WO2003025002A2 - Methode et compositions a base de proteines de fusion a antigene-defensine et de proteines de fusion a antigene-chimiokine utilisees comme vaccins contre les tumeurs et les infections virales - Google Patents

Methode et compositions a base de proteines de fusion a antigene-defensine et de proteines de fusion a antigene-chimiokine utilisees comme vaccins contre les tumeurs et les infections virales Download PDF

Info

Publication number
WO2003025002A2
WO2003025002A2 PCT/US2001/043830 US0143830W WO03025002A2 WO 2003025002 A2 WO2003025002 A2 WO 2003025002A2 US 0143830 W US0143830 W US 0143830W WO 03025002 A2 WO03025002 A2 WO 03025002A2
Authority
WO
WIPO (PCT)
Prior art keywords
subject
defensin
cell
tumor
nucleic acid
Prior art date
Application number
PCT/US2001/043830
Other languages
English (en)
Other versions
WO2003025002A3 (fr
Inventor
Arya Biragyn
Larry W. Kwak
Original Assignee
The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2001/029074 external-priority patent/WO2002022686A2/fr
Application filed by The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services filed Critical The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority to AU2002217820A priority Critical patent/AU2002217820A1/en
Publication of WO2003025002A2 publication Critical patent/WO2003025002A2/fr
Publication of WO2003025002A3 publication Critical patent/WO2003025002A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/21—Retroviridae, e.g. equine infectious anemia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/646—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the entire peptide or protein drug conjugate elicits an immune response, e.g. conjugate vaccines
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4723—Cationic antimicrobial peptides, e.g. defensins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines
    • C07K14/523—Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1, LDCF-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/48—Blood cells, e.g. leukemia or lymphoma
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to a vaccine for increasing the immunogenicity of a tumor antigen thus allowing treatment of cancer, as well as a vaccine that increases the immunogenicity of a viral antigen, thus allowing treatment of viral infection, including immunodeficiency virus (HIV) infection.
  • the present invention provides a fusion protein comprising a defensin or a chemokine fused to either a tumor antigen or viral antigen which is administered as either a protein or nucleic acid vaccine to elicit an immune response effective in treating cancer or effective in treating or preventing viral infection.
  • Tumor cells are known to express tumor-specific antigens on the cell surface. These antigens are believed to be poorly immunogenic, largely because they represent gene products of oncogenes or other cellular genes which are normally present in the host and are therefore not clearly recognized as nonself. Although numerous investigators have tried to target immune responses against epitopes from various tumor specific antigens, none have been successful in eliciting adequate tumor immunity in vivo (71). Humans are particularly vulnerable to cancer as a result of an ineffective immunogenic response (72). In fact, the poor immunogenicity of relevant cancer antigens has proven to be the single greatest obstacle to successful immunotherapy with tumor vaccines (73).
  • tumor cell antigens Over the past 30 years, literally thousands of patients have been administered tumor cell antigens as vaccine preparations, but the results of these trials have demonstrated that tumor cell immunization has failed to provide a rational basis for the design or construction of effective vaccines. Even where patients express tumor-specific antibodies or cytotoxic T-cells, this immune response does not correlate with a suppression of the associated disease. This failure of the immune system to protect the host may be due to expression of tumor antigens that are poorly immunogenic or to heterologous expression of specific antigens by various tumor cells. The appropriate presentation of tumor antigens in order to elicit an immune response effective in inhibiting tumor growth remains a central issue in the development of an effective cancer vaccine.
  • Anti-microbial peptides such as defensins have been identified as key elements in the innate immunity against infection. Originally identified on the basis of their antimicrobial activity, defensins are expressed within tissues and cells that frequently encounter microorganisms, and are divided into the alpha- and beta- defensin subfamilies, distinguished by cysteine residue pairing. Defensins have been suggested to play a role also in inflammation, wound repair, and regulation of the specific immune response. They induce expression of cytokines and chemokines, production of histamine and modulation of antibody responses, and they have been found to be associated with HLA-DR molecules and with lipoprotein (a) (130).
  • Chemokines are a group of usually small secreted proteins (7-15 kDa) induced by inflammatory stimuli and are involved in orchestrating the selective migration, diapedesis and activation of blood-born leukocytes that mediate the inflammatory response (23,26). Chemokines mediate their function through interaction with specific cell surface receptor proteins (23). At least four chemokine subfamilies have been identified as defined by a cysteine signature motif, termed CC, CXC, C and CX 3 C, where C is a cysteine and X is any amino acid residue.
  • Monocyte chemotactic protein-3 (MCP-3) is a potent chemoattractant of monocytes and dendritic cells, T lymphocytes, basophils and eosinophils (10, 23, 26, 37).
  • tumor antigens which are known to be poorly immunogenic, "self” antigens to a subject's immune system in a manner that elicits an immune response powerful enough to inhibit the growth of tumor cells in the subject.
  • This invention overcomes the previous limitations and shortcomings in the art by providing a fusion protein comprising a defensin and a tumor antigen or a chemokine and tumor antigen which can produce an in vivo immune response, resulting in the inhibition of tumor cells.
  • a method of presenting poorly antigenic viral antigens to a subject's immune system particularly as relates to viral antigens such as HTV antigens.
  • This invention also overcomes previous shortcomings in the field of viral vaccine development by providing a fusion protein comprising a defensin and a viral antigen or a chemokine and a viral antigen which is effective as a vaccine for treating or preventing viral infection.
  • the present invention provides a fusion polypeptide comprising a defensin and a tumor antigen.
  • the tumor antigen can be a B cell tumor antigen or MUC-1.
  • the defensin of this invention can be an alpha defensin ( ⁇ -def) such as human neutrophil peptide-1 (HNP-1), human neutrophil peptide-2 (HNP-2), and/or human neutrophil peptide-3 (HNP-3) (128), and/or a beta defensin ( ⁇ -def), such as human ⁇ -defensin-1 (HBD1), human ⁇ -defensin-2 (HBD2) (129), murine ⁇ -defensin-2 (Def2) and or murine ⁇ -defensin-3 (Def3).
  • ⁇ -def alpha defensin
  • HNP-1 human neutrophil peptide-1
  • HNP-2 human neutrophil peptide-2
  • HNP-3 human neutrophil peptide-3
  • the present invention also provides a fusion polypeptide comprising a defensin and a viral antigen.
  • the defensin can be an alpha defensin (oc-def) such as human neutrophil peptide-1 (HNP-1), human neutrophil peptide-2 (HNP-2), and/or human neutrophil peptide-3 (HNP-3) (128), and/or a beta defensin ( ⁇ -def), such as human ⁇ -defensin-1 (HBD1), human ⁇ -defensin-2 (HBD2) (129), Def2, and/or Def3, and the viral antigen can, for example, be an HTV antigen, such as gpl20, gpl60, gp41, an active fragment of gpl20, an active fragment of gpl60 and/or an active fragment of gp41.
  • HNP-1 human neutrophil peptide-1
  • HNP-2 human neutrophil peptide-2
  • HNP-3 human
  • the present invention provides a method of producing an immune response in a subject, comprising administering to the subject any of the fusion polypeptides of this invention, comprising a defensin and viral antigen, or a defensin and a tumor antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • Also provided is a method of treating a cancer in a subject comprising adminstering to the subject any of the fusion polypeptides of this invention, comprising a defensin and a tumor antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • the invention also provides a method of treating or preventing a viral infection in a subject, comprising administering to the subject any of the fusion polypeptides of this invention, comprising a defensin and a viral antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a method of treating or preventing HTV infection in a subject comprising administering to the subject any of the fusion polypeptides of this invention, comprising a defensin and a human immunodeficiency virus (HTV) antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • HTV human immunodeficiency virus
  • a method of treating a B cell tumor in a subject comprising administering to the subject any of the fusion polypeptides of this invention, comprising a defensin and a B cell tumor antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • the present invention additionally provides a fusion polypeptide comprising a chemokine and a tumor antigen.
  • the tumor antigen can be a B cell tumor antigen or MUC-1.
  • the chemokine of this invention can be macrophage- inflammatory protein 3cc (MD?-3 ⁇ ), macrophage-inflammatory protein 3 ⁇ (MIP-3 ⁇ ), interferon-induced protein 10, monocyte chemotactic protein-3, monocyte chemotactic protein-2, monocyte chemotactic protein-1, monocyte chemotactic protein-4, macrophage inflammatory protein 1, RANTES, SDF-1, MIG and macrophage-derived chemokine, as well as any other chemokine now known or later identified.
  • the chemokine of this invention can be from any mammal that produces chemokines and in a preferred embodiment is a human chemokine.
  • the present invention also provides a fusion polypeptide comprising a chemokine and a viral antigen.
  • the chemokine can be macrophage- inflammatory protein 3 ⁇ (MIP-3c ) or macrophage-inflammatory protein 3 ⁇ (MIP-3 ⁇ )
  • the viral antigen can, for example, be an HTV antigen, such as gpl20, gpl60, gp41, an active fragment of gpl20, an active fragment of gpl60 and/or an active fragment of gp41.
  • the present invention provides a method of producing an immune response in a subject, comprising administering to the subject any of the fusion polypeptides of this invention, comprising a chemokine (e.g., MTP-3 ⁇ ) and a viral antigen, or a chemokine and a tumor antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a chemokine e.g., MTP-3 ⁇
  • a viral antigen e.g., MTP-3 ⁇
  • chemokine and a tumor antigen either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a method of treating a cancer in a subject comprising adminstering to the subject any of the fusion polypeptides of this invention, comprising a chemokine (e.g., MTP-3 ) and a tumor antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a chemokine e.g., MTP-3
  • a tumor antigen either as a protein or a nucleic acid encoding the fusion polypeptide.
  • the invention also provides a method of treating or preventing a viral infection in a subject, comprising administering to the subject any of the fusion polypeptides of this invention, comprising a chemokine (e.g., MIP-3 ) and a viral antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a chemokine e.g., MIP-3
  • a viral antigen either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a method of treating or preventing HTN infection in a subject comprising administering to the subject any of the fusion polypeptides of this invention, comprising a chemokine (e.g., MTP-3 ⁇ ) and a human immunodeficiency virus (HIN) antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a chemokine e.g., MTP-3 ⁇
  • HIN human immunodeficiency virus
  • a method of treating a B cell tumor in a subject comprising administering to the subject any of the fusion polypeptides of this invention, comprising a chemokine (e.g., MTP-3 ) and a B cell tumor antigen, either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a chemokine e.g., MTP-3
  • a B cell tumor antigen either as a protein or a nucleic acid encoding the fusion polypeptide.
  • a can include multiples.
  • a cell can mean a single cell or more than one cell.
  • the present invention is based on the unexpected discovery that the administration of a fusion protein comprising a defensin or a chemokine (e.g., MTP-3 ⁇ ) and a tumor antigen or administration of a nucleic acid encoding a fusion protein comprising a defensin or a chemokine (e.g., M-P-3 ⁇ ) and a tumor antigen yields an effective and specific anti-tumor immune response by converting a "self tumor antigen into a potent immunogen by fusing it to a defensin or chemokine moiety.
  • a fusion protein comprising a defensin or a chemokine (e.g., MTP-3 ⁇ ) and a tumor antigen
  • administration of a nucleic acid encoding a fusion protein comprising a defensin or a chemokine (e.g., M-P-3 ⁇ ) and a tumor antigen yields an effective and specific anti-
  • the present invention provides a fusion polypeptide comprising a defensin and a tumor antigen as well as a fusion polypeptide comprising a chemokine and a tumor antigen.
  • the fusion polypeptide can be present in a purified form and can induce an immune response against the tumor antigen and inhibit the growth of tumor cells expressing the tumor antigen.
  • "Purified” as used herein means the polypeptide is sufficiently free of contaminants or cell components with which proteins normally occur to allow the peptide to be used therapeutically.
  • purified necessitates having a preparation that is technically totally pure (homogeneous), but purified as used herein means the fusion polypeptide is sufficiently pure to provide the polypeptide in a state where it can be used therapeutically.
  • fusion polypeptide means a polypeptide made up of two or more amino acid sequences representing peptides or polypeptides from different sources.
  • epitope refers to a specific amino acid sequence of limited length which, when present in the proper conformation, provides a reactive site for an antibody or T cell receptor. The identification of epitopes on antigens can be carried out by immunology protocols that are standard in the art (74).
  • tumor antigen describes a polypeptide expressed on the cell surface of specific tumor cells and which can serve to identify the type of tumor. An epitope of the tumor antigen can be any site on the antigen that is reactive with an antibody or T cell receptor.
  • defensin means an anti-microbial peptide with three to four intramolecular cysteine disulfide bonds which induces leukocyte migration in vitro, and/or enhances concavalin A-stimulated murine spleen cell proliferation and IFN- ⁇ production (128).
  • a defensin may be either a naturally occurring defensin, i.e., a peptide which is produced by, e.g., neutrophils, intestinal Paneth cells, or epithelial cells such as those of the skin, kidney, and trachea-bronchial lining, or a synthetic defensin, such as a variant of a naturally occurring defensin, which may be chemically synthesized or produced by expressing a modified cDNA encoding a naturally occurring defensin. While any mammalian or synthetic defensins may be used in the compositions and methods of the invention, naturally occurring human defensins or variants thereof are preferred.
  • the defensins of this invention can include, but are not limited to, alpha defensins ( ⁇ -defs, such as human neutrophil peptide-1 (HNP-1), human neutrophil peptide-2 (HNP-2), human neutrophil peptide-3 (HNP-3) (128, 130), human neutrophil peptide-4 (HNP-4), human defensin-5 (HD-5), and human defensin-6 (HD-6), and beta defensins ( ⁇ -defs, such as human ⁇ -defensin-1 (HBD1), human ⁇ -defensin-2 (HBD2) (129, 130).
  • alpha defensins ⁇ -defs
  • HNP-1 human neutrophil peptide-1
  • HNP-2 human neutrophil peptide-2
  • HNP-3 human neutrophil peptide-3
  • HNP-4 human neutrophil peptide-4
  • HD-5 human defensin-5
  • HD-6 human defensin-6
  • HNPs 1-4 Human neutrophil defensins
  • HNPs 1-4 are small, cationic, and arginine rich peptides that lack enzymatic activity.
  • the peptides contain six conserved cysteine residues that participate in 3 characteristic intramolecular disulfide bridges (130, the entire contents of this reference is incorporated herein in its entirety). Cysteine pairing distinguishes ⁇ - defensins from ⁇ -defensins, wherein the former are connected 1-5,2-4 and 3-6 and the latter are linked 1-6, 2-4 and 3-5 ( Figure 1) (130).
  • defensins include murine ⁇ -defensin-2 (Def2) and murine ⁇ - defensin-3 (Def3), as well as any other defensin now known or later identified.
  • the defensins of this invention can further include active fragments of defensins which retain the activity, including chemotaxis and inhibition of chemotaxis, of the intact molecule.
  • active fragments of a defensin and identification of defensin fragments which retain the activity of the intact molecule are carried out according to protocols well known in the art.
  • chemokine means a small secreted protein, induced by inflammatory stimuli (e.g., fibroblasts, endothelial cells, epithelial cells, monocytes, macrophages, T cells, B cells, PMNs, etc.
  • inflammatory stimuli e.g., fibroblasts, endothelial cells, epithelial cells, monocytes, macrophages, T cells, B cells, PMNs, etc.
  • cytokines such as interferon-gamma, interieukin 4, products of Thl and Th2 lymphocytes, interieukin- 1, tumor necrosis factor-alpha and bacterial products such as lipopolysaccharide, as well as viral infection (75,76), which orchestrates a chemotactic response typically after binding to specific G-protein-coupled cell surface receptors on target cells (e.g., antigen presenting cells (APC), such as dendritic cells, monocytes, macrophages, keratinocytes and B cells), comprising the selective migration, diapedesis and activation of leukocytes which mediate the inflammatory response.
  • APC antigen presenting cells
  • CXC chemokine receptors CXCR1-CXCR4
  • CCR1-CCR8 human CC chemokine receptors
  • CX 3 CR1 CXXXC chemoldne receptor
  • IP-10 interferon-induced protein 10
  • the chemokine monocyte chemotactic protein-3 acts via binding to the CCR1, CCR2 and CCR3 chemokine receptors on antigen presenting cells (APC) such as dendritic cells, eosinophils, basophils, monocytes and activated T cells.
  • APC antigen presenting cells
  • MCP-3 selectively targets and induces chemotaxis of these cell types.
  • the chemokine of this invention can include, but is not limited to, MTP-3 and MTP-3 ⁇ , interferon-induced protein 10, monocyte chemotactic protein-3, monocyte chemotactic protein-2, monocyte chemotactic protein-1, monocyte chemotactic protein- 4, macrophage inflammatory protein 1, RANTES, SDF-1, MIG and macrophage- derived chemokine, as well as any other chemokine now known or later identified.
  • a chemokine consists of two structural portions: the amino terminal portion and the carboxy terminal portion.
  • the amino terminal portion is responsible for chemokine receptor binding and the carboxy terminal end binds to heparin and heparan sulfate, for example, in the extracellular matrix and on the surface of endothelial cells.
  • the chemokines of this invention can further include active fragments of chemokines which retain the activity, including chemotaxis, of the intact molecule.
  • the production of an active fragments of a chemokine and identification of chemokine fragments which retain the activity of the intact molecule are carried out according to protocols well known in the art.
  • the N terminal region is the critical region of the molecule for biological activity and leukocyte selectivity.
  • the N-terminal ELR motif- containing CXC chemokines are chemotactic for neutrophils, whereas those not containing the motif act on lymphocytes.
  • IP-10 and MIG do not contain the ELR motif and are known to attract activated T cells (77).
  • the defensin gene or chemokine gene can be intact or fragmented as desired according to standard methods and the gene or gene fragments can be fused to a specific gene or gene fragment encoding an antigen to which an immune response is to be elicited (e.g., Muc-1 NNT, lymphoma scFv, gpl20, etc.).
  • a specific gene or gene fragment encoding an antigen to which an immune response is to be elicited e.g., Muc-1 NNT, lymphoma scFv, gpl20, etc.
  • the fusion polypeptide comprising the defensin gene or gene fragment or the chemokine gene or gene fragment and the tumor or viral antigen can be produced and purified as described herein and tested for immunogenicity according to the methods provided herein.
  • the tumor antigen moiety of the fusion polypeptide of this invention can be any tumor antigen now known or later identified as a tumor antigen.
  • the appropriate tumor antigen used in the fusion polypeptide depends on the tumor type being treated.
  • the tumor antigen can be, but is not limited to human epithelial cell mucin (Muc-1; a 20 amino acid core repeat for Muc-1 glycoprotein, present on breast cancer cells and pancreatic cancer cells), the Ha-ras oncogene product, p53, carcino-embryonic antigen (CEA), the raf oncogene product, GD2, GD3, GM2, TF, sTn, MAGE-1, MAGE-3, tyrosinase, gp75, Melan-A/Mart-1, gplOO, HER2/neu, EBN-LMP 1 & 2, HPV-F4, 6, 7, prostatic serum antigen (PSA), alpha-fetoprotein (AFP), CO17-1A, GA733, gp72, p53, the ras oncogene product, HPN E7 and melanoma gangliosides, as well as any other tumor antigens now known or identified in the future.
  • Tumor antigens can be obtained following known procedures or are commercially available (79).
  • the effectiveness of the fusion protein in eliciting an immune response against a particular tumor antigen can be determined according to methods standard in the art for determining the efficacy of vaccines and according to the methods set forth in the Examples.
  • the tumor antigen of the present invention can be an antibody which can be produced by a B cell tumor (e.g., B cell lymphoma; B cell leukemia; myeloma) or the tumor antigen can be a fragment of such an antibody, which contains an epitope of the idiotype of the antibody.
  • the epitope fragment can comprise as few as nine amino acids.
  • the tumor antigen of this invention can be a malignant B cell antigen receptor, a malignant B cell immunoglobulin idiotype, a variable region of an immunoglobulin, a hypervariable region or complementarity determining region (CDR) of a variable region of an immunoglobulin, a malignant T cell receptor (TCR), a variable region of a TCR and/or a hypervariable region of a TCR.
  • a malignant B cell antigen receptor a malignant B cell immunoglobulin idiotype
  • CDR complementarity determining region
  • the tumor antigen of this invention can be a single chain antibody (scFv), comprising linked N H and V L domains and which retains the conformation and specific binding activity of the native idiotype of the antibody (27).
  • scFv single chain antibody
  • Such single chain antibodies are well known in the art and can be produced by standard methods and as described in the Examples herein.
  • the tumor antigen of the present invention can be an epitope of the idiotype of a T cell receptor, which can be produced by a T cell tumor (e.g., T cell lymphoma; T cell leukemia; myeloma).
  • T cell tumor e.g., T cell lymphoma; T cell leukemia; myeloma
  • the epitope can comprise as few as nine amino acids.
  • the invention also includes peptides and polypeptides having slight variations in amino acid sequences or other properties which do not alter the functional identity of the peptide or polypeptide.
  • Such variations may arise naturally as allelic variations (e.g., due to genetic polymorphism) or may be produced synthetically (e.g., by mutagenesis of cloned DNA sequences), such as induced point, deletion, insertion and substitution mutations.
  • Minor changes in amino acid sequence are generally preferred, such as conservative amino acid replacements, small internal deletions or insertions, and additions or deletions at the ends of the molecules. Substitutions may be designed based on, for example, the model of Dayhoff et al. (80). These modifications can result in changes in the amino acid sequence, provide silent mutations, modify a restriction site, or provide other specific mutations while allowing for the presentation of the functional activity of peptides and polypeptides of this invention.
  • the fusion polypeptides can comprise one or more selected epitopes on the same tumor antigen, one or more selected epitopes on different tumor antigens, as well as repeats of the same epitope, either in tandem or interspersed along the amino acid sequence of the fusion polypeptide.
  • the tumor antigen can be positioned in the fusion polypeptide at the carboxy terminus of the defensin or chemokine, the amino terminus of the defensin or chemokine and/or at one or more internal sites within the defensin or chemokine amino acid sequence.
  • the fusion polypeptide can comprise more than one defensin or chemoldne or active fragment thereof in any combination and in any order with the various tumor antigens described above.
  • a fusion protein comprising any defensin or chemoldne moiety and any human tumor antigen (e.g., human single chain antibody) moiety according to the methods described herein, on the basis of the availability in the art of the nucleic acid and/or amino acid sequence of the defensin or chemokine of interest and the human tumor antigen of interest.
  • human tumor antigen e.g., human single chain antibody
  • the present invention further provides a fusion polypeptide comprising a first region comprising a defensin selected from the group consisting of HNP-1, HNP-2, HNP-3, HBDl, and HBD2, or a first region comprising a chemokine (e.g., MIP-3 ) and a second region comprising a tumor antigen selected from the group consisting of human epithelial cell mucin (Muc-1), the Ha-ras oncogene product, p53, carcino- embryonic antigen (CEA), the raf oncogene product, GD2, GD3, GM2, TF, sTn,
  • a fusion polypeptide comprising a first region comprising a defensin selected from the group consisting of HNP-1, HNP-2, HNP-3, HBDl, and HBD2, or a first region comprising a chemokine (e.g., MIP-3 ) and a second region comprising a tumor antigen
  • the present invention provides a fusion polypeptide comprising an scFv cloned from a human subject's biopsy tumor material or from a hybridoma cell line producing a lymphoma antibody and a defensin moiety (e.g. H ⁇ P-1, HNP-2, HNP- 3, HBDl, HBD2, etc.) or a chemoldne moiety (e.g., MTP-3 ⁇ ).
  • the present invention provides a defensin or chemoldne fused with the Muc-1 core epitope of human breast cancer or human pancreatic cancer.
  • Muc-1 is a glycoprotein (Mr>200,000) abundantly expressed on breast cancer cells and pancreatic tumor cells.
  • VNT repeats of a 20 amino acid peptide include B and T cell epitopes.
  • the present invention provides a fusion protein comprising MIP-3 ⁇ and Muc-1, HNP-1 and Muc-1 VNT, HNP-2 and Muc-IVNT, HNP-3 and Muc-IVNT, HBDl and Muc- 1 VNT, and/or HBD2 and Muc-IVNT.
  • the expression vector is designed so that a VNT can be changed by routine cloning methods to produce a fusion polypeptide comprising MIP-3C., HNP-1 , HNP-2, HNP-3, HBDl, or HBD2 fused with a Muc-1 VNT dimer, trimer, tetramer, pentamer, hexamer, etc.
  • the present invention also provides a fusion polypeptide comprising HNP-1 and human Muc-1, HNP-2 and human Muc-1, HNP-3 and human Muc- 1 , HBD 1 and human Muc- 1 , HBD2 and human Muc- 1 and MIP-3 a and human Muc-1.
  • the present invention further provides a fusion polypeptide comprising a defensin (e.g., HNP-1, HNP-2, HNP-3, HBDl, HBD2, etc.) or a chemoldne (e.g., MTP- 3a) and a scFv which recognizes tumor antigens, such as idiotype-specific scFv, Muc-1, etc.
  • a fusion polypeptide would allow migration, recruitment and activation of specialized cells of the immune system, such as natural killer (NK) cells, macrophages, dendritic cells (DC), polymorphonuclear (PMN) leukocytes, cytotoxic lymphocytes (CTL), etc., which would destroy the target cell.
  • the fusion polypeptide of this invention can further comprise a spacer sequence between the defensin or chemokine and the tumor antigen or viral antigen, which can have the amino acid sequence EFNDAQAPKSLE (SEQ ID NO: 2), or an amino acid sequence with conservative substitutions such that it has the same functional activity as the amino acid sequence of SEQ ID NO:2, which allows for retention of the correct folding of the tumor antigen region of the polypeptide.
  • a spacer sequence between the defensin or chemokine and the tumor antigen or viral antigen which can have the amino acid sequence EFNDAQAPKSLE (SEQ ID NO: 2), or an amino acid sequence with conservative substitutions such that it has the same functional activity as the amino acid sequence of SEQ ID NO:2, which allows for retention of the correct folding of the tumor antigen region of the polypeptide.
  • the present invention provides a composition comprising the fusion polypeptide of this invention and a suitable adjuvant.
  • a composition can be in a pharmaceutically acceptable carrier, as described herein.
  • suitable adjuvant describes a substance capable of being combined with the fusion polypeptide to enhance an immune response in a subject without deleterious effect on the subject.
  • a suitable adjuvant can be, but is not limited to, for example, an immunostimulatory cytokine, SYNTEX adjuvant formulation 1 (SAF-1) composed of 5 percent (wt/vol) squalene (DASF, Parsippany, NJ.), 2.5 percent Pluronic, L121 polymer (Aldrich Chemical, Milwaukee), and 0.2 percent polysorbate (Tween 80, Sigma) in phosphate- buffered saline.
  • SAF-1 SYNTEX adjuvant formulation 1
  • Pluronic 5 percent (wt/vol) squalene
  • L121 polymer Aldrich Chemical, Milwaukee
  • Tween 80 polysorbate
  • Suitable adjuvants include QS-21, Freund's adjuvant (complete and incomplete), alum, aluminum phosphate, aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor- muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), -acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(r-2'-dipalmitoyl-sn-glycero-3- hydroxyphosphoryloxy)-ethylamine (CGP 19835A, referred to as MTP-PE) and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trealose dimycolate and cell wall skeleton (MPL+TDM+CWS) in 2% squalen
  • the adjuvant such as an immunostimulatory cytokine can be administered before the administration of the fusion protein or nucleic acid encoding the fusion protein, concurrent with the administration of the fusion protein or nucleic acid or up to five days after the administration of the fusion polypeptide or nucleic acid to a subject.
  • QS-21 similarly to alum, complete Freund's adjuvant, SAF, etc., can be administered within hours of administration of the fusion protein or nucleic acid.
  • combinations of adjuvants, such as immunostimulatory cytokines can be co-administered to the subject before, after, or concurrent with the administration of the fusion polypeptide or nucleic acid.
  • combinations of adjuvants can consist of two or more of immunostimulatory cytokines of this invention, such as GM/CSF, interleukin-2, interieukin- 12, interferon- gamma, interleuldn-4, tumor necrosis factor-alpha, interieukin- 1, hematopoietic factor flt3L, CD40L, B7.1 co-stimulatory molecules and B7.2 co-stimulatory molecules.
  • the effectiveness of an adjuvant or combination of adjuvants may be determined by measuring the immune response directed against the fusion polypeptide with and without the adjuvant or combination of adjuvants, using standard procedures, as described herein.
  • the present invention provides a composition
  • a composition comprising the fusion polypeptide of this invention or a nucleic acid encoding the fusion polypeptide of this invention and an adjuvant, such as an immunostimulatory cytokine or a nucleic acid encoding an adjuvant, such as an immunostimulatory cytokine.
  • an adjuvant such as an immunostimulatory cytokine or a nucleic acid encoding an adjuvant, such as an immunostimulatory cytokine.
  • Such a composition can be in a pharmaceutically acceptable carrier, as described herein.
  • the immunostimulatory cytokine used in this invention can be, but is not limited to, GM/CSF, interleukin-2, interieukin- 12, interferon-gamma, interleukin-4, tumor necrosis factor- alpha, interleuldn-1, hematopoietic factor flt3L, CD40L, B7.1 con-stimulatory molecules and B7.2 co-stimulatory molecules.
  • the present invention further contemplates a fusion polypeptide comprising a defensin or chemoldne, or active fragment thereof, as described herein and a viral antigen, which can be, for example, an antigen of human immunodeficiency virus (HJN).
  • HJN human immunodeficiency virus
  • An HJN antigen of this invention can be, but is not limited to, the envelope glycoprotein gpl20, the third hypervariable region of the envelope glycoprotein, g ⁇ l20 of HTV-1 (the disulfate loop V3), having the amino acid sequence: ⁇ CTRP ⁇ TRKRTRIQRGPGRAFVTIGKIG ⁇ MRQAHC ⁇ IS (SEQ ID ⁇ O:3), any other antigenic fragment of gpl20, the envelope glycoprotein gpl60, an antigenic fragment of gpl60, the envelope glycoprotein gp41 and/or an antigenic fragment of gp41.
  • the nucleic acid encoding the V3 loop can be fused to the 3' end of the nucleic acid encoding a defensin (e.g., HNP-1, HNP-2, HNP-3, HBDl, or HBD2) or encoding a chemokine (e.g., MTP-3o.) directly or separated by nucleic acid encoding a spacer sequence.
  • a defensin e.g., HNP-1, HNP-2, HNP-3, HBDl, or HBD2
  • a chemokine e.g., MTP-3o.
  • the defensin- V3 loop fusion polypeptide or chemokine- V3 loop fusion polypeptide can be produced in an expression system as described herein and purified as also described herein.
  • the present invention provides a fusion polypeptide comprising a defensin or a chemokine and a human immunodeficiency virus (HTV) antigen, wherein the defensin can be HNP-1, HNP-2, HNP-3, HBDl, HBD2, or any other defensin, wherein the chemoldne can be MIP-3 ⁇ , and wherein the HTV antigen can be g ⁇ l20, g ⁇ l60, gp41, an active (i.e., antigenic) fragment of g ⁇ l20, an active (i.e., antigenic) fragment of gpl60 and an active (i.e., antigenic) fragment of gp41.
  • HTV human immunodeficiency virus
  • fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gpl20, HBDl and HTV gpl20, HBD2 and HTV gpl20, or MTP-3 ⁇ and HTV gpl20
  • isolated nucleic acid encoding the fusion polypeptides of this invention as described above is also provided.
  • isolated nucleic acid is meant a nucleic acid molecule that is substantially free of the other nucleic acids and other components commonly found in association with nucleic acid in a cellular environment. Separation techniques for isolating nucleic acids from cells are well known in the art and include phenol extraction followed by ethanol precipitation and rapid solubilization of cells by organic solvent or detergents (81).
  • the nucleic acid encoding the fusion polypeptide can be any nucleic acid that functionally encodes the fusion polypeptide.
  • the nucleic acid can include, for example, expression control sequences, such as an origin of replication, a promoter, an enhancer and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites and transcriptional terminator sequences.
  • expression control sequences are promoters derived from metallothionine genes, actin genes, immunoglobulin genes, CMN, SN40, adenovirus, bovine papilloma virus, etc.
  • a nucleic acid encoding a selected fusion polypeptide can readily be determined based upon the genetic code for the amino acid sequence of the selected fusion polypeptide and many nucleic acids will encode any selected fusion polypeptide. Modifications in the nucleic acid sequence encoding the fusion polypeptide are also contemplated. Modifications that can be useful are modifications to the sequences controlling expression of the fusion polypeptide to make production of the fusion polypeptide inducible or repressible as controlled by the appropriate inducer or repressor. Such means are standard in the art (81).
  • the nucleic acids can be generated by means standard in the art, such as by recombinant nucleic acid techniques, as exemplified in the examples herein and by synthetic nucleic acid synthesis or in vitro enzymatic synthesis.
  • a vector comprising any of the nucleic acids of the present invention and a cell comprising any of the vectors of the present invention are also provided.
  • the vectors of the invention can be in a host (e.g., cell line or transgenic animal) that can express the fusion polypeptide contemplated by the present invention.
  • E. coli Esscherichia coli
  • Other microbial hosts suitable for use include bacilli, such as Bacillus subtilis, and other enterobacteria, such as Salmonella, Serratia, as well as various Pseudomonas species.
  • These prokaryotic hosts can support expression vectors which will typically contain expression control sequences compatible with the host cell (e.g., an origin of replication).
  • any number of a variety of well-known promoters will be present, such as the lactose promoter system, a tryptophan (Trp) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda.
  • the promoters will typically control expression, optionally with an operator sequence and have ribosome binding site sequences for example, for initiating and completing transcription and translation.
  • an amino terminal methionine can be provided by insertion of a Met codon 5' and in-frame with the protein.
  • the carboxy-terminal extension of the protein can be removed using standard oligonucleotide mutagenesis procedures.
  • yeast expression can be used. There are several advantages to yeast expression systems. First, evidence exists that proteins produced in a yeast secretion system exhibit correct disulfide pairing. Second, post-translational glycosylation is efficiently carried out by yeast secretory systems.
  • the Saccharomyces cerevisiae pre-pro-alpha-factor leader region (encoded by the MF -1 gene) is routinely used to direct protein secretion from yeast (82).
  • the leader region of pre-pro-alpha- factor contains a signal peptide and a pro-segment which includes a recognition sequence for a yeast protease encoded by the KEX2 gene.
  • This enzyme cleaves the precursor protein on the carboxyl side of a Lys-Arg dipeptide cleavage-signal sequence.
  • the polypeptide coding sequence can be fused in-frame to the pre-pro-alpha-factor leader region. This construct is then put under the control of a strong transcription promoter, such as the alcohol dehydrogenase I promoter or a glycolytic promoter.
  • the protein coding sequence is followed by a translation termination codon which is followed by transcription termination signals.
  • the polypeptide coding sequence of interest can be fused to a second protein coding sequence, such as Sj26 or ⁇ -galactosidase, used to facilitate purification of the fusion protein by affinity chromatography.
  • the insertion of protease cleavage sites to separate the components of the fusion protein is applicable to constructs used for expression in yeast.
  • Efficient post-translational glycosylation and expression of recombinant proteins can also be achieved in Baculovirus systems in insect cells.
  • Mammalian cells permit the expression of proteins in an environment that favors important post-translational modifications such as folding and cysteine pairing, addition of complex carbohydrate structures and secretion of active protein.
  • Vectors useful for the expression of proteins in mammalian cells are characterized by insertion of the protein coding sequence between a strong viral promoter and a polyadenylation signal.
  • the vectors can contain genes conferring either gentamicin or methotrexate resistance for use as selectable markers.
  • the antigen and immunoreactive fragment coding • sequence can be introduced into a Chinese hamster ovary (CHO) cell line using a methotrexate resistance-encoding vector. Presence of the vector RNA in transformed cells can be confirmed by Northern blot analysis and production of a cDNA or opposite strand RNA corresponding to the protein coding sequence can be confirmed by Southern and Northern blot analysis, respectively.
  • suitable host cell lines capable of secreting intact proteins have been developed in the art and include the CHO cell lines, HeLa cells, myeloma cell lines, Jurkat cells and the like. Expression vectors for these cells can include expression control sequences, as described above.
  • the vectors containing the nucleic acid sequences of interest can be transferred into the host cell by well-known methods, which vary depending on the type of cell host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, lipofection or electroporation may be used for other cell hosts.
  • the vector can include CMV promoter sequences and a polyadenylation signal available for expression of inserted nucleic acid in mammalian cells (such as COS7).
  • the nucleic acid sequences can be expressed in hosts after the sequences have been positioned to ensure the functioning of an expression control sequence.
  • These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
  • expression vectors can contain selection markers, e.g., tetracycline resistance or hygromycin resistance, to permit detection and/or selection of those cells transformed with the desired nucleic acid sequences (83).
  • fusion polypeptides and/or nucleic acids of the present invention can be used in in vitro diagnostic assays, as well as in screening assays for identifying unknown tumor antigen epitopes and fine mapping of tumor antigen epitopes.
  • the expression vector and expression system can be of any of the types as described herein.
  • the cloning of the first and second DNA segments into the expression vector and expression of the DNA under conditions which allow for the production of the fusion protein of this invention can be carried out as described in the Examples section included herein.
  • the method of this invention can further comprise the step of isolating and purifying the fusion polypeptide, according to methods well known in the art and as described herein.
  • any of the fusion polypeptides, the nucleic acids and the vectors of the present invention can be in a pharmaceutically acceptable carrier and in addition, can include other medicinal agents, pharmaceutical agents, carriers, diluents, adjuvants (e.g., immunostimulatory cytokines), etc.
  • pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with the selected antigen without causing substantial deleterious biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art (84).
  • the present invention further provides a method for inducing an immune response in a subject capable of induction of an immune response and preferably human, comprising administering to the subject an immune response-inducing amount of the fusion polypeptide or nucleic acid of this invention.
  • an immune response-inducing amount is that amount of fusion polypeptide or nucleic acid which is capable of producing in a subject a humoral and/or cellular immune response capable of being detected by standard methods of measurement, such as, for example, as described herein.
  • the antigenic polypeptide region of the fusion polypeptide can induce an antibody response.
  • the antibodies can treat or prevent a pathological or harmful condition in the subject in which the antibodies are produced or the antibodies can be removed from the subject and administered to another subject to treat or prevent a pathological or harmful condition.
  • the fusion polypeptide can also induce an effector T cell (cellular) immune response which is effective in treating or preventing a pathological or harmful condition in the subject.
  • the immune response can be the production in the subject of anti-idiotype antibodies, which represent the image of the original antigen and can function in a vaccine preparation to induce an immune response to a pathogenic antigen, thereby avoiding immunization with the antigen itself (85).
  • the anti-idiotype antibodies can treat or prevent a pathological or harmful condition in the subject in which the anti-idiotype antibodies are produced or the anti-idiotype antibodies can be removed from the subject and administered to another subject to treat or prevent a pathological or harmful condition.
  • a method for inhibiting the growth of tumor cells in a subject comprising administering to the subject a tumor cell growth-inhibiting amount of the fusion polypeptide or nucleic acid of this invention.
  • the subject of this method can be any subject in which a humoral and/or cellular immune response to a tumor can be induced, which is preferably an animal and most preferably a human.
  • inhibiting the growth of tumor cells means that, following administration of the fusion polypeptide or nucleic acid encoding the fusion polypeptide, a measurable humoral and/or cellular immune response against the tumor cell epitope is elicited in the subject, resulting in the inhibition of growth of tumor cells present in the subject.
  • the humoral immune response can be measured by detection, in the serum of the subject, of antibodies reactive with the epitope of the tumor antigen present on the fusion polypeptide, according to protocols standard in the art, such as enzyme linked immunosorbent immunoassay (ELISA) and Western blotting protocols.
  • ELISA enzyme linked immunosorbent immunoassay
  • the cellular immune response can be measured by, for example, footpad swelling in laboratory animals, peripheral blood lymphocyte (PBL) proliferation assays and PBL cytotoxicity assays, as would be known to one of ordinary skill in the art of immunology and particularly as set forth in the available handbooks and texts of immunology protocols (86).
  • the present invention also provides a method of treating cancer in a subject diagnosed with cancer, comprising administering to the subject an effective amount of the fusion polypeptide or nucleic acid of the present invention.
  • the cancer can be, but is not limited to B cell lymphoma, T cell lymphoma, myeloma, leukemia, breast cancer, pancreatic cancer, colon cancer, lung cancer, renal cancer, liver cancer, prostate cancer, melanoma and cervical cancer.
  • a method of treating a B cell tumor in a subject diagnosed with a B cell tumor comprising administering an effective amount of the fusion polypeptide or nucleic acid of this invention, which comprises an antibody or a
  • the present invention also provides a method of producing an immune response in a subject, comprising administering to the subject a composition comprising a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide can be a fusion polypeptide comprising HNP-1 and human Muc-1, HNP-2 and human Muc-1, HNP-3 and human Muc-1, HBDl and human Muc-1, HBD2 and human Muc-1, Def2 and human Muc-1, Def3 and human Muc-1, and/or MIP-3 and human Muc-1.
  • Also provided is a method of producing an immune response in a subject comprising administering to the subject a composition comprising a nucleic acid encoding a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide is a fusion polypeptide comprising HNP-1 and human Muc-1, HNP-2 and human Muc-1, HNP-3 and human Muc-1, HBDl and human Muc-1, HBD2 and human Muc-1, Def2 and human Muc-1, Def3 and human Muc-1, and/or MIP-3 oc and Muc-1, under conditions whereby the nucleic acid of the composition can be expressed, thereby producing an immune response in the subject.
  • the present invention also provides a method of producing an immune response in a subject, comprising administering to the subject a composition comprising a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide can be a fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gpl20, HBDl and HTV gpl20, HBD2 and HTV gpl20, Def2 and HTV gpl20, Def3 and HTV gpl20, and/or MIP-3 ⁇ and HTV gpl20, thereby producing an immune response in the subject.
  • a composition comprising a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide can be a fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gp
  • Also provided is a method of producing an immune response in a subject comprising administering to the subject a composition comprising a nucleic acid encoding a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide is a fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gpl20, HBDl and HTV gpl20, HBD2 and HTV gpl20, Def2 and HTV g ⁇ l20, Def3 and HTV g ⁇ l20, and/or MTP-3 and HTV gpl20, under conditions whereby the nucleic acid of the composition can be expressed, thereby producing an immune response in the subject.
  • a composition comprising a nucleic acid encoding a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide is a fusion polypeptide comprising HNP-1 and H
  • Also provided is a method of producing an immune response in a subject comprising administering to the subject a composition comprising a fusion polypeptide and a pharmaceutically acceptable carrier and wherein the fusion polypeptide is a fusion polypeptide comprising a defensin or chemoldne and a human immunodeficiency virus (HTV) antigen, wherein the defensin can be HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, wherein the chemoldne can be MTP-3 ⁇ and wherein the HTV antigen can be gpl20, gpl60, gp41, an active (i.e., antigenic) fragment of gpl20, an active (i.e., antigenic) fragment of gpl60 and/or an active (i.e., antigenic) fragment of gp41, thereby producing an immune response in the subject.
  • HTV human immunodeficiency virus
  • the present invention also provides a method of producing an immune response in a subject, comprising administering to the subject a composition comprising a nucleic acid encoding a fusion polypeptide comprising a defensin or chemoldne and a human immunodeficiency virus (HTV) antigen, wherein the defensin can be HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, wherein the chemoldne can be MTP-3 ⁇ and wherein the HTV antigen can be gpl20, gpl60, g ⁇ 41, an active (i.e., antigenic) fragment of gpl20, an active (i.e., antigenic) fragment of g ⁇ l60 and/or an active (i.e., antigenic) fragment of gp41, and a pharmaceutically acceptable carrier, under conditions whereby the nucleic acid can be expressed, thereby producing an immune response in the subject.
  • the immune response can be humoral and/or an effector T cell (cellular) immune response, as determined according to methods standard in the art.
  • the present invention provides a method of treating a cancer in a subject diagnosed with a cancer, comprising administering to the subject a composition comprising a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide is a fusion polypeptide comprising HNP-1 and human Muc-1, HNP-2 and human Muc-1, HNP-3 and human Muc-1, HBDl and human Muc-1, HBD2 and human Muc-1, Def2 and human Muc-1, Def3 and human Muc-1, and/or MIP-3 and human Muc-1, thereby treating a cancer in the subject.
  • a method of treating a cancer in a subject in need of such treatment comprising administering to the subject a composition comprising a nucleic acid encoding a fusion polypeptide of this invention and a pharmaceutically acceptable carrier and wherein the fusion polypeptide is a fusion polypeptide comprising HNP-1 and human Muc-1, HNP-2 and human Muc-1, HNP-3 and human Muc-1, HBDl and human Muc-1, HBD2 and human Muc-1, Def2 and human Muc-1, Def3 and human Muc-1, and/or MIP-3 ⁇ and human Muc-1, under conditions whereby the nucleic acid of the composition can be expressed, thereby treating a cancer in the subject.
  • a method of treating or preventing HTV infection in a subject comprising administering to the subject a composition comprising a defensin or chemoldne and a human immunodeficiency virus (HTV) antigen, wherein the defensin can be HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, wherein the chemokine can be MIP-3 oc and wherein the HJN antigen can be g ⁇ l20, gpl60, g ⁇ 41, an active (i.e., antigenic) fragment of gpl20, an active (i.e., antigenic) fragment of gpl60 and/or an active (i.e., antigenic) fragment of gp41, and a pharmaceutically acceptable carrier, thereby treating or preventing HTV infection in the subject.
  • HTV human immunodeficiency virus
  • a method of treating or preventing HTV infection in a subject comprising administering to the subject a composition comprising a nucleic acid encoding a fusion polypeptide comprising a defensin or chemokine and a human immunodeficiency virus (HTV) antigen, wherein the defensin can be H ⁇ P-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, wherein the chemoldne can be MIP-3 ⁇ , and wherein the HTV antigen can be gpl20, gpl60, gp41, an active (i.e., antigenic) fragment of gpl20, an active (i.e., antigenic) fragment of gpl60 and/or an active (i.e., antigenic) fragment of gp41, and a pharmaceutically acceptable carrier, under conditions whereby the nucleic acid can be expressed, thereby treating or preventing HTV
  • a method of treating or preventing HTV infection in a subject comprising administering to the subject a composition comprising a fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gpl20, HBDl and HTV gpl20, HBD2 and HTV gpl20, Def2 and HTV gpl20, Def3 and HTV gpl20, and/or MTP-3C. and HTV gpl20, and a pharmaceutically acceptable carrier, thereby treating or preventing HTV infection in the subject.
  • a composition comprising a fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gpl20, HBDl and HTV gpl20, HBD2 and HTV gpl20, Def2 and HTV gpl20, Def3 and HTV g
  • a method of treating or preventing HTV infection in a subject comprising administering to the subject a composition comprising a nucleic acid encoding a fusion polypeptide comprising HNP-1 and HTV gpl20, HNP-2 and HTV gpl20, HNP-3 and HTV gpl20, HBDl and HTV gpl20, HBD2 and HTV gpl20, Def2 and HTV gpl20, Def3 and HTV gpl20, and/or MTP-3c. and HTV gpl20, and a pharmaceutically acceptable carrier, under conditions whereby the nucleic acid can be expressed, thereby treating or preventing HTV infection in the subject.
  • the present invention provides a method of treating a B cell tumor in a subject, comprising administering to the subject a fusion polypeptide comprising a defensin or chemoldne and a B cell tumor antigen, wherein the B cell tumor antigen can be an antibody, a single chain antibody or an epitope of an idiotype of an antibody, wherein the chemokine can be M-P-3 ⁇ , and wherein the defensin can be HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, thereby treating a B cell tumor in the subject.
  • a fusion polypeptide comprising the defensin HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, or the chemoldne MTP-3 ⁇ , and the V3 loop of HTV-1 envelope glycoprotein, gpl20, as well as a fusion protein comprising MTP-3 , HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, and g ⁇ l60 of HTV-1, a fusion protein comprising MTP-3o., HNP-1, HNP-2, HNP-3, HBDl, HBD2, def2, Def3, or any other defensin, and gp41 of HTV-1, a fusion protein comprising MIP-3 ⁇ , HNP-1, HNP-2, HNP-3, HBDl, HBD2, Def2, Def3, or any other defensin, and an active fragment of gpl
  • the methods of this invention which comprise administering the fusion protein of this invention to a subject can further comprise the step of administering one or more adjuvants, such as an immunostimulatory cytokine to the subject.
  • the adjuvant or adjuvants can be administered to the subject prior to, concurrent with and/or after the administration of the fusion protein as described herein.
  • the subject of the present invention can be any animal in which cancer can be treated and/or viral infection can be prevented and/or treated by eliciting an immune response to a tumor and/or viral antigen.
  • the animal is a mammal and most preferably is a human.
  • the animals can either be pre- treated with the fusion polypeptide and then challenged with a lethal dose of tumor cells, or the lethal dose of tumor cells can be administered to the animal prior to receipt of the fusion polypeptide and survival times documented.
  • standard clinical response parameters can be analyzed.
  • animals can be treated with tumor cells as described herein and varying amounts of the fusion polypeptide can be administered to the animals.
  • Standard clinical parameters as described herein, can be measured and that amount of fusion polypeptide effective in inhibiting tumor cell growth can be determined.
  • These parameters as would be known to one of ordinary skill in the art of oncology and tumor biology, can include, but are not limited to, physical examination of the subject, measurements of tumor size, X-ray studies and biopsies.
  • the present invention further provides a method for treating or preventing HTV infection in a human subject, comprising administering to the subject an HTV replication-inhibiting amount of the defensin/HTV antigen or chemokine/TTTV antigen fusion polypeptide of this invention.
  • a replication-inhibiting amount is that amount of fusion polypeptide which produces a measurable humoral and/or effector T cell (cellular) immune response in the subject against the viral antigen, as determined by standard immunological protocols, resulting in the inhibition of HTV replication in cells of the subject, as determined by methods well known in the art for measuring HTV replication, such as viral load measurement, which can be determined by quantitative PCR (QPCR) and branched DNA (bDNA) analysis; reverse transcriptase activity measurement, in situ hybridization, Western immunoblot, ELISA and p24 gag measurement (87,88,89,90,91).
  • the fusion polypeptide can be administered to the subject in varying amounts and the amount of the fusion polypeptide optimally effective in inhibiting HTV replication in a given subject can be determined as described herein.
  • the fusion polypeptide of this invention can be administered to the subject orally or parenterally, as for example, by intramuscular injection, by intraperitoneal injection, topically, transdermally, injection directly into the tumor, or the like, although subcutaneous injection is typically preferred.
  • Immunogenic, tumor cell growth inhibiting and HTV replication inhibiting amounts of the fusion polypeptide can be determined using standard procedures, as described. Briefly, various doses of the fusion polypeptide are prepared, administered to a subject and the immunological response to each dose is determined (92).
  • the exact dosage of the fusion polypeptide will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the cancer or HTV infection that is being treated, the particular antigen being used, the mode of administration, and the like. Thus, it is not possible to specify an exact amount. However, an appropriate amount may be determined by one of ordinary skill in the art using only routine screening given the teachings herein.
  • the dosage of fusion protein will approximate that which is typical for the administration of vaccines, and typically, the dosage will be in the range of about 1 to 500 ⁇ g of the fusion polypeptide per dose, and preferably in the range of 50 to 250 ⁇ g of the fusion polypeptide per dose.
  • This amount can be administered to the subject once every other week for about eight weeks or once every other month for about six months.
  • the effects of the administration of the fusion polypeptide can be determined starting within the first month following the initial administration and continued thereafter at regular intervals, as needed, for an indefinite period of time.
  • fine powders or granules may contain diluting, dispersing, and/or surface active agents, and may be presented in water or in a syrup, in capsules or sachets in the dry state, or in a nonaqueous solution or suspension wherein suspending agents may be included, in tablets wherein binders and lubricants may be included, or in a suspension in water or a syrup. Where desirable or necessary, flavoring, preserving, suspending, thickening, or emulsifying agents may be included. Tablets and granules are preferred oral administration forms, and these may be coated.
  • Parenteral administration if used, is generally characterized by injection.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • One approach for parenteral administration involves use of a slow release or sustained release system, such that a constant level of dosage is maintained. See, e.g., U.S. Patent No. 3,710,795, which is incorporated by reference herein.
  • conventional nontoxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • Liquid pharmaceutically administrable compositions can, for example, be prepared by dissolving, dispersing, etc. an active compound as described herein and optional pharmaceutical adjuvants in an excipient, such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form a solution or suspension.
  • the pharmaceutical composition to be administered may also contain minor amounts of nontoxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like, for example, sodium acetate, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, etc. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this (84).
  • nontoxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like, for example, sodium acetate, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, etc.
  • the present invention also provides a method for producing single chain antibodies against tumor antigens comprising producing a fusion polypeptide comprising a defensin region or chemoldne region and a region comprising a tumor antigen; immunizing animals with an amount of the fusion polypeptide sufficient to produce a humoral immune response to the fusion polypeptide; isolating spleen cells expressing immunoglobulin specific for the fusion polypeptide; isolating the immunoglobulin variable genes from the spleen cells; cloning the immunoglobulin variable genes into an expression vector; expressing the immunoglobulin variable genes in a bacteriophage; infecting E. coli cells with the bacteriophage; isolating bacteriophage from the E. coli cells which express the immunoglobulin variable genes and isolating the immunoglobulin variable gene products for use as single chain antibodies.
  • the defensin-scFv fusion proteins and chemokine-scFv fusion proteins described herein are better targets than tumor cells or purified tumor antigen peptides for antibody selection approaches such as phage displayed scFv production.
  • phage displayed scFv production there are two ways to produce specific Fv displayed on the surface of phage: (1) Immunize mice with tumor cells; isolate immunoglobulin variable fragment genes from spleen cells by RT/PCR; clone the genes into bacteriophage in frame with genes coding phage surface proteins (e.g., major coat protein subunits gpVm or gp HI of the filamentous bacteriophage) (93,94); and (2) Construct semisynthetic antibody libraries by PCR as described (95).
  • the specific phage producing scFv are selected by several rounds of binding elution and infection in E. coli, using biotin labeled defensin-tumor antigen (e.g., Muccore).
  • biotin labeled defensin-tumor antigen e.g., Muccore
  • Muccore biotin labeled defensin-tumor antigen
  • the biotin enables selection of high affinity scFv-phage through binding to streptavidin conjugated magnetic beads. This approach provides simple, fast and efficient production of specific anti-tumor epitope scFv.
  • the present invention also provides a nucleic acid which encodes a fusion polypeptide of this invention and a vector comprising a nucleic acid which encodes a fusion polypeptide of this invention, either of which can be in a pharmaceutically acceptable carrier.
  • a nucleic acid which encodes a fusion polypeptide of this invention and a vector comprising a nucleic acid which encodes a fusion polypeptide of this invention, either of which can be in a pharmaceutically acceptable carrier.
  • Such nucleic acids and vectors can be used in gene therapy protocols to treat cancer as well as to treat or prevent HTV infection in a subject.
  • the present invention further provides a method of treating a cancer in a subject diagnosed with a cancer comprising administering the nucleic acid of this invention to a cell of the subject under conditions whereby the nucleic acid is expressed in the cell, thereby treating the cancer.
  • a method of treating a B cell tumor in a subject diagnosed with a B cell tumor comprising administering the nucleic acid of this invention, encoding a defensin or chemoldne and an antibody or fragment thereof, in a pharmaceutically acceptable carrier, to a cell of the subject, under conditions whereby the nucleic acid is expressed in the cell, thereby treating the B cell tumor.
  • the methods of this invention which comprise administering nucleic acid encoding the fusion protein of this invention to a subject can further comprise the step of administering a nucleic acid encoding an adjuvant such as an immunostimulatory cytokine to the subject, either before, concurrent with or after the administration of the nucleic acid encoding the fusion protein, as described herein.
  • an adjuvant such as an immunostimulatory cytokine
  • the nucleic acid can be administered to the cell in a virus, which can be, for example, adenovirus, retrovirus and adeno-associated virus.
  • the nucleic acid of this invention can be administered to the cell in a liposome.
  • the cell of the subject can be either in vivo or ex vivo.
  • the cell of the subject can be any cell which can take up and express exogenous nucleic acid and produce the fusion polypeptide of this invention.
  • the fusion polypeptide of this invention can be produced by a cell which secretes it, whereby it binds a defensin or chemokine receptor and is subsequently processed by an antigen presenting cell and presented to the immune system for elicitation of an immune response.
  • the fusion polypeptide of this invention can be produced in an antigen presenting cell where it is processed directly and presented to the immune system.
  • cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art.
  • the nucleic acids of this invention can be introduced into the cells via any gene transfer mechanism, such as, for example, virus-mediated gene delivery, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes.
  • the transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
  • nucleic acid or vector of the present invention can be administered in vivo in a pharmaceutically acceptable carrier.
  • the nucleic acids of the present invention can be in the form of naked DNA or the nucleic acids can be in a vector for delivering the nucleic acids to the cells for expression of the nucleic acid to produce the fusion protein of this invention.
  • the vector can be a commercially available preparation, such as an adenovirus vector (Quantum Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of the nucleic acid or vector to cells can be via a variety of mechanisms.
  • delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art.
  • the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Arlington, AZ).
  • Vector delivery can also be via a viral system, such as a retroviral vector system which can package a recombinant retroviral genome (see e.g., 96,97).
  • the recombinant retrovirus can then be used to infect and thereby deliver to the infected cells nucleic acid encoding the fusion polypeptide.
  • the exact method of introducing the exogenous nucleic acid into mammalian cells is, of course, not limited to the use of retroviral vectors. Other techniques are widely available for this procedure including the use of adenoviral vectors (98), adeno-associated viral (AAV) vectors (99), lentiviral vectors (100), pseudotyped retroviral vectors (101).
  • Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanisms (see, for example, 102). This invention can be used in conjunction with any of these or other commonly used gene transfer methods.
  • adenoviruses may be used in the compositions and methods described herein.
  • a nucleic acid encoding the fusion protein can be inserted within the genome of adenovirus type 5.
  • other types of adenovirus may be used such as type 1, type 2, etc.
  • a recombinant nucleic acid comprising an adenoviral nucleic acid from one type adenovirus can be packaged using capsid proteins from a different type adenovirus.
  • the adenovirus of the present invention is preferably rendered replication deficient, depending upon the specific application of the compounds and methods described herein.
  • Methods of rendering an adenovirus replication deficient are well known in the art. For example, mutations such as point mutations, deletions, insertions and combinations thereof, can be directed toward a specific adenoviral gene or genes, such as the El gene.
  • a specific example of the generation of a replication deficient adenovirus for use in gene therapy see WO 94/28938 (Adenovirus Vectors for Gene Therapy Sponsorship) which is incorporated herein in its entirety.
  • the nucleic acid encoding the fusion protein can be inserted within an adenoviral genome and the fusion protein encoding sequence can be positioned such that an adenovirus promoter is operatively linked to the fusion protein nucleic acid insert such that the adenoviral promoter can then direct transcription of the nucleic acid, or the fusion protein insert may contain its own adenoviral promoter.
  • the fusion protein insert may be positioned such that the nucleic acid encoding the fusion protein may use other adenoviral regulatory regions or sites such as splice junctions and polyadenylation signals and/or sites.
  • the nucleic acid encoding the fusion protein may contain a different enhancer/promoter (e.g., CMV or RSV-LTR enhancer/promoter sequences) or other regulatory sequences, such as splice sites and polyadenylation sequences, such that the nucleic acid encoding the fusion protein may contain those sequences necessary for expression of the fusion protein and • not partially or totally require these regulatory regions and/or sites of the adenovirus genome.
  • These regulatory sites may also be derived from another source, such as a virus other than adenovirus.
  • a polyadenylation signal from SV40 or BGH may be used rather than an adenovirus, a human, or a murine polyadenylation signal.
  • the fusion protein nucleic acid insert may, alternatively, contain some sequences necessary for expression of the nucleic acid encoding the fusion protein and derive other sequences necessary for the expression of the fusion protein nucleic acid from the adenovirus genome, or even from the host in which the recombinant adenovirus is introduced.
  • the AAV particle can be directly injected intravenously.
  • the AAV has a broad host range, so the vector can be used to transduce any of several cell types, but preferably cells in those organs that are well perfused with blood vessels.
  • the AAV particle can be directly injected into a target organ, such as muscle, liver or kidney.
  • the vector can be administered intraarterially, directly into a body cavity, such as intraperitoneally, or directly into the central nervous system (CNS).
  • CNS central nervous system
  • An AAV vector can also be administered in gene therapy procedures in various other formulations in which the vector plasmid is administered after incorporation into other delivery systems such as liposomes or systems designed to target cells by receptor-mediated or other endocytosis procedures.
  • the AAV vector can also be incorporated into an adenovirus, retrovirus or other virus which can be used as the delivery vehicle.
  • the mode of administration of the nucleic acid or vector of the present invention can vary predictably according to the disease being treated and the tissue being targeted.
  • catheterization of an artery upstream from the target organ is a preferred mode of delivery, because it avoids significant clearance of the liposome by the lung and liver.
  • the nucleic acid or vector may be administered orally as described herein for oral administration of the fusion polypeptides of this invention, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, although intravenous administration is typically preferred.
  • parenterally e.g., intravenously
  • intramuscular injection by intraperitoneal injection
  • transdermally extracorporeally, topically or the like
  • intravenous administration is typically preferred.
  • the exact amount of the nucleic acid or vector required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every nucleic acid or vector. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein (84).
  • the dosage for administration of adenovirus to humans can range from about 10 7 to 10 9 plaque forming units (pfu) per injection, but can be as high as 10 12 pfu per injection (104,105).
  • a subject will receive a single injection. If additional injections are necessary, they can be repeated at six month intervals for an indefinite period and/or until the efficacy of the treatment has been established.
  • Parenteral administration of the nucleic acid or vector of the present invention is generally characterized by injection.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein in its entirety.
  • mice and tumor C3H/HeN female mice 6 to 12 weeks of age are obtained from the Animal Production Area of the National Cancer Institute-Frederick Cancer Research and Development Center (NCI-FCRDC, Frederick, MD).
  • the cell line 38cl3 is a carcinogen-induced murine B cell tumor cell line (125).
  • the 38cl3 tumor cell secretes and expresses IgM( ⁇ ) on the cell surface and is MHC class I positive but class II negative.
  • 38cl3 cells from a common frozen stock are passaged in vitro 3 days before use in RPMI 1640 supplemented with 100 U/ml of penicillin and streptomycin, 2xlO "5 M 2-mercaptoethanol and heat inactivated 10% fetal bovine serum (BioWhitaker).
  • nucleic acid encoding the fusion protein is expressed in a modified petl Id vector (Stratagene) and purified from inclusion bodies of E.coli.
  • nucleic acid encoding the fusion polypeptide is cloned into a pCMVE/AB (Arya Biragyn) vector under regulatory elements of the early promoter and enhancer of CMN and expressed in the epidermis of mice as a naked D ⁇ A vaccine.
  • Fv fragments are cloned from two different B cell lymphomas, 38C13 and A20, respectively (106,107) by RT/PCR and produced as recombinant fusion peptides with either IP-10 or MCP3, respectively designated as TP10scFv38 and TP10scFv20A, or MCP3scFv38 and MCP3scFv20A.
  • lymphoma specific Vh and VI fragments are cloned by RT/PCR techniques as single chain antibody from total R ⁇ A of 38cl3 and A20 tumor cells, designated scFv38 and scFv20A respectively, using the following primers.
  • PRVh-5' PRV H 38-5': CTCGAGG TGAAGCTGGTGGAGTCTGGA (SEQ TD ⁇ O:4)
  • PRVh-3' PRV H 38-3': AGAGGAGA CTGTGAGAGTGGTGCCTT (SEQ TD NO:5)
  • PRV1-5' PRV L 38-5': GACATCCAGATGACACAGTCTCCA (SEQ TD NO:6)
  • PRV1-3' PRV L 38-3': GGATCCTTTTATTTCCAGCTTGGTCCCCCCTCCGAA (SEQ ID NO:7)
  • PRV H 20A-5' CCATGGTCCAAC TGCAGCAGTCAGGGCCTGAC (SEQ TD NO:8)
  • PRV H 20A-3' TGAGGAGACTGTGAGTTCGGTACCTT GGCC (SEQ TD NO:9)
  • PRV L 20A-5' GATGTTGTGATGACGCAGACTCCACTC (SEQ TD NO: 10)
  • PRV L 20A-3' GGATCCTT TGACTTCCAGCTTTGTGCCTCCA (SEQ ID NO: 11)
  • the resulting scFv contained a (Gly 4 Ser) 3 linker and is cloned into the expression vector pETlld, which is modified to fuse in frame with c-myc and the His tag peptide sequences, followed by an amber stop codon.
  • the resulting scFv contains a 17 a.a. residue linker, GGGGSGGGGSGGGGSGS (Gly 4 Ser) 3 GlySer (SEQ TD NO: 12) (
  • Constructs for the nDNA vaccination are fused in frame to the following defensins lacking the pro-sequence, as defensins are first produced as inactive pro- defensins, and are activated by proteolytic cleavage of the pro sequence.
  • the nucleic acids encoding murine ⁇ defensin-2 (Def2), murine ⁇ defensin-3(Def3), HNP- 1, HNP-2, HNP-3, HBDl, or HBD2 lacking their pro sequence are inserted into pCMVE/AB to enable secretion.
  • the carboxy-terminus of scFv is then fused in frame with the tag sequence encoding c-myc peptide and six His residues, respectively: GGA TCC GCA GAA GAA CAG AAA CTG ATC TCA GAA GAG GAT CTG GCC CAC CAC CAT CAC CAT CAC TAA CCCGGG (SEQ TD NO: 13).
  • Genes for the mature sequence (i.e., lacking the pro-sequence) of defensins HNP-1, HNP-2, HNP-3, HBDl, and HBD2, are cloned by RT/PCR technique from cell lines which are known in the art, and fused in frame with sFv utilizing suitable primers to form HNP-lsFv38, HNP- 2sFv38, HNP-3sFv38, HB lsFv38, and HBD2sFv38.
  • Murine beta defensin-2 and -3 are cloned by RT/PCR from the LPS -treated murine skin and fused in frame with model lymphoma derived sFv antigen, self tumor antigen (Def2sFv38 and Def3sFv38, respectively).
  • sFv fusion proteins with the pro-defensin form of each of the above listed defensins are prepared.
  • Def2, Def3 , HNP- 1 , HNP-2, HNP-3 , HBD 1 , and HBD2 fusions are made by fusing them to amino-terminus of scFv through a short spacer sequence: 5' GAA TTC AAC GAC GCT CAG GCG CCG AAG AGT CTC GAG 3' (SEQ TD NO: 14), encoding the amino acid sequence: EFNDQAPKSLE (SEQ TD NO: 15).
  • Two unique restriction endonuclease sites are introduced at the ends of the space to facilitate cloning: EcoRI at the 5' end (underlined) and Xhol at the 3' end (underlined). All constructs are verified by DNA dideoxy-sequencing method, using T7 SEQUENASE kit (Amersham).
  • Def2, Def3, HNP-1, HNP-2, HNP-3, HBDl, and HBD2 defensins are cloned into the scFv38 expression vector through Ncol and Xhol restriction sites.
  • the resulting fusion nucleic acid contains the defensin gene ligated to the 5 '-end of the scFv38 gene and separated with a short spacer sequence, as described above.
  • HNP-l-scFv38, , HNP-2 -scFv38, HNP-3 -scFv38, HBDl -scFv38, and HBD2 -scFv38 are purified from the inclusion bodies with a modified method (110).
  • inclusion bodies denatured in 6M Gu HCl, 100 mM NaH 2 PO 4 , 10 mM Tris-HCl, pH 8.0, are reduced in 0.3M DTE and refolded at a concentration of 80 ⁇ g/ml in the refolding solution (Tris-HCl, pH 8.0, 0.5M arginine- HCL, 4 mM GSSG and 2 mM EDTA) for 72 hours at 10°C.
  • the refolded solution is dialyzed in 100 mM Urea and 20 mM tris-HCl, pH 7.4 and the recombinant protein is purified by binding to heparin-sepharose resins (Pharmacia, Biotech, Uppsala, Sweden). The integrity and purity of the recombinant protein is tested by PAGE gel electrophoresis in reducing conditions and by Western blot hybridization with mAb 9E10. The purification yields 2-20 mg/1 of the soluble protein with greater than 90% purity.
  • IgM 38c 13 (Id38), as compared to positive sera from mice immunized with Id38-KLH.
  • ELISA plates are coated with 10 ⁇ g/ml Id38, then wells are incubated with anti-Id38 positive sera (1:500) and titrated amounts of scFv.
  • Id38 (10 ⁇ g /ml) and either Def2, Def3, HNP-1 scFv20, HNP-2 scFv20, HNP-3 scFv20, HBDl scFv20, or HBD2 scFv20 HNP-1, HNP-2, HNP-3, HBDl, and HBD2 defensins fused to an irrelevant scFv) are used as positive and negative control samples, respectively.
  • Recombinant fusion proteins purified from E.coli are characterized for proper idiotype folding by their ability to inhibit 38c 13 IgM binding to a monoclonal (SIC5 mAb) or polyclonal anti-idiotypic sera, in order to determine if Def2, Def3, HNP-1, HNP-2, HNP-3, HBDl, and HBD2 defensin fusions interfere with the proper conformation of scFv38.
  • defensin fusions including controls, are tested for their ability to induce chemotaxis of different subsets of immune cells, including splenocytes and bone marrow derived immature dendritic cells.
  • Both Def2sFv38 and Def3sFv38 induce chemotaxis of murine splenocytes and murine bone marrow derived immature DC in a dose dependent manner with the maximum migration to 10 ng/ml and 100 ng/ml of Def2sFv38 and Def3sFv38, respectively.
  • sFv38 In vivo immunization and tumor protection.
  • sFv38 immunogenic when immunized as a genetic vaccine in mice, ten mice per group are gene-gun immunized with plasmid encoding fusions with mature defensin fusions HNP-l-scFv38 , HNP-2 - scFv38 , HNP-3 -scFv38 , HBD 1 -scFv38 , and HBD2 -scFv38 , in order to demonstrate whether these fusions can target APC in vitro.
  • mice are immunized with the similar DNA constructs but encoding inactive pro-defensin fusions (designated, e.g., pproDef2sFv38).
  • Murine defensins induce significant anti- idiotype specific antibodies compared to the prototype Ig38-KLH protein vaccine.
  • no anti-idiotypic antibody response is seen after immunization with pro-defensin fusions.
  • non- immunogenic sFv is rendered immunogenic by mature defensins, and the response correlates with the ability to induce chemotaxis of immature DC and other APC.
  • mice immunized with defensin or control plasmids are challenged with a 20 -fold lethal dose of tumor two weeks after the last of three serial immunizations.
  • Control mice are immunized with inactive pro-defensin-sFv38 fusions or with corresponding active defensins fused with sFvA20 from irrelevant lymphoma A20 sFv or PBS.
  • Mice immunized with inactive pproDef2sFv38 do not survive.
  • significant protective immunity is elicited in mice immunized with pDef2sFv38 and pDef3sFv38.
  • the survival closely correlates with the presence of functionally intact or active defensins which can act on immature DC or other APC via differential expression of their receptors.
  • gene-gun bombarded DNA targets variety of sldn cells, including skin APC and LC, it is not sufficient to render self -tumor antigen (sFv) immunogenic because it requires physical linkage of sFv with defensin moieties.
  • sFv self -tumor antigen
  • mice Six- to nine- week old female C3H/HeN mice are immunized intraperitoneally (i.p.) with 100 to 200 ⁇ g of the soluble protein in PBS and control immunogen Id38- KLH two times at two week intervals or are shaved and immunized by ACCELL gene delivery device (Agracetus, Inc., Middleton, WN) with 1 ⁇ gold particles carrying 1-3 ⁇ g plasmid DNA. Sera are collected by orbital bleeding two weeks after each vaccination. Serum anti-idiotypic (anti-Id) antibody levels are tested as described (111) over microtiter plates coated with 10 ⁇ g/ml native IgM 38cl3.
  • mice Two weeks after the last immunization, mice are inoculated with 2000 38cl3 tumor cells i.p. Survival is determined, and significance with the respect to time to death, is assessed using BMDP TL software (BMDP statistical software, Los Angeles). Mice are observed daily for any signs of toxicity and date of death and animals surviving >80 days after tumor challenge are killed and reported as long-term survivors.
  • BMDP TL software BMDP statistical software, Los Angeles
  • mice are immunized either with a plasmid coding for Def2 -scFv38, Def3 - scFv38, HNP-1 -scFv38, HNP-2 -scFv38, HNP-3 -scFv38, HBDl -scFv38, HBD2 - scFv38, or a mixture of DNA constructs expressing unlinked scFv38 and vMMscFv20A (scFv38D+vMTPIscfv20AD).
  • mice per group are immunized with two types of scFv38 fused to Def2, Def3, HNP-1, HNP-2, HNP-3, HBDl, or HBD2, differing only in orientation of variable genes in scFv.
  • Control mice receive IgM-KLH (Id38-KLH) and the corresponding defensin fusion to A20 lymphoma scFv (TP10scFv20A).
  • mice per group are immunized i.d.
  • mice injections of 400 ⁇ g ⁇ -CD8 mAb 53.6.72, or -CD4 mAb GK1.5 (both ammonium sulfate purified ascites, Biological Resource Branch, NCI- FCRDC) (32,34), or control rat IgG (Sigma).
  • Control mice are immunized with plasmid expressing Def2, Def3, HNP-1, HNP-2, HNP-3, HBDl, or HBD2 fused to A20 scFv (MCP3scFv20AD).
  • mice per group are immunized i.p. twice with 100 ⁇ g of Def2, Def3, HNP-1, HNP-2, HNP-3, HBDl, or HBD2 fused with scFv20A protein in PBS and challenged i.p. with 10 5 A20 tumor cells.
  • defensin-scFv20A is co- injected with the same defensin fused to an irrelevant scFv38 (defensin-scFv20A + defensin-scFv38).
  • Control mice are immunized with A20 IgM-KLH (Id20A-KLH).
  • Immunoassays and serum anti-idiotypic antibody The assessments for correct folding of purified scFv38 and fusion scFv38 are determined by ELISA with mAbs and by inhibition assay with Id38-KLH sera (immunized with native IgM 38c 13 conjugated to KLH). Briefly, microtiter plates (Nunc, Naperville, IL) are coated overnight at 4°C with 10 ⁇ g/ml anti-c-myc mAb 9E10 in carbonate buffer (50 mM NaHCO 3 , pH 9.0). The wells are blocked with 5% nonfat dry milk in PBS for 30 min.
  • Plates are washed in 0.05% Triton X-100 in PBS, and serially diluted scFv (starting from 10 ⁇ g/ml in 50 ⁇ l 2% BSA/PBS) is applied, after which plates are incubated 40 min at room temperature. After washing, the wells are incubated with 50 ⁇ l of 1:300 diluted biotinylated anti-Id38 mAb in 2% BSA/PBS for 30 min at room temperature. Wells are washed and incubated with streptavidin-HRP conjugate (1:5000) in 2%
  • Serum anti-idiotypic (anti-Id) antibody levels are tested as described (37). Briefly, mouse serum is serially diluted over microtiter plates coated with 10 ⁇ g/ml native IgM 38cl3. Binding of antibodies in the serum to 38cl3 IgM is detected by goat anti-mouse IgG-HRP. Serum anti-Id antibody levels are quantitated by comparing sera titration curves with a standard curve obtained with a known concentration of a mixture of purified monoclonal anti-Id antibodies. Antibody levels are expressed in g/ml of serum for individual mice. In each ELISA, sera obtained from mice immunized with control IgM-KLH are included as negative controls. Such sera never showed any titration binding activity on Id-38cl3.
  • a 26 ⁇ l aliquot of the recombinant scFv fusion protein serially diluted in the chemotaxis medium (RPMI 1640, 1% BSA, 25 mM HEPES) is placed in the lower compartment and 50 ⁇ l of cell suspension (5xl0 6 cells/ml) is placed in the upper compartment of the chamber.
  • the two compartments are separated by a polycarbonate filter (5 ⁇ m pore size; Neuroprobe, Cabin John, MD) coated with 10 ⁇ g/ml of fibronectin (Sigma, St. Luis, MO) and incubated overnight at 4°C or for 2 hours at 37°C.
  • the chemotaxis assay is performed at 37°C for 2 hours.
  • C3H/HeN mice are injected s.c. with a single 10 ⁇ g dose of scFv fusion proteins. Portions of the skin from the site of injection are removed 72 hours after the injection, fixed in 10 % neutral buffered formalin, embedded in paraffin, sectioned at 5 ⁇ m and stained with hematoxylin and eosin (H&E). Slides are evaluated microscopically without knowledge of the experimental treatment.
  • mice In vivo cellular infiltration into murine skin.
  • the numbers of PMN and mononuclear (MN) cells infiltrated into murine skin are graded as following: - , no significant lesion; 1, mild; 2, moderate; 3 severe; F, focal; MF, multi focal.
  • Mice are injected with 10 ⁇ g of Def2 -scFv38, Def3 -scFv38, HNP-1 -scFv38, HNP-2 -scFv38, HNP-3 -scFv38, HBDl -scFv38, and HBD2 -scFv38, or PBS, subcutaneously.
  • the injection site is excised and examined histologically on coded slides to determine the extent of infiltration.
  • the amount of endotoxin injected with samples is 0.5-1 units.
  • KLH is not effective.
  • scFv38 single chain antibody fragments from 38c 13 cells in E.coli. Yield of scFv38 differs significantly depending on the method used. Production of scFv38 through a secretory path using a PelB leader sequence as a native protein is least efficient. The problem is solved when scFv38 is produced as insoluble "inclusion" bodies, which yield about 2-8 mg of refolded scFv per liter of the batch culture with greater than 90% purity.
  • Folding properties of the produced scFv38 are monitored by either (i) inhibition assay with native Id38; or (ii) modified ELISA assay where scFv38 is captured through an anti-c-myc tag and detected with the biotinylated monoclonal anti-Id38 antibody (anti-Id38 mAb does not recognize linear or incorrectly folded epitope).
  • anti-Id38 mAb does not recognize linear or incorrectly folded epitope.
  • Def2 -scFv38, Def3 - scFv38, HNP-1 -scFv38, HNP-2 -scFv38, HNP-3 -scFv38, HBDl -scFv38, andHBD2 - scFv38 are subcloned from the relevant cell lines by RT/PCR using specific primers as described herein and inserted in frame in front of the scFv38 DNA sequence.
  • the resulting fusion genes are designated as Def2 -scFv38, Def3 -scFv38, HNP-1 -scFv38, HNP-2 -scFv38, HNP-3 -scFv38, HBDl -scFv38, and HBD2 -scFv38, respectively.
  • two variants of fusion defensin-scFv genes are designed, one containing a V H -V L and one containing a V L -V H sequence, respectively designated as scFv38MH and scFv38(TNV)MH.
  • All fusion proteins used in these experiments are purified from inclusion bodies of E.coli, solubihzed and refolded as described herein.
  • a spacer sequence, as described herein, is introduced into the defensin fusion proteins and correct folding is tested for each recombinant protein.
  • HNP-3 -scFv38, HBDl -scFv38, and HBD2 -scFv38 proteins to induce chemotaxis in vivo in C3H/HeN mice is also tested.
  • Mice are s.c. injected once with 10 ⁇ g of the fusion protein and after 72 hours, the skin around the site of injection is removed and analyzed as described herein.
  • fusion polypeptides comprising a human defensin and a human tumor antigen or HIV antigen.
  • Tumor or viral antigen is cloned by PCR or RT/PCR from DNA or RNA of biopsy cells of a patient, using specific primer.
  • the primers are made using standard methods for selecting and synthesizing primer sequences from analysis of known sequences of the genes of interest (e.g., from GenBank, Kabat lg sequence database and other available genetic databases, as are known in the art).
  • lymphoma or myeloma-specific scFv is cloned by RT/PCR from the nucleic acid from a patient's lymphoma or myeloma biopsy cells or from nucleic acid from hybridoma cells expressing the patient's immunoglobulin.
  • Several sets of primers are used to clone human variable (V) genes based on GenBank and Kabat IG sequence data.
  • V human variable
  • scFv human tumor V fragments are cloned and sequenced using a family-specific primer or primer mixture for leader and constant region sequences.
  • scFv is constructed using primers based on the sequence of each N gene cloned.
  • primers can have specific restriction endonuclease sites to facilitate routine cloning, or scFv is made by overlapping PCR, according to methods well known in the art.
  • the vector expressing the fusion polypeptide can contain several unique restriction endonuclease sites (e.g., Xhol, BamHI) between the 3' end of the spacer sequence and the 5' end of the c-myc and six His tag sequences, or the 5' end of the polyA transcription terminator region (if a Smal site is used), thus enabling routine cloning of any scFv, tumor antigen or viral antigen.
  • restriction endonuclease sites e.g., Xhol, BamHI
  • nucleic acid encoding the defensin-tumor antigen fusion polypeptides of this invention is expressed in yeast (e.g., Saccharomyces cerevisiae; Pichiapastoris, etc.) or in mammalian cell culture according to methods standard in the art.
  • yeast e.g., Saccharomyces cerevisiae; Pichiapastoris, etc.
  • the proteins produced in these systems are affinity purified with anti-c-myc antibodies (e.g., 9E10; M5546, Sigma) or anti-poly-His antibodies (e.g., H1029, Sigma).
  • immobilized metal chelate affinity chromatography ⁇ i- ⁇ TA resin, Qiagen is used for purification of soluble or refolded fusion polypeptides.
  • fusion polypeptides to human subjects. Immunity and suppression of tumor growth in a human subject.
  • a fusion polypeptide comprising a defensin and a tumor antigen which is present in the human subject is administered to the subject subcutaneously in a dose ranging from 1 to 500 ⁇ g of the fusion polypeptide once weekly for about eight weeks or once monthly for about six months.
  • blood samples can be taken from the subject and analyzed to determine the effects of administration of the fusion polypeptide.
  • the presence in the subject's serum, of antibodies reactive with the tumor antigen in the fusion protein can be determined by ELISA, Western blotting or radioimmunoprecipitation, or other methods for detecting the formation of antigen/antibody complexes as would be standard practice for one of ordinary skill in the art of immunology.
  • a cellular immune response to the tumor antigen in the fusion polypeptide can be detected by peripheral blood lymphocyte (PBL) proliferation assays, PBL cytotoxicity assays, cytokine measurements, or other methods for detecting delayed type hypersensitivity and cellular immune response, as would be standard practice for one of ordinary skill in the art of immunology.
  • PBL peripheral blood lymphocyte
  • the kinetics of tumor growth and inhibition of tumor cell growth can be determined by monitoring the subject's clinical response, through physical examination, tumor measurement, x-ray analysis and biopsy.
  • the exact dosage can be determined for a given subject by following the teachings as set forth herein, as would be standard practice for one of ordinary skill in the art of vaccine development.
  • this example demonstrates that protective antitumor immunity can be obtained by targeting immature, but not mature DC.
  • MTP-3o. and ⁇ -defensins render otherwise non-immunogenic tumor antigens immunogenic and induce protective and therapeutic antitumor immunity.
  • immunizations with homeostatic chemokines SLC or SDFl ⁇ do not elicit antitumor immunity. While both humoral and cellular immune responses are useful for treatment of the more aggressive 38C13 tumor that expresses IgM primarily on its surface (Campbell,MJ., L.Esserman, N.E.Byars, A.C.Allison, and R.Levy. 1990.
  • the breadth of the disclosed compositions and methods as useful for vaccines was also made apparent by the ability to elicit for the first time eradication of established A20 lymphoma. Fusion gene cloning and plasmid constructions. Cloning strategy for lymphoma specific V H and V L fragments from 38C13 (Bergmanm Y. and Haimovich, J. 1977. Characterization of a carcinogen-induced murine B lymphocyte cell line of C3H/eb origin. J.Immunol. 7: 413) and A20 (Kim, K. J., Kanellopoulos, Langevin C, Merwin, R. M., Sachs, D. H., and Asofsky, R. 1979.
  • ⁇ -defensin 2 (GeneBank # AJ011800) PRmDF2 ⁇ -5' (ACCATGGAACTTGACCACTGCCACACC; SEQ TD NO:16) and PRmDF2 ⁇ -3' (TGAATTCAAGATCTTTCATGTACTTGCAACAGGGGTTGTT; SEQ TD NO: 17) and for ⁇ -defensin 3 (GeneBank # AF092929) PRmDF3 ⁇ -5' (ACCATGGAAAAAATCAACAATCAGTAAGTTGTTTGAGG; SEQ TD NO: 18) and PRmDF3 ⁇ -3' (CTCGAGCTAGAATTCTTTTCTCTTGCAGCATTTGAGGAAA; SEQ ID NO:61).
  • ⁇ -pro-defensin 2 gene was cloned for eukaryotic expression using PRproDF2 ⁇ L-5' (AAAGCTTCCACCATGAGGACTCTCTGCTCT; SEQ TD NO: 19) and PRmDF2 ⁇ -3', which contained a native secretion signal sequence.
  • SDF-1 ⁇ (GeneBank # HSU16752) was cloned from 10 ng/ml LPS treated human monocytes using PRhSDFl ⁇ -5' (CTCTAGACACCATGAACGCCAAGGTCGTGGTCGTGCTG; SEQ ID NO:20) and PRhSDFl ⁇ -3'
  • Murine MTP-30 (GeneBank # AJ222694) was cloned from a mixture of thymus and kidney cDNA using PRmMTP3 ⁇ -5' (ACCATGGCAAGCAACTACGACTGTTGCCTC; SEQ ID NO:22) and PRmMTP3 ⁇ -3' (ATAGAATTCCATCTTCTTGACTCTTAGGCTGA; SEQ ID NO:23).
  • Murine SLC (GeneBank # U88322) was recloned from the plasmid (Dr. Shakhov, SAIC-Frederick) using PRmSLC-5'
  • Recombinant fusion proteins were purified as inclusion bodies after 8 hours of induction in Super-Broth (Digene Diagnostics, Inc., Beltsville, MD) with 0.8 mM TPTG as described elsewhere (Biragyn, A., Tani, K., Grimm, M. C, Weeks, S. D., and Kwak, L. W. 1999. Genetic fusion of chemokines to a self tumor antigen induces protective, T- cell dependent antitumor immunity. Nature Biotechnology 17: 253), and refolded according to Buchner et al. (Buchner, J., Pastan, L, and Brinkmann, U. 1992.
  • Erythrocytes were lysed with ACK lysis buffer (BioWhittaker, Walkersville, MD).
  • CD8 + , CD4 + , B220 + and I-A b cells were depleted using a mixture of mAbs and rabbit complement.
  • the mAbs were TIB-146 (anti-B220), TIB- 150 (anti-CD8), TTB-207 (anti-CD4), TD3-229 (anti- I-A b ) obtained from the ATCC.
  • DC medium RPMI 1640 containing 5% heat inactivated fetal bovine serum, 1% penicillin, streptomycin, 1% L-glutamine and 5xl0 "5 2-ME
  • Adherent cells were harvested on day 4 and day 7 and used in subsequent experiments.
  • DC were matured by TNF ⁇ (10 ng/ml, PharMingen), overnight in DC medium.
  • iDC at day four • -five cultivation were in general CDll + (69%), B7.2 + and I-A b+ (21%), B7.2 " and I- A b+ (18%), CD40 + (27%).
  • the DC were GDI lc + (87%), B7.2 + and I- A b+ (62%), B7.2 " and I-A + (3%), CD40 + (87%).
  • the following mAb were used in FACS analysis: CD-llc-APC, MAC3-PE, Gr-1-FTTC, B220-PE, Thy 1.2-FITC, I-A b -FTTC, B7.2-PE, CD40-PE (PharMingen).
  • HEK293/CCR6 Murine CCR6-expressing HEK293 cells (HEK293/CCR6) were obtained from Dr. J. Farber (NIATD/NIH).
  • HEK293/CCR6 or HEK293 Trypsinized 2.5xl0 6 (HEK293/CCR6 or HEK293) cells/ml were incubated with 20 mg/ml biotinilated mMTP3asFv38 for 30 min on ice in PBS with 2% BSA (PBS/BSA) and 20% mouse sera. Cells were stained on ice for 30 min with 0.2 mg/ml Streptavidin-PE (Pharmingen) and fixed with 1% paraformaldehyde.
  • mice were challenged i.p. with 2 xlO 3 or 2.5xl0 5 38C13 or A20 lymphoma cells, respectively, and followed for survival. Differences in survival between groups were determined by non-parametric logrank test (BMDP statistical software, Los Angeles). P-values refer to comparison with groups immunized with DNA expressing the same chemoldne or defensin fused with an irrelevant sFv, or sFv fused with mutant chemoldne, unless specified.
  • mice Six- to nine- week old female BALB/c mice (ten per group) were challenged with 2.5xl0 5 syngeneic A20 tumor cells. At day 1, 4, 8 and 18 these mice were gene-gun immunized with DNA plasmid (containing about 1-2 mg DNA per immunization) and mice followed for tumor progression.
  • BALB/c mice were gene gun immunized with 1-2 mg pMCP3sFv20 twice biweekly and splenocytes and sera were removed ten days after the last immunization.
  • Ten BALB/c mice per group were i.p. injected in saline with 2.5xl0 5 A20 tumor cells per mouse mixed with 2xl0 7 splenocytes or sera from immune or mock treated mice and mice followed for tumor progression.
  • Murine ⁇ -defensins and chemokines retain their functional integrity as fusion proteins with sFv and chemo-attract immature DC but not mature DC.
  • sFv fusion proteins with murine inflammatory chemoldne MIP-3 a, murine ⁇ -defensin 2 and ⁇ -defensin 3 were designated mMTP3 ⁇ sFv38, mDF2 ⁇ sFv38 and mDF3 ⁇ sFv38, or mMIP3 sFv20, mDF2 ⁇ sFv20 and mDF3 ⁇ sFv20, respectively.
  • sFv fusion proteins with homeostatic chemokines SLC and SDFl ⁇ were designated mSLCsFv38 and SDFl ⁇ sFv38, respectively.
  • Control proteins contained either sFv fusions with mutant chemoldne, generated by replacing the first Cys residue with Ser or by truncation of the amino- termini to abrogate a respective receptor binding, or an inactive form pro-defensin 2, ⁇ -defensin 2 with its pro-sequence (mproDF2 ⁇ sFv38, Table 1). All fusion proteins had comparable idiotype folding, as tested by inhibition ELISA with monoclonal anti-Id antibodies, which bind only properly folded parental lymphoma Id.
  • murine MIP-3o a ligand of CCR6 fusion protein (mMTP-3 ⁇ sFv38). Both fusion proteins ⁇ -defensin 2 and 3, but not fusion protein ⁇ -defensin 2 containing pro- sequence (mproDF2 ⁇ 2sFv38) or control viral chemoldne (vMTPlMsFv38), chemo- attracted murine CCR6 expressing cells, in a dose dependent manner.
  • a control parental cell line, HEK293, which does not express CCR6 was not attracted to these proteins.
  • both ⁇ - defensin fusion proteins induced chemotaxis of immature DC in a dose dependent manner with peak activity at 10 ng/ml and 100 ng/ml for mDF2 ⁇ sFv38 and mDF3bsFv38, respectively.
  • the predominant immature phenotype of these DC was also supported by their ability to migrate to human MIP-3 a, a chemo-attractant specific for CCR6 + immature DC (Dieu, M. C, Nanbervliet, B., Nicari, A., Bridon, J.
  • J.Immunol 163(4): 1737 J.Immunol 163(4): 1737
  • their limited ability to react to human MTP-3 ⁇ Sallusto, F., Palermo, B., Lenig, D., Montgomeryn, M., Matikainen, S., Julkunen, I., Forster, R., Burgstahler, R., Lipp, M., and Lanzavecchia, A. 1999. Distinct patterns and kinetics of chemoldne production regulate dendritic cell function.
  • Eur.J.lmmunol 29(5): 1617 a chemo-attractant specific for CCR7 + mature DC.
  • mice Ten mice per group were immunized by gene gun with plasmids encoding fusion proteins consisting of mature forms of ⁇ -defensins (pmDF2 ⁇ sFv38 and pmDF3 ⁇ sFv38, respectively) or MTP-3c.
  • mice were immunized with DNA constructs encoding sFv fused with inactive pro-defensin (pproDF2 ⁇ sFv38), or mutated and inactive chemokines (pvMC148MsFv38). No antibody was generated when mice were immunized with 2 ⁇ g DNA expressing a mixture of plasmids containing unlinked sFv and murine ⁇ -defensin (pmDF3 ⁇ Mucl + sFv38) or chemoldne.
  • pproDF2 ⁇ sFv38 inactive pro-defensin
  • pvMC148MsFv38 mutated and inactive chemokines
  • mice immunized with plasmids encoding sFv fusion proteins with murine ⁇ -defensins, M-P-3 ⁇ or SLC produced idiotype-specific antibody levels comparable to the levels induced by vaccination with tumor-derived intact lg protein conjugated to KLH.
  • control mice immunized with an inactive pro- ⁇ -defensin (pproDef2 ⁇ sFv38) or mutant chemokine sFv fusion constructs (pvMC148MsFv38), or sFv38 alone did not produce any anti-Id antibody responses.
  • ⁇ -defensin 3 was superior to ⁇ -defensin 2 for induction of specific antibodies to every antigen tested.
  • ⁇ -defensin fusion vaccines elicit protective and therapeutic antitumor immunity.
  • the vaccine protocol used to elicit protective antitumor immunity was as follows. First, immunizing mice with 2 ⁇ g of DNA constructs three times with biweekly intervals, then, two weeks after the last immunization, challenging them with a 20-fold lethal dose of syngeneic tumor. No survival was observed in control groups immunized with PBS or plasmids encoding sFv38 fused with inactive pro- ⁇ -defensin-2 (pproDef2 ⁇ sFv38), with irrelevant chemoldne plasmid vaccines pMDC-EGFP or with mutant constructs pMC148MsFv38.
  • mice immunized with pmDF2 ⁇ sFv38 or ⁇ mDF3 ⁇ sFv38 by log-rank test, p ⁇ 0.001 and 0.004 as compared with pproDF2 ⁇ sFv38 and ⁇ MC148MsFv38, respectively.
  • the protection elicited with both ⁇ -defensin constructs was comparable to one induced by Ig-KLH protein vaccine, a prototype vaccine that consists of lymphoma derived IgM cross-linked with KLH, being successfully tested in a Phase m clinical trial (Bendandi, M., Gocke, C. D., Kobrin, C. B., Benko, F.
  • mice immunized with constructs encoding sFv fusion with homeostatic chemoldne murine SLC were protected (pmSLCsFv38, by log-rank test, p ⁇ 0.02 compared with pmMTP3c. sFv38), despite the fact that this SLC fusion construct generated anti -Id specific antibodies comparable to pmMTP3 ⁇ sFv38-vaccinated group.
  • no immunity was detected in mice immunized with constructs expressing human SDFl ⁇ , which binds to murine CXCR4.
  • the fusion constructs were used to demonstrate treatment of an established tumor.
  • the A20 model Kanellopoulos, Langevin C, Merwin, R. M., Sachs, D. H., and Asofsky, R. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J.Immunol. 122(2): 549), which is relatively slower growing, was used to demonstrate the therapeutic potency of the approach. The therapeutic efficacy of the DNA constructs was assessed.
  • mice per group were challenge with 2.5 X 10 s tumor cells and immunized with 2 ⁇ g of DNA construct encoding M-P-32 and ⁇ -defensin 2 and 3 fusions with sFv20 (pmMIP3 ⁇ sFv20, pmDF2 ⁇ sFv20 and pmDF3 ⁇ sFv20), starting one day after challenge with a lethal dose of A20 tumor, followed by three booster vaccinations at 4, 8 and 18 days post tumor challenge.
  • sFv20 pmMIP3 ⁇ sFv20, pmDF2 ⁇ sFv20 and pmDF3 ⁇ sFv20
  • a superior antibody response was also generated by vaccinating with A20 lymphoma derived Ig-KLH protein (Biragyn, A., Tani, K, Grimm, M. C, Weeks, S. D., and Kwak, L. W. 1999. Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity. Nature Biotechnology 17: 253), though it was not sufficient to elicit both protective (Biragyn, A., Tani, K, Grimm, M. C, Weeks, S. D., and Kwak, L. W. 1999. Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity.
  • mice/group 10 naive BALB/c mice/group were subjected to adoptive transfer of a lethal dose of A20 tumor mixed with sera or splenocytes from immune mice. No protection was observed in mice injected with A20 tumor mixed with immune serum. However, the mice that received splenocytes from mice immunized with pMCP3sFv2O, but not from mock-treated mice, exhibited significant prolongation of survival (by log-rank test, p ⁇ 0.01; Fig. AC.
  • mice challenged with a lethal dose of syngeneic 38C13 tumor exhibited no protection.
  • mice per group were immunized with either pmDF3 ⁇ sFv38 alone or mixed with DNA encoding ⁇ -defensin fused with irrelevant antigen (pmDF3 ⁇ MuclT).
  • Sera from mice immunized with a plasmid encoding sFv protein fused with murine ⁇ -defensin 3 by itself or in the presence of an irrelevant plasmid contained about 300 ⁇ g/ml idiotype-specific antibodies on average, which was two-three fold higher than the levels induced by vaccination with tumor- derived intact lg protein conjugated to KLH.
  • mice immunized with pmDF3 ⁇ sFv38 were protected (by log-rank test, p ⁇ 0.001 as compared with pmDF3 ⁇ MuclT).
  • mice When mice are vaccinated by cutaneous DNA bombardment, LC and DC residing in the skin can take up, express, and present sFv Ag directly. Alternatively, these cells might be primed by chemokine-sFv protein expressed and secreted by bystander cells. To distinguish between these two possibilities, mice were immunized with MCP-3 fusion constructs with or without a secretory leader sequence (pMCP3sFv38 and pMCP3sFv38-w/o-SL, respectively). High levels of Id-specific Abs were detected in mice immunized with pMCP3sFv38 containing an intact secretory leader.
  • mice immunized with pMCP3sFv38-w/o-SL no Abs were elicited in mice immunized with pMCP3sFv38-w/o-SL.
  • tumor protection was elicited only in those mice immunized with pMCP3sFv38, but not in those immunized with pMCP3sFv38-w/o-SL (by log-rank test, p ⁇ 0.001; Fig. 5B).
  • no protection was detected in mice immunized with DNA expressing a secretable, but mutated, MCP-3 fusion protein, which could not bind the respective receptor (pMCP3MsFv38).
  • lymphoma idiotype a non-immunogenic tumor antigen, lymphoma idiotype (Stevenson, F. K, Zhu, D., King, C. A., Ashworth, L. J., Kumar, S., and Hawkins, R. E. 1995. Idiotypic DNA vaccines against B-cell lymphoma. Immunol.Rev. 145: 211), is rendered immunogenic when genetically fused with defensins or with MIP-3 . This immunity is correlated with the ability of murine ⁇ -defensin 2 and 3 to induce chemotaxis of murine bone marrow derived immature, but not mature DC.
  • Cutting edge immature dendritic cells generated from monocytes in the presence of TGF-beta 1 express functional C-C chemokine receptor 6. J.Immunol 163(4): 1737), but the murine ⁇ -defensin receptor has not yet been identified. It is demonstrated herein for the first time that both murine J-defensins 2 and 3 also bind to CCR6, although the possibility that ?-defensins bind to other receptors (and cells) is not excluded.
  • the g l20 gene was cloned from the plasmid DNA containing a portion of HTV-1 (isolate 89.6) in frame with the IP-10 secretion signal sequence (pgpl20), using primers PRM89.6ENV-5' (AAAGTCGACAAAGAAAAAAAACGTGGGTCACAATCT; SEQ ID NO:26) and PR89.6ENV-3' (ATTCCCGGGTTATTTTTCTCTTTGCACTGTTCTTCTC; SEQ ID NO: 27). Cloning strategy for lymphoma and chemoldne genes has been reported elsewhere (Biragyn, A., Tani, K., Grimm, M. C, Weeks, S.
  • the gene for human MDC was cloned from LPS- trated (10 ng/ml) human monocytes using primers PRhMDC-5' (CTCTAGACACCATGGCTCGCCTACAGACTGCACT; SEQ TD NO:28) and PRhMDC-3' (TGAATTCTTGGCTCAGCTTATTGAGAATCA; SEQ TD NO:29) and murine ⁇ -defensin 2 (GeneBank # AJ011800) and ⁇ -defensin 3 (GeneBank #
  • AF092929 genes were cloned from LPS -treated (10 ng/ml) Balb/c mouse skin cells using the following pairs of primers, respectively: PRmDF2 ⁇ -5' (ACCATGGAACTTGACCACTGCCACACC; SEQ ID NO:30) and PRmDF2 ⁇ -3' (TGAATTCAAGATCTTTCATGTACTTGCAACAGGGGTTGTT; SEQ ID NO:31) and PRmDF3 ⁇ -5 ' (ACCATGGAAAAAATCAACAATCAGTAAGTTGTTTGAGG; SEQ ID NO:32) and PRmDF3 ⁇ -3'
  • the gene encoding gpl20 was fused in frame with coding sequences from murine ⁇ - defensin 2 or 3, hMDC and hMCP3, to generate DNA constructs pmDF2 ⁇ gpl20, pmDF3 ⁇ g ⁇ l20, ⁇ hMDCgpl20 and phMCP3g ⁇ l20, respectively.
  • Chemokines and defensins were fused with gpl20 through a spacer sequence NDAQAPKS (SEQ TD NO:35).
  • C. I. chemotactic index
  • MIP-3 ⁇ and MTP-3 ⁇ were purchased from PeproTech (Rocky Hill, NJ).
  • HIV-1 env antibody and CTL assays Five BALB/c female mice per group were immunized with DNA plasmids four times using a gene gun. Two weeks after the last immunization, HTV-1 89.6 env specific CTL was assessed in spleens and Peyer's patches, as described elsewhere (Belyakov, I. M., Derby, M. A., Ahlers, J. D., Kelsall, B. L., Earl, P., Moss, B., Strober, W., and Berzofsky, J. A. 1998.
  • Mucosal immunization with HTV-1 peptide vaccine induces mucosal and systemic cytotoxic T lymphocytes and protective immunity in mice against intrarectal recombinant HTV-vaccinia challenge.
  • immune cells from spleen or Peyer's patch were cultured at 5xl0 6 per/milliliter in 24-well culture plates in complete T cell medium (CTM): RPMI 1640 containing 10% fetal bovine serum, 2 mM L-glutamine, penicillin (lOOU/ml), streptomycin (100 mg/ml), and 5x 10 "5 M 2-mercaptoethanol.
  • CTM complete T cell medium
  • the percent specific 51 Cr release was calculated as 100X (experimental release-spontaneous release)/(maximum release - spontaneous release). Maximum release was determined from supematants of cells that were lysed by addition of 5% Triton-X 100. Spontaneous release was determined from target cells incubated without added effector cells (Belyakov, I. M., Derby, M. A., Ahlers, J. D., Kelsall, B. L., Earl, P., Moss, B., Strober, W., and Berzofsky, J. A. 1998.
  • Mucosal immunization with HTV-1 peptide vaccine induces mucosal and systemic cytotoxic T lymphocytes and protective immunity in mice against intrarectal recombinant HTV-vaccinia challenge. Proc.Natl.Acad.Sci.U.S.A 95(4): 1709).
  • Serum anti-env antibodies were assessed by ELISA on 5 mg/ml gpl20 protein from isolate 89.6 produced in vaccinia virus coated 96-well plates. The bound antibodies were detected by goat anti-mouse Ig-HRP mAb (Caltag) and developed with ABTS peroxidase substrate (KPL, Gaithersburg, MD).
  • Mammalian expression plasmid vectors were constructed by cloning gpl20 alone (pgpl20), or as fusion constructs of gpl20 with ⁇ -Defensin 2 or 3, human MDC or MCP-3, respectively (pmDF2 ⁇ gpl20, pmDF3 ⁇ gpl20, pMDCgpl20 and pMCP3gpl20; Table 2). All constructs expressed equivalent amounts of gpl20 when transfected transiently in 293 cells.
  • fusion proteins with proinflammatory chemokines or murine ⁇ -defensins generally retained chemokine functional integrity, such as chemo-attraction of murine bone-marrow derived immature, but not mature DC (see Example 3).
  • BALB/c mice were immunized four times biweekly using a gene gun with DNA plasmids encoding gpl20 alone, or fusion constructs of gpl20 with ⁇ -Defensin 2 or 3, human MDC or MCP-3 ( ⁇ gpl20, pmDF2 ⁇ gpl20, pmDF3 ⁇ gpl20, ⁇ MDCgpl20 and pMCP3gpl20, respectively).
  • mice Two weeks after the last immunization, sera from these mice were tested for gpl20 antibodies using recombinant g l20 produced in vaccinia virus.
  • control mice immunized with DNA encoding gpl20 alone did not induce any anti-gpl20 antibody (Putkonen, P., Quesada-Rolander, M., Leandersson, A. C, Schwartz, S., Thorstensson, R., Okuda, K., Wahren, B., and Hinkula, J. 1998. Immune responses but no protection against SHIN by gene-gun delivery of HIN-1 D ⁇ A followed by recombinant subunit protein boosts. Virology 250(2): 293).
  • D ⁇ A fusions were used to induce anti-gpl20 cellular responses.
  • Spleen cells from mice immunized with ⁇ -defensin 2 or MCP-3 fusion constructs demonstrated significant lysis of P815 target cells pulsed with HJV-1 89.6 A9 peptide (pmDF2 ⁇ gpl20 and phMCP3gl20, respectively, pulsed vs. unpulsed targets).
  • no CTL were detected in mice immunized with pgpl20 alone or PBS.
  • expressed fusion proteins may induce expression of co-stimulatory molecules and production of pro-inflammatory cytokines by various subsets of immature DC in vivo.
  • Thl or Th2 cells could be differentially attracted by chemokines, thus modulating immunity.
  • MCP-1 stimulates IL-4 production (Karpus, W.J., N.W. Lukacs, K.J. Kennedy, W.S. Smith, S.D. Hurst, and T.A. Barrett. 1997. Differential CC chemokine- induced enhancement of T helper cell cytokine production.
  • tumor antigen fusion constructs with both MCP-3 and ⁇ -defensin 2 induced moderate antibody production and significant therapeutic antitumor immunity (see Example 3). Therefore, these data show that preferential immunity may be elicited by differential use of chemokines or defensins.
  • the disclosed compositions and methods represent a very efficient and simple approach to generate systemic and mucosal immunity.
  • antigens elicit effective immunity when they are targeted to APC, particularly immature DC, via chemokine receptors as fusions with proinflammatory chemokines or factors.
  • proinflammatory factors such as murine ⁇ -defensins induce chemotaxis of immature, but not mature, DC and can serve effectively as a carrier for targeting antigens to APC.
  • Non-immunogenic tumor antigens or xenogeneic HIV g l20 antigen were rendered effectively immunogenic when immunized as a fusion with murine ⁇ -defensin 2.
  • Kaposi' s sarcoma virus-derived chemoldne analogues of human MTP-ls designated vMTPl and vMIP2
  • Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6. Nat.Med.
  • the Kaposi's sarcoma-related herpesvirus (KSHV)-encoded chemokine vMTP-I is a specific agonist for the CC chemoldne receptor (CCR)8. J.Exp.Med. 189:(12)1993- 1998) and antagonist MC148, expressed by Molluscum contagiosum virus (MCV) (Luttichau, H.R., J. Stine, T.P. Boesen, A.H. Johnsen, D. Chantry, J. Gerstoft, and T.W. Schwartz. 2000.
  • MCV Molluscum contagiosum virus
  • Haimovich. 1977 Characterization of a carcinogen-induced murine B lymphocyte cell line of C3H/eb origin. J.Immunol. 7:413-417) and A20 (Kim, K.J., L.C. Kanellopoulos, R.M. Merwin, D.H. Sachs, and R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J.Immunol. 122:(2)549-554) cells as sFv38 and sFv20, respectively, has been reported elsewhere (Biragyn, A., K. Tani, M.C. Grimm, S.D. Weeks, andL.W. Kwak. 1999.
  • genes for human MDC (GeneBank # HSU83171) and SDF-l ⁇ (GeneBank # HSU16752) were cloned from LPS-treated (10 ng/ml) human monocytes using respectively pairs of primers PRhMDC-5' (CTCTAGACACCATGGCTCGCCTACAGACTGCACT; SEQ ID NO: 37) and PRhMDC-3' (TGAATTCTTGGCTCAGCTTATTGAGAATCA; SEQ ID NO:38); and PRhSDFl ⁇ -5' (CTCTAGACACCATGAACGCCAAGGTCGTGGTCGTGCTG; SEQ ID NO:39) and PRhSDFl ⁇ -3' (TGAATTCCATCTTGAACCTCTTGTTTAAAGCTTT; SEQ ID NO.-40).
  • Murine ⁇ -defensin 2 (GeneBank # AJ011800) and ⁇ -defensin 3 (GeneBank # AF092929) genes were cloned from LPS (10 ng) Balb/c mouse skin using pairs of primers, respectively PRmDF2 ⁇ -5' (ACCATGGAACTTGACCACTGCCACACC; SEQ ID NO-.41) and PRmDF2 ⁇ -3' (TGAATTCAAGATCTTTCATGTACTTGCAACAGGGGTTGTT; SEQ ID NO:42) and PRmDF3 ⁇ -5' (ACCATGGAAAAAATCAACAATCAGTAAGTTGTTTGAGG; SEQ ID NO:43) and PRmDF3 ⁇ -3'
  • Viral chemokine genes vMIP-I (GeneBank # KSU74585) and vMIP-II (GeneBank # KSU67775) were cloned from BCBL-1 lymphoma cell line infected with HHV-8 (NIH AIDS Research & Ref. Reag.
  • the MC148 chemokine gene (GeneBank # U96749) was cloned from plasmid DNA containing a portion of the Moluscum contagiosum virus type 1 genome (Damon, I., P.M. Murphy, and B. Moss. 1998. Broad spectrum chemoldne antagonistic activity of a human poxvirus chemoldne homolog. Proc.Natl.Acad.Sci. U.S.A 95:(11)6403-6407) using primer pairs PRMC148L-5'
  • Chemokines and defensins have been fused with sFv through a spacer sequence NDAQAPKS (SEQ ID NO:57).
  • SEQ ID NO:57 a spacer sequence NDAQAPKS
  • the first Cys residue was replaced to Ser for all chemokines, except hMCP-3 and hMDC, in which the amino-terminus up to the second Cys residue was truncated.
  • Bacterial expression vectors contained only genes encoding mature peptide genes, while constructs for DNA vaccination were fused in frame to a leader sequence of IP- 10 in pCMNE/AB, except for constructs designed for pMDCsFv38 and pSDFl ⁇ sFv38 plasmids, which contained their native signal sequences.
  • gpl20 gene was cloned from the plasmid D ⁇ A containing a portion of HIV-1 (isolate 89.6) in frame with the IP-10 secretion signal sequence (pgpl20) using primers PRM89.6E ⁇ V-5' (AAAGTCGACAAAGAAAAAACGTGG GTCACAATCT; SEQ ID NO:58) and PR89.6ENV-3' (ATTCCCGGGTTATTTTTCTCTTTGCACTGTTCTTCTC; SEQ ID NO :59).
  • gpl20 was fused in frame with coding sequences from murine ⁇ - defensin 2, hMDC and hMCP3, to generate DNA constructs pmDF2 ⁇ gpl20, phMDCgpl20, phMCP3gpl20, respectively.
  • Recombinant fusion proteins were purified as inclusion bodies after 8 hours of induction in Super-Broth (Digene Diagnostics, Inc., Beltsville, MD) with 0.8 mM IPTG in the presence of 150 ⁇ g/ml carbenicillin and 50 ⁇ g/ml ampicillin at 30° C, and refolded according to Buchner, et al. (Buchner, J., I. Pastan, and U. Brinkmann. 1992.
  • Murine bone marrow derived dendritic cells Isolation of murine bone marrow derived dendritic cells.
  • Murine bone marrow derived DC were isolated as described elsewhere (Fields, R.C., J.J. Osterholzer, J.A. Fuller, E.K. Thomas, PJ. Geraghty, and J.J. Mule. 1998. Comparative analysis of murine dendritic cells derived from spleen and bone marrow. J.Immunother. 21:(5)323-339). Briefly, bone marrow was collected from tibias and femurs of 4 to 6 months old BALB/c mice by flushing with PBS using a 10 mL syringe with a 27 gauge needle.
  • Eryhtrocytes were lysed by treatment with ACK lysis buffer (BioWhittaker, Walkersville, MD). Cells expressing CD8, CD4, B220 and I- A b were depleted using a mixture of mAbs and rabbit complement.
  • the mAbs were TIB-146 (anti-B220), TIB-150 (anti-CD8), TIB-207 (anti-CD4), TIB-229 (anti- I-A b ), obtained from the ATCC.
  • DC medium RPMI 1640 containing 5% heat inactivated fetal bovine serum, 1% penicillin streptomycin, 1 % L-glutamine and 5xlO "5 2-ME
  • 10 ng/mL recombinant murine IL-4 and 10 ng/mL recombinant murine GM-CSF Peprotech
  • 6 well plates 7xl0 5 cells/mL, 5 mL/well.
  • 200 ⁇ l of DC medium containing 10 ng/mL of both IL-4 and GM-CSF were added to each well.
  • 5 ⁇ l of DC medium containing cytokines were added to each well after non-adherent cells were removed, and cells were cultured for an additional 4 days. Cells were harvested on day 4 and day 7 and used in subsequent experiments.
  • the lower and upper compartments were separated by a 5- ⁇ m polycarbonate filter (Osmonics, Livermore, CA). After incubation at 37°C in humidified air with 5% CO 2 for 1.5 h, the filters were removed, scraped, and stained. Dendritic cells migrating across the filter were counted with a Bioquant semiautomatic counting system. The results are presented as chemotactic index (C. I.), defined as the fold increase in the number of migrating cells in the presence of test factors over the spontaneous cell migration (in the absence of test factors). The results are expressed as the mean ⁇ SE of triplicate samples. MIP-3 ⁇ and MIP-3 ⁇ were purchased from PeproTech (Rocky Hill, NJ).
  • Chemokine receptor binding assay Binding assays were performed by using a single concentration of radio-labeled MlP-l ⁇ or SDF-l (human [ 125 -I]-[Leu 3 , Gly 47 ]-MIP-l ⁇ and human [ 125 I]-SDF-l ⁇ , 2200 Ci/mmol, NEN Life Science Products Inc. , Boston, MA) in the presence of increasing concentrations of unlabeled ligands (MlP-l ⁇ and SDF-l ⁇ obtained from PeproTech, Rocky Hill, NJ) .
  • MlP-l ⁇ or SDF-l human [ 125 -I]-[Leu 3 , Gly 47 ]-MIP-l ⁇ and human [ 125 I]-SDF-l ⁇ , 2200 Ci/mmol, NEN Life Science Products Inc. , Boston, MA
  • Human HEK293 cells transfected with CCR5 at lxlOVsample were suspended in 200 ⁇ l binding medium composed of RPMI1640, lmg/ml BSA, 25 mM HEPES, and 0.05% sodium azide, and incubated in duplicates at room temperature for 40 min. After incubation, the cells were pelleted through a 10% sucrose/PBS cushion and the radioactivity associated with cell pellets was determined in a ⁇ -counter (Clinigamma-Pharmacia, Gaithersburg, MD). The binding data were then analyzed with a Macintosh computer program LIGAND (P. Munson, Division of Computer Research and Technology, NIH, Bethesda, MD).
  • LIGAND Macintosh computer program
  • HIV-1 env antibody and CTL assays Five BALB/c female mice per group were immunized with DNA plasmids four times using a gene gun. Two weeks after the last immunization, HIV-1 89.6 env specific CTL was assessed in spleens and Peyer's patches as described elsewhere (Belyakov, I.M., M.A. Derby, J.D. Ahlers, B.L. Kelsall, P. Earl, B. Moss, W. Strober, and J.A. Berzofsky. 1998.
  • Mucosal immunization with HIV-1 peptide vaccine induces mucosal and systemic cytotoxic T lymphocytes and protective immunity in mice against intrarectal recombinant HIV- vaccinia challenge.
  • immune cells from spleen or Peyer's patch were cultured at 5xl0 6 per/milliliter in 24-well culture plates in complete T cell medium (CTM): RPMI 1640 containing 10% fetal bovine serum, 2 mM L-glutamine, penicillin (100 U/ml), streptomycin (100 mg/ml), and 5x 10 "5 M 2-mercaptoethanol.
  • CTM complete T cell medium
  • the percent specific 51 Cr release was calculated as 100X (experimental release-spontaneous release)/ (maximum release - spontaneous release). Maximum release was determined from supematants of cells that were lysed by addition of 5% Triton-X 100. Spontaneous release was determined from target cells incubated without added effector cells (Belyakov, I.M., M.A. Derby, J.D. Ahlers, B.L. Kelsall, P. Earl, B. Moss, W. Strober, and J.A. Berzofsky. 1998.
  • Mucosal immunization with HIV-1 peptide vaccine induces mucosal and systemic cytotoxic T lymphocytes and protective immunity in mice against intrarectal recombinant HIV- vaccinia challenge. Proc.NatlAcad.SclU.SA 95.(4)1709-1714).
  • Serum anti-env antibodies were assessed by ELISA on 5 ⁇ g/ml gpl20 protein from isolate 89.6 produced in vaccinia virus coated 96-well plate. The bound antibodies were detected by goat anti-mouse Ig-HRP mAb (Caltag) and developed with ABTS peroxidase substrate (KPL, Gaithersburg, MD). Tumor cell lines and mice. The carcinogen-induced, C3H 38C-13 B cell lymphoma (Bergmanm Y. and J. Haimovich. 1977. Characterization of a carcinogen- induced murine B lymphocyte cell line of C3H/eb origin. J.Immunol. 7:413-417) was obtained from R.
  • the 38C-13 tumor secretes and expresses IgM (K) on the cell surface. Inoculation of as few as 10 2 38C-13 tumor cells i.p. into normal syngeneic mice results in progressive tumor growth and death of the host with a median survival time of only two weeks. Mice surviving past 60 days from tumor challenge are long-term survivors.
  • the BALB/c A20 lymphoma (Kim, K.J., L.C Kanellopoulos, R.M. Merwin, D.H. Sachs, and R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J.Immunol.
  • 122: (2)549-554) was obtained from the American Type Culture Collection (Rockville, MD) and expresses IgG ⁇ . 38C-13 and A20 cells from a common frozen stock were passaged in vitro 3 days before use in RPMI 1640 medium supplemented with 100 U/ml of penicillin and streptomycin, 2xlO "5 M 2-mercaptoethanol, and heat inactivated 10% fetal bovine serum (Gibco BRL, Gaithersburg, MD).
  • mice were challenged i.p. with 2000 38C-13 lymphoma cells from a single preparation of tumor and followed for survival. Differences in survival between groups were determined by non-parametric log-rank test (BMDP statistical software, Los Angeles). P- values refer to comparison with groups immumzed with DNA expressing the same chemokine or defensin fused with an irrelevant sFv, or sFv fused with mutant chemokine, unless specified.
  • mice Six- to nine- week old female BALB/c mice (ten per group) were challenged with 2.5xl0 5 syngeneic A20 tumor cells. At day 1, 4, 8 and 18 these mice were immunized by gene gun with DNA plasmid (containing about 1-2 ⁇ g DNA per immunization) and mice followed for tumor progression.
  • Murine ⁇ -defensins and viral chemokines retain their functional integrity when produced as fusion proteins with sFv.
  • chemokine and ⁇ -defensin fusion proteins with sFv, a lymphoma Ig-derived non-immunogenic Fv were cloned and purified (Table 3). The functional integrity of these proteins was tested by the ability to induce chemotaxis of murine APC and THP-1 cells. As expected, chemokine fusion proteins induced dose-dependent chemotaxis.
  • THP-1 cells were chemo-attracted to vMIPl, human MCP-3, and SDFl ⁇ fusion proteins, but not to the fusion with antagonist chemokine vMIP2, vMIP2sFv38.
  • Control mutant fusion proteins generated for each chemokine by replacing the first Cys residue by Ser or by truncation of the amino terminus, as expected, did not induce chemotaxis of THP-1 cells or murine DC.
  • vMIP2 fusion proteins were tested for their ability to bind to their respective receptor (s).
  • vMIP2sFv38 could displace labeled MlPl ⁇ and SDFl ⁇ in a dose dependent manner from CCR5 and CXCR4 transfected cell lines, respectively. In contrast, no displacement was detected by vMIP2MsFv38 fusion protein, which contained a replacement Cys/Ser mutation in vMIP2, or by control sFv protein alone.
  • Control fusion protein proDef2 ⁇ sFv38 did not induce chemotaxis of any DC. Therefore, murine ⁇ -defensin 2 and 3 fusion proteins can specifically target immature DC. Furthermore, sFv fusion with ⁇ - defensin and xenogeneic human or viral chemokines does not disrupt their functional chemokine properties.
  • Murine ⁇ -defensin, xenogeneic proinflammatory and viral chemoldne fusion constructs render non-immunogenic tumor antigen immunogenic.
  • these fusion proteins were used to induce specific immunity against non-immunogenic sFv38 when administered as a DNA vaccine in mice.
  • Ten mice per group were immunized by gene gun with plasmids encoding fusion proteins with mature ⁇ - defensins, pDef2 ⁇ sFv38 and pDef3 ⁇ sFv38, respectively, or with human or viral chemokines, pSDFl ⁇ sFv38, pMDCsFv38, pvMIPlsFv38 or pvMIP2sFv38.
  • mice were immunized with DNA constructs encoding sFv fused with inactive pro- defensin (pproDef2 ⁇ sFv38), or mutated chemokines (phMCP3MsFv38, pMDCMsFv38, pMIPlMsFv38 and pvMIP2MsFv38).
  • Mice immunized with plasmids encoding sFv fusion proteins with both murine ⁇ -defensins, murine MCP-3, human MDC or viral chemokines induced significant idiotype-specific antibodies which were comparable to the levels induced by vaccination with tumor-derived intact lg protein conjugated to KLH.
  • mice immunized with an inactive pro- ⁇ -defensin pproDef2 ⁇ sFv38
  • mutant chemokine sFv fusion constructs hpMCP3MsFv38, pMDCMsFv38 and pvMIP2MsFv38
  • sFv38 alone did not produce any anti-Id antibody responses.
  • a mixture of separate plasmids encoding ⁇ -defensin 3 (pmDF3 ⁇ MuclT) and sFv antigen (sFv38) failed to elicit a specific humoral response, demonstrating a requirement for sFv to be physically linked to ⁇ -defensin or chemokine moiety.
  • non-immunogenic sFv was rendered immunogenic by fusion with mature murine ⁇ -defensins, syngeneic murine, xenogeneic human or viral chemokines.
  • MDC-containing vaccines also elicited high titers of IgG2b and IgG3, while fusion constructs with ⁇ -defensin-3 and vMIP2 elicited high titers of IgG2b but little IgG3, and little IgG2b or IgG3, respectively.
  • mice Two weeks after the last of three serial immunizations, mice were challenged with a 20-fold lethal dose of syngeneic tumor. No survival was observed in control groups immunized with PBS or plasmids encoding sFv38 fused with inactive pro- ⁇ - defensin-2 (pproDef2 ⁇ sFv38), MDC alone (pMDC-EGFP), or with mutant constructs pMDCMsFv38, pvMIP2MsFv38, pvMIPlMsFv38. Moreover, no protection was observed in mice immunized with DNA encoding a mixture of unlinked functionally active ⁇ -defensin or chemokine with sFv.
  • mice immunized with pDef2 ⁇ sFv38 and pDef3 ⁇ sFv38 demonstrate significant protective immunity (elicited in mice immunized with pDef2 ⁇ sFv38 and pDef3 ⁇ sFv38 (by log-rank test, p ⁇ 0.001 as compared with pproDef2 ⁇ sFv38 and pMIP2MsFv38, respectively).
  • pMDCsFv38, pvMIP2sFv38 and pvMIPlsFv38 immmunized mice demonstrated statistically significantly prolonged survival (by log-rank test, p ⁇ 0.001 as compared with pMDC-EGFP and mutant pvMIP2MsFv38 and pvMIPlMsFv38, respectively).
  • ⁇ -defensins and xenogeneic human and viral chemokines can render a non-immunogenic self-tumor antigen (sFv) immunogenic and elicit specific antitumor immunity.
  • sFv self-tumor antigen
  • mice were immunized with MCP-3 fusion constructs with or without a secretory leader sequence (pMCP3sFv38 and pMCP3sFv38-w/o-SL, respectively). High levels of Id-specific antibodies were detected in mice immunized with pMCP3sFv38, containing an intact secretory leader; however, no antibodies were elicited in mice immunized with pMCP3sFv38-w/o-SL.
  • mice immunized with pMCP3sFv38 were immunized with pMCP3sFv38, but not with pMCP3sFv38-w/o-SL (by log-rank test, p ⁇ 0.001).
  • the vaccine of this invention can be administered to a patient to treat cancer or to treat or prevent HIV infection (with the additional administration of adjuvants, such as immunostimulatory cytokines, if desired), the following is a complete protocol for a clinical trial describing the administration of Id- KLH and GM-CSF to patients to treat follicular lymphoma.
  • the same study design can be employed for the administration of the defensin-tumor antigen fusion polypeptides, the chemokine-tumor antigen fusion polypeptides, the chemokine- viral antigen fusion polypeptides and/or the defensin-viral antigen fusion polypeptides of the present invention and/or nucleic acids encoding the fusion polypeptides of this invention, with appropriate modifications, as would be apparent to one of skill in the art.
  • Immunoglobulin (lg) molecules are composed of heavy and light chains, which possess highly specific variable regions at their amino termini.
  • the variable regions of heavy and light chains combine to form the unique antigen recognition site of the lg protein.
  • These variable regions contain determinants that can themselves be recognized as antigens, or idiotopes.
  • B-cell malignancies are composed of clonal proliferations of cells synthesizing a single antibody molecule with unique variable regions in the heavy and light chains.
  • B-cell lymphomas are neoplasms of mature resting and reactive lymphocytes which generally express synthesized lg at the cell surface. The idiotypic determinants of the surface lg of a B-cell lymphoma can thus serve as a tumor-specific marker for the malignant clone.
  • Patients in the first trial (five patients) received Id-KLH alone for the first three immunizations, then Id-KLH emulsified in a Pluronic polymer-based adjuvant vehicle formulation for all subsequent immunizations. Because no idiotype-specific immune responses were observed prior to the addition of the adjuvant to the program in this first group of patients, patients in the second trial (four patients) received the entire series of immunizations with this adjuvant. All patients were analyzed for idiotype-specific antibody production and peripheral blood mononuclear cell (PBMC) proliferative responses in vitro immediately before each immunization and at one to two month intervals following the last immunization.
  • PBMC peripheral blood mononuclear cell
  • Anti-idiotypic antibody responses were detected by analysis of pro- and hyperimmune sera in either direct, or competition, ELISA.
  • the immunization with autologous Id protein induced significant titers of anti-idiotypic antibody that either directly bound or inhibited the binding of a murine anti-idiotype monoclonal antibody (anti Id mAb) to Id on the plate.
  • anti Id mAb murine anti-idiotype monoclonal antibody
  • the specificity of the humoral response for the lg idiotype was demonstrated by the lack of significant binding of hyperimmune serum to a panel of isotype-matched human Igs of unrelated idiotype, or by the lack of significant inhibition of a panel of heterologous Id-anti-Id systems, respectively.
  • Peak humoral responses were obtained after the fifth immunization and persisted for at least nine months.
  • the anti-idiotypic antibody produced by patient 1 was affinity-purified and shown to contain heterogeneous light chains as well as immunoglobulin G heavy chains.
  • This patient's antibody titer was successfully boosted with a single administration of Id-KLH in adjuvant after a decline of the humoral response after 15 months. milliliter of soluble protein in five day in vitro cultures. None of the pre-immune PBMC demonstrated any preexisting proliferation to autologous Id above that to culture medium alone. Hyperimmune PBMC from all patients demonstrated strong proliferative responses to the KLH carrier.
  • the ability of the idiotype-specific humoral response to bind autologous tumor cells was also tested. This was shown by the inhibition of binding of a labeled murine anti-idiotype mAb to tumor cells from a pre-treatment lymph-node specimen from patient 8 by hyperimmune, but not by pre-immune, serum from this patient.
  • affinity purified anti-idiotypic antibodies from the hyperimmune sera of the two other patients who demonstrated idiotype specific humoral responses were demonstrated by flow cytometry to bind autologous tumor. All patients were also closely monitored for disease activity with physical examinations and routine laboratory and radiographic studies.
  • patient 1 experienced complete regression of a single 2.5 cm left submandibular lymph node, and the other (patient 4) experienced complete regression of a 4.5 cm cutaneous lymphomatous mass on the right arm.
  • patient 4 experienced complete regression of a 4.5 cm cutaneous lymphomatous mass on the right arm.
  • This clinical response in patient 4 correlated with an Id-specific, PBMC proliferative response in vivo.
  • the clinical responses in both patients have continued at 24 and 10 months, respectively, after completion of the immunization series.
  • Toxicity was minimal in all twelve patients. All patients experienced transient local reactions characterized by mild erythema, induration, and discomfort, without skin breakdown, at the injection sites. Splitting the components of the vaccine (Id-KLH and adjuvant) in one patient who had experienced a moderate local reaction and in another patient who had experienced a moderate systemic reaction, characterized by fever, rigors and diffuse arthralgias, established the adjuvant as the component associated with these reactions. Both of these moderate reactions resolved completely after 24-48 hours. The only laboratory abnormality associated with Id immunization was a mild elevation (less than twice the normal value) of serum creatine phosphokinase 24 hours after immunization in an occasional case.
  • This initial study also established the requirement for an immunological adjuvant, as no Id-specific responses were observed prior to the addition of an adjuvant to the program.
  • the objective of further clinical trials using tumor derived Id as a therapeutic vaccine is to further optimize the immunogenicity of this vaccine.
  • this study will focus on the use of novel immunological adjuvants which are 1) more potent and 2) more effective in the induction of cell-mediated immune responses, compared with the pluronic polymer-based adjuvant used in the study.
  • the 38C13 B cell tumor is used as a model system to screen promising immunological adjuvants.
  • a number of these have included cytokines and among these, GM-CSF has emerged as a promising adjuvant for idiotypic lg antigen.
  • syngeneic mice were immunized with 50 ⁇ g Id-KLH derived from the tumor, either alone or in combination with GM-CSF mixed together with the antigen and administered subcutaneously.
  • Three additional daily doses of GM- CSF were administered s.c. as close to the original site of immunization as possible.
  • Mice immunized with an irrelevant Id-KLH (4C5 IgM) served as negative controls for the vaccine.
  • the follicular lymphomas are follicular small cleaved cell (FSC) and follicular mixed lymphoma (FM).
  • Stage I and ⁇ patients comprise only 10% to 15% of all cases of follicular lymphomas and are best managed with radiation therapy. Eight-five percent of patients with follicular lymphomas present with stage in or TV disease. The optimal management of these patients remains controversial and has generally followed two divergent approaches (16, 17). One is an aggressive approach, which has included radiation therapy, combination chemotherapy, or combined modality therapy and the other is a conservative approach that involves no initial treatment followed by a single- agent chemotherapy or involved-field radiotherapy when required (18; 19). Most forms of systemic therapy have the capacity to produce high complete response rates. However, they have failed to produce long-term disease-free survival or to prolong overall survival; thus, it has become clear that the vast majority of patients with this disease will relapse and die of their lymphoma, despite its usually indolent course.
  • the NCI study (MB-110, BRMP 8903) begun in 1978, is a prospective randomized study comparing these two distinct approaches to the management of stage HI or TV indolent histology lymphoma.
  • Most patients were randomized between no initial therapy or aggressive combined modality therapy with ProMACE/MOPP flexitherapy followed by low dose (2400cGy) total nodal irradiation.
  • 125 (84%) were randomized; 62 to watch and wait (W & W) and 63 to aggressive treatment.
  • the 62 patients on the watch and wait arm 29 continue to be observed for periods up to 10+ years.
  • the median time to cross over to aggressive therapy is 23 months.
  • the median duration of remission has not been reached at five years and 57% of patients are projected to be disease-free >8 years and 44% are projected to be in a CR at 12 years.
  • the disease-free survival curves are not significantly different between the two arms.
  • allowing the patient to reach a greater tumor burden before instituting systemic therapy reduces the likelihood of obtaining a CR, but once achieved, CRs are comparably durable to those obtained from primary aggressive therapy.
  • the lengthening of the remission duration has not resulted in a survival advantage for patients randomized to receive primary aggressive chemotherapy.
  • the probability of relapse appears to be continuous over time, and the vast majority of patients are expected to eventually succumb to their disease.
  • the goal is to treat patients with follicular lymphomas to complete remission or maximal response with ProMACE chemotherapy. After the completion of chemotherapy, in an effort to reduce the relapse rate (by eradicating microscopic disease resistant to chemotherapy), patients will receive an autologous Id vaccine administered in combination with GM-CSF.
  • the goal of this study is to evaluate the ability of the Id vaccine to clear the bone marrow of malignant cells detectable by pathologic (morphologic) examination or molecular examination (polymerase chain reaction, PCR) in patients with PCR amplifiable translocations. All patients have serial bone marrow and peripheral blood samples collected to search for clonal abnormalities by PCR. Patients are followed after vaccine therapy and their remission status correlated with clinical vs. molecular determinations of response.
  • the objectives of this trial are to:
  • GM-CSF doses as an adjuvant, as measured by the endpoints in the above objectives.
  • Quantitative immunoglobulins serum protein electrophoresis, immunoelectrophoresis.
  • HTV antibody HBsAg. Urinalysis. Serum ⁇ -HCG in women of child-bearing potential.
  • Tumor Biopsy prior to therapy, all patients must undergo biopsy/harvest of a clinically involved peripheral lymph node to obtain tissue for morphological classification, immunophenotypic characterization, determination of immunoglobulin gene rearrangements, bcl-2 translocation, cytogenetics, and to provide starting material for an Id vaccine.
  • the sample should be at least 2 cm in size. Only patients with tumors that are surface immunoglobulin positive with a monoclonal heavy and light chain will be accepted as study candidates.
  • Use standard lymphoma vaccine biopsy orders see protocol below). Leftover tumor biopsy samples may be used for basic studies of lymphoma biology in vitro. Such future studies may be done without re- consenting the subjects only if the studies involve risks already outlined in the original consent form.
  • Lymphangiogram unless contraindicated by massive pedal edema, severe chronic lung disease, ethiodal sensitivity (Note: sensitivity to other iodine compounds, e.g., renograffin, are relative, but not absolute contraindications).
  • CT chest, ultrasound, liver scan, bone scan, upper and lower GI series, TVP, MRI should be performed as needed to evaluate all disease sites adequately.
  • 5 cc of marrow will be aspirated from each side into 0.5 ml of PFH for PCR analysis.
  • the procedure should be performed in the usual manner with a biopsy performed first. Then a small volume (0.5-1 cc) can be aspirated for the smear and clot tube. A separate Rosenthal needle with bevel should be used for the aspirate.
  • the 5 cc sample for PCR can be obtained from the same site as the initial aspirate.
  • Cyclophosphamide Cyclophosphamide Next cycle begins 650 mg/m 2 TV 650 mg/m 2 TV
  • Etoposide VP-1 6 Etoposide BP-1 6 120 mg/m 2 TV 120 mg/m 2 TV
  • All patients will be treated until a complete remission is obtained and two additional cycles of chemotherapy have been given, or until disease has been stable for two cycles of chemotherapy, or progressive disease develops. A minimum of six cycles will be given to each complete responder before therapy is discontinued. Patients with more than 90% PR or a full CR will be continued on the vaccination part of the protocol. Patients with less than 90% PR or progressive disease will be taken off of the study.
  • Postinduction Therapy Three to six months (or whenever a customized GMP vaccine is available, up to a maximum period of 12 months) after the completion of chemotherapy, all patients in whom either a complete clinical remission or minimal disease status (> 90% partial response) has been achieved will receive a series of five injections of a vaccine consisting of 0.5 mg autologous tumor derived immunoglobulin (Id) conjugated to KLH.
  • the vaccine will be administered together with GM-CSF as an immunological adjuvant. Both the vaccine and GM-CSF will be administered subcutaneously according to the following schedule: Schedule: At 0, 1, 2, 3 and 5 months
  • Id-KLH (0.5 mg s.c.) day 0 adjuvant (s.c.) days 0-3
  • Cohort 1 GM-CSF 500 mcg/m 2 /d s.c. for 4 days
  • Cohort 2 GM-CSF 100 mcg/mVd s.c. for 4 days
  • the sites of injection will be rotated between the upper and lower extremities. Each dose of vaccine or GM-CSF will be split equally between the two upper or lower extremities. All GM-CSF injections will be given in close proximity to the vaccination site, as close to the exact site of injection as possible. If local reactions to GM-CSF are severe, GM-CSF injections may be given elsewhere. Patients will be observed in the clinic for two hours following Id-KLH and/or GM-CSF administration. During the observation period, vital signs will be taken every 15 minutes during the first hour and every 30 minutes during the second hour.
  • G-CSF 5 mcg/kg/d SC may be used in all patients who are hospitalized for the treatment of febrile neutropenia, regardless of how long the neutropenia persists.
  • Dose modification of chemotherapy will be based on the granulocyte count done at the time of drug administration (day 0 or 7 of each cycle). The percentage of drugs administered may be further modified based on toxicity in prior cycles (see below). If the granulocyte count is ⁇ 1200, and the patient is due for day 0 drugs, delay day 0 for one week until appropriate parameters are met. In general, delays of up to one week are preferable to starting G-CSF. If after a one week delay, appropriate parameters are still not met, then G-CSF may be started as above. Also, in general, delays of up to one week are preferable to dose reductions. Full doses of all drugs should be given on time if blood count suppression is due to bone marrow involvement with disease.
  • neutrophil nadir For neutrophil nadir ⁇ 500 or platelet count ⁇ 25,000 on previous cycle, 75% of cyclophosphamide, doxorubicin, and etoposide should be considered. For neutrophil nadir (day 21 counts) > 750 on a previous cycle, dose escalation of cyclophosphamide, doxorubicin, and etoposide by 10-20% should be prescribed.
  • TF PLATELET COUNT IS: THEN DOSE AS FOLLOWS: > 100,000 100% of all drugs 50 - 99,999 100% Prednisone 75% Etoposide 50% Cyclophosphamide,
  • Doxorubicin dosage should be adjusted as follows in the presence of the following LFT abnormalities: % Dose Bilirubin SGOT
  • Id-KLH Vaccine Based on previous experience with autologous Id-KLH vaccines, little or no toxicity is expected from the Id-KLH component of the vaccine (15). Nevertheless, any local skin reactions will be carefully noted and scored for erythema, induration, pain and disruption of the barrier surface. If any patient has a reaction suggestive of sensitization, the vaccine may be split into its component parts; specifically, the patient will be tested with Id-KLH alone and then GM-CSF alone. Toxicities will be graded according to the CRBINCI/DCS common toxicity criteria.
  • Anticipated toxicities from GM-CSF administration in this dose range are expected to be mild based on previous experience. Potential toxicities include fever, chills, myalgias, arthralgias, nausea, vomiting, diarrhea, dyspnea, tachycardia, arrhythmias, elevation of liver function tests, elevation of BUN and creatinine. However, local skin reactions, such as erythema and induration, may be observed and will be carefully noted. Attempts will be made to maintain these patients as outpatients. For grade TV fever (not responsive to lndocin or Tylenol), or grade III vomiting
  • GM-CSF will be held until toxicity is less than grade TI and will be restarted at 50% of the original dose level for the rest of that weekly injection cycle and for subsequent cycles.
  • grade TI grade TI
  • GM-CSF For neurologic toxicity that affects daily function (unable to carry on simple routine duties, or grade TT in the toxicity grading scale), hold treatment until symptoms resolve, then reduce GM-CSF by 50%. If symptoms persist, the adjuvant should be removed for subsequent immunizations. Patients with grade HI neurotoxicity will be removed from the study.
  • the adjuvant will be removed for subsequent immunizations.
  • grade HI including evidence of ischemia or ventricular arrhythmia, but not supraventricular tachycardia or atrial fibrillation controlled by digoxin or calcium channel blocking agents.
  • GM-CSF will be held until values return to ⁇ 5 x normal, then resumed at 50% of the GM-CSF dose for all remaining doses.
  • Fever and chills associated with vaccine administration and/or GM-CSF will be treated with TYLENOL and/or DEMEROL.
  • the use of non-steroidal antiinflammatory drugs and/or steroids should be avoided. Should non-steroidals or steroids be required for unrelated medical conditions for a course exceeding 2 weeks, the patient will be taken off of the study.
  • Two tiger top tubes and peripheral blood (60 cc in PFH) are collected on day 0 of each monthly cycle, for preparation of serum and lymphocytes, respectively.
  • Skin Biopsy is obtained near a planned immunization site on day 0 prior to the first cycle (baseline sample) and again on day 1, 2, or 3 of cycle 3 at an active site of erythema and/or induration as close to the original biopsy site as possible.
  • DTH - Delayed type hypersensitivity test to autologous idiotype protein is performed during cycle 4 and again following completion of the immunization regimen, i.e., during or after cycle 5.
  • the DTH-test is performed by intradermal injection of 0.5 mg of idiotype protein in 0.1- 0.2 ml of NS.
  • 0.5 mg of a heterologous isotype matched Id- protein from another patient on the same study
  • the control idiotypes used on these two occasions will be from two different patients, also in the study, in order to minimize the possibility of eliciting an immunologic response against a particular irrelevant idiotype.
  • a skin biopsy will also be obtained at the site of the intradermal injection of idiotype protein and at the control site, one to three days, after the intradermal injections.
  • Fine needle aspiration or core biopsy (with or without CT guidance) of any enlarged lymph node draining the vaccination sites is performed to obtain lymphocytes for in vitro assays.
  • Fine needle aspiration or core biopsy (with or without CT guidance) of any enlarged lymph node draining the vaccination sites is performed to obtain lymphocytes for in vitro assays.
  • Each lymph node biopsy will be divided as follows: (a) one-third of the specimen will be sent in saline to the Hematopathology Section, Laboratory of Pathology, NTH. Biopsies are processed for routine histopathy and for immunophenotypic characterization, particularly with respect to monotypic heavy and light chain expression; and (b) two-thirds of the specimen is sent in sterile saline in a sterile container to Clinical Immunology Services, NCTFCRDC, where it is processed into a single-cell suspension and cryopreserved.
  • PBMC Peripheral blood mononuclear cells
  • preimmune and hyperimmune serum samples from each patient are diluted over wells of a microtiter plate that are coated with either autologous immunoglobulin idiotype or a panel of isotype-matched human tumor immunoglobulins of umelated idiotype. Bound antibody is detected with horseradish peroxidase-goat antihuman light- chain antibodies directed against the light chain not present in the immunoglobulin idiotype (Caltag Laboratories, South San Francisco).
  • PBMC peripheral blood mononuclear cells
  • TMDM Iscove's modified Dulbecco's medium
  • KLH autologous immunoglobulin idiotype
  • KLH autologous immunoglobulin idiotype
  • a panel of isotype matched immunoglobulins of irrelevant idiotypes at concentrations of 0 to 100 ⁇ g per milliliter in TMDM-1 percent AB preparation are added in triplicate.
  • the cells After the cells are incubated for three days at 37 °C in an atmosphere containing 5 percent carbon dioxide, they are transferred to a preparation of TMDM and 5 percent fetal-. calf serum containing recombinant interleukin-2 (30 U per milliliter). The plates are incubated for two days and pulsed for 16 to 20 hours with 3 H-labeled thymidine (1 ⁇ Ci per well). Data are expressed as mean ( ⁇ SEM) counts per minute of [ Hjfhymidine incorporation.
  • PBMCs initial five-day cultures of PBMCs established as described above are expanded in TMDM-5 percent fetal-calf serum containing interleukin-2 (30 U per milliliter). Harvested cells are replaced in TMDM-1 percent AB containing autologous immunoglobulin idiotype and fresh irradiated (5000 R) autologous PBMCs (4 x 10 cells per well) as antigen-presenting cells for five days, before pulsing with 3 [H] thymidine.
  • TCR T-cell Receptor
  • Pre-chemotherapy and pre- and postimmunization serum samples are assayed for TCR status by Western blot assay.
  • Approximately 7 x 10 purified T-cells from PBMC are lysed for 5 minutes at 4°C in lysis buffer (25mM Tris, pH 7.4 [Sigma Chemical Co., St Louis, MO], 300 mM NaCl, 0.05% Triton X-l 00, 1 mM Na orthovanadate, 10 ⁇ g/ml aprotinin, 10 ⁇ g/ml leupeptin, 10 mM nitrophenol-guanidine benzoate [NPGB] and 5 mM EDTA).
  • lysis buffer 25mM Tris, pH 7.4 [Sigma Chemical Co., St Louis, MO]
  • Triton X-l 00 300 mM Na orthovanadate
  • 10 ⁇ g/ml aprotinin 10 ⁇ g/ml leupeptin
  • the lysates are centrifuged at 12,000 rpm at 4°C for 5 minutes and supernatant is removed with a micropipettor, making sure the nuclear pellet is not disturbed. A sample of the supernatant is then used to quantitate protein using the BCA protein assay (Pierce, Rockford, TL). The rest of the lysate is boiled with 3X reducing sample buffer for 5 minutes and placed on ice before its use in Western blot.
  • Varying concentrations of cellular lysate ranging between 1 and 30 ⁇ g are electrophoresed in 14% Tris-glycine gels (No vex Experimental Technology, CA) under reducing conditions and then transferred to Imobilon-p PVDF transfer membranes (Millipore Co., Bedford, MA). The membranes are incubated with a 5% solution of non-fat dried milk for one hour and then blotted for one hour at room temperature with anti-TCR ⁇ anti-serum (Onco-Zeta 1, OncoTherapeutics, Cranbury, NJ) at a 1:2000 dilution.
  • the membranes are washed with TBS-T buffer [1 M Tris base, 5M NaCl, 0.1 % Tween 20 (pH 7.5)] and incubated with anti-rabbit or anti-mouse lg horseradish peroxidase (Amersham, Buckinghamshire, UK). After washing with TBS-T, the membranes are developed with the chemiluminescence kit ECL (Amersham, UK) for 1 -5 minutes. X-OMAT AR film (Kodak Co., Rochester, NY) is used to detect the chemiluminescence.
  • Nested oligonucleotide amplification is performed at the MBR or mcr of the bcl- 2/Tg H hybrid gene using previously published methods (23). Briefly, samples containing 1 ⁇ g of genomic DNA are initially amplified for 25 cycles in a final volume of 50 ⁇ g containing 50 mmol/L KCl, 10 mmol/L Tris HCL, 2.25 mmol/L MgCl 2 , 200 mmol/L oligonucleotide primers, 200 mmol/L each of dGTP, dCTP, dTTP and dATP, and 1.5 U Taq polymerase(Cetus, Emeryville,CA).
  • Reamplification of an aliquot of product is performed for 30 cycles in a final volume of 50 ⁇ l using identical conditions to the original amplification, with oligonucleotide primers internal to the original primers. Aliquots of the final product are analyzed by gel electrophoresis in 4% agarose gels containing ethidium bromide and visualized under UV light. DNA is Southern blotted onto Zeta-probe blotting membrane (BioRad. Richmond, CA) and bcl-2-specific DNA is detected by hybridization with oligonucleotide probes radiolabeled with 32 P(ATP) using T4 polynucleotide kinase.
  • Partial Response a 50% or greater reduction in the size of the lesions as defined by the sum of the products of the longest perpendicular diameters of all measured lesions lasting for a minimum of one month. No lesions may increase in size and no new lesions may appear.
  • Progressive Disease an increase of 25% or more in the sum of the products of the longest perpendicular diameters of all measured indicator lesions compared to the smallest previous measurement or the appearance of a new lesion.
  • Source and Pharmacology - CTX is an alkylating agent, related to nitrogen mustard, which is biochemically inert until it is metabolized to its active components by the liver phosphoramidases. It is non-phase-specific. The drug is excreted exclusively by the kidney after parenteral administration.
  • Formulation and Stability - CTX is supplied as a 100, 200, 500, 1000 mg and a 2 gram lyophilized powder with 75 mg mannitol per 1 00 mg (anhydrous) cyclophosphamide.
  • the vials are stored at room temperature (59-86°F) and reconstituted with sterile water for injection to yield a final concentration of 20 mg/ml as described in the package insert.
  • Reconstituted cyclophosphamide is stable for at least 6 days under refrigeration and for 24 hours at room temperature.
  • Reconstituted drug and diluted solutions should be stored under refrigeration.
  • Supplier Commercially available.
  • Route of Administration The cyclophosphamide used in this regimen is given TV over 30 minutes and is diluted in 100 cc of either D 5 W or NSS.
  • Toxicity - Toxicities described with cyclophosphamide include nausea, vomiting, myelosuppression, gonadal failure in both males and females, alopecia, interstitial pneumonitis, pulmonary fibrosis. hemorrhagic cystitis, cardiac events (cardiomyopathy), syndrome of inappropriate antidiuretic hormone secretion (SIADH) and rarely, anaphylaxis.
  • Source and Pharmacology - Prednisone is the synthetic congener of hydrocortisone, the natural adrenal hormone. It binds with steroid receptors on the nuclear membrane, blocks mitosis, and inhibits protein synthesis. It kills primarily during the S-phase of the cell cycle. It is catabolized in the liver and excreted in the urine. Peak blood levels occur within two hours after oral intake. Plasma half -life is 3- 6 hours. (Biologic half-life is 12-30 hours.) Cortisone 25
  • Toxicity - Toxicities described with prednisone include fluid and electrolyte changes, edema, hypertension, hyperglycemia, gastritis, osteoporosis, myopathy, behavioral and mood changes, poor wound healing, and Cushing's syndrome (moon face, buffalo hump, central obesity, acne, hirsutism and striae).
  • VP-16 (Etoposide.VePesid) NSC#141540 Source and Pharmacology - VP-16 is a semisynthetic derivative of podophyllotoxin which inhibits topoisomerase ⁇ and functions as mitotic inhibitor, but does not bind microtubules. Its main effect appears to be in the S and G 2 -phase of the cell cycle. The mean terminal half-life is 11.5 hours, with a range of 3 to 15 hours. It is primarily excreted in the urine. Formulation and Stability - VP-16 is supplied in vials containing either
  • etoposide 20 mg/ml in a polyethylene vehicle.
  • VP-16 is diluted in either 500 cc of 5% dextrose or 0.9% Sodium Chloride Injection.
  • Diluted solutions concentration of 0.2, 0.4 mg/ml and 1 mg/ml are stable for 96, 48 hours and 2 hours, respectively at room temperature under normal room fluorescent light in both glass and plastic containers. Do not refrigerate etoposide-containing solutions.
  • Toxicity - Toxicities described with etoposide administration include rnyelosuppression (neutropenia), nausea, vomiting, mucositis, allergic reactions characterized by anaphylactic symptoms and hypotension and alopecia.
  • Doxorubricin (Adriamycin) NSC #123127 Source and Pharmacology - Doxorubicin is an anthracycline antibiotic isolated from cultures of Streptomyces peucetius. It binds to DNA and inhibits nucleic acid synthesis, with its major lethal effect occurring during the S-phase of the cell cycle.
  • liver impairment Since it is primarily excreted by the liver, any liver impairment may enhance toxicity.
  • Doxorubicin is available as a freeze-dried powder in 10, 50 and 150 mg vials.
  • the drug is stored at room temperature, protected from light, and is reconstituted with sodium chloride 0.9% (NSS) to yield a final concentration of 5 mg/ml.
  • NSS sodium chloride 0.9%
  • the reconstituted solution is stable for 7 days at room temperature (1 5-30°C) or if stored under refrigeration (2-8°C).
  • Toxicity - Toxicities described with doxorubicin administration include myelosuppression, nausea, vomiting, mucositis, stomatitis, alopecia, diarrhea, facial flushing, dose-related congestive cardiomopathy, arrhythmias, vein streaking (hypersensitivity reaction), radiation-recall dermatitis, local cellulitis, vesication and tissue necrosis upon extravasation (SQ and dermal necrosis).
  • Source - Idiotype protein from the individual B cell lymphomas is obtained from tissue culture, purified, and covalently coupled to keyhole limpet hemocyanin (KLH) as previously described.
  • KLH keyhole limpet hemocyanin
  • Each batch is produced according to Good Manufacturing Practices standards and tested for sterility, endotoxin contamination, and general safety prior to its use in any patient.
  • the preparation and quality control/quality assurance testing of the Id-KLH conjugate is performed by TSI Washington under CRB contract.
  • the TND for the Id-KLH vaccine will be held by the Drug Regulatory Affairs Section, CTEP.
  • How supplied - Formulated product for subcutaneous administration contains 0.5 mg of Id and KLH each per ml of normal saline.
  • Id-KLH is supplied as a 1 ml vial.
  • Id-KLH Prior to administration, Id-KLH is stored at -20°C Administration - After thawing and gentle agitation, the vial contents are drawn up using an 18-gauge needle on a syringe. After the entire contents have been drawn up, the 18-gauge needle is replaced by a 25-gauge needle for injection. This procedure is important to ensure that all particulates (normal components of this vaccine) are obtained from the vial.
  • Toxicity - Toxicities described with Id-KLH vaccine administration include local site reactions (erythema, induration, swelling and tenderness), fever, chills, rash, myalgias and arthralgias. Mid elevations in creatinine phosphokinase (CPK) have been observed.
  • CPK creatinine phosphokinase
  • GM-CSF (Sargramostim: NSC #613795; BB-TND 2632
  • the GM-CSF used in this study is glycosylated, recombinant human GM-CSF.
  • This GM-CSF is an altered form of the native molecule; the position 23 arginine has been replaced with a leucine to facilitate expression of the protein in yeast (Saccharomyces cerevisiae).
  • the GM-CSF is formulated as a white lyophilized cake and is provided in vials containing 500 ⁇ g of the GM-CSF protein as well as 10.0 mg of sucrose, 40.0 mg of mannitol, and 1.2 mg of Tris (Trimethamine).
  • the solution is stable for at least 24 hours at 2-8°C or at 18-25°C Because the product does not contain a preservative, vials should be treated as unit-dose containers; reconstituted solution should be held at 2-8°C and discarded after no more than six hours. Do not freeze GM- CSF. Supplier. Manufactured by lmmunex.
  • the appropriate total dose is withdrawn into and administered from a plastic tuberculin syringe.
  • the GM-CSF is injected subcutaneously as close as possible to the Id-KLH injection site. All GM-CSF doses for each patient are administered by the nursing staff in the outpatient unit.
  • Toxicity - Toxicities described in patients receiving GM-CSF include: fever, chills, diaphoresis, myalgias, fatigue, malaise, headache, dizziness, dyspnea, bronchospasm, pleural effusion, anorexia, indigestion, nausea, vomiting, diarrhea, injection site tenderness, urticaria, rash, pruritus, hypersensitivity reaction, bone pain, thromboembolic events, phlebitis, hypotension, peripheral edema, leukocytosis, thrombocytosis or thrombocytopenia, hepatic enzyme abnormalities, and bilirubin elevation.
  • the first administration of GM-CSF has provoked a syndrome of dyspnea and hypotension within two hours after GM-CSF injection in a single patient receiving yeast-derived GM-CSF; this type of reaction has more frequently been observed in patients receiving GM-CSF produced in E. coli.
  • One report of a vascular leak-like syndrome occurring after autologous bone marrow transplant in a patient receiving continuous TV infusion of GM-CSF has been recorded.
  • Source - The patient-specific purified idiotype protein, previously produced according to GMP standards as described above , is vialed as a separate product by TSI Washington Laboratories and will be supplied by CT ⁇ P, DCT, NCI. This vialed product is tested separately for sterility, endotoxin, and mycoplasma, according to USED specifications previously discussed with the FDA.
  • Toxicity The toxicities associated with administration of unconjugated Id protein are anticipated to be identical to those described with the Id- KLH vaccine.
  • CRB # 9407 NCI T94-0085; Active immunization of Healthy Sibling Marrow Transplant Donors With Myeloma-derived Idiotype) and are felt to be minimal, because of the highly purified nature of the protein.
  • an immune response of any consequence to the isotype matched idiotype used as a negative control during the second skin test is not likely, based on: 1.
  • the isotype matched idiotype will only be administered once and is not conjugated to a carrier protein. These minimize the chance of eliciting a sustained immune response to the protein.
  • Any immune response specifically directed against the idiotype (i.e., variable region) on the control idiotype protein is not likely to cross-react with host cells and is therefore not likely to be of any consequence.
  • G-CSF Filgrastim
  • r-methi-HuG- CSF methionyl human granulocyte-colony stimulating factor
  • the G-CSF is formulated as a clear, sterile solution and is provided in vials at a final concentration of 300 mcg/ml.
  • the commercial vials are available in 300 and 480 meg sizes.
  • the intact vials are stored under refrigeration (2-8°C) prior to use and must not be frozen and are stable at this temperature for at least one year.
  • Toxicities - Toxicities described with G-CSF include: transient bone pain (sternal/pelvic) myalgias, fatigue, mild elevations in uric acid, LDH and alkaline phosphate, fluid retention, transient hypotension, local inflammation at injection site, rarely cutaneous vasculitis, rarely pericardial effusion and rare anaphylactic reactions with first dose.
  • Statistical issues to be addressed include identification of significant endpoints, sample size determination, power considerations, stratification, randomization and design.
  • PCR Polymerase Chain Reaction
  • the PCR response rate is taken as the primary outcome variable of interest to ascertain the following: (1) to determine the ability of Id immunization to eradicate bcl- 2 positive tumor cells from the bone marrow and; (2) to identify the more biologically active of the two doses of GM-CSF. In this endeavor, the plan is to accrue 42 patients. It is estimated that approximately 38 (90%) of these patients will be bcl-2 (+) and thus evaluable for molecular response rate. The other four patients may still be evaluable for a molecular response rate based on lg gene amplification using allele-specific (CDR3) primers by PCR.
  • CDR3 allele-specific
  • CCR complete clinical responder
  • HPR high partial responder
  • Disease-free survival distributions are estimated by the Kaplan-Meier (product- limit) method and dose groups are compared using the log rank test. If no dose group differences are detected, the subjects from both groups are pooled and the Kaplan-Meier estimate of the survivorship function and related functions are evaluated. H suggested by the data analysis, parametric distributions (e.g., WeibuU, log-normal) are fit as well (32, 33).
  • Consent form The original signed informed consent documents will be kept with the patient's other study documentation (e.g., the research chart). A copy of the informed consent document will also be retained by the Data Management Section.
  • the Clinical Coordinator Data Management Section, will ascertain the dates of the IRB approvals before registering the first patient.
  • Gail M, Gait JJ The Determination of Sample Sizes for Use with the Exact Conditional Test in 2 x 2 Comparative Trials. Biometrics. 29, 441-448, 1973.
  • MCP-4 Human monocyte chemoattractant protein-4 is a novel chemoldne with activities on monocytes, eosinophils and basophils induced in allergic and nonallergic inflammation that signals through the CC chemokine receptors (CCR) -2 and -3. /. Immunol. 157:5613-5626.
  • MCP3 Monocyte chemotactic protein-3
  • DNA vaccine Ligand Defensin or name chemokine Antigen Protein Name Description
  • Inflammatory chemokine fusions ⁇ mMIP3c.sFv38 murine MIP3 ⁇ sFv38 mMIP ⁇ sFv38 • Murine MIP3 ⁇ fused with sFv38 pmMIP3 ⁇ sFv20 murine MIP3c.
  • DNA vaccme Ligand Defensin or name chemokine Antigen Protein Name Description
  • Ig20- LH None Ig20 Ig20-KLH A20 lymphoma derived IgG2a protein cross-linked with KLH
  • DNA vaccine name Ligand Defensin or chemokine Antigen Description
  • DNA vaccine Ligand Defensin or name chemokine Antigen Protein Name Description
  • Viral chemokine fusions pvMIP2sFv38 viral MTP2 sFv38 vMIP2sFv38 Viral MTP2 fusion with sFv38 pvMIPlsFv38 viral MTPl sFv38 vMIP2sFv38 Viral MIPl fusion with sFv38 pMC148sFv38 MC148 sFV38 CM148sFv38 Viral MC148 fusion with sFv38
  • DNA vaccine Ligand Defensin or name chemokine Antigen Protein Name Description phMCP3gpl20 Human MCP-3 gpl20 hMCP3gpl20 Human MCP-3 fusion with gpl20 (HTV-1, isolate 89.6) phMDCsFv38 Human MDC sFv38 hMDCsFv38 Human MDC fusionwith sFv38
  • Mutant chemokine fusions pvMIP2MsFv38 Mutant vMIP2 sFv38 vMIP2MsFv38 Mutant vMIP2 fusion with sFv38 pvMTPlMsFv38 Mutant vMIPl sFv38 vMIPlMsFv38 Mutant vMIPl fusion with sFv38 phMCP3MsFv38 Mutant hMCP-3 sFv38 hMCP3MsFv38 Mutant human MCP-3 fusion with sFv38 phMDCMsFv38 Mutant hMDC sFV38 hMDCMsFv38 Mutant human MDC fusion with sFv38
  • Ig20-KLH None Ig20 Ig20-KLH A20 lymphoma derived IgG2a protein cross-linked with KLH

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Communicable Diseases (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

la présente invention concerne un vaccin permettant d'accroître l'action immunogène d'un antigène tumoral, et donc de traiter un cancer, ainsi qu'un vaccin permettant d'accroître l'action immunogène d'un antigène viral, et donc de traiter des infections virales, dont l'infection par le virus de l'immunodéficience humaine (VIH). Cette invention concerne en particulier une protéine de fusion comprenant une défensine ou une chimiokine fusionnée soit à un antigène tumoral, soit à un antigène viral, que l'on administre sous forme de vaccin à base de protéines ou d'acides nucléiques et qui déclenche une réponse immunitaire efficace pour le traitement du cancer ou pour le traitement/prévention des infections virales.
PCT/US2001/043830 2001-09-17 2001-11-19 Methode et compositions a base de proteines de fusion a antigene-defensine et de proteines de fusion a antigene-chimiokine utilisees comme vaccins contre les tumeurs et les infections virales WO2003025002A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002217820A AU2002217820A1 (en) 2001-09-17 2001-11-19 Method and compositions of defensin-antigen fusion proteins and chemokine-antigen fusion proteins as vaccines for tumors and viral infection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/US2001/029074 WO2002022686A2 (fr) 2000-09-15 2001-09-17 Proteines de fusion defensine-antigene
USPCT/US01/29074 2001-09-17

Publications (2)

Publication Number Publication Date
WO2003025002A2 true WO2003025002A2 (fr) 2003-03-27
WO2003025002A3 WO2003025002A3 (fr) 2003-12-04

Family

ID=21742849

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/043830 WO2003025002A2 (fr) 2001-09-17 2001-11-19 Methode et compositions a base de proteines de fusion a antigene-defensine et de proteines de fusion a antigene-chimiokine utilisees comme vaccins contre les tumeurs et les infections virales

Country Status (2)

Country Link
AU (1) AU2002217820A1 (fr)
WO (1) WO2003025002A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011151078A1 (fr) 2010-06-02 2011-12-08 Bavarian Nordic A/S Nouvelles cellules dendritiques de moelle osseuse produisant de l'interféron alpha
WO2012021558A1 (fr) * 2010-08-09 2012-02-16 Richard Markham Procédés et compositions destinés à prévenir un état pathologique
US11033628B1 (en) 2005-10-14 2021-06-15 Phigenix, Inc. Targeting PAX2 for the treatment of breast cancer
CN113241177A (zh) * 2021-05-19 2021-08-10 上海宝藤生物医药科技股份有限公司 一种评估免疫力水平的方法、装置、设备及存储介质
CN114736925A (zh) * 2022-04-21 2022-07-12 奥明(杭州)生物医药有限公司 用于病毒感染所致癌症的环形mRNA疫苗开发平台

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999046392A1 (fr) * 1998-03-12 1999-09-16 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methodes et compositions utilisant des proteines de fusion chemokine-antigene tumoral comme vaccins anti-cancer
WO2000078334A1 (fr) * 1999-06-17 2000-12-28 University Of Maryland Biotechnology Institute Polypeptides chimeres antigeniques de chemokine et leurs utilisations
WO2002022686A2 (fr) * 2000-09-15 2002-03-21 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, National Institutes Of Health, Office Of Technology Transfer Proteines de fusion defensine-antigene

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999046392A1 (fr) * 1998-03-12 1999-09-16 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methodes et compositions utilisant des proteines de fusion chemokine-antigene tumoral comme vaccins anti-cancer
WO2000078334A1 (fr) * 1999-06-17 2000-12-28 University Of Maryland Biotechnology Institute Polypeptides chimeres antigeniques de chemokine et leurs utilisations
WO2002022686A2 (fr) * 2000-09-15 2002-03-21 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, National Institutes Of Health, Office Of Technology Transfer Proteines de fusion defensine-antigene

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BIRAGYN A ET AL: "B-cell malignancies as a model for cancer vaccines: from prototype protein to next generation genetic chemokine fusions" IMMUNOLOGICAL REVIEWS, MUNKSGAARD, XX, vol. 170, August 1999 (1999-08), pages 115-126, XP001113113 ISSN: 0105-2896 *
BIRAGYN A ET AL: "Mediators of innate immunity that target immature, but not mature, dendritic cells induce antitumor immunity when genetically fused with nonimmunogenic tumor antigens" JOURNAL OF IMMUNOLOGY, THE WILLIAMS AND WILKINS CO. BALTIMORE, US, vol. 167, no. 11, 1 December 2001 (2001-12-01), pages 6644-6653, XP002205899 ISSN: 0022-1767 *
BIRAGYN ET AL: "Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity-" NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 17, no. 3, 1 March 1999 (1999-03-01), pages 253-258, XP002108131 ISSN: 1087-0156 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11033628B1 (en) 2005-10-14 2021-06-15 Phigenix, Inc. Targeting PAX2 for the treatment of breast cancer
WO2011151078A1 (fr) 2010-06-02 2011-12-08 Bavarian Nordic A/S Nouvelles cellules dendritiques de moelle osseuse produisant de l'interféron alpha
WO2012021558A1 (fr) * 2010-08-09 2012-02-16 Richard Markham Procédés et compositions destinés à prévenir un état pathologique
US8557248B2 (en) 2010-08-09 2013-10-15 Cyvax, Inc. Methods and compositions for treating malaria
US20150104500A1 (en) * 2010-08-09 2015-04-16 Cyvax, Inc. Methods and Compositions for Preventing a Condition
CN113241177A (zh) * 2021-05-19 2021-08-10 上海宝藤生物医药科技股份有限公司 一种评估免疫力水平的方法、装置、设备及存储介质
CN113241177B (zh) * 2021-05-19 2024-05-10 上海宝藤生物医药科技股份有限公司 一种评估免疫力水平的方法、装置、设备及存储介质
CN114736925A (zh) * 2022-04-21 2022-07-12 奥明(杭州)生物医药有限公司 用于病毒感染所致癌症的环形mRNA疫苗开发平台

Also Published As

Publication number Publication date
AU2002217820A1 (en) 2003-04-01
WO2003025002A3 (fr) 2003-12-04

Similar Documents

Publication Publication Date Title
US8754030B2 (en) Defensin-antigen fusion proteins
US6562347B1 (en) Chemokine-tumor antigen fusion proteins as cancer vaccines
US8460675B2 (en) Viral chemokine-antigen fusion proteins
Biragyn et al. Mediators of innate immunity that target immature, but not mature, dendritic cells induce antitumor immunity when genetically fused with nonimmunogenic tumor antigens
US20140322160A1 (en) Method and composition for altering a b cell mediated pathology
Fredriksen et al. Chemokine-idiotype fusion DNA vaccines are potentiated by bivalency and xenogeneic sequences
JP2001514502A (ja) ケモカインドメインを含むキメラポリペプチド
Biragyn et al. Chemokine receptor-mediated delivery directs self-tumor antigen efficiently into the class II processing pathway in vitro and induces protective immunity in vivo
AU758576C (en) Chemokines with amino-terminal modifications
EP1309347B1 (fr) Methode et composition de modification d'une pathologie a mediation assuree par les lymphocytes b
WO2003025002A2 (fr) Methode et compositions a base de proteines de fusion a antigene-defensine et de proteines de fusion a antigene-chimiokine utilisees comme vaccins contre les tumeurs et les infections virales
AU2002211214A1 (en) Method and composition for altering a B cell mediated pathology
Qin et al. Vaccine therapies
Immature Mediators of Innate Immunity That Target

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZW AM AZ BY KG KZ MD TJ TM AT BE CH CY DE DK ES FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP