WO2002072855A2

WO2002072855A2 - Process for the preparation of d-pantothenic acid and/or salts thereof

Info

Publication number: WO2002072855A2
Application number: PCT/EP2002/001830
Authority: WO
Inventors: Mechthild Rieping
Original assignee: Degussa Ag
Priority date: 2001-03-14
Filing date: 2002-02-21
Publication date: 2002-09-19
Also published as: DE10112102A1; WO2002072855A3; AU2002233353A1

Abstract

The invention provides a process for the preparation of D-pantothenic acid and/or salts thereof or feedstuffs additives comprising these, by fermentation of microorganisms of the Enterobacteriaceae family, in particular those which already produce D-pantothenic acid, wherein the nucleotide sequence(s) in the microorganisms which code(s) for the poxB gene is (are) attenuated, in particular eliminated.

Description

Process for the Preparation of D-Pantothenic Acid and/or Salts Thereof

Field of the Invention

This invention relates to a process for the preparation of D-pantothenic acid and/or salts thereof or mixtures containing these compounds using microorganisms of the Enterobacteriaceae family in which at least the poxB gene is attenuated.

Prior Art

Pantothenic acid is produced worldwide in an order of magnitude of several thousand tons a year. It is used inter alia in human medicine, in the pharmaceuticals industry and in the foodstuffs industry. A large portion of the pantothenic acid produced is used for nutrition of stock animals such as poultry and pigs.

Pantothenic acid can be prepared by chemical synthesis, or biotechnologically by fermentation of suitable microorganisms in suitable nutrient solutions. In the chemical synthesis, D -pantolactone is an important precursor. It is prepared in a multi-stage process from formaldehyde, isobutylaldehyde and cyanide, and in further process steps, the racemic mixture is separated, D- pantolactone is subjected to a condensation reaction with β-alanine, and D-pantothenic acid is obtained in this way.

The typical commercial form is the calcium salt of D- pantothenic acid. The calcium salt of the racemic mixture of D,L-pantothenic acid is also customary.

The advantage of the fermentative preparation by microorganisms lies in the direct formation of the desired stereoisomeric form, that is to say the D-form, which is free from L-pantothenic acid. Various types of bacteria, such as e.g. Escherichia coli (E. coli), Arthrobacter ureafaciens, Corynebacterium erythrogenes , Brevibacterium ammoniagenes , and also yeasts, such as e.g. Debaromyces castellii, can produce D- pantothenic acid in a nutrient solution which comprises glucose, D -pantoic acid and β-alanine, as shown in EP-A 0 493 060. EP-A 0 493 060 furthermore shows that in the case' of E. coli the formation of D-pantothenic acid is improved by amplification of pantothenic acid biosynthesis genes from E. coli which are contained on the plasmids pFV3 and pFV5 in a nutrient solution comprising glucose, DL- pantoic acid and β-alanine.

EP-A 0 590 857 and US Patent 5,518,906 describe mutants derived from E. coli strain IF03547, such as FV5714, FV525, FV814, FV521, FV221, FV6051 and FV5069, which carry resistances to various antimetabolites, such as salicylic acid, α-ketobutyric acid, β-hydroxyaspartic acid, O- methylthreonine and α-ketoisovaleric acid. They produce pantoic acid in a nutrient solution comprising glucose, and D-pantothenic acid in a nutrient solution comprising glucose and β-alanine. It is furthermore stated in EP-A 0 590 857 and US Patent 5,518,906 that after amplification of the pantothenic acid biosynthesis genes panB, panC and panD, which are said to be contained on the plasmid pFV31, in the above-mentioned strains the production of D-pantoic acid in nutrient solutions comprising glucose and the production of D-pantothenic acid in a nutrient solution comprising glucose and β-alanine is improved.

The favorable effect of enhancement of the ilvGM operon on production of D-pantothenic acid is furthermore reported in WO97/10340. Finally, the effect of enhancement of the panE gene on the formation of D-pantothenic acid is reported in EP-A-1001027.

According to the prior art, D-pantothenic acid or the corresponding salt is isolated from the fermentation broth and purified (EP-A-0590857 and W096/33283) and accordingly used in purified form, or the fermentation broth comprising D-pantothenic acid is dried in total (EP-A-1050219) and used in particular as a feedstuffs additive.

Object of the Invention

It is an object of the invention to provide new measures for improved preparation of D-pantothenic acid and salts thereof or salts thereof, and animal feedstuffs additives comprising these compounds .

Summary of the Invention

When D-pantothenic acid or pantothenic acid or pantothenate are mentioned in the following text, this means not only the free acids but also the salts of D-pantothenic acid, such as e.g. the calcium, sodium, ammonium or potassium salt.

The invention provides a process for the preparation of D- pantothenic acid and/or salts thereof using microorganisms of the Enterobacteriaceae family which in particular already produce D-pantothenic acid and in which the nucleotide sequence (s) which code(s) for the poxB gene are attenuated, in particular eliminated.

In particular, the process is a process in which in general the following steps are carried out:

a) fermentation of microorganisms of the Enterobacteriaceae family in which at least the poxB gene is attenuated or switched off, optionally in combination with attenuation or enhancement of further genes;

b) optionally in the presence of alkaline earth metal compounds, these being added continuously or discontinuously in preferably stoichiometric amounts; c) concentration of the D-pantothenic acid or of the corresponding salt in the medium or the fermentation broth or in the cells of the microorganisms of the Enterobacteriaceae family; and

d) after conclusion of the fermentation, isolation of the D-pantothenic acid, and/or of the corresponding salt.

The invention also provides a process in which, after conclusion of the fermentation, the biomass remains in the fermentation broth in an amount of > 0 to 100 %, and the broth obtained in this way is processed, optionally after concentration, to a solid mixture which comprises D- pantothenic acid and/or salts thereof or salts thereof and also comprises further conventional constituents of the fermentation broth (in an amount of > 0 to 100 %) , if these are formed or added.

Detailed Description of the Invention

The term "attenuation" in this connection describes the reduction or elimination of the intracellular activity of one or more enzymes (proteins) in a microorganism which are coded by the corresponding DNA, for example by using a weak promoter or using a gene or allele which codes for a corresponding enzyme (protein) with a low activity or inactivates the corresponding gene or enzyme (protein) , and optionally combining these measures.

By attenuation measures, the activity or concentration of the corresponding protein is in general reduced to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type protein or of the activity or concentration of the protein in the starting microorganism.

The microorganisms which the present invention provides can produce D-pantothenic acid from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. They are representatives of Enterobacteriaceae, in particular of the genus Escherichia. Of the genus Escherichia, the species Escherichia coli is to be mentioned in particular. Within the species Escherichia coli there may be mentioned the so-called K-12 strains, such as e. g. the strains MG1655 or W3110 (Neidhard et al.: Escherichia coli and Salmonella. Cellular and Molecular Biology (ASM Press, Washington D.C.)) or the Escherichia coli wild type strain IF03547 (Institute of Fermentation, Osaka, Japan) and mutants derived from these which have the ability to produce D-pantothenic acid.

Suitable D-pantothenic acid-producing strains of the genus Escherichia, in particular of the species Escherichia coli, are, for example

Escherichia coli FV5069/pFV31

Escherichia coli FV5069/pFV202 Escherichia coli FE6/pFE80 and Escherichia coli KE3

It has been found that Enterobacteriaceae produce D- pantothenic acid in an improved manner after attenuation of the poxB gene, which codes for pyruvate oxidase (EC 1.2.2.2.).

The nucleotide sequence of the poxB gene of Escherichia coli has been published by Grabau and Cronan (Nucleic Acids Research. 14 (13), 5449-5460 (1986)) and can also be found from the genome sequence of Escherichia coli published by Blattner et al. (Science 277, 1453 - 1462 (1997), under ^•Accession Number AE000188.

The poxB genes described in the' text references mentioned can be used according to the invention. Alleles of the poxB gene which result from the degeneracy of the genetic code or due to sense mutations of neutral function can furthermore be used. To achieve an attenuation, for example, expression of the poxB gene or the catalytic properties of the enzyme protein can be reduced or eliminated. The two measures can optionally be combined.

The reduction in gene expression can take place by suitable culturing, by genetic modification (mutation) of the signal structures of gene expression or also by the antisense-RNA technique. Signal structures of gene expression are, for example, repressor genes, activator genes, operators, promoters, attenuators, ribosome binding sites, the start codon and terminators. The expert can find information in this respect, inter alia, for example, in Jensen and Hammer (Biotechnology and Bioengineering 58: 191-195 (1998)), in Carrier and Keasling (Biotechnology Progress 15, 58-64 (1999) , Franch and Gerdes (Current Opinion in Microbiology 3, 159-164 (2000)) and in known textbooks of genetics and molecular biology, such as, for example, the textbook of Knippers ( "Molekulare Genetik [Molecular Genetics]", 6th edition, Georg Thieme Verlag, Stuttgart, Germany, 1995) or that of Winnacker ("Gene und Klone [Genes and Clones]", VCH Verlagsgesellschaft, Weinheim, Germany, 1990) .

Mutations which lead to a change or reduction in the catalytic properties of enzyme proteins are known from the prior art. Examples which may be mentioned are the works of Qiu and Goodman (Journal of Biological Chemistry 272: 8611- 8617 (1997)), Yano et al. (Proceedings of the National Academy of Sciences, USA 95, 5511-5515 (1998), Wente and Schachmann (Journal of Biological Chemistry 266, 20833- 20839 (1991) . Summarizing descriptions can be found in known textbooks of genetics and molecular biology, such as e.g. that by Hagemann ("Allgemeine Genetik [General Genetics]", Gustav Fischer Verlag, Stuttgart, 1986).

Possible mutations are transitions, trans ersions, insertions and deletions . Depending on the effect of the amino acid exchange on the enzyme activity, "missense mutations" or "nonsense mutations" are referred to. Insertions or deletions of at least one base pair in a gene lead to "frame shift mutations", which lead to incorrect amino acids being incorporated or translation being interrupted prematurely. Deletions of several codons typically lead to a complete loss of the enzyme activity. Instructions on generation of such mutations are prior art and can be found in known textbooks of genetics and molecular biology, such as e.g. the textbook by Knippers ( "Molekulare Genetik [Molecular Genetics]", 6th edition, Georg Thieme Verlag, Stuttgart, Germany, 1995) , that by Winnacker ("Gene und Klone [Genes and Clones]", VCH Verlagsgesellschaft, Weinheim, Germany, 1990) or that by Hagemann ( "Allge eine Genetik [General Genetics]", Gustav Fischer Verlag, Stuttgart, 1986) .

Suitable mutations in the poxB gene, such as, for example, deletion mutations , can be incorporated into suitable strains by gene or allele replacement..

A conventional method is the method, described by Hamilton et al. (Journal of Bacteriology 174, 4617 - 4622 (1989)), of gene replacement with the aid of a conditionally replicating pSClOl derivative pMAK705. Other methods described in the prior art, such as, for example, those of Martinez-Morales et al . (Journal of Bacteriology 1999, 7143-7148 (1999)) or those of Boyd et al. (Journal of Bacteriology 182, 842-847 (2000)), can likewise be used.

It is also possible to transfer mutations in the poxB gene or mutations which affect expression of the poxB gene into various strains by conjugation or transduction.

It may furthermore be advantageous for the production of D- pantothenic acid with strains of the Enterobacteriaceae family, in addition to the attenuation of the poxB gene, for one or more preferably endogenous genes chosen from the group consisting of • the ilvGM operon which codes for acetohydroxy-acid synthase II (WO 97/10340)

• the panB gene which codes for ketopantoate hydroxymethyl transferase (US-A-5, 518, 906) ,

• the panE gene which codes for ketopantoate reductase (EP-A-1001027)

• the panD gene which codes for aspartate decarboxylase (US-A-5, 518, 906)

• the panC gene which codes for pantothenate synthetase (US-A-5, 518, 906)

• the serC gene which codes for phosphoserine transaminase (Duncan and Coggins , Biochemical Journal 234:49-57 (1986)),

• the gcvT, gcvH and gcvP genes which code for the glycine cleavage system (Okamura-Ikeda et al., European Journal of Biochemistry 216, 539-548 (1993))., and

• the glyA gene which codes for serine hydroxymethyl transferase (Plamann et al (Nucleic Acids Research 11(7) -.2065 -2075(1983)))

to be enhanced, in particular over-expressed.

The term "enhancement" in this connection describes the increase in the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, using a potent promoter or a gene or allele which codes for a corresponding enzyme or protein with a high activity, and optionally combining these measures .

By enhancement measures, in particular over-expression, the activity or concentration of the corresponding protein is in general increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on that of the wild-type protein or the activity or concentration of the protein in the starting microorganism.

The incorporation of a mutation which causes resistance to L-valine (J. H. Miller, A Short Course in Bacterial Genetics, A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria Cold Spring Harbor Laboratory Press, USA, 1992) into microorganisms of the

Enterobacteriaceae family which produce pantothenic acid is also favorable for pantothenic acid production.

Finally, it may be advantageous for the production of D- pantothenic acid with strains of the Enterobacteriaceae family, to have further genes in addition to the attenuation of the poxB gene, for preferably endogenous ones, such as, for example

• the avtA gene which codes for transaminase C (EP-A- 1001027) and

• the pckA gene which codes for PEP carboxykinase (Medina et al., Journal of Bacteriology 172, 7151-7156 (1990))

be attenuated, in particular eliminated or expressed at a low level.

In addition to the attenuation of the poxB gene it may furthermore be advantageous for the production of D- pantothenic acid to eliminate undesirable side reactions (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982) . Bacteria in which the metabolic pathways which reduce the formation of D-pantothenic acid are at least partly eliminated can be employed in the process according to the invention. The microorganisms produced according to the invention can be cultured in the batch process (batch culture) , the fed batch (feed process) or the repeated fed batch process (repetitive feed process) . A summary of known culture methods is described in the textbook by Chmiel (Bioprozesstechnik 1. Einfϋhrung in die

Bioverfahrenstechnik [Bioprocess Technology 1. Introduction to Bioprocess Technology (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and Peripheral

Equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).

The culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook "Manual of Methods for General

Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981). Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g.' palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substance can be used individually or as a mixture.

Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen. The sources of nitrogen can be used individually or as a mixture.

Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium- containing salts can be used as the source of phosphorus. The culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances, such as amino acids and vitamins, can be employed in addition to the above-mentioned substances . Precursors of pantothenic acid, such as aspartate, β- alanine, ketoisovalerate, ketopantoic acid or pantoic acid and optionally salts thereof, can moreover be added to the culture medium. The starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture in a suitable manner.

Basic compounds, such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds, such as phosphoric acid or sulfuric acid, can be employed in a suitable manner to control the pH of the culture.

For the preparation of alkaline earth metal salts of pantothenic acid, in particular the calcium salt, it is equally possible to add the suspension or solution of an inorganic compound containing an alkaline earth metal, such as, for example, calcium hydroxide, or of an organic compound, such as the alkaline earth metal salt of an organic acid, for example calcium acetate, continuously or discontinuously during the fermentation. In this manner, the cation necessary for preparation of the desired alkaline earth metal salt of D-pantothenic acid is introduced into the fermentation broth directly in the desired amount, preferably in stoichiometric amounts.

Antifoams, such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam. Suitable substances having a selective action, e.g. antibiotics, can be added to the medium to maintain the stability of plasmids. To maintain aerobic conditions, oxygen or oxygen- containing gas mixtures, such as e.g. air, are introduced into the culture. The temperature of the culture is usually 25²C to 45^δC, and preferably 30²C to 40^aC. Culturing is continued until a maximum of D-pantothenic acid has formed. This target is usually reached within 10 hours to 160 hours.

The D-pantothenic acid or the corresponding salts of D- pantothenic acid contained in the fermentation broth can then be isolated and purified in accordance with the prior art.

It is also possible for the fermentation broths comprising D-pantothenic acid and salts thereof or salts thereof preferably first to be freed from all or some of the biomass by known separation methods, such as, for example, centrifugation, filtration, decanting or a combination thereof. However, it is also possible to leave the biomass in its entirety in the fermentation broth. In general, the suspension or solution is preferably concentrated and worked up to a powder, for example with the aid of a spray dryer or a freeze-drying unit. This powder is then in general converted by suitable compacting or granulating processes, for example build-up granulation, into a coarser-grained, free-flowing, storable and largely dust- free product with the^" desired particle size distribution of 20 to 2000 μm, in particular 100 to 1400 μm. In the conversion of the fermentation broth and its constituents into the solid phase it is advantageous to employ conventional organic or inorganic auxiliary substances or carriers, such as starch, gelatin, cellulose derivatives or similar substances, such as are conventionally used as binders, gelling agents or thickeners in foodstuffs or feedstuffs processing, or further substances, such as, for example, silicas, silicates or stearates .

Alternatively, the fermentation product, with or without further conventional fermentation constituents, can be absorbed on to an organic or inorganic carrier substance which is known and conventional in feedstuffs processing, such as, for example, silicas, silicates, grits, brans, meals, starches, sugars or others, and/or stabilized with conventional thickeners or binders . Use examples and processes in this context are described in the literature (Die Mϋhle + Mischfuttertechnik 132 (1995) 49, page 817).

D-Pantothenic acid and/or the desired salt of D-pantothenic acid or a formulation comprising these compounds, is optionally added at a suitable process stage in order to achieve or establish the desired content of pantothenic acid and/or the desired salt in the end product.

The desired total content of pantothenic acid and/or salt thereof is in general in the range from 20 to 80 wt.% (dry weight) .

The concentration of pantothenic acid can be determined with known chemical (Velisek; Chromatographic Science.60, 515-560 (1992)) or microbiological methods, such as e.g. the Lactobacillus plantaru test (DIFCO MANUAL, 10^th Edition, p. 1100-1102; Michigan, USA).

A pure culture of the Escherichia coli K-12 strain DH5α/pMAK705 was deposited as DSM 13720 on 12th September 2000 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty.

A pure culture of the Escherichia coli K-12 strain MG442ΔpoxB was deposited as DSM 13762 on 2nd October 2000 at the Deutsche Sammlung fϋr Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty.

The present invention is explained in more detail in the following with the aid of embodiment examples . The isolation of plasmid DNA from Escherichia coli and all techniques of restriction, Klenow and alkaline phosphatase treatment are carried out by the method of Sambrook et al . (Molecular cloning - A laboratory manual (1989) Cold Spring Harbor Laboratory Press) . Unless described otherwise, the transformation of Escherichia coli is carried out by the method of Chung et al. (Proceedings of the National Academy of Sciences of the United States of America USA (1989) 86: 2172-2175) .

The incubation temperature for the preparation of strains and transformants is 37^SC. Temperatures of 30^fiC and 44^SC are used in the gene replacement method of Hamilton et. al.

Example 1

Construction of the deletion mutation of the poxB gene

Parts of the 5 ' and 3 ' region of the poxB gene are amplified from Escherichia coli K12 using the polymerase chain reaction (PCR) and synthetic oligonucleotides. Starting from the nucleotide sequence of the poxB gene in E. coli K12 MG1655 (SEQ ID No. 1), the following PCR primers are synthesized (MWG Biotech, Ebersberg, Germany) :

poxB'5'-l: 5^X - CTGAACGGTCTTAGTGACAG - 3 * (SEQ ID No. 3)

poxB'5'-2: 5^X - AGGCCTGGAATAACGCAGCAGTTG - 3 ' (SEQ ID No. 4)

poxB'3'-l: 5^λ - CTGCGTGCATTGCTTCCATTG - 3^X(SEQ ID No. 5)

poxB'3'-2: 5^Λ - GCCAGTTCGATCACTTCATCAC - 3 (SEQ ID No. 6)

The chromosomal E. coli K12 MG1655 DNA employed for the PCR is isolated according to the manufacturers instructions with "Qiagen Genomic-tips 100/G" (QIAGEN, Hilden, Germany) . A DNA fragment approx. 500 base pairs (bp) in size from the 5' region of the poxB gene (called poxBl) and a DNA fragment approx. 750 bp in size from the 3' region of the poxB gene (called poxB2) can be amplified with the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) with Taq-DNA polymerase (Gibco-BRL, Eggenstein, Germany) . The PCR products are each ligated with the vector pCR2.lTOPO (TOPO TA Cloning Kit,

Invitrogen, Groningen, The Netherlands) in accordance with 'the manufacturers instructions and transformed into the E. coli strain TOP10F¹.

Selection of plasmid-carrying cells takes place on LB agar, to which 50 μg/ml ampicillin are added. After isolation of the plasmid DNA, the vector pCR2. lTOPOpoxBl is cleaved with the restriction enzymes Ecll36ll and Xbal and, after separation in 0.8% agarose gel, the poxBl fragment is isolated with the aid of the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany) . After isolation of the plasmid DNA the vector pCR2. lTOPOpoxB2 is cleaved with the enzymes EcoRV and Xbal and ligated with the poxBl fragment isolated. The E. coli strain DH5α is transformed with the ligation batch and plasmid-carrying cells are selected on LB agar, to which 50 μg/ml ampicillin is added. After isolation of the plasmid DNA those plasmid in which the mutagenic DNA sequence shown in SEQ ID No. 7 is cloned are detected by control cleavage with the enzymes Spel and Xbal. One of the plasmids is called pCR2. lTOPOΔpoxB.

Example 2

Construction of the replacement vector pMAK705ΔpoxB

The poxB allele described in Example 1 is isolated from the vector pCR2.lTOPOΔpoxB after restriction with the enzymes HindiII and Xbal and separation in 0.8% agarose gel, and ligated with the. plasmid pMAK705 (Hamilton et al. (1989) Journal of Bacteriology 174, 4617 - 4622), which has been digested with the enzymes HindiII and Xbal. The ligation batch is transformed in DH5 and plasmid-carrying cells are selected on LB agar, to which 20 μg/ml chloramphenicol are added. Successful cloning is demonstrated after isolation of the plasmid DNA and cleavage with the enzymes Hindlll and Xbal. The replacement vector formed, pMAK705ΔpoxB (= pMAK705deltapoxB) , is shown in Figure 1.

Example 3

Position-specific mutagenesis of the poxB gene in the E. coli strain MG442

The L-threonine-producing E. coli strain MG442 is described in the patent specification US-A- 4,278,765 and deposited as CMIM B-1628 at the Russian National Collection for Industrial Microorganisms (VKPM, Moscow, Russia) .

For replacement of the chromosomal poxB gene with the plasmid-coded deletion construct, MG442 is transformed with the plasmid pMAK705ΔpoxB, The gene replacement is carried out by the selection method described by Hamilton et al . (1989) Journal of Bacteriology 174, 4617 - 4622) and is verified by standard PCR methods (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) with the following oligonucleotide primers:

pOxB'5'-l: 5^λ - CTGAACGGTCTTAGTGACAG - 3 '_.(SEQ ID No . 3).

poxB'3'-2: 5^λ - GCCAGTTCGATCACTTCATCAC -3^λ(SEQ ID No. 6)

After replacement has taken place, MG442 contains the form of the ΔpoxB allele shown in SEQ ID No. 8. The strain obtained is called MG442ΔpoxB. Example 4

Preparation of ,D-pantothenic acid with the strain MG442ΔpoxB/pFV31i1vGM

4.1 Amplification and cloning of the ilvGM gene

The ilvGM operon from Escherichia coli IF03547 which codes for acetohydroxy acid synthase II (Institut fur Fermentation [Institute of Fermentation] , Osaka, Japan) is amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides. Starting from the nucleotide sequence of the ilvGM operon in E. coli K12 MG1655 (GenBank: Accession No. M87049) , PCR primers are synthesized, (MWG Biotech, Ebersberg, Germany) . The sequence of the primer ilvGMl is chosen such that it contains an adenine at position 8. As a result, a modified ribosome binding site is generated 7 nucleotides upstream of the start codon of the ilvG protein.

IlvGMl: 5 - CAGGACGAGGAACTAACTATG - 3^λ(SEQ ID No. 9)

IlvGM2: 5^Λ - TCACGATGGCGGAATACAAC - 3 ' (SEQ ID No . 10)

The chromosomal E. coli IF03547 DNA employed for the PCR is isolated according to the manufacturers instructions with "QIAGEN Genomic-tips 100/G" (QIAGEN, Hilden, Germany) . A DNA fragment approx. 2100 bp in size, which comprises the modified ribosome binding site, the ilvGM coding regions and approx. 180 bp 3 '-flanking sequences, can be amplified with the specific primers under standard PCR conditions (Innis et al.: PCR protocols. A guide to methods and applications, 1990, Academic Press) with Pfu-DNA polymerase (Promega Corporation, Madison, USA) . The PCR product is cloned in the plasmid pCR-Bluntll-TOPO and transformed in the E. coli strain TOP10 (Invitrogen, Groningen, The Netherlands, Product Description Zero Blunt TOPO PCR Cloning Kit, Cat. No. K2800-20) . Successful cloning is demonstrated by cleavage of the plasmid pCR- BluntIF03547ilvGM with the restriction enzymes EcoRI and Sphl. For this, the plasmid DNA is isolated by means of the "QIAprep Spin Plasmid Kit" (QIAGEN, Hilden, Germany) and, after cleavage, separated in a 0.8 % agarose gel. The DNA sequence of the amplified fragment is determined using the reverse and universal sequencing primer (QIAGEN, Hilden, Germany) . The sequence of the PCR product is shown in SEQ ID No. 11 and 13. The ilvG gene or allele is identified in SEQ ID No. 11. The ilvM gene or allele is identified in SEQ ID No. 13. The associated gene products or proteins are shown in SEQ ID No. 12 and 14.

4.2 Cloning of the ilvGM gene in the expression vector pTrc99A

The ilvGM genes described in Example 4.1 are cloned in the vector pTrc99A (Amersham Pharmacia Biotech Inc, Uppsala, Sweden) for expression in Escherichia coli K12. For this, the plasmid pCR-BluntIF03547ilvGM is cleaved with the enzyme EcoRI, the cleavage batch is separated in 0.8% agarose gel and the ilvGM fragment 2.1 kbp in size is isolated with the aid of the QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany) . The vector pTrc99A is cleaved with the enzyme EcoRI, an alkaline phosphatase treatment is carried out, and ligation is carried out with the ilvGM fragment isolated. The ligation batch is transformed in the E. coli strain DH5ά. Selection of pTrc99A-carrying cells is carried out on LB agar (Lennox, Virology 1:190 (1955)), to which 50μg/ml ampicillin is added. Successful cloning of the ilvGM operon can be demonstrated after plasmid DNA isolation and control cleavage with Sail and Sphl. In the vector, which is called pTrc99AilvGM (Figure 2), expression of the ilvGM operon is regulated by the Ptrc promoter lying upstream of the modified ribosome binding site and by the rRNA terminator region lying downstream of the ilvGM coding region. 4.3 Construction of the vector pFV31ilvGM

The E. coli strain FV5069/pFV31 which produces D- pantothenic acid is described in EP-A-0590857 and deposited as FERM BP 4395 in accordance with the Budapest Treaty. The plasmid pFV31 is isolated from FV5069/pFV31, cleaved with the enzyme BamHI, and the projecting 3' ends are treated with Klenow enzyme. An alkaline phosphatase treatment is then carried out. From the vector pTrc99AilvGM described in Example.4.2, after restriction with the enzyme Sspl and separation of the cleavage batch in 0.8% agarose gel, the ilvGM expression cassette 2.8 kbp in size is isolated and ligated with the linearized and dephosphorylated vector pFV31. The ligation batch is transformed in the E. coli strain DH5α and plasmid-carrying cells are selected on LB agar, to which 50μg/ml ampicillin are added. Successful cloning of the ilvGM expression cassette can be demonstrated after plasmid DNA isolation and control cleavage with Hindlll, Sail, Smal, Sphl and Xbal. The plasmid is called pFV31ilvGM (Figure 3) .

4.4 Preparation of the strain MG442ΔpckA/pFV31ilvGM

The strain MG442ΔpoxB obtained -in Example 3 and the strain MG442 are transformed with the plasmid pFV31ilvGM and transformants are selected on LB agar, which is supplemented with 50 μg/ml ampicillin. The strains MG442ΔpoxB/pFV31ilvGM and MG442/ρFV31ilvGM are formed in this manner.

4.5 Preparation of D-pantothenic acid with the strain MG442ΔpoxB/pFV31ilvGM

The pantothenate production of the E. coli strains MG442/pFV31ilvGM and MG442ΔpoxB/pFV31ilvGM is checked in batch cultures of 10 ml contained in 100 ml conical flasks . For this, 10 ml of preculture medium of the following composition: 2 g/1 yeast extract, 10 g/1 (NH)₂S0₄, 1 g/1 KH₂P0₄, 0.5 g/1 MgS0₄*7H₂0, 15 g/1 CaC0₃, 20/1 glucose, 50 μg/ml ampicillin, are inoculated with an individual colony and incubated for 20 hours at 33²C and 200 rpm on an ESR incubator from Kύhner AG (Birsfelden, Switzerland) . In each case 200 μl of this preculture are transinoculated into 10 ml of production medium (25 g/1 (NH₄)₂S0₄, 2 g/1 KH₂P0₄, 1 g/1 MgS0₄*7H₂0, 0.03 g/1 FeS0₄*7H₂0, 0.018 g/1 MhS0₄*lH₂0, 30 g/1 CaC0₃, 20 g/1 glucose, 20 g/1 β-alanine, 250 mg/1 thiamine) and the batch is incubated for 48 hours at 37 ^aC and 200 rpm. After the incubation the optical density (OD) of the culture suspension is determined with an LP2W photometer from Dr. Lange (Dusseldorf, Germany) at a measurement wavelength of 660 nm.

The concentration of D-pantothenate formed in the sterile- filtered culture supernatant is then determined by means of the Lactobacillus plantarum ATCC8014 pantothenate assay in accordance with the instructions of DIFCO (DIFGO MANUAL, 10^th Edition, p. 1100-1102; Michigan, USA). D(+)- Pantothenic acid' calcium salt hydrate (catalogue number 25,972-1, Sigma-Aldrich, Deisenhofen, Germany) is used for the calibration.

The result of the experiment is shown in Table 1.

Table 1

Brief Description of the Figures:

• Figure 1: pMAK705ΔpoxB ( = pMAK705deltapoxB) • Figure 2: pTrc99AilvGM

• Figure 3: pFV31ilvGM

The length data are to be understood as approx. data. The abbreviations and designations used have the following meaning:

cat: Chloramphenicol resistance gene

rep-ts : Temperature-sensitive replication region of the plasmid pSClOl

poxBl : Part of the 5 ' region of the poxB gene

poxB2 : Part of the 3 ' region of the poxB gene

Amp: Ampicillin resistance gene

lad: Gene for the repressor protein of the trc promoter

Ptrc: trc promoter region, IPTG-inducible

ilvG: Coding region of the large subunit of acetohydroxy acid synthase II

ilvM: Coding region of the small subunit of acetohydroxy acid synthase II

5S: 5S rRNA region

rrnBT: rRNA terminator region

panB: Coding region of the panB gene

panC: Coding region of the panC gene

The abbreviations for the restriction enzymes have the following meaning • BamHI: Restriction endonuclease from Bacillus amyloliquefaciens

• Bglll: Restriction endonuclease from Bacillus globigii

• Clal: Restriction endonuclease from Caryphanon latum

• EcoRI: Restriction endonuclease from Escherichia coli

• EcoRV: Restriction endonuclease from Escherichia coli

• Hindlll: Restriction endonuclease from Haemophilus influenzae

• Kpnl: Restriction endonuclease from Klebsiella pneumoniae

• Pstl : Restriction endonuclease from Providencia stuartii

• Pvul: Restriction endonuclease from Proteus vulgaris

• Sad: Restriction endonuclease from Streptomyces achromogenes

• Sail: Restriction endonuclease from Streptomyces albus

• Smal: Restriction endonuclease from Serratia marcescens

• Sphl : Restriction endonuclease from Streptomyces phaeochromogenes

• Sspl: Restriction endonuclease from Sphaerotilus species

• Xbal: Restriction endonuclease from Xanthomonas badrii

• Xhol : Restriction endonuclease from Xanthomonas holcicola FOR THE PURPOSE 23 ROCEDURE

INTERN- _

Degussa-Hύls AG Kantstr. 2

33790 Halle

RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page

I. IDENTIFICAΗON OF THE MICROORGANISM

Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY: MG 42ΔpoxB

DSM 13762

H. SCIENTIFIC DESCRIFπON AND/OR PROPOSED TAXONOMIC DESIGNATION

The microorganism identified under I. above was accompanied by:

(X ) a scientific description

(X ) a proposed taxonomic designation

(Mark with a cross where applicable).

in. RECEIPT AND ACCEPTANCE

This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2000 - 10 - 02 (Date of the original deposit)¹.

IV. RECEIPT OF REQUEST FOR CONVERSION

The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).

V. INTERNATIONAL DEPOSITARY AUTHORITY

Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the

MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized officials):

Address: Mascheroder Weg lb D-38124 Braunschweig

Date: 2000 - 10 - 06

Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired. FOR THE PURPOSES 24 tOCEDURE

INTERNA

Degussa-Hύls AG Kantstr. 2

33790 Halle

VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNAΉONAL DEPOSITARY AUTHORITY identified at the bottom of this page

¹ Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new depoi date of the transfer). ^J In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test

³ Mark with a cross the applicable box.

⁴ Fill in if the information has been requested and if the results of the test were negative.

Form DSMZ-BP/9 (sole page) 0196 INTERN

Degussa-Hύls AG Kantstr. 2 33790 Halle

RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the

INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page

I. IDENTIFICAΗON OF THE MICROORGANISM

Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY: DH5α/pMAK705

DSM 13720

H. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION

The microorganism identified under I. above was accompanied by:

(X ) a scientific description

(X ) a proposed taxonomic designation

(Mark with a cross where applicable).

HI. RECEIPT AND ACCEPTANCE

This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2000 - 09 - 08 (Date of the original deposit)¹.

rV. RECEIPT OF REQUEST FOR CONVERSION

V. INTERNAΉONAL DEPOSITARY AUTHORITY

MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official (s):

\ddress: Mascheroder Weg lb D-38124 Braunschweig

Date: 2000 - 09-12

Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired. run. -Hi. PURfυ, 26 PROCEDURE

INTEF tM

Degussa-Hύls AG Kantstr. 2 33790 Halle

I. DEPOSITOR π. IDENΉFICAΉON OF THE MICROORGANISM

Name: Degussa-Hύls AG Accession number given by the Kantstr . 2 INTERNAΗONAL DEPOSITARY AUTHORITY:

Address: 33790 Halle DSM 13720

Date of the deposit or the transfer': 2000 - 09 - 08

in. VTABΠJΠΎ STATEMENT

The viability of the microorganism identified under II above was tested on 2000 - 09 - 08 ² . On that date, the said microorganism was

(X)³ viable

( )³ no longer viable iv. CONDΓΠONS UNDER WHICH THE VIABILΠΎ TEST HAS BEEN PERFORMED⁴

v. INTERNAΉONAL DEPOSITARY AUTHORITY

Address: Mascheroder Weg lb D-38124 Braunschweig

Date: 2000 - 09 - 12

¹ Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new depi date of the transfer).

² In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test

³ Mark with a cross the applicable box.

Form DSMZ-BP/9 (sole page) 0196

Claims

What is claimed is:

1. Process for the preparation of D-pantothenic acid and salts thereof or feedstuffs additives comprising this/these compound(s) by fermentation of microorganisms of the Enterobacteriaceae family, in particular those which already produce D-pantothenic acid, in which at least the nucleotide sequence (s) which code(s) for the poxB gene is/are attenuated, in particular eliminated, under conditions which are suitable for attenuation or elimination of the intracellular activity of pyruvate oxidase.

2. Process according to claim 1, in which

a) the D-pantothenic acid and/or salts thereof are concentrated in the fermentation broth or in the cells of the microorganisms, and

b) after the end of the fermentation the desired product (s) is/are isolated, the biomass and/or further constituents of the fermentation broth being separated off in an amount of > 0 to 100 %.

- 3. Process according to claim 1, wherein the fermentation is carried out in the presence of alkaline earth metal salts, these being added continuously or discontinuously in stoichiometric amounts in particular, and a product comprising alkaline earth metal salts of D-pantothenic acid or consisting of these being obtained.

4. Process according to claim 1, wherein the microorganisms of the Enterobacteriaceae family belong to the genus Escherichia.

5. Process according to claim 4, wherein the microorganisms originate from the genus Escherichia, in particular the species Escherichia coli.

. Process according to claim 1, wherein in addition to the attenuation of the poxB gene, one or more of the genes, in particular endogenous genes, chosen from the group consisting of the following is or are enhanced, in particular over-expressed:

6.1 the ilvGM operon which codes for acetohydroxy-acid synthase II,

6.2 the panB gene which codes for ketopantoate hydroxymethyltransferase,

6.3 the panE gene which codes for ketopantoate reductase,

6.4 the panD gene which codes for aspartate decarboxylase,

6.5 the panC gene which codes for pantothenate synthetase,

6.6 the serC gene which codes for phosphoserine transaminase,

6.7 individually or together, the genes gcvT, gcvH and gcvP which code for the glycine cleavage system,

6.8 the glyA gene which codes for serine hydroxymethyltransferase.

7. Process according to claim 1, wherein bacteria are employed in which the metabolic pathways which reduce the formation of D-pantothenic acid are at least partly eliminated, in particular the

7.1 avtA gene which codes for transaminase C, and

7.2 the pckA gene which codes for PEP carboxykinase.

8. Process according^' to claim 1, wherein Bacteria which have a resistance to -valine are employed.

9. Process according to claim 1, wherein the expression of the polynucleotide(s) which code(s) for the poxB gene is attenuated, in particular eliminated.

10. Process for the preparation of feedstuffs additives comprising D-pantothenic acid and/or salts thereof, according to claim 1, wherein

a) optionally all or some of the biomass and/or a portion of the constituents are separated off from a fermentation broth which is obtained by fermentation and comprises pantothenic acid and/or salts thereof,

b) the mixture obtained in this way is optionally concentrated (concentration) , and

c) the feedstuffs additive comprising the pantothenic acid and/or the pantothenate is converted into finely divided powder by known measures, and

d) a free-flowing animal feedstuffs additive with a particle size distribution of 20 to 2000 μ , in particular 100 to 1400 μm, is obtained therefrom by suitable measures.

11. Process for the preparation of animal feedstuffs additives according to claim 10 with a content of D- pantothenic acid and/or salts thereof, chosen from the group consisting of the magnesium or calcium salt, from fermentation broths, the process comprising the steps of

a) optionally removal of water from the fermentation broth (concentration) ;

b) removal of an amount of > 0 to 100% of the biomass formed during the fermentation; c) optionally addition of one or more of the compounds mentioned to the fermentation broths obtained according to a) or b) , the amount of compounds added being such that the total concentration thereof in the animal feedstuffs additive is in the range from about 20 to 80 wt.% (dry weight); and

d) obtaining of the animal feedstuffs additive in the desired powder or, preferably, granule form.

12.. Process according to claim 10, wherein an animal feedstuffs additive in the desired particle size is obtained from the fermentation broth, optionally after addition of D-pantothenic acid and/or salts thereof and optionally after addition of organic and inorganic auxiliaries, by

a) drying and compacting, or

b) spray drying, or

c) spray drying and granulation, or

d) spray drying and build-up granulation.

13. Process according to claim 12 , wherein the fermentation broth is applied to the inorganic auxiliary, optionally after removal of the biomass in an amount of > 0 to 100 %, and an animal feedstuff is obtained in the desired particle size.

14. Microorganisms of the Enterobacteriaceae family which produce pantothenic acid and in which the poxB gene is present in attenuated form.

15. Microorganisms of the Enterobacteriaceae family which contain, upstream of the ilGM operon, a ribosome binding site (RBS) , shown in SEQ ID No. 11.