WO2003029476A2 - Process for the preparation of d-pantothenic acid and/or its salts - Google Patents

Process for the preparation of d-pantothenic acid and/or its salts Download PDF

Info

Publication number
WO2003029476A2
WO2003029476A2 PCT/EP2002/009373 EP0209373W WO03029476A2 WO 2003029476 A2 WO2003029476 A2 WO 2003029476A2 EP 0209373 W EP0209373 W EP 0209373W WO 03029476 A2 WO03029476 A2 WO 03029476A2
Authority
WO
WIPO (PCT)
Prior art keywords
pantothenic acid
orf
fermentation
salts
process according
Prior art date
Application number
PCT/EP2002/009373
Other languages
French (fr)
Other versions
WO2003029476A3 (en
Inventor
Mechthild Rieping
Original Assignee
Degussa Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Degussa Ag filed Critical Degussa Ag
Priority to EP02760324A priority Critical patent/EP1430139B1/en
Priority to DE60211357T priority patent/DE60211357T2/en
Priority to US10/490,851 priority patent/US20050089971A1/en
Publication of WO2003029476A2 publication Critical patent/WO2003029476A2/en
Publication of WO2003029476A3 publication Critical patent/WO2003029476A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes

Definitions

  • the present invention relates to a process for the preparation of D-pantothenic acid and/or its salts or mixtures containing them using microorganisms of the family Enterobacteriaceae in which at least the ytfP and/or yjfA open reading frame (ORF) is attenuated.
  • ORF open reading frame
  • Pantothenic acid is produced throughout the world on a scale of several thousand tons per year. It is used inter alia in human medicine, in the pharmaceutical industry and in the food industry. A large part of the pantothenic acid produced is used for feeding farm animals such as poultry and pigs .
  • Pantothenic acid can be prepared by chemical synthesis or biotechnologically by the fermentation of suitable microorganisms in suitable nutrient solutions .
  • D -pantolactone is an important precursor. It is prepared in a multistage process from formaldehyde, isobutyl aldehyde and cyanide. In subsequent process steps the racemic mixture is separated and the D- pantolactone is condensed with ⁇ -alanine to give D- pantothenic acid.
  • the typical commercial form is the calcium salt of D- pantothenic acid.
  • the calcium salt of the racemic mixture of DL-pantothenic acid is also useful .
  • the advantage of preparation by the fermentation of microorganisms is the direct formation of the desired stereoisomeric form, namely the D form, free of - pantothenic acid.
  • various species of bacteria e.g. Escherichia coli (E. coli) , Arthrobacter ureafaciens, Corynebacterium erythrogenes and Brevibacterium ammoniagenes , as well as yeasts, e.g. Debaromyces castellii, can produce D-pantothenic acid in a nutrient solution containing glucose, DL-pantoic acid and ⁇ -alanine.
  • EP-A 0 493 060 further indicates that, in the case of E.
  • D-pantothenic acid is improved in a nutrient solution containing glucose, DL- pantoic acid and ⁇ -alanine by amplification of the pantothenic acid biosynthesis genes from E. coli which are contained on plasmids pFV3 and pFV5.
  • EP-A 0 590 857 and US patent 5,518,906 describe mutants derived from the E. coli strain IF03547, such as FV5714, FV525, FV814, FV521, FV221, FV6051 and FV5069, which carry resistances to various antimetabolites such as salicylic acid, ⁇ -ketobutyric acid, ⁇ -hydroxyaspartic acid, O- methylthreonine and ⁇ -ketoisovaleric acid. They produce pantoic acid in a nutrient solution containing glucose, and D-pantothenic acid in a nutrient solution containing glucose and ⁇ -alanine.
  • EP-A 0 590 857 and US patent 5,518,906 further indicate that, after amplification of the pantothenic acid biosynthesis genes panB, panC and panD, which are said to be contained on plas id pFV31, in the above-mentioned strains, the production of D-pantoic acid is improved in nutrient solutions containing glucose and the production of D-pantothenic acid is improved in a nutrient solution containing glucose and ⁇ -alanine.
  • O97/10340 reports the beneficial effect of amplification of the ilvGM operon on the production of D- pantothenic acid.
  • EP-A 1 001 027 reports the effect of amplification of the panE gene on the formation of D-pantothenic acid.
  • the D-pantothenic acid or the corresponding salt is isolated from the fermentation broth and purified as in the prior art (EP-A 0 590 857 and W096/33283) and accordingly used in purified form, or the whole of the fermentation broth containing the D-pantothenic acid is dried (EP-A 1 050 219) and used in particular as an animal feed additive.
  • the inventors set out to provide novel measures to improve the preparation, by fermentation, of D-pantothenic acid and/or its salts or animal feed additives containing them.
  • D-pantothenic acid pantothenic acid or pantothenate
  • this is understood as meaning not only the free acids but also the salts of D- pantothenic acid, e.g. the calcium, sodium, ammonium or potassium salt.
  • the invention provides a process for the preparation, by fermentation, of D-pantothenic acid and/or its salts or animal feed additives containing them by the fermentation of microorganisms of the family Enterobacteriaceae, especially those which already produce D-pantothenic acid, wherein
  • nucleotide sequences coding for the ytfP and/or yifA open reading frames are attenuated or, in particular, switched off under conditions suitable for reducing or switching off the intracellular activity of the appropriate protein (enzyme) , optionally in combination with the attenuation or amplification of other genes, and
  • the D-pantothenic acid or the corresponding salt is enriched in the medium or the fermentation broth or in the cells of the microorganisms of the family Enterobacteriaceae, and
  • the invention also provides a process in which, when the fermentation has finished, all or part of the biomass (>0 to 100%) is separated from the fermentation broth, or optionally remains in it, and the resulting broth is processed, optionally after concentration, to a solid mixture containing D-pantothenic acid and/or its salts together with other constituents of the fermentation broth.
  • the invention also provides microorganisms of the family Enterobacteriaceae, especially of the genus Escherichia, in which the ytfP ORF and/or yifA ORF or their gene products are present in attenuated form.
  • the term 'attenuation' describes the reduction or switching-off, in a microorganism, of the intracellular activity of one or more enzymes or proteins coded for by the appropriate DNA, for example by using a weak promoter or using a gene or allele or an open reading frame (ORF) which codes for an appropriate enzyme or protein with a low activity or inactivates the appropriate gene, ORF or enzyme or protein, and optionally combining these measures .
  • ORF open reading frame
  • An open reading frame is a segment of a nucleotide sequence which codes or can code for a protein or polypeptide or a ribonucleic acid to which no function can be assigned according to the prior art. After a function has been assigned to the particular segment of the nucleotide sequence, the term 'gene' is generally used. /029476 5
  • the attenuation measures generally reduce the activity or concentration of the appropriate protein to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein or of the activity or concentration of the protein in the starting microorganism.
  • the microorganisms provided by the present invention can produce D-pantothenic acid from glucose, sucrose, lactose, fructose, maltose, molasses,, starch and cellulose or from glycerol and ethanol . They are representatives of the Enterobacteriaceae, especially of the genus Escherichia. The species Escherichia coli may be mentioned in particular within the genus Escherichia. Suitable strains within the species Escherichia coli are the so-called K-12 strains, e.g. the strains MG1655 or W3110 (Neidhard et al.:
  • Escherichia coli and Salmonella Cellular and Molecular Biology (ASM Press, Washington DC)) or the Escherichia coli wild-type strain IF03547 (Institute of Fermentation, Osaka, Japan) and mutants derived therefrom which are capable of producing D-pantothenic acid.
  • D-pantothenic acid-producing strains of the genus Escherichia especially of the species Escherichia coli, are:
  • nucleotide sequence of the ytfP ORF is published under Accession Number AAC77179 and the nucleotide sequence of the yjfA ORF is published under Accession Number AAC77180 at the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) . They can also be taken from the genome sequence of Escherichia coli published by Blattner et al. (Science 277, 1453 - 1462 (1997)).
  • Attenuation can be achieved for example by reducing or switching off the expression of the ytfP ORF and/or yjfA ORF or the catalytic properties of the protein. Both measures may optionally be combined.
  • Reduction of the gene expression can be achieved by an appropriate culture technique, by genetic modification
  • signal structures of gene expression or by antisense RNA technology.
  • signal structures of gene expression are repressor genes, activator genes, operators, promoters, attenuators, ribosome binding sites, the start codon and terminators.
  • Possible mutations are transitions, transversions, insertions and deletions .
  • the term 'missense mutations' or 'nonsense mutations' is used. Insertions or deletions of at least one base pair in a gene lead to frame shift mutations, the effect of which is to incorporate false amino acids or terminate the translation prematurely. Deletions of several codons typically result in a complete disappearance of enzyme activity. Instructions on the production of such mutations belong to the prior art and can be found in well-known textbooks on genetics and molecular biology, e.g. the textbook by Knippers ("Molekulare Genetik", 6th edition, Georg Thieme Verlag,
  • Suitable mutations in the ytfP ORF and/or yjfA ORF can be incorporated into suitable strains by gene or allele exchange.
  • a common method is that of gene exchange using a conditionally replicating pSClOl derivative, pMAK705, as described by Hamilton et al. (Journal of Bacteriology 171, 4617 - 4622 (1989)).
  • Other methods described in the prior art for example that of Martinez-Morales et al. (Journal of Bacteriology 181, 7143 - 7148 (1999)) or that of Boyd et al. (Journal of Bacteriology 182, 842 - 847 (2000)), can likewise be used.
  • mutations in the ytfP ORF and/or yjfA ORF or mutations which affect the expression of the ytfP ORF and/or yjfA ORF can be transferred to different strains by conjugation or transduction.
  • panB gene coding for ketopantoate hydroxymethyltransferase (US-A-5, 518, 906)
  • panD gene coding for aspartate decarboxylase (US-A-5, 518, 906)
  • panC gene coding for pantothenate synthetase (US-A-5, 518, 906)
  • the term 'amplification' describes the increase, in a microorganism, of the intracellular activity of one or more enzymes or proteins coded for by the appropriate DNA, for example by increasing the copy number of the gene or genes, using a strong promoter or a gene or allele coding for an appropriate enzyme or protein with a high activity, and optionally combining these measures.
  • the activity or concentration of the appropriate protein is generally increased at least by 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, and at most by up to 1000% or 2000%, based on that of the wild- type protein or the activity or concentration of the protein in the starting microorganism.
  • Microorganisms in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982.
  • bacteria in which the metabolic pathways which reduce the formation of D-pantothenic acid are at least partially switched off.
  • the microorganisms prepared according to the invention can be cultivated by the batch process, the fed batch process or the repeated fed batch process.
  • a summary of known cultivation methods is provided in the textbook by Chmiel (Bioreaktoren und periphere bamboo (Vieweg Verlag, Brunswick/ Wiesbaden, 1994) ) .
  • the culture medium to be used must appropriately meet the demands of the particular strains. Descriptions of culture media for various microorganisms can be found in "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington DC, USA, 1981) .
  • Carbon sources which can be used are sugars and carbohydrates, e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, e.g. soya bean oil, sunflower oil, groundnut oil and coconut fat, fatty acids, e.g. palmitic acid, stearic acid and linoleic acid, alcohols, e.g. glycerol and ethanol, and organic acids, e.g. acetic acid. These substances can be used individually or as a mixture.
  • Nitrogen sources which can be used are organic nitrogen- containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • the nitrogen sources can be used individually or as a mixture.
  • Phosphorus sources which can be used are phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate or the corresponding sodium salts.
  • the culture medium must also contain metal salts, e.g. magnesium sulfate or iron sulfate, which are necessary for growth.
  • essential growth-promoting substances such as amino acids and vitamins can be used in addition to the substances mentioned above.
  • D-pantothenic acid precursors such as aspartate, ⁇ -alanine, ketoisovalerate, ketopantoic acid or pantoic acid, and optionally their salts, can also be added to the culture medium. Said feed materials can be added to the culture all at once or fed in appropriately during cultivation.
  • the pH of the culture is controlled by the appropriate use of basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds such as phosphoric acid or sulfuric acid.
  • basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds such as phosphoric acid or sulfuric acid.
  • the alkaline earth metals salts of pantothenic acid especially the calcium salt
  • a suspension or solution of an inorganic compound containing an alkaline earth metal, for example calcium hydroxide, or of an organic compound such as an alkaline earth metal salt of an organic acid, for example calcium acetate is added continuously or batchwise during the fermentation.
  • the cation required to prepare the desired alkaline earth metal salt of D-pantothenic acid is introduced into the fermentation broth directly in the desired amount, generally in a proportion of 0.8 to 1.2, based on the pantothenic acid, and preferably in stoichiometric amounts.
  • Foaming can be controlled using antifoams such as fatty acid polyglycol esters.
  • the stability of plasmids can be maintained by adding suitable selectively acting substances, e.g. antibiotics, to the medium. Aerobic conditions are maintained by introducing oxygen or oxygen- containing gaseous mixtures, e.g. air, into the culture.
  • the temperature of the culture is normally 25 S C to 45 S C and preferably 30 S C to 40 a C.
  • the culture is continued until the formation of D-pantothenic acid has reached a maximum. This objective is normally achieved within 10 hours to 160 hours .
  • The" D-pantothenic acid or corresponding D-pantothenic acid salts contained in the fermentation broth can then be isolated and purified according to the prior art.
  • the suspension or solution is preferably concentrated and processed to a powder, for example using a spray dryer or a freeze-drying unit.
  • This powder is then generally converted by means of suitable compaction or granulation processes, e.g. pelletizing, to a coarser, easily flowable, storable and largely dust-free product with the desired particle size distribution of optionally 20 to 2000 ⁇ m, especially of 100 to 1400 ⁇ m.
  • compaction or granulation processes e.g. pelletizing
  • a coarser, easily flowable, storable and largely dust-free product with the desired particle size distribution of optionally 20 to 2000 ⁇ m, especially of 100 to 1400 ⁇ m.
  • suitable compaction or granulation processes e.g. pelletizing
  • the granulation or compaction process it is advantageous to use conventional organic or inorganic auxiliary substances or carriers like starch, gelatin, cellulose derivatives or similar substances, such as those conventionally used as binders, gelling agents or thickeners in food or animal feed processing, or to use
  • the fermentation product with or without other conventional constituents of the fermentation broth, can be absorbed onto an organic or inorganic carrier known and conventionally used in animal feed processing, for example silicic acids, silicates, meals, brans, flours, starches, sugars or the like, and/or stabilized with conventional thickeners or binders .
  • an organic or inorganic carrier known and conventionally used in animal feed processing, for example silicic acids, silicates, meals, brans, flours, starches, sugars or the like, and/or stabilized with conventional thickeners or binders .
  • D- pantothenic acid, the desired D-pantothenic acid salt or a preparation containing these compounds is added in order to attain the desired content of pantothenic acid or the desired salt, or adjust said content to the desired value, in the end product.
  • the desired content generally ranges from 20 to 80 wt.% (dry weight) .
  • pantothenic acid can be determined by known chemical methods (Velisek; Chromatographic Science 60, 515 - 560 (1992)) or microbiological methods, e.g. the Lactobacillus plantarum test (DIFCO MANUAL, 10th edition, pp 1100 - 1102; Michigan, USA).
  • M9 and complete medium (LB) used for Escherichia coli are described by J.H. Miller (A Short Course In Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press) .
  • the isolation of plasmid DNA from Escherichia coli, as well as all the techniques for restriction, ligation, Klenow treatment and alkaline phosphatase treatment, are performed according to Sambrook et al. (Molecular Cloning - A Laboratory Manual (1989) Cold Spring Harbor Laboratory Press) . Unless described otherwise, the transformation of Escherichia coli is performed according to Chung et al. (Proceedings of the National Academy of Sciences of the United States of America, USA (1989) 86: 2172 - 2175).
  • the incubation temperature in the preparation of strains and transformants is 37°C. Temperatures of 30°C and 44°C are used in the gene exchange process according to Hamilton et al.
  • the ytfP-yjfA gene region is amplified from Escherichia coli K12 using the polymerase chain reaction (PCR) and synthetic oligonucleotides .
  • PCR polymerase chain reaction
  • the following PCR primers (MWG Biotech, Ebersberg, Germany) are synthesized from the nucleotide sequence of the ytfP-yjf gene region in E. coli K12 MG1655 (SEQ ID No. 1) :
  • ytfP-1 5' - GGCGATGTCGCAACAAGCTG - 3' (SEQ ID No. 2)
  • ytfP-2 5' - CTGTTCATGGCCGCTTGCTG - 3' (SEQ ID No. 3)
  • the chromosomal E. coli K12 MG1655 DNA used for the PCR is isolated with "Qiagen Genomic-tips 100/G" (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.
  • An approx. 1250 bp DNA fragment can be amplified with the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) using Taq DNA polymerase (Gibco-BRL, Eggenstein, Germany) .
  • the PCR product is ligated with vector pCR2.1TOPO (TOPO TA Cloning Kit, Invitrogen, Groningen, The Netherlands) according to the manufacturer's instructions and transformed into the E.
  • Plasmid-carryi ⁇ g cells are selected on LB agar to which 50 ⁇ g/ml of ampicillin have been added. After isolation of the plasmid DNA, the successful cloning of the PCR product is checked with the restriction enzymes EcoRI and Nsil.
  • vector pCR2 To produce a 337 bp deletion in the ytfP-yjfA region, vector pCR2.
  • ITOPOytfP-yj fA is cleaved with the restriction enzymes Ndel and Sspl and the 4.8 kbp DNA fragment is treated with the Klenow enzyme and then ligated.
  • the E. coli strain DH5 ⁇ is transformed with the ligation mixture and plasmid-carrying cells are selected on LB agar to which 50 ⁇ g/ml of ampicillin have been added. After isolation of the plasmid DNA, plasmids in which the mutagenic DNA sequence shown in SEQ ID No. 4 is present in cloned form are detected by control cleavage with the enzyme EcoRI. The plasmid is called pCR2.lTOPO ⁇ yjfA.
  • Example 1 The ytfP-yjf allele described in Example 1 is isolated from vector pCR2. lTOPO ⁇ yj fA after restriction with the enzymes Sacl and Xbal and separation in 0.8% agarose gel, and ligated with plasmid pMAK705 (Hamilton et al . (1989)
  • the E. coli strain FE6 is a valine-resistant mutant of E. coli K12 MG1655 (US-B-6171845) and is deposited as DSM12379 in the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Brunswick, Germany) . Spontaneous mutants are isolated from FE6 after incubation at 37°C on minimal agar to which 2 g/1 of glucose and 1 g/1 of ⁇ - hydroxyaspartic acid have been added.
  • a chosen ⁇ -hydroxyaspartic acid-resistant single colony is then incubated at 37°C on minimal agar containing 2 g/1 of glucose and 0.2 g/1 of O-methylthreonine.
  • a mutant called FE6-1 is resistant to valine, ⁇ - ketoisovaleric acid, ⁇ -hydroxyaspartic acid and 0- methylthreonine.
  • FE6- 1 is transformed with plasmid pMAK705 ⁇ yjfA. The gene exchange is effected by the selection method described by Hamilton et al. (1989) Journal .
  • ytfP-1 5' - GGCGATGTCGCAACAAGCTG - 3' (SEQ ID No. 2)
  • ytfP-2 5' - CTGTTCATGGCCGCTTGCTG - 3' (SEQ ID No. 3)
  • the ilvGM operon from Escherichia coli IF03547 coding for acetohydroxy acid synthase II (Institute of Fermentation, Osaka, Japan) is amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides .
  • PCR primers (MWG Biotech, Ebersberg, Germany) are synthesized from the nucleotide sequence of the ilvGM operon in E. coli K12 MG1655 (GenBank: Accession No. M87049) .
  • the sequence of the ilvGMl primer is chosen so that the primer contains an adenine in position 8. This generates a modified ribosome binding site 7 nucleotides upstream from the start codon of the ilvG proteins.
  • ilvGMl 5' - CAGGACGAGGAACTAACTATG - 3' (SEQ ID No . 5)
  • ilvGM2 5' - TCACGATGGCGGAATACAAC - 3' (SEQ ID No. 6)
  • the chromosomal E. coli IF03547 DNA used for the PCR is isolated with "QIAGEN Genomic-tips 100/G" (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.
  • An approx. 2100 bp DNA fragment comprising the modified ribosome binding site, the ilvGM coding regions and approx. 180 bp 3'-flanking sequences can be amplified with the specific primers under standard PCR conditions (Innis et al.: PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using Pfu DNA polymerase (Promega Corporation, Madison, USA) .
  • the PCR product is cloned into plasmid pCR-Bluntll-TOPO and transformed into the E. coli strain TOP10 (Invitrogen, Groningen, The Netherlands, product description Zero Blunt TOPO PCR Cloning Kit, Cat. No. K2800-20) .
  • the successful cloning is detected by cleavage of plasmid pCR-BluntIF03547ilvGM with the restriction enzymes EcoRI and Sphl.
  • the plasmid DNA is isolated by means of the "QIAprep Spin Plasmid Kit” (QIAGEN, Hilden, Germany), cleaved and then separated in a 0.8% agarose gel.
  • the DNA sequence of the amplified fragment is determined using the reverse and universal sequencing primers (QIAGEN, Hilden, Germany) .
  • the sequence of the PCR product is shown in SEQ ID No. 7 and 9.
  • the ilvG gene or allele is identified in SEQ ID No. 7.
  • the ilvM gene or allele is identified in SEQ ID No. 9.
  • the corresponding gene products or proteins are shown in SEQ ID No. 8 and 10.
  • the ilvGM genes described in Example 4.1 are cloned into vector pTrc99A (Amersham Pharmacia Biotech Inc., Uppsala, Sweden) . This is done by cleaving plasmid pCR-BluntIF03547ilvGM with the enzyme EcoRI, separating the cleavage mixture in 0.8% agarose gel and isolating the 2.1 kbp ilvGM fragment using the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany) .
  • Vector pTrc99A is cleaved with the enzyme EcoRI, an alkaline phosphatase treatment is carried out and the product is ligated with the isolated ilvGM fragment.
  • the ligation mixture is transformed into the E. coli strain DH5 ⁇ .
  • pTrc99A-carrying cells are selected on LB agar (Lennox, Virology 1: 190 (1955)) to which 50 ⁇ g/ml of ampicillin have been added.
  • the successful cloning of the ilvGM operon can be detected after isolation of the plasmid DNA and control cleavage with Sail and Sphl.
  • the D-pantothenic acid-producing E. coli strain FV5069/pFV31 is described in EP-A-0 590 857 and is deposited as FERM BP 4395 under the terms of the Budapest Treaty. Plasmid pFV31 is isolated from FV5069/pFV31 and cleaved with the enzyme BamHI and the protruding 3' ends are treated with the Klenow enzyme. This is followed by an alkaline phosphatase treatment.
  • the 2.8 kbp ilvGM expression cassette is isolated from vector pTrc99AilvGM described in Example 4.2 and ligated with linearized and dephosphorylated vector pFV31.
  • the ligation mixture is transformed into the E. coli strain DH5 ⁇ and plasmid-carrying cells are selected on LB agar to which 50 ⁇ g/ml of ampicillin have been added.
  • the successful cloning of the ilvGM expression cassette can be detected after isolation of the plasmid DNA and control cleavage with Hindlll, Sail, Smal, Sphl and Xbal.
  • the plasmid is called pFV31ilvGM ( Figure 3) .
  • the strain FE6-l ⁇ yjf obtained in Example 3 and the strain FE6-1 are transformed with plasmid pFV31ilvGM and transfor ants are selected on LB agar supplemented with 50 ⁇ g/ml of ampicillin.
  • the strains FE6-l ⁇ yjfA/pFV31ilvGM and FE6-l/pFV31ilvGM are formed in this way.
  • pantothenate production of the E. coli strains FE6- l/pFV31ilvGM and FE6-l ⁇ yjfA/pFV31ilvGM is checked in batch cultures of 10 ml contained in 100 ml Erlenmeyer flasks.
  • the concentration of D-pantothenate formed is then determined in the sterile-filtered culture supernatant by means of the Lactobacillus plantarum ATCC8014 pantothenate assay according to DIFCO's instructions (DIFCO MANUAL, 10th edition, pp 1100 - 1102; Michigan, USA) . Calibration is effected using calcium D(+) -pantothenate hydrate (catalogue number 25,972-1, Sigma-Aldrich, Deisenhofen, Germany).
  • ytfP'-yjfA DNA sequence containing truncated coding regions of ytfP and yjfA
  • panB coding region of the panB gene
  • panC coding region of the panC gene

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Fodder In General (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

The invention provides a process for the preparation of D-pantothenic acid and/or its salts or animal feed additives containing them by the fermentation of microorganisms of the family Enterobacteriaceae, especially those which already produce D-pantothenic acid, wherein the nucleotide sequence(s) coding for the ytfP and/or yjfA open reading frames (ORF) are attenuated or, in particular, switched off, individually or together, in the microorganisms.

Description

Process for the Preparation of D-pantothenic Acid and/or its Salts
Field of the Invention
The present invention relates to a process for the preparation of D-pantothenic acid and/or its salts or mixtures containing them using microorganisms of the family Enterobacteriaceae in which at least the ytfP and/or yjfA open reading frame (ORF) is attenuated.
Prior Art
Pantothenic acid is produced throughout the world on a scale of several thousand tons per year. It is used inter alia in human medicine, in the pharmaceutical industry and in the food industry. A large part of the pantothenic acid produced is used for feeding farm animals such as poultry and pigs .
Pantothenic acid can be prepared by chemical synthesis or biotechnologically by the fermentation of suitable microorganisms in suitable nutrient solutions . In the chemical synthesis, D -pantolactone is an important precursor. It is prepared in a multistage process from formaldehyde, isobutyl aldehyde and cyanide. In subsequent process steps the racemic mixture is separated and the D- pantolactone is condensed with β-alanine to give D- pantothenic acid.
The typical commercial form is the calcium salt of D- pantothenic acid. The calcium salt of the racemic mixture of DL-pantothenic acid is also useful .
The advantage of preparation by the fermentation of microorganisms is the direct formation of the desired stereoisomeric form, namely the D form, free of - pantothenic acid. As indicated in EP-A 0 493 060, various species of bacteria, e.g. Escherichia coli (E. coli) , Arthrobacter ureafaciens, Corynebacterium erythrogenes and Brevibacterium ammoniagenes , as well as yeasts, e.g. Debaromyces castellii, can produce D-pantothenic acid in a nutrient solution containing glucose, DL-pantoic acid and β-alanine. EP-A 0 493 060 further indicates that, in the case of E. coli, the formation of D-pantothenic acid is improved in a nutrient solution containing glucose, DL- pantoic acid and β-alanine by amplification of the pantothenic acid biosynthesis genes from E. coli which are contained on plasmids pFV3 and pFV5.
EP-A 0 590 857 and US patent 5,518,906 describe mutants derived from the E. coli strain IF03547, such as FV5714, FV525, FV814, FV521, FV221, FV6051 and FV5069, which carry resistances to various antimetabolites such as salicylic acid, α-ketobutyric acid, β-hydroxyaspartic acid, O- methylthreonine and α-ketoisovaleric acid. They produce pantoic acid in a nutrient solution containing glucose, and D-pantothenic acid in a nutrient solution containing glucose and β-alanine. EP-A 0 590 857 and US patent 5,518,906 further indicate that, after amplification of the pantothenic acid biosynthesis genes panB, panC and panD, which are said to be contained on plas id pFV31, in the above-mentioned strains, the production of D-pantoic acid is improved in nutrient solutions containing glucose and the production of D-pantothenic acid is improved in a nutrient solution containing glucose and β-alanine.
Furthermore, O97/10340 reports the beneficial effect of amplification of the ilvGM operon on the production of D- pantothenic acid. Finally, EP-A 1 001 027 reports the effect of amplification of the panE gene on the formation of D-pantothenic acid.
The D-pantothenic acid or the corresponding salt is isolated from the fermentation broth and purified as in the prior art (EP-A 0 590 857 and W096/33283) and accordingly used in purified form, or the whole of the fermentation broth containing the D-pantothenic acid is dried (EP-A 1 050 219) and used in particular as an animal feed additive.
Object of the Invention
The inventors set out to provide novel measures to improve the preparation, by fermentation, of D-pantothenic acid and/or its salts or animal feed additives containing them.
Summary of the Invention
Whenever D-pantothenic acid, pantothenic acid or pantothenate is mentioned hereafter, this is understood as meaning not only the free acids but also the salts of D- pantothenic acid, e.g. the calcium, sodium, ammonium or potassium salt.
The invention provides a process for the preparation, by fermentation, of D-pantothenic acid and/or its salts or animal feed additives containing them by the fermentation of microorganisms of the family Enterobacteriaceae, especially those which already produce D-pantothenic acid, wherein
a) the nucleotide sequences coding for the ytfP and/or yifA open reading frames (ORF) are attenuated or, in particular, switched off under conditions suitable for reducing or switching off the intracellular activity of the appropriate protein (enzyme) , optionally in combination with the attenuation or amplification of other genes, and
b) optionally in the presence of alkaline earth metal compounds introduced continuously or batchwise, preferably in stoichiometric amounts,
c) the D-pantothenic acid or the corresponding salt is enriched in the medium or the fermentation broth or in the cells of the microorganisms of the family Enterobacteriaceae, and
d) when the fermentation has finished, the D-pantothenic acid and/or the corresponding salt are isolated.
The invention also provides a process in which, when the fermentation has finished, all or part of the biomass (>0 to 100%) is separated from the fermentation broth, or optionally remains in it, and the resulting broth is processed, optionally after concentration, to a solid mixture containing D-pantothenic acid and/or its salts together with other constituents of the fermentation broth.
The invention also provides microorganisms of the family Enterobacteriaceae, especially of the genus Escherichia, in which the ytfP ORF and/or yifA ORF or their gene products are present in attenuated form.
Detailed Description of the Invention
In this context the term 'attenuation' describes the reduction or switching-off, in a microorganism, of the intracellular activity of one or more enzymes or proteins coded for by the appropriate DNA, for example by using a weak promoter or using a gene or allele or an open reading frame (ORF) which codes for an appropriate enzyme or protein with a low activity or inactivates the appropriate gene, ORF or enzyme or protein, and optionally combining these measures .
An open reading frame (ORF) is a segment of a nucleotide sequence which codes or can code for a protein or polypeptide or a ribonucleic acid to which no function can be assigned according to the prior art. After a function has been assigned to the particular segment of the nucleotide sequence, the term 'gene' is generally used. /029476 5
The attenuation measures, including the reduction of expression, generally reduce the activity or concentration of the appropriate protein to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein or of the activity or concentration of the protein in the starting microorganism.
The microorganisms provided by the present invention can produce D-pantothenic acid from glucose, sucrose, lactose, fructose, maltose, molasses,, starch and cellulose or from glycerol and ethanol . They are representatives of the Enterobacteriaceae, especially of the genus Escherichia. The species Escherichia coli may be mentioned in particular within the genus Escherichia. Suitable strains within the species Escherichia coli are the so-called K-12 strains, e.g. the strains MG1655 or W3110 (Neidhard et al.:
Escherichia coli and Salmonella. Cellular and Molecular Biology (ASM Press, Washington DC)) or the Escherichia coli wild-type strain IF03547 (Institute of Fermentation, Osaka, Japan) and mutants derived therefrom which are capable of producing D-pantothenic acid.
Examples of suitable D-pantothenic acid-producing strains of the genus Escherichia, especially of the species Escherichia coli, are:
Escherichia coli FV5069/pFV31 Escherichia coli FV5069/pFV202 Escherichia coli FE6/pFE80 and Escherichia coli KE3
It has been found that the production of D-pantothenic acid by Enterobacteriaceae is improved after attenuation of the ytfP and/or y fA open reading frames.
The nucleotide sequence of the ytfP ORF is published under Accession Number AAC77179 and the nucleotide sequence of the yjfA ORF is published under Accession Number AAC77180 at the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) . They can also be taken from the genome sequence of Escherichia coli published by Blattner et al. (Science 277, 1453 - 1462 (1997)).
The open reading frames described in the cited literature references can be used according to the invention. It is also possible to use alleles which result from the degeneracy of the genetic code or from neutral sense mutations .
Attenuation can be achieved for example by reducing or switching off the expression of the ytfP ORF and/or yjfA ORF or the catalytic properties of the protein. Both measures may optionally be combined.
Reduction of the gene expression can be achieved by an appropriate culture technique, by genetic modification
(mutation) of the signal structures of gene expression or by antisense RNA technology. Examples of signal structures of gene expression are repressor genes, activator genes, operators, promoters, attenuators, ribosome binding sites, the start codon and terminators. Those skilled in the art can find relevant details inter alia in e.g. Jensen and Hammer (Biotechnology and Bioengineering 58: 191 - 195 (1998)), Carrier and Keasling (Biotechnology Progress 15, 58 - 64 (1999)), Franch and Gerdes (Current Opinion in Microbiology 3, 159 - 164 (2000)) and well-known textbooks on genetics and molecular biology, for example the textbook by Knippers ("Molekulare Genetik", 6th edition, Georg Thieme Verlag, Stuttgart, Germany, 1995) or the textbook by Winnacker ("From Genes to Clones", VCH Verlagsgesellschaft, Weinheim, Germany, 1990) .
Mutations which lead to a change or reduction of the catalytic properties of enzyme proteins are known from the prior art. Examples which may be mentioned are the studies by Qiu and Goodman (Journal of Biological Chemistry 272: 8611 - 8617 (1997)), Yano et al . (Proceedings of the National Academy of Sciences, USA 95, 5511 - 5515 (1998)) and Wente and Schachmann (Journal of Biological Chemistry 266, 20833 - 20839 (1991)). Surveys can be found in well- known textbooks on genetics and molecular biology, e.g. the textbook by Hagemann ("Allgemeine Genetik", Gustav Fischer Verlag, Stuttgart, 1986) .
Possible mutations are transitions, transversions, insertions and deletions . Depending on the effect of amino acid exchange on enzyme activity, the term 'missense mutations' or 'nonsense mutations' is used. Insertions or deletions of at least one base pair in a gene lead to frame shift mutations, the effect of which is to incorporate false amino acids or terminate the translation prematurely. Deletions of several codons typically result in a complete disappearance of enzyme activity. Instructions on the production of such mutations belong to the prior art and can be found in well-known textbooks on genetics and molecular biology, e.g. the textbook by Knippers ("Molekulare Genetik", 6th edition, Georg Thieme Verlag,
Stuttgart, Germany, 1995) , the textbook by Winnacker ("From Genes to Clones", VCH Verlagsgesellschaft, Weinheim, Germany, 1990) or the textbook by Hagemann ("Allgemeine Genetik", Gustav Fischer Verlag, Stuttgart, 1986) .
Suitable mutations in the ytfP ORF and/or yjfA ORF, for example deletion mutations, can be incorporated into suitable strains by gene or allele exchange.
A common method is that of gene exchange using a conditionally replicating pSClOl derivative, pMAK705, as described by Hamilton et al. (Journal of Bacteriology 171, 4617 - 4622 (1989)). Other methods described in the prior art, for example that of Martinez-Morales et al. (Journal of Bacteriology 181, 7143 - 7148 (1999)) or that of Boyd et al. (Journal of Bacteriology 182, 842 - 847 (2000)), can likewise be used. Also, mutations in the ytfP ORF and/or yjfA ORF or mutations which affect the expression of the ytfP ORF and/or yjfA ORF can be transferred to different strains by conjugation or transduction.
Furthermore, for the production of D-pantothenic acid with strains of the family Enterobacteriaceae, it can be advantageous not only to attenuate the ytfP ORF and/or yjfA ORF, but also to amplify or, in particular, overexpress one or more endogenous genes , i.e. genes inherent in the particular species, selected from the group comprising:
• the ilvGM operon coding for acetohydroxy acid synthase II (WO97/10340) ,
• the panB gene coding for ketopantoate hydroxymethyltransferase (US-A-5, 518, 906) ,
• the panE gene coding for ketopantoate reductase (EP-A-1 001 027) ,
• the panD gene coding for aspartate decarboxylase (US-A-5, 518, 906) ,
• the panC gene coding for pantothenate synthetase (US-A-5, 518, 906) ,
• the serC gene coding for phosphoserine transaminase (Duncan and Coggins, Biochemical Journal 234: 49 - 57 (1986)),
• the gcvT, gcvH and gcvP genes coding for the glycine cleavage system (Okamura-Ikeda et al . , European Journal of Biochemistry 216, 539 - 548 (1993)), and
• the glyA gene coding for serine hydroxymethyltransferase (Plamann et al. (Nucleic Acids Research 11(7): 2065 - 2075 (1983))).
In this context the term 'amplification' describes the increase, in a microorganism, of the intracellular activity of one or more enzymes or proteins coded for by the appropriate DNA, for example by increasing the copy number of the gene or genes, using a strong promoter or a gene or allele coding for an appropriate enzyme or protein with a high activity, and optionally combining these measures.
Through the measures of amplification, especially overexpression, the activity or concentration of the appropriate protein is generally increased at least by 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, and at most by up to 1000% or 2000%, based on that of the wild- type protein or the activity or concentration of the protein in the starting microorganism.
Finally, for the production of D-pantothenic acid with strains of the family Enterobacteriaceae, it can be advantageous not only to attenuate the ytfP ORF and/or yjfA ORF, but also to attenuate or, in particular, switch off or express at a low level the following genes, individually or together:
• the avtA gene coding for transaminase C (EP-A-1 001 027) ,
• the poxB gene coding for pyruvate oxidase (Grabau and Cronan, Nucleic Acids Research 14 (13), 5449 - 5460 (1986)), and
• the pckA gene coding for PEP carboxykinase (Medina et al., Journal of Bacteriology 172, 7151 - 7156 (1990)).
Furthermore, for the production of D-pantothenic acid, it can be advantageous not only to attenuate the ytfP ORF and/or yjfA ORF, but also to switch off unwanted secondary reactions (Nakayama: "Breeding of Amino Acid Producing
Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982) . In the process according to the invention, it is possible to use bacteria in which the metabolic pathways which reduce the formation of D-pantothenic acid are at least partially switched off.
The microorganisms prepared according to the invention can be cultivated by the batch process, the fed batch process or the repeated fed batch process. A summary of known cultivation methods is provided in the textbook by Chmiel (Bioprozesstechnik 1. Einfϋhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Brunswick/ Wiesbaden, 1994) ) .
The culture medium to be used must appropriately meet the demands of the particular strains. Descriptions of culture media for various microorganisms can be found in "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington DC, USA, 1981) . Carbon sources which can be used are sugars and carbohydrates, e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, e.g. soya bean oil, sunflower oil, groundnut oil and coconut fat, fatty acids, e.g. palmitic acid, stearic acid and linoleic acid, alcohols, e.g. glycerol and ethanol, and organic acids, e.g. acetic acid. These substances can be used individually or as a mixture.
Nitrogen sources which can be used are organic nitrogen- containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen sources can be used individually or as a mixture.
Phosphorus sources which can be used are phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate or the corresponding sodium salts. The culture medium must also contain metal salts, e.g. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth-promoting substances such as amino acids and vitamins can be used in addition to the substances mentioned above. D-pantothenic acid precursors, such as aspartate, β-alanine, ketoisovalerate, ketopantoic acid or pantoic acid, and optionally their salts, can also be added to the culture medium. Said feed materials can be added to the culture all at once or fed in appropriately during cultivation.
The pH of the culture is controlled by the appropriate use of basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds such as phosphoric acid or sulfuric acid.
As a further possibility, to prepare the alkaline earth metals salts of pantothenic acid, especially the calcium salt, a suspension or solution of an inorganic compound containing an alkaline earth metal, for example calcium hydroxide, or of an organic compound such as an alkaline earth metal salt of an organic acid, for example calcium acetate, is added continuously or batchwise during the fermentation. In this way the cation required to prepare the desired alkaline earth metal salt of D-pantothenic acid is introduced into the fermentation broth directly in the desired amount, generally in a proportion of 0.8 to 1.2, based on the pantothenic acid, and preferably in stoichiometric amounts.
Foaming can be controlled using antifoams such as fatty acid polyglycol esters. The stability of plasmids can be maintained by adding suitable selectively acting substances, e.g. antibiotics, to the medium. Aerobic conditions are maintained by introducing oxygen or oxygen- containing gaseous mixtures, e.g. air, into the culture. The temperature of the culture is normally 25SC to 45SC and preferably 30SC to 40aC. The culture is continued until the formation of D-pantothenic acid has reached a maximum. This objective is normally achieved within 10 hours to 160 hours .
The" D-pantothenic acid or corresponding D-pantothenic acid salts contained in the fermentation broth can then be isolated and purified according to the prior art.
It is also possible to remove all or part (>0 to 100%) of the biomass from the fermentation broths containing D- pantothenic acid and/or its salts, preferably initially by means of known methods of separation, for example centrifugation, filtration, decantation or a combination thereof. Another possibility, however, is to leave the whole of the biomass in the fermentation broth.
In general the suspension or solution is preferably concentrated and processed to a powder, for example using a spray dryer or a freeze-drying unit. This powder is then generally converted by means of suitable compaction or granulation processes, e.g. pelletizing, to a coarser, easily flowable, storable and largely dust-free product with the desired particle size distribution of optionally 20 to 2000 μm, especially of 100 to 1400 μm. In the granulation or compaction process it is advantageous to use conventional organic or inorganic auxiliary substances or carriers like starch, gelatin, cellulose derivatives or similar substances, such as those conventionally used as binders, gelling agents or thickeners in food or animal feed processing, or to use other substances like silicic acids, silicates or stearates.
Alternatively, the fermentation product, with or without other conventional constituents of the fermentation broth, can be absorbed onto an organic or inorganic carrier known and conventionally used in animal feed processing, for example silicic acids, silicates, meals, brans, flours, starches, sugars or the like, and/or stabilized with conventional thickeners or binders . Relevant application examples and processes are described in the literature (Die Muhle + Mischfuttertechnik 132 (1995) 49, page 817).
Optionally, at a suitable stage of the process, D- pantothenic acid, the desired D-pantothenic acid salt or a preparation containing these compounds is added in order to attain the desired content of pantothenic acid or the desired salt, or adjust said content to the desired value, in the end product.
The desired content generally ranges from 20 to 80 wt.% (dry weight) .
The concentration of pantothenic acid can be determined by known chemical methods (Velisek; Chromatographic Science 60, 515 - 560 (1992)) or microbiological methods, e.g. the Lactobacillus plantarum test (DIFCO MANUAL, 10th edition, pp 1100 - 1102; Michigan, USA).
A pure culture of the Escherichia coli K-12 strain DH5 /pMAK705 was deposited as DSM 13720 on 08 September 2000 in the Deutsche Sammlung fur Mikroorganismen und
Zellkulturen (DSMZ, Brunswick, Germany) under the terms of the Budapest Treaty.
A pure culture of the Escherichia coli K-12 strain FE6-1 was deposited as DSM 13721 on 08 September 2000 in the Deutsche Sammlung fur Mikroorganismen und Zellkulturen
(DSMZ, Brunswick, Germany) under the terms of the Budapest Treaty.
The present invention is illustrated in greater detail below with the aid of embodiment examples.
The minimum medium (M9) and complete medium (LB) used for Escherichia coli are described by J.H. Miller (A Short Course In Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press) . The isolation of plasmid DNA from Escherichia coli, as well as all the techniques for restriction, ligation, Klenow treatment and alkaline phosphatase treatment, are performed according to Sambrook et al. (Molecular Cloning - A Laboratory Manual (1989) Cold Spring Harbor Laboratory Press) . Unless described otherwise, the transformation of Escherichia coli is performed according to Chung et al. (Proceedings of the National Academy of Sciences of the United States of America, USA (1989) 86: 2172 - 2175).
The incubation temperature in the preparation of strains and transformants is 37°C. Temperatures of 30°C and 44°C are used in the gene exchange process according to Hamilton et al.
Example 1
Construction of the deletion mutation of the ytfP-yjfA gene region
The ytfP-yjfA gene region is amplified from Escherichia coli K12 using the polymerase chain reaction (PCR) and synthetic oligonucleotides . The following PCR primers (MWG Biotech, Ebersberg, Germany) are synthesized from the nucleotide sequence of the ytfP-yjf gene region in E. coli K12 MG1655 (SEQ ID No. 1) :
ytfP-1: 5' - GGCGATGTCGCAACAAGCTG - 3' (SEQ ID No. 2) ytfP-2: 5' - CTGTTCATGGCCGCTTGCTG - 3' (SEQ ID No. 3)
The chromosomal E. coli K12 MG1655 DNA used for the PCR is isolated with "Qiagen Genomic-tips 100/G" (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. An approx. 1250 bp DNA fragment can be amplified with the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) using Taq DNA polymerase (Gibco-BRL, Eggenstein, Germany) . The PCR product is ligated with vector pCR2.1TOPO (TOPO TA Cloning Kit, Invitrogen, Groningen, The Netherlands) according to the manufacturer's instructions and transformed into the E. coli strain TOP10F'. Plasmid-carryiήg cells are selected on LB agar to which 50 μg/ml of ampicillin have been added. After isolation of the plasmid DNA, the successful cloning of the PCR product is checked with the restriction enzymes EcoRI and Nsil.
To produce a 337 bp deletion in the ytfP-yjfA region, vector pCR2. ITOPOytfP-yj fA is cleaved with the restriction enzymes Ndel and Sspl and the 4.8 kbp DNA fragment is treated with the Klenow enzyme and then ligated.
The E. coli strain DH5α is transformed with the ligation mixture and plasmid-carrying cells are selected on LB agar to which 50 μg/ml of ampicillin have been added. After isolation of the plasmid DNA, plasmids in which the mutagenic DNA sequence shown in SEQ ID No. 4 is present in cloned form are detected by control cleavage with the enzyme EcoRI. The plasmid is called pCR2.lTOPOΔyjfA.
Example 2
Construction of exchange vector pMAK705ΔyjfA
The ytfP-yjf allele described in Example 1 is isolated from vector pCR2. lTOPOΔyj fA after restriction with the enzymes Sacl and Xbal and separation in 0.8% agarose gel, and ligated with plasmid pMAK705 (Hamilton et al . (1989)
Journal of Bacteriology 171, 4617 - 4622) digested with the enzymes Sacl and Xbal. The ligation mixture is transformed into DH5 and plasmid-carrying cells are selected on LB agar to which 20 μg/ml of chloramphenicol have been added. The successful cloning is detected after isolation of the plasmid DNA and cleavage with the enzymes Sacl and Xbal. The exchange vector formed, pMAK705ΔyjfA (= pMAK705deltay fA) , is shown in Figure 1. Example 3
Site-specific mutagenesis of the ytfP-yjfA gene region in the E. coli strain FE6-1
The E. coli strain FE6 is a valine-resistant mutant of E. coli K12 MG1655 (US-B-6171845) and is deposited as DSM12379 in the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Brunswick, Germany) . Spontaneous mutants are isolated from FE6 after incubation at 37°C on minimal agar to which 2 g/1 of glucose and 1 g/1 of β- hydroxyaspartic acid have been added.
A chosen β-hydroxyaspartic acid-resistant single colony is then incubated at 37°C on minimal agar containing 2 g/1 of glucose and 0.2 g/1 of O-methylthreonine. After this step, a mutant called FE6-1 is resistant to valine, α- ketoisovaleric acid, β-hydroxyaspartic acid and 0- methylthreonine. For exchange of the chromosomal ytfP-yjfA gene region with the plasmid-coded deletion construct, FE6- 1 is transformed with plasmid pMAK705ΔyjfA. The gene exchange is effected by the selection method described by Hamilton et al. (1989) Journal. of Bacteriology 171, 4617 - 4622, and is verified by standard PCR methods (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) using the following oligonucleotide primers :
ytfP-1: 5' - GGCGATGTCGCAACAAGCTG - 3' (SEQ ID No. 2) ytfP-2: 5' - CTGTTCATGGCCGCTTGCTG - 3' (SEQ ID No. 3)
The strain obtained is called FE6-lΔyjf . Example 4
Preparation of D-pantothenic acid with the strain FE6-lΔyjfA/pFV31ilvGM
4.1 Amplification and cloning of"the ilvGM gene
The ilvGM operon from Escherichia coli IF03547 coding for acetohydroxy acid synthase II (Institute of Fermentation, Osaka, Japan) is amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides . PCR primers (MWG Biotech, Ebersberg, Germany) are synthesized from the nucleotide sequence of the ilvGM operon in E. coli K12 MG1655 (GenBank: Accession No. M87049) . The sequence of the ilvGMl primer is chosen so that the primer contains an adenine in position 8. This generates a modified ribosome binding site 7 nucleotides upstream from the start codon of the ilvG proteins.
ilvGMl: 5' - CAGGACGAGGAACTAACTATG - 3' (SEQ ID No . 5) ilvGM2: 5' - TCACGATGGCGGAATACAAC - 3' (SEQ ID No. 6)
The chromosomal E. coli IF03547 DNA used for the PCR is isolated with "QIAGEN Genomic-tips 100/G" (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. An approx. 2100 bp DNA fragment comprising the modified ribosome binding site, the ilvGM coding regions and approx. 180 bp 3'-flanking sequences can be amplified with the specific primers under standard PCR conditions (Innis et al.: PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using Pfu DNA polymerase (Promega Corporation, Madison, USA) . The PCR product is cloned into plasmid pCR-Bluntll-TOPO and transformed into the E. coli strain TOP10 (Invitrogen, Groningen, The Netherlands, product description Zero Blunt TOPO PCR Cloning Kit, Cat. No. K2800-20) .
The successful cloning is detected by cleavage of plasmid pCR-BluntIF03547ilvGM with the restriction enzymes EcoRI and Sphl. To do this, the plasmid DNA is isolated by means of the "QIAprep Spin Plasmid Kit" (QIAGEN, Hilden, Germany), cleaved and then separated in a 0.8% agarose gel. The DNA sequence of the amplified fragment is determined using the reverse and universal sequencing primers (QIAGEN, Hilden, Germany) . The sequence of the PCR product is shown in SEQ ID No. 7 and 9. The ilvG gene or allele is identified in SEQ ID No. 7. The ilvM gene or allele is identified in SEQ ID No. 9. The corresponding gene products or proteins are shown in SEQ ID No. 8 and 10.
4.2 Cloning of the ilvGM genes into expression vector pTrc99A
For expression in Escherichia coli K12, the ilvGM genes described in Example 4.1 are cloned into vector pTrc99A (Amersham Pharmacia Biotech Inc., Uppsala, Sweden) . This is done by cleaving plasmid pCR-BluntIF03547ilvGM with the enzyme EcoRI, separating the cleavage mixture in 0.8% agarose gel and isolating the 2.1 kbp ilvGM fragment using the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany) . Vector pTrc99A is cleaved with the enzyme EcoRI, an alkaline phosphatase treatment is carried out and the product is ligated with the isolated ilvGM fragment. The ligation mixture is transformed into the E. coli strain DH5α. pTrc99A-carrying cells are selected on LB agar (Lennox, Virology 1: 190 (1955)) to which 50 μg/ml of ampicillin have been added. The successful cloning of the ilvGM operon can be detected after isolation of the plasmid DNA and control cleavage with Sail and Sphl. In the vector called pTrc99AilvGM (Figure 2), expression of the ilvGM operon is regulated by the Ptrc promoter located upstream from the modified ribosome binding site and by the rRNA terminator region located downstream from the ilvGM coding regions . 4.3 Construction of vector pFV31ilvGM
The D-pantothenic acid-producing E. coli strain FV5069/pFV31 is described in EP-A-0 590 857 and is deposited as FERM BP 4395 under the terms of the Budapest Treaty. Plasmid pFV31 is isolated from FV5069/pFV31 and cleaved with the enzyme BamHI and the protruding 3' ends are treated with the Klenow enzyme. This is followed by an alkaline phosphatase treatment. After restriction with the enzyme Sspl and separation of the cleavage mixture in 0.8% agarose gel, the 2.8 kbp ilvGM expression cassette is isolated from vector pTrc99AilvGM described in Example 4.2 and ligated with linearized and dephosphorylated vector pFV31. The ligation mixture is transformed into the E. coli strain DH5α and plasmid-carrying cells are selected on LB agar to which 50 μg/ml of ampicillin have been added.
The successful cloning of the ilvGM expression cassette can be detected after isolation of the plasmid DNA and control cleavage with Hindlll, Sail, Smal, Sphl and Xbal. The plasmid is called pFV31ilvGM (Figure 3) .
4.4 Preparation of the strain FE6-lΔyjfA/pFV31ilvGM
The strain FE6-lΔyjf obtained in Example 3 and the strain FE6-1 are transformed with plasmid pFV31ilvGM and transfor ants are selected on LB agar supplemented with 50 μg/ml of ampicillin. The strains FE6-lΔyjfA/pFV31ilvGM and FE6-l/pFV31ilvGM are formed in this way.
4.5 Preparation of D-pantothenic acid with the strain FE6- lΔyj fA/pFV3lilvGM
The pantothenate production of the E. coli strains FE6- l/pFV31ilvGM and FE6-lΔyjfA/pFV31ilvGM is checked in batch cultures of 10 ml contained in 100 ml Erlenmeyer flasks. To do this, 10 ml of a preculture medium of the following composition: 2 g/1 of yeast extract, 10 g/1 of (NH4)2S0 > 1 g/1 of KH2P04, 0.5 g/1 of MgS04*7H20, 15 g/1 of CaC03, 20 g/1 of glucose and 50 μg/ml of ampicillin, are inoculated with a single colony and incubated for 20 hours at 33°C and 200 rpm on an ESR incubator from Kϋhner AG (Birsfelden, Switzerland) . 200 μl aliquots of this preculture are inoculated into 10 ml of production medium (25 g/1 of
(NH4)2S04, 2 g/1 of KH2P04, 1 g/1 of MgS04*7H20, 0.03 g/1 of FeS04*7H20, 0.018 g/1 of MnS04-lH20, 30 g/1 of CaC03, 20 g/1 of glucose, 20 g/1 of β-alanine, 250 mg/1 of thiamine) and incubated for 48 hours at 37°C and 200 rpm. After incubation, the optical density (OD) of the culture suspension is determined with an LP2W photometer from Dr. Lange (Dϋsseldorf, Germany) at a wavelength of 660 nm.
The concentration of D-pantothenate formed is then determined in the sterile-filtered culture supernatant by means of the Lactobacillus plantarum ATCC8014 pantothenate assay according to DIFCO's instructions (DIFCO MANUAL, 10th edition, pp 1100 - 1102; Michigan, USA) . Calibration is effected using calcium D(+) -pantothenate hydrate (catalogue number 25,972-1, Sigma-Aldrich, Deisenhofen, Germany).
The experimental results are shown in Table 1.
Table 1
Figure imgf000022_0001
Brief Description of the Figures
• Figure 1: pMAK705Δyjf (= pMAK705deltayjf )
• Figure 2 : pTrc99AilvGM
• Figure 3: pFV31ilvGM
Length data are to be understood as approximate. The abbreviations and symbols used have the following meanings
• cat: chloramphenicol resistance gene
rep-ts: temperature-sensitive replication region of plasmid pSClOl
ytfP'-yjfA": DNA sequence containing truncated coding regions of ytfP and yjfA
• Amp: ampicillin resistance gene
• lad : gene for the repressor protein of the trc promoter
• Ptrc: trc promoter region, IPTG-inducible
• ilvG: coding region of the large subunit of acetohydroxy acid synthase II • ilvM: coding region of the small subunit of acetohydroxy acid synthase II
• 5S: 5S rRNA region
• rrnBT: rRNA terminator region
• panB: coding region of the panB gene
• panC: coding region of the panC gene
The abbreviations for the restriction enzymes have the following meanings:
• EcoRI: restriction endonuclease from Escherichia coli
• Hindlll: restriction endonuclease from Haemophilus influenzae
• Nsil: restriction endonuclease from Neisseria sicca
• Sacl : restriction endonuclease from Streptomyces achromogenes
• Sail: restriction endonuclease from Streptomyces albus
• Smal: restriction endonuclease from Serratia marcescens
• Sphl: restriction endonuclease from Streptomyces phaeochromogenes
• Sspl: restriction endonuclease from Sphaerotilus species
• Xbal: restriction endonuclease from Xanthomonas badrii

Claims

27What is claimed is:
1. Process for the preparation of D-pantothenic acid and/or its alkaline earth metal salts or its salts or animal feed additives containing them by the fermentation of microorganisms of the family
Enterobacteriaceae, especially those which already produce D-pantothenic acid, wherein the nucleotide sequences coding for the ytfP and/or yifA open reading frames (ORF) are attenuated or, in particular, switched off under conditions suitable for reducing or switching off the intracellular activity of the appropriate protein (enzyme) .
2. Process according to Claim 1 wherein
a) the D-pantothenic acid and/or its salts are enriched in the medium or in the cells of the microorganisms , and
b) when the fermentation has finished, the desired products are isolated, the biomass and/or other constituents of the fermentation broth being separated off in an amount of >0 to 100%.
3. Process according to Claim 1 wherein other endogenous genes are amplified and/or attenuated.
4. Process according to Claim 1, wherein the fermentation is carried out in the presence of alkaline earth metal salts introduced continuously or batchwise in the desired amount, and a product containing or consisting of an alkali metal salt of D-pantothenic acid is recovered.
5. Process according to Claim 1, wherein microorganisms of the genus Escherichia are used.
6. Process according to Claim 3 , wherein the 28
microorganisms of the genus Escherichia are derived from the species Escherichia coli .
7. Process according to Claim 1 which comprises not only attenuating or switching off the nucleotide sequences coding for the ytfP ORF and/or yifA ORF, but also amplifying or, in particular, overexpressing one or more endogenous genes selected from the group comprising:
7.1 the ilvGM operon coding for acetohydroxy acid synthase II,
7.2 the panB gene coding for ketopantoate hydroxymethyltransferase,
7.3 the panE gene coding for ketopantoate reductase,
7.4 the panD gene coding for aspartate decarboxylase,
7.5 the panC gene coding for pantothenate synthetase,
7.6 the serC gene coding for phosphoserine transaminase,
7.7 the gcvT, gcvH and gcvP genes coding for the glycine cleavage system (Okamura-Ikeda et al., European Journal of Biochemistry 216, 539 - 548
(1993)), and
7.8 the glyA gene coding for serine hydroxymethyltransferase.
8. Process according to Claim 1 wherein microorganisms are used in which the metabolic pathways which reduce the formation of D-pantothenic acid are at least partially switched off.
9. Process according to Claim 1 which comprises not only attenuating or switching off the nucleotide sequences 29
coding for the ytfP ORF and/or yifA ORF, but also attenuating or, in particular, switching off or expressing at a low level, individually or together, one or more endogenous genes selected from the group comprising:
9.1 the avtA gene coding for transaminase C,
9.2 the poxB gene coding for pyruvate oxidase, and
9.3 the pckA gene coding for PEP carboxykinase.
10. Process according to Claim 1 wherein the mutation in the ytfP ORF and/or yifA ORF is effected by means of a transition, transversion, insertion or deletion.
11. Microorganisms of the family Enterobacteriaceae, especially of the genus Escherichia, which contain the described mutation in attenuated form in the ytfP ORF and/or yifA ORF or their gene products.
12. Microorganisms of the genus Escherichia, especially of the species Escherichia coli, which contain the described mutation in attenuated form in the ytfP ORF and/or yifA ORF or their gene products.
13. Process for the preparation of D-pantothenic acid and/or its salts by the fermentation of microorganisms according to Claim 11 or 12.
14. Process for the preparation of animal feed additives, wherein
a) the biomass and/or optionally the contents of the fermentation broth according to Claim 1, obtained by fermentation and containing D-pantothenic acid and/or its salts, are separated from said broth in an amount of >0 to 100%,
b) the resulting mixture is optionally concentrated, 30
c) the mixture containing pantothenic acid and/or pantothenate is converted to a flowable form by suitable means, and
d) this is used to prepare a flowable animal feed additive with a particle size distribution of 20 to 2000 μ , especially of 100 to 1400 μm.
15. Process according to Claim 14 with a content of D- pantothenic acid and/or its salts selected from the group comprising the magnesium and calcium salts, wherein
a) water is optionally removed from the fermentation broth (concentration) ,
b) the biomass formed during the fermentation is separated off in an amount of >0 to 100%,
c) one or more of said compounds are optionally added to the fermentation broths treated according to a) and b) , the amount of the added compounds being such that their total concentration in the animal feed additive ranges from about 20 to 80 wt.% (dry weight), and
d) the animal feed additive is produced in the desired pulverulent or, preferably, granular form.
16. Process according to Claim 15, wherein an animal feed additive is obtained in the desired pulverulent or granular form from the fermentation broth by
a) drying and compaction, or
b) spray-drying, or
c) spray-drying and granulation, or d) spray-drying and pelletizing,
optionally after the addition of D-pantothenic acid and/or its salts and optionally after the addition of organic or inorganic auxiliary substances.
PCT/EP2002/009373 2001-09-28 2002-08-22 Process for the preparation of d-pantothenic acid and/or its salts WO2003029476A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP02760324A EP1430139B1 (en) 2001-09-28 2002-08-22 Process for the preparation of d-pantothenic acid and/or its salts
DE60211357T DE60211357T2 (en) 2001-09-28 2002-08-22 PROCESS FOR THE PREPARATION OF D-PANTOTHENIC ACID AND / OR ITS SALTS
US10/490,851 US20050089971A1 (en) 2001-09-28 2002-08-22 Process for the preparation of d-pantothenic acid and/or its salts

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10147960A DE10147960A1 (en) 2001-09-28 2001-09-28 Process for the fermentative production of D-pantothenic acid and / or its salts
DE10147960.3 2001-09-28

Publications (2)

Publication Number Publication Date
WO2003029476A2 true WO2003029476A2 (en) 2003-04-10
WO2003029476A3 WO2003029476A3 (en) 2003-09-25

Family

ID=7700690

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/009373 WO2003029476A2 (en) 2001-09-28 2002-08-22 Process for the preparation of d-pantothenic acid and/or its salts

Country Status (5)

Country Link
US (1) US20050089971A1 (en)
EP (1) EP1430139B1 (en)
AT (1) ATE325886T1 (en)
DE (2) DE10147960A1 (en)
WO (1) WO2003029476A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004113510A2 (en) * 2003-06-18 2004-12-29 Dsm Ip Assets B.V. Production of pantothenate using microorganisms incapable of sporulation
WO2005028659A2 (en) * 2003-09-22 2005-03-31 Basf Aktiengesellschaft Method for producing an animal food supplement containing d-pantothenic acid and/or salts thereof
EP2002830A1 (en) 2003-12-24 2008-12-17 N.V. Nutricia Compositions comprising pantothenic acid or derivatives thereof and their use for stimulating appetite
DE112007001179T5 (en) 2006-05-16 2009-04-02 Dsm Ip Assets B.V. Process for the preparation of panthenol

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102589135B1 (en) * 2021-05-10 2023-10-12 씨제이제일제당 (주) Microorganism having inhanced activity of 3-methyl-2-oxobutanoate hydroxymethyltransferase and uses thereof
KR20240105656A (en) * 2022-12-28 2024-07-08 씨제이제일제당 (주) Microorganism having enhanced activity of anion symporter and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0590857A2 (en) * 1992-09-25 1994-04-06 Takeda Chemical Industries, Ltd. Production of D-pantoic acid and D-pantothenic acid
US6171845B1 (en) * 1998-10-09 2001-01-09 Degussa-Huls Ag Mutant E. coli kiz strains for production of pantothenic acid
US6184007B1 (en) * 1998-12-01 2001-02-06 Degussa-Huls Aktiengesellschaft Method for the fermentative production of D-pantothenic acid by enhancement of the panD gene in microorganisms
DE10130192A1 (en) * 2000-09-30 2002-04-11 Degussa Process for the fermentative production of L-amino acids using strains of the Enterobacteriaceae family

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0590857A2 (en) * 1992-09-25 1994-04-06 Takeda Chemical Industries, Ltd. Production of D-pantoic acid and D-pantothenic acid
US6171845B1 (en) * 1998-10-09 2001-01-09 Degussa-Huls Ag Mutant E. coli kiz strains for production of pantothenic acid
US6184007B1 (en) * 1998-12-01 2001-02-06 Degussa-Huls Aktiengesellschaft Method for the fermentative production of D-pantothenic acid by enhancement of the panD gene in microorganisms
DE10130192A1 (en) * 2000-09-30 2002-04-11 Degussa Process for the fermentative production of L-amino acids using strains of the Enterobacteriaceae family

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YUN M ET AL: "Structural basis for the feedback regulation of Escherichia coli pantothenate kinase by coenzyme A." THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 275, no. 36, 8 September 2000 (2000-09-08), pages 28093-28099, XP002235164 US ISSN: 0021-9258 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004113510A2 (en) * 2003-06-18 2004-12-29 Dsm Ip Assets B.V. Production of pantothenate using microorganisms incapable of sporulation
WO2004113510A3 (en) * 2003-06-18 2005-05-26 Dsm Ip Assets Bv Production of pantothenate using microorganisms incapable of sporulation
JP2006527589A (en) * 2003-06-18 2006-12-07 ディーエスエム アイピー アセッツ ビー．ブイ． Production of pantothenate using microorganisms that cannot sporulate
WO2005028659A2 (en) * 2003-09-22 2005-03-31 Basf Aktiengesellschaft Method for producing an animal food supplement containing d-pantothenic acid and/or salts thereof
WO2005028659A3 (en) * 2003-09-22 2005-06-23 Basf Ag Method for producing an animal food supplement containing d-pantothenic acid and/or salts thereof
EP2002830A1 (en) 2003-12-24 2008-12-17 N.V. Nutricia Compositions comprising pantothenic acid or derivatives thereof and their use for stimulating appetite
EP2311448A1 (en) 2003-12-24 2011-04-20 N.V. Nutricia Compositions comprising pantothenic acid or derivatives thereof and their use for stimulating appetite
DE112007001179T5 (en) 2006-05-16 2009-04-02 Dsm Ip Assets B.V. Process for the preparation of panthenol

Also Published As

Publication number Publication date
WO2003029476A3 (en) 2003-09-25
DE10147960A1 (en) 2003-04-10
EP1430139B1 (en) 2006-05-10
US20050089971A1 (en) 2005-04-28
ATE325886T1 (en) 2006-06-15
DE60211357D1 (en) 2006-06-14
DE60211357T2 (en) 2007-02-22
EP1430139A2 (en) 2004-06-23

Similar Documents

Publication Publication Date Title
US6623944B2 (en) Process for preparation of D-pantothenic acid and/or salts thereof
EP1395662B1 (en) Process for the preparation of d-pantothenic acid and/or salts thereof
WO2002072855A2 (en) Process for the preparation of d-pantothenic acid and/or salts thereof
EP1430139B1 (en) Process for the preparation of d-pantothenic acid and/or its salts
US6689592B2 (en) Process for the enzymatic production of D-pantothenic acid and/or its salts
EP1360305B1 (en) A process for the fermentative preparation of d-pantothenic acid and/or its salts
EP1383898B1 (en) A process for the fermentative preparation of d-pantothenic acid and/or its salts
EP1368485A2 (en) Process for the preparation of d-pantothenic acid and/or salts thereof
US20030073204A1 (en) Process for the manufacture of D-pantothene acid and/or its salts by fermentation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2002760324

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002760324

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10490851

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2002760324

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP