SWP2 gene, as disclosed herein. In certain embodiments the primers are used to support DNA amplification reactions. Typically the primers will be capable of being extended in a sequence specific manner. Extension of a primer in a sequence specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer. Extension of the primer in a sequence specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription.
Techniques and conditions that amplify the primer in a sequence specific manner are preferred. In certain embodiments the primers are used for the DNA amplification reactions, such as PCR or direct sequencing. It is understood that in certain embodiments the primers can also be extended using non-enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner. Typically the disclosed primers hybridize with the SWPl gene and/or SWP2 gene or region of the SWPl gene and/or SWP2 gene or they hybridize with the complement of the SWPl gene and/or SWP2 gene or complement of a region of the SWPl gene and/or SWP2 gene. For example, the probe that hybridized with the genes for both spore wall protein 1 (SWPl) and spore wall protein 2 (SWP2) was a PCR fragment of a common sequence representing the predicted amino acids 158-312 of SWPl (SEQ ID NO:72). The SWPl -specific probe was a PCR fragment that encoded the predicted amino acids 239-387 of SWPl (SEQ ID NO:71). The SWP2-specific probe was a nested deletion clone that contained the 3' terminal -500 bases of the SWP2 open reading frame (SEQ ID NO:73).
The size of the primers or probes for interaction with the SWPl gene and/or SWP2 gene in certain embodiments can be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or the simple hybridization of the probe or primer. An SWPl or SWP2 primer or probe would be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. A typical primer can be from at least 15 nucleotides to at least 35 nucleotides long.
In other embodiments an SWPl or SWP2 primer or probe can be less than or equal to 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. In one embodiment, the primer can be up to 15 nucleotides long. In another embodiment, the primer can be up to 35 nucleotides long.
The primers for the SWPl gene and/or SWP2 gene typically will be used to produce an amplified DNA product that contains a fragment of the SWPl gene and/or SWP2 gene. In general, typically the size of the product will be such that the size can be accurately determined to within 3, or 2 or 1 nucleotides. For example, primers having the nucleotide sequences SEQ ID NOs:71 and 72 are primers for the SWPl gene. Primers having the nucleotide sequences SEQ ID NOS: 72 and 73 are primers for the SWP2 gene. In certain embodiments this product is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. Thus, in one embodiment, the product is at least 20 nucleotides long.
In other embodiments the product is less than or equal to 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long. In one embodiment, the SWPl product can be up to 1000 nucleotides long. In another embodiment, the SWPl product can be up to 2000 nucleotides long. Further, in one embodiment, the SWP2 product can be up to 3000 nucleotides long. In another embodiment, the SWP2 product can be up to 4000 nucleotides long.
Functional nucleic acids that have a specific function, such as binding a target molecule or catalyzing a specific reaction are also provided. Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting. For example, functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences. The functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules. Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains. Thus, functional nucleic acids can interact with the mRNA of SWPl and/or SWP2 or the genomic DNA of SWPl and/or SWP2. Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule. In other situations, the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather is based on the formation of tertiary structure that allows specific recognition to take place.
Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation. Alternatively the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC. It is preferred that antisense molecules bind the target molecule with a dissociation constant (kd)less than 10"6. It is more preferred that antisense molecules bind with a kd less than 10"8. It is also more preferred that the antisense molecules bind the target molecule with a kd less than 10"'°. It is also preferred that the antisense molecules bind the target molecule with a kd less than 10"12. A representative sample of methods and techniques which aid in the design and use of antisense molecules can be found in the following non-limiting list of United States patents: 5,135,917, 5,294,533, 5,627,158, 5,641,754, 5,691,317, 5,780,607, 5,786,138, 5,849,903, 5,856,103, 5,919,772, 5,955,590, 5,990,088, 5,994,320, 5,998,602, 6,005,095, 6,007,995, 6,013,522, 6,017,898, 6,018,042, 6,025,198, 6,033,910, 6,040,296, 6,046,004, 6,046,319, and 6,057,437.
Aptamers are molecules that interact with a target molecule, preferably in a specific way. Typically aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G- quartets. Aptamers can bind small molecules, such as ATP (United States patent 5,631,146) and theophiline (United States patent 5,580,737), as well as large molecules, such as reverse transcriptase (United States patent 5,786,462) and thrombin (United States Patent No. 5,543,293). Aptamers can bind very tightly with kds from the target molecule of less than 10"12 M. It is preferred that the aptamers bind the target molecule with a kd less than 10~6. It is more preferred that the aptamers bind the target molecule with a kd less than 10"8. It is also more preferred that the aptamers bind the target molecule with a kd less than 10"'°. It is also preferred that the aptamers bind the target molecule with a kd less than 10"12. Aptamers can bind the target molecule with a very high degree of specificity. For example, aptamers have been isolated that have greater than a 10000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule (United States patent 5,543,293). It is preferred that the aptamer have a kd with the target molecule at least 10 fold lower than the kd with a background binding molecule. It is more preferred that the aptamer have a k^ with the target molecule at least 100 fold lower than the kd with a background binding molecule. It is more preferred that the aptamer have a kd with the target molecule at least 1000 fold lower than the kd with a background binding molecule. It is preferred that the aptamer have a kd with the target molecule at least 10000 fold lower than the kd with a background binding molecule. It is preferred when doing the comparison for a polypeptide for example, that the background molecule be a different polypeptide. Representative examples of how to make and use aptamers to bind a variety of different target molecules can be found in the following non-limiting list of United States patents: 5,476,766, 5,503,978, 5,631,146, 5,731,424 , 5,780,228, 5,792,613, 5,795,721, 5,846,713, 5,858,660 , 5,861,254, 5,864,026, 5,869,641, 5,958,691, 6,001,988, 6,011,020, 6,013,443, 6,020,130, 6,028,186, 6,030,776, and 6,051,698.
Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. Ribozymes are thus catalytic nucleic acids. It is preferred that the ribozymes catalyze intermolecular reactions. There are a number of different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as hammerhead ribozymes, (for example, but not limited to the following United States patents: 5,334,711, 5,436,330, 5,616,466, 5,633,133, 5,646,020, 5,652,094, 5,712,384, 5,770,715, 5,856,463, 5,861,288, 5,891,683, 5,891,684, 5,985,621, 5,989,908, 5,998,193, 5,998,203, WO 9858058 by Ludwig and Sproat, WO 9858057 by Ludwig and Sproat, and WO 9718312 by Ludwig and Sproat) haiφin ribozymes (for example, but not limited to the following United States patents : 5 ,631 , 115 ,
5,646,031, 5,683,902, 5,712,384, 5,856,188, 5,866,701, 5,869,339, and 6,022,962), and tetrahymena ribozymes (for example, but not limited to the following United States patents: 5,595,873 and 5,652,107). There are also a number of ribozymes that are not found in natural systems, but which have been engineered to catalyze specific reactions de novo (for example, but not limited to the following United States patents: 5,580,967, 5,688,670, 5,807,718, and 5,910,408). Preferred ribozymes cleave RNA or DNA substrates, and more preferably cleave RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non- canonical base pair interactions. This property makes ribozymes particularly good candidates for target specific cleavage of nucleic acids because recognition of the target substrate is based on the target substrates sequence. Representative examples of how to make and use ribozymes to catalyze a variety of different reactions can be found in the following non-limiting list of United States patents: 5,646,042, 5,693,535, 5,731,295, 5,811,300, 5,837,855, 5,869,253, 5,877,021, 5,877,022, 5,972,699, 5,972,704, 5,989,906, and 6,017,756.
Triplex forming functional nucleic acid molecules are molecules that can interact with either double-stranded or single-stranded nucleic acid. When triplex molecules interact with a target region, a structure called a triplex is formed, in which there are three strands of DNA forming a complex dependant on both Watson-Crick and Hoogsteen base-pairing. Triplex molecules are preferred because they can bind target regions with high affinity and specificity. It is preferred that the triplex forming molecules bind the target molecule with a kd less than 10'6. It is more preferred that the triplex forming molecules bind with a kd less than 10~8. It is also more preferred that the triplex forming molecules bind the target molecule with a kd less than 10"'°. It is also preferred that the triplex forming molecules bind the target molecule with a kd less than 10"12. Representative examples of how to make and use triplex forming molecules to bind a variety of different target molecules can be found in the following non- limiting list of United States patents: 5,176,996, 5,645,985, 5,650,316, 5,683,874, 5,693,773, 5,834,185, 5,869,246, 5,874,566, and 5,962,426.
External guide sequences (EGSs) are molecules that bind a target nucleic acid molecule forming a complex, and this complex is recognized by RNase P, which cleaves the target molecule. EGSs can be designed to specifically target a RNA molecule of choice. RNAse P aids in processing transfer RNA (tRNA) within a cell. Bacterial RNAse P can be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate. (WO 92/03566 by Yale, and Forster and Altaian, Science 238:407-409 (1990)).
Similarly, eukaryotic EGS/RNAse P-directed cleavage of RNA can be utilized to cleave desired targets within eukaryotic cells. (Yuan et al., Proc. Natl. Acad. Sci. USA 89:8006-8010 (1992); WO 93/22434 by Yale; WO 95/24489 by Yale; Yuan and Altaian, EMBO J 14: 159-168 (1995), and Carrara et a Proc. Natl. Acad. Sci. (USA) 92:2627-2631 (1995)). Representative examples of how to make and use EGS molecules to facilitate cleavage of a variety of different target molecules be found in the following non-limiting list of United States patents: 5,168,053, 5,624,824, 5,683,873, 5,728,521, 5,869,248, and 5,877,162.
Examples of nucleic acids of the invention include those that encode spore wall protein 1. The nucleic acid can encode a protein having an amino acid sequence of SEQ ID NO:2. The present invention further provides a nucleic acid, wherein the nucleic acid comprises the nucleotide sequence of SEQ ID NO: 1 , encoding the spore wall protein 1 having the amino acid sequence of SEQ ID NO:2.
Examples of nucleic acids of the invention include those that encode a spore wall protein 2. The nucleic acid can encode a protein having an amino acid sequence of SEQ ID NO:4. Also provided is a nucleic acid, wherein the nucleic acid comprises the nucleotide sequence of SEQ ID NO:3, encoding the spore wall protein 2 having the amino acid sequence of SEQ ID NO:4.
Having provided and taught how to obtain a nucleic acid that encodes a fragment of spore wall protein, an isolated nucleic acid that encodes a fragment of a protein is also provided. As used herein, a "fragment of a nucleic acid" is a specific part of a nucleic acid having at least about 6 nucleotides. As used herein to describe a nucleic acid sequence, "specific" means that the nucleic acid sequence is not found identically in any other source. The determination of specificity is made routine because of the availability of computerized nucleic acid sequence databases, wherein a nucleic acid sequence of almost any length can be quickly and reliably checked for the existence of identical sequences. If an identical sequence is not found, the nucleic acid fragment is "specific" for the recited source. The fragment can be obtained using any of the methods applicable to the full gene. The fragment can encode a protein specific fragment (i.e., found in the specified spore wall protein (e.g., SWPl or SWP2), but not in other proteins) and/or a species-specific fragment (e.g., found in the spore wall proteins ofE. intestinalis, but not in the spore wall proteins of other species). Nucleic acids encoding protein-specific and/or species-specific fragments of spore wall proteins are themselves gene-specific, species-specific or allele-specific fragments of the genes encoding the proteins and fragments of the present invention.
A nucleic acid fragment of the invention can be a nucleic acid that encodes a fragment of spore wall protein 1. The fragment can encode a protein fragment specific for the protein having the amino acid sequence of SΕQ ID NO:2. The fragment can be a fragment specific for SΕQ ID NO: 1 , i.e., not found in any other nucleic acid. A specific example of a fragment of SΕQ ID NO:l that encodes a fragment of spore wall protein 1 is the nucleic acid comprising nucleotides 211 through 240 of SΕQ ID NO:l (SΕQ ID NO:37) that encodes the amino acid sequence of SΕQ ID NO:5. Further examples of nucleic acid fragments of the invention include the nucleic acids (SΕQ ID NOS:38-56) that encode the fragments of the spore wall protein 1 defined as SΕQ ID NOS:6-24.
A nucleic acid fragment of the invention can be a nucleic acid that encodes a fragment of spore wall protein 2. The fragment can encode a protein fragment specific for the protein having the amino acid sequence of SΕQ ID NO:4. The fragment can be a fragment specific for SΕQ ID NO:3, i.e., not found in any other nucleic acid. A specific example of a fragment of SΕQ ID NO:3 that encodes spore wall protein 2 is the nucleic acid comprising nucleotides 979 through 1008 of SΕQ ID NO:3 (SΕQ ID
NO:57) that encodes the amino acid sequence of SΕQ ID NO:25. Further examples of nucleic acid fragments of the invention include the nucleic acids (SΕQ ID NOS:37-51 and SΕQ ID NOS:26-68) that encode the fragments of the spore wall protein 2 defined as SΕQ ID NOS:5-19 and 26-36. SΕQ ID NOS:37-51 are species specific but not gene specific because they are found in the gene that encodes SWPl and the gene that encodes SWP2.
The present invention provides a nucleic acid of at least 10 nucleotides that hybridizes under stringent conditions to the nucleic acids that encode the spore wall proteins and fragments of the present invention. Under stringent conditions, a combination of solvent and temperature where a perfect double helix is barely stable, two strands of nucleic acids will pair to form a hybrid helix, only if their respective nucleotide sequences are nearly perfectly complementary. For example, the conditions can be polymerase chain reaction conditions and the hybridizing nucleic acid can be a primer consisting of a specific fragment of the reference sequence or a nearly identical nucleic acid that hybridizes only to the exemplified spore wall protein gene or a homolog thereof.
"Stringent conditions" refers to the washing conditions used in a hybridization protocol. In general, the washing conditions should be a combination of temperature and salt concentration chosen so that the denaturation temperature is approximately 5- 20 °C below the calculated Tm of the hybrid under study. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to the probe or protein coding nucleic acid of interest and then washed under conditions of different stringencies. For example, MgCl2 concentrations used in PCR buffer can be altered to increase the specificity with which the primer binds to the template, but the concentration range of this compound used in hybridization reactions is narrow, and therefore, the proper stringency level is easily determined. For example, hybridizations with oligonucleotide probes 18 nucleotides in length can be done at 5-10 °C below the estimated Tm in 6X SSPE, then washed at the same temperature in 2X SSPE. The Tm of such an oligonucleotide can be estimated by allowing 2°C for each A or T nucleotide, and 4°C for each G or C. An 18 nucleotide probe of 50% G+C would, therefore, have an approximate Tm of 54°C. Likewise, the starting salt concentration of an 18 nucleotide primer or probe would be about 100-200 mM. Thus, stringent conditions for such an 18 nucleotide primer or probe would be a Tm of about 54 °C and a starting salt concentration of about 150 mM and modified accordingly by preliminary experiments. Tm values can also be calculated for a variety of conditions utilizing commercially available computer software (e.g., OLIGO®).
The invention provides an isolated nucleic acid that specifically hybridizes with the spore wall protein-encoding genes under the following conditions. After the agarose gel is transferred to Nytran membrane (Schleicher and Schuell; Keene, NH), the membrane is pre-hybridized for 20 minutes in QuikHyb solution (Stratagene; LaJolla, CA) at 65 °C. The radiolabeled probe is denatured and added to the pre- hybridization solution and allowed to hybridize for one hour at 65 °C. The blot is washed two times in 2X SSC, 0.1% SDS at 65 °C and two times in 0.5X SSC, 0.1% SDS at 65 °C. The blot is then exposed to Biomax MR film (Kodak; Rochester, NY). For example, the hybridizing nucleic acid can be a probe that hybridizes only to the exemplified spore wall protein gene or a homolog thereof. Thus, the hybridizing nucleic acid can be a naturally occurring homolog of the exemplified genes. The hybridizing nucleic acid can also include insubstantial base substitutions that do not prevent hybridization under the stated conditions or affect the function of the encoded protein, the way the protein accomplishes that function (e.g., its secondary structure or the ultimate result of the protein's activity. The means for determining these parameters are well known.
The present invention provides a nucleic acid that hybridizes to the nucleic acid of SEQ ID NO:l under stringent conditions selected from the group of nucleic acids having sequences consisting of SEQ ID NOS:37-57 and SEQ ID NOS:74-81 and 88. The present invention also provides a nucleic acid that hybridizes to the nucleic acid of SEQ ID NO: 3 under stringent conditions selected from the group of nucleic acids having sequences consisting of SEQ ID NOS:37-51 and SEQ ID NOS:57-68 and 80 and SEQ ID NOS:83-89.
As used herein to describe nucleic acids, the term "selectively hybridizes" excludes the occasional randomly hybridizing nucleic acids as well as nucleic acids that encode other known homologs of the present polypeptides. The selectively hybridizing nucleic acids of the invention can have at least 70%, 73%, 78%, 80%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% complementarity with the segment and strand of the sequence to which it hybridizes. Nucleotides 1-1063 encoding SWPl and nucleotides 1-1052 encoding SWP2 have 94% similarity.
Nucleotides 1-1063 encoding SWPl and nucleotides 1-1084 encoding the spore wall protein ofE. cuniculi have 67% similarity. Nucleotides 1-1052 encoding SWP2 and nucleotides 1-1084 encoding the spore wall protein ofE. cuniculi have 65% similarity. The nucleic acids of the invention can exclude any nucleic acid ofE. cuniculi. The nucleic acids can be at least 10, 18, 20, 25, 50, 100, 150, 200, 300, 500, 550, 750, 900, 950, or 1000 nucleotides in length, depending on whether the nucleic acid is to be used as a primer, probe or for protein expression. Thus, the nucleic acid can be an alternative coding sequence for the protein, or can be used as a probe or primer for detecting the presence of a spore wall protein-encoding nucleic acid or for obtaining such protein. If used as primers, the invention provides compositions including at least two nucleic acids which selectively hybridize with different regions so as to amplify a desired region. Depending on the length of the probe or primer, it can range between 70% complementary bases and full complementarity and still hybridize under stringent conditions. For example, for the puφose of diagnosing the presence of a spore wall protein-encoding nucleic acid, the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes (DNA from a sample) should be at least enough to exclude hybridization with a nucleic acid from a related organism. The invention provides examples of these nucleic acids so that the degree of complementarity required to distinguish selectively hybridizing from nonselectively hybridizing nucleic acids under stringent conditions can be clearly determined for each nucleic acid. It should also be clear that the hybridizing nucleic acids of the invention will not hybridize with nucleic acids encoding unrelated proteins (hybridization is selective) under stringent conditions. The hybridizing nucleic acids of the invention will include naturally occurring variants.
Once a nucleic acid encoding a particular protein of interest, or a region of that nucleic acid, is constructed, isolated, or modified, that nucleic acid can then be cloned into an appropriate vector, which can direct the in vivo or in vitro synthesis of that wild- type and/or modified protein. The vector is contemplated to have the necessary functional elements that direct and regulate transcription of the inserted gene, hybrid gene or cDNA. The nucleic acid of the invention can be a ribozyme or antisense nucleic acid or other functional elements. These functional elements include, but are not limited to, a promoter, regions upstream or downstream of the promoter, such as enhancers that may regulate the transcriptional activity of the promoter, an origin of replication, appropriate restriction sites to facilitate cloning of inserts adjacent to the promoter, antibiotic resistance genes or other markers which can serve to select for cells containing the vector or the vector containing the insert, RNA splice junctions, a transcription termination region, or any other region which may serve to facilitate the expression of the inserted gene or hybrid gene. (See generally, Sambrook et al). Thus, the nucleic acids of the present invention can be in a vector, and the vector can be in a host for expressing the nucleic acid.
The present invention provides a vector comprising at least one nucleic acid or fragment thereof encoding a protein or fragment thereof of this invention. The vector can be an expression vector which contains all of the genetic components required for expression of the nucleic acid in cells into which the vector has been introduced, as are well known in the art. The expression vector can be a commercial expression vector or it can be constructed in the laboratory according to standard molecular biology protocols. The expression vector can comprise viral nucleic acid including, but not limited to, vaccinia virus, adenovirus, retrovirus and/or adeno-associated virus nucleic acid. The nucleic acid or vector of this invention can also be in a liposome or a delivery vehicle which can be taken up by a cell via receptor-mediated or other type of endocytosis.
The nucleic acid of this invention can be in a cell, which can be a cell expressing the nucleic acid whereby a protein or fragment thereof of this invention is produced in the cell. In addition, the vector of this invention can be in a cell, which can be a cell expressing the nucleic acid of the vector whereby a protein or fragment thereof of this invention is produced in the cell. It is also contemplated that the nucleic acids and/or vectors of this invention can be present in a host animal (e.g., a transgenic animal) which expresses the nucleic acids of this invention and produces the proteins or fragments thereof of this invention.
The present invention provides a composition comprising at least one vector of the present invention and a pharmaceutically acceptable carrier.
Detection Methods The present invention provides a method of detecting in a sample an antibody directed to an SWPl or SWP2 protein of the invention or antigenic fragment thereof, comprising contacting the protein or antigenic fragment thereof with the sample and detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of the antibody directed to the protein or antigenic fragment thereof in the sample. In this method, the protein or fragment used to detect the antibody can be spore wall protein 1. The SWPl can have the amino acid sequence of SEQ ID NO:2, or it can have the sequence of a naturally occurring variant of SWPl. Similarly, in this method, the protein or fragment used to detect the antibody can be SWP2. The SWP2 can have the amino acid sequence of SEQ ID NO:4, or it can have the sequence of a naturally occurring variant of SWP2. Examples of fragments of spore wall protein 1 that can be used in this method include proteins with amino acid sequences identified as SEQ ID NOS:5-24. Examples of fragments of spore wall protein 2 that can be used in this method include proteins with amino acid sequences identified as SEQ ID NOS:5-19 and SEQ ID NOS:25-36. Fragments identified in the sequence listing as SEQ ID NOS: 5- 19 are common to both SWPl and SWP2, such that they can be used to detect antibodies against either SWPl or SWP2.
The present invention provides a method of detecting a protein of the invention or an antigenic fragment thereof in a sample, comprising contacting an antibody directed to the protein or antigenic fragment thereof with the sample and detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of protein or antigenic fragment thereof in the sample. For example, the antibody used to detect the protein can be an antibody that specifically binds spore wall protein 1. The antibody can specifically bind an SWPl having the amino acid sequence of SEQ ID NO:2 or an SWPl having the sequence of a naturally occurring variant of SWPl. Further, the antibody used to detect the protein can be an antibody that specifically binds spore wall protein 2. The antibody can specifically bind an SWP2 having the amino acid sequence of SEQ ID NO:4 or an SWP2 having the sequence of a naturally occurring variant of SWP2. The antibody used in the method can specifically bind a complex of SWPl and SWP2.
The present invention provides a method of detecting in a subject or a sample from a subject a nucleic acid encoding a protein of the invention (e.g., SWPl and/or SWP2) or a fragment thereof, comprising a) amplifying a nucleic acid of the subject by contacting a nucleic acid from the subject with primers that specifically bind to a protein-specific region of a naturally occurring nucleic acid that encodes the protein and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding the protein or fragment thereof in the subject. The nucleic acid of the subject can be obtained from a suitable sample from the subject. As used throughout, by a "subject" is meant an individual. Thus, the "subject" can include domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) and birds. Preferably, the subject is a mammal such as a primate, and, more preferably, a human. As used herein, a "sample" means a part representative of the subject. For example, a sample includes, but is not limited to, a quantity of the subject's skin, blood, saliva, urine, cerebrospinal fluid, hair, semen or any tissue obtainable for study and examination.
The present invention further provides a method of diagnosing a subject having microsporidiosis, comprising a) amplifying a nucleic acid of the subject by contacting a nucleic acid from the subject with primers that specifically bind to a species-specific region of a naturally occurring nucleic acid that encodes a protein of the invention and b) detecting an amplification product from step (a), whereby the detection of an amplification product detects a nucleic acid encoding a protein ofE. intestinalis in the subject. The primers can be any nucleic acid that can specifically bind to and amplify a nucleic acid encoding spore wall protein 1, having the amino acid sequence of SΕQ ID NO:2 or a naturally occurring variant of SWPl . The primers can be any nucleic acid that can specifically bind to and amplify a nucleic acid encoding spore wall protein 2, having the amino acid sequence of SΕQ ID NO:4 or a naturally occurring variant of SWP2. Examples of primers of the present invention include nucleic acids that encode the amino acid sequences identified as SEQ ID NOS:5-36. The nucleic acid of the subject can be obtained from or detected in a suitable sample from the subject.
The present invention provides a method of identifying a subject having a nucleic acid encoding spore wall protein 1 or a fragment thereof, comprising: a) contacting a nucleic acid from the subject with a probe that specifically hybridizes a nucleic acid encoding spore wall protein 1 and b) detecting hybridization of the nucleic acid from the subject with the probe, whereby the presence of hybridization indicates the presence of a nucleic acid that encodes spore wall protein 1 or a fragment thereof.
The present invention also provides a method of identifying a subject having a nucleic acid encoding spore wall protein 2 or a fragment thereof, comprising: a) contacting a nucleic acid from the subject with a probe that specifically hybridizes a nucleic acid encoding spore wall protein 2 and b) detecting hybridization of the nucleic acid from the subject with the probe, whereby the presence of hybridization indicates the presence of a nucleic acid that encodes spore wall protein 2 or a fragment thereof.
The invention teaches a person of skill to detect a subject having a nucleic acid encoding SPWl, SPW2, a protein complex comprising SWPl and SWP2, or a fragment of the proteins by contacting a nucleic acid from the subject with a microchip array comprising a probe that specifically hybridizes a nucleic acid encoding a protein of the invention and b) detecting a signal generated by the nucleic acid hybridizing with the probe, whereby the presence of the signal indicates the presence of a nucleic acid that encodes a protein of the invention or a fragment thereof. A person of skill in the art can use a kit for detection of the nucleic acids as described, for example, by Affymetrix® Coφoration. The nucleic acid of the subject can be obtained from a suitable sample from the subject.
Immunomodulation Methods
The present invention provides a method of producing an immune response in a subject, comprising administering to the subject an effective amount of at least one composition of the present invention and a pharmaceutically acceptable carrier. Specifically, a person of skill can administer to a subject a composition comprising spore wall protein land/or spore wall protein 2 and a pharmaceutically acceptable carrier to produce an immune response. Further, a person of skill can administer to a subject a composition comprising a protein complex comprising spore wall protein 1 and spore wall protein 2 and a pharmaceutically acceptable carrier to produce an immune response. Still further, the skilled person can administer to the subject an immunogenic fragment of SWPl or SWP2 or immunogenic fragments of SWPl and SWP2 or a mosaic protein comprising immunogenic fragments of SWPl, SWP2, or both, in a pharmaceutically acceptable carrier. This composition can be a prophylactic or therapeutic vaccine. A prophylactic vaccine is a composition that can be administered to a subject to produce an immune response in the subject that prevents a later infection by a specific microorganism from progressing into a more severe disseminated infection in the subject. A therapeutic vaccine is a composition that can be administered to a subject who has a disseminated infection to stimulate the subject's immune system to contain and eliminate the infectious microorganism. In general, an " effective amount" of an agent is that amount needed to achieve the desired result or results. Detection of an immune response in the subject or in the cells of the subject can be carried out according to methods standard in the art, such as detecting antibodies directed against a protein of the invention or fragments thereof and/or detecting the presence of delayed type hypersensitivity activated by the proteins or fragments.
The immune response in a subject can be totally protective, whereby infection by E. intestinalis is prevented or partially protective, whereby the pathogen load is decreased and the severity of infection is reduced. Further, the immune response can be therapeutic, whereby a subject infected by E. intestinalis can be treated to partially or totally eradicate the organism, thereby improving the clinical condition of the subject.
It is contemplated that a composition of the present invention that produces a protective immune response in a subject directed against E. intestinalis can also produce a totally or partially protective immune response in a subject directed against E. cuniculi. Although SWPl and SWP2 are distinct from the spore wall protein ofE. cuniculi, it is expected that an agent that interferes with an activity or function of SWPl or SWP2 would interfere with an activity or function of the spore wall protein ofE. cuniculi. For example, an antibody that interacts with SWPl or SWP2 is likely to interact with the spore wall protein ofE. cuniculi.
The present invention also provides a method of treating microsporoidiosis, comprising administering to a subject an effective amount of a ligand directed against a protein of the invention or fragment thereof, in a pharmaceutically acceptable carrier. A ligand that specifically binds the protein is also contemplated. The ligand can be an antibody, a fragment of an antibody (e.g., a Fab fragment), or a smaller molecule designed to bind an epitope of the protein. Because spore wall protein 1 and spore wall protein 2 are glycosylated, in one embodiment of the invention, it is contemplated that a ligand can be a sugar moiety that inhibits binding of a spore wall protein in the spore wall to a host cell, thereby preventing infection. The antibody or ligand can be bound to a substrate or labeled with a detectable moiety or both bound and labeled.
The present invention provides a method of producing an immune response in a subject, comprising administering to the subject an effective amount of an expression construct comprising at least one nucleic acid of the invention or fragment thereof in a pharmaceutically acceptable carrier. As used herein, an "expression construct" is a vector (plasmid or virus) that directs a transfected bacterium, mammalian cell or insect cell to synthesize large amounts of the protein encoded by a foreign DNA insert contained within the vector's DNA. For example, an expression construct can comprise a nucleic acid that encodes spore wall protein 1 or immunogenic fragment thereof and/or a nucleic acid that encodes spore wall protein 2 or fragment thereof. An expression construct described herein can comprise a promoter operably linked to a regulatory sequence as well as a coding sequence that encodes spore wall protein 1 or spore wall protein 2 operably linked to the promoter. Any of the compositions of this invention can comprise in addition to a pharmaceutically acceptable carrier a suitable adjuvant. As used herein, "suitable adjuvant" describes an adjuvant capable of being combined with the polypeptide or fragment thereof of this invention to further enhance an immune response without deleterious effect on the subject or the cell of the subject. A suitable adjuvant can be, but is not limited to, MONTANIDE ISA51 (Seppic, Inc., Fairfield, NJ), SYNTEX adjuvant formulation 1 (SAF-1), composed of 5 percent (wt/vol) squalene (DASF, Parsippany, N.J.), 2.5 percent Pluronic, L121 polymer (Aldrich Chemical, Milwaukee), and 0.2 percent polysorbate (Tween 80, Sigma) in phosphate-buffered saline. Other suitable adjuvants are well known in the art and include QS-21, Freund's adjuvant
(complete and incomplete), alum, aluminum phosphate, aluminum hydroxide, N-acetyl- muramyl-L-threonyl-D-isoglutamine (thr-MDP), -acetyl-nor-muramyl-L-alanyl-D- isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D- isoglutaminyl-L-alanine-2-(r-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)- ethylamine (CGP 19835 A, referred to as MTP-PE) and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trealose dimycolate and cell wall skeleton (MPL+TDM+CWS) in 2% squalene/Tween 80 emulsion.
In the methods in which the composition comprises a nucleic acid, delivery of the nucleic acid or vector to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WT), as well as other liposomes developed according to procedures standard in the art. In addition, the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Coφ., Tucson, AZ). As one example, vector delivery can be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome. The recombinant retrovirus can then be used to infect and thereby deliver to the infected cells nucleic acid encoding the peptide or polypeptide. The exact method of introducing the exogenous nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, pseudotyped retroviral vectors and vaccinia viral vectors, as well as any other viral vectors now known or developed in the future. Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanisms. This invention can be used in conjunction with any of these or other commonly used gene transfer methods.
As one example, if the nucleic acid of this invention is delivered to the cells of a subject in an adeno virus vector, the dosage for administration of adeno virus to humans can range from about 107 to 109 plaque forming units (pfu) per injection, but can be as high as 1012 pfu per injection. Ideally, a subject will receive a single injection. If additional injections are necessary, they can be repeated at intervals (1-6 months) for an indefinite period and/or until the efficacy of the treatment has been established. As set forth herein, the efficacy of treatment can be determined by evaluating the clinical parameters described herein. Efficacy of treatment is measured by absence of disease in subjects exposed to the pathogen.
The exact amount of the nucleic acid or vector required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every nucleic acid or vector. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. Parenteral administration of the polypeptides or fragments thereof, nucleic acids and/or vectors of the present invention, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. As used herein, "parenteral administration" includes intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous and intratracheal routes. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incoφorated by reference herein. The compositions of the present invention can also be administered transmucosally and by inhalation.
The dosage of the composition varies depending on the weight, age, sex, and method of administration. The dosage can also be adjusted by the individual physician as called for based on the particular circumstances. The compositions can be administered conventionally as vaccines containing the active composition as a predetermined quantity of active material calculated to produce the desired therapeutic or immunologic effect in association with the required pharmaceutically acceptable carrier or diluent (i.e., carrier or vehicle). For example, 50 μg of a DNA construct vaccine of the present invention can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect. In another embodiment, a .01 mg/Kg to 10 mg/Kg dosage, for example, a 1 mg/Kg dosage of a protein vaccine of the present invention can be injected intradermally three times at two week intervals to produce the desired therapeutic or immunologic effect.
The present invention is more particularly described in the following examples which are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compositions and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. The present invention is more particularly described in the following examples which are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.
EXAMPLES
Parasite/ host cell cultivation African green monkey kidney (Vero) cells were initially grown in Delbecco's
Modified Eagle's Medium (BioWhittaker; Walkerville, MD) supplemented with L-glutamine (2 mM), Penicillin (100 U/ml), Streptomycin (100 μg/ml), Amphotericin B (0.25 μg/ml), and 10% FBS (Hyclone; Logan, UT) in 5% CO2 at 37°C. For maintenance, 10% FBS was replaced with 2% FBS. Subconfluent host cell monolayers were infected with E. intestinalis spores. Following 12-15 days of infection, spores were harvested 2-3 times a week. Harvested spores were purified from host cell debris by washing with 0.25% SDS, followed by several washes with H20. Washed spores were then mixed with an equal volume of Percoll (Sigma; St. Louis, MO) and centrifuged at 500X g for 30 min. The pellet was washed and stored at 4°C in H2O.
Construction and screening ofcDNA Libraries
Construction and screening methods of the subtracted cDNA library were previously described (15), the reference incoφorated by reference in its entirety. In addition, a unidirectional full-length cDNA expression library was constructed from infected host cell mRNA using the Uni-ZAP XR Vector Kit (Stratagene; La Jolla, CA). The library had a preamplification titer of 1.2xl06 pfu/μg lambda arms. After amplification, the library was screened with radiolabeled probes specific for clone #46 which had been isolated from the subtracted library. The expression library was also screened with monoclonal antibodies (mAbs) previously described (22). All DNA probes were radiolabeled by random priming, and DNA sequencing was preformed using the Dye Terminator Cycle Sequencing kit (Beckman; Fullerton,CA) and the capillary array CEQ 2000 DNA Analysis System (Beckman Coulter; Fullerton, CA).
Southern Analysis
For Southern blotting, genomic DNA was isolated from infected host cells and digested with restriction endonucleases. After electrophoresis, DNA was transferred to nylon membrane by alkaline transfer as previously described (26). The blot was hybridized with randomly primed radiolabeled probes. The probe that hybridized with the genes for both spore wall protein 1 (swpl) and spore wall protein 2 (swp2) was a PCR fragment of common sequence representing the predicted amino acids 158-312 of SWPl (SEQ ID NO:72). The swpl specific probe was a PCR fragment that encoded the predicted amino acids 239-387 of SWPl (SEQ ID NO:71). The swp2 specific probe was a nested deletion clone that contained the 3' terminal -500 bases of the swp2 open reading frame (SEQ ID NO:73). The conditions for hybridization were similar to those used, as noted above.
Inverse PCR and Sequence Analysis of swpl and swp2
The flanking regions of clone 46 (swpl) and clone 2.8 (swp2) were amplified by inverse PCR, cloned, and sequenced by primer walking. Inverse PCR is a method by which an unknown sequence upstream and/or downstream of a known sequence (such as a gene) can be identified. Genomic (chromosomal) DNA is digested with a restriction enzyme that cuts the DNA into smaller fragments. The ends of the linear fragments are then ligated or joined to themselves, thus making a circle of DNA. The PCR primers are constructed to a known sequence, but instead of tracking towards each other as is the traditional way PCR is performed, the primers track away from one another into the unknown upstream and downstream sequences. Since the DNA is in circle form, the amplification will occur because the joint or ligation point that forms the circle is amplified. The PCR product is cloned and sequenced. Any sequence upstream of the restriction site used in the initial cutting of the chromosomal DNA will be upstream flanking sequence of the known gene and any sequence downstream of the restriction site will be downstream of the gene.
To sequence through the repeated motif of swp2, nested deletion clones were constructed using the Erase- A-Base System (Promega; Madison, WI). Based on the size of the deletion clones and overlapping sequence, sequence of the repeated region was determined to be complete. The sequence was confirmed by priming from either end of a modified transposon element randomly inserted into the plasmid insert as described by the manufacturer (EZ: :TN <TET- 1 > Insertion Kit (Epicentre Technologies; Madison, WI).
Comparative analysis of the predictive amino acid sequence of SWPl and SWP2 was performed using the Clustal W alignment program with an open gap penalty of 10.0 and an extended gap penalty of 0.05. Protein sequence motifs of SWPl and SWP2 were analyzed using the protein subsequence analysis tools of the Mac Vector Sequence Analysis program (Genetics Computer Group, Madison, WI).
Western Blotting Analysis Purified spores were processed for SDS-PAGE in Laemmli sample buffer
(BioRad; Hercules, CA), and 30 _1 (-5x105 spores) was subjected to SDS-PAGE on a 4-20% Tris-Glycine polyacrylamide gel (Invitrogen; Carlsbad, CA). Electrophoresis, transfer to nitrocellulose and blocking were preformed under standard conditions (26). Either monoclonal antibody (mAb) 11B2 or 7G7 (1:1000 dilution of ascites) (22) was used as the primary antibody. The secondary antibody, a goat anti-mouse immunoglobulin linked to alkaline phosphatase (Southern Biotechnologies; Birmingham, AL), was detected using the Western Blue reagent (Promega).
For immunoprecipitation assays, an infected host cell monolayer from a 75 cm2 flask was lysed in 10 ml of lysis buffer containing 5 mM EDTA, 250 mM NaCl, 25 mM Tris (pH7.5), 1% Triton X-100, and protease inhibitor cocktail (Roche; Indianapolis, IN). Lysates were centrifuged to remove cell debris, and monoclonal antibodies 11B2 and 7G7 (1:500 dilution) were added to the cell lysate on ice for one hour. Fifty micro liters of protein A/agarose beads (Life Technologies; Rockville, MD) were added to the mAb/lysate mixture and incubated on ice for one hour. The beads were then washed with PBS, resuspended in 70 ml of Lammeli sample buffer (BioRad; Madison WI) with 2-mercaptoefhanol, and boiled for 5 min., electrophoresed into a 4-20% Tris-Glycine polyacrylamide gel.
To determine if SWPl and SWP2 are glycosylated, 50 μl of Concanavalin A/agarose or Wheat Germ Agglutinin/agarose (Vector, Burlingame, CA) were reacted with 125 μl of infected cell lysate on ice for one hr.. For inhibition, either methyl-alpha-mannopyranoside (Sigma; St. Louis, MO) or chitin hydrolysate (Vector) was added to lysate at a final concentration of 0.2 M and 1:8, respectively. The beads were processed as above. Following SDS-PAGE, proteins were transferred to nitrocellulose and processed for Western blotting.
Immunoelectron microscopy Host cells, grown on Thermanox cover slips (Nunc, Naperville, IL) in 12 well plates, were infected with E. intestinalis spores. Cover slips were removed 5-7 days post infection and rinsed with Hanks balanced salt solution (HBSS). Then they were reacted for 2 hr. in fixative containing three parts of solution A (0.1 M lysine HCl-NaPO4), one part solution B (8% paraformaldehyde, 21.3 mg sodium periodate, and 100 μl of 25% glutaraldehyde) and an additional 0.1% glutaraldehyde. Cover slips were then rinsed in PBS and permeablized with either 0.05% or 0.025% saponin in PBS for 5 min. at RT. For immunostaining, mAb (11B2 or 7G7) diluted to 1 :500 in a 3% globulin free BSA/PBS (Sigma; St. Louis, MO) solution was added at RT for one hour. After PBS/BSA washes, the fluoro-nanogold anti-mouse IgG Fab antibody (Nanoprobes; Yaphank, NY), 1 :30 in PBS/BSA with either 0.05 or 0.025% saponin, was added for one hour at RT. Cover slips were washed five times in PBS and stored at 4°C in post-fixative (2.5% glutaraldehyde, 4% paraformaldehyde) until use. The cover slips were washed in H2O and reacted for 4 min. in the dark with a solution of HQ silver reagents (Nanoprobes, Yaphank, NY) at an equal ratio of red:blue:white. The cover slips were then washed three times in H20, and one time in 1% aqueous tannic acid for 5 min., followed by an H2O rinse. Next, the cover slips were reacted with a solution of reduced K4(FeCN)6 and 1% osmium tetroxide for 15 min. followed by two rinses in H2O. They were then subjected to a 5 min. graded alcohol dehydration series of 50, 80, 95, 100% and infiltrated with Spurr's resin and polymerized at 60oC. The samples were then sectioned and examined using a Hitachi H7500 electron microscope equipped with an Hamamatsu digital camera (Advanced Microscopy Techniques Coφ., Danvers, MA). Resulting images were digitally recorded.
Immunofluorescence and Confocal Microscopy
Host cells, grown on glass cover slips in 12 well plates, were infected with E. intestinalis spores. When a majority of cells were infected, cover slips were removed and fixed with acetone/methanol and blocked with 1% FBS in PBS for one hr. at RT. Monoclonal antibodies (11B2 or 7G7) were diluted 1 :500 in blocking solution (1% FBS; Hyclone; Logan, UT). After washing in PBS, fluorescein-conjugated, goat-anti-mouse immunoglobulin (1:500) (Cappel; West Chester, PA) was added. The cover slips were mounted on glass slides with Vectashield (Vector; Burlingame, CA) and viewed with either a Zeiss Axioplan Fluorescence microscope or Leica TCS-NT/SP confocal microscope. Controls included omission of primary antibody and staining of uninfected cells. Confocal images were magnified 100X with a zoom value of 2.7. Differential interference contrast images were collected at the same time as fluorescence images using the transmitted light detector. The images were processed using Leica TCS-NT/SP software (version 1.6.551) and Adobe Photoshop 3.0 (Adobe Systems).
Synchronized Infection and RT-PCR Twelve well tissue culture plates were seeded with 1x105 host cells. After 24 hr., 6x107 spores were added per well for three hr. The plates were extensively washed and fresh medium was added. Infected cells were harvested at 12, 24, and 72 hours post infection. Three wells per time point were used in total RNA isolation following the manufacturer's protocol (RNA STAT-60; Tel-Test, Inc, Friendswood, TX). RNA was treated with DNAasel, and RT-PCR was performed following the manufacturer's descriptions (LifeTechnologies; Rockville, MD). Primers used for amplification were as follows; E. intestinalis beta-Tubulin (SΕQ ID NO:69) 5'- GTTGACTGCAAGCTTCCTAAG, (SΕQ ID NO:70) 5'-CAGAGTCGAGTGACTGCTTG (amplicon is 397 base pairs); swpl (SΕQ ID NO:71) 5'-GTTCCTTCTGTACCCTCATG, (SΕQ ID NO:72)
5'-TCAGGATTCAACCCAGTCTTC (amplicon is 692 base pairs); swp2 (SΕQ ID NO:73) 5-AGTGACCGCTGTAGAAATCA, (SΕQ ID NO:72) 5-TCAGGATTCAACCCAGTCTTC (amplicon is 371 base pairs). Controls included PCR amplification without prior reverse transcriptase elongation.
Mouse Infection Model
IFN-γ receptor null mice (129-Ifhgr ,ml) and wild type mice (129S3/SvImJ) (Jackson Laboratory; Bar Harbor, MΕ) were infected orally with 2x108 Ε. intestinalis spores in H2O as previously described (13). Pooled infected or control sera were collected from each mouse on days 15, 29, 45, and 60 post infection, and used at 1 : 500 in western analysis.
Isolation of two closely related cysteine rich genes To study the molecular aspects of microsporidia infection and propagation, a previously constructed cDNA subtracted library was screened for parasite specific genes (15). Clone 46 was isolated repeatedly in independent screenings of the subtracted cDNA library. Southern analysis of genomic DNA from infected cultures using three different enzymes and a clone 46 fragment as a probe unexpectedly showed two bands, suggesting a second related gene (Fig. 1 A).
The second gene (clone 2.8) was isolated from a conventional cDNA library using a fragment of clone 46 as a probe. Using DNA probes unique to either clone 46 or clone 2.8 in Southern analysis, the two hybridizing bands in figure 1 A were accounted for (Fig. IB and Fig. 1C).
Localization of the protein gene products of clones 46 and 2.8 in infected host cells
Immuno-electron microscopy (EM) was employed to determine the stage specificity and cellular location of the proteins encoded by clones 46 and 2.8. The insert of clone 46 was re-isolated from the conventional cDNA expression library and, along with clone 2.8, was used to screen a battery of monoclonal antibodies (mAb) that are reactive with E. intestinalis and E. hellem (22). mAb 11B2 reacted specifically with clone 46 (spore wall protein 1; SWPl) while mAb 7G7 reacted specifically with clone 2.8 (spore wall protein 2; SWP2). mAb 11B2 localized SWPl to the thickened membrane of cells in transition from meronts to sporonts (Fig.2A). Binding of mAb 11B2 to the cell surface diminished as parasites developed, but some staining was evident on the surface of mature spores. Staining seen on the inside of the PV may represent residual protein from developing meronts that were attached to the PV but have since migrated to the lumen. In mature spores that were released from the PV, SWPl was clearly located in the exospore region of the spore wall and not the endospore or plasma membrane (Fig. 2D). In contrast to the reactivity of mAb 11B2, the 7G7 mAb did not react with developing sporonts (Fig. 2B). However, well-defined sporonts, which had a contiguous dense membrane and were located in the vacuolar lumen, showed heavy staining along the outer membrane. Unlike SWPl, whose expression diminished with spore development, SWP2 was expressed in mature spores inside the PV. The staining appeared to be in the "clear zone" that occurs between the sporoblast and spore thickened membrane and the fibrillar matrix that is unique to E. intestinalis (7). In addition, individual spores released from the PV of an infected cell showed the same intense staining in the exospore region of the spore wall (Fig. 2C). Moreover, as with SWPl, SWP2 was not located in the endospore or plasma membrane. In spores that were released from the PV, mAb 7G7 staining was not always uniformly intense around the spore. A gap in the staining was occasionally observed (arrow, Fig. 2C) and may represent the area near the anchoring disk and polar filament.
These data show that SWPl was expressed in the transition stage between merogamy and sporogamy and that SWP2 was expressed in clearly defined sporonts and spores, suggesting that a difference in expression of SWPl and SWP2. To confirm differential expression, immunofluorescence assays (IF A) were performed on in vitro infected host cells using the anti-SWPl and anti-SWP2 mAbs (11B2 and 7G7, respectively). Five to seven days post infection, 11B2 (anti-SWPl) stained the immature cells lining the PV much more intensely than the well-formed, mature spores that reside in the lumen (Fig 3A-C). The location, elongated shape, and lack of structural definition suggest that these cells are multinucleated immature cells that are developing a uniformly dense thick membrane (transitioning sporonts). In contrast, 7G7 (anti-SWP2) IFA showed that SWP2 was found on structurally well-defined, ovoid spores representing later developmental stages (Fig 3 D-F). These data confirm that SWPl is expressed in an earlier developmental stage than SWP2. mRNA expression of swpl and swp2 in a timed infection
The EM and IFA data suggested that SWPl may be expressed earlier in spore development than SWP2. To correlate protein expression with mRNA expression, RT-PCR was performed on mRNA from "synchronized" infected host cells (Fig.4). Although infection of host cells was performed so that those cells infected should be infected at the same time, Encephalitozoon species develop in an asynchronzed fashion (7). This results in several developmental stages existing within a single PV and complicates the determination of stage specific expression, but by 48 hours post infection, mature spores are formed (23). RT-PCR was performed using RNA purified from "synchronized" infected host cells at 12, 24, and 72 hours post infection. Transcripts for both swpl and swp2 were first detected 24 hours post infection and increased with time; however, the level of swpl mRNA was higher than that of swp2 at 24 hours. This contrasted with the expression of beta-tubulin, which is first detected 12 hours post infection and increased slightly over time. While differences between RNA stabilities between swpl and swp2 could not be ruled out, these data suggest that the swpl gene is transcribed at a higher level that swp2 early in infection.
Sequence analysis of swpl and swp 2
Inverse PCR and genomic sequence analyses were used to obtain the complete coding open reading frame (ORF) and flanking sequences of the swpl and swp2 genes. These analyses showed that swpl and swp2 are related genes that encode proteins of 388 and 1002 amino acids, respectively (Fig. 5), and that both proteins have a predictive 18 amino acid signal sequence at the amino (N)- terminus. No transmembrane domains were found, suggesting that these proteins may be secreted. When the predicted amino acid sequences were aligned; two domains were identified based on sequence identity and length. The N-terminal domains of SWPl (positions 1 to 354) and SWP2 (1 to 351) are 92% identical at the amino acid level. Comparison of the SWPl and SWP2 N-terminal domain with that of the previously identified E. cuniculi SWP showed that the E.c. SWP is 65% and 61% identical to E. . SWPl and SWP2, respectively (5). In addition, ten cysteine residues in this domain are conserved, suggesting similar secondary structures. Tyrosine phosphorylation sites are also conserved in these domains (positions 136-142); however, studies were inconclusive as to whether these sites are phosphorylated. SWPl and SWP2 have N-linked glycosylation sites, but they are in slightly different locations (Figure 5, stippled boxes).
The two SWPs have divergent C-terminal domains that have several distinct features (Fig.5). For example, SWPl has a glycosaminoglycan attachment site at position 356, but lacks the required acidic residue immediately upstream which may render the site non- functional (6). An unusual feature of the SWP2 C-terminal domain is a repeat region where a 12 or 15 amino acid motif is duplicated fifty times. The amino acid sequence is conserved in most of the repeats except where a missense mutations occurs (repeat 25, 26, 33, 48, 49, 50).
The C-termini of both proteins consist mainly of amino acids with either uncharged polar side chains or very acidic or basic polar side chains. These relatively hydrophilic amino acids are usually positioned externally in protein, suggesting that the C- terminal domains of these proteins are externally exposed on the molecule. This is more apparent in SWP2 where fully two-thirds of the 651 amino acids in this domain are considered structurally external. These repeated sequences may represent a unique external structural repeating motif that requires further functional analysis. Because these external, repeating amino acid motifs are acidic, they may facilitate invasion of the host.
The flanking regions of the swpl and swp2 genes were amplified by inverse PCR, and their sequences were analyzed (Fig.6). The 5' flanking regions of swpl and swp2 (-1 to the -61 position) are 75% A/T rich and completely identical, suggesting that these genes are transcriptionally regulated in the same fashion. The transcription start site of swpl, mapped by 5' RACE, was variable with initiation at the -2, 3, 4, or 6 position relative to the translational start codon. Nevertheless, it remained within the A/T rich patch immediately upstream of the ATG, a common transcriptional feature among protozoan genes (27). In addition, an apparent "TATA" box was identified approximately 25 bases upstream from the transcriptional start site, as is typical for most eukaryotic genes. Further computational sequence analysis of this region did not reveal any motifs similar to known transcriptional regulatory elements. Sequence analysis of the 3' flanking regions revealed putative non-consensus polyadenylation sites for both swpl and swp2. The site for swpl differed from the -AATAAA- consensus by one base pair, while the putative swp2 polyadenylation site contained the rare alternative hexanucleotide sequence known to be active in eukaryotes (25). Further studies are required to determine if these sites are utilized in vivo.
SWPl and SWP2 are glycosylated and complexed
To characterize the SWPl and SWP2 proteins, western analysis of in vitro purified spore proteins were performed (Fig.7A). Western analysis using mAb 11B2 (anti-SWPl) detected a protein of about 50 kDa, which differs greatly from the 41 kDa estimated from the swpl ORF. In addition, western analysis using the mAb 7G7 (anti-SWP2) identified a protein of 150 kDa, which is also larger than the estimated size of swp2 (107 kDa). To determine if the proteins are glycosylated at the sites identified by computational sequence analysis, lysates from host cells infected with E. intestinalis were reacted with immobilized lectins (Con A and WGA). Western analysis of the bound proteins indicated that SWPl and SWP2 proteins were glycosylated and that they contain at least the core sugar residues of an N-linked oligosaccharide (Fig.7B). Further studies indicated that SWPl and SWP2 form a protein complex in the spore wall. Western blots of denatured, non-reduced spore proteins detected with either mAb 11B2 (anti-SWPl) or mAb 7G7 (anti-SWP2) showed no product, suggesting that the protein(s) may be complexed and too large for migration into a polyacrylamide gel. However, when mAb 11B2 or 7G7 immunoprecipitation products were reduced and detected by western analysis with the mAb 7G7 (anti-SWP2), a 150 kDa band (SWP2) was detected, indicating that SWPl and SWP2 are part of a protein complex (Fig.8).
SWPl and SWP2 are immunogenic in a mouse animal model infection
Because SWPl and SWP2 are localized to the exospore region of the spore wall, the proteins are probably exposed to the host environment. Since it is well known that most immunocompetent individuals mount an immune response to microsporidia yet have no overt signs of disease (reviewed in 9), it was of interest to determine if the SWP proteins were involved in this process. Toward this end, a well-established mouse infection model system (1, 13) was employed to determine if the SWPs are immunogenic. iNFγ receptor null (iNFγ R-) mice and wild type control mice were infected in vivo with in vitro isolated spores. Sera, collected from the mice at 15, 29, 45, and 60 days post infection, were used in western analysis of proteins from purified spores (Fig.9). Both groups of mice mounted an antibody response to E. intestinalis within 15 days of infection. However, as the infection progressed, the iNFγ R- mice showed more intense reactions as was evidenced by the increase in the number of spore proteins recognized by their sera and the increased intensity of the banding pattern.
Furthermore, INFγ R-mice showed a more pronounced immune response to proteins of the same molecular mass as SWPl and SWP2 (Fig. 9). Antibodies to proteins that were the same size as the SWPs were evident on day 29-post infection, and the intensity of this response strengthened through day 60 of the infection. In addition, pooled sera from INFγR- mice (day 60) readily detected swpl and swp2 from a lambda phage expression library. These data indicate that SWPl and SWP2 are immunogenic and suggest that the immune response toward these proteins may be, in part, responsible for the clearance of the organisms in immunocompetent individuals. It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incoφorated by reference into this application in order to more fully describe the state of the art to which this invention pertains.
REFERENCES 1. Achbarou, A., Ombrouck, C, Gneragbe, T., Charlotte, F., Renia, L.,
Desportes-Livage, I., and Mazier, D. (1996). "Experimental model for human intestinal
microsporidiosis in interferon gamma receptor knockout mice infected by
Encephalitozoon intestinalis." Parasite Immunol 18(8): 387-392.
2. Baker, M. D., Vossbrinck, C.R., Didier, E.S., Maddox, J.V., and Shadduck, J.A.
(1995). "Small subunit ribosomal DNA phylogeny of various microsporidia with
emphasis on AIDS related forms." J Eukaryot Microbiol 42(5): 564-570.
3. Beaugerie, L., Carbonnel, F., Carrat, F., Rached, A.A., Maslo, C, Gendre, J.P.,
Rozenbaum, W., and Cosnes, J. (1998). "Factors of weight loss in patients with HIV
and chronic diarrhea." J Acquir Immune Defic Syndr Hum Retro virol 19(1): 34-39.
4. Bigliardi, E., Selmi, M.G., Lupetti, P., Corona, S., Gatti, S., Scaglia, M., and Sacchi, L. (1996). "Microsporidian spore wall: ultrastructural findings on
Encephalitozoon hellem exospore." J Eukaryot Microbiol 43(3): 181-186.
5. Bohne, W., Ferguson, D.J., Kohler, K., and Gross, U. (2000). "Developmental
expression of a tandemly repeated, glycine- and serine- rich spore wall protein in the
microsporidian pathogen Encephalitozoon cuniculi." Infect Immun 68(4): 2268-2275.
6. Bourdon, M. A., Krusius, T., Campbell, S., Schwartz, N.B., and Ruoslahti, E.
(1987). "Identification and synthesis of a recognition signal for the attachment of
glycosaminoglycans to proteins." Proc Natl Acad Sci U S A 84(10): 3194-3198.
7. Cali, A., Kotler, D.P., and Orenstein, J.M. (1993). "Septata intestinalis N. G., N.
Sp., an intestinal microsporidian associated with chronic diarrhea and dissemination in
AIDS patients." J Eukaryot Microbiol 40(1): 101-112.
8. Canning, E. U. and W. S. Hollister (1990). "Enterocytozoon bieneusi
(Microspora): prevalence and pathogenicity in AIDS patients." Trans R Soc Trop Med
Hyg 84(2): 181-186.
9. Didier, E. and Bessinger, G.T. (1999). Host-Parasite Relationships in
Microsporidiosis: Animal Models and Immunology. In The Microsporidia and
Microsporidiosis. Wittner, M. and Weiss, L.M. (eds). Washington, D.C., ASM Press,
pp. 225-257.
10. Didier, E. S., Snowden, K.F., and Shadduck, J.A. (1998). "Biology of
microsporidian species infecting mammals." Adv Parasitol 40: 283-320.
11. Didier, E. S., Varner, P.W., Didier, P.J., Aldras, A.M., Millichamp, N.J.,
Muφhey-Corb, M., Bohm, R., and Shadduck, J.A. (1994). "Experimental microsporidiosis in immunocompetent and immunodeficient mice and monkeys." Folia
Parasitol 41(1): 1-11.
12. Didier, P. J., Didier, E.S., Orenstein, J.M., and Shadduck, J.A. (1991). "Fine
structure of a new human microsporidian, Encephalitozoon hellem, in culture." J
Protozool 38(5): 502-507.
13. El Fakhry, Y., Achbarou, A., Desportes-Livage, I., and Mazier, D. (1998).
"Encephalitozoon intestinalis: humoral responses in interferon-gamma receptor
knockout mice infected with a microsporidium pathogenic in AIDS patients." Exp
Parasitol 89(1): 113-121.
14. Hartskeerl, R.A., Van Gool, T., Schuitema, A.R., Didier, E.A., and Teφstra,
W.J. (1995). "Genetic and immunological characterization of the microsporidian
Septata intestinalis Cali, Kotler and Orenstein, 1993: reclassification to
Encephalitozoon intestinalis." Parasitology 110(3): 277-285.
15. Hayman, J.R. and Nash, T.E. (1999). "Isolating expressed microsporidial genes
using a cDNA subtractive hybridization approach." J Eukaryot Microbiol 46(5):
21S-24S.
16. Hermanek, J., Koudela, B., Kucerova, Z., Ditrich, O., and Travnicek, J. (1993).
"Prophylactic and therapeutic immune reconstitution of SCID mice infected with
Encephalitozoon cuniculi." Folia Parasitol 40(4): 287-291.
17. Keeling, P.J., Fast, N.M., and McFadden, G.I. (1998). "Evolutionary
relationship between translation initiation factor elF- 2gamma and selenocysteine-specific elongation factor SELB: change of function in translation
factors." J Mol Evol 47(6): 649-655.
18. Keohane, E.M., Orr, G.A., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner,
M., and Weiss, L.M. (1996). "Purification and characterization of a microsporidian
polar tube protein." Mol Biochem Parasitol 79(2): 255-259.
19. Koudela, B., Kucerova, S., and Hudcovic, T. (1999). "Effect of low and high
temperatures on infectivity of Encephalitozoon cuniculi spores suspended in water."
Folia Parasitol 46(3): 171-174.
20. Lambl, B.B., Federman, M., Pleskow, D., and Wanke, CA. (1996).
"Malabsoφtion and wasting in AIDS patients with microsporidia and
pathogen-negative diarrhea." AIDS 10(7): 739-744.
21. Lopez- Velez, R., Turrientes, M.C., Garron, C, Montilla, P., Navajas, R., Fenoy,
S., and del Aguila, C. (1999). "Microsporidiosis in travelers with dianhea from the
tropics." J Travel Med 6(4): 223-227.
22. Lujcn, H.D., Conrad, J.T., Clark, C.G., Touz, M.C., Delbac, F., Vivares, C.P.,
and Nash, T.E. (1998). "Detection of microsporidia spore-specific antigens by
monoclonal antibodies." Hybridoma 17(3): 237-243.
23. Pakes, S.P., Shadduck, J.A., and Cali, A. (1975). "Fine structure of
Encephalitozoon cuniculi from rabbits, mice and hamsters." J Protozool 22(4):
481-488. 24. Prigneau, O., Achbarou, A., Bouladoux, N., Mazier, D., and Desportes-Livage,
I. (2000). "Identification of proteins in Encephalitozoon intestinalis, a microsporidian
pathogen of immunocompromised humans: an immunob lotting and
immunocytochemical study." J Eukaryot Microbiol 47(1): 48-56.
25. Proudfoot, N. J. and G. G. Brownlee (1976). "3' non-coding region sequences in
eukaryotic messenger RNA." Nature 263(5574): 211-214.
26. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning; A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Press.
27. Seeber, F. (1997). "Consensus sequence of translational initiation sites from
Toxoplasma gondii genes." Parasitol Res 83(3): 309-311.
28. Shadduck, J.A. and Polley, M.B. (1978). "Some factors influencing the in vitro
infectivity and replication of Encephalitozoon cuniculi." J Protozool 25(4): 491-496.
29. Svenungsson, B., Capraru, T., Evengard, B., Larsson, R., and Lebbad, M.
(1998). "Intestinal microsporidiosis in a HIV-seronegative patient." Scand J Infect Dis
30(3): 314-316.
30. Undeen, A.H. and Vander Meer, R.K. (1999). "Microsporidian intrasporal
sugars and their role in germination." J Invertebr Pathol 73(3): 294-302.
31. Vavra, J. and Larsson, J.I.R. (1999). Structure Of The Microsporidia. In The
Microsporidia and Microsporidiosis. Washington, D.C., ASM Press, pp 7-84.
32. Visvesvara, G.S., Belloso, M., Moura, H., Da Silva, A.J., Moura, IN., Leitch,
G.J., Schwartz, D.A., Chevez-Barrios, P., Wallace, S., Pieniazek, NJ. and Goosey, J.D. (1999). "Isolation of Nosema algerae from the cornea of an immunocompetent
patient." J Eukaryot Microbiol 46(5): 10S.
33. Weidner, E. (1975). "Interactions between Encephalitozoon cuniculi and
macrophages. Parasitophorous vacuole growth and the absence of lysosomal fusion." Z
Parasitenkd 47(1): 1-9.

Claims

What is claimed is:
1. An isolated nucleic acid, encoding spore wall protein 1.
2. The nucleic acid of claim 1, encoding the spore wall protein 1 having an amino acid
sequence of SEQ ID NO:2.
3. The nucleic acid of claim 2, wherein the nucleic acid comprises the nucleotide
sequence of SEQ ID NO: 1.
4. An isolated fragment of the nucleic acid of claim 1, wherein the fragment encodes a
fragment specific for spore wall protein 1.
5. The fragment of claim 4, encoding an antigenic or immunogenic fragment of spore
wall protein 1.
6. A nucleic acid that hybridizes to the nucleic acid of SEQ ID NO:l under stringent
conditions.
7. The nucleic acid of claim 6, wherein the nucleic acid encodes an antigenic or
immunogenic polypeptide.
8. A nucleic acid that hybridizes to the nucleic acid of SEQ ID NO: 1 under stringent
conditions selected from the group of nucleic acids having sequences consisting of SEQ
JD NOS:37-57 and SEQ ID NOS:74-81 and 88.
9. The nucleic acid of claim 8, wherein the nucleic acid encodes an antigenic or
immunogenic polypeptide.
10. An isolated spore wall protein 1.
11. The isolated spore wall protein 1 of claim 10 having the amino acid sequence of
SEQ ID NO:2.
12. An isolated antigenic or immunogenic fragment of the spore wall protein 1 of
claim 10, wherein the fragment is specific for spore wall protein 1 or spore wall protein
13. The isolated antigenic or immunogenic fragment of claim 12, having the amino
acid sequence selected from the group consisting of SEQ ID NOS:5-25.
14. An isolated nucleic acid, encoding spore wall protein 2.
15. The nucleic acid of claim 14, encoding the spore wall protein 2 having an amino
acid sequence of SEQ ID NO:4.
16. The nucleic acid of claim 15, wherein the nucleic acid comprises the nucleotide
sequence of SEQ ID NO:3.
17. An isolated fragment of the nucleic acid of claim 14, wherein the fragment encodes
a fragment specific for spore wall protein 2.
18. The fragment of claim 17, encoding an antigenic or immunogenic fragment of
spore wall protein 2.
19. A nucleic acid that hybridizes to the nucleic acid of SEQ ID NO:3 under stringent
conditions.
20. The nucleic acid of claim 19, wherein the nucleic acid encodes an antigenic or
immunogenic polypeptide.
21. A nucleic acid that hybridizes to the nucleic acid of SEQ ID NO:3 under stringent
conditions selected from the group of nucleic acids having sequences consisting of SEQ
ID NOS:37-51 and SEQ ID NOS:57-68 and 80 and SEQ ID NOS:83-89.
22. The nucleic acid of claim 21, wherein the nucleic acid encodes an antigenic or
immunogenic polypeptide.
23. An isolated spore wall protein 2.
24. The isolated spore wall protein 2 of claim 23 having the amino acid sequence of
SEQ ID NO:4.
25. An isolated antigenic or immunogenic fragment of the spore wall protein 2 of
claim 23, wherein the fragment is specific for spore wall protein 1 or spore wall protein
2.
26. The isolated antigenic or immunogenic fragment of claim 25, having the amino
acid sequence selected from the group consisting of SEQ ID NOS:5-19 and SEQ ID
NOS:25-36.
27. A method of detecting in a sample an antibody directed to spore wall protein 1 or
antigenic fragment thereof, comprising:
a) contacting isolated spore wall protein 1 or antigenic fragment thereof with the
sample; and b) detecting binding of the protein or fragment by the antibody, whereby
detection of the binding indicates the presence of the antibody directed to spore
wall protein 1 or antigenic fragment thereof in the sample.
28. The method of claim 27, wherein the spore wall protein 1 is the protein of claim
11.
29. The method of claim 28, wherein the antigenic fragment is the fragment of claim
13.
30. A method of detecting in a sample an antibody directed to spore wall protein 2 or
antigenic fragment thereof, comprising:
a) contacting isolated spore wall protein 2 or antigenic fragment thereof with the
sample; and
b) detecting binding of the protein or fragment by the antibody, whereby
detection of the binding indicates the presence of the antibody directed to spore
wall protein 2 or antigenic fragment thereof in the sample.
31. The method of claim 30, wherein the spore wall protein 2 is the protein of claim
24.
32. The method of claim 31, wherein the antigenic fragment is the fragment of claim
26.
33. A method of detecting spore wall protein 1 or an antigenic fragment thereof in a
sample, comprising:
a) contacting an antibody directed to spore wall protein 1 or antigenic fragment
thereof with the sample; and
b) detecting binding of the protein or fragment by the antibody, whereby
detection of the binding indicates the presence of spore wall protein 1 or
antigenic fragment thereof in the sample.
34. The method of claim 33, wherein the spore wall protein 1 is the protein of claim
11.
35. The method of claim 33, wherein the antigenic fragment is the fragment of claim
13.
36. A method of detecting spore wall protein 2 or an antigenic fragment thereof in a
sample, comprising:
a) contacting an antibody directed to spore wall protein 2 or antigenic fragment
thereof with the sample; and
b) detecting binding of the protein or fragment by the antibody, whereby detection of the binding indicates the presence of spore wall protein 2 or
antigenic fragment thereof in the sample.
37. The method of claim 36, wherein the spore wall protein 2 is the protein of claim
24.
38. The method of claim 36, wherein the antigenic fragment is the fragment of claim
26.
39. A method of detecting in a subject a nucleic acid encoding spore wall protein 1 or a
fragment thereof, comprising:
a) amplifying a nucleic acid of the subject using primers that specifically
hybridize to a protein-specific region of a naturally occurring nucleic acid that
encodes spore wall protein 1 ; and
b) detecting an amplification product from step (a), whereby the detection of an
amplification product detects a nucleic acid encoding spore wall protein 1 or
fragment thereof in the subject.
40. A method of detecting in a subject a nucleic acid encoding spore wall protein 2 or
fragment thereof, comprising: a) amplifying a nucleic acid of the subject using primers that specifically
hybridize to a protein-specific region of a naturally occurring nucleic acid that
encodes spore wall protein 2; and
b) detecting an amplification product from step (a), whereby the detection of an
amplification product detects a nucleic acid encoding spore wall protein 2 or
fragment thereof in the subject.
41. A method of diagnosing a subject having microsporidiosis, comprising:
a) amplifying a nucleic acid of the subject using primers that specifically
hybridize to a protein-specific region of a naturally occurring nucleic acid that
encodes spore wall protein 1 ; and
b) detecting an amplification product from step (a), whereby the detection of an
amplification product detects a nucleic acid encoding spore wall protein 1 or
fragment thereof in the subject.
42. A method of diagnosing a subject having microsporidiosis, comprising:
a) amplifying a nucleic acid of the subject using primers that specifically
hybridize to a protein-specific region of a naturally occurring nucleic acid that
encodes spore wall protein 2; and
b) detecting an amplification product from step (a), whereby the detection of an
amplification product detects a nucleic acid encoding spore wall protein 2 or
fragment thereof in the subject.
43. A method of identifying a subject having a nucleic acid encoding spore wall
protein 1 or a fragment thereof, comprising:
a) contacting a nucleic acid from the subject with a probe that specifically
hybridizes a nucleic acid encoding spore wall protein 1 ; and
b) detecting hybridization of the nucleic acid from the subject with the probe,
whereby the presence of hybridization indicates the presence of a nucleic acid
that encodes spore wall protein 1 or a fragment thereof.
44. The method of claim 43, wherein the probe is on a microchip anay and
hybridization is detected by detecting a signal generated by the hybridization.
45. A method of identifying a subject having a nucleic acid encoding spore wall
protein 2 or a fragment thereof, comprising:
a) contacting a nucleic acid from the subject with a probe that specifically
hybridizes a nucleic acid encoding spore wall protein 2; and
b) detecting hybridization of the nucleic acid from the subject with the probe,
whereby the presence of the hybridization indicates the presence of a nucleic
acid that encodes spore wall protein 2 or a fragment thereof.
46. The method of claim 45, wherein the probe is on a microchip array and
hybridization is detected by detecting a signal generated by the hybridization.
47. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of spore wall protein 1 or an immunogenic fragment
thereof in a pharmaceutically acceptable carrier.
48. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of spore wall protein 2 or an immunogenic fragment
thereof in a pharmaceutically acceptable carrier.
49. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of an expression construct comprising the nucleic
acid of claim 1 in a pharmaceutically acceptable carrier.
50. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of an expression construct comprising the nucleic
acid of claim 2 in a pharmaceutically acceptable carrier.
51. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of an expression construct comprising the nucleic
acid of claim 3 in a pharmaceutically acceptable carrier.
52. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of an expression construct comprising the nucleic
acid of claim 14 in a pharmaceutically acceptable carrier.
53. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of an expression construct comprising the nucleic
acid of claim 15 in a pharmaceutically acceptable carrier.
54. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of an expression construct comprising the nucleic
acid of claim 16 in a pharmaceutically acceptable carrier.
55. A method of treating microsporoidiosis, comprising administering to a subject an
effective amount of a ligand directed against spore wall protein 1 , in a pharmaceutically
acceptable carrier.
56. A method of treating microsporoidiosis, comprising administering to a subject an
effective amount of a ligand directed against spore wall protein 2, in a pharmaceutically
acceptable carrier.
57. An isolated protein complex, comprising spore wall protein 1 and spore wall
protein 2.
58. A composition comprising the protein complex of claim 57 in a pharmaceutically
acceptable carrier.
59. A method of producing an immune response in a subject, comprising administering
to the subject an effective amount of the composition of claim 58.
PCT/US2001/047182 2001-12-04 2001-12-04 Novel spore wall proteins and genes from microsporidia WO2003048299A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/US2001/047182 WO2003048299A2 (en) 2001-12-04 2001-12-04 Novel spore wall proteins and genes from microsporidia
AU2002226011A AU2002226011A1 (en) 2001-12-04 2001-12-04 Novel spore wall proteins and genes from microsporidia

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2001/047182 WO2003048299A2 (en) 2001-12-04 2001-12-04 Novel spore wall proteins and genes from microsporidia

Publications (2)

Publication Number Publication Date
WO2003048299A2 true WO2003048299A2 (en) 2003-06-12
WO2003048299A3 WO2003048299A3 (en) 2003-10-02

Family

ID=21743089

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/047182 WO2003048299A2 (en) 2001-12-04 2001-12-04 Novel spore wall proteins and genes from microsporidia

Country Status (2)

Country Link
AU (1) AU2002226011A1 (en)
WO (1) WO2003048299A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112724223A (en) * 2020-12-28 2021-04-30 华南农业大学 Preparation and application of monoclonal antibody of spore wall protein of nosema enteromorpha
CN114732895A (en) * 2022-05-06 2022-07-12 暨南大学 Application of sporoderm protein in prevention and control of shrimp enterocytozoon infection in mixed feeding of shrimps

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BOHNE W. ET AL.: 'Developmental expression of a tandemly repeated, glycine- and serine-rich spore wall protein in the microsporidian pathogen encephalitozoon cuniculi' INFECTION AND IMMUNITY vol. 68, no. 4, April 2000, pages 2268 - 2275, XP002965986 *
BOHNE W. ET AL.: 'Developmental expression of two spore wall proteins during maturation of the microsporidian encephalitozoon intestinalis' INFECTION AND IMMUNITY vol. 69, no. 11, November 2001, pages 7057 - 7066, XP002965987 *
XIAO ET AL.: 'Genotyping encephalitozoon cuniculi by multilocus analyses of genes with repetative sequences' JOURNAL OF CLINICAL MICROBIOLOGY vol. 39, no. 6, June 2001, pages 2248 - 2253, XP002965988 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112724223A (en) * 2020-12-28 2021-04-30 华南农业大学 Preparation and application of monoclonal antibody of spore wall protein of nosema enteromorpha
CN114732895A (en) * 2022-05-06 2022-07-12 暨南大学 Application of sporoderm protein in prevention and control of shrimp enterocytozoon infection in mixed feeding of shrimps
CN114732895B (en) * 2022-05-06 2023-09-29 暨南大学 Application of spore wall protein in preventing and controlling shrimp liver and intestine cytozoon infection of feeding shrimp

Also Published As

Publication number Publication date
AU2002226011A8 (en) 2003-06-17
AU2002226011A1 (en) 2003-06-17
WO2003048299A3 (en) 2003-10-02

Similar Documents

Publication Publication Date Title
Cunningham et al. Molecular analysis of human cardiac myosin-cross-reactive B-and T-cell epitopes of the group A streptococcal M5 protein
DK172619B1 (en) Method for isolating immunogenic preparations of herpes simplex virus type 1 and type 2, method of preparation
Harrop et al. Characterization, cloning and immunogenicity of antigens released by lung-stage larvae of Schistosoma mansoni
PL184373B1 (en) Proteinase k resistant surface protein of neisseria maningitidis
KR20070028547A (en) Identifying virally infected and vaccinated organisms
JP2003523208A (en) Protein containing a conserved region of meningococcal surface antigen NhhA
Clark et al. Surface immobilization antigens of Ichthyophthirius multifiliis: their role in protective immunity
Antao et al. MHC class I genes of the channel catfish: sequence analysis and expression
WO2001089562A1 (en) F-protein epitope-based vaccine for respiratory syncytial virus infection
CA2407740A1 (en) P43 antigen for the immunodiagnosis of canine ehrlichiosis and uses thereof
Radwanska et al. Antibodies raised against the flagellar pocket fraction of Trypanosoma brucei preferentially recognize HSP60 in cDNA expression library
KR930702942A (en) Recombinant Cat Coronavirus S Protein
Centurion-Lara et al. Conservation of the 15-kilodalton lipoprotein among Treponema pallidum subspecies and strains and other pathogenic treponemes: genetic and antigenic analyses
CA2719041C (en) A method for identifying polypeptides which comprise a cross-reactive antigenic determinant
EP0771352A1 (en) Lkp pilin structural genes and operon of nontypable haemophilus influenzae
WO1996002648A9 (en) Lkp pilin structural genes and operon of nontypable haemophilus influenzae
CZ216792A3 (en) Immunogenic polypeptide
JP2003512844A (en) Multiple sclerosis-related superantigen
Mishra et al. Immunogenicity and sequence analysis of recombinant p58: a neutralization-sensitive, antigenically conserved Babesia bigemina merozoite surface protein
WO2003048299A2 (en) Novel spore wall proteins and genes from microsporidia
JP3262273B2 (en) Polypeptides used in the development and diagnosis of protection strategies, nucleotide sequences and vaccines against infections such as pestivirus infections, including swine fever
US6187310B1 (en) Recombinant Entamoeba histolytica lectin subunit peptides and reagents specific for members of the 170 kDa subunit multigene family
Ocampo et al. Identifying Plasmodium falciparum cytoadherence‐linked asexual protein 3 (CLAG 3) sequences that specifically bind to C32 cells and erythrocytes
AU777145B2 (en) Antigenic protein LPPQ of Mycoplasma mycoidessubsp.(mycoides)SC., its preparation and use
US11692026B2 (en) Antibodies to PfGARP kill Plasmodium falciparum malaria parasites and protect against infection and severe disease

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP